WorldWideScience

Sample records for rapid alkaline extraction

  1. The application of extraction chromatography for analysis of alkali and alkaline earth uranates

    International Nuclear Information System (INIS)

    Tomazic, B.; Cukovic, M.

    1978-01-01

    A method for rapid analysis of alkali and alkaline earth uranates is proposed. The method is based on the use of an HDEHP extraction chromatographic column, which makes possible quantitative separations of alkaline earth ions from macroamounts of uranium(VI). Composition of alkaline earth uranates, based on regression analysis, are presented. The results, which show that under the given experimental conditions alkaline earth triuranates precipitate, are in good agreement with previous data from same laboratory. In addition the HDEHP extraction chromatographic column can be suggested as a tool for separation of representative fission products from irradiated uranium for the purpose of determination of the burn-up factor of nuclear reactor materials. (T.G.)

  2. Ethanol production from bamboo using mild alkaline pre-extraction followed by alkaline hydrogen peroxide pretreatment.

    Science.gov (United States)

    Yuan, Zhaoyang; Wen, Yangbing; Kapu, Nuwan Sella

    2018-01-01

    A sequential two-stage pretreatment process comprising alkaline pre-extraction and alkaline hydrogen peroxide pretreatment (AHP) was investigated to convert bamboo carbohydrates into bioethanol. The results showed that mild alkaline pre-extraction using 8% (w/w) sodium hydroxide (NaOH) at 100°C for 180min followed by AHP pretreatment with 4% (w/w) hydrogen peroxide (H 2 O 2 ) was sufficient to generate a substrate that could be efficiently digested with low enzyme loadings. Moreover, alkali pre-extraction enabled the use of lower H 2 O 2 charges in AHP treatment. Two-stage pretreatment followed by enzymatic hydrolysis with only 9FPU/g cellulose led to the recovery of 87% of the original sugars in the raw feedstock. The use of the pentose-hexose fermenting Saccharomyces cerevisiae SR8u strain enabled the utilization of 95.7% sugars in the hydrolysate to reach 4.6%w/v ethanol titer. The overall process also enabled the recovery of 62.9% lignin and 93.8% silica at high levels of purity. Copyright © 2017 Elsevier Ltd. All rights reserved.

  3. Alkaline Extraction of DNA from Pathogenic Fungi for PCR-RFLP Analysis

    OpenAIRE

    Matsumoto, Masaru; Mishima, Shinobu; Matsuyama, Nobuaki; 松元, 賢; 松山, 宣明

    1997-01-01

    For the preparation of DNA samples from fungal mycelia alkaline extraction method was applied and assessed its usefulness for PCR-RFLP analysis. Using alkaline treatment protocols, 18S ribosomal DNAs (rDNA) derived from fungal genomic DNA of Pyricularia oryzae, P. zingiberi, Rhizoctonia solani and R. oryzae were PCR-amplified and digested with Hha I, Msp I and Hae ill. RFLP analysis with HhaI showed the divergent polymorphism between genus Pyricularia and Rhizoctonia. The alkaline DNA extract...

  4. Selective solvation extraction of gold from alkaline cyanide solution by alkyl phosphorus esters

    Energy Technology Data Exchange (ETDEWEB)

    Miller, J.D.; Wan, R.Y.; Mooiman, M.B.; Sibrell, P.L.

    1987-01-01

    Research efforts have shown that solvation extraction of gold from alkaline cyanide solution is possible by alkyl phosphorus esters. Both tributyl phosphate (TBP) and dibutyl butyl phosphonate (DBBP) appear to be effective extractants for gold and exhibit high loading capacities exceeding 30 gpl. Selective solvation extraction of gold from alkaline cyanide solution can be achieved with selectivity factors relative to other cyanoanions as high as 1000 under certain circumstances. Variables influencing the selectivity such as ionic strength, temperature, and extractant structure, are discussed in terms of the extraction chemistry, which seems to involve the solvation of a M dot, dot, dot Au(CN)2 ion pair.

  5. Effect of clay content in rock on oil extraction under alkaline seam conditions

    Energy Technology Data Exchange (ETDEWEB)

    Vezirov, D Sh; Gorbunov, A T; Kasimov, Sh A; Kashchavtsev, V E; Tairov, N D

    1978-01-01

    When oil beds are flooded with alkaline solutions, the alkaline concentration in the solution can be significantly reduced as a result of the interaction between clay and alkali. Large losses of alkali in the bed can render the flooding method ineffective. Experimental studies were conducted on porous media containing up to 25% clay at a constant permeability of 1 D in order to determine the oil extraction indices for clay-containing rock. Constant permeability is maintained by using clays, marshalite, and quartz sand in various proportions. Oil having a viscosity of 99.17 sP, and containing a large amount of surfactants, including 1.1% naphthenic acid, was extracted by fresh water and a 0.25% solution of NaOH. The extraction of oil by fresh water and NaOH solution from quartz sand indicated the advantage of using alkaline solutions. The extraction coefficient increased by 11% with the use of this method. As clay is added to the sand, the extraction coefficient decreases, and is reduced to 12.7% when the clay content reaches 25%. Nevertheless, a comparison of data obtained for quartz sand with fresh water on a porous medium containing 25% clay with an alkaline solution, indicates that the extraction coefficient is just 1.5% lower even in the presence of such a large amount of clay. Consequently, alkaline flooding should still be given preference over the usual methods under specific conditions and where the rock has a comparatively large amount of clay, in view of all the basic factors that influence the extraction process. The results obtained can be used for selecting alkaline concentration in evaluating the efficiency of flooding oil beds with alkaline solutions. 2 figures, 2 tables.

  6. Rapid changes in water hardness and alkalinity: Calcite formation is lethal to Daphnia magna.

    Science.gov (United States)

    Bogart, Sarah J; Woodman, Samuel; Steinkey, Dylan; Meays, Cindy; Pyle, Greg G

    2016-07-15

    There is growing concern that freshwater ecosystems may be negatively affected by ever-increasing anthropogenic inputs of extremely hard, highly alkaline effluent containing large quantities of Ca(2+), Mg(2+), CO3(2-), and HCO3(-) ions. In this study, the toxicity of rapid and extreme shifts in water hardness (38-600mg/L as CaCO3) and alkalinity (30-420mg/L as CaCO3) to Daphnia magna was tested, both independently and in combination. Within these ranges, where no precipitation event occurred, shifts in water hardness and/or alkalinity were not toxic to D. magna. In contrast, 98-100% of D. magna died within 96h after exposure to 600mg/L as CaCO3 water hardness and 420mg/L as CaCO3 alkalinity (LT50 of 60h with a 95% CI of 54.2-66.0h). In this treatment, a CaCO3 (calcite) precipitate formed in the water column which was ingested by and thoroughly coated the D. magna. Calcite collected from a mining impacted stream contained embedded organisms, suggesting field streams may also experience similar conditions and possibly increased mortality as observed in the lab tests. Although further investigation is required to determine the exact fate of aquatic organisms exposed to rapid calcite precipitation in the field, we caution that negative effects may occur more quickly or at lower concentrations of water hardness and alkalinity in which we observed effects in D. magna, because some species, such as aquatic insects, are more sensitive than cladocerans to changes in ionic strength. Our results provide evidence that both calcite precipitation and the major ion balance of waters should be managed in industrially affected ecosystems and we support the development of a hardness+alkalinity guideline for the protection of aquatic life. Crown Copyright © 2016. Published by Elsevier B.V. All rights reserved.

  7. Critical parameters in cost-effective alkaline extraction for high protein yield from leaves

    NARCIS (Netherlands)

    Zhang, C.; Sanders, J.P.M.; Bruins, M.E.

    2014-01-01

    Leaves are potential resources for feed or food, but their applications are limited due to a high proportion of insoluble protein and inefficient processing. To overcome these problems, parameters of alkaline extraction were evaluated using green tea residue (GTR). Protein extraction could be

  8. Alkaline-side extraction of technetium from tank waste using crown ethers and other extractants

    International Nuclear Information System (INIS)

    Bonnesen, P.V.; Moyer, B.A.; Presley, D.J.; Armstrong, V.S.; Haverlock, T.J.; Counce, R.M.; Sachleben, R.A.

    1996-06-01

    The chemical development of a new crown-ether-based solvent-extraction process for the separation of (Tc) from alkaline tank-waste supernate is ready for counter-current testing. The process addresses a priority need in the proposed cleanup of Hanford and other tank wastes. This need has arisen from concerns due to the volatility of Tc during vitrification, as well as 99 Tc's long half-life and environmental mobility. The new process offers several key advantages that direct treatability--no adjustment of the waste composition is needed; economical stripping with water; high efficiency--few stages needed; non-RCRA chemicals--no generation of hazardous or mixed wastes; co-extraction of 90 Sr; and optional concentration on a resin. A key concept advanced in this work entails the use of tandem techniques: solvent extraction offers high selectivity, while a subsequent column sorption process on the aqueous stripping solution serves to greatly concentrate the Tc. Optionally, the stripping solution can be evaporated to a small volume. Batch tests of the solvent-extraction and stripping components of the process have been conducted on actual melton Valley Storage Tank (MVST) waste as well as simulants of MVST and Hanford waste. The tandem process was demonstrated on MVST waste simulants using the three solvents that were selected the final candidates for the process. The solvents are 0.04 M bis-4,4'(5')[(tert-butyl)cyclohexano]-18-crown-6 (abbreviated di-t-BuCH18C6) in a 1:1 vol/vol blend of tributyl phosphate and Isopar reg-sign M (an isoparaffinic kerosene); 0.02 M di-t-BuCH18C6 in 2:1 vol/vol TBP/Isopar M and pure TBP. The process is now ready for counter-current testing on actual Hanford tank supernates

  9. Competitive solvent extraction of alkaline-earth cations into chloroform by lipophilic acyclic polyether dicarboxylic acids

    International Nuclear Information System (INIS)

    Kang, S.I.; Czech, A.; Czech, B.P.; Stewart, L.E.; Bartsch, R.A.

    1985-01-01

    Competitive solvent extraction of alkaline-earth cations from aqueous solutions into chloroform by a series of lipophilic acyclic polyether dicarboxylic acids is reported. The influence of polyether chain length and of terminal carboxylic acid group variation upon extraction selectivity and efficiency is assessed. In the competitive extraction of concentrated magnesium, calcium, strontium and barium chloride solutions, one complexing agent exhibits pronounced selectivity for barium with Ba 2+ /S 2+ = 50, Ba 2+ /Ca 2+ = 250, and no detectable Mg 2+ extraction. 20 references, 3 figures, 1 table

  10. Rapid analytical extraction of volatile fermentation products

    Energy Technology Data Exchange (ETDEWEB)

    Jansen, N B; Flickinger, M C; Tsao, G T

    1979-10-01

    With renewed interest in production of liquid fuels and chemical feedstocks from carbohydrates, numerous authors have utilized gas-liquid chromatography (GC) for quantification of volatile products. Poor separation and short column life will result if residual sugars present in the medium are not separated from the volatile compounds before injection. In our current investigation of 2,3-butanediol production from xylose, we have developed a rapid GC assay for 2,3-butanediol, acetyl methyl carbinol (acetoin), 2,3-butanedione (diacetyl), and ethanol. This method extracts the fermentation products at high pH from residual xylose before injection into the GC. This routine is a modification of the method of Kolfenbach et al. and is more rapid than the method of separation of diacetyl and acetoin from carbohydrates by distillation reported by Gupta et al. Their erroneous reports of yields of 640 mg diacetyl + acetoin/g sugar are 30% higher than the theoretical maximum for Enterobacter cloacae (ATCC 27613) and points out the need for a reliable, accurate assay for these products.

  11. Separation of alkali and alkaline earth metals by polyethers using extraction chromatography

    International Nuclear Information System (INIS)

    Smulek, W.; Lada, W.A.

    1979-01-01

    The separation of alkali and alkaline earth metals by means of an acyclic polyether, 1,13-bis(8-chinolinyl)-1, 4, 7, 10, 13-pentaoxatridecane (CPOD), and cyclic polyethers, benzo-15-crown-5 (BC), dibenzo-18-crown-6 (DBC) and dicyclohexyl-18-crown-6 (DCHC), using extraction chromatography has been studied. The alkali metals can be effectively separated using SCN - as the accompanying ion. For alkaline earth metals, the best results were obtained with ClO 4 - ions. Different elution sequences for these groups were observed using chloroform and/meen=/ sitylene as diluents for the polyethers. (author)

  12. Cold alkaline extraction as a pretreatment for bioethanol production from eucalyptus, sugarcane bagasse and sugarcane straw

    International Nuclear Information System (INIS)

    Carvalho, Danila Morais de; Sevastyanova, Olena; Queiroz, José Humberto de; Colodette, Jorge Luiz

    2016-01-01

    Highlights: • Mathematical approach to optimize the process of cold alkaline extraction. • Hemicelluloses and lignin removal from biomasses by cold alkaline extraction. • Higher xylan and lignin removal for straw during pretreatment. • Formation of pseudo-extractives for eucalyptus during pretreatment. • Higher ethanol production for pretreated sugarcane straw. - Abstract: Optimal conditions for the cold alkaline extraction (CAE) pretreatment of eucalyptus, sugarcane bagasse and sugarcane straw are proposed in view of their subsequent bioconversion into ethanol through the semi-simultaneous saccharification and fermentation (SSSF) process (with presaccharification followed by simultaneous saccharification and fermentation, or SSF). The optimum conditions, which are identified based on an experiment with a factorial central composite design, resulted in the removal of 46%, 52% and 61% of the xylan and 15%, 37% and 45% of the lignin for eucalyptus, bagasse and straw, respectively. The formation of pseudo-extractives was observed during the CAE of eucalyptus. Despite the similar glucose concentration and yield for all biomasses after 12 h of presaccharification, the highest yield (0.065 g_e_t_h_a_n_o_l/g_b_i_o_m_a_s_s), concentrations (5.74 g L"−"1) and volumetric productivity for ethanol (0.57 g L"−"1 h"−"1) were observed for the sugarcane straw. This finding was most likely related to the improved accessibility of cellulose that resulted from the removal of the largest amount of xylan and lignin.

  13. Overestimation of organic phosphorus in wetland soils by alkaline extraction and molybdate colorimetry.

    Science.gov (United States)

    Turner, Benjamin L; Newman, Susan; Reddy, K Ramesh

    2006-05-15

    Accurate information on the chemical nature of soil phosphorus is essential for understanding its bioavailability and fate in wetland ecosystems. Solution phosphorus-31 nuclear magnetic resonance (31P NMR) spectroscopy was used to assess the conventional colorimetric procedure for phosphorus speciation in alkaline extracts of organic soils from the Florida Everglades. Molybdate colorimetry markedly overestimated organic phosphorus by between 30 and 54% compared to NMR spectroscopy. This was due in large part to the association of inorganic phosphate with organic matter, although the error was exacerbated in some samples by the presence of pyrophosphate, an inorganic polyphosphate that is not detected by colorimetry. The results have important implications for our understanding of phosphorus biogeochemistry in wetlands and suggest that alkaline extraction and solution 31p NMR spectroscopy is the only accurate method for quantifying organic phosphorus in wetland soils.

  14. Alkaline extraction: can it be used for the removal of 137Cs from soil?

    International Nuclear Information System (INIS)

    Nageldinger, G.; Flowers, A.; Entwistle, J.

    1998-01-01

    A titration extraction procedure was applied to a silty clay which was spiked with 137 Cs. At least 20% of spiked 137 Cs silty clay was found to be associated with the humic acid (HA) fraction. This shows that HA contributes significantly to cesium fixing in soil and cesium is not only fixed between regular ion exchange complexes (REC) and specific sites in the frayed edges of clay minerals (FES). About 85% of 137 Cs was found in the 12M HCl extract. The titration extraction procedure was found useful for investigation of the impact of the soil pH on the radiocesium mobility. Only trace amounts of cesium were found between pH 1 to 7, demonstrating a high immobility of cesium over this pH range. If the alkaline digestion is applied to soil for the removal of radiocesium, then these can be significantly separated from the extract by protonation of the extracted HA. (P.A.)

  15. Extraction of lithium ion from alkaline aqueous media by a liquid surfactant membrane

    International Nuclear Information System (INIS)

    Kinugasa, Takumi; Ono, Yuri; Kawamura, Yuko; Watanabe, Kunio; Takeuchi, Hiroshi.

    1995-01-01

    Extraction of lithium ion from aqueous alkaline media by a liquid surfactant membrane was performed using a mixture of LIX54 and TOPO as the extractant. Stripping of lithium from the kerosene solution to the acid solution was suppressed with increasing content of polyamine (ECA) surfactant. The extraction rate of lithium by the liquid membrane could be interpreted taking account of an interfacial resistance due to ECA. It was confirmed that swelling of the (W/O) emulsion drops by water permeation through the liquid membrane is evaluated in terms of a change in osmotic pressure gradient between the external and internal aqueous phases during the lithium extraction. In the present operation, the extraction ratio of Li + from the external feed and the uptake into the internal phase reached as high as 95%. (author)

  16. Micelle formation during extraction of alkali elements from strongly alkaline mediums

    International Nuclear Information System (INIS)

    Apanasenko, V.V.; Reznik, A.M.; Bukin, V.I.; Brodskaya, A.V.

    1988-01-01

    Extraction of potassium, rubidium and cesium by phenol reagents in hydrocarbon solvents from strongly alkakine solutions was considered. Tendency of prepared alkali metal phenolates to form micelles in aqueous and organic phases was revealed. Phenolates tendency to form micelles is dictated mainly by the size and position of hydrocarbon substituent in molecule. It is shown that when micelles form in organic phase, alkali elements can be extracted both according to cation-exchange mechanism and according to micellar one. It is noted that alkai element extraction from strongly alkaline media requires the correct choice of extractant: alkali metal phenolate shouldn't form micelles in aqueous solution. n-Alkyl- and arylphenoldisulfides and polysulfides are most preferable for solvent extraction among considered phenol derivatives

  17. Optimization of Alkaline Extraction and Bioactivities of Polysaccharides from Rhizome of Polygonatum odoratum

    Science.gov (United States)

    Chen, Yong; Yin, Luoyi; Zhang, Xuejiao; Wang, Yan; Chen, Qiuzhi; Jin, Chenzhong; Wang, Jihua

    2014-01-01

    The present study is to explore the optimal extraction parameters, antioxidant activity, and antimicrobial activity of alkaline soluble polysaccharides from rhizome of Polygonatum odoratum. The optimal extraction parameters were determined as the following: NaOH concentration (A) 0.3 M, temperature (B) 80°C, ratio of NaOH to solid (C) 10-fold, and extraction time (D) 4 h, in which ratio of NaOH to solid was a key factor. The order of the factors was ratio of NaOH to solid (fold, C) > extraction temperature (°C, B) > NaOH concentration (M, A) > extraction time (h, D). The monosaccharide compositions of polysaccharides from P. odoratum were rhamnose, mannose, xylose, and arabinose with the molecular ratio of 31.78, 31.89, 11.11, and 1.00, respectively. The reducing power, the 1, 1-diphenyl-2-picryl-hydrazil (DPPH) radical scavenging rate, the hydroxyl radicals scavenging rate, and the inhibition rate to polyunsaturated fatty acid (PUFA) peroxidation of the alkaline soluble polysaccharides from P. odoratum at 1 mg/mL were 9.81%, 52.84%, 19.22%, and 19.42% of ascorbic acid at the same concentration, respectively. They also showed antimicrobial activity against pathogenic bacteria Staphylococcus aureus, Pseudomonas aeruginosa, Bacillus subtilis, and Escherichia coli. PMID:25093173

  18. Multiple biological complex of alkaline extract of the leaves of Sasa senanensis Rehder.

    Science.gov (United States)

    Sakagami, Hiroshi; Zhou, Li; Kawano, Michiyo; Thet, May Maw; Tanaka, Shoji; Machino, Mamoru; Amano, Shigeru; Kuroshita, Reina; Watanabe, Shigeru; Chu, Qing; Wang, Qin-Tao; Kanamoto, Taisei; Terakubo, Shigemi; Nakashima, Hideki; Sekine, Keisuke; Shirataki, Yoshiaki; Zhang, Chang-Hao; Uesawa, Yoshihiro; Mohri, Kiminori; Kitajima, Madoka; Oizumi, Hiroshi; Oizumi, Takaaki

    2010-01-01

    Previous studies have shown anti-inflammatory potential of alkaline extract of the leaves of Sasa senanensis Rehder (SE). The aim of the present study was to clarity the molecular entity of SE, using various fractionation methods. SE inhibited the production of nitric oxide (NO), but not tumour necrosis factor-α by lipopolysaccharide (LPS)-stimulated mouse macrophage-like cells. Lignin carbohydrate complex prepared from SE inhibited the NO production to a comparable extent with SE, whereas chlorophyllin was more active. On successive extraction with organic solvents, nearly 90% of SE components, including chlorophyllin, were recovered from the aqueous layer. Anti-HIV activity of SE was comparable with that of lignin-carbohydrate complex, and much higher than that of chlorophyllin and n-butanol extract fractions. The CYP3A inhibitory activity of SE was significantly lower than that of grapefruit juice and chlorophyllin. Oral administration of SE slightly reduced the number of oral bacteria. When SE was applied to HPLC, nearly 70% of SE components were eluted as a single peak. These data suggest that multiple components of SE may be associated with each other in the native state or after extraction with alkaline solution.

  19. Evaluation of a simple, non-alkaline extraction protocol to quantify soil ergosterol

    NARCIS (Netherlands)

    De Ridder-Duine, A.S.; Smant, W.; Van der Wal, A.; Van Veen, J.A.; De Boer, W.

    2006-01-01

    Quantification of soil ergosterol is increasingly used as an estimate for soil fungal biomass. Several methods for extraction of ergosterol from soil have been published, perhaps the simplest being that described by Gong, P., Guan, X., Witter, E. [2001. A rapid method to extract ergosterol from soil

  20. Cyclohexanone solvent extraction of 99TcO4 from alkaline nuclear waste solutions

    International Nuclear Information System (INIS)

    Schulz, W.W.

    1980-01-01

    Although the 99 Tc cyclohexanone solvent extraction process is still in the bench-scale development stage, the process appears well suited for engineering-scale removal of 99 Tc from alkaline Hanford waste solutions. The most pressing process development need is to resolve the phase disengaging problems encountered during water stripping operations. Stripping tests in pulse columns and/or centrifugal contactors are particularly needed to determine the magnitude of the phase disengaging problem in engineering-scale equipment and to find suitable remedies. 5 figures, 7 tables

  1. Preparative yield and properties of humic acids obtained by sequential alkaline extractions

    Science.gov (United States)

    Kholodov, V. A.; Yaroslavtseva, N. V.; Konstantinov, A. I.; Perminova, I. V.

    2015-10-01

    The preparative yield, composition, and structure of humic acids obtained by sequential alkaline extractions from two soils (a soddy-podzolic soil under forest and a typical chernozem in treatment with permanent black fallow of a long-term experiment since 1964) have been studied. The preparative yield of humic acids from the first extraction is 0.40 and 0.94% for the soddy-podzolic soil (Retisols) and the chernozem, respectively. The preparative yield from the second extraction is lower by several times, and the yield from the third extraction is lower by an order of magnitude. The study of the obtained preparations by elemental analysis, gel-permeation chromatography, and 13C NMR spectroscopy has shown insignificant changes in the elemental, molecular-weight, and structural-group composition of humic acids among the extractions. It has been supposed that this is related to the soil features: typical climatic factors for the formation of soil subtype in the case of soddy-podzolic soil and the land use in the long-term experiment in the case of typical chernozem. It has been concluded that that a single extraction is sufficient for the separation of humic acids and the preparation of a representative sample.

  2. Structural Features of Alkaline Extracted Polysaccharide from the Seeds of Plantago asiatica L. and Its Rheological Properties

    Directory of Open Access Journals (Sweden)

    Jun-Yi Yin

    2016-09-01

    Full Text Available Polysaccharide from the seeds of Plantago asiatica L. has many bioactivities, but few papers report on the structural and rheological characteristics of the alkaline extract. The alkaline extracted polysaccharide was prepared from seeds of P. asiatica L. and named herein as alkaline extracted polysaccharide from seeds of P. asiatica L. (PLAP. Its structural and rheological properties were characterized by monosaccharide composition, methylation, GC-MS and rheometry. PLAP, as an acidic arabinoxylan, was mainly composed of 1,2,4-linked Xylp and 1,3,4-linked Xylp residues. PLAP solution showed pseudoplastic behavior, and weak gelling properties at high concentration. Sodium and especially calcium ions played a significant role in increasing the apparent viscosity and gel strength.

  3. Effective extraction method through alkaline hydrolysis for the detection of starch maleate in foods

    Directory of Open Access Journals (Sweden)

    Chia-Fen Tsai

    2015-09-01

    Full Text Available A high-performance liquid chromatography (HPLC method was developed for the determination of maleic acid which was released from starch maleate (SM through the alkaline hydrolysis reaction. The proper alkaline hydrolysis conditions and LC separation are reported in this study. The starch samples were treated with 50% methanol for 30 minutes, and then hydrolyzed by 0.5N KOH for 2 hours to release maleic acid. A C18 column and gradient mobile phase consisting of 0.1% phosphoric acid and methanol at a flow rate of 1.0 mL/minute were used for separation. The method showed a good linearity in the range of 0.01–1.0 ìg/mL, with a limit of quantification (LOQ at 10 mg/kg in starch. The recoveries in corn starch, noodle, and fish balls were between 93.9% and 108.4%. The relative standard deviation (RSD of precision was <4.9% (n = 3. This valid method was rapid, sensitive, precise, and suitable for routine monitoring of the illegal adulteration of SM in foods.

  4. Study of radium extraction mechanisms from scales by leaching in different acidic and alkaline media

    International Nuclear Information System (INIS)

    Al-Masri, M. S.; Gafar, M.; Al-Kurdi, H.

    2002-07-01

    The present report shows the results of leaching experiments for scales containing naturally occuring radioactive materials using different acidic and alkaline media. The obtained result can be used for defining the method of safe disposal of such waste. Leaching solutions used in this study were distilled water, mineral acids (sulpharic acid, hydrochloric acid and nitric acid), sodium, potassium hydroxides, ammonium oxalate EDTA, sodium carbonate, potassium acetate, and a mixture of potassium chloride and hydrochloric acid. The results have shown that the extraction ratio of radium-226, the most abundant isotope in scales, is very low and even negligible using all different media. This indicates that all scales produced in Syrian oil fields do not require any chemical preparation before disposal. In addition, the effect of both stirring time of phrases and concentration of leaching media that may affect the radium transfer process from solid phase to aqueous phase have been investigated were no measurable amount being observed in the leachate. (author)

  5. Effect of alkaline earth metal and magnesium cations on cadmium extraction from chloride solutions by tributyl phosphate

    International Nuclear Information System (INIS)

    Prokuev, V.A.; Belousov, E.A.

    1985-01-01

    At 298 K thermodynamic constants of cadmium (2) extraction from chloride solutions of magnesium, calcium, strontium and barium by tributyl phosphate are calculated. It is established, that logarithm of the thermodynamic extraction constant is in a linear dependence from the change in the cation hydration enthalpy in agqueous solution. It is shown, that activity coefficient of neutral complex CdVCl 2 differs from one, and it is the higher the more stable the complex is in alkaline earth metal chloride solutions

  6. Alkaline-Side Extraction of Cesium from Savannah River Tank Waste Using a Calixarene-Crown Ether Extractant

    Energy Technology Data Exchange (ETDEWEB)

    Bonnesen, P.V.; Delmau, L.H.; Haverlock, T.J.; Moyer, B.A.

    1998-12-01

    Results are presented supporting the viability of the alkaline-side CSEX process as a potential replacement for the In-Tank Precipitation process for removal of cesium from aqueous high-level waste (HLW) at the Savannah River Site (SRS). Under funding from the USDOE Efficient Separations and Crosscutting program, a flowsheet was suggested in early June of 1998, and in the following four months, this flowsheet underwent extensive testing, both in batch tests at ORNL and ANL and in two centrifugal-contactor tests at ANL. To carry out these tests, the initial ESP funding was augmented by direct funds from Westinghouse Savannah River Corporation. The flowsheet employed a solvent containing a calixarene-crown hybrid compound called BoBCalixC6 that was invented at ORNL and can now be obtained commercially for government use from IBC Advanced Technologies. This special extractant is so powerful and selective that it can be used at only 0.01 M, compensating for its expense, but a modifier is required for use in an aliphatic diluent, primarily to increase the cesium distribution ratio D{sub Cs} in extraction. The modifier selected is a relatively economical fluorinated alcohol called Cs3, invented at ORNL and so far available. only from ORNL. For the flowsheet, the modifier is used at 0.2 M in the branched aliphatic kerosene Isopar{reg_sign} L. Testing at ORNL and ANL involved simulants of the SRS HLW. After extraction of the Cs from the waste simulant, the solvent is scrubbed with 0.05 M HNO{sub 3} and stripped with a solution comprised of 0.0005 M HNO{sub 3} and 0.0001 M CsNO{sub 3}. The selection of these conditions is justified in this report, both on the basis of experimental data and underlying theory.

  7. Rapid extraction of virus-contaminated hemocytes from oysters

    Science.gov (United States)

    Rapid viral detection methods are necessary to employ diagnostic testing for viral contamination in shellfish to prevent and control foodborne illness. Current shellfish viral RNA extraction methods, which are time-consuming and not applicable for routine monitoring, require the testing of whole or ...

  8. Rapid Statistical Learning Supporting Word Extraction From Continuous Speech.

    Science.gov (United States)

    Batterink, Laura J

    2017-07-01

    The identification of words in continuous speech, known as speech segmentation, is a critical early step in language acquisition. This process is partially supported by statistical learning, the ability to extract patterns from the environment. Given that speech segmentation represents a potential bottleneck for language acquisition, patterns in speech may be extracted very rapidly, without extensive exposure. This hypothesis was examined by exposing participants to continuous speech streams composed of novel repeating nonsense words. Learning was measured on-line using a reaction time task. After merely one exposure to an embedded novel word, learners demonstrated significant learning effects, as revealed by faster responses to predictable than to unpredictable syllables. These results demonstrate that learners gained sensitivity to the statistical structure of unfamiliar speech on a very rapid timescale. This ability may play an essential role in early stages of language acquisition, allowing learners to rapidly identify word candidates and "break in" to an unfamiliar language.

  9. Rapid automatic keyword extraction for information retrieval and analysis

    Science.gov (United States)

    Rose, Stuart J [Richland, WA; Cowley,; E, Wendy [Richland, WA; Crow, Vernon L [Richland, WA; Cramer, Nicholas O [Richland, WA

    2012-03-06

    Methods and systems for rapid automatic keyword extraction for information retrieval and analysis. Embodiments can include parsing words in an individual document by delimiters, stop words, or both in order to identify candidate keywords. Word scores for each word within the candidate keywords are then calculated based on a function of co-occurrence degree, co-occurrence frequency, or both. Based on a function of the word scores for words within the candidate keyword, a keyword score is calculated for each of the candidate keywords. A portion of the candidate keywords are then extracted as keywords based, at least in part, on the candidate keywords having the highest keyword scores.

  10. Rapid Formation of 1D Titanate Nanotubes Using Alkaline Hydrothermal Treatment and Its Photocatalytic Performance

    Directory of Open Access Journals (Sweden)

    Chin Wei Lai

    2015-01-01

    Full Text Available One-dimensional (1D titanate nanotubes (TNT were successfully synthesized using alkaline hydrothermal treatment of commercial TiO2 nanopowders in a Teflon lined stainless steel autoclave at 150°C. The minimum time required for the formation of the titanate nanotubes was 9 h significantly. After the hydrothermal processing, the layered titanate was washed with acid and water in order to control the amount of Na+ ions remaining in the sample solutions. In this study, the effect of different reaction durations in a range of 3 h to 24 h on the formation of nanotubes was carried out. As the reaction duration is extended, the changes in structure from particle to tubular shapes of alkaline treated TiO2 were obtained via scanning electron microscope (SEM. Also, the significant impact on the phase transformation and crystal structure of TNT was characterized through XRD and Raman analysis. Indeed, the photocatalytic activity of TNT was investigated through the degradation of methyl orange aqueous solution under the ultraviolet light irradiation. As a result, TNT with reaction duration at 6 h has a better photocatalytic performance than other samples which was correlated to the higher crystallinity of the samples as shown in XRD patterns.

  11. Rapid extraction and assay of uranium from environmental surface samples

    Energy Technology Data Exchange (ETDEWEB)

    Barrett, Christopher A.; Chouyyok, Wilaiwan; Speakman, Robert J.; Olsen, Khris B.; Addleman, Raymond Shane

    2017-10-01

    Extraction methods enabling faster removal and concentration of uranium compounds for improved trace and low-level assay are demonstrated for standard surface sampling material in support of nuclear safeguards efforts, health monitoring, and other nuclear analysis applications. A key problem with the existing surface sampling swipes is the requirement for complete digestion of sample and sampling matrix. This is a time-consuming and labour-intensive process that limits laboratory throughput, elevates costs, and increases background levels. Various extraction methods are explored for their potential to quickly and efficiently remove different chemical forms of uranium from standard surface sampling material. A combination of carbonate and peroxide solutions is shown to give the most rapid and complete form of uranyl compound extraction and dissolution. This rapid extraction process is demonstrated to be compatible with standard inductive coupled plasma mass spectrometry methods for uranium isotopic assay as well as screening techniques such as x-ray fluorescence. The general approach described has application beyond uranium to other analytes of nuclear forensic interest (e.g., rare earth elements and plutonium) as well as heavy metals for environmental and industrial hygiene monitoring.

  12. Extraction process of U from its ores using solutions of alkaline earth carbonates and bicarbonates in presence of carbon dioxide

    International Nuclear Information System (INIS)

    Floreancig, Antoine; Schuffenecker, Robert.

    1976-01-01

    A process is described for extracting uranium from its ores, either directly in the ore deposit or after such ore bodies have been taken from the ground, comprising an oxidation-leaching stage followed by a recovery stage. The characteristic of this process is that in the leaching process, carbonate and bicarbonate solutions of an alkaline-earth metal are used under a pressure of carbon dioxide between zero and 60 bars and at a temperature of zero to 100 0 C [fr

  13. Application of alkaline leaching to the extraction of uranium from shale of the Vosges

    International Nuclear Information System (INIS)

    Mouret, P.; Pottier, P.; Le Bris, J.

    1958-01-01

    Description of chemical treatment of Vosges shales to obtain uranium by alkaline leaching. Mineralogy aspects of ore, physical and chemical conditions of leaching, solid/liquid separation, uranium recovery by either ion exchange process or electrolytic precipitation. (author) [fr

  14. Development of Effective Solvent Modifiers for the Solvent Extraction of Cesium from Alkaline High-Level Tank Waste

    International Nuclear Information System (INIS)

    Bonnesen, Peter V.; Delmau, Laetitia H.; Moyer, Bruce A.; Lumetta, Gregg J.

    2003-01-01

    A series of novel alkylphenoxy fluorinated alcohols were prepared and investigated for their effectiveness as modifiers in solvents containing calix(4)arene-bis-(tert-octylbenzo)-crown-6 for extracting cesium from alkaline nitrate media. A modifier that contained a terminal 1,1,2,2-tetrafluoroethoxy group was found to decompose following long-term exposure to warm alkaline solutions. However, replacement of the tetrafluoroethoxy group with a 2,2,3,3-tetrafluoropropoxy group led to a series of modifiers that possessed the alkaline stability required for a solvent extraction process. Within this series of modifiers, the structure of the alkyl substituent (tert-octyl, tert-butyl, tert-amyl, and sec-butyl) of the alkylphenoxy moiety was found to have a profound impact on the phase behavior of the solvent in liquid-liquid contacting experiments, and hence on the overall suitability of the modifier for a solvent extraction process. The sec-butyl derivative(1-(2,2,3,3-tetrafluoropropoxy)-3- (4-sec-butylphenoxy)-2-propanol) (Cs-7SB) was found to possess the best overall balance of properties with respect to third phase and coalescence behavior, cleanup following degradation, resistance to solids formation, and cesium distribution behavior. Accordingly, this modifier was selected for use as a component of the solvent employed in the Caustic-Side Solvent Extraction (CSSX) process for removing cesium from high level nuclear waste (HLW) at the U.S. Department of Energy's (DOE) Savannah River Site. In batch equilibrium experiments, this solvent has also been successfully shown to extract cesium from both simulated and actual solutions generated from caustic leaching of HLW tank sludge stored in tank B-110 at the DOE's Hanford Site.

  15. Application of microwave energy to speed up the alkaline extraction of humic and fulvic acids from marine sediments

    International Nuclear Information System (INIS)

    Romaris-Hortas, Vanessa; Moreda-Pineiro, Antonio; Bermejo-Barrera, Pilar

    2007-01-01

    The feasibility of microwave energy to speed up the alkaline extraction of humic substances (humic acid, HA, and fulvic acid, FA) from marine sediments has been checked. Extractions were performed by using 20 mL of sodium hydroxide at 0.1 M (two repeated extractions) after an ultrasound-assisted acid pre-treatment of samples to remove the carbonate fraction (ultrasound power at 17 kHz, 10 mL of 6.0 M hydrochloric acid for 15 min). After separation of HA and FA fractions by acidifying with 6 M HCl, the FA fraction (supernatant) was purified by passing the solution through a column of Amberlite XAD-8. Both HA and FA extracts were measured by UV-visible spectrophotometry. All variables affecting the extraction process (sodium hydroxide concentration and volume, ramp and hold times, temperature and number of repeated extractions) have been screened by using a Plackett-Burman design (PBD) as multivariate approach. The variables temperature and number of repeated extractions were the most significant factors (P = 95%) affecting the extraction of both FA and HA from marine sediments. These two variables have led optimum values of 150 deg. C and two repeated extractions. The developed method has been found precise (R.S.D.s of 9% for HA and 12% for FA, for 11 determinations) and its results were comparable in terms of elemental (C, H and N) composition to those obtained after applying methods based on mechanical stirring and ultrasounds assisting. However, higher HA and FA concentrations than those obtained after conventional stirring and ultrasound irradiation were obtained when applying microwave energy. This means a higher efficiency of microwave energy than ultrasounds or mechanical stirring to extract HA and FA fractions from marine sediments. The method was finally applied to different surface marine sediments from the Ria de Arousa estuary

  16. Removal of technetium from alkaline nuclear-waste media by a solvent-extraction process using crown ethers

    International Nuclear Information System (INIS)

    Bonnesen, P.V.; Presley, D.J.; Haverlock, T.J.; Moyer, B.A.

    1995-01-01

    Crown ethers dissolved in suitably modified aliphatic kerosene diluents can be employed to extract technetium as pertechnetate anion (TcO 4 - ) with good extraction ratios from realistic simulants of radioactive alkaline nitrate waste. The modifiers utilized are non-halogenated and non-volatile, and the technetium can be removed from the solvent by stripping using water. The crown ethers bis-4,4'(5')[(tert-butyl)cyclohexano]-18-crown-6 (di-t-BuCH18C6) and dicyclohexano-18-crown-6 (DCH18C6) provide stronger TcO 4 - extraction than dicyclohexano-21-crown-7 and 4-tert-butylcyclohexano 15-crown-5. Whereas DCH18C6 provides somewhat higher TcO 4 - extraction ratios than the more lipophilic di-t-BuCH18C6 derivative, the latter was selected for further study owing to its lower distribution to the aqueous phase. Particularly good extraction and stripping results were obtained with di-t-BuCH 18C6 at 0.02 M in a 2:1 vol/vol blend of tributyl phosphate and Isopar reg-sign M. Using this solvent, 98.9% of the technetium contained (at 6 x 10 -5 M) in a Double-Shell Slurry Feed (DSSF) Hanford tank waste simulant was removed following two cross-current extraction contacts. Two cross-current stripping contacts with deionized water afforded removal of 99.1% of the technetium from the organic solvent

  17. Novel Extraction Process Of Rare Earth Elements From NdFeB Powders Via Alkaline Treatment

    Directory of Open Access Journals (Sweden)

    Chung K.W.

    2015-06-01

    Full Text Available The alkaline treatment of NdFeB powders in NaOH solution at various equivalent amounts of NaOH at 100°C was performed. The resultant powders were then leached in 0.5M H2SO4 solution at 25°C for 2 minutes. At 5 equivalents of NaOH, neodymium in NdFeB powders was partially transformed to neodymium hydroxide. The transformation of neodymium to neodymium hydroxide actually occurred at 10 equivalents of NaOH and was facilitated by increasing the equivalent of NaOH from 10 to 30. In addition, iron was partially transformed to magnetite during the alkaline treatment, which was also promoted at a higher equivalent of NaOH. The leaching yield of neodymium from alkaline-treated powders was increased with an increasing equivalent of NaOH up to 10; however, it slightly decreased with the equivalent NaOH of over 10. The leaching yield of iron was inversely proportional to that of rare earth elements. NdFeB powders treated at 10 equivalents of NaOH showed a maximum leaching yield of neodymium and dysprosium of 91.6% and 94.6%, respectively, and the lowest leaching yield of iron of 24.2%, resulting in the highest selective leaching efficiency of 69.4%.

  18. Determination of phosphate compounds in meat products by 31-Phosphorus Nuclear Magnetic Resonance spectroscopy with methylenediphosphonic acid after alkaline extraction

    International Nuclear Information System (INIS)

    Hrynczyszyn, P.; Jastrzebska, A.; Szlyk, E.

    2010-01-01

    Modification of the extraction procedure and application of the 31 P NMR method for the determination of polyphosphates in meat products were studied. In the elaborated procedure threefold water extraction at alkaline pH (borate buffer and 0.1 M EDTA) was applied. Furthermore, the new external standard for 31 P NMR determination of phosphates was proposed. Obtained recoveries were between 95 and 99% and variation coefficients (CV) was ≤5%, indicating an increase in accuracy and the precision of the proposed procedure in relation to the spectrophotometric method. The described procedure of sample preparation with 31 P NMR method was applied for the determination of polyphosphate additives in meat products. The satisfactory precision (CV = 0.39-3.40%) shows the benefit of the NMR method in the routine analysis of the phosphate ions in meat products.

  19. Extraction of uranium from alkaline medium by aliquot-336 in different diluents

    Energy Technology Data Exchange (ETDEWEB)

    Shehata, F A; Elnadi, Y A; Aly, H F [Hot laboratories center, atomic energy authority 13758, Cairo, (Egypt); Ahmed, A S [Faculty of science, Cairo University, Giza, (Egypt)

    1995-10-01

    A study was made on the extraction of uranium from aqueous solutions containing sodium carbonate and sodium hydroxide in the presence of oxidizing agent (H{sub 2} O{sub 2}) by aliquot-336 dissolved in different diluents. The effect of different factors affecting the extraction equilibrium was experimented. From the results obtained, the extraction equilibrium was elaborated. From the effect of temperature on the extraction, The thermodynamic constants of the system were determined and discussed. 5 figs., 1 tab.

  20. Potential of hot water extraction of birch wood to produce high-purity dissolving pulp after alkaline pulping.

    Science.gov (United States)

    Borrega, Marc; Tolonen, Lasse K; Bardot, Fanny; Testova, Lidia; Sixta, Herbert

    2013-05-01

    The potential of hot water extraction of birch wood to produce highly purified dissolving pulp in a subsequent soda-anthraquinone pulping process was evaluated. After intermediate extraction intensities, pulps with low xylan content (3-5%) and high cellulose yield were successfully produced. Increasing extraction intensity further decreased the xylan content in pulp. However, below a xylan content of 3%, the cellulose yield dramatically decreased. This is believed to be due to cleavage of glycosidic bonds in cellulose during severe hot water extractions, followed by peeling reactions during alkaline pulping. Addition of sodium borohydride as well as increased anthraquinone concentration in the pulping liquor increased the cellulose yield, but had no clear effects on pulp purity and viscosity. The low intrinsic viscosity of pulps produced after severe extraction intensities and soda-anthraquinone pulping corresponded to the viscosity at the leveling-off degree of polymerization, suggesting that nearly all amorphous cellulose had been degraded. Copyright © 2012 Elsevier Ltd. All rights reserved.

  1. Roughness comparison of heat cured type of acrylic resin in disinfectant solution immersion (Immersion in a solution of alkaline peroxide and 75% Celery extract (Apium graveolens L

    Directory of Open Access Journals (Sweden)

    Dewi Puspitasari

    2016-08-01

    Full Text Available Acrylic resin denture base has the properties absorbing that affecting physical and mechanical properties. One of the physical properties of acrylic resin is surface roughness. The aim of the study was to find out the roughness effect on heat cured acrylic that was immersed in alkaline peroxide and 75% celery (Apium graveoens L extract as a disinfectant solution. The study was a true experimental and posttest with control group designed with a rectangular shape size 65 x 10 x 3.3 mm based on the ISO standard 1567, six samples were used for alkaline peroxide, celery extract 75% and aquadest group for 5 and 15 days. A Surface Roughness Tester was used for the surface roughness changes observation. The statistical test used One-way ANOVA and post hoc Bonferroni. The results of this study showed the value of roughness on 5 days for alkaline peroxide (1.51 µm is greater than celery extract (0.36µm and aquadest (0.30 µm. The soaking for 15 days in alkaline peroxide (1.52 µm is greater than 75% celery extracts (0.38 µm and aquadest (0.34 µm. Alkaline peroxide caused higher roughness value of heat cured acrylic resin than 75% celery extract.

  2. Presidential Rapid Commercialization Initiative for mixed waste solvent extraction

    International Nuclear Information System (INIS)

    Honigford, L.; Dilday, D.; Cook, D.

    1997-01-01

    Recently, the Fernald Environmental Management Project (FEMP) has made some major steps in mixed waste treatment which have taken it closer to meeting final remediation goals. However, one major hurdle remains for the FEMP mixed waste treatment program, and that hurdle is tri-mixed waste. Tri-mixed is a term coined to describe low-level waste containing RCRA hazardous constituents along with polychlorinated biphenyls (PCB). The prescribed method for disposal of PCBs is incineration. In mixed waste treatment plans developed by the FEMP with public input, the FEMP committed to pursue non-thermal treatment methods and avoid the use of incineration. Through the SITE Program, the FEMP identified a non-thermal treatment technology which uses solvents to extract PCBs. The technology belongs to a small company called Terra-Kleen Response Group, Inc. A question arose as to how can this new and innovative technology be implemented by a small company at a Department of Energy (DOE) facility. The answer came in the form of the Rapid Commercialization Initiative (RCI) and the Mixed Waste Focus Area (MWFA). RCI is a program sponsored by the Department of commerce (DOC), DOE, Department of Defense (DOD), US EPA and various state agencies to aid companies to market new and innovative technologies

  3. Extraction of Zinc and Manganese from Alkaline and Zinc-Carbon Spent Batteries by Citric-Sulphuric Acid Solution

    Directory of Open Access Journals (Sweden)

    Francesco Ferella

    2010-01-01

    Full Text Available The paper is focused on the recovery of zinc and manganese from alkaline and zinc-carbon spent batteries. Metals are extracted by sulphuric acid leaching in the presence of citric acid as reducing agent. Leaching tests are carried out according to a 24 full factorial design, and empirical equations for Mn and Zn extraction yields are determined from experimental data as a function of pulp density, sulphuric acid concentration, temperature, and citric acid concentration. The highest values experimentally observed for extraction yields were 97% of manganese and 100% of zinc, under the following operating conditions: temperature 40∘C, pulp density 20%, sulphuric acid concentration 1.8 M, and citric acid 40 g L-1. A second series of leaching tests is also performed to derive other empirical models to predict zinc and manganese extraction. Precipitation tests, aimed both at investigating precipitation of zinc during leaching and at evaluating recovery options of zinc and manganese, show that a quantitative precipitation of zinc can be reached but a coprecipitation of nearly 30% of manganese also takes place. The achieved results allow to propose a battery recycling process based on a countercurrent reducing leaching by citric acid in sulphuric solution.

  4. Binary Solvent Extraction of Tocols, γ-Oryzanol, and Ferulic Acid from Rice Bran Using Alkaline Treatment Combined with Ultrasonication.

    Science.gov (United States)

    Truong, Hoa Thi; Luu, Phuong Duc; Imamura, Kiyoshi; Matsubara, Takeo; Takahashi, Hideki; Takenaka, Norimichi; Boi, Luu Van; Maeda, Yasuaki

    2017-06-21

    Alkaline treatment (Alk) combined with ultrasound-assisted extraction (UAE) (Alk+UAE) was examined as a means of extracting tocols and γ-oryzanol from rice bran into an organic phase while simultaneously recovering ferulic acid into an aqueous phase. The tocols and γ-oryzanol/ferulic acid yields were determined using high-performance liquid chromatography with fluorescence and UV detection. The effects of extraction conditions were evaluated by varying the Alk treatment temperature and extraction duration. The maximum yields of tocols and γ-oryzanol were obtained at 25 °C over a time span of 30 min. When the temperature was increased to 80 °C, the yield of ferulic acid increased dramatically, whereas the recovery of γ-oryzanol slightly decreased. Employing the Alk+UAE procedure, the recovered concentrations of tocols, γ-oryzanol, and ferulic acid were in the ranges of 146-518, 1591-3629, and 352-970 μg/g, respectively. These results are in good agreement with those reported for rice bran samples from Thailand.

  5. Electromembrane extraction as a rapid and selective miniaturized sample preparation technique for biological fluids

    DEFF Research Database (Denmark)

    Gjelstad, Astrid; Pedersen-Bjergaard, Stig; Seip, Knut Fredrik

    2015-01-01

    This special report discusses the sample preparation method electromembrane extraction, which was introduced in 2006 as a rapid and selective miniaturized extraction method. The extraction principle is based on isolation of charged analytes extracted from an aqueous sample, across a thin film....... Technical aspects of electromembrane extraction, important extraction parameters as well as a handful of examples of applications from different biological samples and bioanalytical areas are discussed in the paper....

  6. Liquid-liquid extraction of plutonium and americium by cekanoic acid from alkaline medium

    International Nuclear Information System (INIS)

    Venugopal Chetty, K.; Sagar, V.; Swarup, R.

    2001-01-01

    Liquid-liquid extraction studies of plutonium and americium from aqueous carbonate medium using a high molecular weight carboxylic acid namely cekanoic acid in different diluents has been carried out. The distribution ratio (D) values for Pu(IV) and Am(III) under various parameters such as concentration of extractant, Na 2 CO 3 and initial pH were obtained. Results indicated that Pu(IV) and Am(III) could be satisfactorily extracted together or individually from aqueous carbonate medium using cekanoic acid in different diluents like carbon tetrachloride, cyclohexane, toluene, n-dodecane or solvesso-100. The D values for Pu(IV) and Am(III) also indicated the possibility of their mutual separation. The back extraction of Pu and Am with different reagents was also studied. (orig.)

  7. Selective Recovery of Yttrium and Ytterbium Oxides from Abu Rusheid REEs Concentrate via Alkaline Leaching and Solvent Extraction

    International Nuclear Information System (INIS)

    El-Sheikh, E.M.

    2017-01-01

    The REEs concentrate prepared from Abu Rusheid lamprophyre ore material is found to assay 44.65% Y_2O_3 and 13.87% Yb_2O_3 together with less amounts of 10 other REEs. This concentrate has been subjected to alkaline leaching process using seven different alkali reagents (single or mixed). From the obtained results, the mixed Na_2CO_3/(NH_4)HCO_3 reagent has been able to leach up to 87.32 % of Yb and 98.73% of Y together with a minor amount of Eu( 1.44)%. Finally, TBP extractant has been used to separate highly pure Yb and Y concentrate oxides from the nitrate solution

  8. Liquid-liquid extraction from molten alkaline nitrates by using nitrogenous and organophosphorus derivatives

    International Nuclear Information System (INIS)

    Vittori, Olivier

    1971-01-01

    This research thesis reports the use of a system made of the LiNO 3 -KNO 3 eutectic at 160 deg. C and poly-phenyls in order to study the behaviour of phosphine and arsine oxides as extracting agents in a liquid-liquid process. In a first part, the author presents the studied system, its physical characteristics and its preparation, and the various analytical methods which have used. He discusses existing computation methods adapted to the separation of molten salts and organic phase, and proposes a specific method. Then, he reports the study of the behaviour of a phosphine oxide with Cobalt II and Nickel II, and discusses its application to the separation of this pair, Co II and Ni II. He highlights the different possibilities of three agents which are derivatives of phosphine and arsine in their ability to extract rare earths. A study of separation of rare earths is then addressed. The author reports the application of extraction equilibriums to the study of equilibriums in environments of molten salts with the Co II - chloride ions system. The author finally addresses the synergic phenomenon that pairs of neutral complexing agents of neighbouring structure or different donor central atom may display in liquid-liquid extraction

  9. Rapid detection of DNA-interstrand and DNA-protein cross-links in mammalian cells by gravity-flow alkaline elution

    International Nuclear Information System (INIS)

    Hincks, J.R.; Coulombe, R.A. Jr.

    1989-01-01

    Alkaline elution is a sensitive and commonly used technique to detect cellular DNA damage in the form of DNA strand breaks and DNA cross-links. Conventional alkaline elution procedures have extensive equipment requirements and are tedious to perform. Our laboratory recently presented a rapid, simplified, and sensitive modification of the alkaline elution technique to detect carcinogen-induced DNA strand breaks. In the present study, we have further modified this technique to enable the rapid characterization of chemically induced DNA-interstrand and DNA-protein associated cross-links in cultured epithelial cells. Cells were exposed to three known DNA cross-linking agents, nitrogen mustard (HN 2 ), mitomycin C (MMC), or ultraviolet irradiation (UV). One hour exposures of HN 2 at 0.25, 1.0, and 4.0 microM or of MMC at 20, 40, and 60 microM produced a dose-dependent induction of total DNA cross-links by these agents. Digestion with proteinase K revealed that HN 2 and MMC induced both DNA-protein cross-links and DNA-interstrand cross-links. Ultraviolet irradiation induced both DNA cross-links and DNA strand breaks, the latter of which were either protein and nonprotein associated. The results demonstrate that gravity-flow alkaline elution is a sensitive and accurate method to characterize the molecular events of DNA cross-linking. Using this procedure, elution of DNA from treated cells is completed in 1 hr, and only three fractions per sample are analyzed. This method may be useful as a rapid screening assay for genotoxicity and/or as an adjunct to other predictive assays for potential mutagenic or carcinogenic agents

  10. Extraction and separation of molybdenum and vanadium from acidic and alkaline media using tertiary and quaternary amines

    International Nuclear Information System (INIS)

    Stas, J.; Dahdouh, A.; Rizkallah, I.

    2010-01-01

    The extraction of vanadium and molybdenum from alkaline leaching solutions coming from the leaching of fly ash of fired electrical power stations by tri-n dodecylamine (TDA) and metyl trioctyl ammonium chloride (QA) in the presence of octanol-2 as modifier in kerosene has been investigated. Some parameters influencing the extraction process have been studied (agitation time, octanol-2 percentage in the organic phase, pH of the aqueous phase, concentration of TDA and QA, concentration of vanadium in the aqueous phase and temperature). It has been shown that the extraction capacity of both V and Mo by TDA increases by decreasing the pH of the aqueous phase and reaches a maximum extraction at pH=2. The concentration of TDA plays an important role on the separation selectivity between these two elements, where the selectivity of Mo vs V (S M o, v=[Mo] o rg/[V] o rg) increases with the decrease of TDA concentration to reach a maximum selectivity value of S M o, v = 0.37 for [TDA]=1.5 M. It has been also shown that, whatever vanadium concentration in the aqueous phase, molybdenum will be first extracted, then the remaining free TDA will be occupied by vanadium. Concerning the quaternary amine QA, the pH value of the aqueous phase plays an important role in the separation process between vanadium and molybdenum, where the value of the selectivity of V vs Mo (S v , Mo=[V] o rg/[Mo] o rg) is maximal for pH>8 and the pH=8.5 is the best value which permit a good separation between these two elements at QA concentration equal to 6%, especially at high vanadium concentration. It is very important to note that for low vanadium concentration and at pH=1.5 the value of the selectivity of Mo vs V (S M o,v) increases with increasing Mo concentration in the aqueous phase which enable us the separation between these two elements under these experimental conditions, where Mo will be much more extracted than vanadium. The stripping of vanadium and molybdenum from the loaded organic

  11. Rapid DNA extraction of bacterial genome using laundry detergents ...

    African Journals Online (AJOL)

    Yomi

    2012-01-03

    Jan 3, 2012 ... Genomic DNA extraction from bacterial cells involves processes normally performed in most biological laboratories. Therefore, various methods have been offered, manually and kit, but these methods may be time consuming and costly. In this paper, genomic DNA extraction of Pseudomonas aeruginosa ...

  12. Rapid DNA extraction of bacterial genome using laundry detergents ...

    African Journals Online (AJOL)

    Genomic DNA extraction from bacterial cells involves processes normally performed in most biological laboratories. Therefore, various methods have been offered, manually and kit, but these methods may be time consuming and costly. In this paper, genomic DNA extraction of Pseudomonas aeruginosa was investigated ...

  13. A comparative study of leaves extracts for corrosion inhibition effect on aluminium alloy in alkaline medium

    Directory of Open Access Journals (Sweden)

    Namrata Chaubey

    2017-12-01

    Full Text Available This paper deals with the comparative inhibition study of some plants leaves extract namely Cannabis sativa (CS, Rauwolfia serpentina (RS, Cymbopogon citratus (CC, Annona squamosa (AS and Adhatoda vasica (AV on the corrosion of aluminium alloy (AA in 1 M NaOH. The corrosion tests were performance by using gravimetric, electrochemical impedance spectroscopy (EIS, potentiodynamic polarization and linear polarization resistance (LPR techniques. RS showed maximum inhibition efficiency (η%, 97% at 0.2 g L−1. Potentiodynamic polarization curves justified that all the inhibitors are mixed-type. Surface morphology of AA is carried by scanning electron microscopy (SEM and atomic force microscopy (AFM.

  14. Extracting of yellowfin tuna (Thunnus albacares) fish skin gelatin as influenced by alkaline concentration and extraction times

    Science.gov (United States)

    Mafazah, E. M.; Pranoto, Y.; Rohman, A.

    2018-03-01

    Yellowfin tuna (Thunnus albacares) skin is a by-product of the fish processing industry. Yellowfin tuna skin was used as materials for gelatin because it contains collagen. This study was conducted to determine the characteristics of yellowfin tuna skin gelatin (YSG). In this study, YSG was obtained by the extraction process in 0.01 M NaOH solution for 12 h. The results show that the yield of YSG was 12.49 % dry basis, with the gel strength of 291.73 g Bloom, viscosity of 8.6 cPs and melting point of 35 °C. The gel strength and melting point of YSG were lower than commercial bovine gelatin (CBG), which was 309.7401 g Bloom and 36.33 °C, respectively. However, the viscosity of YSG was higher than the CBG which was 5.6 cPs.

  15. Microwave alkaline roasting-water dissolving process for germanium extraction from zinc oxide dust and its analysis by response surface methodology (RSM)

    Science.gov (United States)

    Wang, Wankun; Wang, Fuchun; Lu, Fanghai

    2017-12-01

    Microwave alkaline roasting-water dissolving process was proposed to improve the germanium (Ge) extraction from zinc oxide (ZnO) dust. The effects of important parameters were investigated and the process conditions were optimized using response surface methodology (RSM). The Ge extraction is consistent with the linear polynomial model type. Alkali-material ratio, microwave heating temperature and leaching temperature are the significant factors for this process. The optimized conditions are obtained as follows, alkali-material ratio of 0.9 kg/kg, aging time of 1.12 day, microwave heating at 658 K for 10 min, liquid-solid ratio of 4.31 L/kg, leaching temperature at 330 K, leaching time of 47 min with the Ge extraction about 99.38%. It is in consistence with the predictive value of 99.31%. Compared to the existed alkaline roasting process heated by electric furnace in literature, the alkaline roasting temperature and holding time. It shows a good prospect on leaching Ge from ZnO dust with microwave alkaline roasting-water dissolving process.

  16. Theoretical Study on the Extraction of Alkaline Earth Salts by 18-Crown-6: Roles of Counterions, Solvent Types and Extraction Temperatures

    Directory of Open Access Journals (Sweden)

    Saprizal Hadisaputra

    2014-07-01

    Full Text Available The roles of counterions, solvent types and extraction temperatures on the selectivity of 18-crown-6 (L toward alkaline earth salts MX2 (M = Ca, Sr, Ba; X = Cl-, NO3- have been studied by density functional method at B3LYP level of theory in gas and solvent phase. In gas phase, the chloride anion Cl- is the preference counterion than nitrate anion NO3-. This result is confirmed by the interaction energies, the second order interaction energies, charge transfers, energy difference between HOMO-LUMO and electrostatic potential maps. The presence of solvent reversed the gas phase trend. It is found that NO3- is the preference counterion in solvent phase. The calculated free energies demonstrate that the solvent types strongly change the strength of the complex formation. The free energies are exothermic in polar solvent while for the non polar solvent the free energies are endothermic. As the temperature changes the free energies also vary where the higher the temperatures the lower the free energy values. The calculated free energies are correlated well with the experimental stability constants. This theoretical study would have a strong contribution in planning the experimental conditions in terms of the preference counterions, solvent types and optimum extraction temperatures.

  17. rapid extraction of volatile compounds from citrus fruits using a ...

    African Journals Online (AJOL)

    M.A. Ferhat , M.N. Boukhatem, M. Hazzit 3, F.Chemat

    1 sept. 2016 ... que l'industrie chimique utilise des procédés utilisant les propriétés thermiques spécifiques ... moins de solvant, moins d'énergie et diminuant les rejets. ...... expression à froid à l'aide d'un appareil d'extraction semi industriel ...

  18. Improved enzymatic saccharification of steam exploded cotton stalk using alkaline extraction and fermentation of cellulosic sugars into ethanol.

    Science.gov (United States)

    Keshav, Praveen K; Naseeruddin, Shaik; Rao, L Venkateswar

    2016-08-01

    Cotton stalk, a widely available and cheap agricultural residue lacking economic alternatives, was subjected to steam explosion in the range 170-200°C for 5min. Steam explosion at 200°C and 5min led to significant hemicellulose solubilization (71.90±0.10%). Alkaline extraction of steam exploded cotton stalk (SECOH) using 3% NaOH at room temperature for 6h led to 85.07±1.43% lignin removal with complete hemicellulose solubilization. Besides, this combined pretreatment allowed a high recovery of the cellulosic fraction from the biomass. Enzymatic saccharification was studied between steam exploded cotton stalk (SECS) and SECOH using different cellulase loadings. SECOH gave a maximum of 785.30±8.28mg/g reducing sugars with saccharification efficiency of 82.13±0.72%. Subsequently, fermentation of SECOH hydrolysate containing sugars (68.20±1.16g/L) with Saccharomyces cerevisiae produced 23.17±0.84g/L ethanol with 0.44g/g yield. Copyright © 2016 Elsevier Ltd. All rights reserved.

  19. Influence of barley grain treated with alkaline compounds or organic extracts on site and extent of digestion of starch

    Directory of Open Access Journals (Sweden)

    Reza Naseroleslami

    2018-02-01

    Full Text Available Objective Two ex vivo experiments were conducted to verify the effect of barley grain (Nusrat cultivar treated with alkaline compounds (AC including alum, ammonium, and sodium hydroxide or cation-exchanged organic extracts (OE prepared from alfalfa hay, sugar beet pulp and Ulva Fasciata, on extent and digestion of starch. Methods In the first study, the in vitro first order disappearance kinetic parameters of dry matter (DM, crude protein (CP and starch were estimated using a non-linear model (D(t = D(i · e(−kd · time + I, where: D(t = potentially digestible residues at any time, D(i = potentially digestible fraction at any time, kd = fractional rate constant of digestion (/h, I = indigestible fraction at any time. In the second experiment, the ruminal and post-ruminal disappearance of DM, CP, and starch were determined using in situ mobile nylon bag. Results Barley grains treated with alum and alfalfa extract had a higher constant rate of starch digestion (0.11 and 0.09/h than others. Barley grain treated with OE had a higher constant rate of CP digestion and that of treated with AC had a higher constant rate of starch digestion (0.08 and 0.11/h compared with those of the other treatments. The indigestible fraction of starch treated with alum and sugar beet pulp extract was higher than that of the control group (0.24 and 0.25 vs 0.21. Barley grain treated with AC and OE had significant CP disappearance in the rumen, post-rumen and total tract, and also starch disappearance for post-rumen and total tract compared with the untreated (p<0.001. Conclusion This study demonstrated that AC and OE might have positive effects on the starch degradation of the barley grain. In addition, treating barley grain with alum and sugar beet pulp extract could change the site and extend digestion of protein and starch.

  20. A rapid mini-prep DNA extraction method in rice (Oryza sativa)

    African Journals Online (AJOL)

    STORAGESEVER

    2009-01-19

    Jan 19, 2009 ... homogenizer with a plastic tip is incomplete, since the leaves of these plants .... mortar and pestle with liquid nitrogen and transferred to a tube. ... rapid DNA extraction protocols for gymnosperms for application in population ...

  1. Rapid extraction and x-ray fluorescence determination of gold in rock

    International Nuclear Information System (INIS)

    Lobanov, F.I.; Logunova, S.A.; Popov, A.M.; Krasnopevtseva, E.V.

    1994-01-01

    The optimal conditions for gold extractional recovery by melts of aliphatic monocarboxylic acids mixtures (C ≥ 16) with additions of di-2-ethylhexyldithiophosphoric acid, di-n-oxtylsulfide and alkylaniline were determined. A rapid method of extraction and X-ray fluorescence detection of gold in the presence of considerable amounts of Fe, Cu, Pb, Cd, Zn and Bi was developed

  2. Rapid liquid–liquid extraction of thallium(III from succinate media with 2-octylaminopyridine in chloroform as the extractant

    Directory of Open Access Journals (Sweden)

    SANDIP V. MAHAMUNI

    2008-04-01

    Full Text Available A simple solvent extraction study of thallium(III was conducted. Selective and quantitative extraction of thallium(III by 2-octylaminopyridine (2-OAP in chloroform occurred from aqueous sodium succinate medium (0.0075 M at pH 3.0. Thallium(III was back extracted with acetate buffer (pH 4.63. The effect of the concentration of succinate and 2-OAP, the role of various diluents, stripping agents, loading capacity of 2-OAP, equilibrium time and aqueous:organic volume ratio on the extraction of thallium(III was studied. The stoichiometry of the extracted species was determined based on the slope analysis method and found to be 1: 2: 1 (metal:acid:extractant. The temperature dependence of the extraction equilibrium constant was also examined to estimate the apparent thermodynamic functions ∆H, ∆G and ∆S for the extraction reaction. The method is free from interference of a large number of cations and anions. The method was used for the selective extraction of thallium(III from its binary mixture with Zn(II, Cd(II, Hg(II, Bi(III, Pb(II, Se(IV, Te(IV, Sb(III, Ga(III, In(III, Al(III, Tl(I and Fe(III. The proposed method was applied to the synthetic mixtures and alloys. It is simple, selective, rapid and eco-friendly.

  3. Extraction and identification of cyclobutanones from irradiated cheese employing a rapid direct solvent extraction method.

    Science.gov (United States)

    Tewfik, Ihab

    2008-01-01

    2-Alkylcyclobutanones (cyclobutanones) are accepted as chemical markers for irradiated foods containing lipid. However, current extraction procedures (Soxhlet-florisil chromatography) for the isolation of these markers involve a long and tedious clean-up regime prior to gas chromatography-mass spectrophotometry identification. This paper outlines an alternative isolation and clean-up method for the extraction of cyclobutanones in irradiated Camembert cheese. The newly developed direct solvent extraction method enables the efficient screening of large numbers of food samples and is not as resource intensive as the BS EN 1785:1997 method. Direct solvent extraction appears to be a simple, robust method and has the added advantage of a considerably shorter extraction time for the analysis of foods containing lipid.

  4. Rapid Solid-Liquid Dynamic Extraction (RSLDE): a New Rapid and Greener Method for Extracting Two Steviol Glycosides (Stevioside and Rebaudioside A) from Stevia Leaves.

    Science.gov (United States)

    Gallo, Monica; Vitulano, Manuela; Andolfi, Anna; DellaGreca, Marina; Conte, Esterina; Ciaravolo, Martina; Naviglio, Daniele

    2017-06-01

    Stevioside and rebaudioside A are the main diterpene glycosides present in the leaves of the Stevia rebaudiana plant, which is used in the production of foods and low-calorie beverages. The difficulties associated with their extraction and purification are currently a problem for the food processing industries. The objective of this study was to develop an effective and economically viable method to obtain a high-quality product while trying to overcome the disadvantages derived from the conventional transformation processes. For this reason, extractions were carried out using a conventional maceration (CM) and a cyclically pressurized extraction known as rapid solid-liquid dynamic extraction (RSLDE) by the Naviglio extractor (NE). After only 20 min of extraction using the NE, a quantity of rebaudioside A and stevioside equal to 1197.8 and 413.6 mg/L was obtained, respectively, while for the CM, the optimum time was 90 min. From the results, it can be stated that the extraction process by NE and its subsequent purification developed in this study is a simple, economical, environmentally friendly method for producing steviol glycosides. Therefore, this method constitutes a valid alternative to conventional extraction by reducing the extraction time and the consumption of toxic solvents and favouring the use of the extracted metabolites as food additives and/or nutraceuticals. As an added value and of local interest, the experiment was carried out on stevia leaves from the Benevento area (Italy), where a high content of rebaudioside A was observed, which exhibits a sweet taste compared to stevioside, which has a significant bitter aftertaste.

  5. Development of rapid and simple method for DNA extraction from cannabis resin based on the evaluation of relative PCR amplification ability.

    Science.gov (United States)

    Yamamuro, Tadashi; Iwata, Yuko T; Segawa, Hiroki; Kuwayama, Kenji; Tsujikawa, Kenji; Kanamori, Tatsuyuki; Inoue, Hiroyuki

    2018-04-04

    In recent years, analysis of cannabis DNA has been increasingly used in forensic drug tests. However, in the case of cannabis resin, a processed marijuana product, complicated procedures are required for the extraction of clean DNA, as the presence of various impurities inhibits PCR amplification. Therefore, in this study, we attempted to identify the factors that would allow quick and simple DNA extraction from cannabis resin with a commercially available kit. We also constructed a simple assay system for comparing relative amplification efficiencies by end-point PCR and used it to evaluate the purity of the obtained DNA solutions. For extraction with a kit that contains a silica column, reducing the starting amount of resin, using the residue remaining after methanol extraction, dilution of the final solution, extraction with an equal amount of powdered activated carbon or an excess amount of polyvinylpolypyrrolidone, and the addition of an appropriate amount of polyvinylpyrrolidone to the solution after extraction were effective measures that improved amplification efficiency. Furthermore, the use of the most rapid alkaline extraction kit combined with the addition of powdered activated carbon allowed obtaining DNA solutions with sufficient amplification efficiency in about 10min. These findings should be useful for routine DNA analysis of cannabis resin during forensic examination. Copyright © 2018 Elsevier B.V. All rights reserved.

  6. Evaluation of antimicrobial activity of selected plant extracts by rapid XTT colorimetry and bacterial enumeration.

    Science.gov (United States)

    Al-Bakri, Amal G; Afifi, Fatma U

    2007-01-01

    The aim of this study was to screen and evaluate the antimicrobial activity of indigenous Jordanian plant extracts, dissolved in dimethylsulfoxide, using the rapid XTT assay and viable count methods. XTT rapid assay was used for the initial screening of antimicrobial activity for the plant extracts. Antimicrobial activity of potentially active plant extracts was further assessed using the "viable plate count" method. Four degrees of antimicrobial activity (high, moderate, weak and inactive) against Bacillus subtilis, Staphylococcus aureus, Escherichia coli and Pseudomonas aeruginosa, respectively, were recorded. The plant extracts of Hypericum triquetrifolium, Ballota undulata, Ruta chalepensis, Ononis natrix, Paronychia argentea and Marrubium vulgare had shown promising antimicrobial activity. This study showed that while both XTT and viable count methods are comparable when estimating the overall antimicrobial activity of experimental substances, there is no strong linear correlation between the two methods.

  7. Rapid methods for the extraction and archiving of molecular grade fungal genomic DNA.

    Science.gov (United States)

    Borman, Andrew M; Palmer, Michael; Johnson, Elizabeth M

    2013-01-01

    The rapid and inexpensive extraction of fungal genomic DNA that is of sufficient quality for molecular approaches is central to the molecular identification, epidemiological analysis, taxonomy, and strain typing of pathogenic fungi. Although many commercially available and in-house extraction procedures do eliminate the majority of contaminants that commonly inhibit molecular approaches, the inherent difficulties in breaking fungal cell walls lead to protocols that are labor intensive and that routinely take several hours to complete. Here we describe several methods that we have developed in our laboratory that allow the extremely rapid and inexpensive preparation of fungal genomic DNA.

  8. Stability of rapidly quenched and hydrogenated Mg-Ni-Y and Mg-Cu-Y alloys in extreme alkaline medium

    International Nuclear Information System (INIS)

    Gebert, A.; Khorkounov, B.; Wolff, U.; Mickel, Ch.; Uhlemann, M.; Schultz, L.

    2006-01-01

    Amorphous-nanocrystalline Mg 50 Ni 30 Y 20 and Mg 63 Ni 30 Y 7 and amorphous Mg 65 Cu 25 Y 10 alloys were produced by melt-spinning and characterized regarding their microstructure and thermal behaviour using XRD, TEM and DSC. Their electrochemical behaviour in the as-quenched state and after hydrogen charging at -25 mA/cm 2 for up to 20 h was studied in electrolytes with pH 5-7 and 13, but mainly in a battery electrolyte: 6 M KOH with pH 14.8 by means of anodic and cathodic polarization measurements. In the as-quenched state, the highest alloys stability was observed at pH 13. At pH 14.8, gradual oxidation and dissolution of copper or nickel governs the anodic behaviour before a passive state is attained. The dissolution of nickel is much more inhibited than that of copper due to its lower tendency to form soluble oxidized ions and to a stabilizing effect of higher fractions of yttrium in the alloy on the passivation. By galvanostatic charging, the Mg 65 Cu 25 Y 10 alloy shows the highest hydrogen absorption capacity followed by Mg 50 Ni 30 Y 20 and Mg 63 Ni 30 Y 7 . During the charging process, the alloys exhibit a change in the surface state chemistry, i.e. an enrichment of nickel- or copper-rich species, causing preferential oxidation and dissolution during subsequent exposure under free corrosion and anodic conditions. Mg-Ni-Y alloys demonstrate a higher stability during this treatment in extreme alkaline medium. The reasons for this and consequences regarding the use as electrode materials are discussed in detail

  9. A rapid solid-phase extraction fluorometric method for thiamine and riboflavin in salmonid eggs

    Science.gov (United States)

    Zajicek, James L.; Tillitt, Donald E.; Brown, Scott B.; Brown, Lisa R.; Honeyfield, Dale C.; Fitzsimons, John D.

    2005-01-01

    A new method has been developed and successfully applied to the selective measurement of thiamine (nonphosphorylated), total thiamine (sum of thiamine, thiamine monophosphate [TMP], thiamine diphosphate [TDP], and thiamine triphosphate [TTP]), and potentially interfering riboflavin in acidic (2% trichloroacetic acid) extracts of selected salmonid and walleye egg samples. Acidic extracts of eggs were applied directly to end-capped C18, reversed-phase solid-phase extraction (SPE) columns and separated into three fractions by elution with mixtures of PO4 buffer (pH 2), methanol (10%), and acetonitrile (20%). All thiamine compounds recovered in the first two fractions were oxidized to their corresponding thiochromes with alkaline potassium hexacyanoferrate, and we measured the thiochrome fluorescence (excitation at 360 nm, emission at 460 nm) in a 96-well microplate reader. Riboflavin, recovered in third fraction (eluted with pH 2, 20% acetonitrile), was analyzed directly by measuring the fluorescence of this fraction (excitation at 450 nm, emission at 530 nm). Significant portions of the phosphate esters of thiamine (TMP, TDP, and presumably TTP), when present at low concentrations (extract thiamine compounds into 2% trichlororacetic acid solution; an inexpensive, commercially available SPE column; small amounts of sample (0.5-1 g); microliter volumes of solvents per sample; a traditional, relatively nonhazardous, oxidation of thiamine compounds to fluorescent thiochromes; and an ultraviolet-visible-wavelength-filter fluorometer for the measurements. ?? Copyright by the American Fisheries Society 2005.

  10. Combined alkaline hydrolysis and ultrasound-assisted extraction for the release of nonextractable phenolics from cauliflower (Brassica oleracea var. botrytis) waste.

    Science.gov (United States)

    Gonzales, Gerard Bryan; Smagghe, Guy; Raes, Katleen; Van Camp, John

    2014-04-16

    Cauliflower waste contains high amounts phenolic compounds, but conventional solvent extraction misses high amounts of nonextractable phenolics (NEP), which may contribute more to the valorization of these waste streams. In this study, the NEP content and composition of cauliflower waste were investigated. The ability of alkaline hydrolysis, sonication, and their combination to release NEP was assessed. Alkaline hydrolysis with sonication was found to extract the highest NEP content (7.3 ± 0.17 mg gallic acid equivalents (GAE)/g dry waste), which was higher than the extractable fraction. The highest yield was obtained after treatment of 2 M NaOH at 60 °C for 30 min of sonication. Quantification and identification were done using U(H)PLC-DAD and U(H)PLC-ESI-MS(E). Kaempferol and quercetin glucosides along with several phenolic acids were found. The results of the study show that there are higher amounts of valuable health-promoting compounds from cauliflower waste than what is currently described in the literature.

  11. Rapid and reliable extraction of genomic DNA from various wild-type and transgenic plants

    Directory of Open Access Journals (Sweden)

    Yang Moon-Sik

    2004-09-01

    Full Text Available Abstract Background DNA extraction methods for PCR-quality DNA from calluses and plants are not time efficient, since they require that the tissues be ground in liquid nitrogen, followed by precipitation of the DNA pellet in ethanol, washing and drying the pellet, etc. The need for a rapid and simple procedure is urgent, especially when hundreds of samples need to be analyzed. Here, we describe a simple and efficient method of isolating high-quality genomic DNA for PCR amplification and enzyme digestion from calluses, various wild-type and transgenic plants. Results We developed new rapid and reliable genomic DNA extraction method. With our developed method, plant genomic DNA extraction could be performed within 30 min. The method was as follows. Plant tissue was homogenized with salt DNA extraction buffer using hand-operated homogenizer and extracted by phenol:chloroform:isoamyl alcohol (25:24:1. After centrifugation, the supernatant was directly used for DNA template for PCR, resulting in successful amplification for RAPD from various sources of plants and specific foreign genes from transgenic plants. After precipitating the supernatant, the DNA was completely digested by restriction enzymes. Conclusion This DNA extraction procedure promises simplicity, speed, and efficiency, both in terms of time and the amount of plant sample required. In addition, this method does not require expensive facilities for plant genomic DNA extraction.

  12. Modified DNA extraction for rapid PCR detection of methicillin-resistant staphylococci

    International Nuclear Information System (INIS)

    Japoni, A.; Alborzi, A.; Rasouli, M.; Pourabbas, B.

    2004-01-01

    Nosocomial infection caused by methicillin-resistant staphylococci poses a serious problem in many countries. The aim of this study was to rapidly and reliably detect methicillin-resistant-staphylococci in order to suggest appropriate therapy. The presence or absence of the methicillin-resistance gene in 115 clinical isolates of staphylococcus aureus and 50 isolates of coagulase negative staphylococci was examined by normal PCR. DNA extraction for PCR performance was then modified by omission of achromopeptadiase and proteinase K digestion, phenol/chloroform extraction and ethanol precipitation. All isolates with Mic>8 μ g/ml showed positive PCR. No differences in PCR detection have been observed when normal and modified DNA extractions have been performed. Our modified DNA extraction can quickly detect methicillin-resistant staphylococci by PCR. The advantage of rapid DNA extraction extends to both reduction of time and cost of PCR performance. This modified DNA extraction is suitable for different PCR detection, when staphylococci are the subject of DNA analysis

  13. Rapid, room-temperature synthesis of amorphous selenium/protein composites using Capsicum annuum L extract

    Science.gov (United States)

    Li, Shikuo; Shen, Yuhua; Xie, Anjian; Yu, Xuerong; Zhang, Xiuzhen; Yang, Liangbao; Li, Chuanhao

    2007-10-01

    We describe the formation of amorphous selenium (α-Se)/protein composites using Capsicum annuum L extract to reduce selenium ions (SeO32-) at room temperature. The reaction occurs rapidly and the process is simple and easy to handle. A protein with a molecular weight of 30 kDa extracted from Capsicum annuum L not only reduces the SeO32- ions to Se0, but also controls the nucleation and growth of Se0, and even participates in the formation of α-Se/protein composites. The size and shell thickness of the α-Se/protein composites increases with high Capsicum annuum L extract concentration, and decreases with low reaction solution pH. The results suggest that this eco-friendly, biogenic synthesis strategy could be widely used for preparing inorganic/organic biocomposites. In addition, we also discuss the possible mechanism of the reduction of SeO32- ions by Capsicum annuum L extract.

  14. Role of the Group 2 Mrp sodium/proton antiporter in rapid response to high alkaline shock in the alkaline- and salt-tolerant Dietzia sp. DQ12-45-1b.

    Science.gov (United States)

    Fang, Hui; Qin, Xiao-Yu; Zhang, Kai-Duan; Nie, Yong; Wu, Xiao-Lei

    2018-04-01

    The six- and seven-subunit Na + /H + antiporters (Mrp) are widely distributed in bacteria. They are reported to be integral for pH homeostasis in alkaliphilic bacteria when adapting to high pH environments. In this study, operons encoding for the six-subunit Na + /H + antiporters were found in the genomes of all studied Dietzia strains, which have different alkaline-resistant abilities. Disruption of the operon in the strain Dietzia sp. DQ12-45-1b which leads to declined growth in presence of hypersaline and alkaline conditions suggested that the six-subunit Na + /H + antiporter played an important role in hypersaline and alkaline resistance. Although the complexes DqMrp from DQ12-45-1b (strain with high alkaline resistance) and DaMrp from D. alimentaria 72 T (strain with low alkaline resistance) displayed Na + (Li + )/H + antiport activities, they functioned optimally at different pH levels (9.0 for DQ12-45-1b and 8.0 for 72 T ). While both antiporters functioned properly to protect Escherichia coli cells from salt shock, only the DqMrp-containing strain survived the high alkaline shock. Furthermore, real-time PCR results showed that the expression of mrpA and mrpD induced only immediately after DQ12-45-1b cells were subjected to the alkaline shock. These results suggested that the expression of DqMrp might be induced by a pH gradient across the cell membrane, and DqMrp mainly functioned at an early stage to respond to the alkaline shock.

  15. N-nitrosodimethylamine in drinking water using a rapid, solid-phase extraction method

    Energy Technology Data Exchange (ETDEWEB)

    Jenkins, S W.D. [Ministery of Environment and Energy, Etobicoke, ON (Canada). Lab. Services Branch; Koester, C J [Ministery of Environment and Energy, Etobicoke, ON (Canada). Lab. Services Branch; Taguchi, V Y [Ministery of Environment and Energy, Etobicoke, ON (Canada). Lab. Services Branch; Wang, D T [Ministery of Environment and Energy, Etobicoke, ON (Canada). Lab. Services Branch; Palmentier, J P.F.P. [Ministery of Environment and Energy, Etobicoke, ON (Canada). Lab. Services Branch; Hong, K P [Ministery of Environment and Energy, Etobicoke, ON (Canada). Lab. Services Branch

    1995-12-01

    A simple, rapid method for the extraction of N-nitrosodimethylamine (NDMA) from drinking and surface waters was developed using Ambersorb 572. Development of an alternative method to classical liquid-liquid extraction techniques was necessary to handle the workload presented by implementation of a provincial guideline of 9 ppt for drinking water and a regulatory level of 200 ppt for effluents. A granular absorbent, Ambersorb 572, was used to extract the NDMA from the water in the sample bottle. The NDMA was extracted from the Ambersorb 572 with dichloromethane in the autosampler vial. Method characteristics include a precision of 4% for replicate analyses, and accuracy of 6% at 10 ppt and a detection limit of 1.0 ppt NDMA in water. Comparative data between the Ambersorb 572 method and liquid-liquid extraction showed excellent agreement (average difference of 12%). With the Ambersorb 572 method, dichloromethane use has been reduced by a factor of 1,000 and productivity has been increased by a factor of 3-4. Monitoring of a drinking water supply showed rapidly changing concentrations of NDMA from day to day. (orig.)

  16. Combined Extraction of Cesium, Strontium, and Actinides from Alkaline Media: An Extension of the Caustic-Side Solvent Extraction (CSSX) Process Technology

    International Nuclear Information System (INIS)

    Kenneth Raymond

    2004-01-01

    The wastes present at DOE long-term storage sites are usually highly alkaline, and because of this, much of the actinides in these wastes are in the sludge phase. Enough actinide materials still remain in the supernatant liquid that they require separation followed by long-term storage in a geological repository. The removal of these metals from the liquid waste stream would permit their disposal as low-level waste and dramatically reduce the volume of high-level wastes

  17. Use of extraction chromatography, ion chromatography and liquid scintillation spectrometry for rapid determination of strontium-89 and strontium-90 in food in cases of increased release of radionuclides

    International Nuclear Information System (INIS)

    Heilgeist, M.

    2000-01-01

    For rapid determination of 89 Sr and 90 Sr in food, isocratic ion chromatography used for Sr isolation and purification is integrated in a complete analytical system comprising sample preparation, incineration, dissolution, phosphate precipitation for alkali/alkaline earth separation, and Sr specific extraction chromatography on crown ether basis for Ca/Sr separation. Strontium-89 and 90 Sr are determined by liquid scintillation spectrometry after carbonate precipitation. The components of the mixed spectra obtained are calculated by the computerized spectra subtraction method. Two days plus measuring time are required for single, three for double analysis. The limit of detection for 89 Sr and 90 Sr is ca. 0.1 Bq x kg -1 , related to the fresh produce. (author)

  18. Rapid, general synthesis of PdPt bimetallic alloy nanosponges and their enhanced catalytic performance for ethanol/methanol electrooxidation in an alkaline medium.

    Science.gov (United States)

    Zhu, Chengzhou; Guo, Shaojun; Dong, Shaojun

    2013-01-14

    We have demonstrated a rapid and general strategy to synthesize novel three-dimensional PdPt bimetallic alloy nanosponges in the absence of a capping agent. Significantly, the as-prepared PdPt bimetallic alloy nanosponges exhibited greatly enhanced activity and stability towards ethanol/methanol electrooxidation in an alkaline medium, which demonstrates the potential of applying these PdPt bimetallic alloy nanosponges as effective electrocatalysts for direct alcohol fuel cells. In addition, this simple method has also been applied for the synthesis of AuPt, AuPd bimetallic, and AuPtPd trimetallic alloy nanosponges. The as-synthesized three-dimensional bimetallic/trimetallic alloy nanosponges, because of their convenient preparation, well-defined sponge-like network, large-scale production, and high electrocatalytic performance for ethanol/methanol electrooxidation, may find promising potential applications in various fields, such as formic acid oxidation or oxygen reduction reactions, electrochemical sensors, and hydrogen-gas sensors. Copyright © 2013 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  19. [Inhibitory effects of butyl alcohol extract of Baitouweng decoction on yeast-to-hyphae transition of Candida albicans isolates from VVC in alkaline pH environment].

    Science.gov (United States)

    Zhang, Meng-xiang; Xia, Dan; Shi, Gao-xiang; Shao, Jing; Wang, Tian-ming; Tang, Chuan-chao; Wang, Chang-zhong

    2015-02-01

    To investigate the effects of butyl alcohol extract of Baitouweng decoction ( BAEB) on yeast-to-hyphae transition of Candida albicans isolates from vulvovaginal candidiasis (VVC) in alkaline pH. Serial 2-fold dilution assay was used to determine the minimal inhibitory concentrations (MICs) of Baitouweng decoction extracts against C. albicans isolates from VVC, XTT assay was applied to determine the metabolic activity of C. albicans hypha treated by BAEB for 6 h. The morphological change of C. albicans treated by BAEB was inspected at different pH by inverted microscope, fluorescence microscope, scanning electron microscopy (SEM). Solid agar plate and semi-solid agar were utilized to evaluate colony morphology and invasive growth of C. albicans, respectively. Quantitative Real-time PCR (qRT-PCR) was adopted to observe the expressions of hyphae-specific genes including HWP1, ALS3, CSH1, SUN41 and CaPDE2. The MIC of BAEB against C. albicans is less than that of other extracts; hyphae grow best at pH 8. 0; 512 mg · L(-1) and 1,024 mg · L(-1) BAEB could inhibit formation of hyphae and influence colony morphology. When treated by 512 mg · L(-1) and 1,024 mg · L(-1) BAEB, the colonies became smooth; while by 0 and 256 mg · L(-1) BAEB, the colonies became wrinkled. In semi-solid agar, the length of hyphae decreased steadily as the concentration of BAEB lowered. The expression of HWP1, ALS3, CSHl, SUN41 were downregulated by 5.12, 4.26, 3.2 and 2.74 folds, and CaPDE2 was upregulated by 2.38 fold. BAEB could inhibit yeast-to-hyphae transition of C. albicans isolates from VVC in alkaline pH.

  20. A histogram-based technique for rapid vector extraction from PIV photographs

    Science.gov (United States)

    Humphreys, William M., Jr.

    1991-01-01

    A new analysis technique, performed totally in the image plane, is proposed which rapidly extracts all available vectors from individual interrogation regions on PIV photographs. The technique avoids the need for using Fourier transforms with the associated computational burden. The data acquisition and analysis procedure is described, and results of a preliminary simulation study to evaluate the accuracy of the technique are presented. Recently obtained PIV photographs are analyzed.

  1. Alkaline Treatment of Oil Palm Frond Fibers by Using Extract of Oil Palm EFB Ash for Better Adhesion toward Polymeric Matrix

    Directory of Open Access Journals (Sweden)

    Warman Fatra

    2015-10-01

    Full Text Available In Indonesia, 187 million tons of biomass were produced from 8.11 million ha of oil palm plantation in 2009. This massive amount of biomass mainly consists of oil palm fronds (OPF and oil palm empty fruit bunches (EFB, which are normally categorized as waste. The properties of OPF fibers compared to those of synthetic fibers, such as low density, low cost, less abrasion of equipment, and safer production, makes them an attractive reinforcement for composite materials. In this work, the utilization of oil palm empty fruit bunch ash for OPF fiber-polyester resin composite and the effect of process conditions were studied. Water absorption, tensile and flexural strength were used to characterize the effects of alkaline treatment on modified OPF fibers in polyester resin. The investigation focused on the effect of alkaline treatment time. Treatment temperature and liquid to solid ratio were analyzed using Response Surface Method-Central Composite Design (RSM-CCD. The highest tensile strength (44.87 MPa was achieved at 12 hours soaking time, at 40°C treatment temperature and 5:1 water to ash ratio. The highest flexural strength (120.50 MPa was obtained at 1.3 hours soaking time, 4 dissolving ratio and 35°C treatment temperature. The lowest water absorption of composite (3.00% was achieved at the longest soaking time (14.7 hours, 4 dissolving ratio and 35°C treatment temperature. Variance of soaking time, dissolving ratio and temperature in the alkaline treatment process using extract of oil palm empty fruit bunch ash significantly affected the mechanical and physical properties of the oil palm frond fibers reinforced composite.

  2. A Rapid and Cost-Effective Method for DNA Extraction from Archival Herbarium Specimens.

    Science.gov (United States)

    Krinitsina, A A; Sizova, T V; Zaika, M A; Speranskaya, A S; Sukhorukov, A P

    2015-11-01

    Here we report a rapid and cost-effective method for the extraction of total DNA from herbarium specimens up to 50-90-year-old. The method takes about 2 h, uses AMPure XP magnetic beads diluted by PEG-8000- containing buffer, and does not require use of traditional volatile components like chloroform, phenol, and liquid nitrogen. It yields up to 4 µg of total nucleic acid with high purity from about 30 mg of dry material. The quality of the extracted DNA was tested by PCR amplification of 5S rRNA and rbcL genes (nuclear and chloroplast DNA markers) and compared against the traditional chloroform/isoamyl alcohol method. Our results demonstrate that the use of the magnetic beads is crucial for extraction of DNA suitable for subsequent PCR from herbarium samples due to the decreasing inhibitor concentrations, reducing short fragments of degraded DNA, and increasing median DNA fragment sizes.

  3. A rapid method to estimate uranium using ionic liquid as extracting agent from basic aqueous media

    International Nuclear Information System (INIS)

    Prabhath Ravi, K.; Sathyapriya, R.S.; Rao, D.D.; Ghosh, S.K.

    2016-01-01

    Room temperature ionic liquids, as their name suggests are salts with a low melting point typically less than 100 °C and exist as liquid at room temperature. The common cationic parts of ionic liquids are imidazolium, pyridinium, pyrrolidinium, quaternary ammonium, or phosphonium ions, and common anionic parts are chloride, bromide, boron tetrafluorate, phosphorous hexafluorate, triflimide etc. The physical properties of ionic liquids can be tuned by choosing appropriate cations with differing alkyl chain lengths and anions. Application of ionic liquids in organic synthesis, liquid-liquid extractions, electrochemistry, catalysis, speciation studies, nuclear reprocessing is being studied extensively in recent times. In this paper a rapid method to estimate the uranium content in aqueous media by extraction with room temperature ionic liquid tricaprylammoniumthiosalicylate ((A- 336)(TS)) followed by liquid scintillation analysis is described. Re-extraction of uranium from ionic liquid phase to aqueous phase was also studied

  4. Rapid determination of ions by combined solid-phase extraction--diffuse reflectance spectroscopy

    Science.gov (United States)

    Fritz, James S.; Arena, Matteo P.; Steiner, Steven A.; Porter, Marc D.

    2003-01-01

    We introduce colorimetric solid-phase extraction (C-SPE) for the rapid determination of selected ions. This new technique links the exhaustive concentration of an analyte by SPE onto a membrane disk surface for quantitative measurement with a hand-held diffuse reflectance spectrometer. The concentration/measurement procedure is complete in approximately 1 min and can be performed almost anywhere. This method has been used to monitor iodine and iodide in spacecraft water in the 0.1-5.0 ppm range and silver(I) in the range of 5.0-1000 microg/l. Applications to the trace analysis of copper(II), nickel(II), iron(III) and chromium(VI) are described. Studies on the mechanism of extraction showed that impregnation of the disk with a surfactant as well as a complexing reagent results in uptake of additional water, which markedly improves the extraction efficiency.

  5. Rapid detection of Ganoderma-infected oil palms by microwave ergosterol extraction with HPLC and TLC.

    Science.gov (United States)

    Muniroh, M S; Sariah, M; Zainal Abidin, M A; Lima, N; Paterson, R R M

    2014-05-01

    Detection of basal stem rot (BSR) by Ganoderma of oil palms was based on foliar symptoms and production of basidiomata. Enzyme-Linked Immunosorbent Assays-Polyclonal Antibody (ELISA-PAB) and PCR have been proposed as early detection methods for the disease. These techniques are complex, time consuming and have accuracy limitations. An ergosterol method was developed which correlated well with the degree of infection in oil palms, including samples growing in plantations. However, the method was capable of being optimised. This current study was designed to develop a simpler, more rapid and efficient ergosterol method with utility in the field that involved the use of microwave extraction. The optimised procedure involved extracting a small amount of Ganoderma, or Ganoderma-infected oil palm suspended in low volumes of solvent followed by irradiation in a conventional microwave oven at 70°C and medium high power for 30s, resulting in simultaneous extraction and saponification. Ergosterol was detected by thin layer chromatography (TLC) and quantified using high performance liquid chromatography with diode array detection. The TLC method was novel and provided a simple, inexpensive method with utility in the field. The new method was particularly effective at extracting high yields of ergosterol from infected oil palm and enables rapid analysis of field samples on site, allowing infected oil palms to be treated or culled very rapidly. Some limitations of the method are discussed herein. The procedures lend themselves to controlling the disease more effectively and allowing more effective use of land currently employed to grow oil palms, thereby reducing pressure to develop new plantations. Copyright © 2014 Elsevier B.V. All rights reserved.

  6. A rapid and efficient DNA extraction protocol from fresh and frozen human blood samples.

    Science.gov (United States)

    Guha, Pokhraj; Das, Avishek; Dutta, Somit; Chaudhuri, Tapas Kumar

    2018-01-01

    Different methods available for extraction of human genomic DNA suffer from one or more drawbacks including low yield, compromised quality, cost, time consumption, use of toxic organic solvents, and many more. Herein, we aimed to develop a method to extract DNA from 500 μL of fresh or frozen human blood. Five hundred microliters of fresh and frozen human blood samples were used for standardization of the extraction procedure. Absorbance at 260 and 280 nm, respectively, (A 260 /A 280 ) were estimated to check the quality and quantity of the extracted DNA sample. Qualitative assessment of the extracted DNA was checked by Polymerase Chain reaction and double digestion of the DNA sample. Our protocol resulted in average yield of 22±2.97 μg and 20.5±3.97 μg from 500 μL of fresh and frozen blood, respectively, which were comparable to many reference protocols and kits. Besides yielding bulk amount of DNA, our protocol is rapid, economical, and avoids toxic organic solvents such as Phenol. Due to unaffected quality, the DNA is suitable for downstream applications. The protocol may also be useful for pursuing basic molecular researches in laboratories having limited funds. © 2017 Wiley Periodicals, Inc.

  7. Solvent extraction of technetium from alkaline waste media using bis-4,4'(5')[(tert-butyl)cyclohexano]-18-crown-6

    International Nuclear Information System (INIS)

    Bonnesen, P.V.; Presley, D.J.; Moyer, B.A.

    1995-01-01

    The crown ether bis-4,4'(5')[(tert-butyl)cyclohexano]-18-crown-6 can be utilized in a solvent-extraction process for the removal of technetium as pertechnetate ion, TcO 4 - from solutions simulating highly radioactive alkaline defense wastes (''tank wastes'') stored at several sites in the United States. The process employs non-halogenated and non-volatile diluents and modifiers and includes an efficient stripping procedure using only water. More than 95% of the pertechnetate present at 6 x 10 -5 M in Melton Valley (Oak Ridge, TN) and Hanford (Washington) tank-waste simulants was removed following two cross-current extraction contacts using 0.02 M bis-4,4'(5')[(tertbutyl)cyclohexano]- 18-crown-6 in 2:1 vol/vol TBP/Isopar reg-sign M diluent at 25 C. Similarly, for both simulants, more than 98% of the pertechnetate contained in the solvent was back-extracted following two cross-current stripping contacts using deionized water

  8. Land subsidence caused by a single water extraction well and rapid water infiltration

    Directory of Open Access Journals (Sweden)

    I. Martinez-Noguez

    2015-11-01

    Full Text Available Nowadays several parts of the world suffer from land subsidence. This setting of the earth surface occurs due to different factors such as earth quakes, mining activities, and gas, oil and water withdrawal. This research presents a numerical study of the influence of land subsidence caused by a single water extraction well and rapid water infiltration into structural soil discontinuities. The numerical simulation of the infiltration was based on a two-phase flow-model for porous media, and for the deformation a Mohr–Coulomb model was used. A two-layered system with a fault zone is presented. First a single water extraction well is simulated producing a cone-shaped (conical water level depletion, which can cause land subsidence. Land Subsidence can be further increased if a hydrological barrier as a result of a discontinuity, exists. After water extraction a water column is applied on the top boundary for one hours in order to represent a strong storm which produces rapid water infiltration through the discontinuity as well as soil deformation. Both events are analysed and compared in order to characterize deformation of both elements and to get a better understanding of the land subsidence and new fracture formations.

  9. Rapid green synthesis of silver nanoparticles and nanorods using Piper nigrum extract

    International Nuclear Information System (INIS)

    Mohapatra, Bandita; Kuriakose, Sini; Mohapatra, Satyabrata

    2015-01-01

    Highlights: • Silver nanorods were synthesized by photoreduction using Piper nigrum extract. • The morphological and structural properties were studied by XRD and AFM. • Silver nanoparticles were formed at lower AgNO 3 concentration. • Increase in AgNO 3 concentration resulted in formation of silver nanorods. - Abstract: We report sun light driven rapid green synthesis of stable aqueous dispersions of silver nanoparticles and nanorods at room temperature using photoreduction of silver ions with Piper nigrum extract. Silver nanoparticles were formed within 3 min of sun light irradiation following addition of Piper nigrum extract to the AgNO 3 solution. The effects of AgNO 3 concentration and irradiation time on the formation and plasmonic properties of biosynthesized silver nanoparticles were studied using UV–visible absorption spectroscopy. The morphology and structure of silver nanoparticles were well characterized by atomic force microscopy (AFM) and X-ray diffraction (XRD). The size of Ag nanoparticles increased with increase in irradiation time, leading to the formation of anisotropic nanostructures. Increasing the AgNO 3 concentration resulted in the formation of Ag nanorods. UV–visible absorption studies revealed the presence of surface plasmon resonance (SPR) peaks which red shift and broaden with increasing AgNO 3 concentration. We have demonstrated a facile, energy efficient and rapid green synthetic route to synthesize stable aqueous dispersions of silver nanoparticles and nanorods

  10. Rapid green synthesis of silver nanoparticles and nanorods using Piper nigrum extract

    Energy Technology Data Exchange (ETDEWEB)

    Mohapatra, Bandita [Multifunctional Nanomaterials Laboratory, School of Basic and Applied Sciences, Guru Gobind Singh Indraprastha University, Dwarka, New Delhi 110078 (India); Kuriakose, Sini [Multifunctional Nanomaterials Laboratory, School of Basic and Applied Sciences, Guru Gobind Singh Indraprastha University, Dwarka, New Delhi 110078 (India); School of Basic and Applied Sciences, Guru Gobind Singh Indraprastha University, Dwarka, New Delhi 110078 (India); Mohapatra, Satyabrata, E-mail: smiuac@gmail.com [Multifunctional Nanomaterials Laboratory, School of Basic and Applied Sciences, Guru Gobind Singh Indraprastha University, Dwarka, New Delhi 110078 (India); School of Basic and Applied Sciences, Guru Gobind Singh Indraprastha University, Dwarka, New Delhi 110078 (India)

    2015-07-15

    Highlights: • Silver nanorods were synthesized by photoreduction using Piper nigrum extract. • The morphological and structural properties were studied by XRD and AFM. • Silver nanoparticles were formed at lower AgNO{sub 3} concentration. • Increase in AgNO{sub 3} concentration resulted in formation of silver nanorods. - Abstract: We report sun light driven rapid green synthesis of stable aqueous dispersions of silver nanoparticles and nanorods at room temperature using photoreduction of silver ions with Piper nigrum extract. Silver nanoparticles were formed within 3 min of sun light irradiation following addition of Piper nigrum extract to the AgNO{sub 3} solution. The effects of AgNO{sub 3} concentration and irradiation time on the formation and plasmonic properties of biosynthesized silver nanoparticles were studied using UV–visible absorption spectroscopy. The morphology and structure of silver nanoparticles were well characterized by atomic force microscopy (AFM) and X-ray diffraction (XRD). The size of Ag nanoparticles increased with increase in irradiation time, leading to the formation of anisotropic nanostructures. Increasing the AgNO{sub 3} concentration resulted in the formation of Ag nanorods. UV–visible absorption studies revealed the presence of surface plasmon resonance (SPR) peaks which red shift and broaden with increasing AgNO{sub 3} concentration. We have demonstrated a facile, energy efficient and rapid green synthetic route to synthesize stable aqueous dispersions of silver nanoparticles and nanorods.

  11. Rapid extraction of lexical tone phonology in Chinese characters: a visual mismatch negativity study.

    Directory of Open Access Journals (Sweden)

    Xiao-Dong Wang

    Full Text Available BACKGROUND: In alphabetic languages, emerging evidence from behavioral and neuroimaging studies shows the rapid and automatic activation of phonological information in visual word recognition. In the mapping from orthography to phonology, unlike most alphabetic languages in which there is a natural correspondence between the visual and phonological forms, in logographic Chinese, the mapping between visual and phonological forms is rather arbitrary and depends on learning and experience. The issue of whether the phonological information is rapidly and automatically extracted in Chinese characters by the brain has not yet been thoroughly addressed. METHODOLOGY/PRINCIPAL FINDINGS: We continuously presented Chinese characters differing in orthography and meaning to adult native Mandarin Chinese speakers to construct a constant varying visual stream. In the stream, most stimuli were homophones of Chinese characters: The phonological features embedded in these visual characters were the same, including consonants, vowels and the lexical tone. Occasionally, the rule of phonology was randomly violated by characters whose phonological features differed in the lexical tone. CONCLUSIONS/SIGNIFICANCE: We showed that the violation of the lexical tone phonology evoked an early, robust visual response, as revealed by whole-head electrical recordings of the visual mismatch negativity (vMMN, indicating the rapid extraction of phonological information embedded in Chinese characters. Source analysis revealed that the vMMN was involved in neural activations of the visual cortex, suggesting that the visual sensory memory is sensitive to phonological information embedded in visual words at an early processing stage.

  12. Rapid extraction of lexical tone phonology in Chinese characters: a visual mismatch negativity study.

    Science.gov (United States)

    Wang, Xiao-Dong; Liu, A-Ping; Wu, Yin-Yuan; Wang, Peng

    2013-01-01

    In alphabetic languages, emerging evidence from behavioral and neuroimaging studies shows the rapid and automatic activation of phonological information in visual word recognition. In the mapping from orthography to phonology, unlike most alphabetic languages in which there is a natural correspondence between the visual and phonological forms, in logographic Chinese, the mapping between visual and phonological forms is rather arbitrary and depends on learning and experience. The issue of whether the phonological information is rapidly and automatically extracted in Chinese characters by the brain has not yet been thoroughly addressed. We continuously presented Chinese characters differing in orthography and meaning to adult native Mandarin Chinese speakers to construct a constant varying visual stream. In the stream, most stimuli were homophones of Chinese characters: The phonological features embedded in these visual characters were the same, including consonants, vowels and the lexical tone. Occasionally, the rule of phonology was randomly violated by characters whose phonological features differed in the lexical tone. We showed that the violation of the lexical tone phonology evoked an early, robust visual response, as revealed by whole-head electrical recordings of the visual mismatch negativity (vMMN), indicating the rapid extraction of phonological information embedded in Chinese characters. Source analysis revealed that the vMMN was involved in neural activations of the visual cortex, suggesting that the visual sensory memory is sensitive to phonological information embedded in visual words at an early processing stage.

  13. A Swellable Microneedle Patch to Rapidly Extract Skin Interstitial Fluid for Timely Metabolic Analysis.

    Science.gov (United States)

    Chang, Hao; Zheng, Mengjia; Yu, Xiaojun; Than, Aung; Seeni, Razina Z; Kang, Rongjie; Tian, Jingqi; Khanh, Duong Phan; Liu, Linbo; Chen, Peng; Xu, Chenjie

    2017-10-01

    Skin interstitial fluid (ISF) is an emerging source of biomarkers for disease diagnosis and prognosis. Microneedle (MN) patch has been identified as an ideal platform to extract ISF from the skin due to its pain-free and easy-to-administrated properties. However, long sampling time is still a serious problem which impedes timely metabolic analysis. In this study, a swellable MN patch that can rapidly extract ISF is developed. The MN patch is made of methacrylated hyaluronic acid (MeHA) and further crosslinked through UV irradiation. Owing to the supreme water affinity of MeHA, this MN patch can extract sufficient ISF in a short time without the assistance of extra devices, which remarkably facilitates timely metabolic analysis. Due to covalent crosslinked network, the MN patch maintains the structure integrity in the swelling hydrated state without leaving residues in skin after usage. More importantly, the extracted ISF metabolites can be efficiently recovered from MN patch by centrifugation for the subsequent offline analysis of metabolites such as glucose and cholesterol. Given the recent trend of easy-to-use point-of-care devices for personal healthcare monitoring, this study opens a new avenue for the development of MN-based microdevices for sampling ISF and minimally invasive metabolic detection. © 2017 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  14. Rapid, room-temperature synthesis of amorphous selenium/protein composites using Capsicum annuum L extract

    Energy Technology Data Exchange (ETDEWEB)

    Li Shikuo; Shen Yuhua; Xie Anjian; Yu Xuerong; Zhang Xiuzhen; Yang Liangbao; Li Chuanhao [School of Chemistry and Chemical Engineering, Anhui University, Hefei 230039 (China)

    2007-10-10

    We describe the formation of amorphous selenium ({alpha}-Se)/protein composites using Capsicum annuum L extract to reduce selenium ions (SeO{sub 3}{sup 2-}) at room temperature. The reaction occurs rapidly and the process is simple and easy to handle. A protein with a molecular weight of 30 kDa extracted from Capsicum annuum L not only reduces the SeO{sub 3}{sup 2-} ions to Se{sup 0}, but also controls the nucleation and growth of Se{sup 0}, and even participates in the formation of {alpha}-Se/protein composites. The size and shell thickness of the {alpha}-Se/protein composites increases with high Capsicum annuum L extract concentration, and decreases with low reaction solution pH. The results suggest that this eco-friendly, biogenic synthesis strategy could be widely used for preparing inorganic/organic biocomposites. In addition, we also discuss the possible mechanism of the reduction of SeO{sub 3}{sup 2-} ions by Capsicum annuum L extract.

  15. Rapid, room-temperature synthesis of amorphous selenium/protein composites using Capsicum annuum L extract

    International Nuclear Information System (INIS)

    Li Shikuo; Shen Yuhua; Xie Anjian; Yu Xuerong; Zhang Xiuzhen; Yang Liangbao; Li Chuanhao

    2007-01-01

    We describe the formation of amorphous selenium (α-Se)/protein composites using Capsicum annuum L extract to reduce selenium ions (SeO 3 2- ) at room temperature. The reaction occurs rapidly and the process is simple and easy to handle. A protein with a molecular weight of 30 kDa extracted from Capsicum annuum L not only reduces the SeO 3 2- ions to Se 0 , but also controls the nucleation and growth of Se 0 , and even participates in the formation of α-Se/protein composites. The size and shell thickness of the α-Se/protein composites increases with high Capsicum annuum L extract concentration, and decreases with low reaction solution pH. The results suggest that this eco-friendly, biogenic synthesis strategy could be widely used for preparing inorganic/organic biocomposites. In addition, we also discuss the possible mechanism of the reduction of SeO 3 2- ions by Capsicum annuum L extract

  16. Solvent extraction method for rapid separation of strontium-90 in milk and food samples

    International Nuclear Information System (INIS)

    Hingorani, S.B.; Sathe, A.P.

    1991-01-01

    A solvent extraction method, using tributyl phosphate, for rapid separation of strontium-90 in milk and other food samples has been presented in this report in view of large number of samples recieved after Chernobyl accident for checking radioactive contamination. The earlier nitration method in use for the determination of 90 Sr through its daughter 90 Y takes over two weeks for analysis of a sample. While by this extraction method it takes only 4 to 5 hours for sample analysis. Complete estimation including initial counting can be done in a single day. The chemical recovery varies between 80-90% compared to nitration method which is 65-80%. The purity of the method has been established by following the decay of yttrium-90 separated. Some of the results obtained by adopting this chemical method for food analysis are included. The method is, thus, found to be rapid and convenient for accurate estimation of strontium-90 in milk and food samples. (author). 2 tabs., 1 fig

  17. Preclinical evidence of rapid-onset antidepressant-like effect in Radix Polygalae extract.

    Directory of Open Access Journals (Sweden)

    Im-Joon Shin

    Full Text Available Radix Polygalae (the root of Polygala tenuifolia is a herb widely used in traditional Asian medicine that is thought to exert a variety of neuropsychiatric effects. Radix Polygalae extract can protect against N-methyl D-aspartate (NMDA neurotoxicity and induce brain-derived neurotrophic factor (BDNF expression, suggesting modulatory roles at glutamatergic synapses and possible antidepressant action. In accordance with this hypothesis, Radix Polygalae extract demonstrated antidepressant-like effects in 8-week-old male C57Bl/6 mice by decreasing behavioral despair in the forced swim and tail suspension tasks and increasing hedonic-like behavior in the female urine sniffing test 30 minutes after a single oral administration of 0.1 mg/kg. Reduced latency to acquire a food pellet in the novely suppressed feeding paradigm, without change in anxiety-like behaviors suggested a rapid-onset nature of the antidepressant-like effect. In addition, it decreased the number of failed escapes in the learned helplessness paradigm after two oral administrations 24 hours and 30 minutes before the first test. Finally, it reversed anhedonia as measured by saccharin preference in mice exposed to the chronic stress model after two administrations of 0.1 mg/kg, in contrast to the repeated administration generally needed for similar effect by monoamergic antidepressants. Immobility reduction in tail suspension task was blocked by the α-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid (AMPA receptor antagonist NBQX, a pattern previously demonstrated by ketamine and other ketamine-like rapid-onset antidepressants. Also similarly to ketamine, Radix Polygalae appeared to acutely decrease phosphorylation of GluR1 serine-845 in the hippocampus while leaving the phosphorylation of hippocampal mTOR serine 2448 unchanged. These findings serve as preclinical evidence that Radix Polygalae extract exerts rapid-onset antidepressant effects by modulating glutamatergic synapses in

  18. Development of a Rapid and Simple Method to Remove Polyphenols from Plant Extracts

    Directory of Open Access Journals (Sweden)

    Imali Ranatunge

    2017-01-01

    Full Text Available Polyphenols are secondary metabolites of plants, which are responsible for prevention of many diseases. Polyvinylpolypyrrolidone (PVPP has a high affinity towards polyphenols. This method involves the use of PVPP column to remove polyphenols under centrifugal force. Standards of gallic acid, epigallocatechin gallate, vanillin, and tea extracts (Camellia sinensis were used in this study. PVPP powder was packed in a syringe with different quantities. The test samples were layered over the PVPP column and subjected to centrifugation. Supernatant was tested for the total phenol content. The presence of phenolic compounds and caffeine was screened by HPLC and measuring the absorbance at 280. The antioxidant capacity of standards and tea extracts was compared with the polyphenol removed fractions using DPPH scavenging assay. No polyphenols were found in polyphenolic standards or tea extracts after PVPP treatment. The method described in the present study to remove polyphenols is simple, inexpensive, rapid, and efficient and can be employed to investigate the contribution of polyphenols present in natural products to their biological activity.

  19. Rapid column extraction method for actinides and strontium in fish and other animal tissue samples

    International Nuclear Information System (INIS)

    Maxwell III, S.L.; Faison, D.M.

    2008-01-01

    The analysis of actinides and radiostrontium in animal tissue samples is very important for environmental monitoring. There is a need to measure actinide isotopes and strontium with very low detection limits in animal tissue samples, including fish, deer, hogs, beef and shellfish. A new, rapid separation method has been developed that allows the measurement of plutonium, neptunium, uranium, americium, curium and strontium isotopes in large animal tissue samples (100-200 g) with high chemical recoveries and effective removal of matrix interferences. This method uses stacked TEVA Resin R , TRU Resin R and DGA Resin R cartridges from Eichrom Technologies (Darien, IL, USA) that allows the rapid separation of plutonium (Pu), neptunium (Np), uranium (U), americium (Am), and curium (Cm) using a single multi-stage column combined with alphaspectrometry. Strontium is collected on Sr Resin R from Eichrom Technologies (Darien, IL, USA). After acid digestion and furnace heating of the animal tissue samples, the actinides and 89/90 Sr are separated using column extraction chromatography. This method has been shown to be effective over a wide range of animal tissue matrices. Vacuum box cartridge technology with rapid flow rates is used to minimize sample preparation time. (author)

  20. A three-phase microfluidic chip for rapid sample clean-up of alkaloids from plant extracts

    NARCIS (Netherlands)

    Tetala, K.K.R.; Swarts, J.W.; Chen, B.; Janssen, A.E.M.; Beek, van T.A.

    2009-01-01

    A three-phase microchip was developed for the rapid and efficient small-scale purification of alkaloids from plant extracts. As part of the development of such a three-phase microchip, first a two-phase microchip with two channels (3.2 cm and 9.3 cm) was used to study the extraction efficiency of

  1. Development of Novel Method for Rapid Extract of Radionuclides from Solution Using Polymer Ligand Film

    Science.gov (United States)

    Rim, Jung H.

    Accurate and fast determination of the activity of radionuclides in a sample is critical for nuclear forensics and emergency response. Radioanalytical techniques are well established for radionuclides measurement, however, they are slow and labor intensive, requiring extensive radiochemical separations and purification prior to analysis. With these limitations of current methods, there is great interest for a new technique to rapidly process samples. This dissertation describes a new analyte extraction medium called Polymer Ligand Film (PLF) developed to rapidly extract radionuclides. Polymer Ligand Film is a polymer medium with ligands incorporated in its matrix that selectively and rapidly extract analytes from a solution. The main focus of the new technique is to shorten and simplify the procedure necessary to chemically isolate radionuclides for determination by alpha spectrometry or beta counting. Five different ligands were tested for plutonium extraction: bis(2-ethylhexyl) methanediphosphonic acid (H2DEH[MDP]), di(2-ethyl hexyl) phosphoric acid (HDEHP), trialkyl methylammonium chloride (Aliquat-336), 4,4'(5')-di-t-butylcyclohexano 18-crown-6 (DtBuCH18C6), and 2-ethylhexyl 2-ethylhexylphosphonic acid (HEH[EHP]). The ligands that were effective for plutonium extraction further studied for uranium extraction. The plutonium recovery by PLFs has shown dependency on nitric acid concentration and ligand to total mass ratio. H2DEH[MDP] PLFs performed best with 1:10 and 1:20 ratio PLFs. 50.44% and 47.61% of plutonium were extracted on the surface of PLFs with 1M nitric acid for 1:10 and 1:20 PLF, respectively. HDEHP PLF provided the best combination of alpha spectroscopy resolution and plutonium recovery with 1:5 PLF when used with 0.1M nitric acid. The overall analyte recovery was lower than electrodeposited samples, which typically has recovery above 80%. However, PLF is designed to be a rapid field deployable screening technique and consistency is more important

  2. Rapid extraction of genomic DNA from medically important yeasts and filamentous fungi by high-speed cell disruption.

    Science.gov (United States)

    Müller, F M; Werner, K E; Kasai, M; Francesconi, A; Chanock, S J; Walsh, T J

    1998-06-01

    Current methods of DNA extraction from different fungal pathogens are often time-consuming and require the use of toxic chemicals. DNA isolation from some fungal organisms is difficult due to cell walls or capsules that are not readily susceptible to lysis. We therefore investigated a new and rapid DNA isolation method using high-speed cell disruption (HSCD) incorporating chaotropic reagents and lysing matrices in comparison to standard phenol-chloroform (PC) extraction protocols for isolation of DNA from three medically important yeasts (Candida albicans, Cryptococcus neoformans, and Trichosporon beigelii) and two filamentous fungi (Aspergillus fumigatus and Fusarium solani). Additional extractions by HSCD were performed on Saccharomyces cerevisiae, Pseudallescheria boydii, and Rhizopus arrhizus. Two different inocula (10(8) and 10(7) CFU) were compared for optimization of obtained yields. The entire extraction procedure was performed on as many as 12 samples within 1 h compared to 6 h for PC extraction. In comparison to the PC procedure, HSCD DNA extraction demonstrated significantly greater yields for 10(8) CFU of C. albicans, T. beigelii, A. fumigatus, and F. solani (P extraction and PC extraction. For 10(7) CFU of T. beigelii, PC extraction resulted in a greater yield than did HSCD (P fungi than for yeasts by the HSCD extraction procedure (P extraction procedure, differences were not significant. For all eight organisms, the rapid extraction procedure resulted in good yield, integrity, and quality of DNA as demonstrated by restriction fragment length polymorphism, PCR, and random amplified polymorphic DNA. We conclude that mechanical disruption of fungal cells by HSCD is a safe, rapid, and efficient procedure for extracting genomic DNA from medically important yeasts and especially from filamentous fungi.

  3. The coupling of rapidly synergistic cloud point extraction with thermospray flame furnace atomic absorption spectrometry

    International Nuclear Information System (INIS)

    Wen, X.; Deng, Q.; Guo, J.; Zhao, X.; Zhao, Y.; Ji, S.

    2012-01-01

    Rapidly synergistic cloud point extraction (RS-CPE) was coupled with thermospray flame furnace atomic absorption spectrometry (TS-FF-AAS) to result in new CPE patterns and accelerated (1 min) protocols. It is demonstrated, for the case of copper (II) ion, that TS-FF-AAS improves the sampling efficiency and the sensitivity of FAAS determinations. Problems of nebulization associated with previous methods based on the coupling of FAAS and RS-CPE are overcome. TS-FF-AAS also improves sensitivity and gives a limit of detection for copper of 0.20 μg L -1 , which is better by a factor of 32. Compared to direct FAAS, the factor is 114. (author)

  4. Extractive Atmospheric Pressure Photoionization (EAPPI) Mass Spectrometry: Rapid Analysis of Chemicals in Complex Matrices.

    Science.gov (United States)

    Liu, Chengyuan; Yang, Jiuzhong; Wang, Jian; Hu, Yonghua; Zhao, Wan; Zhou, Zhongyue; Qi, Fei; Pan, Yang

    2016-10-01

    Extractive atmospheric pressure photoionization (EAPPI) mass spectrometry was designed for rapid qualitative and quantitative analysis of chemicals in complex matrices. In this method, an ultrasonic nebulization system was applied to sample extraction, nebulization, and vaporization. Mixed with a gaseous dopant, vaporized analytes were ionized through ambient photon-induced ion-molecule reactions, and were mass-analyzed by a high resolution time-of-flight mass spectrometer (TOF-MS). After careful optimization and testing with pure sample solution, EAPPI was successfully applied to the fast screening of capsules, soil, natural products, and viscous compounds. Analysis was completed within a few seconds without the need for preseparation. Moreover, the quantification capability of EAPPI for matrices was evaluated by analyzing six polycyclic aromatic hydrocarbons (PAHs) in soil. The correlation coefficients (R (2) ) for standard curves of all six PAHs were above 0.99, and the detection limits were in the range of 0.16-0.34 ng/mg. In addition, EAPPI could also be used to monitor organic chemical reactions in real time. Graphical Abstract ᅟ.

  5. Rapid and efficient method to extract metagenomic DNA from estuarine sediments.

    Science.gov (United States)

    Shamim, Kashif; Sharma, Jaya; Dubey, Santosh Kumar

    2017-07-01

    Metagenomic DNA from sediments of selective estuaries of Goa, India was extracted using a simple, fast, efficient and environment friendly method. The recovery of pure metagenomic DNA from our method was significantly high as compared to other well-known methods since the concentration of recovered metagenomic DNA ranged from 1185.1 to 4579.7 µg/g of sediment. The purity of metagenomic DNA was also considerably high as the ratio of absorbance at 260 and 280 nm ranged from 1.88 to 1.94. Therefore, the recovered metagenomic DNA was directly used to perform various molecular biology experiments viz. restriction digestion, PCR amplification, cloning and metagenomic library construction. This clearly proved that our protocol for metagenomic DNA extraction using silica gel efficiently removed the contaminants and prevented shearing of the metagenomic DNA. Thus, this modified method can be used to recover pure metagenomic DNA from various estuarine sediments in a rapid, efficient and eco-friendly manner.

  6. Human Mobility Analysis for Extracting Local Interactions under Rapid Socio-Economic Transformation in Dawei, Myanmar

    Directory of Open Access Journals (Sweden)

    Satomi Kimijima

    2017-09-01

    Full Text Available Understanding human mobility patterns provides knowledge about impacts of a socio-economic transformation in a rapidly urbanizing environment. This study assesses a long-term mobility data which uses a face-to-face questionnaire and GPS logger-based method of data collection for extracting socio-economic impacts from the rapid transformation. Conversion of mobility related information such as travel distance, direction, and time from the questionnaire survey into spatiotemporal information was carried out by developing an algorithm. To illustrate the proposed approach, a case study in Dawei Special Economic Zone, Myanmar was conducted. The results show that the questionnaire-based mobility data can be associated with GPS-based mobility data and diverse mobility patterns are found for different social groups in the stage of urban formation. The results enabled an understanding of the human dynamics in interactions, which can be used for monitoring rural sustainability and its challenges in the future with the background of the accelerated project development in the area.

  7. High-resolution Imaging of pH in Alkaline Sediments and Water Based on a New Rapid Response Fluorescent Planar Optode

    Science.gov (United States)

    Han, Chao; Yao, Lei; Xu, Di; Xie, Xianchuan; Zhang, Chaosheng

    2016-05-01

    A new dual-lumophore optical sensor combined with a robust RGB referencing method was developed for two-dimensional (2D) pH imaging in alkaline sediments and water. The pH sensor film consisted of a proton-permeable polymer (PVC) in which two dyes with different pH sensitivities and emission colors: (1) chloro phenyl imino propenyl aniline (CPIPA) and (2) the coumarin dye Macrolex® fluorescence yellow 10 GN (MFY-10 GN) were entrapped. Calibration experiments revealed the typical sigmoid function and temperature dependencies. This sensor featured high sensitivity and fast response over the alkaline working ranges from pH 7.5 to pH 10.5. Cross-sensitivity towards ionic strength (IS) was found to be negligible for freshwater when IS applications.

  8. Rapid extraction of PCDD/Fs from soil and fly ash samples. Pressurized fluid extraction (PFE) and microwave-assisted extraction (MAE)

    Energy Technology Data Exchange (ETDEWEB)

    Sanz, P.; Fabrellas, B. [Centro de Investigaciones Energeticas Medioambientales y Tecnologicas (CIEMAT), Madrid (Spain)

    2004-09-15

    The main reference extraction method in the analysis of polychlorinated dibenzop- dioxins and dibenzofurans (PCDD/Fs) is still the Soxhlet extraction. But it requires long extraction times (up to 24 hs), large volumes of hazardous organic solvents (100-300 ml) and its automation is limited. Pressurized Fluid Extraction (PFE) and Microwave-Assisted Extraction (MAE) are two relatively new extraction techniques that reduce the time and the volume of solvent required for extraction. However, very different PFE extraction conditions are found for the same enviromental matrices in the literature. MAE is not a extraction technique very applied for the analysis of PCDD/Fs yet, although it is used for the determination of other organic compounds, such as PCBs and PAHs. In this study, PFE and MAE extraction conditions were optimized to determine PCDDs y PCDFs in fly ash and soil/sediment samples. Conventional Soxhlet extraction with toluene was used to compare the extraction efficiency of both techniques.

  9. Droplet centrifugation, droplet DNA extraction, and rapid droplet thermocycling for simpler and faster PCR assay using wire-guided manipulations.

    Science.gov (United States)

    You, David J; Yoon, Jeong-Yeol

    2012-09-04

    A computer numerical control (CNC) apparatus was used to perform droplet centrifugation, droplet DNA extraction, and rapid droplet thermocycling on a single superhydrophobic surface and a multi-chambered PCB heater. Droplets were manipulated using "wire-guided" method (a pipette tip was used in this study). This methodology can be easily adapted to existing commercial robotic pipetting system, while demonstrated added capabilities such as vibrational mixing, high-speed centrifuging of droplets, simple DNA extraction utilizing the hydrophobicity difference between the tip and the superhydrophobic surface, and rapid thermocycling with a moving droplet, all with wire-guided droplet manipulations on a superhydrophobic surface and a multi-chambered PCB heater (i.e., not on a 96-well plate). Serial dilutions were demonstrated for diluting sample matrix. Centrifuging was demonstrated by rotating a 10 μL droplet at 2300 round per minute, concentrating E. coli by more than 3-fold within 3 min. DNA extraction was demonstrated from E. coli sample utilizing the disposable pipette tip to cleverly attract the extracted DNA from the droplet residing on a superhydrophobic surface, which took less than 10 min. Following extraction, the 1500 bp sequence of Peptidase D from E. coli was amplified using rapid droplet thermocycling, which took 10 min for 30 cycles. The total assay time was 23 min, including droplet centrifugation, droplet DNA extraction and rapid droplet thermocycling. Evaporation from of 10 μL droplets was not significant during these procedures, since the longest time exposure to air and the vibrations was less than 5 min (during DNA extraction). The results of these sequentially executed processes were analyzed using gel electrophoresis. Thus, this work demonstrates the adaptability of the system to replace many common laboratory tasks on a single platform (through re-programmability), in rapid succession (using droplets), and with a high level of

  10. Droplet centrifugation, droplet DNA extraction, and rapid droplet thermocycling for simpler and faster PCR assay using wire-guided manipulations

    Directory of Open Access Journals (Sweden)

    You David J

    2012-09-01

    Full Text Available Abstract A computer numerical control (CNC apparatus was used to perform droplet centrifugation, droplet DNA extraction, and rapid droplet thermocycling on a single superhydrophobic surface and a multi-chambered PCB heater. Droplets were manipulated using “wire-guided” method (a pipette tip was used in this study. This methodology can be easily adapted to existing commercial robotic pipetting system, while demonstrated added capabilities such as vibrational mixing, high-speed centrifuging of droplets, simple DNA extraction utilizing the hydrophobicity difference between the tip and the superhydrophobic surface, and rapid thermocycling with a moving droplet, all with wire-guided droplet manipulations on a superhydrophobic surface and a multi-chambered PCB heater (i.e., not on a 96-well plate. Serial dilutions were demonstrated for diluting sample matrix. Centrifuging was demonstrated by rotating a 10 μL droplet at 2300 round per minute, concentrating E. coli by more than 3-fold within 3 min. DNA extraction was demonstrated from E. coli sample utilizing the disposable pipette tip to cleverly attract the extracted DNA from the droplet residing on a superhydrophobic surface, which took less than 10 min. Following extraction, the 1500 bp sequence of Peptidase D from E. coli was amplified using rapid droplet thermocycling, which took 10 min for 30 cycles. The total assay time was 23 min, including droplet centrifugation, droplet DNA extraction and rapid droplet thermocycling. Evaporation from of 10 μL droplets was not significant during these procedures, since the longest time exposure to air and the vibrations was less than 5 min (during DNA extraction. The results of these sequentially executed processes were analyzed using gel electrophoresis. Thus, this work demonstrates the adaptability of the system to replace many common laboratory tasks on a single platform (through re-programmability, in rapid succession (using droplets

  11. Rapid Screening of Natural Plant Extracts with Calcium Diacetate for Differential Effects Against Foodborne Pathogens and a Probiotic Bacterium.

    Science.gov (United States)

    Colonna, William; Brehm-Stecher, Byron; Shetty, Kalidas; Pometto, Anthony

    2017-12-01

    This study focused on advancing a rapid turbidimetric bioassay to screen antimicrobials using specific cocktails of targeted foodborne bacterial pathogens. Specifically, to show the relevance of this rapid screening tool, the antimicrobial potential of generally recognized as safe calcium diacetate (DAX) and blends with cranberry (NC) and oregano (OX) natural extracts was evaluated. Furthermore, the same extracts were evaluated against beneficial lactic acid bacteria. The targeted foodborne pathogens evaluated were Escherichia coli O157:H7, Salmonella spp., Listeria monocytogenes, and Staphylococcus aureus using optimized initial cocktails (∼10 8 colony-forming unit/mL) containing strains isolated from human food outbreaks. Of all extracts evaluated, 0.51% (w/v) DAX in ethanol was the most effective against all four pathogens. However, DAX when reduced to 0.26% and with added blends from ethanol extractions consisting of DAX:OX (3:1), slightly outperformed or was equal to same levels of DAX alone. Subculture of wells in which no growth occurred after 1 week indicated that all water and ethanol extracts were bacteriostatic against the pathogens tested. All the targeted antimicrobials had no effect on the probiotic organism Lactobacillus plantarum. The use of such rapid screening methods combined with the use of multistrain cocktails of targeted foodborne pathogens from outbreaks will allow rapid large-scale screening of antimicrobials and enable further detailed studies in targeted model food systems.

  12. Optimisation of pressurised liquid extraction (PLE) for rapid and efficient extraction of superficial and total mineral oil contamination from dry foods.

    Science.gov (United States)

    Moret, Sabrina; Scolaro, Marianna; Barp, Laura; Purcaro, Giorgia; Sander, Maren; Conte, Lanfranco S

    2014-08-15

    Pressurised liquid extraction (PLE) represents a powerful technique which can be conveniently used for rapid extraction of mineral oil saturated (MOSH) and aromatic hydrocarbons (MOAH) from dry foods with a low fat content, such as semolina pasta, rice, and other cereals. Two different PLE methods, one for rapid determination of superficial contamination mainly from the packaging, the other for efficient extraction of total contamination from different sources, have been developed and optimised. The two methods presented good performance characteristics in terms of repeatability (relative standard deviation lower than 5%) and recoveries (higher than 95%). To show their potentiality, the two methods have been applied in combination on semolina pasta and rice packaged in direct contact with recycled cardboard. In the case of semolina pasta it was possible to discriminate between superficial contamination coming from the packaging, and pre-existing contamination (firmly enclosed into the matrix). Copyright © 2014 Elsevier Ltd. All rights reserved.

  13. Rapid Extraction of Genomic DNA from Medically Important Yeasts and Filamentous Fungi by High-Speed Cell Disruption

    OpenAIRE

    Müller, Frank-Michael C.; Werner, Katherine E.; Kasai, Miki; Francesconi, Andrea; Chanock, Stephen J.; Walsh, Thomas J.

    1998-01-01

    Current methods of DNA extraction from different fungal pathogens are often time-consuming and require the use of toxic chemicals. DNA isolation from some fungal organisms is difficult due to cell walls or capsules that are not readily susceptible to lysis. We therefore investigated a new and rapid DNA isolation method using high-speed cell disruption (HSCD) incorporating chaotropic reagents and lysing matrices in comparison to standard phenol-chloroform (PC) extraction protocols for isolatio...

  14. Can the rapid identification of mature spermatozoa during microdissection testicular sperm extraction guide operative planning?

    Science.gov (United States)

    Alrabeeah, K; Doucet, R; Boulet, E; Phillips, S; Al-Hathal, N; Bissonnette, F; Kadoch, I J; Zini, A

    2015-05-01

    The minimum sperm count and quality that must be identified during microdissection testicular sperm extraction (micro-TESE) to deem the procedure successful remains to be established. We conducted a retrospective study of 81 consecutive men with non-obstructive azoospermia who underwent a primary (first) micro-TESE between March 2007 and October 2013. Final assessment of sperm recovery [reported on the day of (intracytoplasmic sperm injection) ICSI] was recorded as (i) successful (available spermatozoa for ICSI) or (ii) unsuccessful (no spermatozoa for ICSI). The decision to perform a unilateral (with limited or complete microdissection) or bilateral micro-TESE was guided by the intra-operative identification of sperm recovery (≥5 motile or non-motile sperm) from the first testicle. Overall, sperm recovery was successful in 56% (45/81) of the men. A unilateral micro-TESE was performed in 47% (38/81) of the men (based on intra-operative identification of sperm) and in 100% (38/38) of these men, spermatozoa was found on final assessment. In 42% (16/38) of the unilateral cases, a limited microdissection was performed (owing to the rapid intra-operative identification of sperm). The remaining 43 men underwent a bilateral micro-TESE and 16% (7/43) of these men had sperm identified on final assessment. The cumulative ICSI pregnancy rates (per cycle started and per embryo transfer) were 47% (21/45) and 60% (21/35), respectively, with a mean (±SD) of 1.9 ± 1.0 embryos transferred. The data demonstrate that intra-operative assessment of sperm recovery can correctly identify those men that require a unilateral micro-TESE. Moreover, the rapid identification of sperm recovery can allow some men to undergo a limited unilateral micro-TESE and avoid the need for complete testicular microdissection. © 2015 American Society of Andrology and European Academy of Andrology.

  15. Sensitive Quantification of Cannabinoids in Milk by Alkaline Saponification-Solid Phase Extraction Combined with Isotope Dilution UPLC-MS/MS.

    Science.gov (United States)

    Wei, Binnian; McGuffey, James E; Blount, Benjamin C; Wang, Lanqing

    2016-01-01

    Maternal exposure to marijuana during the lactation period-either active or passive-has prompted concerns about transmission of cannabinoids to breastfed infants and possible subsequent adverse health consequences. Assessing these health risks requires a sensitive analytical approach that is able to quantitatively measure trace-level cannabinoids in breast milk. Here, we describe a saponification-solid phase extraction approach combined with ultra-high-pressure liquid chromatography-tandem mass spectrometry for simultaneously quantifying Δ9-tetrahydrocannabinol (THC), cannabidiol (CBD), and cannabinol (CBN) in breast milk. We demonstrate for the first time that constraints on sensitivity can be overcome by utilizing alkaline saponification of the milk samples. After extensively optimizing the saponification procedure, the validated method exhibited limits of detections of 13, 4, and 66 pg/mL for THC, CBN, and CBD, respectively. Notably, the sensitivity achieved was significantly improved, for instance, the limits of detection for THC is at least 100-fold more sensitive compared to that previously reported in the literature. This is essential for monitoring cannabinoids in breast milk resulting from passive or nonrecent active maternal exposure. Furthermore, we simultaneously acquired multiple reaction monitoring transitions for 12 C- and 13 C-analyte isotopes. This combined analysis largely facilitated data acquisition by reducing the repetitive analysis rate for samples exceeding the linear limits of 12 C-analytes. In addition to high sensitivity and broad quantitation range, this method delivers excellent accuracy (relative error within ±10%), precision (relative standard deviation <10%), and efficient analysis. In future studies, we expect this method to play a critical role in assessing infant exposure to cannabinoids through breastfeeding.

  16. A simple and rapid infrared-assisted self enzymolysis extraction method for total flavonoid aglycones extraction from Scutellariae Radix and mechanism exploration.

    Science.gov (United States)

    Wang, Liping; Duan, Haotian; Jiang, Jiebing; Long, Jiakun; Yu, Yingjia; Chen, Guiliang; Duan, Gengli

    2017-09-01

    A new, simple, and fast infrared-assisted self enzymolysis extraction (IRASEE) approach for the extraction of total flavonoid aglycones (TFA) mainly including baicalein, wogonin, and oroxylin A from Scutellariae Radix is presented to enhance extraction yield. Extraction enzymolysis temperature, enzymolysis liquid-to-solid ratio, enzymolysis pH, enzymolysis time and infrared power, the factors affecting IRASEE procedure, were investigated in a newly designed, temperature-controlled infrared-assisted extraction (TC-IRAE) system to acquire the optimum analysis conditions. The results illustrated that IRASEE possessed great advantages in terms of efficiency and time compared with other conventional extraction techniques. Furthermore, the mechanism of IRASEE was preliminarily explored by observing the microscopic change of the samples surface structures, studying the main chemical compositions change of the samples before and after extraction and investigating the kinetics and thermodynamics at three temperature levels during the IRASEE process. These findings revealed that IRASEE can destroy the surface microstructures to accelerate the mass transfer and reduce the activation energy to intensify the chemical process. This integrative study presents a simple, rapid, efficient, and environmental IRASEE method for TFA extraction which has promising prospects for other similar herbal medicines. Graphical Abstract ᅟ.

  17. Development of a micropulverized extraction method for rapid toxicological analysis of methamphetamine in hair.

    Science.gov (United States)

    Miyaguchi, Hajime; Kakuta, Masaya; Iwata, Yuko T; Matsuda, Hideaki; Tazawa, Hidekatsu; Kimura, Hiroko; Inoue, Hiroyuki

    2007-09-07

    We developed a rapid sample preparation method for the toxicological analysis of methamphetamine and amphetamine (the major metabolite of methamphetamine) in human hair by high-performance liquid chromatography-tandem mass spectrometry (HPLC-MS/MS), to facilitate fast screening and quantitation. Two milligrams of hair were mechanically micropulverized for 5 min in a 2-ml plastic tube together with 100 microl of an aqueous solvent containing 10% acetonitrile, 100 mM trifluoroacetic acid and the corresponding deuterium analogues as internal standards. The pulverizing highly disintegrated the hair components, simultaneously allowing the extraction of any drugs present in the hair. After filtering the suspension with a membrane-filter unit, the clear filtrate was directly analyzed by HPLC-MS/MS. No evaporation processes were required for sample preparation. Method optimization and validation study were carried out using real-case specimens and fortified samples in which the drugs had been artificially absorbed, respectively. Concentration ranges for quantitation were 0.040-125 and 0.040-25 ng/mg for methamphetamine and amphetamine, respectively. Real-case specimens were analyzed by the method presented here and by conventional ones to verify the applicability of our method to real-world analysis. Our method took less than 30 min for a set of chromatograms to be obtained from a washed hair sample.

  18. Recyclable bio-reagent for rapid and selective extraction of contaminants from soil

    International Nuclear Information System (INIS)

    Lomasney, H.L.

    1997-01-01

    This Phase I Small Business Innovation Research program is confirming the effectiveness of a bio-reagent to cost-effectively and selectively extract a wide range of heavy metals and radionuclide contaminants from soil. This bioreagent solution, developed by ISOTRON reg-sign Corporation (New Orleans, LA), is flushed through the soil and recycled after flowing through an electrokinetic separation module, also developed by ISOTRON reg-sign. The process is ex situ, and the soil remains in its transport container through the decontamination process. The transport container can be a fiberglass box, or a bulk bag or open-quotes super sack.close quotes Rocks, vegetation, roots, etc. need not be removed. High clay content soils are accommodated. The process provides rapid injection of reagent solution, and when needed, sand is introduced to speed up the heap leach step. The concentrated waste form is eventually solidified. The bio-reagent is essentially a natural product, therefore any solubizer residual in soil is not expected to cause regulatory concern. The Phase I work will confirm the effectiveness of this bio-reagent on a wide range of contaminants, and the engineering parameters that are needed to carry out a full-scale demonstration of the process. ISOTRON reg-sign scientists will work with contaminated soil from Los Alamos National Laboratory. LANL is in the process of decontaminating and decommissioning more than 300 sites within its complex, many of which contain heavy metals or radionuclides; some are mixed wastes containing TCE, PCB, and metals

  19. Recyclable bio-reagent for rapid and selective extraction of contaminants from soil

    Energy Technology Data Exchange (ETDEWEB)

    Lomasney, H.L. [ISOTRON Corp., New Orleans, LA (United States)

    1997-10-01

    This Phase I Small Business Innovation Research program is confirming the effectiveness of a bio-reagent to cost-effectively and selectively extract a wide range of heavy metals and radionuclide contaminants from soil. This bioreagent solution, developed by ISOTRON{reg_sign} Corporation (New Orleans, LA), is flushed through the soil and recycled after flowing through an electrokinetic separation module, also developed by ISOTRON{reg_sign}. The process is ex situ, and the soil remains in its transport container through the decontamination process. The transport container can be a fiberglass box, or a bulk bag or {open_quotes}super sack.{close_quotes} Rocks, vegetation, roots, etc. need not be removed. High clay content soils are accommodated. The process provides rapid injection of reagent solution, and when needed, sand is introduced to speed up the heap leach step. The concentrated waste form is eventually solidified. The bio-reagent is essentially a natural product, therefore any solubizer residual in soil is not expected to cause regulatory concern. The Phase I work will confirm the effectiveness of this bio-reagent on a wide range of contaminants, and the engineering parameters that are needed to carry out a full-scale demonstration of the process. ISOTRON{reg_sign} scientists will work with contaminated soil from Los Alamos National Laboratory. LANL is in the process of decontaminating and decommissioning more than 300 sites within its complex, many of which contain heavy metals or radionuclides; some are mixed wastes containing TCE, PCB, and metals.

  20. An Alternative and Rapid Method for the Extraction of Nucleic Acids from Ixodid Ticks by Potassium Acetate Procedure

    Directory of Open Access Journals (Sweden)

    Islay Rodríguez

    2014-08-01

    Full Text Available Four variants of the potassium acetate procedure for DNA extraction from ixodid ticks at different stage of their life cycles were evaluated and compared with phenol-chloroform and ammonium hydroxide methods. The most rapid and most efficient variant was validated in the DNA extraction procedure from the engorged ticks collected from bovine, canine as well as from house ticks for the screening of Borrelia burgdorferi sensu lato, Anaplasma spp. and Babesia spp. The ammonium hydroxide procedure was used for non-engorged ticks. All the variants were efficient and allowed obtaining PCR-quality material according to the specific amplification of 16S rRNA gene fragment of the original tick. DNA extracted from the ticks under the study was tested by multiplex PCR for the screening of tick-borne pathogens. Anaplasma spp. and Babesia spp. amplification products were obtained from 29/48 extracts. Ammonium hydroxide protocol was not efficient for two extracts. Detection of amplification products from the PCR indicated that DNA had been successfully extracted. The potassium acetate procedure could be an alternative, rapid, and reliable method for DNA extraction from the ixodid ticks, mainly for poorly-resourced laboratories.

  1. New method for the rapid extraction of natural products: efficient isolation of shikimic acid from star anise.

    Science.gov (United States)

    Just, Jeremy; Deans, Bianca J; Olivier, Wesley J; Paull, Brett; Bissember, Alex C; Smith, Jason A

    2015-05-15

    A new, practical, rapid, and high-yielding process for the pressurized hot water extraction (PHWE) of multigram quantities of shikimic acid from star anise (Illicium verum) using an unmodified household espresso machine has been developed. This operationally simple and inexpensive method enables the efficient and straightforward isolation of shikimic acid and the facile preparation of a range of its synthetic derivatives.

  2. Development of rapid hemocyte-based extraction methods for detection of hepatitis A virus and murine norovirus in contaminated oysters

    Science.gov (United States)

    The human enteric pathogens, hepatitis A virus and human norovirus, have been shown to contaminate molluscan shellfish and cause foodborne disease in consumers. Rapid viral extraction methods are needed to replace current time consuming methods, which use whole oysters or dissected tissues. In our ...

  3. Rapid determination of carbohydrates, ash, and extractives contents of straw using attenuated total reflectance fourier transform mid-infrared spectroscopy.

    Science.gov (United States)

    Tamaki, Yukihiro; Mazza, Giuseppe

    2011-06-22

    Analysis of the chemical components of lignocellulosic biomass is essential to understanding its potential for utilization. Mid-infrared spectroscopy and partial least-squares regression were used for rapid measurement of the carbohydrate (total glycans; glucan; xylan; galactan; arabinan; mannan), ash, and extractives content of triticale and wheat straws. Calibration models for total glycans, glucan, and extractives showed good and excellent predictive performance on the basis of slope, r², RPD, and R/SEP criteria. The xylan model showed good and acceptable predictive performance. However, the ash model was evaluated as providing only approximate quantification and screening. The models for galactan, arabinan, and mannan indicated poor and insufficient prediction for application. Most models could predict both triticale and wheat straw samples with the same degree of accuracy. Mid-infrared spectroscopic techniques coupled with partial least-squares regression can be used for rapid prediction of total glycans, glucan, xylan, and extractives in triticale and wheat straw samples.

  4. Rapid quantification of polycyclic aromatic hydrocarbons in hydroxypropyl-{beta}-cyclodextrin (HPCD) soil extracts by synchronous fluorescence spectroscopy (SFS)

    Energy Technology Data Exchange (ETDEWEB)

    Guoxiong, Hua [School of Biology and Psychology, Institute for Research on Environment and Sustainability, Newcastle University, Newcastle upon Tyne NE1 7RU (United Kingdom); Broderick, John [School of Biology and Psychology, Institute for Research on Environment and Sustainability, Newcastle University, Newcastle upon Tyne NE1 7RU (United Kingdom); Semple, Kirk T [Department of Environmental Science, Faculty of Science and Technology, University of Lancaster, Lancaster LA1 4YQ (United Kingdom); Killham, Ken [School of Biological Sciences, University of Aberdeen, Aberdeen AB24 3UU (United Kingdom); Singleton, Ian [School of Biology and Psychology, Institute for Research on Environment and Sustainability, Newcastle University, Newcastle upon Tyne NE1 7RU (United Kingdom)

    2007-07-15

    Synchronous fluorescence spectroscopy (SFS) was directly applied to rapidly quantify selected polycyclic aromatic hydrocarbons (PAHs: benzo[a]pyrene and pyrene) in aqueous hydroxypropyl-{beta}-cyclodextrin (HPCD) soil extract solutions from a variety of aged contaminated soils containing four different PAHs. The method was optimized and validated. The results show that SFS can be used to analyse benzo[a]pyrene and pyrene in HPCD based soil extracts with high sensitivity and selectivity. The linear calibration ranges were 4.0 x 10{sup -6}-1.0 x 10{sup -3} mM for benzo[a]pyrene and 6.0 x 10{sup -6}-1.2 x 10{sup -3} mM for pyrene in 10 mM HPCD aqueous solution alone. The detection limits according to the error propagation theory for benzo[a]pyrene and pyrene were 3.9 x 10{sup -6} and 5.4 x 10{sup -6} mM, respectively. A good agreement between SFS and HPLC was reached for both determinations of PAHs in HPCD alone and in soil HPCD extracts. Hence, SFS is a potential means to simplify the present non-exhaustive hydroxypropyl-{beta}-cyclodextrin (HPCD)-based extraction technique for the evaluation of PAH bioavailability in soil. - SFS can be used to rapidly quantify selected PAHs in soil extracts and to simplify the non-exhaustive HPCD-based extraction technique for the evaluation of PAH bioavailability.

  5. A novel automated device for rapid nucleic acid extraction utilizing a zigzag motion of magnetic silica beads

    International Nuclear Information System (INIS)

    Yamaguchi, Akemi; Matsuda, Kazuyuki; Uehara, Masayuki; Honda, Takayuki; Saito, Yasunori

    2016-01-01

    We report a novel automated device for nucleic acid extraction, which consists of a mechanical control system and a disposable cassette. The cassette is composed of a bottle, a capillary tube, and a chamber. After sample injection in the bottle, the sample is lysed, and nucleic acids are adsorbed on the surface of magnetic silica beads. These magnetic beads are transported and are vibrated through the washing reagents in the capillary tube under the control of the mechanical control system, and thus, the nucleic acid is purified without centrifugation. The purified nucleic acid is automatically extracted in 3 min for the polymerase chain reaction (PCR). The nucleic acid extraction is dependent on the transport speed and the vibration frequency of the magnetic beads, and optimizing these two parameters provided better PCR efficiency than the conventional manual procedure. There was no difference between the detection limits of our novel device and that of the conventional manual procedure. We have already developed the droplet-PCR machine, which can amplify and detect specific nucleic acids rapidly and automatically. Connecting the droplet-PCR machine to our novel automated extraction device enables PCR analysis within 15 min, and this system can be made available as a point-of-care testing in clinics as well as general hospitals. - Highlights: • Automatic nucleic acid extraction is performed in 3 min. • Zigzag motion of magnetic silica beads yields rapid and efficient extraction. • The present our device provides better performance than the conventional procedure.

  6. Rapid quantification of polycyclic aromatic hydrocarbons in hydroxypropyl-β-cyclodextrin (HPCD) soil extracts by synchronous fluorescence spectroscopy (SFS)

    International Nuclear Information System (INIS)

    Hua Guoxiong; Broderick, John; Semple, Kirk T.; Killham, Ken; Singleton, Ian

    2007-01-01

    Synchronous fluorescence spectroscopy (SFS) was directly applied to rapidly quantify selected polycyclic aromatic hydrocarbons (PAHs: benzo[a]pyrene and pyrene) in aqueous hydroxypropyl-β-cyclodextrin (HPCD) soil extract solutions from a variety of aged contaminated soils containing four different PAHs. The method was optimized and validated. The results show that SFS can be used to analyse benzo[a]pyrene and pyrene in HPCD based soil extracts with high sensitivity and selectivity. The linear calibration ranges were 4.0 x 10 -6 -1.0 x 10 -3 mM for benzo[a]pyrene and 6.0 x 10 -6 -1.2 x 10 -3 mM for pyrene in 10 mM HPCD aqueous solution alone. The detection limits according to the error propagation theory for benzo[a]pyrene and pyrene were 3.9 x 10 -6 and 5.4 x 10 -6 mM, respectively. A good agreement between SFS and HPLC was reached for both determinations of PAHs in HPCD alone and in soil HPCD extracts. Hence, SFS is a potential means to simplify the present non-exhaustive hydroxypropyl-β-cyclodextrin (HPCD)-based extraction technique for the evaluation of PAH bioavailability in soil. - SFS can be used to rapidly quantify selected PAHs in soil extracts and to simplify the non-exhaustive HPCD-based extraction technique for the evaluation of PAH bioavailability

  7. Increased liver alkaline phosphatase and aminotransferase ...

    African Journals Online (AJOL)

    The effect of daily, oral administration of ethanolic extract of Khaya senegalensis stem bark (2mg/kg body weight) for 18days on the alkaline phosphatase, aspartate and alanine aminotransferase activities of rat liver and serum were investigated. Compared with the control, the activities of liver alkaline phosphatase (ALP), ...

  8. catalysed oxidation of atenolol by alkaline permanganate

    Indian Academy of Sciences (India)

    Unknown

    Abstract. Kinetics of ruthenium (III) catalyzed oxidation of atenolol by permanganate in alkaline medium at constant ionic strength of 0⋅30 mol dm3 has been studied spectrophotometrically using a rapid kinetic accessory. Reaction between permanganate and atenolol in alkaline medium exhibits 1 : 8 stoichiometry.

  9. A rapid extraction and analysis method for the simultaneous determination of 26 bioflavonoids in Portulaca oleracea L.

    Science.gov (United States)

    Liang, Xiao; Li, Lingzhi; Tian, Jinlong; Wu, Yingying; Gao, Pinyi; Li, Danqi; Zhang, Qingyi; Song, Shaojiang

    2014-01-01

    Portulaca oleracea L. (P. oleracea, purslane) is an edible plant that is widely distributed around the world, and flavonoids are its main bioactive constituents. Therefore, the detection of flavonoids is very important for a better understanding of its pharmacological actions and to monitor the product quality control of P. oleracea. To develop a rapid method to extract and determine 26 bioflavonoids in P. oleracea, based on microwave extraction (MWE) and triple quadrupole-linear ion trap mass spectrometry. The optimal conditions of MWE for the extraction of flavonoids from P. oleracea involved the use of methanol as the extraction solvent, a microwave power of 300 W, an extraction time of 450 s, and a solvent-to-solid ratio of 30 mL/g. The samples were analysed using an ultra-performance liquid chromatograph coupled with a triple quadrupole-linear ion trap mass spectrometer (UPLC-MS/MS) system. The calibration curves of all 26 analytes showed good linearity (r ≥ 0.999) and the intra- and interday precisions and repeatability were all within required limits. The mean recoveries measured at three concentrations were higher than 94.2%, with RSDs lower than 2.94% for the targets. The established MWE/UPLC-MS/MS method is a rapid and effective method for quality evaluation of P. oleracea from different production regions and different harvest periods. Copyright © 2014 John Wiley & Sons, Ltd.

  10. The BUME method: a new rapid and simple chloroform-free method for total lipid extraction of animal tissue.

    Science.gov (United States)

    Löfgren, Lars; Forsberg, Gun-Britt; Ståhlman, Marcus

    2016-06-10

    In this study we present a simple and rapid method for tissue lipid extraction. Snap-frozen tissue (15-150 mg) is collected in 2 ml homogenization tubes. 500 μl BUME mixture (butanol:methanol [3:1]) is added and automated homogenization of up to 24 frozen samples at a time in less than 60 seconds is performed, followed by a 5-minute single-phase extraction. After the addition of 500 μl heptane:ethyl acetate (3:1) and 500 μl 1% acetic acid a 5-minute two-phase extraction is performed. Lipids are recovered from the upper phase by automated liquid handling using a standard 96-tip robot. A second two-phase extraction is performed using 500 μl heptane:ethyl acetate (3:1). Validation of the method showed that the extraction recoveries for the investigated lipids, which included sterols, glycerolipids, glycerophospholipids and sphingolipids were similar or better than for the Folch method. We also applied the method for lipid extraction of liver and heart and compared the lipid species profiles with profiles generated after Folch and MTBE extraction. We conclude that the BUME method is superior to the Folch method in terms of simplicity, through-put, automation, solvent consumption, economy, health and environment yet delivering lipid recoveries fully comparable to or better than the Folch method.

  11. The BUME method: a new rapid and simple chloroform-free method for total lipid extraction of animal tissue

    Science.gov (United States)

    Löfgren, Lars; Forsberg, Gun-Britt; Ståhlman, Marcus

    2016-06-01

    In this study we present a simple and rapid method for tissue lipid extraction. Snap-frozen tissue (15-150 mg) is collected in 2 ml homogenization tubes. 500 μl BUME mixture (butanol:methanol [3:1]) is added and automated homogenization of up to 24 frozen samples at a time in less than 60 seconds is performed, followed by a 5-minute single-phase extraction. After the addition of 500 μl heptane:ethyl acetate (3:1) and 500 μl 1% acetic acid a 5-minute two-phase extraction is performed. Lipids are recovered from the upper phase by automated liquid handling using a standard 96-tip robot. A second two-phase extraction is performed using 500 μl heptane:ethyl acetate (3:1). Validation of the method showed that the extraction recoveries for the investigated lipids, which included sterols, glycerolipids, glycerophospholipids and sphingolipids were similar or better than for the Folch method. We also applied the method for lipid extraction of liver and heart and compared the lipid species profiles with profiles generated after Folch and MTBE extraction. We conclude that the BUME method is superior to the Folch method in terms of simplicity, through-put, automation, solvent consumption, economy, health and environment yet delivering lipid recoveries fully comparable to or better than the Folch method.

  12. A rapid extraction of landslide disaster information research based on GF-1 image

    Science.gov (United States)

    Wang, Sai; Xu, Suning; Peng, Ling; Wang, Zhiyi; Wang, Na

    2015-08-01

    In recent years, the landslide disasters occurred frequently because of the seismic activity. It brings great harm to people's life. It has caused high attention of the state and the extensive concern of society. In the field of geological disaster, landslide information extraction based on remote sensing has been controversial, but high resolution remote sensing image can improve the accuracy of information extraction effectively with its rich texture and geometry information. Therefore, it is feasible to extract the information of earthquake- triggered landslides with serious surface damage and large scale. Taking the Wenchuan county as the study area, this paper uses multi-scale segmentation method to extract the landslide image object through domestic GF-1 images and DEM data, which uses the estimation of scale parameter tool to determine the optimal segmentation scale; After analyzing the characteristics of landslide high-resolution image comprehensively and selecting spectrum feature, texture feature, geometric features and landform characteristics of the image, we can establish the extracting rules to extract landslide disaster information. The extraction results show that there are 20 landslide whose total area is 521279.31 .Compared with visual interpretation results, the extraction accuracy is 72.22%. This study indicates its efficient and feasible to extract earthquake landslide disaster information based on high resolution remote sensing and it provides important technical support for post-disaster emergency investigation and disaster assessment.

  13. New extraction technique for alkaloids

    Directory of Open Access Journals (Sweden)

    Djilani Abdelouaheb

    2006-01-01

    Full Text Available A method of extraction of natural products has been developed. Compared with existing methods, the new technique is rapid, more efficient and consumes less solvent. Extraction of alkaloids from natural products such as Hyoscyamus muticus, Datura stramonium and Ruta graveolens consists of the use of a sonicated solution containing a surfactant as extracting agent. The alkaloids are precipitated by Mayer reagent, dissolved in an alkaline solution, and then extracted with chloroform. This article compares the results obtained with other methods showing clearly the advantages of the new method.

  14. A RAPID DNA EXTRACTION METHOD FOR PCR IDENTIFICATION OF FUNGAL INDOOR AIR CONTAMINANTS

    Science.gov (United States)

    Following air sampling, fungal DNA needs to be extracted and purified to a state suitable for laboratory use. Our laboratory has developed a simple method of extraction and purification of fungal DNA appropriate for enzymatic manipulation and polymerase chain reaction (PCR) appli...

  15. A rapid and low-cost DNA extraction method for isolating ...

    African Journals Online (AJOL)

    The price of commercial DNA extraction methods makes the routine use of polymerase chain reaction amplification (PCR) based methods rather costly for scientists in developing countries. A guanidium thiocayante-based DNA extraction method was investigated in this study for the isolation of Escherichia coli (E. coli) DNA ...

  16. Processing Methods of Alkaline Hydrolysate from Rice Husk

    Directory of Open Access Journals (Sweden)

    Olga D. Arefieva

    2017-07-01

    Full Text Available This paper devoted to finding processing methods of alkaline hydrolysate produced from rice husk pre-extraction, and discusses alkaline hydrolysate processing schemed and disengagement of some products: amorphous silica of various quality, alkaline lignin, and water and alkaline extraction polysaccharides. Silica samples were characterized: crude (air-dried, burnt (no preliminary water treatment, washed in distilled water, and washed in distilled water and burnt. Waste water parameters upon the extraction of solids from alkaline hydrolysate dropped a few dozens or thousand times depending on the applied processing method. Color decreased a few thousand times, turbidity was virtually eliminated, chemical oxygen demanded about 20–136 times; polyphenols content might decrease 50% or be virtually eliminated. The most prospective scheme obtained the two following solid products from rice husk alkaline hydrolysate: amorphous silica and alkaline extraction polysaccharide. Chemical oxygen demand of the remaining waste water decreased about 140 times compared to the silica-free solution.

  17. Towards a method of rapid extraction of strontium-90 from urine: urine pretreatment and alkali metal removal

    Energy Technology Data Exchange (ETDEWEB)

    Hawkins, C. [Argonne National Lab. (ANL), Argonne, IL (United States); Dietz, M. [Argonne National Lab. (ANL), Argonne, IL (United States); Kaminski, M. [Argonne National Lab. (ANL), Argonne, IL (United States); Mertz, C. [Argonne National Lab. (ANL), Argonne, IL (United States); Shkrob, I. [Argonne National Lab. (ANL), Argonne, IL (United States)

    2016-03-01

    A technical program to support the Centers of Disease Control and Prevention is being developed to provide an analytical method for rapid extraction of Sr-90 from urine, with the intent of assessing the general population’s exposure during an emergency response to a radiological terrorist event. Results are presented on the progress in urine sample preparation and chemical separation steps that provide an accurate and quantitative detection of Sr-90 based upon an automated column separation sequence and a liquid scintillation assay. Batch extractions were used to evaluate the urine pretreatment and the column separation efficiency and loading capacity based upon commercial, extractant-loaded resins. An efficient pretreatment process for decolorizing and removing organics from urine without measurable loss of radiostrontium from the sample was demonstrated. In addition, the Diphonix® resin shows promise for the removal of high concentrations of common strontium interferents in urine as a first separation step for Sr-90 analysis.

  18. Rapid Antidepressant Activity of Ethanol Extract of Gardenia jasminoides Ellis Is Associated with Upregulation of BDNF Expression in the Hippocampus

    Directory of Open Access Journals (Sweden)

    Hailou Zhang

    2015-01-01

    Full Text Available Ethanol extract of Yueju pill, a Traditional Chinese Medicine herbal formula widely used to treat mood disorders, demonstrates rapid antidepressant effects similar to ketamine, likely via instant enhancement of brain-derived neurotrophic factor (BDNF expression in the hippocampus. Here we investigated ethanol extracts of the constituent herbs of Yueju responsible for rapid antidepressant effects. Screening with tail suspension test in Kunming mice at 24 hours after a single administration of five individual constituent herbs of Yueju, we found that only Gardenia jasminoides Ellis (GJ showed a significant effect. The antidepressant response started at 2 hours after GJ administration. Similar to Yueju and ketamine, a single administration of GJ significantly reduced the number of escape failures in the learned helplessness test. Furthermore, GJ decreased latency of food consumption in the novelty suppressed-feeding test. Additionally, starting from 2 hours and continuing for over 20 hours after GJ administration, BDNF expression in the hippocampus was upregulated, temporally linked with the antidepressant response. These findings suggest that GJ has rapid antidepressant effects, which are associated with the elevated expression of BDNF in the hippocampus. In Yueju formula, Yue represents GJ, as thus our study demonstrates the primary role of GJ in rapid antidepressant efficacy of Yueju.

  19. Rapid validated HPTLC method for estimation of piperine and piperlongumine in root of Piper longum extract and its commercial formulation

    Directory of Open Access Journals (Sweden)

    Anagha A. Rajopadhye

    2012-12-01

    Full Text Available Piperine and piperlongumine, alkaloids having diverse biological activities, commonly occur in roots of Piper longum L., Piperaceae, which have high commercial, economical and medicinal value. In present study, rapid, validated HPTLC method has been established for the determination of piperine and piperlongumine in methanolic root extract and its commercial formulation 'Mahasudarshan churna®' using ICH guidelines. The use of Accelerated Solvent Extraction (ASE as an alternative to conventional techniques has been explored. The methanol extracts of root, its formulation and both standard solutions were applied on silica gel F254 HPTLC plates. The plates were developed in Twin chamber using mobile phase toluene: ethyl acetate (6:4, v/v and scanned at 342 and 325 nm (λmax of piperine and piperlongumine, respectively using Camag TLC scanner 3 with CATS 4 software. A linear relationship was obtained between response (peak area and amount of piperine and piperlongumine in the range of 20-100 and 30-150 ng/spot, respectively; the correlation coefficient was 0.9957 and 0.9941 respectively. Sharp, symmetrical and well resolved peaks of piperine and piperlongumine spots resolved at Rf 0.51 and 0.74, respectively from other components of the sample extracts. The HPTLC method showed good linearity, recovery and high precision of both markers. Extraction of plant using ASE and rapid HPTLC method provides a new and powerful approach to estimate piperine and piperlongumine as phytomarkers in the extract as well as its commercial formulations for routine quality control.

  20. Universal and rapid salt-extraction of high quality genomic DNA for PCR-based techniques.

    OpenAIRE

    Aljanabi, S M; Martinez, I

    1997-01-01

    A very simple, fast, universally applicable and reproducible method to extract high quality megabase genomic DNA from different organisms is described. We applied the same method to extract high quality complex genomic DNA from different tissues (wheat, barley, potato, beans, pear and almond leaves as well as fungi, insects and shrimps' fresh tissue) without any modification. The method does not require expensive and environmentally hazardous reagents and equipment. It can be performed even i...

  1. Sample preparation in alkaline media

    International Nuclear Information System (INIS)

    Nobrega, Joaquim A.; Santos, Mirian C.; Sousa, Rafael A. de; Cadore, Solange; Barnes, Ramon M.; Tatro, Mark

    2006-01-01

    The use of tetramethylammonium hydroxide, tertiary amines and strongly alkaline reagents for sample treatment involving extraction and digestion procedures is discussed in this review. The preparation of slurries is also discussed. Based on literature data, alkaline media offer a good alternative for sample preparation involving an appreciable group of analytes in different types of samples. These reagents are also successfully employed in tailored speciation procedures wherein there is a critical dependence on maintenance of chemical forms. The effects of these reagents on measurements performed using spectroanalytical techniques are discussed. Several undesirable effects on transport and atomization processes necessitate use of the method of standard additions to obtain accurate results. It is also evident that alkaline media can improve the performance of techniques such as inductively coupled plasma mass spectrometry and accessories, such as autosamplers coupled to graphite furnace atomic absorption spectrometers

  2. A single-step method for rapid extraction of total lipids from green microalgae.

    Directory of Open Access Journals (Sweden)

    Martin Axelsson

    Full Text Available Microalgae produce a wide range of lipid compounds of potential commercial interest. Total lipid extraction performed by conventional extraction methods, relying on the chloroform-methanol solvent system are too laborious and time consuming for screening large numbers of samples. In this study, three previous extraction methods devised by Folch et al. (1957, Bligh and Dyer (1959 and Selstam and Öquist (1985 were compared and a faster single-step procedure was developed for extraction of total lipids from green microalgae. In the single-step procedure, 8 ml of a 2∶1 chloroform-methanol (v/v mixture was added to fresh or frozen microalgal paste or pulverized dry algal biomass contained in a glass centrifuge tube. The biomass was manually suspended by vigorously shaking the tube for a few seconds and 2 ml of a 0.73% NaCl water solution was added. Phase separation was facilitated by 2 min of centrifugation at 350 g and the lower phase was recovered for analysis. An uncharacterized microalgal polyculture and the green microalgae Scenedesmus dimorphus, Selenastrum minutum, and Chlorella protothecoides were subjected to the different extraction methods and various techniques of biomass homogenization. The less labour intensive single-step procedure presented here allowed simultaneous recovery of total lipid extracts from multiple samples of green microalgae with quantitative yields and fatty acid profiles comparable to those of the previous methods. While the single-step procedure is highly correlated in lipid extractability (r² = 0.985 to the previous method of Folch et al. (1957, it allowed at least five times higher sample throughput.

  3. A sunlight-induced method for rapid biosynthesis of silver nanoparticles using an Andrachnea chordifolia ethanol extract

    Energy Technology Data Exchange (ETDEWEB)

    Karimi Zarchi, A.A.; Faridi Majidi, R. [Tehran University of Medical Sciences, Department of Nanomedicine, School of Advanced Medical Technologies, Tehran (Iran, Islamic Republic of); Mokhtari, N.; Shahverdi, A.R. [Tehran University of Medical Sciences, Department of Pharmaceutical Biotechnology and Medicinal Plants Research Center, Faculty of Pharmacy, Tehran (Iran, Islamic Republic of); Arfan, M.; Rehman, T.; Ali, M. [University of Peshawar, Institute of Chemical Sciences, Peshawar, Khyber Pakhtoonkhwa (Pakistan); Amini, M. [Tehran University of Medical Sciences, Department of Medicinal Chemistry, Faculty of Pharmacy, Tehran (Iran, Islamic Republic of)

    2011-05-15

    In this study a sunlight-induced method for rapid synthesis of silver nanoparticles using an ethanol extract of Andrachnea chordifolia is described. The silver nitrate solutions (1 mM) containing the ethanol extract of Andrachnea chordifolia were irradiated by both sunlight radiation and by sunlight radiation passed through different colored filters (red, yellow or green). The smallest size of silver nanoparticles was obtained when a silver ion solution was irradiated for 5 minutes by direct sunlight radiation. Further examination of the shape and size and of the surface chemistry of these biogenic silver nanoparticles, which were prepared under sunlight radiation, was carried out using transmission electron microscopy and infrared spectroscopy, respectively. Transmission electron microscopy images show spherical particles with an average size of 3.4 nm. Hydroxyl residues were also detected on the surface of these biogenic silver nanoparticles fabricated using plant extract of Andrachnea chordifolia under sunlight radiation. Our study on the reduction of silver ions by this plant extract in darkness shows that the synthesis process can take place under dark conditions at much longer incubations (48 hours). Larger silver polydispersed nanoparticles ranging in size from 3 to 30 nm were obtained when the silver ions were treated with the ethanol extract of Andrachnea chordifolia under dark conditions for 48 hours. (orig.)

  4. Airborne LIDAR and high resolution satellite data for rapid 3D feature extraction

    Science.gov (United States)

    Jawak, S. D.; Panditrao, S. N.; Luis, A. J.

    2014-11-01

    This work uses the canopy height model (CHM) based workflow for individual tree crown delineation and 3D feature extraction approach (Overwatch Geospatial's proprietary algorithm) for building feature delineation from high-density light detection and ranging (LiDAR) point cloud data in an urban environment and evaluates its accuracy by using very high-resolution panchromatic (PAN) (spatial) and 8-band (multispectral) WorldView-2 (WV-2) imagery. LiDAR point cloud data over San Francisco, California, USA, recorded in June 2010, was used to detect tree and building features by classifying point elevation values. The workflow employed includes resampling of LiDAR point cloud to generate a raster surface or digital terrain model (DTM), generation of a hill-shade image and an intensity image, extraction of digital surface model, generation of bare earth digital elevation model (DEM) and extraction of tree and building features. First, the optical WV-2 data and the LiDAR intensity image were co-registered using ground control points (GCPs). The WV-2 rational polynomial coefficients model (RPC) was executed in ERDAS Leica Photogrammetry Suite (LPS) using supplementary *.RPB file. In the second stage, ortho-rectification was carried out using ERDAS LPS by incorporating well-distributed GCPs. The root mean square error (RMSE) for the WV-2 was estimated to be 0.25 m by using more than 10 well-distributed GCPs. In the second stage, we generated the bare earth DEM from LiDAR point cloud data. In most of the cases, bare earth DEM does not represent true ground elevation. Hence, the model was edited to get the most accurate DEM/ DTM possible and normalized the LiDAR point cloud data based on DTM in order to reduce the effect of undulating terrain. We normalized the vegetation point cloud values by subtracting the ground points (DEM) from the LiDAR point cloud. A normalized digital surface model (nDSM) or CHM was calculated from the LiDAR data by subtracting the DEM from the DSM

  5. Rapid and efficient extraction of genomic DNA from different phytopathogenic fungi using DNAzol reagent.

    Science.gov (United States)

    Guo, Jian-Rong; Schnieder, F; Abd-Elsalam, K A; Verreet, J A

    2005-01-01

    A modified procedure using the commercial DNAzol reagent was successfully applied to extract genomic DNA from 25 fungal species. The DNA yield varied from 306 to 1,927 microg g(-1) dry mycelia and the A(260)/A(280) ratio from 1.59 to 1.93. Compared with the method of J.L. Cenis (Nucleic Acids Res. 1992, 20: 2380) this procedure generated a higher DNA yield from 17 species and a higher A(260)/A(280) ratio from 23 species. But for four species, Cenis (1992) method was more suitable. No inhibitor of polymerase chain reaction was evident for the DNA extracted by the modified procedure, whereas some inhibitors remained in DNA of eight species extracted by the previous method.

  6. A rapid and simple method for DNA extraction from yeasts and fungi isolated from Agave fourcroydes.

    Science.gov (United States)

    Tapia-Tussell, Raul; Lappe, Patricia; Ulloa, Miguel; Quijano-Ramayo, Andrés; Cáceres-Farfán, Mirbella; Larqué-Saavedra, Alfonso; Perez-Brito, Daisy

    2006-05-01

    A simple and easy protocol for extracting high-quality DNA from different yeast and filamentous fungal species is described. This method involves two important steps: first, the disruption of cell walls by mechanical means and freezing; and second, the extraction, isolation, and precipitation of genomic DNA. The absorbance ratios (A(260)/A(280)) obtained ranged from 1.6 to 2.0. The main objective of this procedure is to extract pure DNA from yeast and filamentous fungi, including those with high contents of proteins, polysaccharides, and other complex compounds in their cell walls. The yield and quality of the DNAs obtained were suitable for micro/minisatellite primer-polymerase chain reaction (MSP-PCR) fingerprinting as well as for the sequence of the D1/D2 domain of the 26S rDNA.

  7. Liquid-liquid extraction of U(VI), Np(V) et Th(IV) ions by two calix[4]arene carboxyls, and effect of Na+ and K+ alkaline ions

    International Nuclear Information System (INIS)

    Montavon, Gilles

    1996-01-01

    As the process mainly used for the reprocessing of nuclear wastes was the Purex process, this research thesis first presents this process and outlines that it allows the residual fissile matter to be recovered and reused for the fabrication of new fuel elements, but is neither efficient nor safe enough to separate fission and activation products. Thus, this thesis reports the study of extraction and selectivity properties of two compounds derived from the p-tert-butyl-calix[4]arene with respect to actinide ions such as Th(IV), U(VI) and Np(VI). The liquid-liquid extraction technique has been used with chloroform and 1,2-dichloroethane as solvents. After some generalities on actinides, calixarenes and the liquid-liquid extraction technique, and a presentation of the experimental method, the author reports and discusses the extractive properties of the studied calixarenes with respect to Na + and K + ions. Structural studies by proton NMR have been performed. He reports and discusses the liquid-liquid extraction on actinide ions when they are alone or in presence on Na + and K + alkaline ions [fr

  8. A rapid and low-cost DNA extraction method for isolating ...

    African Journals Online (AJOL)

    user

    2011-02-21

    Feb 21, 2011 ... Available online at http://www.academicjournals.org/AJB ... α-casein, produces PCR ready DNA at a fraction of the cost of commercial DNA extraction kits. Key words: DNA .... This experiment was performed to evaluate the efficiency of the ..... Zoetendal EG, Ben-Amor K, Akkermans AD, Abee T, De Vos WM.

  9. A simple, rapid and efficient method for the extraction of genomic ...

    African Journals Online (AJOL)

    The isolation of intact, high-molecular-mass genomic DNA is essential for many molecular biology applications including long range PCR, endonuclease restriction digestion, southern blot analysis, and genomic library construction. Many protocols are available for the extraction of DNA from plant material, but obtain it is ...

  10. Enumeration and rapid identification of yeasts during extraction processes of extra virgin olive oil in Tuscany.

    Science.gov (United States)

    Mari, Eleonora; Guerrini, Simona; Granchi, Lisa; Vincenzini, Massimo

    2016-06-01

    The aim of this study was to evaluate the occurrence of yeast populations during different olive oil extraction processes, carried out in three consecutive years in Tuscany (Italy), by analysing crushed pastes, kneaded pastes, oil from decanter and pomaces. The results showed yeast concentrations ranging between 10(3) and 10(5) CFU/g or per mL. Seventeen dominant yeast species were identified by random amplified polymorphic DNA with primer M13 and their identification was confirmed by restriction fragments length polymorphism of ribosomal internal transcribed spacer and sequencing rRNA genes. The isolation frequencies of each species in the collected samples pointed out that the occurrence of the various yeast species in olive oil extraction process was dependent not only on the yeasts contaminating the olives but also on the yeasts colonizing the plant for oil extraction. In fact, eleven dominant yeast species were detected from the washed olives, but only three of them were also found in oil samples at significant isolation frequency. On the contrary, the most abundant species in oil samples, Yamadazyma terventina, did not occur in washed olive samples. These findings suggest a phenomenon of contamination of the plant for oil extraction that selects some yeast species that could affect the quality of olive oil.

  11. Rapid reagent-less on-line H2O2 quantification in alkaline semiconductor etching solution, Part 2: Nephelometry application.

    Science.gov (United States)

    Zlatev, Roumen; Stoytcheva, Margarita; Valdez, Benjamin

    2018-03-01

    A simple and rapid reagent less nephelometric method for on-line H 2 O 2 quantification in semiconductors etching solutions was developed, optimized, characterized and validated. The intensity of the light scattered by the oxygen gas suspension resulted from H 2 O 2 catalytic decomposition by immobilized MnO 2 was registered as analytical response. The influences of the light wave length, the agitation rate, the temperature and the catalyst surface area on the response amplitude were studied and optimization was done. The achieved linear concentration range from 10 to 150mmolL -1 at 0.9835 calibration curve correlation coefficient, precision from 3.65% to 0.95% and response time from 35 to 20s respectively, at sensitivity of 8.01µAmmol -1 L and LOD of 2.9mmolL -1 completely satisfy the semiconductor industry requirements. Copyright © 2017 Elsevier B.V. All rights reserved.

  12. Microwave-assisted rapid extracellular synthesis of stable bio-functionalized silver nanoparticles from guava (Psidium guajava) leaf extract

    Energy Technology Data Exchange (ETDEWEB)

    Raghunandan, Deshpande [H.K.E.S' s College of Pharmacy (India); Mahesh, Bedre D. [Gulbarga University, Materials Chemistry Laboratory, Department of Material Science (India); Basavaraja, S. [Jawaharlal Nehru Centre for Advanced Scientific Research, Veeco-India Nanotechnology Laboratory (India); Balaji, S. D. [Gulbarga University, Materials Chemistry Laboratory, Department of Material Science (India); Manjunath, S. Y. [Sri Krupa, Institute of Pharmaceutical Science (India); Venkataraman, A., E-mail: raman_chem@rediffmail.com [Gulbarga University, Materials Chemistry Laboratory, Department of Material Science (India)

    2011-05-15

    Our research interest centers on microwave-assisted rapid extracellular synthesis of bio-functionalized silver nanoparticles of 26 {+-} 5 nm from guava (Psidium guajava) leaf extract with control over dimension and composition. The reaction occurs very rapidly as the formation of spherical nanoparticles almost completed within 90 s. The probable pathway of the biosynthesis is suggested. Appearance, crystalline nature, size and shape of nanoparticles are understood by UV-vis (UV-vis spectroscopy), FTIR (fourier transform infrared spectroscopy), XRD (X-ray diffraction), FESEM (field emission scanning electron microscopy) and TEM (transmission electron microscopy) techniques. Microwave-assisted route is selected for the synthesis of silver nanoparticles to carry out the reaction fast, suppress the enzymatic action and to keep the process environmentally clean and green.

  13. Microwave-assisted rapid extracellular synthesis of stable bio-functionalized silver nanoparticles from guava (Psidium guajava) leaf extract

    International Nuclear Information System (INIS)

    Raghunandan, Deshpande; Mahesh, Bedre D.; Basavaraja, S.; Balaji, S. D.; Manjunath, S. Y.; Venkataraman, A.

    2011-01-01

    Our research interest centers on microwave-assisted rapid extracellular synthesis of bio-functionalized silver nanoparticles of 26 ± 5 nm from guava (Psidium guajava) leaf extract with control over dimension and composition. The reaction occurs very rapidly as the formation of spherical nanoparticles almost completed within 90 s. The probable pathway of the biosynthesis is suggested. Appearance, crystalline nature, size and shape of nanoparticles are understood by UV–vis (UV–vis spectroscopy), FTIR (fourier transform infrared spectroscopy), XRD (X-ray diffraction), FESEM (field emission scanning electron microscopy) and TEM (transmission electron microscopy) techniques. Microwave-assisted route is selected for the synthesis of silver nanoparticles to carry out the reaction fast, suppress the enzymatic action and to keep the process environmentally clean and green.

  14. Microwave-assisted rapid extracellular synthesis of stable bio-functionalized silver nanoparticles from guava ( Psidium guajava) leaf extract

    Science.gov (United States)

    Raghunandan, Deshpande; Mahesh, Bedre D.; Basavaraja, S.; Balaji, S. D.; Manjunath, S. Y.; Venkataraman, A.

    2011-05-01

    Our research interest centers on microwave-assisted rapid extracellular synthesis of bio-functionalized silver nanoparticles of 26 ± 5 nm from guava ( Psidium guajava) leaf extract with control over dimension and composition. The reaction occurs very rapidly as the formation of spherical nanoparticles almost completed within 90 s. The probable pathway of the biosynthesis is suggested. Appearance, crystalline nature, size and shape of nanoparticles are understood by UV-vis (UV-vis spectroscopy), FTIR (fourier transform infrared spectroscopy), XRD (X-ray diffraction), FESEM (field emission scanning electron microscopy) and TEM (transmission electron microscopy) techniques. Microwave-assisted route is selected for the synthesis of silver nanoparticles to carry out the reaction fast, suppress the enzymatic action and to keep the process environmentally clean and green.

  15. An inexpensive and rapid method for extracting papilionoid genomic DNA from herbarium specimens.

    Science.gov (United States)

    Riahi, M; Zarre, S; Maassoumi, A A; Attar, F; Kazempour Osaloo, S

    2010-07-13

    Three DNA extraction protocols were compared for their ability to yield DNA from the leaves of herbarium specimens of nine species from nine genera of the Papilionoideae. We tested two protocols that use classic procedures for lysis and purification with cetyl trimethylammonium bromide (CTAB); a third protocol used a Nucleospin Plant kit. DNA obtained from all three procedures was quantified and tested by PCR. Test results indicated the superiority of one of the CTAB protocols. We made some modifications, developing a protocol that produced high-quality DNA from all nine species. The modification involved the use of a lower EDTA concentration (20 mM instead of 50 mM) and a higher beta-mercaptoethanol concentration (1% instead of 0.4%) in the extraction buffer. The modified protocol avoids the necessity for a second DNA precipitation step. This new CTAB protocol includes the use of 1.4 M NaCl, 20 mM EDTA and 1% beta-mercaptoethanol in the extraction; DNA precipitation time is reduced. A reduction in contaminating metabolites (such as PCR inhibitors) in the sample mixtures and lower costs for reagents are characteristics of this modified protocol; the cost of analysis per sample was lowered, compared to previous options. The quality of DNA was suitable for PCR amplification. This is a practical alternative to more difficult, time-consuming and expensive protocols.

  16. Filtration Isolation of Nucleic Acids: A Simple and Rapid DNA Extraction Method.

    Science.gov (United States)

    McFall, Sally M; Neto, Mário F; Reed, Jennifer L; Wagner, Robin L

    2016-08-06

    FINA, filtration isolation of nucleic acids, is a novel extraction method which utilizes vertical filtration via a separation membrane and absorbent pad to extract cellular DNA from whole blood in less than 2 min. The blood specimen is treated with detergent, mixed briefly and applied by pipet to the separation membrane. The lysate wicks into the blotting pad due to capillary action, capturing the genomic DNA on the surface of the separation membrane. The extracted DNA is retained on the membrane during a simple wash step wherein PCR inhibitors are wicked into the absorbent blotting pad. The membrane containing the entrapped DNA is then added to the PCR reaction without further purification. This simple method does not require laboratory equipment and can be easily implemented with inexpensive laboratory supplies. Here we describe a protocol for highly sensitive detection and quantitation of HIV-1 proviral DNA from 100 µl whole blood as a model for early infant diagnosis of HIV that could readily be adapted to other genetic targets.

  17. Rapid DNA extraction from dried blood spots on filter paper: potential applications in biobanking.

    Science.gov (United States)

    Choi, Eun-Hye; Lee, Sang Kwang; Ihm, Chunhwa; Sohn, Young-Hak

    2014-12-01

    Dried blood spot (DBS) technology is a microsampling alternative to traditional plasma or serum sampling for pharmaco- or toxicokinetic evaluation. DBS technology has been applied to diagnostic screening in drug discovery, nonclinical, and clinical settings. We have developed an improved elution protocol involving boiling of blood spots dried on Whatman filter paper. The purpose of this study was to compare the quality, purity, and quantity of DNA isolated from frozen blood samples and DBSs. We optimized a method for extraction and estimation of DNA from blood spots dried on filter paper (3-mm FTA card). A single DBS containing 40 μL blood was used. DNA was efficiently extracted in phosphate-buffered saline (PBS) or Tris-EDTA (TE) buffer by incubation at 37°C overnight. DNA was stable in DBSs that were stored at room temperature or frozen. The housekeeping genes GAPDH and beta-actin were used as positive standards for polymerase chain reaction (PCR) validation of general diagnostic screening. Our simple and convenient DBS storage and extraction methods are suitable for diagnostic screening by using very small volumes of blood collected on filter paper, and can be used in biobanks for blood sample storage.

  18. Rapid extraction of genomic DNA from saliva for HLA typing on microarray based on magnetic nanobeads

    Energy Technology Data Exchange (ETDEWEB)

    Xie Xin; Zhang Xu E-mail: shinezhang@hotmail.com; Yu Bingbin; Gao Huafang; Zhang Huan; Fei Weiyang

    2004-09-01

    A series of simplified protocols are developed for extracting genomic DNA from saliva by using the magnetic nanobeads as absorbents. In these protocols, both the enrichment of the target cells and the adsorption of DNA can be achieved simultaneously by our functionally modified magnetic beads in one step, and the DNA-nanobeads complex can be used as PCR templates. HLA typing based on an oligonucleotide array was conducted by hybridization with the PCR products. The result shows that the protocols are robust and sensitive.

  19. Computer aided detection of suspicious regions on digital mammograms : rapid segmentation and feature extraction

    Energy Technology Data Exchange (ETDEWEB)

    Ruggiero, C; Giacomini, M; Sacile, R [DIST - Department of Communication Computer and System Sciences, University of Genova, Via Opera Pia 13, 16145 Genova (Italy); Rosselli Del Turco, M [Centro per lo studio e la prevenzione oncologica, Firenze (Italy)

    1999-12-31

    A method is presented for rapid detection of suspicious regions which consists of two steps. The first step is segmentation based on texture analysis consisting of : histogram equalization, Laws filtering for texture analysis, Gaussian blur and median filtering to enhance differences between tissues in different respects, histogram thresholding to obtain a binary image, logical masking in order to detect regions to be discarded from the analysis, edge detection. This method has been tested on 60 images, obtaining 93% successful detection of suspicious regions. (authors) 4 refs, 9 figs, 1 tabs.

  20. A simple rapid process for semi-automated brain extraction from magnetic resonance images of the whole mouse head.

    Science.gov (United States)

    Delora, Adam; Gonzales, Aaron; Medina, Christopher S; Mitchell, Adam; Mohed, Abdul Faheem; Jacobs, Russell E; Bearer, Elaine L

    2016-01-15

    Magnetic resonance imaging (MRI) is a well-developed technique in neuroscience. Limitations in applying MRI to rodent models of neuropsychiatric disorders include the large number of animals required to achieve statistical significance, and the paucity of automation tools for the critical early step in processing, brain extraction, which prepares brain images for alignment and voxel-wise statistics. This novel timesaving automation of template-based brain extraction ("skull-stripping") is capable of quickly and reliably extracting the brain from large numbers of whole head images in a single step. The method is simple to install and requires minimal user interaction. This method is equally applicable to different types of MR images. Results were evaluated with Dice and Jacquard similarity indices and compared in 3D surface projections with other stripping approaches. Statistical comparisons demonstrate that individual variation of brain volumes are preserved. A downloadable software package not otherwise available for extraction of brains from whole head images is included here. This software tool increases speed, can be used with an atlas or a template from within the dataset, and produces masks that need little further refinement. Our new automation can be applied to any MR dataset, since the starting point is a template mask generated specifically for that dataset. The method reliably and rapidly extracts brain images from whole head images, rendering them useable for subsequent analytical processing. This software tool will accelerate the exploitation of mouse models for the investigation of human brain disorders by MRI. Copyright © 2015 Elsevier B.V. All rights reserved.

  1. Rapid fingerprinting and classification of extra virgin olive oil by microjet sampling and extractive electrospray ionization mass spectrometry.

    Science.gov (United States)

    Law, Wai Siang; Chen, Huan Wen; Balabin, Roman; Berchtold, Christian; Meier, Lukas; Zenobi, Renato

    2010-04-01

    Microjet sampling in combination with extractive electrospray ionization (EESI) mass spectrometry (MS) was applied to the rapid characterization and classification of extra virgin olive oil (EVOO) without any sample pretreatment. When modifying the composition of the primary ESI spray solvent, mass spectra of an identical EVOO sample showed differences. This demonstrates the capability of this technique to extract molecules with varying polarities, hence generating rich molecular information of the EVOO. Moreover, with the aid of microjet sampling, compounds of different volatilities (e.g.E-2-hexenal, trans-trans-2,4-heptadienal, tyrosol and caffeic acid) could be sampled simultaneously. EVOO data was also compared with that of other edible oils. Principal Component Analysis (PCA) was performed to discriminate EVOO and EVOO adulterated with edible oils. Microjet sampling EESI-MS was found to be a simple, rapid (less than 2 min analysis time per sample) and powerful method to obtain MS fingerprints of EVOO without requiring any complicated sample pretreatment steps.

  2. Effect of acid- and alkaline-aided extractions on functional and rheological properties of proteins recovered from mechanically separated turkey meat (MSTM).

    Science.gov (United States)

    Hrynets, Yuliya; Omana, Dileep A; Xu, Yan; Betti, Mirko

    2010-09-01

    Functional and rheological characteristics of acid- and alkali-extracted proteins from mechanically separated turkey meat (MSTM) have been investigated. Extractions were carried out at 4 pH values (2.5, 3.5, 10.5, and 11.5). The study demonstrated that alkali and acid extractions resulted in significant (P hardness, chewiness, springiness, and cohesiveness) of recovered proteins were found to be unaffected (P > 0.05) by different extraction pH. The protein extracted at pH 3.5 formed a highly viscoelastic gel network as evidenced by storage modulus (G') values, whereas the gel formed from proteins extracted at pH 10.5 was found to be the weakest. The work also revealed that acid treatments were more effective for removal of total heme pigments from MSTM. Color characteristics of protein isolates were markedly improved compared to the initial material and tended to be better when subjected to acid extractions. Mechanically separated meat is one of the cheapest sources of protein obtained by grinding meat and bones together and forcing the mixture through a perforated drum. The use of mechanically separated turkey meat (MSTM) for the production of further processed poultry products is limited due to its undesirable color and textural properties. Recovery of proteins from MSTM using pH shifting process will help the poultry processors to get better returns and also create opportunity to produce functional food ingredients.

  3. Rapid screening and guided extraction of antioxidants from microalgae using voltammetric methods.

    Science.gov (United States)

    Goiris, Koen; De Vreese, Peter; De Cooman, Luc; Muylaert, Koenraad

    2012-08-01

    Currently, microalgae draw much attention as a promising source of natural antioxidants to replace synthetic antioxidants for food applications. In this paper, the use of voltammetric techniques as a fast alternative for chemical assays to determine the antioxidant power of microalgal biomass is discussed. It was found that antioxidant activities determined by square wave voltammetry correlate well with the results from other established antioxidant assays, such as Trolox equivalent antioxidant capacity (R(2) = 0.737), ferric reducing antioxidant potential (R(2) = 0.729), and AAPH-induced oxidation of linoleic acid (R(2) = 0.566). Besides yielding quantitative data on the antioxidant activity, square wave voltammetry provides additional information on the antioxidant profile of microalgal biomass as the peak potentials of antioxidant components are determined. Consequently, square wave voltammetry can be used as a tool for optimizing the extraction processes to recover antioxidant components from microalgae.

  4. Pressure disequilibria induced by rapid valve closure in noble gas extraction lines

    Science.gov (United States)

    Morgan, Leah; Davidheiser-Kroll, Brett

    2015-01-01

    Pressure disequilibria during rapid valve closures can affect calculated molar quantities for a range of gas abundance measurements (e.g., K-Ar geochronology, (U-Th)/He geochronology, noble gas cosmogenic chronology). Modeling indicates this effect in a system with a 10 L reservoir reaches a bias of 1% before 1000 pipette aliquants have been removed from the system, and a bias of 10% before 10,000 aliquants. Herein we explore the causes and effects of this problem, which is the result of volume changes during valve closure. We also present a solution in the form of an electropneumatic pressure regulator that can precisely control valve motion. This solution reduces the effect to ∼0.3% even after 10,000 aliquants have been removed from a 10 L reservoir.

  5. Pressure disequilibria induced by rapid valve closure in noble gas extraction lines

    Science.gov (United States)

    Morgan, Leah E.; Davidheiser-Kroll, Brett

    2015-06-01

    Pressure disequilibria during rapid valve closures can affect calculated molar quantities for a range of gas abundance measurements (e.g., K-Ar geochronology, (U-Th)/He geochronology, noble gas cosmogenic chronology). Modeling indicates this effect in a system with a 10 L reservoir reaches a bias of 1% before 1000 pipette aliquants have been removed from the system, and a bias of 10% before 10,000 aliquants. Herein we explore the causes and effects of this problem, which is the result of volume changes during valve closure. We also present a solution in the form of an electropneumatic pressure regulator that can precisely control valve motion. This solution reduces the effect to ˜0.3% even after 10,000 aliquants have been removed from a 10 L reservoir.

  6. RAPID DNA EXTRACTION AND PCR VALIDATION FOR DIRECT DETECTION OF Listeria monocytogenes IN RAW MILK

    Directory of Open Access Journals (Sweden)

    Edith Burbano

    2006-05-01

    Full Text Available Objective. The aim of this study was to validate a method for detecting L. monocytogenes in raw milk.Materials and methods. The extraction procedure carried out using a chaotropic agent like NaI, toreduce fat in the sample to 0.2% w/v, which is the lowest limit for detection in the Gerber method, toavoid the polymerization. The raw milk samples were analyzed by using the traditional gold standardmethod for L. monocytogenes. Detection PCR was done on the specificity of primers that recognize theListeria genus by amplifying a specific fragment of about 938bp of the 16S rDNA. Several primer setswere use: L1 (CTCCATAAAGGTGACCCT, U1 (CAGCMGCCGCGGTAATWC, LF (CAAACGTTAACAACGCAGTAand LR (TCCAGAGTGATCGATGTTAA that recognize the hlyA gene of L. monocytogenes, amplifying a 750bpfragment. Results. The DNA of 39 strains evidenced high specificity of the technique since all the strainsof L. monocytogenes amplified the fragments 938bp and 750bp, specifically for genus and species,respectively. The detection limit of the PCR was 101 CFU/ml. T he PCR reproducibility showed a Kappa of0.85; the specificity and sensitivity of 100% were found, predictive positive and negative values were of100% respectively. Conclusions. These results demonstrate that is possible to detect of Listeria spp. byusing any of the three methods since they share the same sensitivity and specificity. One hundred percentof the predictive value for PCR (alternative method provides high reliability, and allows the detection ofthe positive samples. The extraction procedure combined with a PCR method can reduce in 15 days thetime of identification of L. monocytogenes in raw milk. This PCR technique could be adapted and validatedto be use for other types of food such as poultry, meat products and cheeses

  7. Development of a triple hyphenated HPLC-radical scavenging detection-DAD-SPE-NMR system for the rapid identification of antioxidants in complex plant extracts

    NARCIS (Netherlands)

    Pukalskas, A.; Beek, van T.A.; Waard, de P.

    2005-01-01

    A rapid method for the simultaneous detection and identification of radical scavenging compounds in plant extracts was developed by combining an HPLC with on-line radical scavenging using DPPH as a model radical and an HPLC¿DAD¿SPE¿NMR system. Using this method a commercial rosemary extract was

  8. Treatment of different parts of corn stover for high yield and lower polydispersity lignin extraction with high-boiling alkaline solvent.

    Science.gov (United States)

    Yang, Mengyao; Rehman, Muhammad Saif Ur; Yan, Tingxuan; Khan, Asad Ullah; Oleskowicz-Popiel, Piotr; Xu, Xia; Cui, Ping; Xu, Jian

    2018-02-01

    The influence of different parts of corn stover on lignin extraction was investigated. Five kinds of lignin were isolated by the high boiling point solvent extraction from the whole corn stover and four different parts including leaf, husk, bark and pith. The optimal condition was obtained: 6.25 g/L NaOH, 140 °C, 1 h and 60% (v/v) 1,4-butanediol. The extracted lignins were then characterized. FT-IR analysis revealed that all of the lignins were typically herbaceous. The lignin extracted from husk contained more S unit. Gel permeation chromatography analysis showed that it was necessary to separate corn stover into different parts to obtain low polydispersity lignin. The SEM and FT-IR analysis proved that the lignin dissolution was related to the tightness structure presenting a positive correlation with hydrogen bond index. Copyright © 2017 Elsevier Ltd. All rights reserved.

  9. A simple and rapid method for calixarene-based selective extraction of bioactive molecules from natural products.

    Science.gov (United States)

    Segneanu, Adina-Elena; Damian, Daniel; Hulka, Iosif; Grozescu, Ioan; Salifoglou, Athanasios

    2016-03-01

    Natural products derived from medicinal plants have gained an important role in drug discovery due to their complex and abundant composition of secondary metabolites, with their structurally unique molecular components bearing a significant number of stereo-centers exhibiting high specificity linked to biological activity. Usually, the extraction process of natural products involves various techniques targeting separation of a specific class of compounds from a highly complex matrix. Aiding the process entails the use of well-defined and selective molecular extractants with distinctly configured structural attributes. Calixarenes conceivably belong to that class of molecules. They have been studied intensely over the years in an effort to develop new and highly selective receptors for biomolecules. These macrocycles, which display remarkable structural architectures and properties, could help usher a new approach in the efficient separation of specific classes of compounds from complex matrices in natural products. A simple and rapid such extraction method is presented herein, based on host-guest interaction(s) between a calixarene synthetic receptor, 4-tert-butyl-calix[6]arene, and natural biomolecular targets (amino acids and peptides) from Helleborus purpurascens and Viscum album. Advanced physicochemical methods (including GC-MS and chip-based nanoESI-MS analysis) suggest that the molecular structure and specifically the calixarene cavity size are closely linked to the nature of compounds separated. Incorporation of biomolecules and modification of the macrocyclic architecture during separation were probed and confirmed by scanning electronic microscopy and atomic force microscopy. The collective results project calixarene as a promising molecular extractant candidate, facilitating the selective separation of amino acids and peptides from natural products.

  10. Rapid Biosynthesis of Silver Nanoparticles by Exploiting the Reducing Potential of Trapa bispinosa Peel Extract

    International Nuclear Information System (INIS)

    Pandey, S.; Mewada, A.; Thakur, M.; Shinde, S.; Shah, R.; Oza, G.; Sharon, M.

    2013-01-01

    Present work reports exceptionally high reducing capacity of Trapa bispinosa to synthesize monodispersed silver nanoparticles (SNPs) within 120 seconds at 30 degree C which is the shortest tenure reported for SNP synthesis using plants. Moreover, we also instigated impact of different ph values on fabrication of SNPs using visible spectroscopy with respect to time. Percentage conversion of Ag + ions into Ag was calculated using ICP-AES analysis and was found to be 97% at pH = 7. To investigate the reduction of Ag + ions to SNPs, cyclic voltammetry (CV) and open circuit potential (OCP) using 0.1M KNO 3 were performed. There was prompt reduction in cathodic and anodic currents after addition of the peel extract which indicates the reducing power of T. bispinosa peel. Stability of the SNPs was studied using flocculation parameter (FP) which was found to be least at all the pH values. FP was found to be indirectly proportional to stability of the nanoparticles

  11. You had me at "Hello": Rapid extraction of dialect information from spoken words.

    Science.gov (United States)

    Scharinger, Mathias; Monahan, Philip J; Idsardi, William J

    2011-06-15

    Research on the neuronal underpinnings of speaker identity recognition has identified voice-selective areas in the human brain with evolutionary homologues in non-human primates who have comparable areas for processing species-specific calls. Most studies have focused on estimating the extent and location of these areas. In contrast, relatively few experiments have investigated the time-course of speaker identity, and in particular, dialect processing and identification by electro- or neuromagnetic means. We show here that dialect extraction occurs speaker-independently, pre-attentively and categorically. We used Standard American English and African-American English exemplars of 'Hello' in a magnetoencephalographic (MEG) Mismatch Negativity (MMN) experiment. The MMN as an automatic change detection response of the brain reflected dialect differences that were not entirely reducible to acoustic differences between the pronunciations of 'Hello'. Source analyses of the M100, an auditory evoked response to the vowels suggested additional processing in voice-selective areas whenever a dialect change was detected. These findings are not only relevant for the cognitive neuroscience of language, but also for the social sciences concerned with dialect and race perception. Copyright © 2011 Elsevier Inc. All rights reserved.

  12. Environmentally Benign, Rapid, and Selective Extraction of Gold from Ores and Waste Electronic Materials.

    Science.gov (United States)

    Yue, Chunlin; Sun, Huaming; Liu, Wen-Jing; Guan, Binbin; Deng, Xudong; Zhang, Xu; Yang, Peng

    2017-08-01

    The extraction of gold from ores and electronic waste is an important topic worldwide, as this precious metal has immense value in a variety of fields. However, serious environmental pollution and high energy consumption due to the use of toxic oxidation reagents and harsh reaction conditions is a well-known problem in the gold industry. Herein, we report a new chemical method based on the combined use of N-bromosuccinimide (NBS) and pyridine (Py), which has a greatly decreased environmental impact and reagent cost, as well as mild reaction requirements. This method can directly leach Au 0 from gold ore and electronic waste to form Au III in water. The process is achieved in a yield of approximately 90 % at room temperature and a nearly neutral pH. The minimum dose of NBS/Py is as low as 10 mm, which exhibits low toxicity towards mammalian cells and animals as well as aquatic creatures. The high leaching selectivity of Au over other metals during gold leaching is demonstrated, showing that this method has great potential for practical industrial application towards the sustainable refining of gold from ores and electronic waste. © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

  13. Rapid Computer Aided Ligand Design and Screening of Precious Metal Extractants from TRUEX Raffinate with Experimental Validation

    International Nuclear Information System (INIS)

    Clark, Aurora Sue; Wall, Nathalie; Benny, Paul

    2015-01-01

    design of a software program that uses state-of-the-art computational combinatorial chemistry, and is developed and validated with experimental data acquisition; the resulting tool allows for rapid design and screening of new ligands for the extraction of precious metals from SNF. This document describes the software that has been produced, ligands that have been designed, and fundamental new understandings of the extraction process of Rh(III) as a function of solution phase conditions (pH, nature of acid, etc.).

  14. Rapid Computer Aided Ligand Design and Screening of Precious Metal Extractants from TRUEX Raffinate with Experimental Validation

    Energy Technology Data Exchange (ETDEWEB)

    Clark, Aurora Sue [Washington State Univ., Pullman, WA (United States); Wall, Nathalie [Washington State Univ., Pullman, WA (United States); Benny, Paul [Washington State Univ., Pullman, WA (United States)

    2015-11-16

    through the design of a software program that uses state-of-the-art computational combinatorial chemistry, and is developed and validated with experimental data acquisition; the resulting tool allows for rapid design and screening of new ligands for the extraction of precious metals from SNF. This document describes the software that has been produced, ligands that have been designed, and fundamental new understandings of the extraction process of Rh(III) as a function of solution phase conditions (pH, nature of acid, etc.).

  15. Back to basics: an evaluation of NaOH and alternative rapid DNA extraction protocols for DNA barcoding, genotyping, and disease diagnostics from fungal and oomycete samples.

    Science.gov (United States)

    Osmundson, Todd W; Eyre, Catherine A; Hayden, Katherine M; Dhillon, Jaskirn; Garbelotto, Matteo M

    2013-01-01

    The ubiquity, high diversity and often-cryptic manifestations of fungi and oomycetes frequently necessitate molecular tools for detecting and identifying them in the environment. In applications including DNA barcoding, pathogen detection from plant samples, and genotyping for population genetics and epidemiology, rapid and dependable DNA extraction methods scalable from one to hundreds of samples are desirable. We evaluated several rapid extraction methods (NaOH, Rapid one-step extraction (ROSE), Chelex 100, proteinase K) for their ability to obtain DNA of quantity and quality suitable for the following applications: PCR amplification of the multicopy barcoding locus ITS1/5.8S/ITS2 from various fungal cultures and sporocarps; single-copy microsatellite amplification from cultures of the phytopathogenic oomycete Phytophthora ramorum; probe-based P. ramorum detection from leaves. Several methods were effective for most of the applications, with NaOH extraction favored in terms of success rate, cost, speed and simplicity. Frozen dilutions of ROSE and NaOH extracts maintained PCR viability for over 32 months. DNA from rapid extractions performed poorly compared to CTAB/phenol-chloroform extracts for TaqMan diagnostics from tanoak leaves, suggesting that incomplete removal of PCR inhibitors is an issue for sensitive diagnostic procedures, especially from plants with recalcitrant leaf chemistry. NaOH extracts exhibited lower yield and size than CTAB/phenol-chloroform extracts; however, NaOH extraction facilitated obtaining clean sequence data from sporocarps contaminated by other fungi, perhaps due to dilution resulting from low DNA yield. We conclude that conventional extractions are often unnecessary for routine DNA sequencing or genotyping of fungi and oomycetes, and recommend simpler strategies where source materials and intended applications warrant such use. © 2012 Blackwell Publishing Ltd.

  16. Rapid Mass Spectrometric Analysis of a Novel Fucoidan, Extracted from the Brown Alga Coccophora langsdorfii

    Directory of Open Access Journals (Sweden)

    Stanislav D. Anastyuk

    2014-01-01

    Full Text Available The novel highly sulfated (35% fucoidan fraction Cf2 , which contained, along with fucose, galactose and traces of xylose and uronic acids was purified from the brown alga Coccophora langsdorfii. Its structural features were predominantly determined (in comparison with fragments of known structure by a rapid mass spectrometric investigation of the low-molecular-weight fragments, obtained by “mild” (5 mg/mL and “exhaustive” (maximal concentration autohydrolysis. Tandem matrix-assisted laser desorption/ionization mass spectra (MALDI-TOF/TOFMS of fucooligosaccharides with even degree of polymerization (DP, obtained by “mild” autohydrolysis, were the same as that observed for fucoidan from Fucus evanescens, which have a backbone of alternating (1 → 3- and (1 → 4 linked sulfated at C-2 and sometimes at C-4 of 3-linked α-L-Fucp residues. Fragmentation patterns of oligosaccharides with odd DP indicated sulfation at C-2 and at C-4 of (1 → 3 linked α-L-Fucp residues on the reducing terminus. Minor sulfation at C-3 was also suggested. The “exhaustive” autohydrolysis allowed us to observe the “mixed” oligosaccharides, built up of fucose/xylose and fucose/galactose. Xylose residues were found to occupy both the reducing and nonreducing termini of FucXyl disaccharides. Nonreducing galactose residues as part of GalFuc disaccharides were found to be linked, possibly, by 2-type of linkage to fucose residues and were found to be sulfated, most likely, at position C-2.

  17. Lipophilic extractives from several nonwoody lignocellulosic crops (flax, hemp, sisal, abaca) and their fate during alkaline pulping and TCF/ECF bleaching.

    Science.gov (United States)

    Marques, Gisela; del Río, José C; Gutiérrez, Ana

    2010-01-01

    The fate of lipophilic extractives from several nonwoody species (flax, hemp, sisal and abaca) used for the manufacturing of cellulose pulps, was studied during soda/anthraquinone (AQ) pulping and totally chorine free (TCF) and elemental chlorine free (ECF) bleaching. With this purpose, the lipophilic extracts from the raw materials and their unbleached and bleached industrial pulps, were analyzed by gas chromatography-mass spectrometry. Aldehydes, hydroxyfatty acids and esterified compounds such as ester waxes, sterol esters and alkylferulates strongly decreased after soda/AQ pulping while alkanes, alcohols, free sterols and sterol glycosides survived the cooking process. Among the lipophilic extractives that remained in the unbleached pulps, some amounts of free sterols were still present in the TCF pulps whereas they were practically absent in the ECF pulps. Sterol glycosides were also removed after both TCF and ECF bleaching. By contrast, saturated fatty acids, fatty alcohols and alkanes were still present in both bleached pulps.

  18. Rapid and simple purification of elastin-like polypeptides directly from whole cells and cell lysates by organic solvent extraction.

    Science.gov (United States)

    VerHeul, Ross; Sweet, Craig; Thompson, David H

    2018-03-26

    Elastin-like polypeptides (ELP) are a well-known class of proteins that are being increasingly utilized in a variety of biomedical applications, due to their beneficial physicochemical properties. A unifying feature of ELP is their demonstration of a sequence tunable inverse transition temperature (Tt) that enables purification using a simple, straightforward process called inverse transition cycling (ITC). Despite the utility of ITC, the process is inherently limited to ELP with an experimentally accessible Tt. Since the underlying basis for the ELP Tt is related to its high overall hydrophobicity, we anticipated that ELP would be excellent candidates for purification by organic extraction. We report the first method for rapidly purifying ELP directly from whole E. coli cells or clarified lysates using pure organic solvents and solvent mixtures, followed by aqueous back extraction. Our results show that small ELP and a large ELP-fusion protein can be isolated in high yield from whole cells or cell lysates with greater than 95% purity in less than 30 min and with very low levels of LPS and DNA contamination.

  19. Rapid Extraction of Landslide and Spatial Distribution Analysis after Jiuzhaigou Ms7.0 Earthquake Based on Uav Images

    Science.gov (United States)

    Jiao, Q. S.; Luo, Y.; Shen, W. H.; Li, Q.; Wang, X.

    2018-04-01

    Jiuzhaigou earthquake led to the collapse of the mountains and formed lots of landslides in Jiuzhaigou scenic spot and surrounding roads which caused road blockage and serious ecological damage. Due to the urgency of the rescue, the authors carried unmanned aerial vehicle (UAV) and entered the disaster area as early as August 9 to obtain the aerial images near the epicenter. On the basis of summarizing the earthquake landslides characteristics in aerial images, by using the object-oriented analysis method, landslides image objects were obtained by multi-scale segmentation, and the feature rule set of each level was automatically built by SEaTH (Separability and Thresholds) algorithm to realize the rapid landslide extraction. Compared with visual interpretation, object-oriented automatic landslides extraction method achieved an accuracy of 94.3 %. The spatial distribution of the earthquake landslide had a significant positive correlation with slope and relief and had a negative correlation with the roughness, but no obvious correlation with the aspect. The relationship between the landslide and the aspect was not found and the probable reason may be that the distance between the study area and the seismogenic fault was too far away. This work provided technical support for the earthquake field emergency, earthquake landslide prediction and disaster loss assessment.

  20. RAPID EXTRACTION OF LANDSLIDE AND SPATIAL DISTRIBUTION ANALYSIS AFTER JIUZHAIGOU Ms7.0 EARTHQUAKE BASED ON UAV IMAGES

    Directory of Open Access Journals (Sweden)

    Q. S. Jiao

    2018-04-01

    Full Text Available Jiuzhaigou earthquake led to the collapse of the mountains and formed lots of landslides in Jiuzhaigou scenic spot and surrounding roads which caused road blockage and serious ecological damage. Due to the urgency of the rescue, the authors carried unmanned aerial vehicle (UAV and entered the disaster area as early as August 9 to obtain the aerial images near the epicenter. On the basis of summarizing the earthquake landslides characteristics in aerial images, by using the object-oriented analysis method, landslides image objects were obtained by multi-scale segmentation, and the feature rule set of each level was automatically built by SEaTH (Separability and Thresholds algorithm to realize the rapid landslide extraction. Compared with visual interpretation, object-oriented automatic landslides extraction method achieved an accuracy of 94.3 %. The spatial distribution of the earthquake landslide had a significant positive correlation with slope and relief and had a negative correlation with the roughness, but no obvious correlation with the aspect. The relationship between the landslide and the aspect was not found and the probable reason may be that the distance between the study area and the seismogenic fault was too far away. This work provided technical support for the earthquake field emergency, earthquake landslide prediction and disaster loss assessment.

  1. Rapid analysis of carbohydrates in aqueous extracts and hydrolysates of biomass using a carbonate-modified anion-exchange column.

    Science.gov (United States)

    Sevcik, Richard S; Mowery, Richard A; Becker, Christopher; Chambliss, C Kevin

    2011-03-04

    Quantitative liquid-chromatography techniques used to characterize carbohydrates present in biomass samples can suffer from long analysis times, limited analyte resolution, poor stability, or a combination of these factors. The current manuscript details a novel procedure enabling resolution of glucose, xylose, arabinose, galactose, mannose, fructose, and sucrose via isocratic elution in less than 5 min. Equivalent conditions also enable analysis of cellobiose and maltose with a minimal increase in chromatographic run time (ca. 3 and 6 min, respectively). Noted chromatographic performance requires that a commercially available anion-exchange column be modified with carbonate prior to analysis. Analytical performance of a modified column was assessed over a 5-day period via repeated analyses of 4 samples, resulting from aqueous extraction or quantitative saccharification of a potential biofuel feedstock (i.e., corn stover or switchgrass). A simple solid phase extraction procedure was utilized to clean up each sample prior to analysis. Analytical accuracy of the extraction protocol was assessed by evaluation of matrix spike recoveries which typically ranged from 84% to 98%. The instrumental variability of measured concentrations in real samples over the 5-day period was generally less than 5% RSD for all detected analytes, independent of sample type. Finally, it is important to note that the modified column exhibited exceptional stability over approximately 800 injections of biofeedstock-based samples. These data demonstrate that a carbonate-modified anion-exchange column can be employed for rapid determination of carbohydrates in biomass samples of lignocellulosic origin. Copyright © 2011 Elsevier B.V. All rights reserved.

  2. Application of alkaline leaching to the extraction of uranium from shale of the Vosges; Application de la lixiviation alcaline a l'extraction de l'uranium du schiste des Vosges

    Energy Technology Data Exchange (ETDEWEB)

    Mouret, P; Pottier, P; Le Bris, J [Commissariat a l' Energie Atomique, Saclay (France). Centre d' Etudes Nucleaires; Soudan, P [Centre d' Etude de Lalumine, Compagnie Pechiney (France)

    1958-07-01

    Description of chemical treatment of Vosges shales to obtain uranium by alkaline leaching. Mineralogy aspects of ore, physical and chemical conditions of leaching, solid/liquid separation, uranium recovery by either ion exchange process or electrolytic precipitation. (author)Fren. [French] Description du traitement chimique des schistes des Vosges pour extraire l'uranium en milieu alcalin. L'aspect mineralogique, les conditions physiques et chimiques de la lixiviation, la separation solide/liquide et la recuperation de l'uranium soit par echangeurs d'ions, soit par precipitation electrolytique y sont exposes. (auteur)

  3. A rapid, solid phase extraction (SPE technique for the extraction and gas chromatographic determination lindane pesticide residue in tissue and milk

    Directory of Open Access Journals (Sweden)

    Yuningsih

    2006-03-01

    Full Text Available Organochlorine pesticide contamination in feed can cause residue in animal product (tissue and milk, so its become a problem in food safety. Solid phase extraction (SPE has been carried out for determination organochlorine pesticide residues in food animal production. The technique was rapid, not costly and produce limited amount of hazardous-waste. Samples were homogenized with acetonitrile trough cartridge C18, eluted in fluorocyl column with 2% ether-petroleum or acetonitrile fortissue and milk samples respectively. The recoveries of tissue sample by addition lindane standard solution: 0.50 and 1.00 μg are 85.10 and 103.10% respectively, while that of milk with the addition of 0.50, 1.00 and 1.50 μg are 83.80, 88.69 and 91.24% respectively. Three replicates were carried out for every sample. According of validation criteria of FAO/IAEA the recovery for analysis of pesticide residues was 70-110%. Therefore, the method is applicable.

  4. A rapid supercritical fluid extraction method for the qualitative detection of 2-alkylcyclobutanones in gamma-irradiated fresh and sea water fish

    International Nuclear Information System (INIS)

    Tewfik, I.H.; Ismail, H.M.; Sumar, S.

    1999-01-01

    2-Alkylcyclobutanones are routinely used as chemical markers for irradiated foods containing lipids. However, current extraction procedures (soxhlet-Florisil chromatography) for the isolation of these markers involve a long and tedious clean-up regime prior to GC-MS identification. A simple and rapid method for the isolation of these markers using carbon dioxide as a super critical fluid is described for low lipid content fish samples (fresh and sea water) irradiated up to 8kGy. The presence of 2-dodecylcyclobutanone (2-DCB), a radiolytic marker, was confirmed in all irradiated fish samples at all doses. This was a clear indication that the fish samples had been irradiated and that both methods of isolation (florisil and supercritical fluid extraction) were capable of qualitatively extracting this marker. Supercritical fluid extraction is proposed as an alternative extraction procedure to the florisil chromatography method currently in use and has the added advantage of a considerably shorter extraction time

  5. Rapid extraction combined with LC-tandem mass spectrometry (CREM-LC/MS/MS) for the determination of ciguatoxins in ciguateric fish flesh.

    Science.gov (United States)

    Lewis, Richard J; Yang, Aijun; Jones, Alun

    2009-07-01

    Ciguatera is a significant food borne disease caused by potent polyether toxins known as ciguatoxins, which accumulate in the flesh of ciguateric fish at risk levels above 0.1 ppb. The management of ciguatera has been hindered by the lack of analytical methods to detect and quantify clinically relevant levels of ciguatoxin in easily prepared crude extracts of fish. Here we report a ciguatoxin rapid extraction method (CREM) that allows the rapid preparation of fish flesh extracts for the detection and quantification of ciguatoxin by gradient reversed-phase liquid chromatography-tandem mass spectrometry (LC/MS/MS). CREM-LC/MS/MS delivers a linear response to P-CTX-1 spiked into fish prior to extraction. A similar response was obtained for P-CTX-1 spiked after extraction, indicating >95% extraction efficiency was achieved overall and 85% at the limit of quantification (0.1 ppb). Using this approach, levels >or=0.1 ppb P-CTX-1 could be detected and quantified from an extract of 2g fish flesh, making it suitable as a confirmatory assay for suspect ciguateric carnivorous fish in the Pacific Ocean. The approach is designed to simplify the extraction and analysis of multiple samples per day.

  6. A Rapid and Reproducible Genomic DNA Extraction Protocol for Sequence-Based Identification of Archaea, Bacteria, Cyanobacteria, Diatoms, Fungi, and Green Algae

    OpenAIRE

    Farkhondeh Saba; Moslem Papizadeh; Javad Khansha; Mahshid Sedghi; Mehrnoosh Rasooli; Mohammad Ali Amoozegar; Mohammad Reza Soudi; Seyed Abolhassan Shahzadeh Fazeli

    2016-01-01

    Background:  Sequence-based identification of various microorganisms including Archaea, Bacteria, Cyanobacteria, Diatoms, Fungi, and green algae necessitates an efficient and reproducible genome extraction procedure though which a pure template DNA is yielded and it can be used in polymerase chain reactions (PCR). Considering the fact that DNA extraction from these microorganisms is time consuming and laborious, we developed and standardized a safe, rapid and inexpensive miniprep protocol. Me...

  7. Rapid, specific determination of iodine and iodide by combined solid-phase extraction/diffuse reflectance spectroscopy

    Science.gov (United States)

    Arena, Matteo P.; Porter, Marc D.; Fritz, James S.

    2002-01-01

    A new, rapid methodology for trace analysis using solid-phase extraction is described. The two-step methodology is based on the concentration of an analyte onto a membrane disk and on the determination by diffuse reflectance spectroscopy of the amount of analyte extracted on the disk surface. This method, which is adaptable to a wide range of analytes, has been used for monitoring ppm levels of iodine and iodide in spacecraft water. Iodine is used as a biocide in spacecraft water. For these determinations, a water sample is passed through a membrane disk by means of a 10-mL syringe that is attached to a disk holder assembly. The disk, which is a polystyrene-divinylbenzene composite, is impregnated with poly(vinylpyrrolidone) (PVP), which exhaustively concentrates iodine as a yellow iodine-PVP complex. The amount of concentrated iodine is then determined in only 2 s by using a hand-held diffuse reflectance spectrometer by comparing the result with a calibration curve based on the Kubelka-Munk function. The same general procedure can be used to determine iodide levels after its facile and exhaustive oxidation to iodine by peroxymonosulfate (i.e., Oxone reagent). For samples containing both analytes, a two-step procedure can be used in which the iodide concentration is calculated from the difference in iodine levels before and after treatment of the sample with peroxymonosulfate. With this methodology, iodine and iodide levels in the 0.1-5.0 ppm range can be determined with a total workup time of approximately 60 s with a RSD of approximately 6%.

  8. Screening of 23 β-lactams in foodstuffs by LC-MS/MS using an alkaline QuEChERS-like extraction.

    Science.gov (United States)

    Bessaire, Thomas; Mujahid, Claudia; Beck, Andrea; Tarres, Adrienne; Savoy, Marie-Claude; Woo, Pei-Mun; Mottier, Pascal; Desmarchelier, Aurélien

    2018-04-01

    A fast and robust high performance LC-MS/MS screening method was developed for the analysis of β-lactam antibiotics in foods of animal origin: eggs, raw milk, processed dairy ingredients, infant formula, and meat- and fish-based products including baby foods. QuEChERS extraction with some adaptations enabled 23 drugs to be simultaneously monitored. Screening target concentrations were set at levels adequate to ensure compliance with current European, Chinese, US and Canadian regulations. The method was fully validated according to the European Community Reference Laboratories Residues Guidelines using 93 food samples of different composition. False-negative and false-positive rates were below 5% for all analytes. The method is adequate for use in high-routine laboratories. A 1-year study was additionally conducted to assess the stability of the 23 analytes in the working standard solution.

  9. Distribution of Plasmodium species on the island of Grande Comore on the basis of DNA extracted from rapid diagnostic tests

    Directory of Open Access Journals (Sweden)

    Papa Mze Nasserdine

    2016-01-01

    Full Text Available In the Union of Comoros, interventions for combating malaria have contributed to a spectacular decrease in the prevalence of the disease. We studied the current distribution of Plasmodium species on the island of Grande Comore using nested PCR. The rapid diagnostic tests (RDTs currently used in the Comoros are able to identify Plasmodium falciparum but no other Plasmodium species. In this study, we tested 211 RDTs (158 positive and 53 negative. Among the 158 positive RDTs, 22 were positive for HRP2, 3 were positive only for pLDH, and 133 were positive for HRP2 and pLDH. DNA was extracted from a proximal part of the nitrocellulose membrane of RDTs. A total of 159 samples were positive by nested PCR. Of those, 156 (98.11% were positive for P. falciparum, 2 (1.25% were positive for P. vivaxI, and 1 (0.62% was positive for P. malariae. None of the samples were positive for P. ovale. Our results show that P. falciparum is still the most dominant species on the island of Grande Comore, but P. vivax and P. malariae are present at a low prevalence.

  10. Monitoring sea lamprey pheromones and their degradation using rapid stream-side extraction coupled with UPLC-MS/MS

    Science.gov (United States)

    Wang, Huiyong; Johnson, Nicholas; Bernardy, Jeffrey; Hubert, Terry; Li, Weiming

    2013-01-01

    Pheromones guide adult sea lamprey (Petromyzon marinus) to suitable spawning streams and mates, and therefore, when quantified, can be used to assess population size and guide management. Here, we present an efficient sample preparation method where 100 mL of river water was spiked with deuterated pheromone as an internal standard and underwent rapid field-based SPE and elution in the field. The combination of field extraction with laboratory UPLC-MS/MS reduced the sample consumption from 1 to 0.1 L, decreased the sample process time from more than 1 h to 10 min, and increased the precision and accuracy. The sensitivity was improved more than one order of magnitude compared with the previous method. The influences of experimental conditions were assessed to optimize the separation and peak shapes. The analytical method has been validated by studies of stability, selectivity, precision, and linearity and by the determination of the limits of detection and quantification. The method was used to quantify pheromone concentration from five streams tributary to Lake Ontario and to estimate that the environmental half-life of 3kPZS is about 26 h.

  11. Lab-on-capillary: a rapid, simple and quantitative genetic analysis platform integrating nucleic acid extraction, amplification and detection.

    Science.gov (United States)

    Fu, Yu; Zhou, Xiaoming; Xing, Da

    2017-12-05

    In this work, we describe for the first time a genetic diagnosis platform employing a polydiallyldimethylammonium chloride (PDDA)-modified capillary and a liquid-based thermalization system for rapid, simple and quantitative DNA analysis with minimal user interaction. Positively charged PDDA is modified on the inner surface of the silicon dioxide capillary by using an electrostatic self-assembly approach that allows the negatively charged DNA to be separated from the lysate in less than 20 seconds. The capillary loaded with the PCR mix is incorporated in the thermalization system, which can achieve on-site real-time PCR. This system is based on the circulation of pre-heated liquids in the chamber, allowing for high-speed thermalization of the capillary and fast amplification. Multiple targets can be simultaneously analysed with multiplex spatial melting. Starting with live Escherichia coli (E. coli) cells in milk, as a realistic sample, the current method can achieve DNA extraction, amplification, and detection within 40 min.

  12. Facile and rapid DNA extraction and purification from food matrices using IFAST (immiscible filtration assisted by surface tension).

    Science.gov (United States)

    Strotman, Lindsay N; Lin, Guangyun; Berry, Scott M; Johnson, Eric A; Beebe, David J

    2012-09-07

    Extraction and purification of DNA is a prerequisite to detection and analytical techniques. While DNA sample preparation methods have improved over the last few decades, current methods are still time consuming and labor intensive. Here we demonstrate a technology termed IFAST (Immiscible Filtration Assisted by Surface Tension), that relies on immiscible phase filtration to reduce the time and effort required to purify DNA. IFAST replaces the multiple wash and centrifugation steps required by traditional DNA sample preparation methods with a single step. To operate, DNA from lysed cells is bound to paramagnetic particles (PMPs) and drawn through an immiscible fluid phase barrier (i.e. oil) by an external handheld magnet. Purified DNA is then eluted from the PMPs. Here, detection of Clostridium botulinum type A (BoNT/A) in food matrices (milk, orange juice), a bioterrorism concern, was used as a model system to establish IFAST's utility in detection assays. Data validated that the DNA purified by IFAST was functional as a qPCR template to amplify the bont/A gene. The sensitivity limit of IFAST was comparable to the commercially available Invitrogen ChargeSwitch® method. Notably, pathogen detection via IFAST required only 8.5 μL of sample and was accomplished in five-fold less time. The simplicity, rapidity and portability of IFAST offer significant advantages when compared to existing DNA sample preparation methods.

  13. Measurement of 90Sr radioactivity in a rapid method of strontium estimation by solvent extraction with dicarbollides

    International Nuclear Information System (INIS)

    Svoboda, K.; Kyrs, M.

    1994-01-01

    The application of liquid scintillation counting to the measurement of 90 Sr radioactivity was studied, using a previously published rapid method of strontium separation, based on solvent extraction with a solution of cobalt dicarbollide and Slovafol 909 in a nitrobenzene-carbon tetrachloride mixture and subsequent stripping of strontium with a 0.15 M Chelaton IV (CDTA) solution at pH 10.2. With liquid scintillation counting, a more efficient elimination of the effect of 90 Y β-activity on 90 Sr counting is possible than when measuring the evaporated aliquot with the use of a solid scintillator. The adverse effect of traces of dicarbollide, nitrobenzene, and CCl 4 passed over in the aqueous 90 Sr solution prepared for counting, is caused by the (poorly reproducible) shift of the 90 Sr + 90 Y β-radiation spectral curve towards lower energies, the so-called quenching. The shift is independent of the aqueous phase concentration of the organic compounds mentioned. They can be removed by shaking the aqueous reextract with an equal volume of octanol or amyl acetate so that the undesirable spectral shift does not occur. No loss of strontium was found in this washing procedure. (author) 2 tabs., 6 figs., 5 refs

  14. Development of rapid bioconversion with integrated recycle technology for ethanol production from extractive ammonia pretreated corn stover.

    Science.gov (United States)

    Jin, Mingjie; Liu, Yanping; da Costa Sousa, Leonardo; Dale, Bruce E; Balan, Venkatesh

    2017-08-01

    High enzyme loading and low productivity are two major issues impeding low cost ethanol production from lignocellulosic biomass. This work applied rapid bioconversion with integrated recycle technology (RaBIT) and extractive ammonia (EA) pretreatment for conversion of corn stover (CS) to ethanol at high solids loading. Enzymes were recycled via recycling unhydrolyzed solids. Enzymatic hydrolysis with recycled enzymes and fermentation with recycled yeast cells were studied. Both enzymatic hydrolysis time and fermentation time were shortened to 24 h. Ethanol productivity was enhanced by two times and enzyme loading was reduced by 30%. Glucan and xylan conversions reached as high as 98% with an enzyme loading of as low as 8.4 mg protein per g glucan. The overall ethanol yield was 227 g ethanol/kg EA-CS (191 g ethanol/kg untreated CS). Biotechnol. Bioeng. 2017;114: 1713-1720. © 2017 Wiley Periodicals, Inc. © 2017 Wiley Periodicals, Inc.

  15. Rapid determination of volatile constituents in safflower from Xinjiang and Henan by ultrasonic-assisted solvent extraction and GC–MS

    Directory of Open Access Journals (Sweden)

    Ling-Han Jia

    2011-08-01

    Full Text Available The total volatile components were extracted from safflower by ultrasonic-assisted solvent extraction (USE and their chemical constituents were analyzed by gas chromatography–mass spectrometry (GC–MS to provide scientific basis for the quality control of safflower. Five different solvents (diethyl ether, ethanol, ethyl acetate, dichloromethane and acetone were used and compared in terms of number of volatile components extracted and the peak areas of these components in TIC. The results showed that USE could be used as an efficient and rapid method for extracting the volatile components from safflower. It also could be found that the number of components in the TIC of ethyl acetate extract was more than that in the TIC of other solvent ones. Meanwhile, the volatile components of safflower from Xinjiang Autonomous Region and Henan Province of China were different in chemical components and relative contents. It could be concluded that both the extraction solvents and geographical origin of safflower are responsible for these differences. The experimental results also indicated that USE/GC–MS is a simple, rapid and effective method to analyze the volatile oil components of safflower. Keywords: Safflower, Ultrasonic solvent extraction, Gas chromatography–mass spectrometry (GC–MS

  16. Biomass production on saline-alkaline soils

    Energy Technology Data Exchange (ETDEWEB)

    Chaturvedi, A.N.

    1985-01-01

    In a trial of twelve tree species (both nitrogen fixing and non-fixing) for fuel plantations on saline-alkaline soil derived from Gangetic alluvium silty clay, Leucaena leucocephala failed completely after showing rapid growth for six months. Results for other species at age two showed that Prosopis juliflora had the best productivity.

  17. Isocratic Solid Phase Extraction-Liquid Chromatography (SPE-LC) Interfaced to High-Performance Tandem Mass Spectrometry for Rapid Protein Identification

    DEFF Research Database (Denmark)

    Hørning, Ole B; Kjeldsen, Frank; Theodorsen, Søren

    2008-01-01

    the isocratic solid phase extraction-liquid chromatography (SPE-LC) technology for rapid separation ( approximately 8 min) of simple peptide samples. We now extend these studies to demonstrate the potential of SPE-LC separation in combination with a hybrid linear ion trap-Orbitrap tandem mass spectrometer...

  18. EXTRACT

    DEFF Research Database (Denmark)

    Pafilis, Evangelos; Buttigieg, Pier Luigi; Ferrell, Barbra

    2016-01-01

    The microbial and molecular ecology research communities have made substantial progress on developing standards for annotating samples with environment metadata. However, sample manual annotation is a highly labor intensive process and requires familiarity with the terminologies used. We have the...... and text-mining-assisted curation revealed that EXTRACT speeds up annotation by 15-25% and helps curators to detect terms that would otherwise have been missed.Database URL: https://extract.hcmr.gr/......., organism, tissue and disease terms. The evaluators in the BioCreative V Interactive Annotation Task found the system to be intuitive, useful, well documented and sufficiently accurate to be helpful in spotting relevant text passages and extracting organism and environment terms. Comparison of fully manual...

  19. Uranium in alkaline rocks

    International Nuclear Information System (INIS)

    Murphy, M.; Wollenberg, H.; Strisower, B.; Bowman, H.; Flexser, S.; Carmichael, I.

    1978-04-01

    Geologic and geochemical criteria were developed for the occurrence of economic uranium deposits in alkaline igneous rocks. A literature search, a limited chemical analytical program, and visits to three prominent alkaline-rock localities (Ilimaussaq, Greenland; Pocos de Caldas, Brazil; and Powderhorn, Colorado) were made to establish criteria to determine if a site had some uranium resource potential. From the literature, four alkaline-intrusive occurrences of differing character were identified as type-localities for uranium mineralization, and the important aspects of these localities were described. These characteristics were used to categorize and evaluate U.S. occurrences. The literature search disclosed 69 U.S. sites, encompassing nepheline syenite, alkaline granite, and carbonatite. It was possible to compare two-thirds of these sites to the type localities. A ranking system identified ten of the sites as most likely to have uranium resource potential

  20. Uranium in alkaline rocks

    Energy Technology Data Exchange (ETDEWEB)

    Murphy, M.; Wollenberg, H.; Strisower, B.; Bowman, H.; Flexser, S.; Carmichael, I.

    1978-04-01

    Geologic and geochemical criteria were developed for the occurrence of economic uranium deposits in alkaline igneous rocks. A literature search, a limited chemical analytical program, and visits to three prominent alkaline-rock localities (Ilimaussaq, Greenland; Pocos de Caldas, Brazil; and Powderhorn, Colorado) were made to establish criteria to determine if a site had some uranium resource potential. From the literature, four alkaline-intrusive occurrences of differing character were identified as type-localities for uranium mineralization, and the important aspects of these localities were described. These characteristics were used to categorize and evaluate U.S. occurrences. The literature search disclosed 69 U.S. sites, encompassing nepheline syenite, alkaline granite, and carbonatite. It was possible to compare two-thirds of these sites to the type localities. A ranking system identified ten of the sites as most likely to have uranium resource potential.

  1. A solid-phase extraction method for rapidly determining the adsorption coefficient of pharmaceuticals in sewage sludge

    Science.gov (United States)

    Berthod, Laurence; Roberts, Gary; Whitley, David C.; Sharpe, Alan; Mills, Graham A.

    2014-01-01

    The partitioning of pharmaceuticals in the environment can be assessed by measuring their adsorption coefficients (Kd) between aqueous and solid phases. Measuring this coefficient in sewage sludge gives an indication of their partitioning behaviour in a wastewater treatment plant and hence contributes to an understanding of their subsequent fate. The regulatory approved method for measuring Kd in sewage sludge is the US Environmental Protection Agency's Office of Prevention, Pesticides and Toxic Substances (OPPTS) guideline 835.1110, which is labour intensive and time consuming. We describe an alternative method for measuring the Kd of pharmaceuticals in sewage sludge using a modified solid-phase extraction (SPE) technique. SPE cartridges were packed at different sludge/PTFE ratios (0.4, 6.0, 24.0 and 40.0% w/w sludge) and eluted with phosphate buffer at pH 7.4. The approach was tested initially using three pharmaceuticals (clofibric acid, diclofenac and oxytetracycline) that covered a range of Kd values. Subsequently, the sorption behaviour of ten further pharmaceuticals with varying physico-chemical properties was evaluated. Results from the SPE method were comparable to those of the OPPTS test, with a correlation coefficient of 0.93 between the two approaches. SPE cartridges packed with sludge and PTFE were stable for up to one year; use within one month reduced variability in measurements (to a maximum of 0.6 log units). The SPE method is low-cost, easy to use and enables the rapid measurement of Kd values for a large number of chemicals. It can be used as an alternative to the more laborious full OPPTS test in environmental fate studies and risk assessments. PMID:25299795

  2. Bead Injection Extraction Chromatography using High-capacity Lab-on-Valve as a Front End to Inductively Coupled Plasma Mass Spectrometry for Rapid Urine Radiobioassay

    DEFF Research Database (Denmark)

    Qiao, Jixin; Hou, Xiaolin; Roos, Per

    2013-01-01

    A novel bead injection (BI) extraction chromatographic microflow system exploiting high-capacity lab-on-valve (LOV) platform coupled with inductively coupled plasma mass spectrometric detection is developed for rapid and automated determination of plutonium in human urine. A microconduit (1 m......L) incorporated within the LOV processing unit is loaded on-line with a metered amount of disposable extraction chromatographic resin (up to 330 mg of TEVA) through programmable beads transport. Selective capture and purification of plutonium onto the resin beads is then performed by pressure driven flow after...

  3. ALKALINE CARBONATE LEACHING PROCESS FOR URANIUM EXTRACTION

    Science.gov (United States)

    Thunaes, A.; Brown, E.A.; Rabbitts, A.T.

    1957-11-12

    A process for the leaching of uranium from high carbonate ores is presented. According to the process, the ore is leached at a temperature of about 200 deg C and a pressure of about 200 p.s.i.g. with a solution containing alkali carbonate, alkali permanganate, and bicarbonate ion, the bicarbonate ion functionlng to prevent premature formation of alkali hydroxide and consequent precipitation of a diuranate. After the leaching is complete, the uranium present is recovered by precipitation with NaOH.

  4. Alkaline earth metals

    International Nuclear Information System (INIS)

    Brown, Paul L.; Ekberg, Christian

    2016-01-01

    The beryllium ion has a relatively small ionic radius. As a consequence of this small size, its hydrolysis reactions begin to occur at a relatively low pH. To determine the stability and solubility constants, however, the Gibbs energy of the beryllium ion is required. In aqueous solution calcium, like the other alkaline earth metals, only exists as a divalent cation. The size of the alkaline earth cations increases with increasing atomic number, and the calcium ion is bigger than the magnesium ion. The hydrolysis of barium(II) is weaker than that of strontium(II) and also occurs in quite alkaline pH solutions, and similarly, only the species barium hydroxide has been detected. There is only a single experimental study on the hydrolysis of radium. As with the stability constant trend, it would be expected that the enthalpy of radium would be lower than that of barium due to the larger ionic radius.

  5. Advanced alkaline water electrolysis

    International Nuclear Information System (INIS)

    Marini, Stefania; Salvi, Paolo; Nelli, Paolo; Pesenti, Rachele; Villa, Marco; Berrettoni, Mario; Zangari, Giovanni; Kiros, Yohannes

    2012-01-01

    A short review on the fundamental and technological issues relevant to water electrolysis in alkaline and proton exchange membrane (PEM) devices is given. Due to price and limited availability of the platinum group metal (PGM) catalysts they currently employ, PEM electrolyzers have scant possibilities of being employed in large-scale hydrogen production. The importance and recent advancements in the development of catalysts without PGMs are poised to benefit more the field of alkaline electrolysis rather than that of PEM devices. This paper presents our original data which demonstrate that an advanced alkaline electrolyzer with performances rivaling those of PEM electrolyzers can be made without PGM and with catalysts of high stability and durability. Studies on the advantages/limitations of electrolyzers with different architectures do show how a judicious application of pressure differentials in a recirculating electrolyte scheme helps reduce mass transport limitations, increasing efficiency and power density.

  6. Rapid magnetic solid-phase extraction based on monodisperse magnetic single-crystal ferrite nanoparticles for the determination of free fatty acid content in edible oils.

    Science.gov (United States)

    Wei, Fang; Zhao, Qin; Lv, Xin; Dong, Xu-Yan; Feng, Yu-Qi; Chen, Hong

    2013-01-09

    This study proposes a rapid magnetic solid-phase extraction (MSPE) based on monodisperse magnetic single-crystal ferrite (Fe(3)O(4)) nanoparticles (NPs) for determining the quantities of eight free fatty acids (FFAs), including palmitic acid (C16:0), stearic acid (C18:0), oleic acid (C18:1), linoleic acid (C18:2), linolenic acid (C18:3), arachidic acid (C20:0), eicosenoic acid (C20:1), and behenic acid (C22:0) in oil. The amine-functionalized mesoporous Fe(3)O(4) magnetic NPs were applied as a sorbent for MSPE of FFAs from oil samples in a process that is based on hydrophilic interaction. The extraction can be completed rapidly in a dispersive mode with the aid of vigorous vortex. Additional tedious processing steps such as centrifugation and evaporation of organic solvent were not necessary with this procedure. Furthermore, esterification of FFAs can be accomplished during the desorption procedure by using methanol/sulfuric acid (99:1, v/v) as the desorption solvent. Several parameters affecting the extraction efficiency were investigated, including the matrix solvent for extraction, the desorption solvent and desorption time, and the amount of sorbent and extraction time. The pretreatment process was rapid under optimal conditions, being accomplished within 15 min. When coupled with gas chromatography-flame ionization detection (GC-FID), a rapid, simple, and convenient MSPE-GC-FID method for the determination of FFAs in oil samples was established with a total analysis time within 25 min. The limits of detection for the target FFAs were found to be 7.22-26.26 ng/mL. Recoveries in oil samples were in the range of 81.33-117.75%, with RSDs of <6.4% (intraday) and <6.9% (interday). This method was applied successfully to the analysis of dynamic FFA formation in four types of edible oils subjected to an accelerated storage test. The simple, rapid, and cost-effective method developed in the current study offers a potential application for the extraction and

  7. Rapid evaluation and comparison of natural products and antioxidant activity in calendula, feverfew, and German chamomile extracts.

    Science.gov (United States)

    Agatonovic-Kustrin, Snezana; Babazadeh Ortakand, Davoud; Morton, David W; Yusof, Ahmad P

    2015-03-13

    The present study describes a simple high performance thin layer chromatographic (HPTLC) method for the simultaneous quantification of apigenin, chamazulene, bisabolol and the use of DPPH free radical as a post-chromatographic derivatization agent to compare the free radical scavenging activities of these components in leaf and flower head extracts from feverfew, German chamomile and marigold from the Asteraceae family. Feverfew (Tanacetum parthenium) leaves have been traditionally used in the treatment of migraine with parthenolide being the main bioactive compound. However, due to similar flowers, feverfew is sometimes mistaken for the German chamomile (Matricaria recutita). Bisabolol and chamazulene are the main components in chamomile essential oil. Marigold (Calendula officinalis) was included in the study for comparison, as it belongs to the same family. Parthenolide was found to be present in all leaf extracts but was not detected in calendula flower extract. Chamazulene and bisabolol were found to be present in higher concentrations in chamomile and Calendula flowers. Apigenin was detected and quantified only in chamomile extracts (highest concentration in flower head extracts). Antioxidant activity in sample extracts was compared by superimposing the chromatograms obtained after post-chromatographic derivatization with DPPH and post-chromatographic derivatization with anisaldehyde. It was found that extracts from chamomile flower heads and leaves have the most prominent antioxidant activity, with bisabolol and chamazulene being the most effective antioxidants. Crown Copyright © 2015. Published by Elsevier B.V. All rights reserved.

  8. Online extraction-high performance liquid chromatography-diode array detector-quadrupole time-of-flight tandem mass spectrometry for rapid flavonoid profiling of Fructus aurantii immaturus.

    Science.gov (United States)

    Tong, Runna; Peng, Mijun; Tong, Chaoying; Guo, Keke; Shi, Shuyun

    2018-03-01

    Chemical profiling of natural products by high performance liquid chromatography (HPLC) was critical for understanding of their clinical bioactivities, and sample pretreatment steps have been considered as a bottleneck for analysis. Currently, concerted efforts have been made to develop sample pretreatment methods with high efficiency, low solvent and time consumptions. Here, a simple and efficient online extraction (OLE) strategy coupled with HPLC-diode array detector-quadrupole time-of-flight tandem mass spectrometry (HPLC-DAD-QTOF-MS/MS) was developed for rapid chemical profiling. For OLE strategy, guard column inserted with ground sample (2 mg) instead of sample loop was connected with manual injection valve, in which components were directly extracted and transferred to HPLC-DAD-QTOF-MS/MS system only by mobile phase without any extra time, solvent, instrument and operation. By comparison with offline heat-reflux extraction for Fructus aurantii immaturus (Zhishi), OLE strategy presented higher extraction efficiency perhaps because of the high pressure and gradient elution mode. A total of eighteen flavonoids were detected according to their retention times, UV spectra, exact mass, and fragmentation ions in MS/MS spectra, and compound 9, natsudaidain-3-O-glucoside, was discovered in Zhishi for the first time. It is concluded that the developed OLE-HPLC-DAD-QTOF-MS/MS system offers new perspectives for rapid chemical profiling of natural products. Copyright © 2018. Published by Elsevier B.V.

  9. A rapid biosynthesis route for the preparation of gold nanoparticles by aqueous extract of cypress leaves at room temperature

    Science.gov (United States)

    Noruzi, Masumeh; Zare, Davood; Davoodi, Daryoush

    In the present study, green synthesis of gold nanoparticles was reported using the aqueous extract of cypress leaves. The reduction of gold salt with the extract of cypress leaves resulted in the formation of gold nanoparticles. Effects of extract concentration and extract pH were investigated on the size of the nanoparticles. It was found that the average particle size of synthesized gold nanoparticles depends strongly on extract concentration and extract pH. FT-IR spectroscopy showed that bioorganic capping molecules were bound to the surface of particles. X-ray techniques confirmed the formation of gold nanoparticles and their crystalline structure. The inductively coupled plasma atomic emission spectroscopy analysis displayed that the reaction progress is higher than 90% at room temperature. Gold nanoparticles were mostly spherical in shape along with some irregular shapes. Cypress is an evergreen plant and its leaves are easily available in all four seasons. Also, the rate of the reaction was high and it was completed in only 10 min. For these reasons, this method is cost-effective and environmentally friendly. Thus, it can be used in the synthesis of gold nanoparticles instead of chemical methods and other biosynthesis approaches.

  10. Simple, rapid and cost-effective method for high quality nucleic acids extraction from different strains of Botryococcus braunii.

    Directory of Open Access Journals (Sweden)

    Byung-Hyuk Kim

    Full Text Available This study deals with an effective nucleic acids extraction method from various strains of Botryococcus braunii which possesses an extensive extracellular matrix. A method combining freeze/thaw and bead-beating with heterogeneous diameter of silica/zirconia beads was optimized to isolate DNA and RNA from microalgae, especially from B. braunii. Eukaryotic Microalgal Nucleic Acids Extraction (EMNE method developed in this study showed at least 300 times higher DNA yield in all strains of B. braunii with high integrity and 50 times reduced working volume compared to commercially available DNA extraction kits. High quality RNA was also extracted using this method and more than two times the yield compared to existing methods. Real-time experiments confirmed the quality and quantity of the input DNA and RNA extracted using EMNE method. The method was also applied to other eukaryotic microalgae, such as diatoms, Chlamydomonas sp., Chlorella sp., and Scenedesmus sp. resulting in higher efficiencies. Cost-effectiveness analysis of DNA extraction by various methods revealed that EMNE method was superior to commercial kits and other reported methods by >15%. This method would immensely contribute to area of microalgal genomics.

  11. Rapid extraction of Amomum tsao-ko essential oil and determination of its chemical composition, antioxidant and antimicrobial activities.

    Science.gov (United States)

    Cui, Qi; Wang, Li-Tao; Liu, Ju-Zhao; Wang, Hui-Mei; Guo, Na; Gu, Cheng-Bo; Fu, Yu-Jie

    2017-09-01

    A simple, green and efficient extraction method named modified-solvent free microwave extraction (M-SFME) was employed for the extraction of essential oils (EOs) from Amomun tsao-ko. The process of M-SFME was optimized with the prominent preponderance of such higher extraction yield (1.13%) than those of solvent free microwave extraction (SFME, 0.91%) and hydrodistillation (HD, 0.84%) under the optimal parameters. Thirty-four volatile substances representing 95.4% were identified. The IC 50 values of EOs determined by DPPH radical scavenging activity and β-carotene/linoleic acid bleaching assay were 5.27 and 0.63mg/ml. Furthermore, the EOs exhibited moderate to potent broad-spectrum antimicrobial activity against all tested strains including five gram-positive and two gram-negative bacteria (MIC: 2.94-5.86mg/ml). In general, M-SFME is a potential and desirable alternative for the extraction of EOs from aromatic herbs, and the EOs obtained from A. tsao-ko can be explored as a potent natural antimicrobial and antioxidant preservative ingredient in food industry from the technological and economical points of view. Copyright © 2017 Elsevier B.V. All rights reserved.

  12. Mass spectra of alkaline earth salts with a FAB source. Complexation with crown ethers

    International Nuclear Information System (INIS)

    Ulrich, J.

    1987-01-01

    With a liquid desorption FAB source it is possible to obtain alkaline earth metal ions complexed by a crown ether. Conditions for formation of these complexes ions are examined for selection of the complexing agent in function of cation size. Behaviour of alkaline and alkaline earth compounds are compared allowing the differentiation of ion extraction phenomena by liquid desorption ion source and solvent extraction [fr

  13. Rapid determination of eight bioactive alkaloids in Portulaca oleracea L. by the optimal microwave extraction combined with positive-negative conversion multiple reaction monitor (+/-MRM) technology.

    Science.gov (United States)

    Liang, Xiao; Tian, Jinlong; Li, Lingzhi; Gao, Jun; Zhang, Qingyi; Gao, Pinyi; Song, Shaojiang

    2014-03-01

    A rapid and reliable microwave extraction and the triple quadrupole-linear ion trap mass spectrometry method was developed and validated for the determination of eight alkaloids in Portulaca oleracea L. The optimal microwave extraction (MWE) condition was performed at 60 °C for 12 min with ethanol-water (70:30, v/v) as the extracting solvent, and the solvent to solid ratio was 30:1. The alkaloids were first detected simultaneously by electrospray ionization tandem mass spectrometry under positive-negative conversion multiple reaction monitor ((+/-)MRM) technique. With investigating three different columns, samples were separated in only 8 min on a Waters ACQUITY UPLC HSS T3 (50 × 2.1 mm(2), 1.8 μm) column using acetonitrile and formic acid-water solution as a mobile phase with a flow rate at 0.2 mL/min. All calibration curves showed good linearity (r>0.999) within the test ranges. The method developed was validated with acceptable sensitivity, intra- and inter-day precision, reproducibility, and extraction recoveries. It was successfully applied to the determination of eight alkaloids in Portulaca oleracea L. from different sources and different harvest periods. The method also provide a reference for extraction and determination of alkaloids in other complex systems. © 2013 Elsevier B.V. All rights reserved.

  14. Rapid and reliable high-throughput methods of DNA extraction for use in barcoding and molecular systematics of mushrooms.

    Science.gov (United States)

    Dentinger, Bryn T M; Margaritescu, Simona; Moncalvo, Jean-Marc

    2010-07-01

    We present two methods for DNA extraction from fresh and dried mushrooms that are adaptable to high-throughput sequencing initiatives, such as DNA barcoding. Our results show that these protocols yield ∼85% sequencing success from recently collected materials. Tests with both recent (100 years) specimens reveal that older collections have low success rates and may be an inefficient resource for populating a barcode database. However, our method of extracting DNA from herbarium samples using small amount of tissue is reliable and could be used for important historical specimens. The application of these protocols greatly reduces time, and therefore cost, of generating DNA sequences from mushrooms and other fungi vs. traditional extraction methods. The efficiency of these methods illustrates that standardization and streamlining of sample processing should be shifted from the laboratory to the field. © 2009 Blackwell Publishing Ltd.

  15. Rapid and simple extraction of lipids from blood plasma and urine for liquid chromatography-tandem mass spectrometry.

    Science.gov (United States)

    Bang, Dae Young; Byeon, Seul Kee; Moon, Myeong Hee

    2014-02-28

    A simple and fast lipid extraction method from human blood plasma and urine is introduced in this study. The effective lipid extraction from biological systems with a minimization of the matrix effect is important for the successful qualitative and quantitative analysis of lipids in liquid chromatography-electrospray ionization-tandem mass spectrometry (LC-ESI-MS/MS). The method described here is based on the modification of the quick, easy, cheap, effective, rugged and safe (QuEChERS) extraction method, which was originally developed for pesticide residue analysis in food, for the purpose of isolating lipids from biological fluids. Applicability of QuEChERS method for lipids was evaluated by varying organic solvents for the extraction/partitioning of lipids in MgSO4/CH3COONa for the removal of water and by varying sorbents (primary secondary amines, graphitized carbon black, silica, strong anion exchange resins and C18 particles) for the dispersive solid-phase extraction (dSPE) step. This study shows that 2:1 (v/v) CHCl3/CH3OH is effective in the extraction/partitioning step and that 50mg of C18 particles (for 0.1mL plasma and 1mL of urine) are more suitable for sample cleanup for the dSPE step of the QuEChERS method. Matrix effects were calculated by comparing the recovery values of lipid standards spiked to both plasma and urine samples after extraction with those of the same standards in a neat solution using nanoflow LC-ESI-MS/MS, resulting in improved MS signals due to the decrease of the ion suppression compared to the conventional Folch method. The modified QuEChERS method was applied to lipid extracts from both human urine and plasma samples, demonstrating that it can be powerfully utilized for high-speed (<15min) preparation of lipids compared to the Folch method, with equivalent or slightly improved results in lipid identification using nLC-ESI-MS/MS. Copyright © 2014 Elsevier B.V. All rights reserved.

  16. Assessment of the arterial input curve for [99mTc]-d,l-HM-PAO by rapid octanol extraction

    DEFF Research Database (Denmark)

    Andersen, A R; Friberg, H; Lassen, N A

    1988-01-01

    The in vitro conversion of the lipophilic molecule [99mTc]-d,l-hexamethylpropyleneamine oxime [( 99mTc]-d,l-HM-PAO) to a hydrophilic form was studied in saline, plasma, and blood at 37 degrees C by paper chromatography and by octanol extraction. The octanol:saline ratio was 79.9. From this value...... and the corresponding octanol: plasma and octanol:blood partitioning values, an estimate of the transport of the lipophilic compound by various components of blood was made: 20% is carried in hemoglobin, 53% by the plasma proteins and 27% by the water phases of the red blood cell and plasma. Octanol extraction provided...

  17. Rapid extraction and quantitative detection of the herbicide diuron in surface water by a hapten-functionalized carbon nanotubes based electrochemical analyzer.

    Science.gov (United States)

    Sharma, Priyanka; Bhalla, Vijayender; Tuteja, Satish; Kukkar, Manil; Suri, C Raman

    2012-05-21

    A solid phase extraction micro-cartridge containing a non-polar polystyrene absorbent matrix was coupled with an electrochemical immunoassay analyzer (EIA) and used for the ultra-sensitive detection of the phenyl urea herbicide diuron in real samples. The EIA was fabricated by using carboxylated carbon nanotubes (CNTs) functionalized with a hapten molecule (an amine functionalized diuron derivative). Screen printed electrodes (SPE) were modified with these haptenized CNTs and specific in-house generated anti diuron antibodies were used for bio-interface development. The immunodetection was realized in a competitive electrochemical immunoassay format using alkaline phosphatase labeled secondary anti-IgG antibody. The addition of 1-naphthyl phosphate substrate resulted in the production of an electrochemically active product, 1-naphthol, which was monitored by using differential pulse voltammetry (DPV). The assay exhibited excellent sensitivity and specificity having a dynamic response range of 0.01 pg mL(-1) to 10 μg mL(-1) for diuron with a limit of detection of around 0.1 pg mL(-1) (n = 3) in standard water samples. The micro-cartridge coupled hapten-CNTs modified SPE provided an effective and efficient electrochemical immunoassay for the real-time monitoring of pesticides samples with a very high degree of sensitivity.

  18. Hyphenated chromatographic techniques for the rapid screening and identification of antioxidants in methanolic extracts of pharmaceutically used plants .

    NARCIS (Netherlands)

    Exarchou, V.; Fiamegos, Y.C.; Beek, van T.A.; Nanos, C.G.; Vervoort, J.J.M.

    2006-01-01

    Phytochemical analysis is an important scientific research area, which normally relies on a number of rather laborious and time-consuming techniques for compound identification. Isolation of the ingredients of plant extracts in adequate quantities for spectral and biological analysis was the basis

  19. Rapid microwave-assisted acid extraction of metals from chromated copper arsenate (CCA)-treated southern pine wood

    Science.gov (United States)

    Bin Yu; Chung Y. Hse; Todd F. Shupe

    2009-01-01

    The effects of acid concentration, reaction time, and temperature in a microwave reactor on recovery of CCA-treated wood were evaluated. Extraction of copper, chromium, and arsenic metals from chromated copper arsenate (CCA)-treated southern pine wood samples with three different acids (i.e., acetic acid, oxalic acid, and phosphoric acid) was investigated using in...

  20. A rapid PCR-based approach for molecular identification of filamentous fungi.

    Science.gov (United States)

    Chen, Yuanyuan; Prior, Bernard A; Shi, Guiyang; Wang, Zhengxiang

    2011-08-01

    In this study, a novel rapid and efficient DNA extraction method based on alkaline lysis, which can deal with a large number of filamentous fungal isolates in the same batch, was established. The filamentous fungal genomic DNA required only 20 min to prepare and can be directly used as a template for PCR amplification. The amplified internal transcribed spacer regions were easy to identify by analysis. The extracted DNA also can be used to amplify other protein-coding genes for fungal identification. This method can be used for rapid systematic identification of filamentous fungal isolates.

  1. Rapid and Green Analytical Method for the Determination of Quinoline Alkaloids from Cinchona succirubra Based on Microwave-Integrated Extraction and Leaching (MIEL Prior to High Performance Liquid Chromatography

    Directory of Open Access Journals (Sweden)

    Farid Chemat

    2011-11-01

    Full Text Available Quinas contains several compounds, such as quinoline alkaloids, principally quinine, quinidine, cinchonine and cichonidine. Identified from barks of Cinchona, quinine is still commonly used to treat human malaria. Microwave-Integrated Extraction and Leaching (MIEL is proposed for the extraction of quinoline alkaloids from bark of Cinchona succirubra. The process is performed in four steps, which ensures complete, rapid and accurate extraction of the samples. Optimal conditions for extraction were obtained using a response surface methodology reached from a central composite design. The MIEL extraction has been compared with a conventional technique soxhlet extraction. The extracts of quinoline alkaloids from C. succirubra obtained by these two different methods were compared by HPLC. The extracts obtained by MIEL in 32 min were quantitatively (yield and qualitatively (quinine, quinidine, cinchonine, cinchonidine similar to those obtained by conventional Soxhlet extraction in 3 hours. MIEL is a green technology that serves as a good alternative for the extraction of Cinchona alkaloids.

  2. Rapid and green analytical method for the determination of quinoline alkaloids from Cinchona succirubra based on Microwave-Integrated Extraction and Leaching (MIEL) prior to high performance liquid chromatography.

    Science.gov (United States)

    Fabiano-Tixier, Anne-Sylvie; Elomri, Abdelhakim; Blanckaert, Axelle; Seguin, Elisabeth; Petitcolas, Emmanuel; Chemat, Farid

    2011-01-01

    Quinas contains several compounds, such as quinoline alkaloids, principally quinine, quinidine, cinchonine and cichonidine. Identified from barks of Cinchona, quinine is still commonly used to treat human malaria. Microwave-Integrated Extraction and Leaching (MIEL) is proposed for the extraction of quinoline alkaloids from bark of Cinchona succirubra. The process is performed in four steps, which ensures complete, rapid and accurate extraction of the samples. Optimal conditions for extraction were obtained using a response surface methodology reached from a central composite design. The MIEL extraction has been compared with a conventional technique soxhlet extraction. The extracts of quinoline alkaloids from C. succirubra obtained by these two different methods were compared by HPLC. The extracts obtained by MIEL in 32 min were quantitatively (yield) and qualitatively (quinine, quinidine, cinchonine, cinchonidine) similar to those obtained by conventional Soxhlet extraction in 3 hours. MIEL is a green technology that serves as a good alternative for the extraction of Cinchona alkaloids.

  3. Rapid-resolution HPLC with specgtrometric detection for the determination and identification of isoflavones in soy preparations and plant extracts

    Czech Academy of Sciences Publication Activity Database

    Klejdus, B.; Vacek, J.; Benešová, L.; Kopecký, Jiří; Lapčík, O.; Kubáň, V.

    2007-01-01

    Roč. 389, - (2007), s. 2277-2285 ISSN 1618-2642 R&D Projects: GA ČR GA525/07/0338; GA ČR GA525/06/0864 Institutional research plan: CEZ:AV0Z50200510 Keywords : rapid resolution * fast chromatography * hplc Subject RIV: EE - Microbiology, Virology Impact factor: 2.867, year: 2007

  4. Increased river alkalinization in the Eastern U.S.

    Science.gov (United States)

    Kaushal, Sujay S; Likens, Gene E; Utz, Ryan M; Pace, Michael L; Grese, Melissa; Yepsen, Metthea

    2013-09-17

    The interaction between human activities and watershed geology is accelerating long-term changes in the carbon cycle of rivers. We evaluated changes in bicarbonate alkalinity, a product of chemical weathering, and tested for long-term trends at 97 sites in the eastern United States draining over 260,000 km(2). We observed statistically significant increasing trends in alkalinity at 62 of the 97 sites, while remaining sites exhibited no significant decreasing trends. Over 50% of study sites also had statistically significant increasing trends in concentrations of calcium (another product of chemical weathering) where data were available. River alkalinization rates were significantly related to watershed carbonate lithology, acid deposition, and topography. These three variables explained ~40% of variation in river alkalinization rates. The strongest predictor of river alkalinization rates was carbonate lithology. The most rapid rates of river alkalinization occurred at sites with highest inputs of acid deposition and highest elevation. The rise of alkalinity in many rivers throughout the Eastern U.S. suggests human-accelerated chemical weathering, in addition to previously documented impacts of mining and land use. Increased river alkalinization has major environmental implications including impacts on water hardness and salinization of drinking water, alterations of air-water exchange of CO2, coastal ocean acidification, and the influence of bicarbonate availability on primary production.

  5. Rapid determination of trace nitrophenolic organics in water by combining solid-phase extraction with surface-assisted laser desorption/ionization time-of-flight mass spectrometry.

    Science.gov (United States)

    Chen, Y C; Shiea, J; Sunner, J

    2000-01-01

    A rapid technique for the screening of trace compounds in water by combining solid-phase extraction (SPE) with activated carbon surface-assisted laser desorption/ionization (SALDI) time-of-flight mass spectrometry is demonstrated. Activated carbon is used both as the sorbent in SPE and as the solid in the SALDI matrix system. This eliminates the need for an SPE elution process. After the analytes have been adsorbed on the surfaces of the activated carbon during SPE extraction, the activated carbon is directly mixed with the SALDI liquid and mass spectrometric analysis is performed. Trace phenolic compounds in water were used to demonstrate the effectiveness of the method. The detection limit for these compounds is in the ppb to ppt range. Copyright 2000 John Wiley & Sons, Ltd.

  6. Rapid and simultaneous determination of neptunium and plutonium isotopes in environmental samples by extraction chromatography using sequential injection analysis and ICP-MS

    DEFF Research Database (Denmark)

    Qiao, Jixin; Hou, Xiaolin; Roos, Per

    2010-01-01

    plutonium and neptunium in three reference materials were in agreement with the recommended or literature values at the 0.05 significance level. The developed method is suitable for the analysis of up to 10 g of soil and 20 g of seaweed samples. The extraction chromatographic separation within the SI system......This paper reports an automated analytical method for rapid and simultaneous determination of plutonium isotopes (239Pu and 240Pu) and neptunium (237Np) in environmental samples. An extraction chromatographic column packed with TrisKem TEVA® resin was incorporated in a sequential injection (SI...... for a single sample takes less than 1.5 h. As compared to batchwise procedures, the developed method significantly improves the analysis efficiency, reduces the labor intensity and expedites the simultaneous determination of plutonium and neptunium as demanded in emergency actions....

  7. A rapid assay for the simultaneous determination of nicotine, cocaine and metabolites in meconium using disposable pipette extraction and gas chromatography-mass spectrometry (GC-MS).

    Science.gov (United States)

    Mozaner Bordin, Dayanne C; Alves, Marcela N R; Cabrices, Oscar G; de Campos, Eduardo G; De Martinis, Bruno Spinosa

    2014-01-01

    Drug abuse by pregnant women is considered a serious public health problem worldwide. Meconium is the first excretion in newborns and has been used as an alternative matrix to evaluate in utero drug exposure. Solid phase extraction (SPE) is widely employed to prepare and clean up samples in the field of forensic analysis. Most SPE products require large volumes of solvent, which culminates in longer sample processing times and increased cost per sample. Disposable pipette extraction (DPX) tips have been used as an alternative to traditional SPE cartridges. They combine efficient and rapid extraction with reduced solvent consumption. The purpose of this study was to develop and validate a method to determine nicotine, cotinine, cocaine, benzoylecgonine, cocaethylene and methyl ester anhydroecgonine in meconium using DPX and gas chromatography-mass spectrometry (GC-MS). Validation results indicated that extraction efficiency ranged 50-98%, accuracy 92-106%, intra-assay precision 4-12% and inter-assay precision 6-12%. Linear calibration curves resulted in R(2) values >0.99, limits of detection ranged from 2.5 to 15 ng/g and the limit of quantitation from 10 to 20 ng/g. The DPX-GC-MS method was shown to selectively analyze trace concentrations of drugs in meconium samples. Finally, the developed and validated method was applied to 50 meconium samples.

  8. A rapid method for the extraction and analysis of carotenoids and other hydrophobic substances suitable for systems biology studies with photosynthetic bacteria.

    Science.gov (United States)

    Bóna-Lovász, Judit; Bóna, Aron; Ederer, Michael; Sawodny, Oliver; Ghosh, Robin

    2013-10-11

    A simple, rapid, and inexpensive extraction method for carotenoids and other non-polar compounds present in phototrophic bacteria has been developed. The method, which has been extensively tested on the phototrophic purple non-sulphur bacterium Rhodospirillum rubrum, is suitable for extracting large numbers of samples, which is common in systems biology studies, and yields material suitable for subsequent analysis using HPLC and mass spectroscopy. The procedure is particularly suitable for carotenoids and other terpenoids, including quinones, bacteriochlorophyll a and bacteriopheophytin a, and is also useful for the analysis of polar phospholipids. The extraction procedure requires only a single step extraction with a hexane/methanol/water mixture, followed by HPLC using a Spherisorb C18 column, with a mobile phase consisting of acetone-water and a non-linear gradient of 50%-100% acetone. The method was employed for examining the carotenoid composition observed during microaerophilic growth of R. rubrum strains, and was able to determine 18 carotenoids, 4 isoprenoid-quinones, bacteriochlorophyll a and bacteriopheophytin a as well as four different phosphatidylglycerol species of different acyl chain compositions. The analytical procedure was used to examine the dynamics of carotenoid biosynthesis in the major and minor pathways operating simultaneously in a carotenoid biosynthesis mutant of R. rubrum.

  9. A Rapid Method for the Extraction and Analysis of Carotenoids and Other Hydrophobic Substances Suitable for Systems Biology Studies with Photosynthetic Bacteria

    Directory of Open Access Journals (Sweden)

    Oliver Sawodny

    2013-10-01

    Full Text Available A simple, rapid, and inexpensive extraction method for carotenoids and other non-polar compounds present in phototrophic bacteria has been developed. The method, which has been extensively tested on the phototrophic purple non-sulphur bacterium Rhodospirillum rubrum, is suitable for extracting large numbers of samples, which is common in systems biology studies, and yields material suitable for subsequent analysis using HPLC and mass spectroscopy. The procedure is particularly suitable for carotenoids and other terpenoids, including quinones, bacteriochlorophyll a and bacteriopheophytin a, and is also useful for the analysis of polar phospholipids. The extraction procedure requires only a single step extraction with a hexane/methanol/water mixture, followed by HPLC using a Spherisorb C18 column, with a mobile phase consisting of acetone-water and a non-linear gradient of 50%–100% acetone. The method was employed for examining the carotenoid composition observed during microaerophilic growth of R. rubrum strains, and was able to determine 18 carotenoids, 4 isoprenoid-quinones, bacteriochlorophyll a and bacteriopheophytin a as well as four different phosphatidylglycerol species of different acyl chain compositions. The analytical procedure was used to examine the dynamics of carotenoid biosynthesis in the major and minor pathways operating simultaneously in a carotenoid biosynthesis mutant of R. rubrum.

  10. Optimization of pressurized liquid extraction (PLE) for rapid determination of mineral oil saturated (MOSH) and aromatic hydrocarbons (MOAH) in cardboard and paper intended for food contact.

    Science.gov (United States)

    Moret, Sabrina; Sander, Maren; Purcaro, Giorgia; Scolaro, Marianna; Barp, Laura; Conte, Lanfranco S

    2013-10-15

    Packaging can represent a primary source of food contamination with mineral oil saturated hydrocarbons (MOSH) and aromatic hydrocarbons (MOAH), especially when recycled cardboard or mineral oil based printing inks are used. A pressurized liquid extraction (PLE) method, followed by on-line LC-GC analysis, has been optimized for rapid mineral oil determination in cardboard and paper samples. The proposed method involves extraction with hexane (2 cycles) at 60°C for 5 min, and allows for the processing of up to 6 samples in parallel with minimal sample manipulation and solvent consumption. It gave good repeatability (coefficient of variation lower than 5%) and practically quantitative extraction yield (less than 2% of the total contamination found in a third separate cycle). The method was applied to different cardboards and paper materials intended for food contact. Results obtained were similar to those obtained by applying classical solvent extraction with hexane/ethanol 1:1 (v/v) as described by Lorenzini et al. [20]. Copyright © 2013 Elsevier B.V. All rights reserved.

  11. Rapid qualitative and quantitative analysis of opiates in extract of poppy head via FTIR and chemometrics: towards in-field sensors.

    Science.gov (United States)

    Turner, Nicholas W; Cauchi, Michael; Piletska, Elena V; Preston, Christopher; Piletsky, Sergey A

    2009-07-15

    Identification and quantification of the opiates morphine and thebaine has been achieved in three commercial poppy cultivars using FTIR-ATR spectroscopy, from a simple and rapid methanolic extraction, suitable for field analysis. The limits of detection were 0.13 mg/ml (0.013%, w/v) and 0.3 mg/ml (0.03%, w/v) respectively. The concentrations of opiates present were verified with HPLC-MS. The chemometrics has been used to identify specific "signature" peaks in the poppy IR spectra for characterisation of cultivar by its unique fingerprint offering a potential forensic application in opiate crop analysis.

  12. Rapid Determination of Trace Palladium in Active Pharmaceutical Ingredients by Magnetic Solid-Phase Extraction and Flame Atomic Absorption Spectrometry

    Science.gov (United States)

    Yin, Q. H.; Zhu, D. M.; Yang, D. Z.; Hu, Q. F.; Yang, Y. L.

    2018-01-01

    Clutaraldehyde cross-linked magnetic chitosan nanoparticles were synthesized and used as an adsorbent for the dispersive solid-phase extraction of palladium in active pharmaceutical ingredients (APIs) prior to analysis by a flame atomic absorption spectrophotometer. FT-IR, X-ray diffraction, and TEM were used to characterize the adsorbent. Various parameters of experimental performance, such as adsorbent amount, pH, adsorption time, desorption solutions, coexisting ions, and adsorbent reusability, were investigated and optimized. Under the optimized conditions, good linearity was achieved in the 5.0-500 μg/L concentration range, with correlation coefficients of 0.9989. The limit of detection is 2.8 μg/L and the recoveries of spiked samples ranged from 91.7 to 97.6%. It was confirmed that the GMCNs nanocomposite was a promising adsorbing material for extraction and preconcentration of Pd in APIs.

  13. Rapid microwave-assisted acid extraction of southern pine waste wood to remove metals from chromated copper arsenate (CCA) treatment

    Science.gov (United States)

    Chung-Yun Hse; Todd F. Shupe; Bin Yu

    2013-01-01

    Recovery of metals from chromated copper arsenate (CCA)-treated southern pine wood particles was investigated by extraction in a microwave reactor with binary combinations of acetic acid (AA), oxalic acid (OxA), and phosphoric acid (PhA). Use of OxA was not successful, as insoluble copper oxalate complexes impeded copper removal. The combination of OxA and AA also had...

  14. The rapid determination of 210Po in uranium ores by TRPO extraction-α inner-scintillation method

    International Nuclear Information System (INIS)

    Zhu Tianxia

    1993-02-01

    Ores are treated with HF to remove Si, then 210 Po is leached out by HCl + H 2 O 2 solution. The solution is extracted by TRPO and re-extracted with 5% H 2 C 2 O 4 solution. Ti(SO 4 ) 2 is added to the re-extraction solution and the pH value of solution is adjusted with NaOH, then the solution is evenly mixed with ZnS(Ag) and filtered. After the filter has dried the activity is measured by alpha counting of inner-scintillation method. When the sample has prepared the measurement can immediately carry out. The measurement are not interfered by α-radiators from 238 U, 235 U and 2 '3'2Th as well as daughters of Pb and Bi. The recovery of whole chemical process is 98%. The detecting efficiency is (95+-1)%. The precision is better than +- 4%. The α-4π detect in limitation depends on the background counting of Ti(SO 4 ) 2 . For the CP reagent, the value is (7 ∼ 23) x 10 -3 Bq/6 mg Ti 4+ . It can be reduced greatly after purification. The analytical period is 12 samples/8 h (activity of 210 Po ≥ 1 Bq/g

  15. Novel method for the rapid and specific extraction of multiple β2 -agonist residues in food by tailor-made Monolith-MIPs extraction disks and detection by gas chromatography with mass spectrometry.

    Science.gov (United States)

    Liu, Haibo; Gan, Ning; Chen, Yinji; Ding, Qingqing; Huang, Jie; Lin, Saichai; Cao, Yuting; Li, Tianhua

    2016-09-01

    A quick and specific pretreatment method based on a series of extraction clean-up disks, consisting of molecularly imprinted polymer monoliths and C18 adsorbent, was developed for the specific enrichment of salbutamol and clenbuterol residues in food. The molecularly imprinted monolithic polymer disk was synthesized using salbutamol as a template through a one-step synthesis process. It can simultaneously and specifically recognize salbutamol and clenbuterol. The monolithic polymer disk and series of C18 disks were assembled with a syringe to form a set of tailor-made devices for the extraction of target molecules. In a single run, salbutamol and clenbuterol can be specifically extracted, cleaned, and eluted by methanol/acetic acid/H2 O. The target molecules, after a silylation derivatization reaction were detected by gas chromatography-mass spectrometry. The parameters including solvent desorption, sample pH, and the cycles of reloading were investigated and discussed. Under the optimized extraction and clean-up conditions, the limits of detection and quantitation were determined as 0.018-0.022 and 0.042-0.049 ng/g for salbutamol and clenbuterol, respectively. The assay described was convenient, rapid, and specific; thereby potentially efficient in the high-throughput analysis of β2 -agonists residues in real food samples. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  16. [Study of alkaline lignin from Arundo donax linn based on FT Raman spectroscopy].

    Science.gov (United States)

    You, Ting-ting; Ma, Jian-feng; Guo, Si-qin; Xu, Feng

    2014-08-01

    Arundo donax linn, as a perennial energy crop, has promising application prospect. In the present study, Fourier transform Raman (FT Raman) spectroscopy was applied to determine the structural information of materials, milled wood lignin (MWL), and alkaline lignins (AL, under different treated time) from A. donax stem nondestructively. The results indicated that, extractable compounds in A. donax had negative contribution to the Raman spectra without rising new Raman peaks. FT Raman spectrum of MWL indicated that MWL from A. donax was HGS type lignins. Compared with the spectra of MWL from wood materials, the peak at 1173 cm(-1) was much higher in intensity for the MWL from A. donax stem, which may be assigned to hydroxycinnamic acid by analyzing the standard. With respect to FT Raman spectra of ALs, the relatively highest intensity of 1173 cm(-1) was found in alkaline lignin (AL2), which was treated for 40 min by alkaline. Moreover, the peak of coniferaldehyde/sinapaldehyde (1630 cm(-1)) was lowest in intensity while the band attributed to coniferyl alcohol/sinapyl alcohol (1660 cm(-1)) was almost disappeared in AL2. It could be inferred that AL2 demonstrated a highest content of phenolic acid, which may improve its potential application, such as for antioxidant activity. Furthermore, the results obtained by FT Raman spectra were verified by two dimensional heteronuclear singlequantum coherence nuclear magnetic resonance analyses. Above all, FT Raman spectroscopy provided alternative safe, rapid, accurate, and nondestructive technology for lignin structure determination.

  17. Rapid method for determination of glyphosate in groundwater using high performance liquid chromatography and solid-phase extraction after derivatization

    Directory of Open Access Journals (Sweden)

    Valdir Eduardo Olivo

    2015-04-01

    Full Text Available The intensive use of pesticides in agriculture has prompted researchers to develop new methods for identifying these pollutants in water. This study sought to validate a high performance liquid chromatography (HPLC method to determine the concentration of the pesticide glyphosate in groundwater samples by using solid-phase extraction (SPE filters after derivatization with chloroformate 9-fluorenylmethoxycarbonyl (FMOC-Cl. For the HPLC method, we evaluated the following main validation parameters: linearity, specificity, precision, accuracy, robustness, and limits of detection and quantification. After validation of the method, we determined the concentration of glyphosate in samples from thirteen deep, tubular wells distributed in urban and rural areas in Chapecó, SC, Brazil. The solvent used in the extraction of excess FMOC-Cl was dichloromethane and subsequently filtration was performed on C18 SPE, and injected into the chromatograph column in amino polymer with fluorescence detection. The analytical curve made in ultrapure water was linear, with a correlation coefficient of 0.99. The limits of detection and quantification were 0.24 and 0.07 µg L-1, respectively. Recovery tests in natural waters ranged from 90.37 to 101.70%. Glyphosate was detected in 5 of the thirteen wells evaluated. The highest concentration of glyphosate (6.80 µg L-1 was detected in a countryside well, near the municipal water supply. Despite the low levels of glyphosate detected in our study, any amount present in groundwater samples is worrisome, as these molecules have low ground mobility.

  18. Extraction-less, rapid assay for the direct detection of 2,4,6-trichloroanisole (TCA) in cork samples.

    Science.gov (United States)

    Apostolou, Theofylaktos; Pascual, Nuria; Marco, M-Pilar; Moschos, Anastassios; Petropoulos, Anastassios; Kaltsas, Grigoris; Kintzios, Spyridon

    2014-07-01

    2,4,6-trichloroanisole (TCA), the cork taint molecule, has been the target of several analytical approaches over the few past years. In spite of the development of highly efficient and sensitive tools for its detection, ranging from advanced chromatography to biosensor-based techniques, a practical breakthrough for routine cork screening purposes has not yet been realized, in part due to the requirement of a lengthy extraction of TCA in organic solvents, mostly 12% ethanol and the high detectability required. In the present report, we present a modification of a previously reported biosensor system based on the measurement of the electric response of cultured fibroblast cells membrane-engineered with the pAb78 TCA-specific antibody. Samples were prepared by macerating cork tissue and mixing it directly with the cellular biorecognition elements, without any intervening extraction process. By using this novel approach, we were able to detect TCA in just five minutes at extremely low concentrations (down to 0.2 ppt). The novel biosensor offers a number of practical benefits, including a very considerable reduction in the total assay time by one day, and a full portability, enabling its direct employment for on-site, high throughput screening of cork in the field and production facilities, without requiring any type of supporting infrastructure. Copyright © 2014 Elsevier B.V. All rights reserved.

  19. Centrifuge-less dispersive liquid-liquid microextraction base on the solidification of switchable solvent for rapid on-site extraction of four pyrethroid insecticides in water samples.

    Science.gov (United States)

    Hu, Lu; Wang, Huazi; Qian, Heng; Liu, Chaoran; Lu, Runhua; Zhang, Sanbing; Zhou, Wenfeng; Gao, Haixiang; Xu, Donghui

    2016-11-11

    An on-site dispersive liquid liquid microextraction base on the solidification of switchable solvent has been developed as a simple, rapid and eco-friendly sample extraction method for the fast determination of pyrethroid insecticides in aqueous samples using high-performance liquid chromatography with ultraviolet detection. In this extraction method, medium-chain saturated fatty acids (n≥10), which can rapidly solidify at low temperatures (centrifugation. The microextraction process was performed in a 10mL syringe and the pretreatment process could thus be finished in 5min. No external energy resources were required in this method, which makes it a potential method for on-site extraction. The optimal experimental parameters were as follows: 350μL of decanoic acid (1mol/L) was used as the extraction solvent, 150μL of sulfuric acid (2mol/L) was used to decrease the pH of the samples, no salt was added, and the temperature of the samples was in the range of 20-40°C. Finally, the sample was cooled in an ice bath for three minutes. Under these optimal conditions, good responses for four pyrethroid insecticides were obtained in the concentration ranges of 1-500μg/L, with coefficients of determination greater than 0.9993. The recoveries of the four pyrethroid insecticides ranged from 84.7 to 95.3%, with relative standard deviations ranging from 1.6 to 4.6%. The limits of detection based on a signal-to-noise ratio of 3 were in the range of 0.24-0.68μg/L, and the enrichment factors were in the range of 121-136. The results demonstrate that this method was successfully applied to determine pyrethroid insecticides in real water samples. No centrifugation or any special apparatus are required, make this a promising method for rapid field-sampling procedures. Copyright © 2016 Elsevier B.V. All rights reserved.

  20. Rapid Extraction and Identification of Maitotoxin and Ciguatoxin-Like Toxins from Caribbean and Pacific Gambierdiscus Using a New Functional Bioassay.

    Directory of Open Access Journals (Sweden)

    Richard J Lewis

    Full Text Available Ciguatera is a circumtropical disease produced by polyether sodium channel toxins (ciguatoxins that enter the marine food chain and accumulate in otherwise edible fish. Ciguatoxins, as well as potent water-soluble polyethers known as maitotoxins, are produced by certain dinoflagellate species in the genus Gambierdiscus and Fukuyoa spp. in the Pacific but little is known of the potential of related Caribbean species to produce these toxins.We established a simplified procedure for extracting polyether toxins from Gambierdiscus and Fukuyoa spp. based on the ciguatoxin rapid extraction method (CREM. Fractionated extracts from identified Pacific and Caribbean isolates were analysed using a functional bioassay that recorded intracellular calcium changes (Ca2+ in response to sample addition in SH-SY5Y cells. Maitotoxin directly elevated Ca2+i, while low levels of ciguatoxin-like toxins were detected using veratridine to enhance responses.We identified significant maitotoxin production in 11 of 12 isolates analysed, with 6 of 12 producing at least two forms of maitotoxin. In contrast, only 2 Caribbean isolates produced detectable levels of ciguatoxin-like activity despite a detection limit of >30 pM. Significant strain-dependent differences in the levels and types of ciguatoxins and maitotoxins produced by the same Gambierdiscus spp. were also identified.The ability to rapidly identify polyether toxins produced by Gambierdiscus spp. in culture has the potential to distinguish ciguatoxin-producing species prior to large-scale culture and in naturally occurring blooms of Gambierdiscus and Fukuyoa spp. Our results have implications for the evaluation of ciguatera risk associated with Gambierdiscus and related species.

  1. Rapid Extraction and Identification of Maitotoxin and Ciguatoxin-Like Toxins from Caribbean and Pacific Gambierdiscus Using a New Functional Bioassay.

    Science.gov (United States)

    Lewis, Richard J; Inserra, Marco; Vetter, Irina; Holland, William C; Hardison, D Ransom; Tester, Patricia A; Litaker, R Wayne

    2016-01-01

    Ciguatera is a circumtropical disease produced by polyether sodium channel toxins (ciguatoxins) that enter the marine food chain and accumulate in otherwise edible fish. Ciguatoxins, as well as potent water-soluble polyethers known as maitotoxins, are produced by certain dinoflagellate species in the genus Gambierdiscus and Fukuyoa spp. in the Pacific but little is known of the potential of related Caribbean species to produce these toxins. We established a simplified procedure for extracting polyether toxins from Gambierdiscus and Fukuyoa spp. based on the ciguatoxin rapid extraction method (CREM). Fractionated extracts from identified Pacific and Caribbean isolates were analysed using a functional bioassay that recorded intracellular calcium changes (Ca2+) in response to sample addition in SH-SY5Y cells. Maitotoxin directly elevated Ca2+i, while low levels of ciguatoxin-like toxins were detected using veratridine to enhance responses. We identified significant maitotoxin production in 11 of 12 isolates analysed, with 6 of 12 producing at least two forms of maitotoxin. In contrast, only 2 Caribbean isolates produced detectable levels of ciguatoxin-like activity despite a detection limit of >30 pM. Significant strain-dependent differences in the levels and types of ciguatoxins and maitotoxins produced by the same Gambierdiscus spp. were also identified. The ability to rapidly identify polyether toxins produced by Gambierdiscus spp. in culture has the potential to distinguish ciguatoxin-producing species prior to large-scale culture and in naturally occurring blooms of Gambierdiscus and Fukuyoa spp. Our results have implications for the evaluation of ciguatera risk associated with Gambierdiscus and related species.

  2. A simple method for point-of-need extraction, concentration and rapid multi-mycotoxin immunodetection in feeds using aqueous two-phase systems.

    Science.gov (United States)

    Soares, Ruben R G; Azevedo, Ana M; Fernandes, Pedro; Chu, Virginia; Conde, João P; Aires-Barros, M Raquel

    2017-08-18

    The rapid detection of mycotoxins in feed samples is becoming an increasingly relevant challenge for the food production sector, in order to effectively enforce current regulations and assure food and feed safety. To achieve rapid mycotoxin detection, several biosensing strategies have been published, many reaching assay times of the order of a few minutes. However, the vast majority of these rely on sample preparation based on volatile organic solvents, often comprising complex multi-step procedures and devoid of clean-up and/or concentration effects. Here, a novel sample preparation methodology based on a green, non-toxic and inexpensive polyethylene glycol-sodium citrate aqueous two-phase system is reported, providing single-step extraction and concentration of three target mycotoxins within 20min: aflatoxin B1 (AFB1), ochratoxin A (OTA) and deoxynivalenol (DON). With point-of-need applications in mind, the extraction procedure was optimized and validated using a rapid multi-toxin microfluidic competitive immunoassay. The assay was successfully tested with spiked complex solid matrices including corn, soy, chickpea and sunflower-based feeds and limits of detection of 4.6ngg -1 ±15.8%, 24.1ngg -1 ±8.1% and 129.7ngg -1 ±53.1% (±CV) were obtained in corn for AFB1, OTA and DON, respectively. These sensitivities are fit-for-purpose at the required regulatory and recommended limits for animal feed, providing an effective and safe semi-quantitative mycotoxin analysis that can be performed in the field. Copyright © 2017 Elsevier B.V. All rights reserved.

  3. [18F]Fallypride: Metabolism studies and quantification of the radiotracer and its radiometabolites in plasma using a simple and rapid solid-phase extraction method

    International Nuclear Information System (INIS)

    Peyronneau, Marie-Anne; Saba, Wadad; Goutal, Sébastien; Kuhnast, Bertrand; Dollé, Frédéric; Bottlaender, Michel; Valette, Héric

    2013-01-01

    Introduction: [ 18 F]Fallypride, a fluorinated and substituted benzamide with high affinity for D 2 /D 3 receptors, is a useful PET radioligand for the study of striatal/extrastriatal areas. Since [ 18 F]fallypride is extensively metabolized in vivo and since PET examinations are long lasting in humans, the rapid measurement of the unchanged radiotracer in plasma is essential for the quantification of images. The present study aims: i) to evaluate if the radiometabolites of [ 18 F]fallypride cross the blood–brain barrier in rodents, ii) to identify these radiometabolites in baboon plasma and iii) to develop a rapid solid phase extraction method (SPE) suitable for human applications to quantify both [ 18 F]fallypride and its radiometabolites in plasma. Methods: The metabolites P450-dependant in rat and human liver microsomes were characterized by LC–MS–MS and compared to those detected in vivo. Sequential solvent elution on Oasis®-MCX-SPE cartridges was used to quantify [ 18 F]fallypride and its radiometabolites. Result: In rat microsomal incubations, five metabolites generated upon N/O-dealkylation or hydroxylation at the pyrrolidine and/or at the benzamide moiety were identified. No radiometabolite was detected in the rat brain. N-dealkylated and hydroxylated derivatives were detected in human microsomal incubations as well as in baboon plasma. The use of SPE (total recovery 100.2% ± 2.8%, extraction yield 95.5% ± 0.3%) allowed a complete separation of [ 18 F]fallypride from its radiometabolites in plasma and evaluate [ 18 F]fallypride at 150 min pi to be 22% ± 5% of plasma radioactivity. Conclusions: The major in vivo radiometabolites of [ 18 F]fallypride were produced by N-dealkylation and hydroxylation. Allowing the rapid analysis of multiple plasma samples, SPE is a method of choice for the determination of [ 18 F]fallypride until late images required for quantitative PET imaging in humans

  4. A microfluidic platform for the rapid determination of distribution coefficients by gravity assisted droplet-based liquid-liquid extraction

    DEFF Research Database (Denmark)

    Poulsen, Carl Esben; Wootton, Robert C. R.; Wolff, Anders

    2015-01-01

    The determination of pharmacokinetic properties of drugs, such as the distribution coefficient, D, is a crucial measurement in pharmaceutical research. Surprisingly, the conventional (gold standard) technique used for D measurements, the shake-flask method, is antiquated and unsuitable...... for the testing of valuable and scarce drug candidates. Herein we present a simple micro fluidic platform for the determination of distribution coefficients using droplet-based liquid-liquid extraction. For simplicity, this platform makes use of gravity to enable phase separation for analysis and is 48 times...... the apparent acid dissociation constant, pK', as a proxy for inter-system comparison. Our platform determines a pK' value of 7.24 ± 0.15, compared to 7.25 ± 0.58 for the shake-flask method in our hands and 7.21 for the shake-flask method in literature. Devices are fabricated using injection moulding, the batch...

  5. A Rapid and Reproducible Genomic DNA Extraction Protocol for Sequence-Based Identification of Archaea, Bacteria, Cyanobacteria, Diatoms, Fungi, and Green Algae

    Directory of Open Access Journals (Sweden)

    Farkhondeh Saba

    2017-01-01

    Full Text Available Background:  Sequence-based identification of various microorganisms including Archaea, Bacteria, Cyanobacteria, Diatoms, Fungi, and green algae necessitates an efficient and reproducible genome extraction procedure though which a pure template DNA is yielded and it can be used in polymerase chain reactions (PCR. Considering the fact that DNA extraction from these microorganisms is time consuming and laborious, we developed and standardized a safe, rapid and inexpensive miniprep protocol. Methods:  According to our results, amplification of various genomic regions including SSU, LSU, ITS, β-tubulin, actin, RPB2, and EF-1 resulted in a reproducible and efficient DNA extraction from a wide range of microorganisms yielding adequate pure genomic material for reproducible PCR-amplifications. Results:   This method relies on a temporary shock of increased concentrations of detergent which can be applied concomitant with multiple freeze-thaws to yield sufficient amount of DNA for PCR amplification of multiple or single fragments(s of the genome. As an advantage, the recipe seems very flexible, thus, various optional steps can be included depending on the samples used.Conclusion:   Having the needed flexibility in each step, this protocol is applicable on a very wide range of samples. Hence, various steps can be included depending on the desired quantity and quality.

  6. A Rapid and Reproducible Genomic DNA Extraction Protocol for Sequence-Based Identification of Archaea, Bacteria, Cyanobacteria, Diatoms, Fungi, and Green Algae

    Directory of Open Access Journals (Sweden)

    Farkhondeh Saba

    2016-09-01

    Full Text Available Background:  Sequence-based identification of various microorganisms including Archaea, Bacteria, Cyanobacteria, Diatoms, Fungi, and green algae necessitates an efficient and reproducible genome extraction procedure though which a pure template DNA is yielded and it can be used in polymerase chain reactions (PCR. Considering the fact that DNA extraction from these microorganisms is time consuming and laborious, we developed and standardized a safe, rapid and inexpensive miniprep protocol. Methods:  According to our results, amplification of various genomic regions including SSU, LSU, ITS, β-tubulin, actin, RPB2, and EF-1 resulted in a reproducible and efficient DNA extraction from a wide range of microorganisms yielding adequate pure genomic material for reproducible PCR-amplifications. Results:   This method relies on a temporary shock of increased concentrations of detergent which can be applied concomitant with multiple freeze-thaws to yield sufficient amount of DNA for PCR amplification of multiple or single fragments(s of the genome. As an advantage, the recipe seems very flexible, thus, various optional steps can be included depending on the samples used.Conclusion:   Having the needed flexibility in each step, this protocol is applicable on a very wide range of samples. Hence, various steps can be included depending on the desired quantity and quality.

  7. An easy, rapid, and cost-effective method for DNA extraction from various lichen taxa and specimens suitable for analysis of fungal and algal strains.

    Science.gov (United States)

    Park, Sook-Young; Jang, Seol-Hwa; Oh, Soon-Ok; Kim, Jung A; Hur, Jae-Seoun

    2014-12-01

    Lichen studies, including biodiversity, phylogenetic relationships, and conservation concerns require definitive species identification, however many lichens can be challenging to identify at the species level. Molecular techniques have shown efficacy in discriminating among lichen taxa, however, obtaining genomic DNA from herbarium and fresh lichen thalli by conventional methods has been difficult, because lichens contain high proteins, polysaccharides, and other complex compounds in their cell walls. Here we report a rapid, easy, and inexpensive protocol for extracting PCR-quality DNA from various lichen species. This method involves the following two steps: first, cell breakage using a beadbeater; and second, extraction, isolation, and precipitation of genomic DNA. The procedure requires approximately 10 mg of lichen thalli and can be completed within 20 min. The obtained DNAs were of sufficient quality and quantity to amplify the internal transcribed spacer region from the fungal and algal lichen components, as well as to sequence the amplified products. In addition, 26 different lichen taxa were tested, resulting in successful PCR products. The results of this study validated the experimental protocols, and clearly demonstrated the efficacy and value of our KCl extraction method applied in the fungal and algal samples.

  8. One pot synthesis of magnetic graphene/carbon nanotube composites as magnetic dispersive solid-phase extraction adsorbent for rapid determination of oxytetracycline in sewage water.

    Science.gov (United States)

    Sun, Yunyun; Tian, Jing; Wang, Lu; Yan, Hongyuan; Qiao, Fengxia; Qiao, Xiaoqiang

    2015-11-27

    A simple and time-saving one pot synthesis of magnetic graphene/carbon nanotube composites (M-G/CNTs) was developed that could avoid the tedious drying process of graphite oxide, and G/CNTs were modified by Fe3O4 nanoparticles in the reduction procedure. It contributed to a shorten duration of the synthesis process of M-G/CNTs. The obtained M-G/CNTs were characterized and the results indicated that CNTs and Fe3O4 nanoparticles were served as spacer distributing to the layers of graphene, which was beneficial for enlarging surface area and improving extraction efficiency. Moreover, M-G/CNTs showed good magnetic property and outstanding thermal stability. Then M-G/CNTs were applied as adsorbent of magnetic dispersive solid-phase extraction for rapid extraction and determination of oxytetracycline in sewage water. Under the optimum conditions, good linearity was obtained in the range of 20-800ngmL(-1) and the recoveries were ranged from 95.5% to 112.5% with relative standard deviations less than 5.8%. Copyright © 2015 Elsevier B.V. All rights reserved.

  9. Capillary electrophoresis coupled with chloroform-acetonitrile extraction for rapid and highly selective determination of cysteine and homocysteine levels in human blood plasma and urine.

    Science.gov (United States)

    Ivanov, Alexander Vladimirovich; Bulgakova, Polina Olegovna; Virus, Edward Danielevich; Kruglova, Maria Petrovna; Alexandrin, Valery Vasil'evich; Gadieva, Viktoriya Aleksandrovna; Luzyanin, Boris Petrovich; Kushlinskii, Nikolai Evgen'evich; Fedoseev, Anatolij Nikolaevich; Kubatiev, Aslan Amirkhanovich

    2017-10-01

    A rapid and selective method has been developed for highly sensitive determination of total cysteine and homocysteine levels in human blood plasma and urine by capillary electrophoresis (CE) coupled with liquid-liquid extraction. Analytes were first derivatized with 1,1'-thiocarbonyldiimidazole and then samples were purified by chloroform-ACN extraction. Electrophoretic separation was performed using 0.1 M phosphate with 30 mM triethanolamine, pH 2, containing 25 μM CTAB, 2.5 μM SDS, and 2.5% polyethylene glycol 600. Samples were injected into the capillary (with total length 32 cm and 50 μm id) at 2250 mbar*s and subsequent injection was performed for 30 s with 0.5 M KОН. The total analysis time was less than 9 min, accuracy was 98%, and precision was <2.6%. The LOD was 0.2 μM for homocysteine and 0.5 μM for cysteine. The use of liquid-liquid extraction allowed the precision and sensitivity of the CE method to be significantly increased. The validated method was applied to determine total cysteine and homocysteine content in human blood plasma and urine samples obtained from healthy volunteers and patients with kidney disorders. © 2017 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  10. Alkalinity of the Mediterranean Sea

    OpenAIRE

    Schneider, Anke; Wallace, Douglas W.R.; Körtzinger, Arne

    2007-01-01

    Total alkalinity (AT) was measured during the Meteor 51/2 cruise, crossing the Mediterranean Sea from west to east. AT concentrations were high (∼2600 μmol kg−1) and alkalinity-salinity-correlations had negative intercepts. These results are explained by evaporation coupled with high freshwater AT inputs into coastal areas. Salinity adjustment of AT revealed excess alkalinity throughout the water column compared to mid-basin surface waters. Since Mediterranean waters are supersaturated with r...

  11. Alkaline fuel cells applications

    Science.gov (United States)

    Kordesch, Karl; Hacker, Viktor; Gsellmann, Josef; Cifrain, Martin; Faleschini, Gottfried; Enzinger, Peter; Fankhauser, Robert; Ortner, Markus; Muhr, Michael; Aronson, Robert R.

    On the world-wide automobile market technical developments are increasingly determined by the dramatic restriction on emissions as well as the regimentation of fuel consumption by legislation. Therefore there is an increasing chance of a completely new technology breakthrough if it offers new opportunities, meeting the requirements of resource preservation and emission restrictions. Fuel cell technology offers the possibility to excel in today's motive power techniques in terms of environmental compatibility, consumer's profit, costs of maintenance and efficiency. The key question is economy. This will be decided by the costs of fuel cell systems if they are to be used as power generators for future electric vehicles. The alkaline hydrogen-air fuel cell system with circulating KOH electrolyte and low-cost catalysed carbon electrodes could be a promising alternative. Based on the experiences of Kordesch [K. Kordesch, Brennstoffbatterien, Springer, Wien, 1984, ISBN 3-387-81819-7; K. Kordesch, City car with H 2-air fuel cell and lead-battery, SAE Paper No. 719015, 6th IECEC, 1971], who operated a city car hybrid vehicle on public roads for 3 years in the early 1970s, improved air electrodes plus new variations of the bipolar stack assembly developed in Graz are investigated. Primary fuel choice will be a major issue until such time as cost-effective, on-board hydrogen storage is developed. Ammonia is an interesting option. The whole system, ammonia dissociator plus alkaline fuel cell (AFC), is characterised by a simple design and high efficiency.

  12. Production and partial characterization of alkaline protease from bacillus subtilis mutant induced by gamma radiation

    International Nuclear Information System (INIS)

    Ibrahim, H.M.M.; Bashandy, A.S.

    2010-01-01

    Fourteen bacterial isolates belonging to B.subtilis were locally isolated from soil and screened for alkaline protease production. Only one strain, the highly potent one, was selected as alkaline protease producer and subjected to further studies to optimize its production. Alkaline protease production was maximum at 35 degree C after 72 h of incubation and at ph 10.0. molasses as a carbon source and combination of peptone and yeast extract as a nitrogen source enhanced greatly alkaline protease production. The mutant strain induced by gamma radiation showed higher alkaline protease production by 1.97 fold as compared with the parent strain. The alkaline protease enzyme was active at 40 degree C and ph 10. It was compatible with many commercial detergents and showed high stability (84 %) of its original activity with Ariel detergent. Moreover, alkaline protease enhanced the washing performance, and retained 95 % of its activity in the formulated dry powder.

  13. Impacts of Extraction Methods in the Rapid Determination of Atrazine Residues in Foods using Supercritical Fluid Chromatography and Enzyme-Linked Immunosorbent Assay: Microwave Solvent vs. Supercritical Fluid Extractions

    Directory of Open Access Journals (Sweden)

    Mohamed H. El-Saeid

    2005-01-01

    Full Text Available It is an accepted fact that many food products that we eat today have the possibility of being contaminated by various chemicals used from planting to processing. These chemicals have been shown to cause illnesses for which some concerned government agencies have instituted regulatory mechanisms to minimize the risks and the effects on humans. It is for these concerns that reliable and accurate rapid determination techniques are needed to effect proper regulatory standards for the protection of people's nutritional health. This paper, therefore, reports the comparative evaluation of the extraction methods in the determination of atrazine (commonly used in agricultural as a herbicide residues in foods using supercritical fluid chromatography (SFC and enzyme-linked immunosorbent assay (ELISA techniques. Supercritical fluid extraction (SFE and microwave solvent extraction (MSE methods were used to test samples of frozen vegetables, fruit juice, and jam from local food markets in Houston. Results showed a high recovery percentage of atrazine residues using supercritical fluid coupled with ELISA and SFC than with MSE. Comparatively, however, atrazine was detected 90.9 and 54.5% using SFC and ELISA techniques, respectively. ELISA technique was, however, less time consuming, lower in cost, and more sensitive with low detection limit of atrazine residues than SFC technique.

  14. Rapid screening for cyclo-dopa and diketopiperazine alkaloids in crude extracts of Portulaca oleracea L. using liquid chromatography/tandem mass spectrometry.

    Science.gov (United States)

    Xing, Jie; Yang, Zijuan; Lv, Beibei; Xiang, Lan

    2008-05-01

    A simple and rapid qualitative liquid chromatography/tandem mass spectrometry (LC/MS/MS) method was developed and validated for screening cyclo-dopa and diketopiperazine alkaloids in crude extracts of Portulaca oleracea L. at sub-ppm levels. An electrospray ionization orbitrap mass spectrometer, which provides accurate full scan MS and MS/MS data, was used in this study. After simple extraction with ethanol and purification by AB-8 resin, the extracts were subjected to LC/MS/MS analysis. A high mass tolerance (10 ppm) was used in the initial screening to filter the full scan MS data. The cyclo-dopa and diketopiperazine alkaloid standards gave limits of detection (LODs) at or below 5 ng/mL. The results also indicated that the method had an acceptable precision for day-to-day use in the identification of compounds. The alkaloids could be identified based on their MS/MS data, elemental compositions, and retention behavior. This system was used to assay trace amounts of cyclo-dopa and diketopiperazine alkaloids in crude extracts of Portulaca oleracea L., leading to the identification of 5/2 confirmed/unconfirmed cyclo-dopa and 7/6 confirmed/unconfirmed diketopiperazine alkaloids, respectively. The screening method considerably reduces the time and cost involved in the identification of cyclo-dopa and diketopiperazine alkaloids in Portulaca oleracea L., as well as being a simple and convenient approach to the identification of other structural families of natural products. Copyright (c) 2008 John Wiley & Sons, Ltd.

  15. Rapid and Simple Determination of Sarafloxacin and Difloxacin in Beef by Capillary Electrophoresis Coupled with Solid-Phase Extraction

    Directory of Open Access Journals (Sweden)

    Qian Wang

    2018-01-01

    Full Text Available A simple and rapid capillary electrophoresis method with diode array detector was developed for determination of sarafloxacin and difloxacin in beef. In this study, the experimental parameters affecting the determination were systematically optimized, including wavelength, buffer system, pH and concentration, and separation temperature and voltage. Under the optimal conditions, sarafloxacin and difloxacin could be quantified within 4 min using H3BO3/Na2B4O7 buffer (35 mmol/L, pH 8.8 as background electrolyte, 25 kV as separation voltage, and 22°C as the column temperature. The linear range of the method was 1–20 μg/mL with LOD 0.8 μg/mL for sarafloxacin and 0.5–20 μg/mL with LOD 0.3 μg/mL for difloxacin. The RSDs for the peak area of 8 μg/mL sarafloxacin were 4.8% (intraday and 7.8% (interday, respectively. The proposed method has been applied to determine the residue of sarafloxacin and difloxacin in beef samples with the satisfactory recovery.

  16. Method of cleaning alkaline metal

    International Nuclear Information System (INIS)

    Kawakami, Yukio; Naito, Kesahiro; Iizawa, Katsuyuki; Nakasuji, Takashi

    1981-01-01

    Purpose: To prevent scattering of used sodium and aqueous alkaline solution when cleaning used sodium and metallic sodium adhering to equipment with an aqueous alkaline solution. Method: A sodium treating container is filled with an aqueous alkaline solution, and stainless steel gauze is sunk in the container. Equipment to be cleaned such as equipment with sodium adhering to it are retained under the gauze and are thus cleaned. On the other hand, the surface of the aqueous alkaline solution is covered with a fluid paraffin liquid covering material. Thus, the hydrogen produced by the reaction of the sodium and the aqueous alkaline solution will float up, pass through the liquid covering material and be discharged. The sodium will pass through the gauze and float upwardly while reacting with the aqueous alkaline solution in a partic ulate state to the boundary between the aqueous alkaline solution and up to the covering material, and thus the theratment reaction will continue. Thus, the cover material prevents the sodium and the aqueous alkaline solution from scattering. (Kamimura, M.)

  17. Rapid Determination of Major Compounds in the Ethanol Extract of Geopropolis from Malaysian Stingless Bees, Heterotrigona itama, by UHPLC-Q-TOF/MS and NMR.

    Science.gov (United States)

    Zhao, Lingling; Yu, Mengjiao; Sun, Minghui; Xue, Xiaofeng; Wang, Tongtong; Cao, Wei; Sun, Liping

    2017-11-10

    A reliable, rapid analytical method was established for the characterization of constituents of the ethanol extract of geopropolis (EEGP) produced by Malaysian stingless bees- Heterotrigona itama -by combining ultra-high-performance liquid chromatography with quadruple time-of-flight mass spectrometry (UHPLC-Q-TOF/MS). Based on known standards, the online METLIN database, and published literature, 28 compounds were confirmed. Phenolic acids, flavones, triterpenes and phytosterol were identified or tentatively identified using characteristic diagnostic fragment ions. The results indicated that terpenoids were the main components of EEGP, accompanied by low levels of phenolic acids, flavonoids, and phytosterol. Two major components were further purified by preparative high-performance liquid chromatography (PHPLC) and identified by nuclear magnetic resonance (NMR) as 24( E )-cycloart-24-ene-26-ol-3-one and 20-hydroxy-24-dammaren-3-one. These two triterpenes, confirmed in this geopropolis for the first time, are potential chemical markers for the identification of geopropolis from Malaysian stingless bees, H. itama .

  18. Rapid assessment of iron in blood plasma and serum by spectrophotometry with cloud-point extraction [version 1; referees: 2 approved

    Directory of Open Access Journals (Sweden)

    Tatyana Samarina

    2015-08-01

    Full Text Available Rapid photometric assessment of iron in blood plasma and serum by a simple procedure after the extraction of iron(II complex with 1-nitroso-2-naphthol in the micellar phase of a nonionic surfactant at the cloud point upon heating (pH range is 4.5–6.3 is proposed. The procedure trueness was verified using a standard reference protocol using bathophenanthroline. The advantages of the procedure are higher sensitivity than the reference protocol: the limit of detection is 0.03 μg/mL, the limit of quantitation is 0.1 μg/mL, the determination range is 0.1 – 2.8 μg/mL (RSD 0.02–0.10. Copper does not interfere with the iron assessment.

  19. Rapid Determination of Plutonium Isotopes in Environmental Samples Using Sequential Injection Extraction Chromatography and Detection by Inductively Coupled Plasma Mass Spectrometry

    DEFF Research Database (Denmark)

    Qiao, Jixin; Hou, Xiaolin; Roos, Per

    2009-01-01

    This article presents an automated method for the rapid determination of 239Pu and 240Pu in various environmental samples. The analytical method involves the in-line separation of Pu isotopes using extraction chromatography (TEVA) implemented in a sequential injection (SI) network followed...... by detection of isolated analytes with inductively coupled plasma mass spectrometry (ICP-MS). The method has been devised for the determination of Pu isotopes at environmentally relevant concentrations, whereby it has been successfully applied to the analyses of large volumes/amounts of samples, for example......, 100−200 g of soil and sediment, 20 g of seaweed, and 200 L of seawater following analyte preconcentration. The investigation of the separation capability of the assembled SI system revealed that up to 200 g of soil or sediment can be treated using a column containing about 0.70 g of TEVA resin...

  20. Rapid determination of environmental plutonium in large water samples by means of manganese dioxide Co-precipitation and extraction chromatographic separation

    International Nuclear Information System (INIS)

    Sidhu, R.S.; Hoff, P.

    1999-01-01

    Plutonium activity determinations in environmental water samples are routinely performed in many laboratories. Due to the low plutonium concentrations and the complexity of the plutonium aqueous chemistry, these analysis involve cumbersome preconcentration and separation procedures and long measurement times. We describe a procedure where MnO 2 (s) is used as scavenger to preconcentrate Pu prior to separation by the transuranium specific extraction chromatographic resin TRU-Resin. The ability of MnO 4 - /MnO 2 (s) to destroy organic matter and oxidise plutonium is combined with the specific behaviour of the TRU-resin for transuranium elements. The method facilitates a rapid preconcentration and separation of plutonium. With the use of this procedure, the laboratory work on one sample can be performed in one day with minimum attention. The overall yields from a 200 litre fresh- or seawater sample to a measurable Pu source are between 70-85%. (orig.)

  1. A rapid MCM-41 dispersive micro-solid phase extraction coupled with LC/MS/MS for quantification of ketoconazole and voriconazole in biological fluids.

    Science.gov (United States)

    Yahaya, Noorfatimah; Sanagi, Mohd Marsin; Abd Aziz, Noorizan; Wan Ibrahim, Wan Aini; Nur, Hadi; Loh, Saw Hong; Kamaruzaman, Sazlinda

    2017-02-01

    A rapid dispersive micro-solid phase extraction (D-μ-SPE) combined with LC/MS/MS method was developed and validated for the determination of ketoconazole and voriconazole in human urine and plasma samples. Synthesized mesoporous silica MCM-41 was used as sorbent in d-μ-SPE of the azole compounds from biological fluids. Important D-μ-SPE parameters, namely type desorption solvent, extraction time, sample pH, salt addition, desorption time, amount of sorbent and sample volume were optimized. Liquid chromatographic separations were carried out on a Zorbax SB-C 18 column (2.1 × 100 mm, 3.5 μm), using a mobile phase of acetonitrile-0.05% formic acid in 5 mm ammonium acetate buffer (70:30, v/v). A triple quadrupole mass spectrometer with positive ionization mode was used for the determination of target analytes. Under the optimized conditions, the calibration curves showed good linearity in the range of 0.1-10,000 μg/L with satisfactory limit of detection (≤0.06 μg/L) and limit of quantitation (≤0.3 μg/L). The proposed method also showed acceptable intra- and inter-day precisions for ketoconazole and voriconazole from urine and human plasma with RSD ≤16.5% and good relative recoveries in the range 84.3-114.8%. The MCM-41-D-μ-SPE method proved to be rapid and simple and requires a small volume of organic solvent (200 μL); thus it is advantageous for routine drug analysis. Copyright © 2016 John Wiley & Sons, Ltd.

  2. Rapid gas chromatography with flame photometric detection of multiple organophosphorus pesticides in Salvia miltiorrhizae after ultrasonication assisted one-step extraction.

    Science.gov (United States)

    Zhang, Shanshan; Liu, Xiaofei; Qin, Jia'an; Yang, Meihua; Zhao, Hongzheng; Wang, Yong; Guo, Weiying; Ma, Zhijie; Kong, Weijun

    2017-11-15

    A simple and rapid gas chromatography-flame photometric detection (GC-FPD) method was developed for the determination of 12 organophosphorus pesticides (OPPs) in Salvia miltiorrhizae by using ultrasonication assisted one-step extraction (USAE) without any clean-up steps. Some crucial parameters such as type of extraction solvent were optimized to improve the method performance for trace analysis. Any clean-up steps were negligent as no interferences were detected in the GC-FPD chromatograms for sensitive detection. Under the optimized conditions, limits of detection (LODs) and quantitation (LOQs) for all pesticides were in the range of 0.001-0.002mg/kg and 0.002-0.01mg/kg and 0.002-0.01mg/kg, respectively, which were all below the regulatory maximum residue limits suggested. RSDs for method precision (intra- and inter-day variations) were lower than 6.8% in approval with international regulations. Average recovery rates for all pesticides at three fortification levels (0.5, 1.0 and 5.0mg/kg) were in the range of 71.2-101.0% with relative standard deviations (RSDs) pesticide (dimethoate) out of the 12 targets was simultaneously detected in four samples at concentrations of 0.016-0.02mg/kg. Dichlorvos and omethoate were found in the same sample from Sichuan province at 0.004 and 0.027mg/kg, respectively. Malathion and monocrotophos were determined in the other two samples at 0.014 and 0.028mg/kg, respectively. All the positive samples were confirmed by LC-MS/MS. The simple, reliable and rapid USAE-GC-FPD method with many advantages over traditional techniques would be preferred for trace analysis of multiple pesticides in more complex matrices. Copyright © 2017 Elsevier B.V. All rights reserved.

  3. Rapid Identification of Flavonoid Constituents Directly from PTP1B Inhibitive Extract of Raspberry (Rubus idaeus L.) Leaves by HPLC-ESI-QTOF-MS-MS.

    Science.gov (United States)

    Li, Zhuan-Hong; Guo, Han; Xu, Wen-Bin; Ge, Juan; Li, Xin; Alimu, Mireguli; He, Da-Jun

    2016-01-01

    Many potential health benefits of raspberry (Rubus idaeus L.) leaves were attributed to polyphenolic compounds, especially flavonoids. In this study, the methanol extract of R. idaeus leaves showed significant protein tyrosine phosphatase-1B (PTP1B) inhibitory activity with IC50 value of 3.41 ± 0.01 µg mL(-1) Meanwhile, a rapid and reliable method, employed high-performance liquid chromatography coupled with electrospray ionization quadrupole time-of-flight tandem mass spectrometry, was established for structure identification of flavonoids from PTP1B inhibitive extract of R. idaeus leaves using accurate mass measurement and characteristic fragmentation patterns. A total of 16 flavonoids, including 4 quercetin derivatives, 2 luteolin derivatives, 8 kaempferol derivatives and 2 isorhamnetin derivatives, were identified. Compounds 3: and 4: , Compounds 6: and 7: and Compounds 15: and 16: were isomers with different aglycones and different saccharides. Compounds 8: , 9: and 10: were isomers with the same aglycone and the same saccharide but different substituent positions. Compounds 11: and 12: were isomers with the same aglycone but different saccharides. Compounds 2: , 8: , 9: and 10: possessed the same substituent saccharide of glycuronic acid. Most of them were reported inR. idaeus for the first time. © The Author 2016. Published by Oxford University Press. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

  4. Effect of rapid maxillary expansion and transpalatal arch treatment associated with deciduous canine extraction on the eruption of palatally displaced canines: A 2-center prospective study.

    Science.gov (United States)

    Sigler, Lauren M; Baccetti, Tiziano; McNamara, James A

    2011-03-01

    Our aim was to investigate the effect of rapid maxillary expansion and transpalatal arch therapy combined with deciduous canine extraction on the eruption rate of palatally displaced canines (PDCs) in patients in the late mixed dentition in a 2-center prospective study. Seventy subjects were enrolled based on PDCs diagnosed on panoramic radiographs. The treatment group (TG, 40 subjects) underwent RME followed by TPA therapy and extraction of the deciduous canines. The control group (CG, 30 subjects) received no orthodontic treatment. At the start of the trial, panoramic radiographs and dental casts were compared between the TG and the CG with the Mann-Whitney U test (P anomalies was reported. No statistically significant difference was found for any measurement at the start of the trial between the 2 groups. The prevalence rates of eruption of the maxillary canines were 80% for the TG and 28% in the CG, a statistically significant difference (chi-square =16.26, P mixed dentition with PDCs. Pretreatment variables indicating success of treatment on the eruption of PDCs were less severe sectors of displacement, prepubertal stages of skeletal maturity, and open root apices of PDCs. Several dental anomalies were associated significantly with PDCs, thus confirming the genetic etiology of this eruption disturbance. Copyright © 2011 American Association of Orthodontists. Published by Mosby, Inc. All rights reserved.

  5. Rapid Identification of Flavonoid Constituents Directly from PTP1B Inhibitive Extract of Raspberry (Rubus idaeus L.) Leaves by HPLC–ESI–QTOF–MS-MS

    Science.gov (United States)

    Li, Zhuan-Hong; Guo, Han; Xu, Wen-Bin; Ge, Juan; Li, Xin; Alimu, Mireguli; He, Da-Jun

    2016-01-01

    Many potential health benefits of raspberry (Rubus idaeus L.) leaves were attributed to polyphenolic compounds, especially flavonoids. In this study, the methanol extract of R. idaeus leaves showed significant protein tyrosine phosphatase-1B (PTP1B) inhibitory activity with IC50 value of 3.41 ± 0.01 µg mL−1. Meanwhile, a rapid and reliable method, employed high-performance liquid chromatography coupled with electrospray ionization quadrupole time-of-flight tandem mass spectrometry, was established for structure identification of flavonoids from PTP1B inhibitive extract of R. idaeus leaves using accurate mass measurement and characteristic fragmentation patterns. A total of 16 flavonoids, including 4 quercetin derivatives, 2 luteolin derivatives, 8 kaempferol derivatives and 2 isorhamnetin derivatives, were identified. Compounds 3 and 4, Compounds 6 and 7 and Compounds 15 and 16 were isomers with different aglycones and different saccharides. Compounds 8, 9 and 10 were isomers with the same aglycone and the same saccharide but different substituent positions. Compounds 11 and 12 were isomers with the same aglycone but different saccharides. Compounds 2, 8, 9 and 10 possessed the same substituent saccharide of glycuronic acid. Most of them were reported in R. idaeus for the first time. PMID:26896347

  6. A high-throughput solid-phase extraction microchip combined with inductively coupled plasma-mass spectrometry for rapid determination of trace heavy metals in natural water.

    Science.gov (United States)

    Shih, Tsung-Ting; Hsieh, Cheng-Chuan; Luo, Yu-Ting; Su, Yi-An; Chen, Ping-Hung; Chuang, Yu-Chen; Sun, Yuh-Chang

    2016-04-15

    Herein, a hyphenated system combining a high-throughput solid-phase extraction (htSPE) microchip with inductively coupled plasma-mass spectrometry (ICP-MS) for rapid determination of trace heavy metals was developed. Rather than performing multiple analyses in parallel for the enhancement of analytical throughput, we improved the processing speed for individual samples by increasing the operation flow rate during SPE procedures. To this end, an innovative device combining a micromixer and a multi-channeled extraction unit was designed. Furthermore, a programmable valve manifold was used to interface the developed microchip and ICP-MS instrumentation in order to fully automate the system, leading to a dramatic reduction in operation time and human error. Under the optimized operation conditions for the established system, detection limits of 1.64-42.54 ng L(-1) for the analyte ions were achieved. Validation procedures demonstrated that the developed method could be satisfactorily applied to the determination of trace heavy metals in natural water. Each analysis could be readily accomplished within just 186 s using the established system. This represents, to the best of our knowledge, an unprecedented speed for the analysis of trace heavy metal ions. Copyright © 2016 Elsevier B.V. All rights reserved.

  7. Rapid Determination of Two Triterpenoid Acids in Chaenomelis Fructus Using Supercritical Fluid Extraction On-line Coupled with Supercritical Fluid Chromatography.

    Science.gov (United States)

    Zhang, Xiaotian; Ji, Feng; Li, Yueqi; He, Tian; Han, Ya; Wang, Daidong; Lin, Zongtao; Chen, Shizhong

    2018-01-01

    In this study, an on-line supercritical fluid extraction (SFE) and supercritical fluid chromatography (SFC) method was developed for the rapid determination of oleanoic acid and ursolic acid in Chaenomelis Fructus. After optimization of the conditions, the two triterpenoid acids was obtained by SFE using 20% methanol as a modifier at 35°C in 8 min. They were resolved on a Shim-pack UC-X Diol column (4.6 × 150 mm, 3 μm) in 14 min (0 - 10 min, 5 - 10%; 10 - 14 min, 10% methanol in CO 2 ) with a backpressure of 15 MPa at 40°C. The on-line SFE-SFC method could be completed within 40 min (10.79 mg/g dry plant, R s = 2.36), while the ultrasound-assisted extraction and HPLC method required at least 90 min (3.55 mg/g dry plant, R s = 1.92). This on-line SFE-SFC method is powerful to simplify the pre-processing and quantitative analysis of natural products.

  8. Rapid determination of six carcinogenic primary aromatic amines in mainstream cigarette smoke by two-dimensional online solid phase extraction combined with liquid chromatography tandem mass spectrometry.

    Science.gov (United States)

    Bie, Zhenying; Lu, Wei; Zhu, You; Chen, Yusong; Ren, Hubo; Ji, Lishun

    2017-01-27

    A fully automated, rapid, and reliable method for simultaneous determination of six carcinogenic primary aromatic amines (AAs), including o-toluidine (o-TOL), 2, 6-dimethylaniline (2, 6-DMA), o-anisidine (o-ASD), 1-naphthylamine (1-ANP), 2-naphthylamine (2-ANP), and 4-aminobiphenyl (4-ABP), in mainstream cigarette smoke was established. The proposed method was based on two-dimensional online solid phase extraction combined with liquid chromatography tandem mass spectrometry (SPE/LC-MS/MS). The particulate phase of the mainstream cigarette smoke was collected on a Cambridge filter pad and pretreated via ultrasonic extraction with 2% formic acid (FA), while the gas phase was trapped by 2% FA without pretreatment for determination. The two-dimensional online SPE comprised of two cartridges with different absorption characteristics was applied for sample pretreatment. Analysis was performed by liquid chromatography coupled with tandem mass spectrometry (LC-MS/MS) under multiple reaction monitoring mode. Each sample required about 0.5h for solid phase extraction and analysis. The limit of detections (LODs) for six AAs ranged from 0.04 to 0.58ng/cig and recoveries were within 84.5%-122.9%. The relative standard deviations of intra- and inter-day tests for 3R4F reference cigarette were less than 6% and 7%, respectively, while no more than 7% and 8% separately for a type of Virginia cigarette. The proposed method enabled minimum sample pretreatment, full automation, and high throughput with high selectivity, sensitivity, and accuracy. As a part of the validation procedure, fifteen brands of cigarettes were tested by the designed method. Copyright © 2016 Elsevier B.V. All rights reserved.

  9. A rapid method based on hot water extraction and liquid chromatography-tandem mass spectrometry for analyzing tetracycline antibiotic residues in cheese.

    Science.gov (United States)

    Bogialli, Sara; Coradazzi, Cristina; Di Corcia, Antonio; Lagana, Aldo; Sergi, Manuel

    2007-01-01

    A rapid, specific, and sensitive procedure for determining residues of 4 widely used tetracycline antibiotics and 3 of their 4-epimers in cheese is presented. The method is based on the matrix solid-phase dispersion (MSPD) technique followed by liquid chromatography/tandem mass spectrometry (LC/MS/MS). After dispersing samples of mozzarella, asiago, parmigiano, gruyere, emmenthal, and camembert on sand, target compounds were eluted from the MSPD column by passing through it 6 mL water heated at 70 degrees C. After acidification and filtration, 200 microL of the aqueous extract was directly injected into the LC column. For analyte identification and quantification, MS data acquisition was performed in the multireaction monitoring mode, selecting 2 precursor ion-to-product ion transitions for each target compound. Hot water appeared to be an efficient extractant, because absolute recoveries were no lower than 78%. Using demeclocycline as a surrogate analyte, recoveries of analyte added to the 6 types of cheeses at the 30 ng/g level were 96-117%, with relative standard deviation (RSD) not higher than 9%. Statistical analysis of the mean recovery data showed that the extraction efficiency was not dependent on the type of cheese analyzed. This result indicates that this method could be applied to other cheese types not considered here. At the lowest concentration considered, i.e., 10 ng/g, the accuracy of the method ranged between 90 and 107%, with RSDs not larger than 12%. Based on a signal-to-noise ratio of 10, limits of quantitation were estimated to be 1-2 ng/g.

  10. Rapid solid-phase extraction method to quantify [11C]-verapamil, and its [11C]-metabolites, in human and macaque plasma

    International Nuclear Information System (INIS)

    Unadkat, Jashvant D.; Chung, Francisco; Sasongko, Lucy; Whittington, Dale; Eyal, Sara; Mankoff, David; Collier, Ann C.; Muzi, Mark; Link, Jeanne

    2008-01-01

    Introduction: P-glycoprotein (P-gp), an efflux transporter, is a significant barrier to drug entry into the brain and the fetus. The positron emission tomography (PET) ligand, [ 11 C]-verapamil, has been used to measure in vivo P-gp activity at various tissue-blood barriers of humans and animals. Since verapamil is extensively metabolized in vivo, it is important to quantify the extent of verapamil metabolism in order to interpret such P-gp activity. Therefore, we developed a rapid solid-phase extraction (SPE) method to separate, and then quantify, verapamil and its radiolabeled metabolites in plasma. Methods: Using high-performance liquid chromatography (HPLC), we established that the major identifiable circulating radioactive metabolite of [ 11 C]-verapamil in plasma of humans and the nonhuman primate, Macaca nemestrina, was [ 11 C]-D-617/717. Using sequential and differential pH elution on C 8 SPE cartridges, we developed a rapid method to separate [ 11 C]-verapamil and [ 11 C]-D-617/717. Recovery was measured by spiking the samples with the corresponding nonradioactive compounds and assaying these compounds by HPLC. Results: Verapamil and D-617/717 recovery with the SPE method was >85%. When the method was applied to PET studies in humans and nonhuman primates, significant plasma concentration of D-617/717 and unknown polar metabolite(s) were observed. The SPE and the HPLC methods were not significantly different in the quantification of verapamil and D-617/717. Conclusions: The SPE method simultaneously processes multiple samples in less than 5 min. Given the short half-life of [ 11 C], this method provides a valuable tool to rapidly determine the concentration of [ 11 C]-verapamil and its [ 11 C]-metabolites in human and nonhuman primate plasma

  11. Rapid solid-phase extraction method to quantify [{sup 11}C]-verapamil, and its [{sup 11}C]-metabolites, in human and macaque plasma

    Energy Technology Data Exchange (ETDEWEB)

    Unadkat, Jashvant D. [Department of Pharmaceutics, University of Washington, Box 357610, Seattle, WA 98195 (United States)], E-mail: jash@u.washington.edu; Chung, Francisco; Sasongko, Lucy; Whittington, Dale; Eyal, Sara [Department of Pharmaceutics, University of Washington, Box 357610, Seattle, WA 98195 (United States); Mankoff, David [Department of Radiology, University of Washington, Box 356004, Seattle, WA 98195 (United States); Collier, Ann C. [Department of Medicine, University of Washington, Box 359929, Seattle, WA 98195 (United States); Muzi, Mark; Link, Jeanne [Department of Radiology, University of Washington, Box 356004, Seattle, WA 98195 (United States)

    2008-11-15

    Introduction: P-glycoprotein (P-gp), an efflux transporter, is a significant barrier to drug entry into the brain and the fetus. The positron emission tomography (PET) ligand, [{sup 11}C]-verapamil, has been used to measure in vivo P-gp activity at various tissue-blood barriers of humans and animals. Since verapamil is extensively metabolized in vivo, it is important to quantify the extent of verapamil metabolism in order to interpret such P-gp activity. Therefore, we developed a rapid solid-phase extraction (SPE) method to separate, and then quantify, verapamil and its radiolabeled metabolites in plasma. Methods: Using high-performance liquid chromatography (HPLC), we established that the major identifiable circulating radioactive metabolite of [{sup 11}C]-verapamil in plasma of humans and the nonhuman primate, Macaca nemestrina, was [{sup 11}C]-D-617/717. Using sequential and differential pH elution on C{sub 8} SPE cartridges, we developed a rapid method to separate [{sup 11}C]-verapamil and [{sup 11}C]-D-617/717. Recovery was measured by spiking the samples with the corresponding nonradioactive compounds and assaying these compounds by HPLC. Results: Verapamil and D-617/717 recovery with the SPE method was >85%. When the method was applied to PET studies in humans and nonhuman primates, significant plasma concentration of D-617/717 and unknown polar metabolite(s) were observed. The SPE and the HPLC methods were not significantly different in the quantification of verapamil and D-617/717. Conclusions: The SPE method simultaneously processes multiple samples in less than 5 min. Given the short half-life of [{sup 11}C], this method provides a valuable tool to rapidly determine the concentration of [{sup 11}C]-verapamil and its [{sup 11}C]-metabolites in human and nonhuman primate plasma.

  12. Improving the extraction of crisis information in the context of flood, fire, and landslide rapid mapping using SAR and optical remote sensing data

    Science.gov (United States)

    Martinis, Sandro; Clandillon, Stephen; Twele, André; Huber, Claire; Plank, Simon; Maxant, Jérôme; Cao, Wenxi; Caspard, Mathilde; May, Stéphane

    2016-04-01

    Optical and radar satellite remote sensing have proven to provide essential crisis information in case of natural disasters, humanitarian relief activities and civil security issues in a growing number of cases through mechanisms such as the Copernicus Emergency Management Service (EMS) of the European Commission or the International Charter 'Space and Major Disasters'. The aforementioned programs and initiatives make use of satellite-based rapid mapping services aimed at delivering reliable and accurate crisis information after natural hazards. Although these services are increasingly operational, they need to be continuously updated and improved through research and development (R&D) activities. The principal objective of ASAPTERRA (Advancing SAR and Optical Methods for Rapid Mapping), the ESA-funded R&D project being described here, is to improve, automate and, hence, speed-up geo-information extraction procedures in the context of natural hazards response. This is performed through the development, implementation, testing and validation of novel image processing methods using optical and Synthetic Aperture Radar (SAR) data. The methods are mainly developed based on data of the German radar satellites TerraSAR-X and TanDEM-X, the French satellite missions Pléiades-1A/1B as well as the ESA missions Sentinel-1/2 with the aim to better characterize the potential and limitations of these sensors and their synergy. The resulting algorithms and techniques are evaluated in real case applications during rapid mapping activities. The project is focussed on three types of natural hazards: floods, landslides and fires. Within this presentation an overview of the main methodological developments in each topic is given and demonstrated in selected test areas. The following developments are presented in the context of flood mapping: a fully automated Sentinel-1 based processing chain for detecting open flood surfaces, a method for the improved detection of flooded vegetation

  13. An oxidant, detergent and salt stable alkaline protease from Bacillus ...

    African Journals Online (AJOL)

    A novel soil bacterium, Bacillus cereus SIU1 was earlier isolated from non-saline, slightly alkaline soil of Eastern Uttar Pradesh, India. The isolate B. cereus SIU1 was grown in modified glucose yeast extract (modified GYE) medium at pH 9.0 and 45°C. It produced maximum protease at 20 h incubation. The enzyme was ...

  14. Production of alkaline proteases by alkalophilic Bacillus subtilis ...

    African Journals Online (AJOL)

    Among various nitrogen sources, yeast extract was found to be the best inducer of alkaline protease. Among metal salts, KNO3 and NH4Cl were found to increase protease production. The maximum enzyme production (3600 U/ml) was observed with pomegranate peels of fermentation medium in the presence of yeast ...

  15. Effect of alkaline treatment on the sulfate content and quality of semi ...

    African Journals Online (AJOL)

    Administrator

    2015-05-06

    May 6, 2015 ... quality of semi-refined carrageenan prepared from seaweed Kappaphycus ... importance for industry to deliver a standard product and to develop new ..... alkaline extraction media (compared to pure water) have also been ...

  16. A rapid and sensitive method for the simultaneous analysis of aliphatic and polar molecules containing free carboxyl groups in plant extracts by LC-MS/MS

    Directory of Open Access Journals (Sweden)

    Bonaventure Gustavo

    2009-11-01

    Full Text Available Abstract Background Aliphatic molecules containing free carboxyl groups are important intermediates in many metabolic and signalling reactions, however, they accumulate to low levels in tissues and are not efficiently ionized by electrospray ionization (ESI compared to more polar substances. Quantification of aliphatic molecules becomes therefore difficult when small amounts of tissue are available for analysis. Traditional methods for analysis of these molecules require purification or enrichment steps, which are onerous when multiple samples need to be analyzed. In contrast to aliphatic molecules, more polar substances containing free carboxyl groups such as some phytohormones are efficiently ionized by ESI and suitable for analysis by LC-MS/MS. Thus, the development of a method with which aliphatic and polar molecules -which their unmodified forms differ dramatically in their efficiencies of ionization by ESI- can be simultaneously detected with similar sensitivities would substantially simplify the analysis of complex biological matrices. Results A simple, rapid, specific and sensitive method for the simultaneous detection and quantification of free aliphatic molecules (e.g., free fatty acids (FFA and small polar molecules (e.g., jasmonic acid (JA, salicylic acid (SA containing free carboxyl groups by direct derivatization of leaf extracts with Picolinyl reagent followed by LC-MS/MS analysis is presented. The presence of the N atom in the esterified pyridine moiety allowed the efficient ionization of 25 compounds tested irrespective of their chemical structure. The method was validated by comparing the results obtained after analysis of Nicotiana attenuata leaf material with previously described analytical methods. Conclusion The method presented was used to detect 16 compounds in leaf extracts of N. attenuata plants. Importantly, the method can be adapted based on the specific analytes of interest with the only consideration that the

  17. Magnetic covalent triazine framework for rapid extraction of phthalate esters in plastic packaging materials followed by gas chromatography-flame ionization detection.

    Science.gov (United States)

    Yan, Zijun; He, Man; Chen, Beibei; Gui, Bo; Wang, Cheng; Hu, Bin

    2017-11-24

    Covalent triazine frameworks (CTFs), featuring with high surface area, good thermal, chemical and mechanical stability, are good adsorbents in sample pretreatment. Herein, magnetic CTFs/Ni composite was prepared by in situ reduction of nickel ions on CTFs matrix with a solvothermal method. The prepared CTFs/Ni composite exhibited good preparation reproducibility, high chemical stability, and high extraction efficiency for targeted phthalate esters (PAEs) due to π-π interaction and hydrophobic effect. The porous structure of CTFs/Ni composite benefited the fast transfer of target PAEs from aqueous solution to the adsorbents, and the integrated magnetism contributed to the rapid separation of adsorbents from sample and elution solution. Based on it, a novel method of magnetic solid phase extraction (MSPE) combined with gas chromatography-flame ionization detector (GC-FID) was developed for the analysis of PAEs including dimethyl phthalate (DMP), diethyl phthalate (DEP), di-n-butyl phthalate (DBP), benzyl butyl phthalate (BBP), di-2-ethylhexl phthalate (DEHP), and di-n-octyl phthalate (DNOP) in plastic packaging materials. Under the optimal experimental conditions, the limits of detection (LODs, S/N=3) for six PAEs were found to be in the range of 0.024-0.085mg/kg. The linear range was 0.32-16mg/kg for DMP, DEP, 0.08-80mg/kg for DBP, 0.16-32mg/kg for BBP, DEHP, and 0.32-32mg/kg for DNOP, respectively. The enrichment factors ranged from 59 to 88-fold (theoretical enrichment factor was 133-fold). The proposed method was successfully applied to the analysis of PAEs in various plastic packaging materials with recoveries in the range of 70.6-119% for the spiked samples. This method is characterized with short operation time, high sensitivity, low consumption of harmful organic solvents and can be extended to the analysis of other trace aromatic compounds. Copyright © 2017 Elsevier B.V. All rights reserved.

  18. Rapid identification and quantification of methamphetamine and amphetamine in hair by gas chromatography/mass spectrometry coupled with micropulverized extraction, aqueous acetylation and microextraction by packed sorbent.

    Science.gov (United States)

    Miyaguchi, Hajime; Iwata, Yuko T; Kanamori, Tatsuyuki; Tsujikawa, Kenji; Kuwayama, Kenji; Inoue, Hiroyuki

    2009-05-01

    We developed a rapid identification and quantification method for the toxicological analysis of methamphetamine and amphetamine in human hair by gas chromatography/mass spectrometry coupled with a novel combination of micropulverized extraction, aqueous acetylation and microextraction by packed sorbent (MEPS) named MiAMi-GC/MS. A washed hair sample (1-5 mg) was micropulverized for 5 min in a 2 mL plastic tube with 250 microL of water. An anion-exchange sorbent was added to adsorb anionic interferences. After removing the residue with a membrane-filter unit, sodium carbonate and acetic anhydride was admixed in turn. Acetylation was completed in approximately 20 min at room temperature. The acetylated analytes in the reaction liquid were concentrated to an octadecylsilica sorbent packed in the needle of a syringe by a CombiPAL autosampler. Elution was carried out with 50 microL of methanol, and the entire eluate injected into a gas chromatograph using a programmable temperature vaporizing (PTV) technique. The time required for sample preparation and GC/MS analysis was approximately 1 h from a washed hair sample, and an evaporation process was not required. Ranges for quantification were 0.20-50 (ng/mg) each for methamphetamine and amphetamine using 1 mg of hair. Accuracy and relative standard deviation (RSD) were evaluated intraday and interday at three concentrations, and the results were within the limit of a guidance issued by U.S. Food and Drug Administration. For identification, full-scan mass spectra of methamphetamine and amphetamine were obtained using 5 mg of fortified hair samples at 0.2 ng/mg. The extraction device of MEPS was durable for at least 300 extractions, whereas the liner of the gas chromatograph should be replaced after 20-30 times use. The carry over was estimated to be about 1-2%. This sample-preparation method coupled with GC/MS is fast and labor-saving in comparison with conventional methods.

  19. Rapid Determination of Major Compounds in the Ethanol Extract of Geopropolis from Malaysian Stingless Bees, Heterotrigona itama, by UHPLC-Q-TOF/MS and NMR

    Directory of Open Access Journals (Sweden)

    Lingling Zhao

    2017-11-01

    Full Text Available A reliable, rapid analytical method was established for the characterization of constituents of the ethanol extract of geopropolis (EEGP produced by Malaysian stingless bees—Heterotrigona itama—by combining ultra-high-performance liquid chromatography with quadruple time-of-flight mass spectrometry (UHPLC-Q-TOF/MS. Based on known standards, the online METLIN database, and published literature, 28 compounds were confirmed. Phenolic acids, flavones, triterpenes and phytosterol were identified or tentatively identified using characteristic diagnostic fragment ions. The results indicated that terpenoids were the main components of EEGP, accompanied by low levels of phenolic acids, flavonoids, and phytosterol. Two major components were further purified by preparative high-performance liquid chromatography (PHPLC and identified by nuclear magnetic resonance (NMR as 24(E-cycloart-24-ene-26-ol-3-one and 20-hydroxy-24-dammaren-3-one. These two triterpenes, confirmed in this geopropolis for the first time, are potential chemical markers for the identification of geopropolis from Malaysian stingless bees, H. itama.

  20. Event Patterns Extracted from Transverse Momentum and Rapidity Spectra of Z Bosons and Quarkonium States Produced in pp and Pb-Pb Collisions at LHC

    Directory of Open Access Journals (Sweden)

    Ya-Hui Chen

    2016-01-01

    Full Text Available Transverse momentum (pT and rapidity (y spectra of Z bosons and quarkonium states (some charmonium cc¯ mesons such as J/ψ and ψ(2S and some bottomonium bb¯ mesons such as Υ(1S, Υ(2S, and Υ(3S produced in proton-proton (pp and lead-lead (Pb-Pb collisions at the large hadron collider (LHC are uniformly described by a hybrid model of two-component Erlang distribution for pT spectrum and two-component Gaussian distribution for y spectrum. The former distribution results from a multisource thermal model, and the latter one results from the revised Landau hydrodynamic model. The modelling results are in agreement with the experimental data measured in pp collisions at center-of-mass energies s=2.76 and 7 TeV and in Pb-Pb collisions at center-of-mass energy per nucleon pair sNN=2.76 TeV. Based on the parameter values extracted from pT and y spectra, the event patterns (particle scatter plots in two-dimensional pT-y space and in three-dimensional velocity space are obtained.

  1. Rapid and sensitive determination of phenylurea herbicides in water in the presence of their anilines by extraction with a Carbopack cartridge followed by liquid chromatography.

    Science.gov (United States)

    Di Corcia, A; Marchetti, M

    1991-03-22

    A rapid and sensitive method for determining phenylurea herbicides in environmental aqueous samples in the presence of their anilines is described. The water sample is preconcentrated by passage at a flow-rate of ca. 150 ml/min through a 250-mg graphitized carbon black (Carbopack B) cartridge. After washing with 0.6 ml of methanol, the Carbopack B trap is connected with a cartridge containing a strong cation exchanger. Organics trapped by the Carbopack cartridge are eluted by passage of 6 ml of methylene chloride-methanol (95:5, v/v). Anilines and other basic compounds are quantitatively subtracted from the solvent system while flowing through the cation-exchange cartridge. After evaporation and redissolution, the sample is subjected to reversed-phase gradient elution high-performance liquid chromatography with UV detection at 250 nm. Recoveries of phenylureas added to water at levels between 30 and 3000 ng/l were higher than 92%. The limit of detection was about 1 ng/l, for a 2-1 sample. With respect to an octadecyl (C18)-bonded silica cartridge, the Carbopack B cartridge had a far better extraction efficiency for polar phenylureas.

  2. Rapid and sensitive determination of major polyphenolic components in Euphoria longana Lam. seeds using matrix solid-phase dispersion extraction and UHPLC with hybrid linear ion trap triple quadrupole mass spectrometry.

    Science.gov (United States)

    Rathore, Atul S; Sathiyanarayanan, L; Deshpande, Shreekant; Mahadik, Kakasaheb R

    2016-11-01

    A rapid and sensitive method for the extraction and determination of four major polyphenolic components in Euphoria longana Lam. seeds is presented for the first time based on matrix solid-phase dispersion extraction followed by ultra high performance liquid chromatography with hybrid triple quadrupole linear ion trap mass spectrometry. Matrix solid-phase dispersion method was designed for the extraction of Euphoria longana seed constituents and compared with microwave-assisted extraction and ultrasonic-assisted extraction methods. An Ultra high performance liquid chromatography with hybrid triple quadrupole linear ion-trap mass spectrometry method was developed for quantitative analysis in multiple-reaction monitoring mode in negative electrospray ionization. The chromatographic separation was accomplished using an ACQUITY UPLC BEH C 18 (2.1 mm × 50 mm, 1.7 μm) column with gradient elution of 0.1% aqueous formic acid and 0.1% formic acid in acetonitrile. The developed method was validated with acceptable linearity (r 2 > 0.999), precision (RSD ≤ 2.22%) and recovery (RSD ≤ 2.35%). The results indicated that matrix solid-phase dispersion produced comparable extraction efficiency compared with other methods nevertheless was more convenient and time-saving with reduced requirements on sample and solvent volumes. The proposed method is rapid and sensitive in providing a promising alternative for extraction and comprehensive determination of active components for quality control of Euphoria longana products. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  3. Development and validation of a rapid high performance liquid chromatography - photodiode array detection method for estimation of a bioactive compound wedelolactone in extracts of Eclipta alba

    Directory of Open Access Journals (Sweden)

    Satyanshu Kumar

    2013-03-01

    Full Text Available Following optimization of extraction, separation and analytical conditions, a rapid, sensitive and simple reverse-phase high performance liquid chromatography-photo diode array (HPLC-PDA method has been developed for the identification and quantification of wedelolactone in different extracts of Eclipta alba. The separation of wedelolactone was achieved on a C18 column using the solvent system consisting of a mixture of methanol: water: acetic acid (95: 5: 0.04 as a mobile phase in isocratic elution mode followed by photo diode array detection at 352 nm. The developed method was validated as per the guidelines of the International Conference on Harmonization (ICH. Calibration curve presented good linear regression (r²>0.998 within the test range and the maximum relative standard deviation (RSD, % values for intra-day assay were found to be 0.15, 1.30 and 1.1 for low (5 µg/mL, medium (20 µg/mL and high (80 µg/mL concentrations of wedelolactone. For inter-day assay the maximum RSD (% values were found to be 2.83, 1.51 and 2.06 for low, medium and high concentrations, respectively. Limit of detection (LOD and limit of quantification (LOQ were calculated to be 2 and 5 µg/mL respectively. Analytical recovery of wedelolactone was greater than 95%. Wedelolactone in different extracts of Eclipta alba was identified and quantified using the developed HPLC method. The validated HPLC method allowed precise quantitative analysis of wedelolactone in Eclipta. alba extracts.Desenvolveu-se método rápido, sensível e simples de Cromatografia Líquida de Alta Eficiência em fase reversa, utilizando-se arranjo de fotodiodo (HPLC-PDA, visando à separação, extração e às condições analíticas para a identificação e quantificação de wedelolactona em diferentes extratos de Eclipta alba. A separação de wedelolactona foi efetuada por meio de uma coluna C18, utilizando mistura de metanol:água:ácido acético (95:5:0.04 como fase móvel, em sistema de

  4. Electromembrane extraction

    DEFF Research Database (Denmark)

    Huang, Chuixiu; Chen, Zhiliang; Gjelstad, Astrid

    2017-01-01

    Electromembrane extraction (EME) was inspired by solid-phase microextraction and developed from hollow fiber liquid-phase microextraction in 2006 by applying an electric field over the supported liquid membrane (SLM). EME provides rapid extraction, efficient sample clean-up and selectivity based...

  5. Application of an efficient strategy based on liquid-liquid extraction, high-speed counter-current chromatography, and preparative HPLC for the rapid enrichment, separation, and purification of four anthraquinones from Rheum tanguticum.

    Science.gov (United States)

    Chen, Tao; Liu, Yongling; Zou, Denglang; Chen, Chen; You, Jinmao; Zhou, Guoying; Sun, Jing; Li, Yulin

    2014-01-01

    This study presents an efficient strategy based on liquid-liquid extraction, high-speed counter-current chromatography, and preparative HPLC for the rapid enrichment, separation, and purification of four anthraquinones from Rheum tanguticum. A new solvent system composed of petroleum ether/ethyl acetate/water (4:2:1, v/v/v) was developed for the liquid-liquid extraction of the crude extract from R. tanguticum. As a result, emodin, aloe-emodin, physcion, and chrysophanol were greatly enriched in the organic layer. In addition, an efficient method was successfully established to separate and purify the above anthraquinones by high-speed counter-current chromatography and preparative HPLC. This study supplies a new alternative method for the rapid enrichment, separation, and purification of emodin, aloe-emodin, physcione, and chrysophanol. © 2013 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  6. Application of dried spot cards as a rapid sample treatment method for determining hydroxytyrosol metabolites in human urine samples. Comparison with microelution solid-phase extraction.

    Science.gov (United States)

    Serra, Aida; Rubió, Laura; Macià, Alba; Valls, Rosa-M; Catalán, Úrsula; de la Torre, Rafael; Motilva, Maria-José

    2013-11-01

    Two different rapid sample pretreatment strategies, dried spot cards, and microelution solid-phase extraction plates (μSPE), with ultra-high performance liquid chromatography coupled to tandem mass spectrometry (UPLC-MS/MS) have been developed and validated for the determination of hydroxytyrosol and its metabolites in spiked human urine samples. Hydroxytyrosol, hydroxytyrosol-3'-O-glucuronide, hydroxytyrosol-4'-O-glucuronide, hydroxytyrosol-3-O-sulphate, and homovanillic alcohol-4'-O-glucuronide were used as the target compounds. Using the FTA DMPK-A dried urine spot card under optimum conditions, with 5 μL of preconcentrated urine volume and 100 μL of methanol/water (50/50, v/v) as the elution solvent, the extraction recovery (%R) of the compounds studied was higher than 80%, and the matrix effect (%ME) was less than 8%. The stability of these cards and punching at the centre or side of the card were also studied, obtaining an excellent stability after 7 days of storage and complete homogeneity across the surface of the dried drop. The different μSPE parameters that affect the efficiency were also studied, and under optimum conditions, the %R and the %ME were higher than 70% and lower than 17%, respectively. The linearity range in dried urine spot cards was 2.5-20 μM for all the metabolites, with the exception of hydroxytyrosol-3-O-sulphate and hydroxytyrosol, which were 0.3-70 μM and 2.5-50 μM respectively. With regards to μSPE, the linearity range was 0.5-5 μM for all the studied compounds, except for hydroxytyrosol-3-O-sulphate, which was 0.08-5 μM. The quantification limits (LOQs) were 0.3-2.5 μM and 0.08-0.5 μM in dried spot cards and in μSPE, respectively. The two developed methods were then applied and compared for determining hydroxytyrosol and its metabolites in human 24 h-urine samples after a sustained consumption (21 days) of a phenol-enriched virgin olive oil. The metabolites identified were hydroxytyrosol in its glucuronide and sulphate

  7. DNA DAMAGE QUANTITATION BY ALKALINE GEL ELECTROPHORESIS.

    Energy Technology Data Exchange (ETDEWEB)

    SUTHERLAND,B.M.; BENNETT,P.V.; SUTHERLAND, J.C.

    2004-03-24

    Physical and chemical agents in the environment, those used in clinical applications, or encountered during recreational exposures to sunlight, induce damages in DNA. Understanding the biological impact of these agents requires quantitation of the levels of such damages in laboratory test systems as well as in field or clinical samples. Alkaline gel electrophoresis provides a sensitive (down to {approx} a few lesions/5Mb), rapid method of direct quantitation of a wide variety of DNA damages in nanogram quantities of non-radioactive DNAs from laboratory, field, or clinical specimens, including higher plants and animals. This method stems from velocity sedimentation studies of DNA populations, and from the simple methods of agarose gel electrophoresis. Our laboratories have developed quantitative agarose gel methods, analytical descriptions of DNA migration during electrophoresis on agarose gels (1-6), and electronic imaging for accurate determinations of DNA mass (7-9). Although all these components improve sensitivity and throughput of large numbers of samples (7,8,10), a simple version using only standard molecular biology equipment allows routine analysis of DNA damages at moderate frequencies. We present here a description of the methods, as well as a brief description of the underlying principles, required for a simplified approach to quantitation of DNA damages by alkaline gel electrophoresis.

  8. Magnetic molecularly imprinted polymers based on silica modified by deep eutectic solvents for the rapid simultaneous magnetic-based solid-phase extraction of Salvia miltiorrhiza bunge, Glycine max (Linn.) Merr and green tea.

    Science.gov (United States)

    Li, Guizhen; Wang, Xiaoqin; Row, Kyung Ho

    2018-04-01

    Novel magnetic molecularly imprinted polymers (MMIPs) with multiple-template based on silica were modified by four types of deep eutectic solvents (DESs) for the rapid simultaneous magnetic solid-phase extraction (MSPE) of tanshinone Ⅰ, tanshinone ⅡA, and cryptotanshinone from Salvia miltiorrhiza bunge; glycitein, genistein, and daidzein from Glycine max (Linn.) Merr; and epicatechin, epigallocatechin gallate, and epicatechin gallate from green tea, respectively. The synthesized materials were characterized by Fourier transform infrared spectroscopy and field emission scanning electron microscopy. Single factor experiments were to explore the relationship between the extraction efficiency and four factors (the sample solution pH, amount of DESs for modification, amount of adsorbent, and extraction time). It was showed that the DES4-MMIPs have better extraction ability than the MMIPs without DESs and the other three DESs-modified MMIPs. The best extraction recoveries with DES4-MMIP were tanshinone Ⅰ (85.57%), tanshinone ⅡA (80.58%), cryptotanshinone (92.12%), glycitein (81.65%), genistein (87.72%), daidzein (92.24%), epicatechin (86.43%), epigallocatechin gallate (80.92%), and epicatechin gallate (93.64%), respectively. The novel multiple-template MMIPs materials modified by DES for the rapid simultaneous MSPE of active compounds were proved to reduce the experimental steps than single-template technique, and increase the extraction efficiency. © 2018 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  9. Photo-catalyzed and phyto-mediated rapid green synthesis of silver nanoparticles using herbal extract of Salvinia molesta and its antimicrobial efficacy.

    Science.gov (United States)

    Verma, Devendra Kumar; Hasan, Syed Hadi; Banik, Rathindra Mohan

    2016-02-01

    Current study presents an economic, ecofriendly and simple photo-catalytic green route for the swift biosynthesis of silver nanoparticles (AgNPs) within 20s, devoid of any instrumental support or chemical reductant. Aqueous leaf-extract of an aquatic fern, Salvinia molesta (AES), was used as a bioreductant as well as a stabilizing agent. Rapid change in color of reaction mixture from yellowish green to reddish brown within 20s in direct sun light exposure was considered as the primary visual indication of AgNPs biosynthesis. The biosynthesis of AgNPs was confirmed by UV-visible spectroscopy through the presence of a characteristic surface plasmon resonance (SPR) band for AgNPs at λmax of 425 nm. The process parameters were optimized through one factor at a time approach. Optimal values of different process parameters for the current biosynthetic system were found as; 35 min of reaction time under sun light, 8.0mM AgNO3 concentration and 5.0% (v/v) AES inoculum dose. Field emission scanning electron microscopy (FESEM), energy dispersive X-Ray spectroscopy (EDX), high resolution transmission electron microscopy (HRTEM), atomic force microscopy (AFM) and X-ray diffraction (XRD) analysis showed that most of AgNPs were spherical in shape with average size distribution of 12.46 nm having face centered cubic (fcc) crystal lattice. IR analysis of AES and synthesized AgNPs indicated the involvement of both hydroxyl and amino groups in the biosynthesis and stabilization of AgNPs. The synthesized AgNPs were found to be an effective antibacterial agent against both Gram positive and Gram negative bacteria. On the basis of results and facts, a probable mechanism has also been proposed to explore the possible route of biosynthesis of AgNPs through AES. Copyright © 2015 Elsevier B.V. All rights reserved.

  10. Simplified and rapid method for extraction of ergosterol from natural samples and detection with quantitative and semi-quantitative methods using thin-layer chromatography

    OpenAIRE

    Larsen, Cand.scient Thomas; Ravn, Senior scientist Helle; Axelsen, Senior Scientist Jørgen

    2004-01-01

    A new and simplified method for extraction of ergosterol (ergoste-5,7,22-trien-3-beta-ol) from fungi in soil and litter was developed using pre-soaking extraction and paraffin oil for recovery. Recoveries of ergosterol were in the range of 94 - 100% depending on the solvent to oil ratio. Extraction efficiencies equal to heat-assisted extraction treatments were obtained with pre-soaked extraction. Ergosterol was detected with thin-layer chromatography (TLC) using fluorodensitometry with a quan...

  11. Development of a rapid method for the sequential extraction and subsequent quantification of fatty acids and sugars from avocado mesocarp tissue.

    Science.gov (United States)

    Meyer, Marjolaine D; Terry, Leon A

    2008-08-27

    Methods devised for oil extraction from avocado (Persea americana Mill.) mesocarp (e.g., Soxhlet) are usually lengthy and require operation at high temperature. Moreover, methods for extracting sugars from avocado tissue (e.g., 80% ethanol, v/v) do not allow for lipids to be easily measured from the same sample. This study describes a new simple method that enabled sequential extraction and subsequent quantification of both fatty acids and sugars from the same avocado mesocarp tissue sample. Freeze-dried mesocarp samples of avocado cv. Hass fruit of different ripening stages were extracted by homogenization with hexane and the oil extracts quantified for fatty acid composition by GC. The resulting filter residues were readily usable for sugar extraction with methanol (62.5%, v/v). For comparison, oil was also extracted using the standard Soxhlet technique and the resulting thimble residue extracted for sugars as before. An additional experiment was carried out whereby filter residues were also extracted using ethanol. Average oil yield using the Soxhlet technique was significantly (P < 0.05) higher than that obtained by homogenization with hexane, although the difference remained very slight, and fatty acid profiles of the oil extracts following both methods were very similar. Oil recovery improved with increasing ripeness of the fruit with minor differences observed in the fatty acid composition during postharvest ripening. After lipid removal, methanolic extraction was superior in recovering sucrose and perseitol as compared to 80% ethanol (v/v), whereas mannoheptulose recovery was not affected by solvent used. The method presented has the benefits of shorter extraction time, lower extraction temperature, and reduced amount of solvent and can be used for sequential extraction of fatty acids and sugars from the same sample.

  12. PURIFICATION AND CHARACTERISATION OF ALKALINE ...

    African Journals Online (AJOL)

    Prof. Adipala Ekwamu

    There was no clear decrease in the yield seen in the bands and the loss of enzyme was not observed with the gel analysis. It may ... The native gel results show clear distinct bands for the 3 alkaline phosphotase isoenzymes ..... British Medical.

  13. Alkaline resistant ceramics; Alkalimotstaandskraftiga keramer

    Energy Technology Data Exchange (ETDEWEB)

    Westberg, Stig-Bjoern [Vattenfall Utveckling AB, Aelvkarleby (Sweden)

    2001-02-01

    Despite durability in several environments, ceramics and refractories can not endure alkaline environments at high temperature. An example of such an environment is when burning biofuel in modern heat and power plants in which the demand for increasing efficiency results in higher combustion temperatures and content of alkaline substances in the flue gas. Some experiences of these environments has been gained from such vastly different equipment as regenerator chambers in the glass industry and MHD-generators. The grains of a ceramic material are usually bonded together by a glassy phase which despite it frequently being a minor constituent render the materials properties and limits its use at elevated temperature. The damage is usually caused by alkaline containing low-melting phases and the decrease of the viscosity of the bonding glass phase which is caused by the alkaline. The surfaces which are exposed to the flue gas in a modern power plant are not only exposed to the high temperature but also a corroding and eroding, particle containing, gas flow of high velocity. The use of conventional refractory products is limited to 1300-1350 deg C. Higher strength and fracture toughness as well as durability against gases, slag and melts at temperatures exceeding 1700 deg C are expected of the materials of the future. Continuous transport of corrosive compounds to the surface and corrosion products from the surface as well as a suitable environment for the corrosion to occur in are prerequisites for extensive corrosion to come about. The highest corrosion rate is therefore found in a temperature interval between the dew point and the melting point of the alkaline-constituent containing compound. It is therefore important that the corrosion resistance is sufficient in the environment in which alkaline containing melts or slag may appear. In environments such as these, even under normal circumstances durable ceramics, such as alumina and silicon carbide, are attacked

  14. [Application of rapid PCR to authenticate medicinal snakes].

    Science.gov (United States)

    Chen, Kang; Jiang, Chao; Yuan, Yuan; Huang, Lu-Qi; Li, Man

    2014-10-01

    To obtained an accurate, rapid and efficient method for authenticate medicinal snakes listed in Chinese Pharmacopoeia (Zaocysd humnades, Bungarus multicinctus, Agkistrodon acutus), a rapid PCR method for authenticate snakes and its adulterants was established based on the classic molecular authentication methods. DNA was extracted by alkaline lysis and the specific primers were amplified by two-steps PCR amplification method. The denatured and annealing temperature and cycle numbers were optimized. When 100 x SYBR Green I was added in the PCR product, strong green fluorescence was visualized under 365 nm UV whereas adulterants without. The whole process can complete in 30-45 minutes. The established method provides the technical support for authentication of the snakes on field.

  15. Homogeneous liquid-liquid extraction (HoLLE) via flotation combined with gas chromatography-flame ionization detection as a very simple, rapid and sensitive method for the determination of fenitrothion in water samples.

    Science.gov (United States)

    Mashayekhi, Hossein Ali

    2013-01-01

    Homogeneous liquid-liquid extraction via flotation assistance (HoLLE-FA) and gas chromatography-flame ionization detection (GC-FID) was presented for the extraction and determination of fenitrothion in water samples. In this work, a rapid, simple and efficient HoLLE-FA method was developed based on applying low-density organic solvents without employing centrifugation. A special extraction cell was designed to facilitate the collection of low-density solvent extraction in the determination of fenitrothion in water samples. The water sample solution was added into an extraction cell that contained an appropriate mixture of extraction and homogeneous solvents. By using air flotation, the organic solvent was collected at the conical part of the designed cell. Under the optimum conditions, the method performance was studied in terms of the linear dynamic range (LDR from 1.0 up to 100 μg L⁻¹), linearity (r² > 0.998), and precision (repeatability extraction and determination of fenitrothion in three different water samples.

  16. Simple and Rapid Dual-Dispersive Liquid-Liquid Microextraction as an Innovative Extraction Method for Uranium in Real Water Samples Prior to the Determination of Uranium by a Spectrophotometric Technique.

    Science.gov (United States)

    Khan, Naeemullah; Tuzen, Mustafa; Kazi, Tasneem Gul

    2017-11-01

    An innovative, rapid, and simple dual-dispersive liquid-liquid microextraction (DDLL-ME) approach was used to extract uranium from real samples for the first time. The main objective of this study was to disperse extraction solvent by using an air-agitated syringe system to overcome matrix effects and avoid dispersion of hazardous dispersive organic solvents by using heat. The DDLL-ME method consisted of two dispersive liquid-liquid extraction steps with chloroform as the extracting solvent. Uranium formed complexes with 4-(2-thiazolylazo) resorcinol in the aqueous phase and was extracted in extracting solvent (chloroform) after the first dispersive liquid-liquid process. Uranium was then back-extracted in the acidic aqueous phase in a second dispersive liquid-liquid process. Finally, uranium was determined by a spectrophotometric detection technique. The variables that played a key role in the proposed method were studied and optimized. The LOD and sensitivity enhancement factor for uranium were found to be 0.60 µg/L and 45, respectively, under optimized conditions. Calibration graphs were found to be linear in the range of 5.0-600 µg/L. The RSD was 2.5%. Reliability of the proposed method was verified by analyzing certified reference material TM-28.3.

  17. Optical properties of alkaline earth borate glasses

    African Journals Online (AJOL)

    user

    ... devices; radiation shields, surgical lasers and their glass ceramic counter ... Alkaline earth oxides improve glass forming capability while heavy metal ... reports on optical properties of MO-B2O3 glasses containing alkaline earth oxides.

  18. Qualitative Carbohydrate Analysis using Alkaline Potassium ...

    Indian Academy of Sciences (India)

    IAS Admin

    CLASSROOM. 285. RESONANCE | March 2016. Qualitative Carbohydrate Analysis using Alkaline. Potassium Ferricyanide. Keywords. Alkaline potassium ferricyanide, qualitative ... Carbohydrates form a distinct class of organic compounds often .... Laboratory Techniques: A contemporary Approach, W B Saunders Com-.

  19. Management of Purex spent solvents by the alkaline hydrolysis process

    International Nuclear Information System (INIS)

    Srinivas, C.; Manohar, Smitha; Vincent, Tessy; Wattal, P.K.; Theyyunni, T.K.

    1995-01-01

    Various treatment processes were evaluated on a laboratory scale for the management of the spent solvent from the extraction of nuclear materials. Based on the lab scale evaluation it is proposed to adopt the alkaline hydrolysis process as the treatment mode for the spent solvent. The process has advantages over the other processes in terms of simplicity, low cost and ease of disposal of the secondary waste generated. (author)

  20. Rapid determination of volatile constituents in safflower from Xinjiang and Henan by ultrasonic-assisted solvent extraction and GC–MS

    OpenAIRE

    Jia, Ling-Han; Liu, Yi; Li, Yu-Zhen

    2011-01-01

    The total volatile components were extracted from safflower by ultrasonic-assisted solvent extraction (USE) and their chemical constituents were analyzed by gas chromatographyâmass spectrometry (GCâMS) to provide scientific basis for the quality control of safflower. Five different solvents (diethyl ether, ethanol, ethyl acetate, dichloromethane and acetone) were used and compared in terms of number of volatile components extracted and the peak areas of these components in TIC. The results sh...

  1. Development of alkaline fuel cells.

    Energy Technology Data Exchange (ETDEWEB)

    Hibbs, Michael R.; Jenkins, Janelle E.; Alam, Todd Michael; Janarthanan, Rajeswari; Horan, James L.; Caire, Benjamin R.; Ziegler, Zachary C.; Herring, Andrew M.; Yang, Yuan; Zuo, Xiaobing; Robson, Michael H.; Artyushkova, Kateryna; Patterson, Wendy; Atanassov, Plamen Borissov

    2013-09-01

    This project focuses on the development and demonstration of anion exchange membrane (AEM) fuel cells for portable power applications. Novel polymeric anion exchange membranes and ionomers with high chemical stabilities were prepared characterized by researchers at Sandia National Laboratories. Durable, non-precious metal catalysts were prepared by Dr. Plamen Atanassovs research group at the University of New Mexico by utilizing an aerosol-based process to prepare templated nano-structures. Dr. Andy Herrings group at the Colorado School of Mines combined all of these materials to fabricate and test membrane electrode assemblies for single cell testing in a methanol-fueled alkaline system. The highest power density achieved in this study was 54 mW/cm2 which was 90% of the project target and the highest reported power density for a direct methanol alkaline fuel cell.

  2. Chromatographic separation of alkaline phosphatase from dental enamel

    DEFF Research Database (Denmark)

    Moe, D; Kirkeby, S; Salling, E

    1989-01-01

    Alkaline phosphatase (AP) was prepared from partly mineralized bovine enamel by extraction in phosphate buffer, centrifugation and various chromatographic techniques. Chromatofocusing showed that the enamel enzyme possessed five isoelectric points at the acid pH level ranging from pH 5.7 to pH 4.......4. Three enzyme peaks were eluted using low pressure chromatography with a Bio-gel column. With a HPLC gel filtration column the separation of the enamel extract resulted in only one peak with AP activity. The fractions of this peak were used to produce an antibody against bovine AP....

  3. Extraction of intracellular protein from Glaciozyma antarctica for proteomics analysis

    Science.gov (United States)

    Faizura, S. Nor; Farahayu, K.; Faizal, A. B. Mohd; Asmahani, A. A. S.; Amir, R.; Nazalan, N.; Diba, A. B. Farah; Muhammad, M. Nor; Munir, A. M. Abdul

    2013-11-01

    Two preparation methods of crude extracts of psychrophilic yeast Glaciozyma antarctica were compared in order to obtain a good recovery of intracellular proteins. Extraction with mechanical procedures using sonication was found to be more effective for obtaining good yield compare to alkaline treatment method. The procedure is simple, rapid, and produce better yield. A total of 52 proteins were identified by combining both extraction methods. Most of the proteins identified in this study involves in the metabolic process including glycolysis pathway, pentose phosphate pathway, pyruyate decarboxylation and also urea cyle. Several chaperons were identified including probable cpr1-cyclophilin (peptidylprolyl isomerase), macrolide-binding protein fkbp12 and heat shock proteins which were postulate to accelerate proper protein folding. Characteristic of the fundamental cellular processes inferred from the expressed-proteome highlight the evolutionary and functional complexity existing in this domain of life.

  4. Alkaline phosphatase activity in gingival crevicular fluid during canine retraction.

    Science.gov (United States)

    Batra, P; Kharbanda, Op; Duggal, R; Singh, N; Parkash, H

    2006-02-01

    The aim of the study was to investigate alkaline phosphatase activity in the gingival crevicular fluid (GCF) during orthodontic tooth movement in humans. Postgraduate orthodontic clinic. Ten female patients requiring all first premolar extractions were selected and treated with standard edgewise mechanotherapy. Canine retraction was done using 100 g sentalloy springs. Maxillary canine on one side acted as experimental site while the contralateral canine acted as control. Gingival crevicular fluid was collected from mesial and distal of canines before initiation of canine retraction (baseline), immediately after initiation of retraction, and on 1st, 7th, 14th and 21st day and the alkaline phosphatase activity was estimated. The results show significant (p < 0.05) changes in alkaline phosphatase activity on the 7th, 14th and 21st day on both mesial and distal aspects of the compared experimental and control sides. The peak in enzyme activity occurred on the 14th day of initiation of retraction followed by a significant fall in activity especially on the mesial aspect. The study showed that alkaline phosphatase activity could be successfully estimated in the GCF using calorimetric estimation assay kits. The enzyme activity showed variation according to the amount of tooth movement.

  5. Rapid Identification and Quantification of Natural Antioxidants in the Seeds of Rhubarb from Different Habitats in China Using Accelerated Solvent Extraction and HPLC-DAD-ESI-MSn-DPPH Assay.

    Science.gov (United States)

    Tan, Liang; Geng, Dan-dan; Hu, Feng-zu; Dong, Qi

    2016-01-01

    In this study, the 10 accessions of rhubarb seeds from different habitats in China were investigated. Lipids were removed using petroleum ether, and the effective components were then separated using accelerated solvent extraction with 80% aqueous methanol. An off-line 2,2-diphenyl-1-picrylhydrazyl (DPPH) free-radical scavenging method was used as the marker to evaluate the total antioxidant capability of extracts. On-line high-performance liquid chromatography-diode-array detectors-electrospray ionization-tandem mass spectrometry (HPLC-DAD-ESI-MS(n)) and HPLC-DAD-DPPH assays were developed for rapid identification and quantification of individual free-radical scavengers in extracts of rhubarb seeds. Ten free-radical scavengers from methanolic extracts of the rhubarb seeds were screened, five of which were identified and quantitatively analyzed: epicatechin, myricetin, hyperoside, quercitrin and quercetin. All were identified in rhubarb seeds for the first time and can be regarded as the major potent antioxidants in rhubarb seeds due to representing most of the total free-radical scavenging activity. Preliminary analysis of structures was performed for another five antioxidants. Based on our validation results, the developed method can be used for rapid separation, convenient identification and quantification of the multiple antioxidative constituents in rhubarb seeds, featuring good quantification parameters, accuracy and precision. The results are important to clarify the material basis and therapeutic mechanism of rhubarb seeds. © The Author 2015. Published by Oxford University Press. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

  6. Feature extraction from high resolution satellite imagery as an input to the development and rapid update of a METRANS geographic information system (GIS).

    Science.gov (United States)

    2011-06-01

    This report describes an accuracy assessment of extracted features derived from three : subsets of Quickbird pan-sharpened high resolution satellite image for the area of the : Port of Los Angeles, CA. Visual Learning Systems Feature Analyst and D...

  7. Rapid determination of the volatile components in tobacco by ultrasound-microwave synergistic extraction coupled to headspace solid-phase microextraction with gas chromatography-mass spectrometry.

    Science.gov (United States)

    Yang, Yanqin; Chu, Guohai; Zhou, Guojun; Jiang, Jian; Yuan, Kailong; Pan, Yuanjiang; Song, Zhiyu; Li, Zuguang; Xia, Qian; Lu, Xinbo; Xiao, Weiqiang

    2016-03-01

    An ultrasound-microwave synergistic extraction coupled to headspace solid-phase microextraction was first employed to determine the volatile components in tobacco samples. The method combined the advantages of ultrasound, microwave, and headspace solid-phase microextraction. The extraction, separation, and enrichment were performed in a single step, which could greatly simplify the operation and reduce the whole pretreatment time. In the developed method, several experimental parameters, such as fiber type, ultrasound power, and irradiation time, were optimized to improve sampling efficiency. Under the optimal conditions, there were 37, 36, 34, and 36 components identified in tobacco from Guizhou, Hunan, Yunnan, and Zimbabwe, respectively, including esters, heterocycles, alkanes, ketones, terpenoids, acids, phenols, and alcohols. The compound types were roughly the same while the contents were varied from different origins due to the disparity of their growing conditions, such as soil, water, and climate. In addition, the ultrasound-microwave synergistic extraction coupled to headspace solid-phase microextraction method was compared with the microwave-assisted extraction coupled to headspace solid-phase microextraction and headspace solid-phase microextraction methods. More types of volatile components were obtained by using the ultrasound-microwave synergistic extraction coupled to headspace solid-phase microextraction method, moreover, the contents were high. The results indicated that the ultrasound-microwave synergistic extraction coupled to headspace solid-phase microextraction technique was a simple, time-saving and highly efficient approach, which was especially suitable for analysis of the volatile components in tobacco. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  8. A rapid and validated HPLC method to quantify sphingosine 1-phosphate in human plasma using solid-phase extraction followed by derivatization with fluorescence detection

    NARCIS (Netherlands)

    Butter, Jan J.; Koopmans, Richard P.; Michel, Martin C.

    2005-01-01

    We describe the development and validation of analytical methodology for the determination of sphingosine 1-phosphate (S1P) in plasma. It uses solid-phase extraction (SPE) followed by an automated reversed-phase gradient HPLC column-switching system with a pre-column derivatization with

  9. A Rapid Magnetic Solid Phase Extraction Method Followed by Liquid Chromatography-Tandem Mass Spectrometry Analysis for the Determination of Mycotoxins in Cereals.

    Science.gov (United States)

    Barbera, Giorgia La; Capriotti, Anna Laura; Cavaliere, Chiara; Foglia, Patrizia; Montone, Carmela Maria; Chiozzi, Riccardo Zenezini; Laganà, Aldo

    2017-04-21

    Mycotoxins can contaminate various food commodities, including cereals. Moreover, mycotoxins of different classes can co-contaminate food, increasing human health risk. Several analytical methods have been published in the literature dealing with mycotoxins determination in cereals. Nevertheless, in the present work, the aim was to propose an easy and effective system for the extraction of six of the main mycotoxins from corn meal and durum wheat flour, i.e., the main four aflatoxins, ochratoxin A, and the mycoestrogen zearalenone. The developed method exploited magnetic solid phase extraction (SPE), a technique that is attracting an increasing interest as an alternative to classical SPE. Therefore, the use of magnetic graphitized carbon black as a suitable extracting material was tested. The same magnetic material proved to be effective in the extraction of mycoestrogens from milk, but has never been applied to complex matrices as cereals. Ultra high-performance liquid chromatography tandem mass spectrometry was used for detection. Recoveries were >60% in both cereals, even if the matrix effects were not negligible. The limits of quantification of the method results were comparable to those obtained by other two magnetic SPE-based methods applied to cereals, which were limited to one or two mycotoxins, whereas in this work the investigated mycotoxins belonged to three different chemical classes.

  10. Development of a rapid LC-DAD/FLD method for the simultaneous determination of auxins and abscisic acid in plant extracts.

    Science.gov (United States)

    Bosco, Renato; Caser, Matteo; Vanara, Francesca; Scariot, Valentina

    2013-11-20

    Plant hormones play a crucial role in controlling plant growth and development. These groups of naturally occurring substances trigger physiological processes at very low concentrations, which mandate sensitive techniques for their quantitation. This paper describes a method to quantify endogenous (±)-2-cis-4-trans-abscisic acid, indole-3-acetic acid, indole-3-propionic acid, and indole-3-butyric acid. The method combines high-performance liquid chromatography (HPLC) with diode array and fluorescence detection in a single run. Hybrid tea rose 'Monferrato' matrices (leaves, petals, roots, seeds, androecium, gynoecium, and pollen) were used as references. Rose samples were separated and suspended in extracting methanol, after which (±)-2-cis-4-trans-abscisic acid and auxins were extracted by solvent extraction. Sample solutions were added first to cation solid phase extraction (SPE) cartridges and the eluates to anion SPE cartridges. The acidic hormones were bound to the last column and eluted with 5% phosphoric acid in methanol. Experimental results showed that this approach can be successfully applied to real samples and that sample preparation and total time for routine analysis can be greatly reduced.

  11. Rapid and simple pretreatment of human body fluids using electromembrane extraction across supported liquid membrane for capillary electrophoretic determination of lithium

    Czech Academy of Sciences Publication Activity Database

    Strieglerová, Lenka; Kubáň, Pavel; Boček, Petr

    2011-01-01

    Roč. 32, č. 10 (2011), s. 1182-1189 ISSN 0173-0835 R&D Projects: GA ČR GAP206/10/1219 Institutional research plan: CEZ:AV0Z40310501 Keywords : electromembrane extraction * biological samples * capillary electrophoresis Subject RIV: CB - Analytical Chemistry, Separation Impact factor: 3.303, year: 2011

  12. A Rapid Magnetic Solid Phase Extraction Method Followed by Liquid Chromatography-Tandem Mass Spectrometry Analysis for the Determination of Mycotoxins in Cereals

    Directory of Open Access Journals (Sweden)

    Giorgia La Barbera

    2017-04-01

    Full Text Available Mycotoxins can contaminate various food commodities, including cereals. Moreover, mycotoxins of different classes can co-contaminate food, increasing human health risk. Several analytical methods have been published in the literature dealing with mycotoxins determination in cereals. Nevertheless, in the present work, the aim was to propose an easy and effective system for the extraction of six of the main mycotoxins from corn meal and durum wheat flour, i.e., the main four aflatoxins, ochratoxin A, and the mycoestrogen zearalenone. The developed method exploited magnetic solid phase extraction (SPE, a technique that is attracting an increasing interest as an alternative to classical SPE. Therefore, the use of magnetic graphitized carbon black as a suitable extracting material was tested. The same magnetic material proved to be effective in the extraction of mycoestrogens from milk, but has never been applied to complex matrices as cereals. Ultra high–performance liquid chromatography tandem mass spectrometry was used for detection. Recoveries were >60% in both cereals, even if the matrix effects were not negligible. The limits of quantification of the method results were comparable to those obtained by other two magnetic SPE-based methods applied to cereals, which were limited to one or two mycotoxins, whereas in this work the investigated mycotoxins belonged to three different chemical classes.

  13. Rapid determination of alkaloids in Macleaya cordata using ionic liquid extraction followed by multiple reaction monitoring UPLC-MS/MS analysis.

    Science.gov (United States)

    Li, Linqiu; Huang, Mingyuan; Shao, Junli; Lin, Bokun; Shen, Qing

    2017-02-20

    The ultrasonic-assisted extraction (UAE) and ionic liquid based dispersive liquid-liquid microextraction (IL-DLLME) have been successfully applied in extracting of six alkaloids from M. cordata. 1-hexyl-3-methylimidazolium tetrafluoroborate ([C 6 MIM][BF 4 ]) aqueous solution was used as extraction solvent. The target analytes in raw material were deposited into a single drop of 1-hexyl-3-methylimidazolium hexafluorophosphate ([C 6 MIM][PF 6 ]), which was in situ formed by mixing [C 6 MIM][BF 4 ] and potassium hexafluorophosphate ([K][PF 6 ]. Afterwards, the extract was analyzed by ultra-performance liquid chromatography tandem mass spectrometry (UPLC-MS/MS) in multiple-reaction monitoring (MRM) mode. The proposed method was fully validated in terms of linearity (0.9983-0.9992), LOD (0.080ngmL -1 ), LOQ (0.25ngmL -1 ), intra-day precision (MS/MS is powerful and practical for analyzing alkaloids in M. cordata., and it also has great potential for comprehensive quality control of other herbal medicines. Copyright © 2016 Elsevier B.V. All rights reserved.

  14. Non-polluting treatment of alkaline uranium effluents contaning SO42- ions

    International Nuclear Information System (INIS)

    Berger, Bernard.

    1978-01-01

    New non-polluting process for treating uranium effluents from the alkaline digestion of an uranium ore containing sulfur, which makes it possible, on the one hand, to extract uranium and SO 4 2- contained in these effluents allowing the recycling of the sole alkaline carbonates and/or bicarbonates involved, towards the digestion of the ore and on the other hand the separation of the mixture uranium and SO 4 2- ions extracted simultaneously to obtain relatively pure uranium in oxide form [fr

  15. Progress of research on the influence of alkaline cation and alkaline solution on bentonite properties

    International Nuclear Information System (INIS)

    Ye Weimin; Zheng Zhenji; Chen Bao; Chen Yonggui

    2011-01-01

    Based on the previous laboratory studies and numerical simulation on bentonite in alkaline environments, the effects of alkaline cation and alkaline solution on mineral composition, microstructure, swelling capacity and hydraulic properties of bentonite are emphasized in this paper, temperature, pH values and concentration are discussed as main affecting factors. When bentonite is exposed to alkaline cation or alkaline solution, microstructure of bentonite will be changed due to the dissolution of montmorillonite and the formation of secondary minerals, which results in the decrease of swelling pressure. The amount of the reduction of swelling pressure depends on the concentration of alkaline solution. Temperature, polyvalent cation, salinity and concentration are the main factors affecting hydraulic properties of bentonite under alkaline conditions. Therefore, future research should focus on the mechanism of coupling effects of weak alkaline solutions on the mineral composition, microstructure, swelling capacity and hydraulic properties of bentonite under different temperatures and different pH values. (authors)

  16. 大豆种子DNA快速提取方法的改良及应用%Improvement and application of the rapid DNA extraction method from Soybean Seeds

    Institute of Scientific and Technical Information of China (English)

    朱振雷; 束永俊; 李勇; 柏锡; 才华; 纪巍; 朱延明

    2009-01-01

    High-quality DNA is an important base of molecular biology manipulation, such as gene cloning. There are lots of protein and fat in the soybean seeds, so the DNA extracted from them by using traditional methods is very difficult to achieve quality requirements of experiments. This study improved the SDS extraction buffer by adding NP-40 and Tween-20, and established a rapid DNA extraction method that is suitable for soybean seeds. The DNA extraction by the optimized SDS extraction method has high-quality, and the values of OD_(260)/OD_(280) ranged from 1.809 to 1.916, that means non-protein and RNA pollution. The DNA extraction method was validated by gene cloning and genotyping, and the results showed that it could be used for soybean gene cloning and molecular markers.%高质量的DNA是进行基因克隆等分子生物学试验的前提条件.因大豆种子中蛋白质和油脂含量丰富,利用传统方法提取DNA质量很难达到试验要求.研究在SDS提取液的基础上.通过添加表面活性剂NP-40和Tween-20,优化出一种适合于大豆种子DNA快速提取的方法.优化后的SDS方法提取的DNA质量较高.OD_(260)/OD_(280)在1.809~1.916之间,无蛋白质和RNA污染.对该方法提取的DNA进行了基因克隆和分子标记的试验验证,结果表明,它们能够用于大豆基因克隆、分子标记.

  17. Pollution control and resource reuse for alkaline hydrometallurgy of amphoteric metal hazardous wastes

    CERN Document Server

    Youcai, Zhao

    2017-01-01

    This book provides a comprehensive description of alkaline hydrometallurgy of amphoteric metal hazardous wastes. Topics focus on leaching of zinc and lead hazardous wastes, purification of leach solution of zinc and lead, electrowinning of zinc and lead from purified alkaline solutions, chemical reactions taking place in the production flowsheets, thermodynamic and spent electrolyte regeneration, alkaline hydrometallurgy of low-grade smithsonite ores, recovery of molybdenum and tungsten using ion flotation and solvent extraction processes and their application in chemical synthesis of Nb and Ta inorganic compounds, and industrial scale production of 1500-2000 t/a zinc powder using alkaline leaching–electrowinning processes. Processes described are cost-effective, generate lesser secondary pollutants, and have been applied widely in China. Readers that will find the book appealing include solid waste engineers, environmental managers, technicians, recycling coordinators, government officials, undergraduates ...

  18. Determination of As, Cr, Mo, Sb, Se and V in agricultural soil samples by inductively coupled plasma optical emission spectrometry after simple and rapid solvent extraction using choline chloride-oxalic acid deep eutectic solvent.

    Science.gov (United States)

    Matong, Joseph M; Nyaba, Luthando; Nomngongo, Philiswa N

    2017-01-01

    A rapid, simple and green ultrasound-assisted extraction method using deep eutectic solvents (DES) for extraction of As, Cr, Mo, Sb, Se and V in soil samples, has been developed. Choline chloride-oxalic acid based DES was used as a solvent. The target analytes were subsequently quantified using inductively coupled plasma optical emission spectrometer (ICP OES). The parameters that affect the extraction of the target analytes was optimized using standard reference material of San Joaquin soil (SRM 2709a). In the optimization step, a two-level full factorial experimental design was used. The factors under investigation include extraction time, sample mass and acid concentration. Under optimized conditions, limits of detection (LOD) and limits of quantification (LOQ) ranged from 0.009 to 0.1 and 0.03-0.3µgg -1 , respectively. The repeatability (n=20) estimated in terms of relative standard deviation (%RSD) ranged from 0.9% to 3.7%. The accuracy of the proposed method was carried out using SRM 2709a. The obtained and certified/ indicative values were statistically in good agreement at 95% confidence level. The proposed method applied for quantification of As, Cr, Mo, Sb, Se and V in real soil samples. For comparison, the analytes of interest were also determined using a conventional acid digestion method. According to the paired t-test, the analytical results were not significant differences at 95% confidence level. The method was found to be accurate, precise and environmentally friendly. Copyright © 2016 Elsevier Inc. All rights reserved.

  19. A Rapid Centrifugation-Assisted Solid-Phase Extraction and Liquid Chromatography Method for Determination of Loureirin A and Loureirin B of Dragon's Blood Capsules in Rat Plasma and Urine After Oral Administration.

    Science.gov (United States)

    Chen, Xiaoshuang; Li, Gaofeng; Ma, Shangfang; Hu, Xujia

    2015-07-01

    A simple, sensitive and rapid centrifugation-assisted solid-phase extraction (SPE) with high-performance liquid chromatography (SPE-HPLC) method was developed for simultaneous determination of the metabolites loureirin A and loureirin B from Dragon's blood in rat plasma and urine. The development of the extraction procedure included optimization of some important extraction phases. After evaluation, the metabolites of Dragon's blood were extracted by centrifugation-assisted SPE and separated by using HPLC. This method showed good linearity (r(2) > 0.99), and in the rat plasma and urine, the recoveries were 93.1 and 95.7% for loureirin A and were 90.1 and 94.2% for loureirin B. The relative standard deviation (RSD) values of intraday and interday precision in rat plasma and urine for loureirin A were <3.84 and 2.01%, respectively. The RSD values of the intraday and interday precision in rat plasma and urine for loureirin B were below 4.25 and 5.83%, respectively. Thus, the established method is suitable for metabolism studies of loureirin A and loureirin B in rat plasma and urine. © The Author 2015. Published by Oxford University Press. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

  20. Sunlight based irradiation strategy for rapid green synthesis of highly stable silver nanoparticles using aqueous garlic (Allium sativum) extract and their antibacterial potential

    International Nuclear Information System (INIS)

    Rastogi, Lori; Arunachalam, J.

    2011-01-01

    Highlights: → We report green synthetic route for the production crystalline silver nanoparticles using garlic as both reducing and stabilizing agent. → Synthesis has been achieved by exposing the solution mixture of [Ag(NH 3 ) 2 ] + and aqueous garlic extract under sunlight. → Role of light in the synthesis process has been investigated and is discussed in detail. → The antibacterial effect of the synthesized silver nanoparticles has been assessed against both Gram classes of bacteria. → Synthesized silver colloidal solutions were found to be stable for a very long period and retained their bactericidal potential. - Abstract: A green synthetic route for the production of highly stable silver nanoparticles using aqueous garlic extract is being reported for the first time. The silver nanoparticles were synthesized by exposing a mixture of 0.1 M [Ag(NH 3 ) 2 ] + and diluted aqueous garlic extract under bright sunlight for 15 min. The garlic extract components served as both reducing and capping agents in the synthesis of silver nanoparticles while the sunlight acted as catalyst in the synthesis process. The synthesized nanoparticles were characterized using UV-visible (UV-vis) spectrophotometer; transmission electron microscopy (TEM), glancing angle X-ray diffraction (GA-XRD) and Fourier transform infra red (FTIR) spectrometry. The nanoparticles were found to be poly-dispersed in nature, spherical in shape and of 7.3 ± 4.4 nm in size. The FTIR analysis was suggestive of proteins as capping agents around the nanoparticles. The yield of synthesized nanoparticles was calculated to be approximately 80% by dry weight and 85% ICP-AES method. The synthesized silver nanoparticles exhibited good antibacterial potential against both Gram positive and Gram negative bacterial strains, as measured using well diffusion assay. Most importantly, the silver colloidal solutions thus synthesized were found to be stable for a very long period (more than a year) and retained

  1. Rapid and simple pretreatment of human body fluids using electromembrane extraction across supported liquid membrane for capillary electrophoretic determination of lithium.

    Science.gov (United States)

    Strieglerová, Lenka; Kubáň, Pavel; Boček, Petr

    2011-05-01

    Electromembrane extraction was used for simultaneous sample cleanup and preconcentration of lithium from untreated human body fluids. The sample of a body fluid was diluted 100 times with 0.5 mM Tris solution and lithium was extracted by electromigration through a supported liquid membrane composed of 1-octanol into 100 mM acetic acid acceptor solution. Matrix compounds, such as proteins, red blood cells, and other high-molecular-weight compounds were efficiently retained on the supported liquid membrane. The liquid membrane was anchored in pores of a short segment of a polypropylene hollow fiber, which represented a low cost, single use, disposable extraction unit and was discarded after each use. Acceptor solutions were analyzed using capillary electrophoresis with capacitively coupled contactless conductivity detection (CE-C(4) D) and baseline separation of lithium was achieved in a background electrolyte solution consisting of 18 mM L-histidine and 40 mM acetic acid at pH 4.6. Repeatability of the electromembrane extraction-CE-C(4) D method was evaluated for the determination of lithium in standard solutions and real samples and was better than 0.6 and 8.2% for migration times and peak areas, respectively. The concentration limit of detection of 9 nM was achieved. The developed method was applied to the determination of lithium in urine, blood serum, blood plasma, and whole blood at both endogenous and therapeutic concentration levels. Copyright © 2011 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  2. Sunlight based irradiation strategy for rapid green synthesis of highly stable silver nanoparticles using aqueous garlic (Allium sativum) extract and their antibacterial potential

    Energy Technology Data Exchange (ETDEWEB)

    Rastogi, Lori [National Center for Chemical Characterization of Materials, Bhabha Atomic Research Centre, ECIL-PO, Hyderabad 500 062 (India); Arunachalam, J., E-mail: aruncccm@rediffmail.com [National Center for Chemical Characterization of Materials, Bhabha Atomic Research Centre, ECIL-PO, Hyderabad 500 062 (India)

    2011-09-15

    Highlights: {yields} We report green synthetic route for the production crystalline silver nanoparticles using garlic as both reducing and stabilizing agent. {yields} Synthesis has been achieved by exposing the solution mixture of [Ag(NH{sub 3}){sub 2}]{sup +} and aqueous garlic extract under sunlight. {yields} Role of light in the synthesis process has been investigated and is discussed in detail. {yields} The antibacterial effect of the synthesized silver nanoparticles has been assessed against both Gram classes of bacteria. {yields} Synthesized silver colloidal solutions were found to be stable for a very long period and retained their bactericidal potential. - Abstract: A green synthetic route for the production of highly stable silver nanoparticles using aqueous garlic extract is being reported for the first time. The silver nanoparticles were synthesized by exposing a mixture of 0.1 M [Ag(NH{sub 3}){sub 2}]{sup +} and diluted aqueous garlic extract under bright sunlight for 15 min. The garlic extract components served as both reducing and capping agents in the synthesis of silver nanoparticles while the sunlight acted as catalyst in the synthesis process. The synthesized nanoparticles were characterized using UV-visible (UV-vis) spectrophotometer; transmission electron microscopy (TEM), glancing angle X-ray diffraction (GA-XRD) and Fourier transform infra red (FTIR) spectrometry. The nanoparticles were found to be poly-dispersed in nature, spherical in shape and of 7.3 {+-} 4.4 nm in size. The FTIR analysis was suggestive of proteins as capping agents around the nanoparticles. The yield of synthesized nanoparticles was calculated to be approximately 80% by dry weight and 85% ICP-AES method. The synthesized silver nanoparticles exhibited good antibacterial potential against both Gram positive and Gram negative bacterial strains, as measured using well diffusion assay. Most importantly, the silver colloidal solutions thus synthesized were found to be stable for

  3. Rapid analysis of aminoglycoside antibiotics in bovine tissues using disposable pipette extraction and ultrahigh performance liquid chromatography-tandem mass spectrometry.

    Science.gov (United States)

    Lehotay, Steven J; Mastovska, Katerina; Lightfield, Alan R; Nuñez, Alberto; Dutko, Terry; Ng, Chilton; Bluhm, Louis

    2013-10-25

    A high-throughput qualitative screening and identification method for 9 aminoglycosides of regulatory interest has been developed, validated, and implemented for bovine kidney, liver, and muscle tissues. The method involves extraction at previously validated conditions, cleanup using disposable pipette extraction, and analysis by a 3 min ultrahigh-performance liquid chromatography-tandem mass spectrometry (UHPLC-MS/MS) method. The drug analytes include neomycin, streptomycin, dihydrosptreptomycin, and spectinomycin, which have residue tolerances in bovine in the US, and kanamicin, gentamicin, apramycin, amikacin, and hygromycin, which do not have US tolerances established in bovine tissues. Tobramycin was used as an internal standard. An additional drug, paromomycin also was validated in the method, but it was dropped during implementation due to conversion of neomycin into paromomycin. Proposed fragmentation patterns for the monitored ions of each analyte were elucidated with the aid of high resolution MS using a quadrupole-time-of-flight instrument. Recoveries from spiking experiments at regulatory levels of concern showed that all analytes averaged 70-120% recoveries in all tissues, except hygromycin averaged 61% recovery. Lowest calibrated levels were as low as 0.005 μg/g in matrix extracts, which approximately corresponded to the limit of detection for screening purposes. Drug identifications at levels advantages compared to the previous microbial inhibition screening assay, especially for distinguishing individual drugs from a mixture and improving identification of gentamicin in tissue samples. Published by Elsevier B.V.

  4. One simple DNA extraction device and its combination with modified visual loop-mediated isothermal amplification for rapid on-field detection of genetically modified organisms.

    Science.gov (United States)

    Zhang, Miao; Liu, Yinan; Chen, Lili; Quan, Sheng; Jiang, Shimeng; Zhang, Dabing; Yang, Litao

    2013-01-02

    Quickness, simplicity, and effectiveness are the three major criteria for establishing a good molecular diagnosis method in many fields. Herein we report a novel detection system for genetically modified organisms (GMOs), which can be utilized to perform both on-field quick screening and routine laboratory diagnosis. In this system, a newly designed inexpensive DNA extraction device was used in combination with a modified visual loop-mediated isothermal amplification (vLAMP) assay. The main parts of the DNA extraction device included a silica gel membrane filtration column and a modified syringe. The DNA extraction device could be easily operated without using other laboratory instruments, making it applicable to an on-field GMO test. High-quality genomic DNA (gDNA) suitable for polymerase chain reaction (PCR) and isothermal amplification could be quickly isolated from plant tissues using this device within 15 min. In the modified vLAMP assay, a microcrystalline wax encapsulated detection bead containing SYBR green fluorescent dye was introduced to avoid dye inhibition and cross-contaminations from post-LAMP operation. The system was successfully applied and validated in screening and identification of GM rice, soybean, and maize samples collected from both field testing and the Grain Inspection, Packers, and Stockyards Administration (GIPSA) proficiency test program, which demonstrated that it was well-adapted to both on-field testing and/or routine laboratory analysis of GMOs.

  5. A rapid genotyping method for an obligate fungal pathogen, Puccinia striiformis f.sp. tritici, based on DNA extraction from infected leaf and Multiplex PCR genotyping

    Directory of Open Access Journals (Sweden)

    Enjalbert Jérôme

    2011-07-01

    Full Text Available Abstract Background Puccinia striiformis f.sp. tritici (PST, an obligate fungal pathogen causing wheat yellow/stripe rust, a serious disease, has been used to understand the evolution of crop pathogen using molecular markers. However, numerous questions regarding its evolutionary history and recent migration routes still remains to be addressed, which need the genotyping of a large number of isolates, a process that is limited by both DNA extraction and genotyping methods. To address the two issues, we developed here a method for direct DNA extraction from infected leaves combined with optimized SSR multiplexing. Findings We report here an efficient protocol for direct fungal DNA extraction from infected leaves, avoiding the costly and time consuming step of spore multiplication. The genotyping strategy we propose, amplified a total of 20 SSRs in three Multiplex PCR reactions, which were highly polymorphic and were able to differentiate different PST populations with high efficiency and accuracy. Conclusion These two developments enabled a genotyping strategy that could contribute to the development of molecular epidemiology of yellow rust disease, both at a regional or worldwide scale.

  6. Kinetic studies of alkaline phosphatase extracted from rabbit (Lepus ...

    African Journals Online (AJOL)

    user

    activity, and the kinetic constants-maximum enzyme velocity (Vmax) and Michealis-Menten constant (Km) were evaluated. ... the enzyme a readily available parameter for diagnostic and research .... procedure while treatment means were separated by the least .... mammalian enzymes are responsible for this increase in ...

  7. Alkaline azide mutagenicity in cowpea

    Energy Technology Data Exchange (ETDEWEB)

    Mahna, S K; Bhargava, Anubha; Mohan, Lalit [Cytogenetics and Mycology Laboratory, Department of Botany, Government College, Ajmer (India)

    1990-07-01

    Sodium azide is known as a potent mutagen in cereals and legumes. It is very effective in acidic medium in barley. Here an attempt is made to measure the effectiveness of sodium azide in alkaline medium (pH 7.4) on cowpea (Vigna unguiculata (L.) Walp., variety FS-68). Seeds pre-soaked in distilled water for 5 hours were treated with different concentrations (10{sup -6}, 10{sup -5}, 10{sup -4} and 10{sup -3}M) of sodium azide (NaN{sub 3}) for 4 hours at 28{+-} 2 deg. C. Bottles were intermittently shaken, then the seeds were thoroughly washed in running tap water and subsequently planted in pots. The treatment caused significant biological damage such as reduction in seed germination, length of root and shoot, number of nodules and pods per plant and morphological leaf variations. Morphological, as well as chlorophyll mutants, were detected in M{sub 2}.

  8. Alkaline azide mutagenicity in cowpea

    International Nuclear Information System (INIS)

    Mahna, S.K.; Bhargava, Anubha; Mohan, Lalit

    1990-01-01

    Sodium azide is known as a potent mutagen in cereals and legumes. It is very effective in acidic medium in barley. Here an attempt is made to measure the effectiveness of sodium azide in alkaline medium (pH 7.4) on cowpea (Vigna unguiculata (L.) Walp., variety FS-68). Seeds pre-soaked in distilled water for 5 hours were treated with different concentrations (10 -6 , 10 -5 , 10 -4 and 10 -3 M) of sodium azide (NaN 3 ) for 4 hours at 28± 2 deg. C. Bottles were intermittently shaken, then the seeds were thoroughly washed in running tap water and subsequently planted in pots. The treatment caused significant biological damage such as reduction in seed germination, length of root and shoot, number of nodules and pods per plant and morphological leaf variations. Morphological, as well as chlorophyll mutants, were detected in M 2

  9. Preparation of magnetic graphene/mesoporous silica composites with phenyl-functionalized pore-walls as the restricted access matrix solid phase extraction adsorbent for the rapid extraction of parabens from water-based skin toners.

    Science.gov (United States)

    Feng, Jianan; He, Xinying; Liu, Xiaodan; Sun, Xueni; Li, Yan

    2016-09-23

    In this work, phenyl-functionalized magnetic graphene/mesoporous silica composites (MG-mSiO2-Ph) were prepared and applied as restricted access matrix solid phase extraction (RAM-SPE) adsorbents to determine the parabens in commercially available retail cosmetics. MG-mSiO2-Ph composites were synthesized by a surfactant-mediated co-condensation reaction in which mesoporous silica with phenyl-functionalized pore-walls was coated on a magnetic graphene sheet. The obtained nano-composites were proven to be of sufficient quality for an ideal RAM-SPE adsorbent with a large specific surface area of 369m(2)g(-1), uniform mesopores of 2.8nm, and special phenyl-functionalized pore-walls. Parabens, such as methyl paraben, ethyl paraben and propyl paraben, were extracted from water-based skin toners using one step of the RAM-SPE and were then analysed by a HPLC-DAD system. The SPE conditions were optimized by studying the parameters, such as the adsorbent amount, elution solvent type, adsorption time and desorption time, that influence the extraction efficiency. For each analyte, there were good linearities of approximately 0.10-120μgmL(-1) with determination coefficients (R(2))>0.995. The sensitivity was as low as 0.01-0.025μgmL(-1) for the LOD, and the percent recoveries were 98.37-105.84%. The intra-day and inter-day RSDs were 1.44-6.11% (n=6) and 3.12-11.70% (n=6), respectively. The results indicated that this method with novel RAM-SPE adsorbents is sensitive and convenient. The results also offered an attractive alternative for the extraction and determination of paraben preservatives in a complex matrix, such as cosmetics. Copyright © 2016 Elsevier B.V. All rights reserved.

  10. Rapid monitoring of residual UV-stabilizers in seawater samples from beaches using fabric phase sorptive extraction and UHPLC-MS/MS.

    Science.gov (United States)

    García-Guerra, Romualdo B; Montesdeoca-Esponda, Sarah; Sosa-Ferrera, Zoraida; Kabir, Abuzar; Furton, Kenneth G; Santana-Rodríguez, José Juan

    2016-12-01

    Benzotriazole UV stabilizers (BUVSs) are a group of compounds added to personal care products such as sunscreens, hair dyes, make up formulations, soaps or shampoos, among others. Direct input from beaches or another aquatic recreational areas is the main source of BUVSs incorporation to the environment, where they can be mutagenic, toxic, pseudo-persistent and bioaccumulative. Due to the low levels of concentration of these compounds found in environmental samples, an extraction process is required prior to their determination. Fabric phase sorptive extraction integrates the advanced material properties of sol-gel hybrid inorganic-organic sorbents with flexible, permeable and functionally active fabric substrates, being a highly responsive, efficient and cheap device that also can be reused. In this paper, we applied fabric phase sorptive extraction methodology to analyse six BUVSs in twenty-four seawater samples from different coastal areas of Gran Canaria Island (Spain). It was coupled to ultra high performance liquid chromatography with tandem mass spectrometry in order to achieve a fast, reliable and sensitive separation and determination of the analytes from different simple matrices, regardless of its complexity and composition. Under the optimum conditions, the proposed method provided enrichment factors of 25 times with limits of detection from 1.06 to 8.96 ng L -1 and limits of quantification from 3.54 to 29.9 ng L -1 for the analytes under study in spiked samples. Intra and inter-day relative standard deviations were between 3.97 and 20.8% for all compounds. The application of the optimized methodology to non-spiked seawater samples allows detecting and quantifying the UV 360 in the range from 41.12 to 544.9 ng L -1 . Copyright © 2016 Elsevier Ltd. All rights reserved.

  11. A Rapid LC-HRMS Method for the Determination of Domoic Acid in Urine Using a Self-Assembly Pipette Tip Solid-Phase Extraction

    Directory of Open Access Journals (Sweden)

    Yiping Zhang

    2015-12-01

    Full Text Available In this study, we developed a self-assembly pipette tip solid-phase extraction (PTSPE method using a high molecular weight polymer material (PAX as the adsorbent for the determination of domoic acid (DA in human urine samples by liquid chromatography high-resolution mass spectrometry (LC-HRMS analysis. The PTSPE cartridge, assembled by packing 9.1 mg of PAX as sorbent into a 200 μL pipette tip, showed high adsorption capacity for DA owing to the strong cationic properties of PAX. Compared with conventional SPE, the PTSPE is simple and fast, and shows some advantages in the aspects of less solvent consumption, low cost, the absence of the evaporation step, and short time requirement. All the parameters influencing the extraction efficiency such as pH, the amount of sorbent, the number of aspirating/dispensing cycles, and the type and volume of eluent in PTSPE were carefully investigated and optimized. Under the optimized conditions, the limit of detection (LOD and limit of quantification (LOQ values of DA were 0.12 μg/L and 0.37 μg/L respectively. The extraction recoveries of DA from the urine samples spiked at four different concentrations were in a range from 88.4% to 102.5%. The intra- and inter-day precisions varied from 2.1% to 7.6% and from 2.6% to 12.7%, respectively. The accuracy ranged from −1.9% to −7.4%.

  12. A Rapid LC-HRMS Method for the Determination of Domoic Acid in Urine Using a Self-Assembly Pipette Tip Solid-Phase Extraction

    Science.gov (United States)

    Zhang, Yiping; Chen, Dawei; Hong, Zhuan

    2015-01-01

    In this study, we developed a self-assembly pipette tip solid-phase extraction (PTSPE) method using a high molecular weight polymer material (PAX) as the adsorbent for the determination of domoic acid (DA) in human urine samples by liquid chromatography high-resolution mass spectrometry (LC-HRMS) analysis. The PTSPE cartridge, assembled by packing 9.1 mg of PAX as sorbent into a 200 μL pipette tip, showed high adsorption capacity for DA owing to the strong cationic properties of PAX. Compared with conventional SPE, the PTSPE is simple and fast, and shows some advantages in the aspects of less solvent consumption, low cost, the absence of the evaporation step, and short time requirement. All the parameters influencing the extraction efficiency such as pH, the amount of sorbent, the number of aspirating/dispensing cycles, and the type and volume of eluent in PTSPE were carefully investigated and optimized. Under the optimized conditions, the limit of detection (LOD) and limit of quantification (LOQ) values of DA were 0.12 μg/L and 0.37 μg/L respectively. The extraction recoveries of DA from the urine samples spiked at four different concentrations were in a range from 88.4% to 102.5%. The intra- and inter-day precisions varied from 2.1% to 7.6% and from 2.6% to 12.7%, respectively. The accuracy ranged from −1.9% to −7.4%. PMID:26729165

  13. Direct Quantification of Campylobacter jejuni in Chicken Fecal Samples Using Real-Time PCR: Evaluation of Six Rapid DNA Extraction Methods

    DEFF Research Database (Denmark)

    Garcia Clavero, Ana Belén; Kamara, Judy N.; Vigre, Håkan

    2013-01-01

    of this study, the Easy-DNA (Invitrogen) method generated lower Ct values, the best amplification efficiency (AE = 93.2 %) and good precision (R squared = 0.996). The method NucleoSpin® Tissue was able to detect samples spiked with the lowest Campylobacter concentration level (10 CFU/ml) but the amplification...... efficiency was not optimal (AE = 139.5 %). DNA extraction methods Easy-DNA Invitrogen, MiniMAG® and NucleoSpin® Tissue produced good real-time PCR reproducibility generating standard deviations from 0.3 to 0.8 between replicates....

  14. Alkaline pH sensor molecules.

    Science.gov (United States)

    Murayama, Takashi; Maruyama, Ichiro N

    2015-11-01

    Animals can survive only within a narrow pH range. This requires continual monitoring of environmental and body-fluid pH. Although a variety of acidic pH sensor molecules have been reported, alkaline pH sensor function is not well understood. This Review describes neuronal alkaline pH sensors, grouped according to whether they monitor extracellular or intracellular alkaline pH. Extracellular sensors include the receptor-type guanylyl cyclase, the insulin receptor-related receptor, ligand-gated Cl- channels, connexin hemichannels, two-pore-domain K+ channels, and transient receptor potential (TRP) channels. Intracellular sensors include TRP channels and gap junction channels. Identification of molecular mechanisms underlying alkaline pH sensing is crucial for understanding how animals respond to environmental alkaline pH and how body-fluid pH is maintained within a narrow range. © 2015 Wiley Periodicals, Inc.

  15. Rapid and simple one-step membrane extraction for the determination of 8-hydroxy-2'-deoxyguanosine in human plasma by a combination of on-line solid phase extraction and LC-MS/MS.

    Science.gov (United States)

    Wang, Chien-Jen; Yang, Ning-Hsiang; Chang, Chia-Chi; Liou, Saou-Hsing; Lee, Hui-Ling

    2011-11-15

    A quantitative analytical method using automated on-line solid phase extraction (SPE) and liquid chromatography-electrospray tandem mass spectrometry (LC-ESI-MS/MS) for the determination of 8-OHdG (8-hydroxy-2'-deoxyguanosine) in human plasma was developed and validated. A one-step membrane extraction method for the plasma sample preparation and a C18 SPE column with simple extraction and purification were used for the on-line extraction. A C18 column was employed for LC separation and ESI-MS/MS was utilized for detection. (15)N(5)-8-OHdG ((15)N(5)-8-hydroxy-2'-deoxyguanosine) was used as an internal standard for quantitative determination. The extraction, clean-up and analysis procedures were controlled by a fully automated six-port switch valve as one strategy to reduce the matrix effect and simultaneously improve detection sensitivity. Identification and quantification were based on the following transitions: m/z 284→168 for 8-OHdG and m/z 289→173 for (15)N(5)-8-OHdG. Satisfactory recovery was obtained, and the recovery ranged from 95.1 to 106.1% at trace levels in human plasma and urine, with a CV lower than 5.4%. Values for intraday and interday precision were between 2.3 and 6.8% for plasma and between 2.7 and 4.5% for urine, respectively. Values for the method accuracy of intraday and interday assays ranged from 93.0 and 100.5% for plasma and 110.2 and 119.4% for urine, respectively. The limits of detection (LOD) and LOQ were 0.008 ng/mL and 0.02 ng/mL, respectively.The applicability of this newly developed method was demonstrated by analysis of human plasma samples for an evaluation of the future risk of oxidative stress status in human exposure to nanoparticles and other diseases. Crown Copyright © 2011. Published by Elsevier B.V. All rights reserved.

  16. Alkaline autoclave leaching of refractory uranium-thorium minerals

    International Nuclear Information System (INIS)

    Milani, S. A.; Sam, S.

    2011-01-01

    This paper deals with the study of an innovative method for processing the Oman placer ores by alkaline leaching in ball mill autoclaves, where grinding and leaching of the refractory minerals take place simultaneously. This was followed by the selective separation of thorium and uranium from lanthanides by autoclave leaching of the hydroxide cake with ammonium carbonate-bicarbonate solutions. The introduced method is based on the fact that thorium and uranium form soluble carbonate complexes with ammonium carbonate, while lanthanides form sparingly soluble double carbonates. It was found that a complete alkaline leaching of Oman placer ores (98.0 P ercent ) was attained at 150 and 175 d egree C within 2.5 and 2h, respectively. Oman placer ores leaching was intensified and accelerated in a ball mill autoclaves as a result of the grinding action of steel balls, removal of the hydroxide layer covering ores grains and the continuous contact of fresh ore grains with alkaline solution. The study of selective carbonate processing of hydroxide cake with ammonium carbonate-bicarbonate solutions on autoclave under pressure revealed that the complete thorium recovery (97.5 P ercent ) with uranium recovery (90.8 P ercent ) and their separation from the lanthanides were attained at 70-80 d egree C during l-2h. The extraction of lanthanides in carbonate solution was low and did not exceed 4.6 P ercent .

  17. Evaluation of electrolytic alkaline cleaners by evaporative-rate analysis

    International Nuclear Information System (INIS)

    Hamilton, C.B.

    1975-01-01

    A method has been developed by which electrolytic alkaline cleaners used in large volumes in steel mills can be evaluated for their ability to clean rolling oil from steel strip without the necessity of large-scale mill trials. The method is evaporative-rate analysis, which can be used to determine the relative amount of residual oil on steel strip after cleaning. The procedure consists in placing a droplet of a solution of a volatile, radioactive, carbon-14 tagged organic compound dissolved in a more volatile solvent, on the surface of the metal, where it forms a ternary solution with any oil on the surface. The amount of oil in this ternary solution affects the rate of evaporation of the tagged compound. The rate of evaporation, monitored by a Geiger-Mueller detector, is a measure of the cleanliness of the surface. A number of commercial alkaline cleaners, both solids and liquids, were evaluated over a range of concentrations. Results indicated that the effectiveness of commercial alkaline cleaners varies greatly, and is a function of the cleaner concentration, cleaner composition, and polarity of cleaning. The presence of antifoaming agents also affects cleaning ability. The results of this study indicate that evaporative-rate analysis is a rapid and effective method for evaluating cleaners

  18. Simple and rapid determination of 5-nitroimidazoles and metabolites in fish roe samples by salting-out assisted liquid-liquid extraction and UHPLC-MS/MS.

    Science.gov (United States)

    Hernández-Mesa, Maykel; Cruces-Blanco, Carmen; García-Campaña, Ana M

    2018-06-30

    A novel multiresidue method is proposed for the determination of 12 5-nitroimidazoles and their metabolites in fish roe samples using UHPLC-MS/MS. A salting-out assisted liquid-liquid extraction procedure was performed prior to sample analysis. The separation of compounds was accomplished using a C18 Zorbax Eclipse Plus column (50 mm × 2.1 mm, 1.8 µm) at 25 °C and a mobile phase consisting of 0.025% (v/v) aqueous formic acid and pure MeOH at a flow rate of 0.5 mL/min. Parameters involved in ionization and fragmentation were also optimized. The method was characterized in terms of linearity (R 2  ≥ 0.9992), extraction efficiency (≥68.9%), repeatability (RSD ≤ 9.8%), reproducibility (RSD ≤ 13.9%) and trueness (recoveries ≥81.4%). Decision limits (CCα) and detection capabilities (CCβ) were obtained in the ranges 0.1-1.0 and 0.2-1.7 µg/kg, respectively. Copyright © 2018 Elsevier Ltd. All rights reserved.

  19. Rapid trace level determination of sulfonamide residues in honey with online extraction using short C-18 column by high-performance liquid chromatography with fluorescence detection.

    Science.gov (United States)

    Sajid, Muhammad; Na, Na; Safdar, Muhammad; Lu, Xin; Ma, Lin; He, Lan; Ouyang, Jin

    2013-11-01

    A sensitive and inexpensive quantification method with online extraction using a short C-18 column for sulfonamide residues in honey by high performance liquid chromatography with fluorescence detector was developed and validated. In sample preparation, acid hydrolysis was used to break the N-glycoside bond between the honey sugar and sulfonamide drugs and derivatization of sulfonamide residues with fluorescamine was conducted at pH 3.5 using a citrate buffer (0.5M) in the honey matrix. The chromatography was carried out on Zorbax Extended C-18 (250mm×4.6mm; 5μm) column, using a mixture of acetonitrile and an acetate buffer (pH 4.50, 20mM) as a mobile phase. A Zorbax Extended C-18 (12mm×4.6mm; 5μm) column was used for online extraction of fifteen sulfonamide residues from honey sample with the help of a two position valve. The limit of quantification of sulfonamide residues in honey was less than 3ngg(-1), and the percentage recovery of study compounds in spiked honey sample was from 80% for sulfacetamide to 100% of sulfachloropyridazine. The developed method has excellent linearity for all studied sulfonamides with a correlation coefficient 0.993. Copyright © 2013 Elsevier B.V. All rights reserved.

  20. Simple and rapid determination of norethindrone in human plasma by supported liquid extraction and ultra performance liquid chromatography with tandem mass spectrometry.

    Science.gov (United States)

    Gong, Zhilong; Chandler, Kiresha; Webster, Stephen; Kerley, Remy; Buist, Susan; McCort-Tipton, Melanie

    2012-03-15

    We report for the first time an ultra performance liquid chromatographic method with tandem mass spectrometric detection (UPLC/MS/MS) for the determination of norethindrone alone in human plasma over the concentration range of 50.0-25000 pg mL(-1) using a sample volume of 0.250 mL. Norethindrone and its internal standard (ISTD), norethindrone-(13)C(2), were extracted from human plasma by supported liquid extraction (SLE). After evaporation of the organic solvent, samples were reconstituted and analyzed on an UPLC/MS/MS system. The UPLC system used a Waters BEH C18 (100 mm × 2.1mm, 1.7 μm) column with mobile phase A of 0.05% formic acid in water:acetonitrile (65:35, v/v) and mobile phase B of 0.05% formic acid in methanol:acetonitrile (50:50, v/v). The flow rate was 0.500 mL min(-1). The method was fully validated. The inter-run accuracy and precision at the lower limit of quantitation (LLOQ), low, mid and high quality control (QC) concentration levels were 99.2-108.4% with a <8.1% CV (coefficient of variation), respectively. The validated method has been successfully applied to analysis of thousands of pharmacokinetic samples. Copyright © 2012 Elsevier B.V. All rights reserved.

  1. Eichrom's ABEC trademark resins: Alkaline radioactive waste treatment, radiopharmaceutical, and potential hydrometallurgical applications

    International Nuclear Information System (INIS)

    Bond, A.H.; Gula, M.J.; Chang, F.; Rogers, R.D.

    1997-01-01

    Eichrom's ABEC trademark resins selectivity extract certain anions from high ionic strength acidic, neutral, or strongly alkaline media, and solute stripping can be accomplished by eluting with water. ABEC resins are stable to pH extreme and radiolysis and operate in high ionic strength and/or alkaline solutions where anion-exchange is often ineffective. Potential applications of the ABEC materials include heavy metal and ReO 4 - separations in hydrometallurgy and purification of perrhenate iodide, and iodate in radiopharmaceutical production. Separation of 99m TcO 4 - from its 99 MoO 4 2- parent and stripping with water or physiological saline solution have been demonstrated for radiopharmaceutical applications. Removal of 99 TcO 4 - and 129 I - from alkaline tank wastes has also been successfully demonstrated. The authors will discuss the scale-up studies, process-scale testing, and market development of this new extraction material

  2. A Rapid Protocol of Crude RNA/DNA Extraction for RT-qPCR Detection and Quantification of 'Candidatus Phytoplasma prunorum'.

    Science.gov (United States)

    Minguzzi, Stefano; Terlizzi, Federica; Lanzoni, Chiara; Poggi Pollini, Carlo; Ratti, Claudio

    2016-01-01

    Many efforts have been made to develop a rapid and sensitive method for phytoplasma and virus detection. Taking our cue from previous works, different rapid sample preparation methods have been tested and applied to Candidatus Phytoplasma prunorum ('Ca. P. prunorum') detection by RT-qPCR. A duplex RT-qPCR has been optimized using the crude sap as a template to simultaneously amplify a fragment of 16S rRNA of the pathogen and 18S rRNA of the host plant. The specific plant 18S rRNA internal control allows comparison and relative quantification of samples. A comparison between DNA and RNA contribution to qPCR detection is provided, showing higher contribution of the latter. The method presented here has been validated on more than a hundred samples of apricot, plum and peach trees. Since 2013, this method has been successfully applied to monitor 'Ca. P. prunorum' infections in field and nursery. A triplex RT-qPCR assay has also been optimized to simultaneously detect 'Ca. P. prunorum' and Plum pox virus (PPV) in Prunus.

  3. Graphene-coated polystyrene-divinylbenzene dispersive solid-phase extraction coupled with supercritical fluid chromatography for the rapid determination of 10 allergenic disperse dyes in industrial wastewater samples.

    Science.gov (United States)

    Lou, Chaoyan; Wu, Can; Zhang, Kai; Guo, Dandan; Jiang, Lei; Lu, Yang; Zhu, Yan

    2018-05-18

    Allergenic disperse dyes are a group of environmental contaminants, which are toxic and mutagenic to human beings. In this work, a method of dispersive solid-phase extraction (d-SPE) using graphene-coated polystyrene-divinylbenzene (G@PS-DVB) microspheres coupled with supercritical fluid chromatography (SFC) was proposed for the rapid determination of 10 allergenic disperse dyes in industrial wastewater samples. G@PS-DVB microspheres were synthesized by coating graphene (G) sheets onto polystyrene-divinylbenzene (PS-DVB) polymers. Such novel sorbents were employed in d-SPE for the purification and concentration of allergenic disperse dyes in wastewater samples prior to the determination by SFC with UV detection. To achieve the maximum extraction efficiency for the target dyes, several parameters influencing d-SPE process such as sorbent dosage, extraction time, desorption conditions were investigated. SFC conditions including stationary phase, modifier composition and percentage, column temperature, backpressure and flow rate were optimized to well separate the allergenic disperse dyes. Under the optimum conditions, satisfactory linear relationship (R ≥ 0.9989) was observed with the concentration of dyes ranging from 0.02 to 10.0 μg/mL. The limits of detection (LOD, S/N = 3) for the ten dyes were in the range of 1.1-15.6 ng/mL. Recoveries for the spiked samples were between 89.1% and 99.7% with relative standard deviations (RSD) lower than 10.5% in all cases. The proposed method is time-saving, green, precise and repeatable for the analysis of the target dyes. Furthermore, the application of G@PS-DVB based d-SPE process can be potentially expanded to isolate and concentrate other aromatic compounds in various matrices and supercritical fluid chromatography methodology featuring rapidity, accuracy and green will be an ideal candidate for the analysis of these compounds. Copyright © 2018 Elsevier B.V. All rights reserved.

  4. A simple and rapid micromethod for genomic DNA extraction from jugal epithelial cells. Application to human lymphocyte antigen typing in one large family of atopic/asthmatic probands.

    Science.gov (United States)

    Aron, Y; Swierczewski, E; Lockhart, A

    1994-10-01

    We describe a rapid and reliable micromethod for DNA isolation from buccal epithelial cells from the interior mouth mucosa. This convenient, noninvasive method could be applied to genetic typing in a small number of cells (about 2000 cells per cheek). We have shown that DNA released by this method is suitable for further amplification by polymerase chain reaction (PCR). Using this protocol, coupled with the PCR-RFLP (restriction fragment length polymorphism) method, we analyzed the allelic sequence diversity of the human lymphocyte antigen (HLA) class II genes in an extended family of 33 persons containing 14 asthmatic or atopic members. Six of eight DQA1 alleles, and 11 DQB1, 20 DPB1, and 10 DR haplotypes could be identified in a single DNA sample. Our results suggest that the DR53 group haplotype is frequently associated with allergic asthma and atopy. The micromethod described here may be useful in genetic epidemiology, especially in family studies involving small children.

  5. Tandem solid-phase extraction followed by HPLC-ESI/QTOF/MS/MS for rapid screening and structural identification of trace diterpenoids in flowers of Rhododendron molle.

    Science.gov (United States)

    Zou, Hong-Yan; Luo, Jun; Xu, De-Ran; Kong, Ling-Yi

    2014-01-01

    'Naoyanghua', composed of the flowers of Rhododendron molle G. Don, is a traditional Chinese medicine that is widely known for its toxicity. Grayanane-type diterpenoids are the main active ingredients in R. molle, as well as possibly their toxicity: they are, however, difficult to isolate and analyse using common chromatographic methods, due to their small amounts and absence of conjugated groups, such as phenyl and α, β-unsaturated ketone. To establish a highly sensitive, selective and reliable method for the qualitative evaluation of trace diterpenoids in the flowers of R. molle by using tandem solid-phase extraction followed by high-performance liquid chromatography with electrospray ionisation quadrupole-time-of-flight mass spectrometry (HPLC-ESI/QTOF/MS/MS). Tandem solid phase extraction (SPE) was undertaken using a polyamide cartridge and a C18E cartridge in succession to enrich the trace diterpenoids. HPLC-ESI/QTOF/MS/MS was used to determine the fragmentation patterns of diterpenoids and to tentatively characterise their fragmentation pathways. HPLC-ESI/QTOF/MS/MS detected a total of 14 diterpenoids, eight of which were identified by comparison with literature sources and six based on fragmentation analysis. Among the latter six, rhodojaponin VI-3-glucoside was tentatively identified as a new diterpenoid glycoside and rhodojaponin VII, rhodojaponin IV and rhodojaponin I were reported from R. molle for the first time. By qualitative research of diterpenoids in this plant by HPLC-ESI/QTOF/MS/MS, a reliable methodology for the analysis of these active constituents of R. molle was established for the first time. Copyright © 2014 John Wiley & Sons, Ltd.

  6. Gold and uranium extraction

    International Nuclear Information System (INIS)

    James, G.S.; Davidson, R.J.

    1977-01-01

    A process for extracting gold and uranium from an ore containing them both comprising the steps of pulping the finely comminuted ore with a suitable cyanide solution at an alkaline pH, acidifying the pulp for uranium dissolution, adding carbon activated for gold recovery to the pulp at a suitable stage, separating the loaded activated carbon from the pulp, and recovering gold from the activated carbon and uranium from solution

  7. Electrochemical Performance of Low-Carbon Steel in Alkaline Model Solutions Containing Hybrid Aggregates

    NARCIS (Netherlands)

    Koleva, D.A.; Hu, J.; De Wit, J.H.W.; Boshkov, N.; Radeva, T.; Milkova, V.; Van Breugel, K.

    2010-01-01

    This work reports on the electrochemical performance of low-carbon steel electrodes in model alkaline solutions in the presence of 4.9.10-4 g/l hybrid aggregates i.e. cement extract, containing PDADMAC (poly (diallyl, dimethyl ammonium chloride) / PAA (Poly (acrylic acid)/ PDADMAC over a CaO core.

  8. Alkaline pretreatment of Mexican pine residues for bioethanol ...

    African Journals Online (AJOL)

    Alkaline pretreatment of Mexican pine residues for bioethanol production. ... Keywords: Lignocellulosic biomass, alkaline pretreatment, enzymatic hydrolysis, fermentable sugars, fermentation. African Journal of Biotechnology Vol. 12(31), pp.

  9. Alkaline sorbent injection for mercury control

    Science.gov (United States)

    Madden, Deborah A.; Holmes, Michael J.

    2002-01-01

    A mercury removal system for removing mercury from combustion flue gases is provided in which alkaline sorbents at generally extremely low stoichiometric molar ratios of alkaline earth or an alkali metal to sulfur of less than 1.0 are injected into a power plant system at one or more locations to remove at least between about 40% and 60% of the mercury content from combustion flue gases. Small amounts of alkaline sorbents are injected into the flue gas stream at a relatively low rate. A particulate filter is used to remove mercury-containing particles downstream of each injection point used in the power plant system.

  10. Alkaline rocks and the occurrence of uranium

    International Nuclear Information System (INIS)

    Hambleton-Jones, B.B.; Toens, P.D.

    1980-10-01

    Many alkaline complexes contain uranium and other minerals in low concentrations and are regarded as constituting valuable potential reserves. Certain complex metallurgical problems, however, remain to be solved. Alkaline rocks occur in a number of forms and environments and it is noted that they are generated during periods of geological quiescence emplaced mainly in stable aseismic areas. Many occur along the extensions of oceanic transform faults beneath the continental crust and the application of this concept to areas not currently known to host alkaline complexes may prove useful in identifying potential target areas for prospecting operations [af

  11. Rapid detection of peptide markers for authentication purposes in raw and cooked meat using ambient liquid extraction surface analysis mass spectrometry.

    Science.gov (United States)

    Montowska, Magdalena; Alexander, Morgan R; Tucker, Gregory A; Barrett, David A

    2014-10-21

    In this Article, our previously developed ambient LESA-MS methodology is implemented to analyze five types of thermally treated meat species, namely, beef, pork, horse, chicken, and turkey meat, to select and identify heat-stable and species-specific peptide markers. In-solution tryptic digests of cooked meats were deposited onto a polymer surface, followed by LESA-MS analysis and evaluation using multivariate data analysis and tandem electrospray MS. The five types of cooked meat were clearly discriminated using principal component analysis and orthogonal partial least-squares discriminant analysis. 23 heat stable peptide markers unique to species and muscle protein were identified following data-dependent tandem LESA-MS analysis. Surface extraction and direct ambient MS analysis of mixtures of cooked meat species was performed for the first time and enabled detection of 10% (w/w) of pork, horse, and turkey meat and 5% (w/w) of chicken meat in beef, using the developed LESA-MS/MS analysis. The study shows, for the first time, that ambient LESA-MS methodology displays specificity sufficient to be implemented effectively for the analysis of processed and complex peptide digests. The proposed approach is much faster and simpler than other measurement tools for meat speciation; it has potential for application in other areas of meat science or food production.

  12. Rapid and novel discrimination and quantification of oleanolic and ursolic acids in complex plant extracts using two-dimensional nuclear magnetic resonance spectroscopy-Comparison with HPLC methods

    International Nuclear Information System (INIS)

    Kontogianni, Vassiliki G.; Exarchou, Vassiliki; Troganis, Anastassios; Gerothanassis, Ioannis P.

    2009-01-01

    A novel strategy for NMR analysis of mixtures of oleanolic and ursolic acids that occur in natural products is described. These important phytochemicals have similar structure and their discrimination and quantification is rather difficult. We report herein the combined use of proton-carbon heteronuclear single-quantum coherence ( 1 H- 13 C HSQC) and proton-carbon heteronuclear multiple-bond correlation ( 1 H- 13 C HMBC) NMR spectroscopy, in the identification and quantitation of oleanolic acid (OA) and ursolic acid (UA)in plant extracts of the Lamiaceae and Oleaceae family. The combination of 1 H- 13 C HSQC and 1 H- 13 C HMBC techniques allows the connection of the proton and carbon-13 spins across the molecular backbone resulting in the identification and, thus, discrimination of oleanolic and ursolic acid without resorting to physicochemical separation of the components. The quantitative results provided by 2D 1 H- 13 C HSQC NMR data were obtained within a short period of time (∼14 min) and are in excellent agreement with those obtained by HPLC, which support the efficiency of the suggested methodology

  13. A rapid silica spin column-based method of RNA extraction from fruit trees for RT-PCR detection of viruses.

    Science.gov (United States)

    Yang, Fan; Wang, Guoping; Xu, Wenxing; Hong, Ni

    2017-09-01

    Efficient recovery of high quality RNA is very important for successful RT-PCR detection of plant RNA viruses. High levels of polyphenols and polysaccharides in plant tissues can irreversibly bind to and/or co-precipitate with RNA, which influences RNA isolation. In this study, a silica spin column-based RNA isolation method was developed by using commercially available silica columns combined with the application of a tissue lysis solution, and binding and washing buffers with high concentration guanidinium thiocyanate (GuSCN, 50% w/v), which helps remove plant proteins, polysaccharides and polyphenolic compounds. The method was successfully used to extract high quality RNA from citrus (Citrus aurantifolia), grapevine (Vitis vinifera), peach (Prunus persica), pear (Pyrus spp.), taro (Colocosia esculenta) and tobacco (Nicotiana benthamiana) samples. The method was comparable to conventional CTAB method in RNA isolation efficiency, but it was more sample-adaptable and cost-effective than commercial kits. High quality RNA isolated using silica spin column-based method was successfully used for the RT-PCR and/or multiplex RT-PCR amplification of woody fruit tree viruses and a viroid. The study provided a useful tool for the detection and characterization of plant viruses. Copyright © 2017 Elsevier B.V. All rights reserved.

  14. Occurrence investigation of perfluorinated compounds in surface water from East Lake (Wuhan, China) upon rapid and selective magnetic solid-phase extraction

    Science.gov (United States)

    Zhou, Yusun; Tao, Yun; Li, Huarong; Zhou, Tingting; Jing, Tao; Zhou, Yikai; Mei, Surong

    2016-12-01

    Using a novel magnetic nanocomposite as adsorbent, a convenient and effective magnetic solid-phase extraction (MSPE) procedure was established for selective separation and concentration of nine perfluorinated compounds (PFCs) in surface water sample. Then an ultra high-performance liquid chromatography-tandem mass spectrometry (UPLC-MS/MS) system was employed for detection of PFCs. Good linearity of the developed analytical method was in the range of 0.5-100 ng L-1 with R2 > 0.9917, and the limits of detection (LODs) ranged from 0.029 to 0.099 ng L-1. At three fortified concentrations of 0.5, 5 and 50 ng L-1, the spiked recoveries of PFCs were in the range of 90.05-106.67% with RSDs < 12.62% (n = 3). The proposed analytical method was applied for determination of PFCs in surface water from East Lake (Wuhan, China). The total concentrations of nine PFCs ranged from 30.12 to 125.35 ng L-1, with perfluorooctane sulfonate and perfluoroctanoic acid as the most prevalent PFCs, and the greatest concentrations of PFCs were observed in Niuchao lakelet. The concentrations of the PFCs (C ≥ 11) were mostly less than the limits of quantification (LOQs), attributed to the possibility that the more hydrophobic long-chain PFCs are potential to accumulate in sediment and aquatic biota.

  15. Cementitious porous pavement in stormwater quality control: pH and alkalinity elevation.

    Science.gov (United States)

    Kuang, Xuheng; Sansalone, John

    2011-01-01

    A certain level of alkalinity acts as a buffer and maintains the pH value in a stable range in water bodies. With rapid urban development, more and more acidic pollutants flow to watersheds with runoff and drop alkalinity to a very low level and ultimately degrade the water environment. Cementitious porous pavement is an effective tool for stormwater acidic neutralization. When stormwater infiltrates cement porous pavement (CPP) materials, alkalinity and pH will be elevated due to the basic characteristics of cement concrete. The elevated alkalinity will neutralize acids in water bodies and maintain the pH in a stable level as a buffer. It is expected that CPP materials still have a certain capability of alkalinity elevation after years of service, which is important for CPP as an effective tool for stormwater management. However, few previous studies have reported on how CPP structures would elevate runoff alkalinity and pH after being exposed to rainfall-runoff for years. In this study, three groups of CPP specimens, all exposed to rainfall-runoff for 3 years, were used to test the pH and alkalinity elevation properties. It was found that runoff pH values were elevated from 7.4 to the range of 7.8-8.6 after infiltrating through the uncoated specimens, and from 7.4 to 8.5-10.7 after infiltrating through aluminum-coated specimens. Runoff alkalinity elevation efficiencies are 11.5-14.5% for uncoated specimens and 42.2% for coated specimens. The study shows that CPP is an effective passive unit operation for stormwater acid neutralization in our built environment.

  16. Rapid and simple method by combining FTA™ card DNA extraction with two set multiplex PCR for simultaneous detection of non-O157 Shiga toxin-producing Escherichia coli strains and virulence genes in food samples.

    Science.gov (United States)

    Kim, S A; Park, S H; Lee, S I; Ricke, S C

    2017-12-01

    The aim of this research was to optimize two multiplex polymerase chain reaction (PCR) assays that could simultaneously detect six non-O157 Shiga toxin-producing Escherichia coli (STEC) as well as the three virulence genes. We also investigated the potential of combining the FTA™ card-based DNA extraction with the multiplex PCR assays. Two multiplex PCR assays were optimized using six primer pairs for each non-O157 STEC serogroup and three primer pairs for virulence genes respectively. Each STEC strain specific primer pair only amplified 155, 238, 321, 438, 587 and 750 bp product for O26, O45, O103, O111, O121 and O145 respectively. Three virulence genes were successfully multiplexed: 375 bp for eae, 655 bp for stx1 and 477 bp for stx2. When two multiplex PCR assays were validated with ground beef samples, distinctive bands were also successfully produced. Since the two multiplex PCR examined here can be conducted under the same PCR conditions, the six non-O157 STEC and their virulence genes could be concurrently detected with one run on the thermocycler. In addition, all bands clearly appeared to be amplified by FTA card DNA extraction in the multiplex PCR assay from the ground beef sample, suggesting that an FTA card could be a viable sampling approach for rapid and simple DNA extraction to reduce time and labour and therefore may have practical use for the food industry. Two multiplex polymerase chain reaction (PCR) assays were optimized for discrimination of six non-O157 Shiga toxin-producing Escherichia coli (STEC) and identification of their major virulence genes within a single reaction, simultaneously. This study also determined the successful ability of the FTA™ card as an alternative to commercial DNA extraction method for conducting multiplex STEC PCR assays. The FTA™ card combined with multiplex PCR holds promise for the food industry by offering a simple and rapid DNA sample method for reducing time, cost and labour for detection of STEC in

  17. Mid-infrared and near-infrared spectroscopy for rapid detection of Gardeniae Fructus by a liquid-liquid extraction process.

    Science.gov (United States)

    Tao, Lingyan; Lin, Zhonglin; Chen, Jiashan; Wu, Yongjiang; Liu, Xuesong

    2017-10-25

    Gardeniae Fructus is widely used in the pharmaceutical industry, and many studies have confirmed its medical and economic value. In this study, samples collected from different liquid-liquid extraction batches of Gardeniae Fructus were detected by mid-infrared (MIR) and near-infrared (NIR) spectroscopy. Seven analytes, neochlorogenic acid (5-CQA), cryptochlorogenic acid (4-CQA), chlorogenic acid (3-CQA), geniposidic acid (GEA), deacetyl-asperulosidic acid methyl ester (DAAME), genipin-gentiobioside (GGB), and gardenoside (GA), were chosen as quality property indexes of Gardeniae Fructus. The two kinds of spectra were each used to build models by single partial least squares (PLS). Additionally, both spectral data were combined and modeled by multiblock PLS. For single spectroscopy modeling results, NIR had a better prediction for high-concentration analytes (3-CQA, DAAME, GGB, and GA) whereas MIR performed better for low-concentration analytes (5-CQA, 4-CQA, and GEA). The multiblock methodology was found to be better compared to single spectroscopy models for all seven analytes. Specifically, the coefficients of determination (R 2 ) of the NIR, MIR, and multiblock PLS calibration models of all seven components were higher than 0.95. Relative standard errors of prediction (RSEP) were all less than 7%, except for models of GGB, which were 10.36%, 13.24%, and 8.15% for the NIR-PLS, MIR-PLS, and multiblock models, respectively. These results indicate that MIR and NIR spectrographic techniques could provide a new choice for quality control in industrial production of Gardeniae Fructus. Copyright © 2017 Elsevier B.V. All rights reserved.

  18. Alkalinity in oil field waters - what alkalinity is and how it is measured

    International Nuclear Information System (INIS)

    Kaasa, B.; Oestvold, T.

    1996-01-01

    The alkalinity is an important parameter in the description of pH-behaviour, buffer capacity and scaling potentials in oil field waters. Although the alkalinity is widely used, it seems to be considerable confusion in connection with the concept. It is often used incorrectly and different authors define the concept in different ways. Several different methods for the determination of alkalinity can be found in the literature. This paper discusses the definition of alkalinity and how to use alkalinity in oil field waters to obtain data of importance for scale and pH predictions. There is also shown how a simple titration of oil field waters can give both the alkalinity and the content of organic acids in these waters. It is obvious from these findings that most of the methods used to day may give considerable errors when applied to oil field waters with high contents of organic acids. 8 refs., 8 figs., 5 tabs

  19. Optical properties of alkaline earth borate glasses

    African Journals Online (AJOL)

    user

    The alkaline earth borate glasses containing heavy metal oxides show good solubility of rare-earth ions. Glasses containing PbO exhibit low glass transition temperature (Tg) and high ..... These oxygen ions carry a partial negative charge and.

  20. Technetium recovery from high alkaline solution

    Energy Technology Data Exchange (ETDEWEB)

    Nash, Charles A.

    2016-07-12

    Disclosed are methods for recovering technetium from a highly alkaline solution. The highly alkaline solution can be a liquid waste solution from a nuclear waste processing system. Methods can include combining the solution with a reductant capable of reducing technetium at the high pH of the solution and adding to or forming in the solution an adsorbent capable of adsorbing the precipitated technetium at the high pH of the solution.

  1. Alkaline Waterflooding Demonstration Project, Ranger Zone, Long Beach Unit, Wilmington Field, California. Fourth annual report, June 1979-May 1980. Volume 3. Appendices II-XVII

    Energy Technology Data Exchange (ETDEWEB)

    Carmichael, J.D.

    1981-03-01

    Volume 3 contains Appendices II through XVII: mixing instructions for sodium orthosilicate; oil displacement studies using THUMS C-331 crude oil and extracted reservoir core material from well B-110; clay mineral analysis of B-827-A cores; sieve analysis of 4 Fo sand samples from B-110-IA and 4 Fo sand samples from B-827-A; core record; delayed secondary caustic consumption tests; long-term alkaline consumption in reservoir sands; demulsification study for THUMS Long Beach Company, Island White; operating plans and instructions for DOE injection demonstration project, alkaline injection; caustic pilot-produced water test graphs; well test irregularities (6/1/79-5/31/80); alkaline flood pump changes (6/1/79-5/31/80); monthly DOE pilot chemical waterflood injection reports (preflush injection, alkaline-salt injection, and alkaline injection without salt); and caustic safety procedures-alkaline chemicals.

  2. Selective leaching of Zn from spent alkaline batteries using environmentally friendly approaches.

    Science.gov (United States)

    Maryam Sadeghi, S; Vanpeteghem, Guillaumme; Neto, Isabel F F; Soares, Helena M V M

    2017-02-01

    The main aim of this work was to evaluate the possibility of using microwave or ultrasound to assist the efficient and selective leaching of Zn from spent alkaline batteries and compare the results with those obtained using the conventional method. Two different strategies were applied: acid leaching of a washed residue and alkaline leaching of the original residue. In both (acid and alkaline) approaches, the use of microwave- or ultrasound-assisted leaching increased the extraction of Zn compared with the best results obtained using conventional leaching [acid leaching (1.5mol/L H 2 SO 4 , 3h, 80°C), 90% of Zn extracted; alkaline leaching (6mol/L NaOH, 3h, 80°C), 42% of Zn extracted]. With acid leaching, 94% of the Zn was extracted using microwave-assisted leaching (1 cycle, 30s, 1mol/L H 2 SO 4 ), and 92% of the Zn was extracted using ultrasound-assisted leaching (2min, 0.1p, 20% amplitude, 1mol/L H 2 SO 4 ). Ultrasound-assisted leaching resulted in a more selective (Zn/Mn ratio of 5.1) Zn extraction than microwave-assisted leaching (Zn/Mn ratio of 3.5); both processes generated a concentrated Zn solution (⩾18.7g/L) with a purity (83.3% and 77.7%, respectively) that was suitable for electrowinning. With alkaline leaching, microwave- (1 cycle, 3 min, 4mol/L NaOH) and ultrasound-assisted (14min, 0.1p, 20% amplitude, 4mol/L NaOH) leaching extracted about 80% of the Zn and less than 0.01% of the Mn, which resulted in lesser concentrated Zn solutions (approximately 16.5g/L) but with high purity (>99.5%) that was suitable for the recovery of Zn by precipitation. The microwave- and ultrasound-assisted leaching strategies used in this work proved to be efficient and environmentally-friendly approaches for the extraction of Zn from spent alkaline residues since a concentrated Zn solution with adequate purity for subsequent Zn recovery was obtained using significantly decreased leaching times and concentrations of chemicals. Copyright © 2017 Elsevier Ltd. All rights

  3. Automated extraction of lysergic acid diethylamide (LSD) and N-demethyl-LSD from blood, serum, plasma, and urine samples using the Zymark RapidTrace with LC/MS/MS confirmation.

    Science.gov (United States)

    de Kanel, J; Vickery, W E; Waldner, B; Monahan, R M; Diamond, F X

    1998-05-01

    A forensic procedure for the quantitative confirmation of lysergic acid diethylamide (LSD) and the qualitative confirmation of its metabolite, N-demethyl-LSD, in blood, serum, plasma, and urine samples is presented. The Zymark RapidTrace was used to perform fully automated solid-phase extractions of all specimen types. After extract evaporation, confirmations were performed using liquid chromatography (LC) followed by positive electrospray ionization (ESI+) mass spectrometry/mass spectrometry (MS/MS) without derivatization. Quantitation of LSD was accomplished using LSD-d3 as an internal standard. The limit of quantitation (LOQ) for LSD was 0.05 ng/mL. The limit of detection (LOD) for both LSD and N-demethyl-LSD was 0.025 ng/mL. The recovery of LSD was greater than 95% at levels of 0.1 ng/mL and 2.0 ng/mL. For LSD at 1.0 ng/mL, the within-run and between-run (different day) relative standard deviation (RSD) was 2.2% and 4.4%, respectively.

  4. Rapid analysis of pesticide residues in drinking water samples by dispersive solid-phase extraction based on multiwalled carbon nanotubes and pulse glow discharge ion source ion mobility spectrometry.

    Science.gov (United States)

    Zou, Nan; Gu, Kejia; Liu, Shaowen; Hou, Yanbing; Zhang, Jialei; Xu, Xiang; Li, Xuesheng; Pan, Canping

    2016-03-01

    An analytical method based on dispersive solid-phase extraction with a multiwalled carbon nanotubes sorbent coupled with positive pulse glow discharge ion mobility spectrometry was developed for analysis of 30 pesticide residues in drinking water samples. Reduced ion mobilities and the mass-mobility correlation of 30 pesticides were measured. The pesticides were divided into five groups to verify the separation capability of pulse glow discharge in mobility spectrometry. The extraction conditions such as desorption solvent, ionic strength, conditions of adsorption and desorption, the amounts of multiwalled carbon nanotubes, and solution pH were optimized. The enrichment factors of pesticides were 5.4- to 48.7-fold (theoretical enrichment factor was 50-fold). The detection limits of pesticides were 0.01∼0.77 μg/kg. The linear range was 0.005-0.2 mg/L for pesticide standard solutions, with determination coefficients from 0.9616 to 0.9999. The method was applied for the analysis of practical and spiked drinking water samples. All results were confirmed by high-performance liquid chromatography with tandem mass spectrometry. The proposed method was proven to be a commendably rapid screening qualitative and semiquantitative technique for the analysis of pesticide residues in drinking water samples on site. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  5. Improved electrodes and gas impurity investigations on alkaline electrolysers

    DEFF Research Database (Denmark)

    Reissner, R.; Schiller, G.; Knoeri, T.

    Alkaline water electrolysis for hydrogenproduction is a well-established techniquebut some technological issues regarding thecoupling of alkaline water electrolysis andRenewable Energy Sources (RES) remain tobe improved.......Alkaline water electrolysis for hydrogenproduction is a well-established techniquebut some technological issues regarding thecoupling of alkaline water electrolysis andRenewable Energy Sources (RES) remain tobe improved....

  6. 21 CFR 73.30 - Annatto extract.

    Science.gov (United States)

    2010-04-01

    ... fats. The alkaline alcohol or aqueous extracts may be treated with food-grade acids to precipitate..., methyl alcohol, methylene chloride, trichloroethylene. (2) Color additive mixtures for food use made with... 21 Food and Drugs 1 2010-04-01 2010-04-01 false Annatto extract. 73.30 Section 73.30 Food and...

  7. Extraction of molybdenum VI by alpha benzoinoxime

    International Nuclear Information System (INIS)

    Achache, M.; Meklati, M.

    1990-06-01

    The concentration of molybdenum, was studied using alpha benzoinoxime dissolved in chloroform. Several acids and salt at different levels of concentration were investigated as well as other parameters such as (mixing time, extractant to metal ratio, temperature etc.) The molybdenum stippling was also studied in alkaline medium with the subsequent recovery of the extractant and solvent

  8. Alkaline sulfide pretreatment of an antimonial refractory Au-Ag ore for improved cyanidation

    Science.gov (United States)

    Alp, Ibrahim; Celep, Oktay; Deveci, Haci

    2010-11-01

    This paper presents the alkaline sulfide pretreatment of an antimonial refractory gold and silver ore. In the ore, gold occurs mainly as gold-silver alloys and as associated with quartz and framboidal pyrite grains, and, to a small extent, as the inclusions within antimonial sulfides. Silver is present extensively as antimonial sulfides such as andorite. Alkaline sulfide pretreatment was shown to allow the decomposition of the antimonial sulfide minerals (up to 98% Sb removal) and to remarkably improve the amenability of gold (e.g., from leaching. An increase in reagent concentration (1-4 mol/L Na2S or NaOH) and temperature (20-80°C), and a decrease in particle size seem to produce an enhancing effect on metal extraction. These findings suggest that alkaline sulfide leaching can be suitably used as a chemical pretreatment method prior to the conventional cyanidation for antimonial refractory gold and silver ores.

  9. Non-polluting treatment of uranium effluents from the alkaline digestion of an uranium ore containing sulfur

    International Nuclear Information System (INIS)

    Berger, Bernard.

    1978-01-01

    New non-polluting process for treating uranium effluents from the alkaline digestion of an uranium ore containing sulphur, which makes it possible (a) to extract and obtain relatively pure uranium and (b) to process the digestion liquor freed from the uranium and containing in an aqueous solution a mixture of alkaline carbonate and/or bicarbonate and sodium sulphate, consisting in the selective extraction of the sodium sulphate present and the recycling of the liquor free of SO 4 = ions, containing in solution the sole carbonates and/or bicarbonates involved, towards the digestion of the ore [fr

  10. Zinc, copper and manganese availability in soils treated with alkaline sewage sludge from Paraná state (Brazil

    Directory of Open Access Journals (Sweden)

    Maristela Dalpisol

    Full Text Available ABSTRACT In Paraná, most of the sludge generated in sewage treatment plants is subjected to the prolonged alkaline stabilization process. Although it is known that the alkaline sewage sludge contains micronutrients such as Zn, Cu and Mn, little is known about the availability of these elements in soils treated with this type of sewage sludge. Thus, the objective of the study was to evaluate the influence of alkaline sewage sludge from Paraná on Zn, Cu and Mn availability in soils. Twenty sewage treatment plants were selected throughout Paraná, where alkaline sewage sludge and the most representative agricultural soil of the each region were collected. Each soil was incubated for 60 days with alkaline sewage sludge rates (0, 10, 20, 40, and 80 Mg ha-1 from their region. Subsequently, Zn, Cu and Mn availability was determined using the Mehlich-1 extractant. The alkaline sewage sludge increased Zn availability and decreased Mn availability in most soils. Cu showed intermediate results, with increased availability, primarily in medium texture soils and decrease in most of the clayey soils. In soils with pH close to ideal for the plant growth, the alkaline sewage sludge rate should be carefully calculated so that there is no excessive increase in the pH and Zn, Cu and Mn imbalance.

  11. Properties of whey protein isolates extruded under acidic and alkaline conditions.

    Science.gov (United States)

    Onwulata, C I; Isobe, S; Tomasula, P M; Cooke, P H

    2006-01-01

    Whey proteins have wide acceptance and use in many products due to their beneficial nutritional properties. To further increase the amount of whey protein isolates (WPI) that may be added to products such as extruded snacks and meats, texturization of WPI is necessary. Texturization changes the folding of globular proteins to improve interaction with other ingredients and create new functional ingredients. In this study, WPI pastes (60% solids) were extruded in a twin-screw extruder at 100 degrees C with 4 pH-adjusted water streams: acidic (pH 2.0 +/- 0.2) and alkaline (pH 12.4 +/- 0.4) streams from 2 N HCl and 2 N NaOH, respectively, and acidic (pH 2.5 +/- 0.2) and alkaline (pH 11.5 +/- 0.4) electrolyzed water streams; these were compared with WPI extruded with deionized water. The effects of water acidity on WPI solubility at pH 7, color, microstructure, Rapid Visco Analyzer pasting properties, and physical structure were determined. Alkaline conditions increased insolubility caused yellowing and increased pasting properties significantly. Acidic conditions increased solubility and decreased WPI pasting properties. Subtle structural changes occurred under acidic conditions, but were more pronounced under alkaline conditions. Overall, alkaline conditions increased denaturation in the extruded WPI resulting in stringy texturized WPI products, which could be used in meat applications.

  12. Effect of ethanolic leave extract of phyllantus amarus on carbon ...

    African Journals Online (AJOL)

    Peters

    (AST), alanine amino transferase (ALT), alkaline phosphate (ALP) activities, and total ... and bladder problems, diabetes and intestinal ... studies, that the Phyllanthus amarus extracts (polar .... astragalin, ellagitannins like amarinic acid and.

  13. Assessing ocean alkalinity for carbon sequestration

    Science.gov (United States)

    Renforth, Phil; Henderson, Gideon

    2017-09-01

    Over the coming century humanity may need to find reservoirs to store several trillions of tons of carbon dioxide (CO2) emitted from fossil fuel combustion, which would otherwise cause dangerous climate change if it were left in the atmosphere. Carbon storage in the ocean as bicarbonate ions (by increasing ocean alkalinity) has received very little attention. Yet recent work suggests sufficient capacity to sequester copious quantities of CO2. It may be possible to sequester hundreds of billions to trillions of tons of C without surpassing postindustrial average carbonate saturation states in the surface ocean. When globally distributed, the impact of elevated alkalinity is potentially small and may help ameliorate the effects of ocean acidification. However, the local impact around addition sites may be more acute but is specific to the mineral and technology. The alkalinity of the ocean increases naturally because of rock weathering in which >1.5 mol of carbon are removed from the atmosphere for every mole of magnesium or calcium dissolved from silicate minerals (e.g., wollastonite, olivine, and anorthite) and 0.5 mol for carbonate minerals (e.g., calcite and dolomite). These processes are responsible for naturally sequestering 0.5 billion tons of CO2 per year. Alkalinity is reduced in the ocean through carbonate mineral precipitation, which is almost exclusively formed from biological activity. Most of the previous work on the biological response to changes in carbonate chemistry have focused on acidifying conditions. More research is required to understand carbonate precipitation at elevated alkalinity to constrain the longevity of carbon storage. A range of technologies have been proposed to increase ocean alkalinity (accelerated weathering of limestone, enhanced weathering, electrochemical promoted weathering, and ocean liming), the cost of which may be comparable to alternative carbon sequestration proposals (e.g., $20-100 tCO2-1). There are still many

  14. Posttranslational heterogeneity of bone alkaline phosphatase in metabolic bone disease.

    Science.gov (United States)

    Langlois, M R; Delanghe, J R; Kaufman, J M; De Buyzere, M L; Van Hoecke, M J; Leroux-Roels, G G

    1994-09-01

    Bone alkaline phosphatase is a marker of osteoblast activity. In order to study the posttranscriptional modification (glycosylation) of bone alkaline phosphatase in bone disease, we investigated the relationship between mass and catalytic activity of bone alkaline phosphatase in patients with osteoporosis and hyperthyroidism. Serum bone alkaline phosphatase activity was measured after lectin precipitation using the Iso-ALP test kit. Mass concentration of bone alkaline phosphatase was determined with an immunoradiometric assay (Tandem-R Ostase). In general, serum bone alkaline phosphatase mass and activity concentration correlated well. The activity : mass ratio of bone alkaline phosphatase was low in hyperthyroidism. Activation energy of the reaction catalysed by bone alkaline phosphatase was high in osteoporosis and in hyperthyroidism. Experiments with neuraminidase digestion further demonstrated that the thermodynamic heterogeneity of bone alkaline phosphatase can be explained by a different glycosylation of the enzyme.

  15. The characterization of soybean oil body integral oleosin isoforms and the effects of alkaline pH on them.

    Science.gov (United States)

    Cao, Yanyun; Zhao, Luping; Ying, Yusang; Kong, Xiangzhen; Hua, Yufei; Chen, Yeming

    2015-06-15

    Oil body, an organelle in seed cell (naturally pre-emulsified oil), has great potentials to be used in food, cosmetics, pharmaceutical and other applications requiring stable oil-in-water emulsions. Researchers have tried to extract oil body by alkaline buffers, which are beneficial for removing contaminated proteins. But it is not clear whether alkaline buffers could remove oil body integral proteins (mainly oleosins), which could keep oil body integrity and stability. In this study, seven oleosin isoforms were identified for soybean oil body (three isoforms, 24 kDa; three isoforms, 18 kDa; one isoform, 16kDa). Oleosins were not glycoproteins and 24 kDa oleosin isoforms possessed less thiol groups than 18 kDa ones. It was found that alkaline pH not only removed contaminated proteins but also oleosins, and more and more oleosins were removed with increasing alkaline pH. Copyright © 2015 Elsevier Ltd. All rights reserved.

  16. High temperature and pressure alkaline electrolysis

    DEFF Research Database (Denmark)

    Allebrod, Frank; Chatzichristodoulou, Christodoulos; Mogensen, Mogens Bjerg

    2013-01-01

    Alkaline electrolyzers have proven to operate reliable for decades on a large scale, but in order to become commercially attractive and compete against conventional technologies for hydrogen production, the production and investment costs have to be reduced. This may occur by increasing the opera......Alkaline electrolyzers have proven to operate reliable for decades on a large scale, but in order to become commercially attractive and compete against conventional technologies for hydrogen production, the production and investment costs have to be reduced. This may occur by increasing...

  17. Catalytic oxidation of soot over alkaline niobates

    International Nuclear Information System (INIS)

    Pecchi, G.; Cabrera, B.; Buljan, A.; Delgado, E.J.; Gordon, A.L.; Jimenez, R.

    2013-01-01

    Highlights: ► No previous reported studies about alkaline niobates as catalysts for soot oxidation. ► NaNbO 3 and KNbO 3 perovskite-type oxides show lower activation energy than other lanthanoid perovskite-type oxides. ► The alkaline niobate does not show deactivation by metal loss. - Abstract: The lack of studies in the current literature about the assessment of alkaline niobates as catalysts for soot oxidation has motivated this research. In this study, the synthesis, characterization and assessment of alkaline metal niobates as catalysts for soot combustion are reported. The solids MNbO 3 (M = Li, Na, K, Rb) are synthesized by a citrate method, calcined at 450 °C, 550 °C, 650 °C, 750 °C, and characterized by AAS, N 2 adsorption, XRD, O 2 -TPD, FTIR and SEM. All the alkaline niobates show catalytic activity for soot combustion, and the activity depends basically on the nature of the alkaline metal and the calcination temperature. The highest catalytic activity, expressed as the temperature at which combustion of carbon black occurs at the maximum rate, is shown by KNbO 3 calcined at 650 °C. At this calcination temperature, the catalytic activity follows an order dependent on the atomic number, namely: KNbO 3 > NaNbO 3 > LiNbO 3 . The RbNbO 3 solid do not follow this trend presumably due to the perovskite structure was not reached. The highest catalytic activity shown by of KNbO 3 , despite the lower apparent activation energy of NaNbO 3 , stress the importance of the metal nature and suggests the hypothesis that K + ions are the active sites for soot combustion. It must be pointed out that alkaline niobate subjected to consecutive soot combustion cycles does not show deactivation by metal loss, due to the stabilization of the alkaline metal inside the perovskite structure.

  18. Alkaline earth filled nickel skutterudite antimonide thermoelectrics

    Science.gov (United States)

    Singh, David Joseph

    2013-07-16

    A thermoelectric material including a body centered cubic filled skutterudite having the formula A.sub.xFe.sub.yNi.sub.zSb.sub.12, where A is an alkaline earth element, x is no more than approximately 1.0, and the sum of y and z is approximately equal to 4.0. The alkaline earth element includes guest atoms selected from the group consisting of Be, Mb, Ca, Sr, Ba, Ra and combinations thereof. The filled skutterudite is shown to have properties suitable for a wide variety of thermoelectric applications.

  19. [Preparation and applications of a supported liquid-liquid extraction column with a composite diatomite material].

    Science.gov (United States)

    Bao, Jianmin; Ma, Zhishuang; Sun, Ying; Wang, Yongzun; Li, Youxin

    2012-08-01

    A rapid and special supported liquid-liquid extraction (SLE) column was developed with a composite diatomite material. The SLE column was evaluated by high performance liquid chromatography (HPLC) with acidic, neutral and alkaline compounds dissolved in water. Furthermore, some real complex samples were also analyzed by HPLC with the SLE method. The recoveries of benzoic acid (acidic), p-nitroaniline (alkaline) and 4-hydroxy-benzoic methyl ester (neutral) treated by the SLE column were 90.6%, 98.1% and 97.7%. However, the recoveries of the three compounds treated by traditional liquid-liquid extraction (LLE) method were 71.9%, 81.9% and 83.9%. The results showed that the SLE technique had higher recoveries than the traditional LLE method. The spiked recoveries of the complex samples, such as benzoic acid in Sprite and dexamethasone acetate, chlorphenamine maleate, indomethacin in bovine serum, were between 80% and 110% and the relative standard deviations (RSDs) were less than 15%. For biological specimen, the results could be accepted. Meantime, many disadvantages associated with traditional LLE method, such as emulsion formation, didn't occur using SLE column. The SLE column technique is a good sample preparation method with many advantages, such as rapid, simple, robust, easily automated, high recovery and high-throughput, which would be widely used in the future.

  20. Magnetic Solid-phase Extraction with Fe3O4/Molecularly Imprinted Polymers Modified by Deep Eutectic Solvents and Ionic Liquids for the Rapid Purification of Alkaloid Isomers (Theobromine and Theophylline from Green Tea

    Directory of Open Access Journals (Sweden)

    Guizhen Li

    2017-06-01

    Full Text Available Different kinds of deep eutectic solvents (DES based on choline chloride (ChCl and ionic liquids (ILs based on 1-methylimidazole were used to modify Fe3O4/molecularly imprinted polymers (Fe3O4/MIPs, and the resulting materials were applied for the rapid purification of alkaloid isomers (theobromine and theophylline from green tea with magnetic solid-phase extraction (M-SPE. The M-SPE procedure was optimized using the response surface methodology (RSM to analyze the maximum conditions. The materials were characterized by Fourier transform infrared spectroscopy (FI-IR and field emission scanning electron microscopy (FE-SEM. Compared to the ILs-Fe3O4/MIPs, the DESs-Fe3O4/MIPs were developed for the stronger recognition and higher recoveries of the isomers (theophylline and theobromine from green tea, particularly DES-7-Fe3O4/MIPs. With RSM, the optimal recovery condition for theobromine and theophylline in the M-SPE were observed with ratio of methanol (80% as the washing solution, methanol/acetic acid (HAc (8:2 as the eluent at pH 3, and an eluent volume of 4 mL. The practical recoveries of theobromine and theophylline in green tea were 92.27% and 87.51%, respectively, with a corresponding actual extraction amount of 4.87 mg•g−1 and 5.07 mg•g−1. Overall, the proposed approach with the high affinity of Fe3O4/MIPs might offer a novel method for the purification of complex isomer samples.

  1. Magnetic Solid-phase Extraction with Fe₃O₄/Molecularly Imprinted Polymers Modified by Deep Eutectic Solvents and Ionic Liquids for the Rapid Purification of Alkaloid Isomers (Theobromine and Theophylline) from Green Tea.

    Science.gov (United States)

    Li, Guizhen; Wang, Xiaoqin; Row, Kyung Ho

    2017-06-25

    Different kinds of deep eutectic solvents (DES) based on choline chloride (ChCl) and ionic liquids (ILs) based on 1-methylimidazole were used to modify Fe3O4/molecularly imprinted polymers (Fe3O4/MIPs), and the resulting materials were applied for the rapid purification of alkaloid isomers (theobromine and theophylline) from green tea with magnetic solid-phase extraction (M-SPE). The M-SPE procedure was optimized using the response surface methodology (RSM) to analyze the maximum conditions. The materials were characterized by Fourier transform infrared spectroscopy (FI-IR) and field emission scanning electron microscopy (FE-SEM). Compared to the ILs-Fe3O4/MIPs, the DESs-Fe3O4/MIPs were developed for the stronger recognition and higher recoveries of the isomers (theophylline and theobromine) from green tea, particularly DES-7-Fe3O4/MIPs. With RSM, the optimal recovery condition for theobromine and theophylline in the M-SPE were observed with ratio of methanol (80%) as the washing solution, methanol/acetic acid (HAc) (8:2) as the eluent at pH 3, and an eluent volume of 4 mL. The practical recoveries of theobromine and theophylline in green tea were 92.27% and 87.51%, respectively, with a corresponding actual extraction amount of 4.87 mg•g-1 and 5.07 mg•g-1. Overall, the proposed approach with the high affinity of Fe3O4/MIPs might offer a novel method for the purification of complex isomer samples.

  2. A rapid solid-phase extraction method for measurement of non-metabolised peripheral benzodiazepine receptor ligands, [18F]PBR102 and [18F]PBR111, in rat and primate plasma

    International Nuclear Information System (INIS)

    Katsifis, Andrew; Loc'h, Christian; Henderson, David; Bourdier, Thomas; Pham, Tien; Greguric, Ivan; Lam, Peter; Callaghan, Paul; Mattner, Filomena; Eberl, Stefan; Fulham, Michael

    2011-01-01

    Objectives: To develop a rapid and reliable method for estimating non-metabolised PBR ligands fluoroethoxy ([ 18 F]PBR102)- and fluoropropoxy ([ 18 F]PBR111)-substituted 2-(6-chloro-2-phenyl)imidazo[1,2-a]pyridine-3-yl)-N,N-diethylacetamides in plasma. Methods: Rats and baboons were imaged with PET up to 2 h postinjection of [ 18 F]PBR102 and [ 18 F]PBR111 under baseline conditions, after pre-blocking or displacement with PK11195. Arterial plasma samples were directly analysed by reverse-phase solid-phase extraction (RP-SPE) and RP-HPLC and by normal-phase TLC. SPE cartridges were successively washed with acetonitrile/water mixtures. SPE eluant radioactivity was measured in a γ-counter to determine the parent compound fraction and then analysed by HPLC and TLC for validation. Results: In SPE, hydrophilic and lipophilic radiolabelled metabolites were eluted in water and 20% acetonitrile/water. All non-metabolised [ 18 F]PBR102 and [ 18 F]PBR111 were in SPE acetonitrile fraction as confirmed by HPLC and TLC analysis. Unchanged (%) [ 18 F]PBR102 and [ 18 F]PBR111 from SPE analysis in rat and baboon plasma agreed with those from HPLC and TLC analysis. In rats and baboons, the fraction of unchanged tracer followed a bi-exponential decrease, with half-lives of 7 to 10 min for the fast component and >80 min for the slow component for both tracers. Conclusions: Direct plasma SPE analysis of [ 18 F]PBR102 and [ 18 F]PBR111 can reliably estimate parent compound fraction. SPE was superior to HPLC for samples with low activity; it allows rapid and accurate metabolite analysis of a large number of plasma samples for improved estimation of metabolite-corrected input function during quantitative PET imaging studies.

  3. Mineralogical, petrological and geochemical aspects of alkaline and alkaline-carbonatite associations from Brazil

    Science.gov (United States)

    Morbidelli, L.; Gomes, C. B.; Beccaluva, L.; Brotzu, P.; Conte, A. M.; Ruberti, E.; Traversa, G.

    1995-12-01

    A general description of Mesozoic and Tertiary (Fortaleza) Brazilian alkaline and alkaline-carbonatite districts is presented with reference to mineralogy, petrology, geochemistry and geochronology. It mainly refers to scientific results obtained during the last decade by an Italo-Brazilian research team. Alkaline occurrences are distributed across Brazilian territory from the southern (Piratini, Rio Grande do Sul State) to the northeastern (Fortaleza, Ceará State) regions and are mainly concentrated along the borders of the Paraná Basin generally coinciding with important tectonic lineaments. The most noteworthy characteristics of these alkaline and alkaline-carbonatite suites are: (i) prevalence of intrusive forms; (ii) abundance of cumulate assemblages (minor dunites, frequent clinopyroxenites and members of the ijolite series) and (iii) abundance of evolved rock-types. Many data demonstrate that crystal fractionation was the main process responsible for magma evolution of all Brazilian alkaline rocks. A hypothesis is proposed for the genesis of carbonatite liquids by immiscibility processes. The incidence of REE and trace elements for different major groups of lithotypes, belonging both to carbonatite-bearing and carbonatite-free districts, are documented. Sr and preliminary Nd isotopic data are indicative of a mantle origin for the least evolved magmas of all the studied occurrences. Mantle source material and melting models for the generation of the Brazilian alkaline magma types are also discussed.

  4. Determination of Acidity and Alkalinity of Food Materials

    OpenAIRE

    三浦,芳助; 福永,祐子; 瀧川,裕里子; 津田,真美; 渡辺,陽子; 瀨山,一正

    2006-01-01

    The acidity and alkalinity of food materials in various menus was determined to clarify the influence of food on physiological functions. Menus mainly containing alkaline food materials (alkaline menu) and acid ones (acid menu) were compared. Determination of acidity and alkalinity was performed for each food material in the alkaline menu and acid menu, and acidity and alkalinity of one meal and a day's one were estimated. 1. Most of food materials in acid menu were assessed to be...

  5. Establishing Quantitative Standards for Residual Alkaline Phosphatase in Pasteurized Milk.

    Science.gov (United States)

    Kim, Dong-Hyeon; Chon, Jung-Whan; Lim, Jong-Soo; Kim, Hong-Seok; Kang, Il-Byeong; Jeong, Dana; Song, Kwang-Young; Kim, Hyunsook; Kim, Kwang-Yup; Seo, Kun-Ho

    2016-01-01

    The alkaline phosphatase (ALP) assay is a rapid and convenient method for verifying milk pasteurization. Since colorimetric ALP assays rely on subjective visual assessments, their results are especially unreliable near the detection limits. In this study, we attempted to establish quantitative criteria for residual ALP in milk by using a more objective method based on spectrophotometric measurements. Raw milk was heat-treated for 0, 10, 20, 30, and 40 min and then subjected to ALP assays. The quantitative criteria for residual ALP in the milk was determined as 2 μg phenol/mL of milk, which is just above the ALP value of milk samples heat-treated for 30 min. These newly proposed methodology and criteria could facilitate the microbiological quality control of milk.

  6. The Alkaline Diet: Is There Evidence That an Alkaline pH Diet Benefits Health?

    Directory of Open Access Journals (Sweden)

    Gerry K. Schwalfenberg

    2012-01-01

    Full Text Available This review looks at the role of an alkaline diet in health. Pubmed was searched looking for articles on pH, potential renal acid loads, bone health, muscle, growth hormone, back pain, vitamin D and chemotherapy. Many books written in the lay literature on the alkaline diet were also reviewed and evaluated in light of the published medical literature. There may be some value in considering an alkaline diet in reducing morbidity and mortality from chronic diseases and further studies are warranted in this area of medicine.

  7. The Alkaline Diet: Is There Evidence That an Alkaline ph Diet Benefits Health?

    International Nuclear Information System (INIS)

    Schwalfenberg, G.K.

    2012-01-01

    This review looks at the role of an alkaline diet in health. Pub med was searched looking for articles on ph, potential renal acid loads, bone health, muscle, growth hormone, back pain, vitamin D and chemotherapy. Many books written in the lay literature on the alkaline diet were also reviewed and evaluated in light of the published medical literature. There may be some value in considering an alkaline diet in reducing morbidity and mortality from chronic diseases and further studies are warranted in this area of medicine

  8. Alkaline Activator Impact on the Geopolymer Binders

    Science.gov (United States)

    Błaszczyński, Tomasz Z.; Król, Maciej R.

    2017-10-01

    Concrete structures are constantly moving in the direction of improving the durability. Durability depends on many factors, which are the composition of concrete mix, the usage of additives and admixtures and the place, where material will work and carry the load. The introduction of new geopolymer binders for geopolymer structures adds a new aspect that is type of used activator. This substance with strongly alkaline reaction is divided because of the physical state, the alkaline degree and above all the chemical composition. Taking into account, that at present the geopolymer binders are made essentially from waste materials or by-products from the combustion of coal or iron ore smelting, unambiguous determination of the effect of the activator on the properties of the geopolymer material requires a number of trials, researches and observation. This paper shows the influence of the most alkaline activators on the basic parameters of the durability of geopolymer binders. In this study there were used highly alkaline hydroxides, water glasses and granules, which are waste materials in a variety of processes taking place in chemical plants. As the substrate of geopolymer binders there were used fly ash which came from coal and high calcareous ash from the burning of lignite.

  9. ENHANCED OIL RECOVERY USING LOCAL ALKALINE

    African Journals Online (AJOL)

    user

    the discovery of new oil producing fields and the ever increasing ... followed by water flooding is between 35 to 50% of the ... involved and lack of scale up and is considered among ... carbonate alkaline chemical reacts with certain types of ... reservoirs because of the profusion of calcium and the ... damage the formation.

  10. Electrochemical behaviour of alkaline copper complexes

    Indian Academy of Sciences (India)

    Abstract. A search for non-cyanide plating baths for copper resulted in the development of alkaline copper complex baths containing trisodium citrate [TSC] and triethanolamine [TEA]. Voltammetric studies were carried out on platinum to understand the electrochemical behaviour of these complexes. In TSC solutions, the.

  11. Alkaline fuel cell technology in the lead

    International Nuclear Information System (INIS)

    Nor, J.K.

    2004-01-01

    The Alkaline Fuel Cell (AFC) was the first fuel cell successfully put into practice, a century after William Grove patented his 'hydrogen battery' in 1839. The space program provided the necessary momentum, and alkaline fuel cells became the power source for both the U.S. and Russian manned space flight. Astris Energi's mission has been to bring this technology down to earth as inexpensive, rugged fuel cells for everyday applications. The early cells, LABCELL 50 and LABCELL 200 were aimed at deployment in research labs, colleges and universities. They served well in technology demonstration projects such as the 1998 Mini Jeep, 2001 Golf Car and a series of portable and stationary fuel cell generators. The present third generation POWERSTACK MC250 poised for commercialization is being offered to AFC system integrators as a building block of fuel cell systems in numerous portable, stationary and transportation applications. It is also used in Astris' own E7 and E8 alkaline fuel cell generators. Astris alkaline technology leads the way toward economical, plentiful fuel cells. The paper highlights the progress achieved at Astris, improvements of performance, durability and simplicity of use, as well as the current and future thrust in technology development and commercialization. (author)

  12. A simple and rapid in situ preconcentration method for the determination of phosphate in environmental waters by use of solid-phase extraction, and its applications to brackish lake waters.

    Science.gov (United States)

    Okumura, M; Tong, L; Fujinaga, K; Seike, Y

    2001-05-01

    A simple and rapid in situ preconcentration method for the determination of phosphate in environmental waters has been developed for field analysis. This method is based on solid-phase extraction on a zirconium-loaded Sep-Pack Accell CM cartridge (Zr-SP) and is applicable to studies in which sampling is performed by use of a graduated syringe to prevent contamination and to ensure easy operation at sampling sites. The Zr-SP cartridge was prepared by passing 0.1 mol L(-1) zirconium solution through a Sep-Pak Accell CM cartridge, packed with cation exchange sorbent based on a silica matrix. The adsorption of phosphate and its desorption depend only on the pH of the solution. A water sample containing phosphate was adjusted to pH 2 and passed through the Zr-SP cartridge to collect it. The retained phosphate was quantitatively eluted with 0.5 mol L(-1) sodium hydroxide solution. The phosphate retained in the Zr-SP cartridge was stable for at least one month. The established preconcentration method was successfully applied to brackish lake waters to investigate seasonal changes in the distribution and behavior of phosphate in a brackish lake.

  13. Rapid and sensitive analysis of phthalate metabolites, bisphenol A, and endogenous steroid hormones in human urine by mixed-mode solid-phase extraction, dansylation, and ultra-performance liquid chromatography coupled with triple quadrupole mass spectrometry.

    Science.gov (United States)

    Wang, He-xing; Wang, Bin; Zhou, Ying; Jiang, Qing-wu

    2013-05-01

    Steroid hormone levels in human urine are convenient and sensitive indicators for the impact of phthalates and/or bisphenol A (BPA) exposure on the human steroid hormone endocrine system. In this study, a rapid and sensitive method for determination of 14 phthalate metabolites, BPA, and ten endogenous steroid hormones in urine was developed and validated on the basis of ultra-performance liquid chromatography coupled with electrospray ionization triple quadrupole mass spectrometry. The optimized mixed-mode solid phase-extraction separated the weakly acidic or neutral BPA and steroid hormones from acidic phthalate metabolites in urine: the former were determined in positive ion mode with a methanol/water mobile phase containing 10 mM ammonium formate; the latter were determined in negative ion mode with a acetonitrile/water mobile phase containing 0.1 % acetic acid, which significantly alleviated matrix effects for the analysis of BPA and steroid hormones. Dansylation of estrogens and BPA realized simultaneous and sensitive analysis of the endogenous steroid hormones and BPA in a single chromatographic run. The limits of detection were less than 0.84 ng/mL for phthalate metabolites and less than 0.22 ng/mL for endogenous steroid hormones and BPA. This proposed method had satisfactory precision and accuracy, and was successfully applied to the analyses of human urine samples. This method could be valuable when investigating the associations among endocrine-disrupting chemicals, endogenous steroid hormones, and relevant adverse outcomes in epidemiological studies.

  14. Conventional Treatment of Surface Water Using Moringa Oleifera Seeds Extract as a Primary Coagulant

    Directory of Open Access Journals (Sweden)

    Suleyman A. Muyibi, Ahmed Hissein M Birima, Thamer A. Mohammed

    2012-10-01

    Full Text Available The present study involved the use of a model pilot scale water treatment plant to treat turbid surface water from a stream using processed Moringa oleifera seed with 25 % w/w oil extracted as primary coagulant. The water treatment plant was made up of four unit operations: coagulation, flocculation, sedimentation, and filtration (rapid sand filter. Test runs were carried out for three hours per run over a three-month period with turbidities ranging from 18 to 261 NTU. The turbidity, pH, and alkalinity as well as the filter head loss were measured every 30 minutes during the experimental runs. Average turbidity removal of up to 96 % at an effective doses of 20 and 30 mg/l of oil extracted M. oleifera for low (< 50 NTU and moderate turbidity (< 100 NTU water respectively was observed doses 50 – 80 mg/l for high turbidity (> 100 NTU water. M. oleifera seed extract was found to have no significant effect on pH or alkalinity of the water. The residual turbidities measured during most of the test runs satisfied the Malaysian Guideline for Drinking Water Supplies. Key Words: Moringa oleifera, primary coagulant, coagulation, pilot plant, filtration.

  15. Three rapid methods for determination 90Sr in milk samples using liquid scintillation spectrometry

    International Nuclear Information System (INIS)

    Abbasisiara, F.; Attarilar, N.; Afshar, N.

    2006-01-01

    Strontium radionuclide 90 Sr is one of the main long-lived components of the radioactive fallout which occurred as a result of previous atmospheric nuclear tests and also nuclear accidents such as Chernobyl accident. Due to chemical and biochemical similarities between strontium and calcium, more than 99% of strontium is efficiently incorporated into bone tissue and teeth and Characterized by along physical and biological half-life, it may cause damage to bone marrow. Since determination of this radionuclide often is a time consuming process, rapid determination methods specially in emergency situations is always desirable. In this work, three rapid methods for determination of this radionuclide in milk samples will be evaluated. All of the methods include two major steps: 1- strontium separation from fats and proteins which can be performed by drying (in case of the fresh milk samples), ashing and leaching by nitric acids or by using exchange or chelating resins which have strong affinity for alkaline earth cations such as Dowex 50W-X8. And 2- Separation of Sr-90 or its daughter product, Y-90. In two methods separation of 90 Sr is performed by extraction of the daughter nuclide, 90 Y, by aid of organic extracting agent, Tributylphosphate or T.B.P., and then Cherenkov counting of the Y-90 extracted. The third method is based on separation of this radionuclide using Crown Ether or Sr -Spec resin. The detailed radiochemical procedures and evaluation of each method advantages or disadvantages will explained in full text paper. (authors)

  16. Production of alkaline proteases by alkalophilic Bacillus subtilis ...

    African Journals Online (AJOL)

    Tuoyo Aghomotsegin

    2016-11-23

    Nov 23, 2016 ... Key words: Production, alkaline protease, Bacillus subtilis, animal wastes, enzyme activity. ... Generally, alkaline proteases are produced using submerged fermentation .... biopolymer concentrations were reported to have an influence ... adding nitrogenous compounds stimulate microorganism growth and ...

  17. Osteocalcin and bone-specific alkaline phosphatase in Sickle cell ...

    African Journals Online (AJOL)

    specific alkaline phosphatase (b-AP) total protein levels were evaluated as indicators of bone turnover in twenty patients with sickle cell haemoglobinopathies and in twenty normal healthy individuals. The serum bonespecific alkaline phosphatase ...

  18. Elaboration and test of the method of separation of alkaline metals ions with tin phosphate

    International Nuclear Information System (INIS)

    Smirnov, G.I.; Chernyak, A.S.; Kostromina, O.N.; Kachur, N.Ya.; Shpeyzer, B.G.

    1986-01-01

    Present work is devoted to elaboration and test of the method of separation of alkaline metals ions with tin phosphate. Thus, the isotherms of sorption of lithium, sodium, potassium, rubidium and cesium ions with amorphous tin phosphate depending on their concentration, ph of solution, sorbent quantity are obtained. The parameters of extraction of potassium microquantities from sodium salts are defined. Ultra pure sodium chloride, sodium iodide, sodium sulphate, sodium nitrate, sodium nitrite, sodium phosphate are synthesized.

  19. Effects of biodegradable Mg–6Zn alloy extracts on apoptosis of intestinal epithelial cells

    International Nuclear Information System (INIS)

    Wang Zhanhui; Yan Jun; Li Jianan; Zheng Qi; Wang Zhigang; Zhang Xiaonong; Zhang Shaoxiang

    2012-01-01

    Highlights: ► We evaluated the effects of Mg–6Zn alloys on apoptosis of IEC-6 cells. ► The apoptosis was evaluated by investigating the expression of caspase-1 and Bcl-2. ► The IEC-6 cells displayed better cell functions in 60% or 20% extract. ► The conspicuous alkaline environment is disadvantageous to apoptosis of IEC cells. ► The excessive Mg concentration is disadvantageous to apoptosis of IEC-6 cells. - Abstract: In this study, intestinal epithelial cells (IEC)-6 were cultured in different concentration extracts of Mg–6Zn alloys for different time periods. To achieve a total of three concentrations (100%, 60% and 20% concentration), the extracts were serially diluted with Dulbecco's modified Eagle medium High Glucose to observe a dose–response relationship. We studied the indirect effects of Mg–6Zn alloys on IEC-6 cells apoptosis. The apoptosis of IEC-6 cells was measured using flow cytometry. And the apoptosis of IEC-6 cells was evaluated by investigating the expression of caspase-1and Bcl-2 using real-time polymerase chain reaction (PCR) and Western blotting tests. It was found that the levels of apoptosis in IEC-6 cells cultured in 100% Mg–6Zn alloy extracts were significantly higher than those in 60% and 20% extracts; the 100% extract can down-regulate expression of Bcl-2 after culture. The in vitro results indicated that the conspicuous alkaline environment and excessive Mg concentration, even Zn concentration caused by rapid corrosion of Mg–6Zn alloys promote IEC-6 cells apoptosis, although further experiments will be necessary to formally prove our conclusions. Therefore, the adjustment of the degradation rate is needed for using Mg–Zn alloy as a surgical suture material.

  20. Population structure of microbial communities associated with two deep, anaerobic, alkaline aquifers.

    Science.gov (United States)

    Fry, N K; Fredrickson, J K; Fishbain, S; Wagner, M; Stahl, D A

    1997-04-01

    Microbial communities of two deep (1,270 and 316 m) alkaline (pH 9.94 and 8.05), anaerobic (Eh, -137 and -27 mV) aquifers were characterized by rRNA-based analyses. Both aquifers, the Grande Ronde (GR) and Priest rapids (PR) formations, are located within the Columbia River Basalt Group in south-central Washington, and sulfidogenesis and methanogenesis characterize the GR and PR formations, respectively. RNA was extracted from microorganisms collected from groundwater by ultrafiltration through hollow-fiber membranes and hybridized to taxon-specific oligonucleotide probes. Of the three domains, Bacteria dominated both communities, making up to 92.0 and 64.4% of the total rRNA from the GR and PR formations, respectively. Eucarya comprised 5.7 and 14.4%, and Archaea comprised 1.8% and 2.5%, respectively. The gram-positive target group was found in both aquifers, 11.7% in GR and 7.6% in PR. Two probes were used to target sulfate- and/or metal-reducing bacteria within the delta subclass of Proteobacteria. The Desulfobacter groups was present (0.3%) only in the high-sulfate groundwater (GR). However, comparable hybridization to a probe selective for the desulfovibrios and some metal-reducing bacteria was found in both aquifers, 2.5 and 2.9% from the GR and PR formations, respectively. Selective PCR amplification and sequencing of the desulfovibrio/metal-reducing group revealed a predominance of desulfovibrios in both systems (17 of 20 clones), suggesting that their environmental distribution is not restricted by sulfate availability.

  1. CRIEPI's research results (2006-2011) and clarified future issues on alteration behavior of bentonite barrier by alkaline solutions

    International Nuclear Information System (INIS)

    Yokoyama, Shingo; Nakamura, Kunihiko; Tanaka, Yukihisa; Hironaga, Michihiko

    2013-01-01

    In radioactive waste disposal facilities, bentonite barrier would be altered by alkaline solutions which arise by leaching of cementitious materials. Consequently suitable properties of the bentonite barrier would be degraded for a long time period. In CRIEPI, the investigation on the alteration of the bentonite under alkaline conditions was started in 2006, and several CRIEPI reports have been published. Specifically, we have investigated the kinetics of montmorillonite dissolution, the mineralogical alteration of compacted bentonite (with high- and low-dry density) and the change of permeability of the compacted bentonite (with high- and low-dry density) during alteration under the alkaline conditions. Furthermore, stability of saponite, which has similar physical properties to the bentonite, under the alkaline conditions was also examined. In this report, we show the outline of those research results, and lay out the clarified future issues extracted from our results. Ten clarified future issues were divided three categories as follows: 1) the estimation of the alteration behavior of the bentonite by alkaline solutions, 2) the elucidation of the mechanism of physical properties (e.g., permeability, swelling properties and mechanistic properties) change of the compacted bentonites during alteration, and 3) the development of the model building and simulation technology concerning the change in physical properties during alteration under alkaline conditions. (author)

  2. Study of niobium corrosion in alkaline medium

    International Nuclear Information System (INIS)

    Almeida, S.H. de.

    1987-01-01

    A comparative study of niobium electrochemical behaviour in NaOH and KOH solution, with concentrations between 0,5 and 6,1M is presented. The studies were done through electrochemicals assays, consisting in the corrosion potential and anodic and cathodic polarization curves, complemented by loss of mass experiments. The niobium anodic behaviour in alkaline medium is characterized by passivation occurrence, with a stable film formation. The Na oH solution in alkaline medium are more corrosible to niobium than the KOH solution. The loss of mass assays showed that the corrosion velocit is more dependente of hydroxide concentration in KOH medium than the NaOH medium. (C.G.C.) [pt

  3. Hydrolysis of alkaline pretreated banana peel

    Science.gov (United States)

    Fatmawati, A.; Gunawan, K. Y.; Hadiwijaya, F. A.

    2017-11-01

    Banana peel is one of food wastes that are rich in carbohydrate. This shows its potential as fermentation substrate including bio-ethanol. This paper presented banana peel alkaline pretreatment and enzymatic hydrolysis. The pretreatment was intended to prepare banana peel in order to increase hydrolysis performance. The alkaline pretreatment used 10, 20, and 30% w/v NaOH solution and was done at 60, 70 and 80°C for 1 hour. The hydrolysis reaction was conducted using two commercial cellulose enzymes. The reaction time was varied for 3, 5, and 7 days. The best condition for pretreatment process was one conducted using 30% NaOH solution and at 80°C. This condition resulted in cellulose content of 90.27% and acid insoluble lignin content of 2.88%. Seven-day hydrolysis time had exhibited the highest reducing sugar concentration, which was7.2869 g/L.

  4. Extraction and characterization of proteins from banana (Musa Sapientum L) flower and evaluation of antimicrobial activities.

    Science.gov (United States)

    Sitthiya, Kewalee; Devkota, Lavaraj; Sadiq, Muhammad Bilal; Anal, Anil Kumar

    2018-02-01

    Ultrasonic assisted alkaline extraction of protein from banana flower was optimized using response surface methodology. The extracted proteins were characterized by Fourier transform infrared spectroscopy and molecular weight distribution was determined by gel electrophoresis. The maximum protein yield of 252.25 mg/g was obtained under optimized extraction conditions: temperature 50 °C, 30 min extraction time and 1 M NaOH concentration. The alkaline extraction produced a significantly high protein yield compared to enzymatic extraction of banana flower. Chemical finger printing of proteins showed the presence of tyrosine, tryptophan and amide bonds in extracted protein. Alkaline and pepsin assisted extracted banana flower proteins showed characteristic bands at 40 and 10 kDA, respectively. The extracted proteins showed antibacterial effects against both gram positive and gram negative bacteria. The high protein content and antimicrobial activity indicate the potential applications of banana flower in the food and feed industry.

  5. Effects of garlic and diallyl trisulfide on the growth, photosynthesis, and alkaline phosphatase activity of the toxic cyanobacterium Microcystis aeruginosa.

    Science.gov (United States)

    Wang, Shoubing; Wang, Yuanan; Ma, Xiaoxue; Xu, Ziran

    2016-03-01

    To identify a botanical algicide and elucidate the response of cyanobacteria to the extract from higher plants, the effects of garlic and garlic-derived diallyl trisulfide on Microcystis aeruginosa were studied. Effects were evaluated by changes in cell density, chlorophyll a, maximum effective quantum yield (Fv/Fm), effective quantum yield (YII), non-photochemical quenching (NPQ), and rapid light curves of M. aeruginosa. In addition, alkaline phosphatase activity (APA) was measured when M. aeruginosa was incubated with diallyl trisulfide. Results indicated that the inhibition by garlic and diallyl trisulfide was significant. The 120-h 50 % effective concentrations of garlic and diallyl trisulfide (EC50) were 0.75 g L(-1) and 2.84 mg L(-1), respectively. Moreover, the inhibitory rate increased with increasing concentration and the growth of M. aeruginosa was inhibited by 90.0 % at the highest concentrations. We also show that the response of M. aeruginosa to stress could involve both impairment of the photosynthetic center PSII and alteration of APA. For example, at high garlic concentration (2.0 g L(-1)), Fv/Fm significantly decreased from 0.501 to 0.084 (p garlic as an environmentally friendly algicide.

  6. Oxidation catalysts on alkaline earth supports

    Science.gov (United States)

    Mohajeri, Nahid

    2017-03-21

    An oxidation catalyst includes a support including particles of an alkaline earth salt, and first particles including a palladium compound on the support. The oxidation catalyst can also include precious metal group (PMG) metal particles in addition to the first particles intermixed together on the support. A gas permeable polymer that provides a continuous phase can completely encapsulate the particles and the support. The oxidation catalyst may be used as a gas sensor, where the first particles are chemochromic particles.

  7. Heavy water production by alkaline water electrolysis

    International Nuclear Information System (INIS)

    Kamath, Sachin; Sandeep, K.C.; Bhanja, Kalyan; Mohan, Sadhana; Sugilal, G.

    2014-01-01

    Several heavy water isotope production processes are reported in literature. Water electrolysis in combination with catalytic exchange CECE process is considered as a futuristic process to increase the throughput and reduce the cryogenic distillation load but the application is limited due to the high cost of electricity. Any improvement in the efficiency of electrolyzers would make this process more attractive. The efficiency of alkaline water electrolysis is governed by various phenomena such as activation polarization, ohmic polarization and concentration polarization in the cell. A systematic study on the effect of these factors can lead to methods for improving the efficiency of the electrolyzer. A bipolar and compact type arrangement of the alkaline water electrolyzer leads to increased efficiency and reduced inventory in comparison to uni-polar tank type electrolyzers. The bipolar type arrangement is formed when a number of single cells are stacked together. Although a few experimental studies have been reported in the open literature, CFD simulation of a bipolar compact alkaline water electrolyzer with porous electrodes is not readily available.The principal aim of this study is to simulate the characteristics of a single cell compact electrolyzer unit. The simulation can be used to predict the Voltage-Current Density (V-I) characteristics, which is a measure of the efficiency of the process.The model equations were solved using COMSOL multi-physics software. The simulated V-I characteristic is compared with the experimental data

  8. Changes of serum alkaline phosphatase isoenzymes in fasted rats.

    Science.gov (United States)

    Wada, H; Niwa, N; Hayakawa, T; Tsuge, H

    1996-10-01

    Changes of serum alkaline phosphatase (sALP) isoenzymes under fasting conditions were examined using polyacrylamide gel electrophoresis (PAGE), amino-acids (L-phenylalanine (L-Phe), L-homoarginine (L-HArg)) inhibition and wheat germ agglutinin (WGA) treatment. The sALP of non-fasted rats was separated into three bands (S1, S2, S3) by PAGE. The molecular weight (M.W.) of S1 corresponded to that of an isoenzyme found in the ileum. By the addition of L-Phe, the staining intensity of S1 was weakened, S2 and S3 remained unchanged and the total activity of the isoenzymes extracted from intestine decreased. On the other hand, the activity of isoenzymes extracted from kidney and bone decreased by the addition of L-HArg. Therefore, S1 was judged to be derived from intestine. The activities of total sALP and S1 decreased from 16 h of fasting. Total sALP activity and sALP activity of the supernatant prepared by WGA treatment decreased, whereas the ALP activity of the precipitate (difference between total sALP activity and supernatant sALP activity) did not change. The activity band of the precipitate corresponded to that of S3 by PAGE. Therefore, S3 was judged to be derived from bone. In conclusion, under fasting conditions, the activity of S1 decreased while the activities of S2 and S3 remained unchanged.

  9. Ammonium carbonate and/or bicarbonate plus alkaline chlorate oxidant for recovery of uranium values

    International Nuclear Information System (INIS)

    Stapp, P.R.

    1983-01-01

    In accordance with the present invention, uranium values are extracted from materials containing uranium in valence states lower than its hexavalent state by contacting the materials containing uranium with an aqueous alkaline leach solution containing an alkaline chlorate in an amount sufficient to oxidize at least a portion of the uranium in valence states lower than its hexavalent state to its hexavalent state. In a further embodiment of the present invention, the alkaline leach solution is an aqueous solution of a carbonate selected from the group consisting of ammonium carbonate, ammonium bicarbonate and mixtures thereof. In yet another embodiment of the present invention, at least one catalytic compound of a metal selected from the group consisting of copper, cobalt, iron, nickel, chromium and mixtures thereof adapted to assure the presence of the ionic species Cu ++ , Co ++ , Fe +++ , Ni ++ , Cr +++ and mixtures thereof, respectively, during the contacting of the material containing uranium with the alkaline leach solution and in an amount sufficient to catalyze the oxidation of at least a portion of the uranium in its lower valence states to its hexavalent state, is present

  10. Long-term evolution of highly alkaline steel slag drainage waters.

    Science.gov (United States)

    Riley, Alex L; Mayes, William M

    2015-07-01

    The disposal of slag generated by the steel industry can have negative consequences upon the surrounding aquatic environment by the generation of high pH waters, leaching of potentially problematic trace metals, and rapid rates of calcite precipitation which smother benthic habitats. A 36-year dataset was collated from the long-term ambient monitoring of physicochemical parameters and elemental concentrations of samples from two steel slag leachate-affected watercourses in northern England. Waters were typified by elevated pH (>10), high alkalinity, and were rich in dissolved metals (e.g. calcium (Ca), aluminium (Al), and zinc (Zn)). Long-term trend analysis was performed upon pH, alkalinity, and Ca concentration which, in addition to Ca flux calculations, were used to highlight the longevity of pollution arising as a result of the dumping and subsequent leaching of steel slags. Declines in calcium and alkalinity have been modest over the monitoring period and not accompanied by significant declines in water pH. If the monotonic trends of decline in alkalinity and calcium continue in the largest of the receiving streams, it will be in the region of 50-80 years before calcite precipitation would be expected to be close to baseline levels, where ecological impacts would be negligible.

  11. Alkaline solution/binder ratio as a determining factor in the alkaline activation of aluminosilicates

    Energy Technology Data Exchange (ETDEWEB)

    Ruiz-Santaquiteria, C., E-mail: ruiz.cs@ietcc.csic.es [Eduardo Torroja Institute (CSIC), c/Serrano Galvache, n Degree-Sign 4, 28033 Madrid (Spain); Skibsted, J. [Instrument Centre for Solid-State NMR Spectroscopy, Interdisciplinary Nanoscience Center (iNANO), Department of Chemistry, Aarhus University, DK-8000 Aarhus C (Denmark); Fernandez-Jimenez, A.; Palomo, A. [Eduardo Torroja Institute (CSIC), c/Serrano Galvache, n Degree-Sign 4, 28033 Madrid (Spain)

    2012-09-15

    This study investigates the effect of the alkaline solution/binder (S/B) ratio on the composition and nanostructure of the reaction products generated in the alkaline activation of aluminosilicates. The experiments used two mixtures of fly ash and dehydroxylated white clay and for each of these, varying proportions of the solution components. The alkali activator was an 8 M NaOH solution (with and without sodium silicate) used at three S/B ratios: 0.50, 0.75 and 1.25. The {sup 29}Si, {sup 27}Al MAS NMR and XRD characterisation of the reaction products reveal that for ratios nearest the value delivering suitable paste workability, the reaction-product composition and structure depend primarily on the nature and composition of the starting materials and the alkaline activator used. However, when an excess alkaline activator is present in the system, the reaction products tend to exhibit SiO{sub 2}/Al{sub 2}O{sub 3} ratios of approximately 1, irrespective of the composition of the starting binder or the alkaline activator.

  12. Cyclic, Early Diagenetic Dolomite Formation in Alkaline Lake Van

    Science.gov (United States)

    McCormack, J.; Bontognali, T. R. R.; Immenhauser, A.; Kwiecien, O.

    2017-12-01

    rapid Northern Hemisphere temperature oscillation (i.e. Greenland Interstadials). Lake Vańs dolomite record thus provides compelling arguments suggesting that early diagenetic dolomite formation within an alkaline environment can be highly sensitive to hydrological changes even on centennial timescales.

  13. Effects of biochars on the availability of heavy metals to ryegrass in an alkaline contaminated soil.

    Science.gov (United States)

    Zhang, Guixiang; Guo, Xiaofang; Zhao, Zhihua; He, Qiusheng; Wang, Shuifeng; Zhu, Yuen; Yan, Yulong; Liu, Xitao; Sun, Ke; Zhao, Ye; Qian, Tianwei

    2016-11-01

    A pot experiment was conducted to investigate the effects of biochars on the availability of heavy metals (Cd, Cu, Mn, Ni, Pb, and Zn) to ryegrass in an alkaline contaminated soil. Biochars only slightly decreased or even increased the availability of heavy metals assesses by chemical extractant (a mixture of 0.05 mol L -1 ethylenediaminetetraacetic acid disodium, 0.01 mol L -1 CaCl 2 , and 0.1 mol L -1 triethanolamine). The significantly positive correlation between most chemical-extractable heavy metals and the ash content in biochars indicated the positive role of ash in this extraction. Biochars significantly reduced the plant uptake of heavy metals, excluding Mn. The absence of a positive correlation between the chemical-extractable heavy metals and the plant uptake counterparts (except for Mn) indicates that chemical extractability is probably not a reliable indicator to predict the phytoavailability of most heavy metals in alkaline soils treated with biochars. The obviously negative correlation between the plant uptake of heavy metals (except for Mn) and the (O + N)/C and H/C indicates that biochars with more polar groups, which were produced at lower temperatures, had higher efficiency for reducing the phytoavailability of heavy metals. The significantly negative correlations between the plant uptake of Mn and ryegrass biomass indicated the "dilution effect" caused by the improvement of biomass. These observations will be helpful for designing biochars as soil amendments to reduce the availability of heavy metals to plants in soils, especially in alkaline soils. Copyright © 2016. Published by Elsevier Ltd.

  14. JINR rapid communications

    International Nuclear Information System (INIS)

    1998-01-01

    The present collection of rapid communications from JINR, Dubna, contains seven separate records on decays of excited strange mesons in the extended NJL model, production of heavy evaporation residues in the reactions induced by an extracted 48 Ca beam on a 208 Pb target, scaling behaviour of tensor analyzing power (A yy ) in the inelastic scattering or relativistic deuterons,two-photon collisions at very low Q 2 from LEP2: forthcoming results, high magnetic field uniformity superconducting magnet for a movable polarized target, multichannel time-to-digital converter for drift detector and wavelet-analysis: application to Gaussian signals

  15. Temperature Dependence of Mineral Solubility in Water. Part 2. Alkaline and Alkaline Earth Bromides

    Science.gov (United States)

    Krumgalz, B. S.

    2018-03-01

    Databases of alkaline and alkaline earth bromide solubilities in water at various temperatures were created using experimental data from publications over about the last two centuries. Statistical critical evaluation of the created databases was produced since there were enough independent data sources to justify such evaluation. The reliable experimental data were adequately described by polynomial expressions over various temperature ranges. Using the Pitzer approach for ionic activity and osmotic coefficients, the thermodynamic solubility products for the discussed bromide minerals have been calculated at various temperature intervals and also represented by polynomial expressions.

  16. Fractional, biodegradable and spectral characteristics of extracted and fractionated sludge extracellular polymeric substances.

    Science.gov (United States)

    Wei, Liang-Liang; Wang, Kun; Zhao, Qing-Liang; Jiang, Jun-Qiu; Kong, Xiang-Juan; Lee, Duu-Jong

    2012-09-15

    Correlation between fractional, biodegradable and spectral characteristics of sludge extracellular polymeric substances (EPS) by different protocols has not been well established. This work extracted sludge EPS using alkaline extractants (NH₄OH and formaldehyde + NaOH) and physical protocols (ultrasonication, heating at 80 °C or cation exchange resin (CER)) and then fractionated the extracts using XAD-8/XAD-4 resins. The alkaline extractants yielded more sludge EPS than the physical protocols. However, the physical protocols extracted principally the hydrophilic components which were readily biodegradable by microorganisms. The alkaline extractants dissolved additional humic-like substances from sludge solids which were refractory in nature. Different extraction protocols preferably extracted EPS with distinct fractional, biodegradable and spectral characteristics which could be applied in specific usages. Copyright © 2012 Elsevier Ltd. All rights reserved.

  17. A study of extraction of oil through a polymer flooding method

    Energy Technology Data Exchange (ETDEWEB)

    Aliyev, V.S.; Agazade, A.D.; Asadov, Z.G.; Yusubov, A.Yu.

    1983-01-01

    A number of representatives of water soluble acrylic polymers is synthesized. These include polyacrylamine (PAA), methylated polyacrylamine, polymethacrylic acid (PMAK) and its alkaline salts. The oil extracting properties of the synthesized polymers are studied in a laboratory installation. The effectiveness for extracting Romaninsk oil of solutions of polyacrylamine, methylated polyacrylamine and polymethacrylic acid in alkaline stratum water (the effect is 12 to 17 percent) is shown. It is established that the solutions of alkaline (sodium, potassium, and ammonium) salts of polymethacrylic acid in fresh water have good extracting capabilities as compared to light Balakhansk oil. The effect is 14 to 19 percent.

  18. Net alkalinity and net acidity 2: Practical considerations

    Science.gov (United States)

    Kirby, C.S.; Cravotta, C.A.

    2005-01-01

    The pH, alkalinity, and acidity of mine drainage and associated waters can be misinterpreted because of the chemical instability of samples and possible misunderstandings of standard analytical method results. Synthetic and field samples of mine drainage having various initial pH values and concentrations of dissolved metals and alkalinity were titrated by several methods, and the results were compared to alkalinity and acidity calculated based on dissolved solutes. The pH, alkalinity, and acidity were compared between fresh, unoxidized and aged, oxidized samples. Data for Pennsylvania coal mine drainage indicates that the pH of fresh samples was predominantly acidic (pH 2.5-4) or near neutral (pH 6-7); ??? 25% of the samples had pH values between 5 and 6. Following oxidation, no samples had pH values between 5 and 6. The Standard Method Alkalinity titration is constrained to yield values >0. Most calculated and measured alkalinities for samples with positive alkalinities were in close agreement. However, for low-pH samples, the calculated alkalinity can be negative due to negative contributions by dissolved metals that may oxidize and hydrolyze. The Standard Method hot peroxide treatment titration for acidity determination (Hot Acidity) accurately indicates the potential for pH to decrease to acidic values after complete degassing of CO2 and oxidation of Fe and Mn, and it indicates either the excess alkalinity or that required for neutralization of the sample. The Hot Acidity directly measures net acidity (= -net alkalinity). Samples that had near-neutral pH after oxidation had negative Hot Acidity; samples that had pH mine drainage treatment can lead to systems with insufficient Alkalinity to neutralize metal and H+ acidity and is not recommended. The use of net alkalinity = -Hot Acidity titration is recommended for the planning of mine drainage treatment. The use of net alkalinity = (Alkalinitymeasured - Aciditycalculated) is recommended with some cautions

  19. Improvement of Aluminum-Air Battery Performances by the Application of Flax Straw Extract.

    Science.gov (United States)

    Grishina, Ekaterina; Gelman, Danny; Belopukhov, Sergey; Starosvetsky, David; Groysman, Alec; Ein-Eli, Yair

    2016-08-23

    The effect of a flax straw extract on Al corrosion inhibition in a strong alkaline solution was studied by using electrochemical measurements, weight-loss analysis, SEM, and FTIR spectroscopy. Flax straw extract added (3 vol %) to the 5 m KOH solution to act as a mixed-type Al corrosion inhibitor. The electrochemistry of Al in the presence of a flax straw extract in the alkaline solution, the effect of the extract on the Al morphology and surface films formed, and the corrosion inhibition mechanism are discussed. Finally, the Al-air battery discharge capacity recorded from a cell that used the flax straw extract in the alkaline electrolyte is substantially higher than that with only a pure alkaline electrolyte. This improved sustainability of the Al anode is attributed to Al corrosion inhibition and, consequently, to hydrogen evolution suppression. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  20. RES Hydrogen: efficient pressurised alkaline electrolysers

    DEFF Research Database (Denmark)

    Bowen, Jacob R.; Bentzen, Janet Jonna; Jørgensen, Peter Stanley

    The RESelyser project addresses issues associated with coupling alkaline electrolysis to renewable energy sources such as electrode stability and gas purity by implementing improved electrodes and a new separator membrane concept. The project aims to improve performance, operation pressure...... and reduce system cost. The project supports DTU Energy's activities on electrodes within the larger FCH-JU project. The overall project demonstrated: improved electrode efficiency also during cyclic operation, safe gas purity at a system pressure of 30 bar, 10 kW stack operation and estimated system costs...

  1. Alkaline carbonates in blast furnace process

    Directory of Open Access Journals (Sweden)

    P. Besta

    2014-10-01

    Full Text Available The production of iron in blast furnaces is a complex of physical, chemical and mechanical processes. The input raw materials contain not only metallic components, but also a number of negative elements. The most important negative elements include alkaline carbonates. They can significantly affect the course of the blast furnace process and thus the overall performance of the furnace. As a result of that, it is essential to accurately monitor the alkali content in the blast furnace raw materials. The article analyzes the alkali content in input and output raw materials and their impact on the blast furnace process.

  2. Persistently increased intestinal fraction of alkaline phosphatase

    DEFF Research Database (Denmark)

    Nathan, E; Baatrup, G; Berg, H

    1984-01-01

    Persistent elevation of the intestinal fraction of the alkaline phosphatase (API) as an isolated finding has to our knowledge not been reported previously. It was found in a boy followed during a period of 5.5 years. The only symptom was transient periodic fatigue observed at home, but not apparent...... during hospitalization. His blood type was O, RH+, Le (a-, b+) and he was a secretor of H-substance, which may be associated with rising API activity after fat-loading. In this case API was unchanged after fat-loading. Neither intestinal nor liver diseases were found, and no other cause for the elevated...

  3. Alkaline erosion of CR 39 polymer surfaces

    International Nuclear Information System (INIS)

    Faiman, Laurence

    2009-01-01

    We have investigated the mechanism of erosion of CR 39 polymer in alkaline environments. We observed the kinetics of absorption of water and methanol into both unirradiated and γ-irradiated samples. We use a capillary model to interpret our results. We etched our samples in both KOH solutions, and KOH solutions doped with methanol. Etch rate was desensitizing to γ-irradiation when KOH concentration approached saturation, but KOH solutions doped with methanol were not desensitizing, unlike with nuclear tracks. We account for this difference

  4. Electrochemistry of Some New Alkaline Battery Electrodes

    Science.gov (United States)

    1976-02-01

    1NýT;7 ~~ AFAPI 4TR- 75)aI Electrochemistry of Somwý New Alkaline V CI RG, 0OTNME Dr/ David F., ’Pickett, IM Wayue ’,Hisb’q Mr. R ic ha rd A I Mid...adding ZnO to the electi-olyte (saturated) and usi .j the interc:ell conrec;tor d isr:ussed earlier ,itLh el4cc.roploated zinc ag inst. the silver fo

  5. Effect of subchronic administration of ethanolic leaf extract of croton ...

    African Journals Online (AJOL)

    The biochemical effcts of ethanolic leaf extract of Croton zambesicus on serum alkaline phosphatase(SAP),aspartate aminotransferase (AST) ,alanine aminotransferase(ALT),serum total protein and albumin were studied.The levels of these enzymes and that of total protein and albumin in the extract treated rats were not ...

  6. Impact of anode substrates on electrodeposited zinc over cycling in zinc-anode rechargeable alkaline batteries

    International Nuclear Information System (INIS)

    Wei, Xia; Desai, Divyaraj; Yadav, Gautam G.; Turney, Damon E.; Couzis, Alexander; Banerjee, Sanjoy

    2016-01-01

    Electrochemical behavior of Ag, Bi, Cu, Fe, Ni and Sn substrates on zinc deposition was evaluated over battery cycling by cyclic voltammetry and electrochemical impedance spectroscopy. The effect of Bi, Cu, Ni, and Sn substrates on zinc electrodeposition during battery cycling was investigated using scanning electron microscopy and X-ray diffraction. The corrosion behavior of each metal in 9 M KOH and the corrosion rates of zinc plated on each substrate were analyzed by Tafel extrapolation method from the potentiodynamic polarization curves and electrochemical impedance spectroscopy. Although the charge-transfer resistance (R_c_t) of zinc electrodeposition is lowest on Sn, Sn eventually corrodes on cycling in alkaline media. Use of Ni as a substrate causes zinc to deteriorate on account of rapid hydrogen evolution. Bi and Cu substrates are more suitable for use as current collectors in zinc-anode alkaline rechargeable batteries because of their low corrosion rate and compact zinc deposition over battery cycling.

  7. Transport phenomena in alkaline direct ethanol fuel cells for sustainable energy production

    Science.gov (United States)

    An, L.; Zhao, T. S.

    2017-02-01

    Alkaline direct ethanol fuel cells (DEFC), which convert the chemical energy stored in ethanol directly into electricity, are one of the most promising energy-conversion devices for portable, mobile and stationary power applications, primarily because this type of fuel cell runs on a carbon-neutral, sustainable fuel and the electrocatalytic and membrane materials that constitute the cell are relatively inexpensive. As a result, the alkaline DEFC technology has undergone a rapid progress over the last decade. This article provides a comprehensive review of transport phenomena of various species in this fuel cell system. The past investigations into how the design and structural parameters of membrane electrode assemblies and the operating parameters affect the fuel cell performance are discussed. In addition, future perspectives and challenges with regard to transport phenomena in this fuel cell system are also highlighted.

  8. Alkaline chemistry of transuranium elements and technetium and the treatment of alkaline radioactive wastes

    International Nuclear Information System (INIS)

    Delegard, C.H.; Peretrukhin, V.F.; Shilov, V.P.; Pikaev, A.K.

    1995-05-01

    Goal of this survey is to generalize the known data on fundamental physical-chemical properties of TRUs and Tc, methods for their isolation, and to provide recommendations that will be useful for partitioning them from alkaline high-level wastes

  9. Alkaline chemistry of transuranium elements and technetium and the treatment of alkaline radioactive wastes

    Energy Technology Data Exchange (ETDEWEB)

    Delegard, C.H. [Westinghouse Hanford Co., Richland, WA (United States); Peretrukhin, V.F.; Shilov, V.P.; Pikaev, A.K. [Russian Academy of Sciences (Russian Federation). Inst. of Physical Chemistry

    1995-05-01

    Goal of this survey is to generalize the known data on fundamental physical-chemical properties of TRUs and Tc, methods for their isolation, and to provide recommendations that will be useful for partitioning them from alkaline high-level wastes.

  10. Isotherms of ion exchange on titanates of alkaline metals

    International Nuclear Information System (INIS)

    Fillina, L.P.; Belinskaya, F.A.

    1986-01-01

    Present article is devoted to isotherms of ion exchange on titanates of alkaline metals. Therefore, finely dispersed hydrated titanates of alkaline metals (lithium, sodium, potassium) with ion exchange properties are obtained by means of alkaline hydrolysis of titanium chloride at high ph rates. Sorption of cations from salts solution of Li 2 SO 4 , NaNO 3 , Ca(NO 3 ) 2 , AgNO 3 by titanates is studied.

  11. Acid transformation of bauxite residue: Conversion of its alkaline characteristics

    OpenAIRE

    Kong, X.; Li, M.; Xue, S.; Hartley, W.; Chen, C.; Wu, C.; Li, X.; Li, Y.

    2016-01-01

    Bauxite residue (BR) is a highly alkaline solid hazardous waste produced from bauxite processing for alumina production. Alkaline transformation appears to reduce the environmental risk of bauxite residue disposal areas (BRDAs) whilst potentially providing opportunities for the sustainable reuse and on-going management of BR. Mineral acids, a novel citric acid and a hybrid combination of acid-gypsum treatments were investigated for their potential to reduce residue pH and total alkalinity and...

  12. Spectroscopic characterization of alkaline earth uranyl carbonates

    International Nuclear Information System (INIS)

    Amayri, Samer; Reich, Tobias; Arnold, Thuro; Geipel, Gerhard; Bernhard, Gert

    2005-01-01

    A series of alkaline uranyl carbonates, M[UO 2 (CO 3 ) 3 ].nH 2 O (M=Mg 2 , Ca 2 , Sr 2 , Ba 2 , Na 2 Ca, and CaMg) was synthesized and characterized by inductively coupled plasma mass spectrometry (ICP-MS) and atomic absorption spectrometry (AAS) after nitric acid digestion, X-ray powder diffraction (XRD), and thermal analysis (TGA/DTA). The molecular structure of these compounds was characterized by extended X-ray absorption fine-structure (EXAFS) spectroscopy and X-ray photoelectron spectroscopy (XPS). Crystalline Ba 2 [UO 2 (CO 3 ) 3 ].6H 2 O was obtained for the first time. The EXAFS analysis showed that this compound consists of (UO 2 )(CO 3 ) 3 clusters similar to the other alkaline earth uranyl carbonates. The average U-Ba distance is 3.90+/-0.02A.Fluorescence wavelengths and life times were measured using time-resolved laser-induced fluorescence spectroscopy (TRLFS). The U-O bond distances determined by EXAFS, TRLFS, XPS, and Raman spectroscopy agree within the experimental uncertainties. The spectroscopic signatures observed could be useful for identifying uranyl carbonate species adsorbed on mineral surfaces

  13. Activation of Alkaline Irrigation Fluids in Endodontics

    Directory of Open Access Journals (Sweden)

    Laurence J. Walsh

    2017-10-01

    Full Text Available In conventional endodontic treatment, alkaline solutions of sodium hypochlorite (NaOCl and ethylenediaminetetraacetic acid (EDTA are used in combination to disinfect the root canal system and to eliminate debris and smear layers. An important concept that has emerged over recent years is the use of active physical methods for agitating these fluids to improve their penetration within areas that are not reached by endodontic instruments and to accelerate the chemical actions of these alkaline fluids against planktonic microorganisms, biofilms, soft tissue remnants and smear layers. Ultrasonic agitation and more recently pulsed lasers have emerged as two promising methods for activating endodontic irrigation fluids. Ultrasonic agitation with piezoelectric devices employs a moving tip, while laser agitation uses a stationary tip. Both methods cause cavitation, followed by implosions and shear forces which assist with debridement. Fluid streaming further enhances the activity of the fluids. While agitation enhances performance of irrigants, extrusion of fluids from the root canal during activation is a hazard that must be controlled.

  14. A solution for cesium removal from high-salinity acidic or alkaline liquid waste: The crown calix[4]arenes

    International Nuclear Information System (INIS)

    Dozol, J.F.; Simon, N.; Lamare, V.; Rouquette, H.; Eymard, S.; Tournois, B.; Marc, D. de; Macias, R.M.

    1999-01-01

    Calix[4]arenes monocrown or biscrown, blocked in 1,3 alternative cone conformation, display an exceptional efficiency for cesium extraction, even from very acid or alkaline media. Moreover, they possess an important selectivity for cesium over sodium that makes possible the extraction of cesium from media containing high sodium nitrate loadings. Another advantage, since the extraction of cesium is reversible, is that the stripping of cesium can be carried out in deionized water, a property which leads to very high concentration factors. 79 refs., 10 figs., 6 tabs

  15. simple and rapid spectrophotometric assay of levocetirizine

    African Journals Online (AJOL)

    Preferred Customer

    Simple, rapid, selective and fairly sensitive method is described for the ... Determination of small amounts of LCTZ in pharmaceutical preparations is important for .... sodium hydroxide and extraction of HCl-free-amine into chloroform followed ...

  16. Metal mobilization under alkaline conditions in ash-covered tailings.

    Science.gov (United States)

    Lu, Jinmei; Alakangas, Lena; Wanhainen, Christina

    2014-06-15

    The aim of this study was to determine element mobilization and accumulation in mill tailings under alkaline conditions. The tailings were covered with 50 cm of fly ash, and above a sludge layer. The tailings were geochemically and mineralogically investigated. Sulfides, such as pyrrhotite, sphalerite and galena along with gangue minerals such as dolomite, calcite, micas, chlorite, epidote, Mn-pyroxene and rhodonite were identified in the unoxidized tailings. The dissolution of the fly ash layer resulted in a high pH (close to 12) in the underlying tailings. This, together with the presence of organic matter, increased the weathering of the tailings and mobilization of elements in the uppermost 47 cm of the tailings. All primary minerals were depleted, except quartz and feldspar which were covered by blurry secondary carbonates. Sulfide-associated elements such as Cd, Fe, Pb, S and Zn and silicate-associated elements such as Fe, Mg and Mn were released from the depletion zone and accumulated deeper down in the tailings where the pH decreased to circum-neutral. Sequential extraction suggests that Cd, Cu, Fe, Pb, S and Zn were retained deeper down in the tailings and were mainly associated with the sulfide phase. Calcium, Cr, K and Ni released from the ash layer were accumulated in the uppermost depletion zone of the tailings. Copyright © 2014 Elsevier Ltd. All rights reserved.

  17. Reduction of Fumonisin Toxicity by Extrusion and Nixtamalization (Alkaline Cooking).

    Science.gov (United States)

    Voss, Kenneth; Ryu, Dojin; Jackson, Lauren; Riley, Ronald; Gelineau-van Waes, Janee

    2017-08-23

    Fumonisins are mycotoxins found in corn. They are toxic to animals and cause cancer in rodents and neural tube defects in LM/Bc mice. Reducing their concentrations in corn-based foods is therefore desirable. Chemical analysis or in vitro bioassays of food extracts might not detect toxic fumonisin reaction products that are unknown or unextractable from food matrices, thus potentially underestimating in vivo toxicity. The effectiveness of two common cooking methods, extrusion and nixtamalization (alkaline cooking), to reduce the toxicity of fumonisin-contaminated corn grits (extrusion) and whole kernel corn (nixtamalization) was shown by means of rat feeding bioassays using fumonisin-specific kidney effects as indicators of potential toxicity. A third bioassay showed that in contrast to fumonisin B 1 (FB 1 ), hydrolyzed fumonisin B 1 (HFB 1 ; formed from FB 1 during nixtamalization) did not cause neural tube defects in LM/Bc mice. The findings indicate that extrusion and nixtamalization reduce the potential toxicity of FB 1 -contaminated corn.

  18. New alternative processes for the treatment of the alkaline solvent wash waste

    International Nuclear Information System (INIS)

    Cecille, L.; Cumming, I.W.; Gasparini, G.; Dozol, J.F.

    1986-09-01

    The separate treatment of the solvent wash alkaline waste (ASWW) from the other low and medium level liquid wastes generated during reprocessing operations has been investigated through the development of three alternative processes dealing with solvent extraction, chemical precipitation combined with ultrafiltration and inorganic ion exchange. On the basis of lab-scale experiments performed on the same genuine ASWW sample, a comparison has been made between the respective performances of each of these processes in terms of selectivity, decontamination and volume reduction factors. From this assessment, it evolved that solvent extraction and chemical precipitation combined with utrafiltration processes are good competitors for implementing such kind of treatment although for the alpha DF, solvent extraction appears more flexible. To be really attractive, inorganic ion exchange should exhibit better VRF and DF possibly by pretreating the ASWW. 10 refs

  19. Ionic liquids used in extraction and separation of metal ions

    International Nuclear Information System (INIS)

    Shen Xinghai; Xu Chao; Liu Xinqi; Chu Taiwei

    2006-01-01

    Ionic liquids as green solvents now have become a research hotspot in the field of separation of metal ions by solvent extraction. Experimental results of extraction of various metal ions with ionic liquids as solvents, including that of alkali metals, alkaline earths, transition metals rare earths and actinides are introduced. The extraction of uranium, plutonium and fission products that are involved in spent nuclear fuel reprocessing is also reviewed. The possible extraction mechanisms are discussed. Finally, the prospect of replacement of volatile and/or toxic organic solvents with environmentally benign ionic liquids for solvent extraction and the potency of applications of ionic liquids in solvent extraction are also commented. (authors)

  20. Hydrogen production by alkaline water electrolysis

    Directory of Open Access Journals (Sweden)

    Diogo M. F. Santos

    2013-01-01

    Full Text Available Water electrolysis is one of the simplest methods used for hydrogen production. It has the advantage of being able to produce hydrogen using only renewable energy. To expand the use of water electrolysis, it is mandatory to reduce energy consumption, cost, and maintenance of current electrolyzers, and, on the other hand, to increase their efficiency, durability, and safety. In this study, modern technologies for hydrogen production by water electrolysis have been investigated. In this article, the electrochemical fundamentals of alkaline water electrolysis are explained and the main process constraints (e.g., electrical, reaction, and transport are analyzed. The historical background of water electrolysis is described, different technologies are compared, and main research needs for the development of water electrolysis technologies are discussed.

  1. Alkaline lixiviation of uranium in granitic pegmatite

    International Nuclear Information System (INIS)

    Jambor, S.

    1980-06-01

    The work described herein concerns the determination of the experimental optimum conditions for the alkaline lixiviation of uranium based on the following parameters: time, pH, temperature, density and grane size. The samples were obtained from the Supamo complex, near the Currupia river in the Piar District of the Bolivar State in Venezuela. They have a granitic composition and graphitic texture. The uranium was found in them as a secondary oxidized mineral of green-yellow colour localized in fractures fissures, intergranular spaces and also in the mica as. Secondary uranitite. The lixiviation process was carried out using Na 2 CO 3 /NaHCO 3 buffer solution and for 100 gr. samples the best values for an efficient process were found by using 170 mesh grane size and 500 ml of pH buffer at 70 0 C for a 24 hour time period. (author)

  2. Ethylenediaminetetraacetates of neodymium and alkaline earth metals

    International Nuclear Information System (INIS)

    Barinov, A.V.; Pechurova, L.I.; Martynenko, K.I.; Popov, K.I.; Spitsyn, V.I.

    1977-01-01

    The possibilities have been studied of the formation of polynuclear complexonates of alkaline-earth metals (Ca, Sr, and Ba) based on neodymium derivatives EDTA of the composition NdA - . By pH-metry, electron spectroscopy, and derivatography it has been shown that the structure of complexes M 2 (NdA) 2 (where M- Ca, Sr, or Ba; A- EDTA) in the solution is not polynuclear. Hydroxopolynuclear complexes do not form under conditions studied. The data obtained agree with an assumption about polynuclear structure of the solid complex Ca(NdA) 2 x17 H 2 O and gradual weakening of the polynuclear nature upon substitution of Ca 2+ with Sr 2+ and Ba 2+

  3. Corrosion of copper in alkaline chloride environments

    International Nuclear Information System (INIS)

    King, F.

    2002-08-01

    The available literature information on the corrosion and electrochemical behaviour of copper in alkaline environments has been reviewed. The purpose of the review was to assess the impact of an alkaline plume from cementitious material on the corrosion behaviour of a copper canister in an SKB-3 type repository. The effect of the evolution of the environmental conditions within the repository have been considered, including the effects of temperature, redox conditions, pore-water salinity and pH. If the pore-water pH increases prior to the establishment of anoxic conditions, the canister surface will passivate as the pore-water pH exceeds a value of ∼ pH 9. Passivation will result from the formation of a duplex Cu 2 O/Cu(OH) 2 film. The corrosion potential will be determined by the equilibrium potential for the Cu 2 O/Cu(OH) 2 couple under oxic conditions, or by the Cu/Cu 2 O redox couple under anoxic conditions (in the absence of sulphide). Pitting corrosion is only likely to occur early in the evolution of the repository environment, whilst the canister is still relatively cool ( 2 available to support localised corrosion, and prior to the increase in pore-water pH and salinity. The subsequent increase in canister surface temperature, pore-water pH and salinity, and decrease in O 2 will make pit initiation less likely, although the canister will remain passive provided the pore-water pH is maintained above pH 9. The higher the pore-water pH, the more strongly the canister is passivated and the less likely the surface is to undergo localised attack. If the pore-water salinity increases prior to the increase in pH, there could be a period of active canister corrosion before passivation occurs.Under these circumstances, the corrosion potential will be a true mixed potential, determine by the relative kinetics of Cu dissolution as CuCl 2 - and of the reduction of O 2 . The development of anoxic conditions and an increase in pore-water sulphide concentration will

  4. Retention of alkaline earth elements in man

    International Nuclear Information System (INIS)

    Newton, D.

    1990-06-01

    The data on human metabolism and long-term retention of alkaline earth elements ( 133 Ba injected into six healthy male volunteers at age 25-81 y and 45 Ca and 85 Sr received by one healthy male volunteer) are presented. Excreta were collected for 2-3 weeks after injection of the tracer into an antecubital vein. Activity in urine, ashed faeces and early samples of blood plasma was determined by gamma-ray scintillation spectrometry. Whole body retention has been assessed through serial measurements of body radioactivity. The injected 133 Ba apparently became mainly skeletal within several days, much earlier than predicted by the ICRP model. The whole-body retention at 32 d ranged from 5 to 14%, the rate of loss correlating with the excretory plasma clearance rate. No age-related trends were identified in the metabolism of Ca and Sr. 2 refs, 2 figs

  5. Properties of cathode materials in alkaline cells

    International Nuclear Information System (INIS)

    Salkind, A.J.; McBreen, J.; Freeman, R.; Parkhurst, W.A.

    1985-01-01

    Conventional and new cathode materials in primary and secondary alkaline cells were investigated for stability, structure, electrochemical reversibility and efficiency. Included were various forms of AgO for reserve-type silver-zinc batteries, a new material - AgNiO/sub 2/ - and several nickel electrodes for nickel-cadmium and nickel-hydrogen cells for aerospace applications. A comparative study was made of the stability of electroformed and chemically prepared AgO. Stability was correlated with impurities detected by XPS and SAM. After the first discharge AgNiO/sub 2/ can be recharged to the monovalent level. The discharge product is predominantly silver. Plastic-bonded nickel electrodes display a second plateau on discharge. Additions of Co(OH)/sub 2/ largely eliminate this

  6. Alkaline pulping of some eucalypts from Sudan.

    Science.gov (United States)

    Khristova, P; Kordsachia, O; Patt, R; Dafaalla, S

    2006-03-01

    Four eucalypts (Eucalyptus camaldulensis, Eucalyptus microtheca, Eucalyptus tereticornis and Eucalyptus citriodora) grown in Sudan were examined for their suitability for pulping and papermaking with different alkaline methods. Their physical, morphological and chemical characteristics are reported. The pulping trials with E. citriodora and E. tereticornis were carried out using the kraft-AQ, soda-AQ, modified AS/AQ (ASA), ASAM and kraft methods. For the other two species, only the ASAM and the kraft process were applied. ASAM pulping gave the best results in terms of yield, degree of delignification, mechanical and optical pulp properties. The best pulps, obtained in kraft and ASAM cooking of E. citriodora, were bleached to 88% ISO brightness in a totally chlorine free bleaching sequence (OQ1O/PQ2P). The bleached pulps, especially the ASAM pulp, showed good papermaking properties and would be suitable for manufacture of writing and printing grades of paper.

  7. Corrosion of copper in alkaline chloride environments

    Energy Technology Data Exchange (ETDEWEB)

    King, F. [Integrity Corrosion Consulting Ltd., Calgary (Canada)

    2002-08-01

    The available literature information on the corrosion and electrochemical behaviour of copper in alkaline environments has been reviewed. The purpose of the review was to assess the impact of an alkaline plume from cementitious material on the corrosion behaviour of a copper canister in an SKB-3 type repository. The effect of the evolution of the environmental conditions within the repository have been considered, including the effects of temperature, redox conditions, pore-water salinity and pH. If the pore-water pH increases prior to the establishment of anoxic conditions, the canister surface will passivate as the pore-water pH exceeds a value of {approx} pH 9. Passivation will result from the formation of a duplex Cu{sub 2}O/Cu(OH){sub 2} film. The corrosion potential will be determined by the equilibrium potential for the Cu{sub 2}O/Cu(OH){sub 2} couple under oxic conditions, or by the Cu/Cu{sub 2}O redox couple under anoxic conditions (in the absence of sulphide). Pitting corrosion is only likely to occur early in the evolution of the repository environment, whilst the canister is still relatively cool (<40 deg C), whilst there is still O{sub 2} available to support localised corrosion, and prior to the increase in pore-water pH and salinity. The subsequent increase in canister surface temperature, pore-water pH and salinity, and decrease in O{sub 2} will make pit initiation less likely, although the canister will remain passive provided the pore-water pH is maintained above pH 9. The higher the pore-water pH, the more strongly the canister is passivated and the less likely the surface is to undergo localised attack. If the pore-water salinity increases prior to the increase in pH, there could be a period of active canister corrosion before passivation occurs.Under these circumstances, the corrosion potential will be a true mixed potential, determine by the relative kinetics of Cu dissolution as CuCl{sub 2} - and of the reduction of O{sub 2}. The development

  8. Alkaline batteries for hybrid and electric vehicles

    Science.gov (United States)

    Haschka, F.; Warthmann, W.; Benczúr-Ürmössy, G.

    Forced by the USABC PNGV Program and the EZEV regulation in California, the development of hybrid vehicles become more strong. Hybrids offer flexible and unrestricted mobility, as well as pollution-free driving mode in the city. To achieve these requirements, high-power storage systems are demanded fulfilled by alkaline batteries (e.g., nickel/cadmium, nickel/metal hydride). DAUG has developed nickel/cadmium- and nickel/metal hydride cells in Fibre Technology of different performance types (up to 700 W/kg peak power) and proved in electric vehicles of different projects. A special bipolar cell design will meet even extreme high power requirements with more than 1000 W/kg peak power. The cells make use of the Recom design ensuring high power charge ability at low internal gas pressure. The paper presents laboratory test results of cells and batteries.

  9. Alkaline batteries for hybrid and electric vehicles

    Energy Technology Data Exchange (ETDEWEB)

    Haschka, F.; Warthmann, W.; Benczur-Uermoessy, G. [DAUG Deutsche Automobilgesellschaft, Esslingen (Germany)

    1998-03-30

    Forced by the USABC PNGV Program and the EZEV regulation in California, the development of hybrid vehicles become more strong. Hybrids offer flexible and unrestricted mobility, as well as pollution-free driving mode in the city. To achieve these requirements, high-power storage systems are demanded fulfilled by alkaline batteries (e.g. nickel/cadmium, nickel/metal hydride). DAUG has developed nickel/cadmium- and nickel/metal hydride cells in Fibre Technology of different performance types (up to 700 W/kg peak power) and proved in electric vehicles of different projects. A special bipolar cell design will meet even extreme high power requirements with more than 1000 W/kg peak power. The cells make use of the Recom design ensuring high power charge ability at low internal gas pressure. The paper presents laboratory test results of cells and batteries. (orig.)

  10. Enzymatic Hydrolysis of Alkaline Pretreated Coconut Coir

    Directory of Open Access Journals (Sweden)

    Akbarningrum Fatmawati

    2013-06-01

    Full Text Available The purpose of this research is to study the effect of concentration and temperature on the cellulose and lignin content, and the reducing sugars produced in the enzymatic hydrolysis of coconut coir. In this research, the coconut coir is pretreated using 3%, 7%, and 11% NaOH solution at 60oC, 80oC, and 100oC. The pretreated coir were assayed by measuring the amount of cellulose and lignin and then hydrolysed using Celluclast and Novozyme 188 under various temperature (30oC, 40oC, 50oC and pH (3, 4, 5. The hydrolysis results were assayed for the reducing sugar content. The results showed that the alkaline delignification was effective to reduce lignin and to increase the cellulose content of the coir. The best delignification condition was observed at 11% NaOH solution and 100oC which removed 14,53% of lignin and increased the cellulose content up to 50,23%. The best condition of the enzymatic hydrolysis was obtained at 50oC and pH 4 which produced 7,57 gr/L reducing sugar. © 2013 BCREC UNDIP. All rights reservedReceived: 2nd October 2012; Revised: 31st January 2013; Accepted: 6th February 2013[How to Cite: Fatmawati, A., Agustriyanto, R., Liasari, Y. (2013. Enzymatic Hydrolysis of Alkaline Pre-treated Coconut Coir. Bulletin of Chemical Reaction Engineering & Catalysis, 8 (1: 34-39 (doi:10.9767/bcrec.8.1.4048.34-39[Permalink/DOI: http://dx.doi.org/10.9767/bcrec.8.1.4048.34-39] | View in  |

  11. Rapid extraction of uranium from sea water using Fe{sub 3}O{sub 4} and humic acid coated Fe{sub 3}O{sub 4} nanoparticles

    Energy Technology Data Exchange (ETDEWEB)

    Singhal, Pallavi, E-mail: psinghal@barc.gov.in [Homi Bhabha National Institute, Mumbai 400094 (India); Health Physics Division, Bhabha Atomic Research Centre, Mumbai 400085 (India); Jha, Sanjay K. [Homi Bhabha National Institute, Mumbai 400094 (India); Health Physics Division, Bhabha Atomic Research Centre, Mumbai 400085 (India); Pandey, Shailaja P. [Analytical Chemistry Division, Bhabha Atomic Research Centre, Mumbai 400085 (India); Neogy, Suman [Mechanical Metallurgy Division, Bhabha Atomic Research Centre, Mumbai 400085 (India)

    2017-08-05

    Highlights: • Uranium extraction using Fe{sub 3}O{sub 4} and HA coated Fe{sub 3}O{sub 4} NPs has been demonstrated. • Result indicates uranium extraction from both water and sea water matrix. • With increase in HA coating uranium extraction increases. • Fe{sub 3}O{sub 4}/HA 1 is the best material among synthesized one for uranium extraction. - Abstract: Uranium is one of the most toxic elements present in the environment and a number of methods have been developed for its extraction. Herein we have demonstrated a new method using magnetic nanoparticles (NPs) that can be used for uranium extraction from water and sea water matrix. Fe{sub 3}O{sub 4} and humic acid (HA) coated Fe{sub 3}O{sub 4} NPs with different amount of HA coating were synthesized and uranium sorption from water and sea water matrix was demonstrated. It was observed that sorption increases with increase in amount of HA coating. NPs settlement in presence of magnetic field was monitored where only bare Fe{sub 3}O{sub 4} and Fe{sub 3}O{sub 4}/HA 1 NPs settles while no settlement was observed for Fe{sub 3}O{sub 4}/HA 2 and Fe{sub 3}O{sub 4}/HA 3 NPs. Considering both sorption and particle separation from the matrix Fe{sub 3}O{sub 4}/HA 1 NPs are the best among synthesized ones with maximum sorption capacity of 10.5 mg of U/g of NPs. The results presented here reveal the exceptional potential of magnetic NPs and functionalized magnetic NPs for environmental remediation of uranium and to extract uranium from sea water on which to the best of our knowledge no report is available till now.

  12. Application of alkaline waterflooding to a high acidity crude oil

    Energy Technology Data Exchange (ETDEWEB)

    Sayyouh, M.H. (King Sand Univ., Riyadh (SA). Petroleum Engineering Dept.); Abdel-Waly, A.; Osman, A. (Cairo Univ. (EG). Petroleum Engineering Dept.); Awara, A.Z. (Geisum Oil Company, Cairo (EG))

    The enhanced recovery of a high acidity crude oil (South Geisum crude) by alkaline solutions is studied. Acidity, interfacial tension, and contact angle, were investigated. Displacement tests were carried out to study the effect of alkaline slug concentration, slug size, oil alkali type, temperature and viscosity on recovery. The interfacial tension between crude oil and formation water decreases with increasing alkaline concentration until a minimum, after which it increases again. Contact angle measurements indicated oil-wetting conditions that increase by the addition of alkaline solutions. At the early stages of displacement, oil recovery increases with increasing alkaline concentration until a maximum at 4% by weight NaOH concentration. Also, at such early stages, an excessive increase in alkaline concentration results in lower oil recovery. On the other hand, after the injection of many pore volumes of water, oil recovery is almost the same regardless of the alkaline concentration. Oil recovery increases with increasing alkaline slug size until a maximum at 15% PV. Sodium hydroxide slugs produce more oil recovery than sodium carbonate slugs. Oil recovery increases with increasing temperature (from 25 to 55{sup 0}C) and decreasing oil viscosity.

  13. Alkaline protease production on date waste by an alkalophilic ...

    African Journals Online (AJOL)

    STORAGESEVER

    2008-05-16

    May 16, 2008 ... After 72 h incubation in a shaker incubator ... different incubation times (0 to 72 h) were investigated. Alkaline .... of alkaline protease (75%) and 24% of total protein is precipitated. ... starches and wheat flour as carbon source on protease production .... JP 395, method of making and detergent composition.

  14. A generally applicable sequential alkaline phosphatase immunohistochemical double staining

    NARCIS (Netherlands)

    van der Loos, Chris M.; Teeling, Peter

    2008-01-01

    A universal type of sequential double alkaline phosphatase immunohistochemical staining is described that can be used for formalin-fixed, paraffin-embedded and cryostat tissue sections from human and mouse origin. It consists of two alkaline phosphatase detection systems including enzymatic

  15. Increasing the alkaline protease activity of Bacillus cereus and ...

    African Journals Online (AJOL)

    User

    2011-05-09

    May 9, 2011 ... cereus and Bacillus polymyxa simultaneously with the start of sporulation phase as a ... microbial forms to inactivation by chemical or physical agents. .... alkaline pH, 9, 10 and 11 and the pH of the culture media was optimized with .... incubation temperature for alkaline protease production by Bacillus ...

  16. Production of alkaline protease by Teredinobacter turnirae cells ...

    African Journals Online (AJOL)

    The conditions for immobilizing the new alkaline protease-producing bacteria strain Teredinobacter turnirae by entrapment in calcium alginate gel were investigated. The influence of alginate concentration (20, 25 and 30 g/l) and initial cell loading (ICL) on enzyme production were studied. The production of alkaline ...

  17. Production of alkaline proteases by alkalophilic Bacillus subtilis ...

    African Journals Online (AJOL)

    Tuoyo Aghomotsegin

    2016-11-23

    Nov 23, 2016 ... A new strain of Bacillus sp. was isolated from alkaline soil, which was able to produce extracellular alkaline ... rice and dates (Khosravi-Darani et al., 2008), protein by- products from lather ..... Pigeon pea waste as a novel ...

  18. Comparative Detection of Alkaline Protease Production in Exiguobacterium acetylicum

    International Nuclear Information System (INIS)

    Gomaa, O.M.; EI Shafey, H.M.

    2009-01-01

    Alkaline protease is one of the most important enzymes in industry, medicine, and research. In the present work, a comparative detection for alkaline protease activity was established for instant detection of enzyme activity. Eight different alkalophilic bacterial isolates were compared based on the clear zone they produced on skim milk agar. One strain gave an absolute clear zone in 16 hours and was used for alkaline protease detection. The result of Phenotypic identification using Biology Microlog 3 identified the isolate as Exiguobacterium acetylicum. The isolate under study showed slightly different characteristics from a known Exiguobacterium acetylicum strain. The isolate tolerated alkaline conditions up to ph 11, while good growth was evident at ph 7, the maximum alkaline protease activity was observed at ph 9 which reached up to 109.01 U/ml. The alkaline activity assay using alkaline protease enzyme assay were coordinating with those obtained by conductivity; there was a relevant decrease in conductivity at the maximum increase in enzyme activity, which proved the cell membrane conductivity has a close relation to alkaline protease production. This isolate has tolerated gamma radiation, the increase in dose (up to 4 Gy) gave wider clear zones in terms of diameter and this was relevant to the conductivity measurements

  19. Partial purification and characterization of alkaline proteases from ...

    African Journals Online (AJOL)

    Alkaline proteases from the digestive tract of anchovy were partially purified by ammonium sulfate fractionation, dialysis and Sephadex G-75 gel filtration. The purification fold and yield were 6.23 and 4.49%, respectively. The optimum activities of partially purified alkaline proteases were observed at 60°C and at pH 11.0.

  20. Physicochemical Properties of Defatted Rambutan (Nephelium lappaceum) Seed Flour after Alkaline Treatment.

    Science.gov (United States)

    Eiamwat, Jirawat; Wanlapa, Sorada; Kampruengdet, Sukit

    2016-03-31

    Rambutan seeds were subjected to SC-CO₂ extraction at 35 MPa, 45 °C to obtain defatted rambutan seed flour. Its physicochemical properties before and after treatment with alkali solution using 0.075 N NaOH were investigated. Alkali-treated flour had a significant increment in bulk density, swelling power, water adsorption capacity, emulsion capacity and stability but a reduction in turbidity, solubility and oil absorption capacity. Pasting measurements showed peak viscosity, breakdown, setback and final viscosity increased significantly for the alkali-treated flour, while pasting temperature decreased. The alkaline treatment decreased the least gelation concentration, but increased the apparent viscosity.

  1. Physicochemical Properties of Defatted Rambutan (Nephelium lappaceum Seed Flour after Alkaline Treatment

    Directory of Open Access Journals (Sweden)

    Jirawat Eiamwat

    2016-03-01

    Full Text Available Rambutan seeds were subjected to SC-CO2 extraction at 35 MPa, 45 °C to obtain defatted rambutan seed flour. Its physicochemical properties before and after treatment with alakali solution using 0.075 N NaOH were investigated. Alkali-treated flour had a significant increment in bulk density, swelling power, water adsorption capacity, emulsion capacity and stability but a reduction in turbidity, solubility and oil absorption capacity. Pasting measurements showed peak viscosity, breakdown, setback and final viscosity increased significantly for the alkali-treated flour, while pasting temperature decreased. The alkaline treatment decreased the least gelation concentration, but increased the apparent viscosity.

  2. Measurement of M. luteus endonuclease-sensitive lesions by alkaline elution

    Energy Technology Data Exchange (ETDEWEB)

    Fornace, Jr, A J [National Cancer Inst., Bethesda, MD (USA). Lab. for Experimental Pathology

    1982-01-01

    The UV-endonuclease approach to detect DNA damage has been combined with the alkaline elution technique with a resultant marked increase in sensitivity compared to the conventional method using alkaline sedimentation. DNA from UV-irradiated cells was digested on an inert filter with an extract from Micrococcus luteus and then analyzed by alkaline elution. Endonuclease-sensitive sites (endo-sites) were measured after doses of 0.08-0.7 Jm/sup -2/ of UV-radiation. An estimate of endo-site production with UV radiation, 0.27 endo-sites/10/sup 8/ daltons of DNA/0.1 Jm/sup -2/, was similar to that usually seen at higher doses by others. With repair incubation, approx. 50% of the endo-sites were removed in 4 h by normal human fibroblasts after 0.2 or 0.4 Jm/sup -2/, no appreciable repair was seen in xeroderma pigmentosum fibroblasts from complementation group A after 24 h of repair incubation. No photoreaction of UV damage due to 0.4 Jm/sup -2/ was detected in normal human fibroblasts.

  3. Measurement of M. luteus endonuclease-sensitive lesions by alkaline elution

    International Nuclear Information System (INIS)

    Fornace, A.J. Jr.

    1982-01-01

    The UV-endonuclease approach to detect DNA damage has been combined with the alkaline elution technique with a resultant marked increase in sensitivity compared to the conventional method using alkaline sedimentation. DNA from UV-irradiated cells was digested on an inert filter with an extract from Micrococcus luteus and then analyzed by alkaline elution. Endonuclease-sensitive sites (endo-sites) were measured after doses of 0.08-0.7 Jm -2 of UV-radiation. An estimate of endo-site production with UV radiation, 0.27 endo-sites/10 8 daltons of DNA/0.1 Jm -2 , was similar to that usually seen at higher doses by others. With repair incubation, approx. 50% of the endo-sites were removed in 4 h by normal human fibroblasts after 0.2 or 0.4 Jm -2 , no appreciable repair was seen in xeroderma pigmentosum fibroblasts from complementation group A after 24 h of repair incubation. No photoreaction of UV damage due to 0.4 Jm -2 was detected in normal human fibroblasts. (orig./AJ)

  4. Process optimization by response surface methodology for extracellular alkaline protease production from bacillus subtilis

    International Nuclear Information System (INIS)

    Mushtaq, Z.; Adnan, A.; Mehmood, Z.

    2014-01-01

    Three microbial cultures Bacillus subtilis DSM 1970, Bacillus subtilis GCU-8 and Bacillus licheniformis DSM 1969 were screened for protease production by casein agar plate method. Among these Bacillus subtilis GCU-8 was found to be the most potent protease producer in wide pH range (5.0 to 8.0). Fermentation conditions were optimized for the production of alkaline protease using two statistical tools: Placket Burmen Model for linear regression study and Response Surface Model for interactive effects of significant factors on production. The alkaline protease was optimally produced after 48 hours of incubation at 37 degree C in fermentation media containing equal amounts of substrates (soybean meal and wheat bran, 7.5 g), MgSO/sub 4/ 7H/sub 2/O, 0.10 g and yeast extract 0.55 g. The protease was purified to homogeneity by salt precipitation, ion-exchange chromatography and size exclusion chromatography. The homogeneity and molecular weights were checked by SDS-PAGE. The protease was 45 KDa protein, predominantly alkaline and optimally active at pH 8.0. (author)

  5. Membrane treatment of alkaline bleaching effluents from elementary chlorine free kraft softwood cellulose production.

    Science.gov (United States)

    Oñate, Elizabeth; Rodríguez, Edgard; Bórquez, Rodrigo; Zaror, Claudio

    2015-01-01

    This paper reports experimental results on the sequential use of ultrafiltration (UF), nanofiltration (NF) and reverse osmosis (RO) to fractionate alkaline extraction bleaching effluents from kraft cellulose production. The aim was to unveil the way key pollutants are distributed when subjected to sequential UF/NF/RO membrane separation processes. Alkaline bleaching effluents were obtained from a local pinewood-based mill, featuring elementary chlorine free bleaching to produce high-brightness cellulose. The experimental system was based on a laboratory-scale membrane system, DSS LabStak® M20 Alfa Laval, using Alfa Laval UF and NF/RO membranes, operated at a constant transmembrane pressure (6 bar for UF membranes and 32 bar for NF/RO membranes), at 25°C. Results show that 78% chemical oxygen demand (COD) and total phenols, 82% adsorbable organic halogens (AOX) and 98% colour were retained by UF membranes which have molecular weight cut-off (MWCO) above 10 kDa. In all, 16% of original COD, total phenols and AOX, and the remaining 2% colour were retained by UF membranes within the 1 to 10 kDa MWCO range. Chloride ions were significantly present in all UF permeates, and RO was required to obtain a high-quality permeate with a view to water reuse. It is concluded that UF/NF/RO membranes offer a feasible option for water and chemicals recovery from alkaline bleaching effluents in kraft pulp production.

  6. Application of Resin in Pulp Technique for Ion Exchange Separation of Uranium from Alkaline Leachate

    International Nuclear Information System (INIS)

    Sreenivas, T.; Rajan, K.C.; Chakravartty, J.K.

    2014-01-01

    Conclusions: • Resin-in-pulp technique was applied for purification and enrichment of uranium values from a finely ground uranium ore leach slurry of alkaline nature using strong base anion exchange resin (size 500 - 675μm). • The chemical composition of the solution phase of the alkaline leach slurry (pH 9.5) was consisting of about 40 g/L of total dissolved solutes (TDS) predominantly with Na_2CO_3 and NaHCO_3 and minor levels of Na_2SO_4. The uranium content was only 730 mg/L and d50 of solids was 34μm. • Amongst the various commercially available resins studied PFA 4740 and 4783 having quaternary ammonium ion on polystyrene crosslink with divibyl benzez (DVB) gave best performance. The maximum loading capacity achieved in the RIP studies was about 60-65 g of U_3O_8/L of wet settled resin amounting to 98% of loading. This has necessitated 4 stages of counter-current extraction with overall contact time of 100 minutes at a resin to leach slurry volume ratio of about 1:50. Practically the entire uranium values loaded on the resin were eluted using NaCl. • The RIP process was found quite efficient for uranium bearing alkaline leach slurries.

  7. Experimental Simulation of Long Term Weathering in Alkaline Bauxite Residue Tailings

    Directory of Open Access Journals (Sweden)

    Talitha C. Santini

    2015-07-01

    Full Text Available Bauxite residue is an alkaline, saline tailings material generated as a byproduct of the Bayer process used for alumina refining. Developing effective plans for the long term management of potential environmental impacts associated with storage of these tailings is dependent on understanding how the chemical and mineralogical properties of the tailings will change during weathering and transformation into a soil-like material. Hydrothermal treatment of bauxite residue was used to compress geological weathering timescales and examine potential mineral transformations during weathering. Gibbsite was rapidly converted to boehmite; this transformation was examined with in situ synchrotron XRD. Goethite, hematite, and calcite all precipitated over longer weathering timeframes, while tricalcium aluminate dissolved. pH, total alkalinity, and salinity (electrical conductivity all decreased during weathering despite these experiments being performed under “closed” conditions (i.e., no leaching. This indicates the potential for auto-attenuation of the high alkalinity and salinity that presents challenges for long term environmental management, and suggests that management requirements will decrease during weathering as a result of these mineral transformations.

  8. Grain size effect in corrosion behavior of electrodeposited nanocrystalline Ni coatings in alkaline solution

    International Nuclear Information System (INIS)

    Wang Liping; Zhang Junyan; Gao Yan; Xue Qunji; Hu Litian; Xu Tao

    2006-01-01

    Effects of grain size reduction on the electrochemical corrosion behavior of nanocrystalline Ni produced by pulse electrodeposition were characterized using potentiodynamic polarization testing and electrochemical impedance spectroscopy; X-ray photoelectron spectroscopy were used to confirm the electrochemical measurements and the suggested mechanisms. The corrosion resistance of Ni coatings in alkaline solutions considerably increased as the grain size decreased from microcrystalline to nanocrystalline. The higher corrosion resistance of NC Ni may be due to the more rapid formation of continuous Ni(OH) 2 passive films compared with coarse-grained Ni coatings

  9. Fuelwood production potential of six Prosopis species on an alkaline soil site

    Energy Technology Data Exchange (ETDEWEB)

    Goel, V.L.; Behl, H.M. [National Botanical Research Inst., Lucknow (India). Biomass Research Center

    1995-07-01

    The biomass potential of six species Prosopis was evaluated on highly alkaline soil site. Prosopis alba I was found to have the fastest growth rate and highest above-ground biomass production. P. juliflora ranked next. P. cineraria showed high plant establishment but relatively slow growth. The performance of P. glandulosa was poor on such sites. The high fuelwood value index and rapid growth rate of P. juliflora and P. alba makes them suitable for short-rotation fuelwood forestry programmes on waste-lands. Selection of promising genotypes is suggested as a means of improvement in yields. (author)

  10. Rapid chemical separations

    CERN Document Server

    Trautmann, N

    1976-01-01

    A survey is given on the progress of fast chemical separation procedures during the last few years. Fast, discontinuous separation techniques are illustrated by a procedure for niobium. The use of such techniques for the chemical characterization of the heaviest known elements is described. Other rapid separation methods from aqueous solutions are summarized. The application of the high speed liquid chromatography to the separation of chemically similar elements is outlined. The use of the gas jet recoil transport method for nuclear reaction products and its combination with a continuous solvent extraction technique and with a thermochromatographic separation is presented. Different separation methods in the gas phase are briefly discussed and the attachment of a thermochromatographic technique to an on-line mass separator is shown. (45 refs).

  11. The effect of irrigated rice cropping on the alkalinity of two alkaline rice soils in the Sahel

    NARCIS (Netherlands)

    Asten, van P.J.A.; Zelfde, van 't J.A.; Zee, van der S.E.A.T.M.; Hammecker, C.

    2004-01-01

    Irrigated rice cropping is practiced to reclaim alkaline-sodic soils in many parts of the world. This practice is in apparent contrast with earlier studies in the Sahel, which suggests that irrigated rice cropping may lead to the formation of alkaline-sodic soils. Soil column experiments were done

  12. Direct quantification of fatty acids in wet microalgal and yeast biomass via a rapid in situ fatty acid methyl ester derivatization approach.

    Science.gov (United States)

    Dong, Tao; Yu, Liang; Gao, Difeng; Yu, Xiaochen; Miao, Chao; Zheng, Yubin; Lian, Jieni; Li, Tingting; Chen, Shulin

    2015-12-01

    Accurate determination of fatty acid contents is routinely required in microalgal and yeast biofuel studies. A method of rapid in situ fatty acid methyl ester (FAME) derivatization directly from wet fresh microalgal and yeast biomass was developed in this study. This method does not require prior solvent extraction or dehydration. FAMEs were prepared with a sequential alkaline hydrolysis (15 min at 85 °C) and acidic esterification (15 min at 85 °C) process. The resulting FAMEs were extracted into n-hexane and analyzed using gas chromatography. The effects of each processing parameter (temperature, reaction time, and water content) upon the lipids quantification in the alkaline hydrolysis step were evaluated with a full factorial design. This method could tolerate water content up to 20% (v/v) in total reaction volume, which equaled up to 1.2 mL of water in biomass slurry (with 0.05-25 mg of fatty acid). There were no significant differences in FAME quantification (p>0.05) between the standard AOAC 991.39 method and the proposed wet in situ FAME preparation method. This fatty acid quantification method is applicable to fresh wet biomass of a wide range of microalgae and yeast species.

  13. Separation of strontium ions from other alkaline earth metal ions using masking reagent

    International Nuclear Information System (INIS)

    Komatsu, Y.

    1996-01-01

    Cs + and Sr 2+ have been well known as serious elements in high level radioactive waste. Separation of Cs + has already been successful when using an ion-exchange method from solution in the presence of other alkali metal ions. The separation of Sr 2+ is, however, not so easy by any known separation method such as solvent-extraction and ion-exchange methods. This is because Sr 2+ is in the middle of the selectivity series, which is Mg 2+ > Ca 2+ > Sr 2+ > Ba 2+ for the solvent-extraction method and Ba 2+ > Sr 2+ > Ca 2+ > Mg 2+ for the ion- exchange method. In the present study, separation of strontium from other alkaline earth metal ions was studied by a combined use of three types of separation methods at 298 K: the solvent-extraction method was applied for the first separation, in which thenoyltrifluoroacetone (TTA, extractant) and trioctylphosphine oxide ( TOPO, adduct forming ligand) were used for the organic phase of the system. The separation factors for each combination of four alkaline earth metal ions were determined by the values of the distribution ratio. The Mg 2+ was well separated from Sr 2+ by the TTA-TOPO system. However, the separation of the combinations of Ca 2+ -Sr 2+ and Sr 2+ -Ba 2+ was not complete by the above solvent-extraction system. The second separation method, an ion-exchange method was applied using dihydrogen tetratitanate hydrate fibers (H 2 Ti 4 O 9 nH 2 O) as an ion exchanger to separate Sr 2+ and Ba 2+ . The separation factors for each combination of four alkaline earth metal ions were calculated by the values of the distribution coefficients. Ba 2+ was well separated from Sr 2+ by the ion-exchange method. To separate Ca 2+ and Sr 2+ , however, a modified solvent-extraction method was finally used in which H 2 Ti 4 O 9 nH 2 O was used as a masking reagent of Sr 2+ . After the dihydrogen tetratitanate hydrate fibers were contacted with the aqueous solution containing Ca 2+ and Sr 2+ , the organic solution containing TTA and TOPO

  14. Reduced time for urinary alkalinization before high-dose methotrexate with preadmission oral bicarbonate.

    Science.gov (United States)

    Kintzel, Polly E; Campbell, Alan D; Yost, Kathleen J; Brinker, Brett T; Arradaza, Nicole V; Frobish, Daniel; Wehr, Alison M; O'Rourke, Timothy J

    2012-06-01

    Hydration and urinary alkalinization are essential for reducing renal dysfunction with high dose methotrexate (HDMTX). This report presents an analysis of institutional methods used to achieve adequate urinary alkalinization and output for patients receiving single agent HDMTX. Renal and metabolic parameters of tolerance were examined. Medical records of adult patients receiving HDMTX during the calendar years of 2008-2009 were retrospectively reviewed to determine the time to achieve urine pH > 7. Number of hospital days, bicarbonate dose, ordered hydration rate, urine output, and urine pH were assessed. A survival analysis model was run for time to urine pH > 7 using preadmission oral bicarbonate as a predictor variable and including a frailty term. Observational statistics were performed for other parameters. The analysis included 79 encounters for ten patients. Urine pH > 7 was achieved more rapidly in patients receiving preadmission oral bicarbonate (P = 0.012). The number of patients receiving HDMTX on the same day as admission was greater for those receiving preadmission oral bicarbonate (47%) in comparison to those who did not (2%), and they spent less time in the hospital. A standard regimen for hydration and urinary alkalinization based on this project is reported. The nature and frequency of adverse events were as expected for this treatment. At our institution, the time to achieve urinary alkalinization was reduced for patients receiving preadmission oral bicarbonate which facilitated chemotherapy infusion on the same day as admission and decreased the number of calendar days that patients stayed in the hospital.

  15. Transgenic petunia with the iron(III)-phytosiderophore transporter gene acquires tolerance to iron deficiency in alkaline environments.

    Science.gov (United States)

    Murata, Yoshiko; Itoh, Yoshiyuki; Iwashita, Takashi; Namba, Kosuke

    2015-01-01

    Iron is an essential nutrient for all plants. However, terrestrial plants often suffer from iron deficiency in alkaline soil due to its extremely low solubility. Alkaline soil accounts for about 30% of all cultivated ground in the world. Plants have evolved two distinct strategies, I and II, for iron uptake from the soil. Dicots and non-graminaceous monocots use Strategy I, which is primarily based on the reduction of iron(III) to iron(II) and the uptake of iron(II) by the iron-regulated transporter, IRT1. In contrast, graminaceous plants use Strategy II to efficiently acquire insoluble iron(III). Strategy II comprises the synthesis and secretion of iron-chelating phytosiderophores, such as mugineic acids and the Yellow Stripe 1 transporter proteins of the iron(III)-phytosiderophore complex. Barley, which exhibits the highest tolerance to iron deficiency in alkaline soil among graminaceous plants, utilizes mugineic acids and the specific iron(III)-mugineic acids transporter, HvYS1. In this study, we established the transgenic plant Petunia hybrida, which originally had only Strategy I, by introducing the HvYS1 transporter gene derived from barley. When the transgenic plants were grown hydroponically in media containing the iron(III)-2'-deoxymugineic acid complex, free 2'-deoxymugineic acid and its iron(III) complex were detected in the root extract of the transgenic plant by electrospray ionization-Fourier transform-ion cyclotron resonance mass spectrometry. The growth of the transgenic petunia was significantly better than that of the control host in alkaline conditions. Consequently, the transgenic plant acquired a significantly enhanced tolerance to alkaline hydroponic media in the presence of the iron(III)-2'-deoxymugineic acid complex. Furthermore, the flower color of the transgenic plant deepened. The results showed that iron-phytosiderophore complexes and their transporters can potentially be utilized to overcome the worldwide iron uptake problems to diverse

  16. Transgenic petunia with the iron(III-phytosiderophore transporter gene acquires tolerance to iron deficiency in alkaline environments.

    Directory of Open Access Journals (Sweden)

    Yoshiko Murata

    Full Text Available Iron is an essential nutrient for all plants. However, terrestrial plants often suffer from iron deficiency in alkaline soil due to its extremely low solubility. Alkaline soil accounts for about 30% of all cultivated ground in the world. Plants have evolved two distinct strategies, I and II, for iron uptake from the soil. Dicots and non-graminaceous monocots use Strategy I, which is primarily based on the reduction of iron(III to iron(II and the uptake of iron(II by the iron-regulated transporter, IRT1. In contrast, graminaceous plants use Strategy II to efficiently acquire insoluble iron(III. Strategy II comprises the synthesis and secretion of iron-chelating phytosiderophores, such as mugineic acids and the Yellow Stripe 1 transporter proteins of the iron(III-phytosiderophore complex. Barley, which exhibits the highest tolerance to iron deficiency in alkaline soil among graminaceous plants, utilizes mugineic acids and the specific iron(III-mugineic acids transporter, HvYS1. In this study, we established the transgenic plant Petunia hybrida, which originally had only Strategy I, by introducing the HvYS1 transporter gene derived from barley. When the transgenic plants were grown hydroponically in media containing the iron(III-2'-deoxymugineic acid complex, free 2'-deoxymugineic acid and its iron(III complex were detected in the root extract of the transgenic plant by electrospray ionization-Fourier transform-ion cyclotron resonance mass spectrometry. The growth of the transgenic petunia was significantly better than that of the control host in alkaline conditions. Consequently, the transgenic plant acquired a significantly enhanced tolerance to alkaline hydroponic media in the presence of the iron(III-2'-deoxymugineic acid complex. Furthermore, the flower color of the transgenic plant deepened. The results showed that iron-phytosiderophore complexes and their transporters can potentially be utilized to overcome the worldwide iron uptake problems

  17. Excitation functions of parameters extracted from three-source (net-)proton rapidity distributions in Au-Au and Pb-Pb collisions over an energy range from AGS to RHIC

    Energy Technology Data Exchange (ETDEWEB)

    Gao, Li-Na; Liu, Fu-Hu [Shanxi University, Institute of Theoretical Physics, Taiyuan, Shanxi (China); Sun, Yan; Sun, Zhu [Shanxi Datong University, Department of Physics, Datong, Shanxi (China); Lacey, Roy A. [Stony Brook University, Departments of Chemistry and Physics, Stony Brook, NY (United States)

    2017-03-15

    Experimental results of the rapidity spectra of protons and net-protons (protons minus antiprotons) emitted in gold-gold (Au-Au) and lead-lead (Pb-Pb) collisions, measured by a few collaborations at the alternating gradient synchrotron (AGS), super proton synchrotron (SPS), and relativistic heavy ion collider (RHIC), are described by a three-source distribution. The values of the distribution width σ{sub C} and fraction k{sub C} of the central rapidity region, and the distribution width σ{sub F} and rapidity shift Δy of the forward/backward rapidity regions, are then obtained. The excitation function of σ{sub C} increases generally with increase of the center-of-mass energy per nucleon pair √(s{sub NN}). The excitation function of σ{sub F} shows a saturation at √(s{sub NN}) = 8.8 GeV. The excitation function of k{sub C} shows a minimum at √(s{sub NN}) = 8.8 GeV and a saturation at √(s{sub NN}) ∼ 17 GeV. The excitation function of Δy increases linearly with ln(√(s{sub NN})) in the considered energy range. (orig.)

  18. Solvent extraction of radionuclides from aqueous tank waste

    International Nuclear Information System (INIS)

    Bonnesen, P.; Sachleben, R.; Moyer, B.

    1996-01-01

    The purpose of this task is to develop an efficient solvent-extraction and stripping process to remove the fission products 99 Tc, 90 Sr, and 137 Cs from alkaline tank waste, such as those stored at Hanford and Oak Ridge. As such, this task expands on FY 1995's successful development of a solvent-extraction and stripping process for technetium separation from alkaline tank-waste solutions. This process now includes the capability of removing both technetium and strontium simultaneously. In this form, the process has been named SRTALK and will be developed further in this program as a prelude to developing a system capable of removing technetium, strontium, and cesium

  19. Three rapid methods for determination {sup 90}Sr in milk samples using liquid scintillation spectrometry

    Energy Technology Data Exchange (ETDEWEB)

    Abbasisiara, F.; Attarilar, N. [Iranian Nuclear Regulatory Authority (INRA), Atomic Energy Organization of Iran (AEOI), Environmental Radiation Protection Div., National Radiation Protection Dept. (Iran, Islamic Republic of); Afshar, N. [Tarbiat Modarres Univ. (Iran, Islamic Republic of)

    2006-07-01

    Strontium radionuclide {sup 90}Sr is one of the main long-lived components of the radioactive fallout which occurred as a result of previous atmospheric nuclear tests and also nuclear accidents such as Chernobyl accident. Due to chemical and biochemical similarities between strontium and calcium, more than 99% of strontium is efficiently incorporated into bone tissue and teeth and Characterized by along physical and biological half-life, it may cause damage to bone marrow. Since determination of this radionuclide often is a time consuming process, rapid determination methods specially in emergency situations is always desirable. In this work, three rapid methods for determination of this radionuclide in milk samples will be evaluated. All of the methods include two major steps: 1- strontium separation from fats and proteins which can be performed by drying (in case of the fresh milk samples), ashing and leaching by nitric acids or by using exchange or chelating resins which have strong affinity for alkaline earth cations such as Dowex 50W-X8. And 2- Separation of Sr-90 or its daughter product, Y-90. In two methods separation of {sup 90}Sr is performed by extraction of the daughter nuclide, {sup 90}Y, by aid of organic extracting agent, Tributylphosphate or T.B.P., and then Cherenkov counting of the Y-90 extracted. The third method is based on separation of this radionuclide using Crown Ether or Sr -Spec resin. The detailed radiochemical procedures and evaluation of each method advantages or disadvantages will explained in full text paper. (authors)

  20. 2nd Generation alkaline electrolysis. Final report

    Energy Technology Data Exchange (ETDEWEB)

    Yde, L. [Aarhus Univ. Business and Social Science - Centre for Energy Technologies (CET), Aarhus (Denmark); Kjartansdottir, C.K. [Technical Univ. of Denmark. DTU Mechanical Engineering, Kgs. Lyngby (Denmark); Allebrod, F. [Technical Univ. of Denmark. DTU Energy Conversion, DTU Risoe Campus, Roskilde (Denmark)] [and others

    2013-03-15

    The overall purpose of this project has been to contribute to this load management by developing a 2{sup nd} generation of alkaline electrolysis system characterized by being compact, reliable, inexpensive and energy efficient. The specific targets for the project have been to: 1) Increase cell efficiency to more than 88% (according to the higher heating value (HHV)) at a current density of 200 mA /cm{sup 2}; 2) Increase operation temperature to more than 100 degree Celsius to make the cooling energy more valuable; 3) Obtain an operation pressure more than 30 bar hereby minimizing the need for further compression of hydrogen for storage; 4) Improve stack architecture decreasing the price of the stack with at least 50%; 5) Develop a modular design making it easy to customize plants in the size from 20 to 200 kW; 6) Demonstrating a 20 kW 2{sup nd} generation stack in H2College at the campus of Arhus University in Herning. The project has included research and development on three different technology tracks of electrodes; an electrochemical plating, an atmospheric plasma spray (APS) and finally a high temperature and pressure (HTP) track with operating temperature around 250 deg. C and pressure around 40 bar. The results show that all three electrode tracks have reached high energy efficiencies. In the electrochemical plating track a stack efficiency of 86.5% at a current density of 177mA/cm{sup 2} and a temperature of 74.4 deg. C has been shown. The APS track showed cell efficiencies of 97%, however, coatings for the anode side still need to be developed. The HTP cell has reached 100 % electric efficiency operating at 1.5 V (the thermoneutral voltage) with a current density of 1. 1 A/cm{sup 2}. This track only tested small cells in an externally heated laboratory set-up, and thus the thermal loss to surroundings cannot be given. The goal set for the 2{sup nd} generation electrolyser system, has been to generate 30 bar pressure in the cell stack. An obstacle to be

  1. Alkaline fuel cell with nitride membrane

    Science.gov (United States)

    Sun, Shen-Huei; Pilaski, Moritz; Wartmann, Jens; Letzkus, Florian; Funke, Benedikt; Dura, Georg; Heinzel, Angelika

    2017-06-01

    The aim of this work is to fabricate patterned nitride membranes with Si-MEMS-technology as a platform to build up new membrane-electrode-assemblies (MEA) for alkaline fuel cell applications. Two 6-inch wafer processes based on chemical vapor deposition (CVD) were developed for the fabrication of separated nitride membranes with a nitride thickness up to 1 μm. The mechanical stability of the perforated nitride membrane has been adjusted in both processes either by embedding of subsequent ion implantation step or by optimizing the deposition process parameters. A nearly 100% yield of separated membranes of each deposition process was achieved with layer thickness from 150 nm to 1 μm and micro-channel pattern width of 1μm at a pitch of 3 μm. The process for membrane coating with electrolyte materials could be verified to build up MEA. Uniform membrane coating with channel filling was achieved after the optimization of speed controlled dip-coating method and the selection of dimethylsulfoxide (DMSO) as electrolyte solvent. Finally, silver as conductive material was defined for printing a conductive layer onto the MEA by Ink-Technology. With the established IR-thermography setup, characterizations of MEAs in terms of catalytic conversion were performed successfully. The results of this work show promise for build up a platform on wafer-level for high throughput experiments.

  2. Reduction of proteinuria through podocyte alkalinization.

    Science.gov (United States)

    Altintas, Mehmet M; Moriwaki, Kumiko; Wei, Changli; Möller, Clemens C; Flesche, Jan; Li, Jing; Yaddanapudi, Suma; Faridi, Mohd Hafeez; Gödel, Markus; Huber, Tobias B; Preston, Richard A; Jiang, Jean X; Kerjaschki, Dontscho; Sever, Sanja; Reiser, Jochen

    2014-06-20

    Podocytes are highly differentiated cells and critical elements for the filtration barrier of the kidney. Loss of their foot process (FP) architecture (FP effacement) results in urinary protein loss. Here we show a novel role for the neutral amino acid glutamine in structural and functional regulation of the kidney filtration barrier. Metabolic flux analysis of cultured podocytes using genetic, toxic, and immunologic injury models identified increased glutamine utilization pathways. We show that glutamine uptake is increased in diseased podocytes to couple nutrient support to increased demand during the disease state of FP effacement. This feature can be utilized to transport increased amounts of glutamine into damaged podocytes. The availability of glutamine determines the regulation of podocyte intracellular pH (pHi). Podocyte alkalinization reduces cytosolic cathepsin L protease activity and protects the podocyte cytoskeleton. Podocyte glutamine supplementation reduces proteinuria in LPS-treated mice, whereas acidification increases glomerular injury. In summary, our data provide a metabolic opportunity to combat urinary protein loss through modulation of podocyte amino acid utilization and pHi. © 2014 by The American Society for Biochemistry and Molecular Biology, Inc.

  3. Alkaline phosphatase activity of rumen bacteria.

    Science.gov (United States)

    Cheng, K J; Costerton, J W

    1977-11-01

    Of the 54 strains of rumen bacteria examined for alkaline phosphatase (APase) production, 9 of 33 gram-negative strains and none of 21 gram-positive strains produced the enzyme. The APase of the cells of the three strains of Bacteroides ruminicola that produced significant amounts of the enzyme was located in the periplasmic area of the cell envelope, whereas the enzyme was located in the strains of Selenomonas ruminantium and Succinivibrio dextrinosolvens was associated with the outer membrane. The localization of APase production in the cells of natural populations of rumen bacteria from hay-fed sheep was accomplished by reaction product deposition, and both the proportion of APase-producing bacteria and the location of the enzyme in the cell envelope of the producing cells could be determined. We suggest that this procedure is useful in detecting shifts in the bacterial population and the release of cell-bound APase that accompany feedlot bloat and other sequelae of dietary manipulation in ruminants.

  4. Identification of human pulmonary alkaline phosphatase isoenzymes.

    Science.gov (United States)

    Capelli, A; Cerutti, C G; Lusuardi, M; Donner, C F

    1997-04-01

    An increase of alkaline phosphatase (ALP) activity has been observed in the bronchoalveolar lavage fluid (BALF) of patients affected by pulmonary fibrosis in chronic interstitial lung disorders. To characterize the ALP isoenzymes in such cases, we used gel filtration, agarose gel electrophoresis, heat and amino acid inhibition assays, wheat-germ agglutinin (WGA) precipitation, and an immunoassay specific for the bone-isoform of ALP. Only one anodic band representing a high-molecular-weight isoform of ALP (Mr approximately 2,000 kDa) was observed on electrophoresis of BALF. The inhibition assay results were consistent for a tissue-nonspecific isoenzyme sensitive to a temperature of 56 degrees C (71.9 +/- 2.5% inhibition) and to homoarginine (65.7 +/- 1.9%), and resistant to L-phenylalanine and L-leucine. Less than 13% of ALP activity was heat-stable. After incubation of BALF specimens with glycosyl-phosphatidylinositol-phospholipase D plus Nonidet P-40, or with phosphatidylinositol-phospholipase C alone, an electrophoretic cathodic band (Mr approximately 220 kDa) appeared near the bone band of a standard serum. With the WGA assay, 84.4 +/- 3.3% of ALP precipitated and the band disappeared. After immunoassay for the bone isoform, a mean of less than 5% enzyme activity was measured. We conclude that the ALP found in BALF is a pulmonary isoform of a tissue nonspecific isoenzyme.

  5. Response of Desulfovibrio vulgaris to Alkaline Stress

    Energy Technology Data Exchange (ETDEWEB)

    Stolyar, S.; He, Q.; He, Z.; Yang, Z.; Borglin, S.E.; Joyner, D.; Huang, K.; Alm, E.; Hazen, T.C.; Zhou, J.; Wall, J.D.; Arkin, A.P.; Stahl, D.A.

    2007-11-30

    The response of exponentially growing Desulfovibrio vulgarisHildenborough to pH 10 stress was studied using oligonucleotidemicroarrays and a study set of mutants with genes suggested by microarraydata to be involved in the alkaline stress response deleted. The datashowed that the response of D. vulgaris to increased pH is generallysimilar to that of Escherichia coli but is apparently controlled byunique regulatory circuits since the alternative sigma factors (sigma Sand sigma E) contributing to this stress response in E. coli appear to beabsent in D. vulgaris. Genes previously reported to be up-regulated in E.coli were up-regulated in D. vulgaris; these genes included three ATPasegenes and a tryptophan synthase gene. Transcription of chaperone andprotease genes (encoding ATP-dependent Clp and La proteases and DnaK) wasalso elevated in D. vulgaris. As in E. coli, genes involved in flagellumsynthesis were down-regulated. The transcriptional data also identifiedregulators, distinct from sigma S and sigma E, that are likely part of aD. vulgaris Hildenborough-specific stress response system.Characterization of a study set of mutants with genes implicated inalkaline stress response deleted confirmed that there was protectiveinvolvement of the sodium/proton antiporter NhaC-2, tryptophanase A, andtwo putative regulators/histidine kinases (DVU0331 andDVU2580).

  6. Solubility of pllutonium in alkaline salt solutions

    International Nuclear Information System (INIS)

    Hobbs, D.T.; Edwards, T.B.

    1993-01-01

    Plutonium solubility data from several studies have been evaluated. For each data set, a predictive model has been developed where appropriate. In addition, a statistical model and corresponding prediction intervals for plutonium solubility as a quadratic function of the hydroxide concentration have been developed. Because of the wide range of solution compositions, the solubility of plutonium can vary by as much as three orders of magnitude for any given hydroxide concentration and still remain within the prediction interval. Any nuclear safety assessments that depend on the maximum amount of plutonium dissolved in alkaline salt solutions should use concentrations at least as great as the upper prediction limits developed in this study. To increase the confidence in the prediction model, it is recommended that additional solubility tests be conducted at low hydroxide concentrations and with all of the other solution components involved. To validate the model for application to actual waste solutions, it is recommended that the plutonium solubilities in actual waste solutions be determined and compared to the values predicted by the quadratic model

  7. Alkaline Materials and Regenerative Endodontics: A Review

    Directory of Open Access Journals (Sweden)

    Bill Kahler

    2017-12-01

    Full Text Available Periapical health is the primary goal of endodontic treatment in mature and immature teeth. In addition, the goals of treatment of immature teeth with arrested root development include root growth to length and maturation of the apex, as well as thickening of the canal wall. These goals are valid for immature teeth that have been subjected to trauma and dental caries or that are the result of developmental anomalies that expose the tooth to the risk of pulp necrosis and consequently result in the cessation of root maturation. Regenerative endodontic procedures (REPs have been described as a “paradigm shift” in the treatment of immature teeth with pulp necrosis and underdeveloped roots, as there is the potential for further root maturation and return of vitality. Treatment with REPs is advocated as the treatment of choice for immature teeth with pulp necrosis. REP protocols involve the use of alkaline biomaterials, primarily sodium hypochlorite, calcium hydroxide, mineral trioxide aggregates and Biodentine, and are the essential components of a successful treatment regimen.

  8. Alkaline Phosphatase, an Unconventional Immune Protein

    Directory of Open Access Journals (Sweden)

    Bethany A. Rader

    2017-08-01

    Full Text Available Recent years have seen an increase in the number of studies focusing on alkaline phosphatases (APs, revealing an expanding complexity of function of these enzymes. Of the four human AP (hAP proteins, most is known about tissue non-specific AP (TNAP and intestinal AP (IAP. This review highlights current understanding of TNAP and IAP in relation to human health and disease. TNAP plays a role in multiple processes, including bone mineralization, vitamin B6 metabolism, and neurogenesis, is the genetic cause of hypophosphatasia, influences inflammation through regulation of purinergic signaling, and has been implicated in Alzheimer’s disease. IAP regulates fatty acid absorption and has been implicated in the regulation of diet-induced obesity and metabolic syndrome. IAP and TNAP can dephosphorylate bacterial-derived lipopolysaccharide, and IAP has been identified as a potential regulator of the composition of the intestinal microbiome, an evolutionarily conserved function. Endogenous and recombinant bovine APs and recombinant hAPs are currently being explored for their potential as pharmacological agents to treat AP-associated diseases and mitigate multiple sources of inflammation. Continued research on these versatile proteins will undoubtedly provide insight into human pathophysiology, biochemistry, and the human holobiont.

  9. The aluminum chemistry and corrosion in alkaline solutions

    International Nuclear Information System (INIS)

    Zhang Jinsuo; Klasky, Marc; Letellier, Bruce C.

    2009-01-01

    Aluminum-alkaline solution systems are very common in engineering applications including nuclear engineering. Consequently, a thorough knowledge of the chemistry of aluminum and susceptibility to corrosion in alkaline solutions is reviewed. The aluminum corrosion mechanism and corrosion rate are examined based on current experimental data. A review of the phase transitions with aging time and change of environment is also performed. Particular attention is given to effect of organic and inorganic ions. As an example, the effect of boron is examined in detail because of the application in nuclear reactor power systems. Methods on how to reduce the corrosion rate of aluminum in alkaline solutions are also highlighted

  10. Rapid method for direct identification of bacteria in urine and blood culture samples by matrix-assisted laser desorption ionization time-of-flight mass spectrometry: intact cell vs. extraction method.

    Science.gov (United States)

    Ferreira, L; Sánchez-Juanes, F; Muñoz-Bellido, J L; González-Buitrago, J M

    2011-07-01

    Matrix-assisted laser desorption ionization time-of-flight (MALDI-TOF) mass spectrometry (MS) is a fast and reliable technology for the identification of microorganisms with proteomics approaches. Here, we compare an intact cell method and a protein extraction method before application on the MALDI plate for the direct identification of microorganisms in both urine and blood culture samples from clinical microbiology laboratories. The results show that the intact cell method provides excellent results for urine and is a good initial method for blood cultures. The extraction method complements the intact cell method, improving microorganism identification from blood culture. Thus, we consider that MALDI-TOF MS performed directly on urine and blood culture samples, with the protocols that we propose, is a suitable technique for microorganism identification, as compared with the routine methods used in the clinical microbiology laboratory. © 2010 The Authors. Clinical Microbiology and Infection © 2010 European Society of Clinical Microbiology and Infectious Diseases.

  11. Review and assessment of technologies for the separation of strontium from alkaline and acidic media

    International Nuclear Information System (INIS)

    Orth, R.J.; Kurath, D.E.

    1994-01-01

    A literature survey has been conducted to identify and evaluate methods for the separation of strontium from acidic and alkaline media as applied to Hanford tank waste. The most promising methods of solvent extraction, precipitation, and ion exchange are described. The following criteria were used for evaluating the separation methods: Appreciable strontium removal must be demonstrated; Strontium selectivity over bulk components must be demonstrated; The method must show promise for evolving into a practical and fairly simple process; The process should be safe to operate; The method must be robust (i.e., capable of separating strontium from various waste types); Secondary waste generation must be minimized; and The method must show resistance to radiation damage. The methods discussed did not necessarily satisfy all of the above criteria; thus, key areas requiring further development are also given for each method. Less promising solvent extraction, precipitation, and ion exchange methods were also identified; areas for potential development are included in this report

  12. Effectiveness of Alkaline Pretreatment and Acetic Acid Hydrolysis on the Characteristics of Collagen from Fish Skin of Snakehead

    Directory of Open Access Journals (Sweden)

    Wulandari

    2015-12-01

    Full Text Available Fish skin is one of marine byproducts potential for alternative source of collagen. This study investigated the effectiveness of alkaline and acetic acid pretreatment on the characteristics of collagen from skin snakehead fish. The concentrations of alkaline pretreatment were 0.05; 0.1; 0.15 and 0.2 M for 2, 4, 6, 8, 10 and 12 hours, acetic acid concentrations were 0.05 M, 0.1 M, 0.15 M and 0.2 M for 1 and 2 hours. The experimental design used for alkaline and acetic acid pretreatment was factorial completely randomized design. The result showed that the concentration of alkaline 0.05 M for 6 hours have significant effect on the elimination of non-collagen protein (p<0.05, whereas for the optimum acetic acid at a concentration 0.1 M for 2 hours significantly different on solubility and swelling. Extraction yields of collagen was 16%, with characteristics of whiteness 66.67%, protein content 96.21%, viscosity 10 cP, Tmax 159.9oC and glass transition temperature 78.55oC. The dominant amino acid composition were glycine (27.11%, proline (13.87% and alanine (12.58%. Functional groups collagen from skin snakehead fish has β-sheet structure which is a characteristic of collagen.

  13. Effectiveness of Alkaline Pretreatment and Acetic Acid Hydrolysis on the Characteristics of Collagen from Fish Skin of Snakehead

    Directory of Open Access Journals (Sweden)

    Wulandari Wulandari

    2015-12-01

    Full Text Available Fish skin is one of marine byproducts potential for alternative source of collagen. This studyinvestigated the effectiveness of alkaline and acetic acid pretreatment on the characteristics ofcollagen from skin snakehead fish. The concentrations of alkaline pretreatment were 0.05; 0.1; 0.15and 0.2 M for 2, 4, 6, 8, 10 and 12 hours, acetic acid concentrations were 0.05 M, 0.1 M, 0.15 M and0.2 M for 1 and 2 hours. The experimental design used for alkaline and acetic acid pretreatmentwas factorial completely randomized design. The result showed that the concentration of alkaline0.05 M for 6 hours have significant effect on the elimination of non-collagen protein (p<0.05,whereas for the optimum acetic acid at a concentration 0.1 M for 2 hours significantly differenton solubility and swelling. Extraction yields of collagen was 16%, with characteristics of whiteness66.67%, protein content 96.21%, viscosity 10 cP, Tmax 159.9oC and glass transition temperature78.55oC. The dominant amino acid composition were glycine (27.11%, proline (13.87% andalanine (12.58%. Functional groups collagen from skin snakehead fish has β-sheet structurewhich is a characteristic of collagen.

  14. Extraction process

    International Nuclear Information System (INIS)

    Rendall, J.S.; Cahalan, M.J.

    1979-01-01

    A process is described for extracting at least two desired constituents from a mineral, using a liquid reagent which produces the constituents, or compounds thereof, in separable form and independently extracting those constituents, or compounds. The process is especially valuable for the extraction of phosphoric acid and metal values from acidulated phosphate rock, the slurry being contacted with selective extractants for phosphoric acid and metal (e.g. uranium) values. In an example, uranium values are oxidized to uranyl form and extracted using an ion exchange resin. (U.K.)

  15. Microbial alkaline proteases: Optimization of production parameters and their properties

    Directory of Open Access Journals (Sweden)

    Kanupriya Miglani Sharma

    2017-06-01

    Full Text Available Proteases are hydrolytic enzymes capable of degrading proteins into small peptides and amino acids. They account for nearly 60% of the total industrial enzyme market. Proteases are extensively exploited commercially, in food, pharmaceutical, leather and detergent industry. Given their potential use, there has been renewed interest in the discovery of proteases with novel properties and a constant thrust to optimize the enzyme production. This review summarizes a fraction of the enormous reports available on various aspects of alkaline proteases. Diverse sources for isolation of alkaline protease producing microorganisms are reported. The various nutritional and environmental parameters affecting the production of alkaline proteases in submerged and solid state fermentation are described. The enzymatic and physicochemical properties of alkaline proteases from several microorganisms are discussed which can help to identify enzymes with high activity and stability over extreme pH and temperature, so that they can be developed for industrial applications.

  16. Spectroscopic characterization of manganese-doped alkaline earth ...

    Indian Academy of Sciences (India)

    The shapes of spectra are also changed with varying alkaline earth ions content. ... of manganese ion and electrical properties of glass contain- ing mobile ions like .... octahedral crystal field are located above the ground 6S state. Figure 2.

  17. Optimization of alkaline protease production and its fibrinolytic ...

    African Journals Online (AJOL)

    Optimization of alkaline protease production and its fibrinolytic activity from the ... nitrogen sources and sodium chloride concentration for protease production by the ... exploited to assist in protein degradation in various industrial processes.

  18. Guest–host interactions in the alkaline bleaching of ...

    Indian Academy of Sciences (India)

    Administrator

    cyclodextrin on the bleaching rates of triphenylmethane dyes crystal violet (CV), malachite green (MG) and rosaniline. (RA) have been investigated in alkaline medium with a view to understand the guest–host interaction in these system. 2.

  19. The Estimation Formation Alkaline In The Proses Desalination MSF

    International Nuclear Information System (INIS)

    Latiffah, Siti Nurul

    2000-01-01

    Already to go on estimation phenomena formation alkaline scale of a seawater. In desalination system seawater on MSF to go on scale by a thermal decomposition HCO sub.3- ion and hydrolysis carbonate ion with water on the temperature operation. The varieties alkaline scale in attached on tube surface, while reduced efficiency heat transfer and to raise corrosion attack to structure material is caused all this high cost. Estimation to take please which a sum step by step decomposition ion bicarbonate from then information scale which carbonate and hydroxyl ion. The various scale maximal is alkaline form is a calcium carbonate = 116,5 gram per meter cubic the various sedimentation is alkaline and magnesium hydroxide = 67,57 gram per meter cubic

  20. Solvent extraction

    Energy Technology Data Exchange (ETDEWEB)

    Coombs, D.M.; Latimer, E.G.

    1988-01-05

    It is an object of this invention to provide for the demetallization and general upgrading of heavy oil via a solvent extracton process, and to improve the efficiency of solvent extraction operations. The yield and demetallization of product oil form heavy high-metal content oil is maximized by solvent extractions which employ either or all of the following techniques: premixing of a minor amount of the solvent with feed and using countercurrent flow for the remaining solvent; use of certain solvent/free ratios; use of segmental baffle tray extraction column internals and the proper extraction column residence time. The solvent premix/countercurrent flow feature of the invention substantially improves extractions where temperatures and pressures above the critical point of the solvent are used. By using this technique, a greater yield of extract oil can be obtained at the same metals content or a lower metals-containing extract oil product can be obtained at the same yield. Furthermore, the premixing of part of the solvent with the feed before countercurrent extraction gives high extract oil yields and high quality demetallization. The solvent/feed ratio features of the invention substanially lower the captial and operating costs for such processes while not suffering a loss in selectivity for metals rejection. The column internals and rsidence time features of the invention further improve the extractor metals rejection at a constant yield or allow for an increase in extract oil yield at a constant extract oil metals content. 13 figs., 3 tabs.