WorldWideScience

Sample records for rapid alkaline extraction

  1. Rapid, Effective DNA Isolation from Osmanthus via Modified Alkaline Lysis.

    Science.gov (United States)

    Alexander, Lisa

    2016-07-01

    Variability of leaf structure and presence of secondary metabolites in mature leaf tissue present a challenge for reliable DNA extraction from Osmanthus species and cultivars. The objective of this study was to develop a universal rapid, effective, and cost-efficient method of DNA isolation for Osmanthus mature leaf tissue. Four different methods were used to isolate DNA from 8 cultivars of Osmanthus. Absorbance spectra, DNA concentration, appearance on agarose gel, and performance in PCR were used to analyze quality, quantity, and integrity of isolated DNA. Methods were ranked in order, based on total quantity, quality, and performance points as the following: 1) solid-phase extraction (SPE), 2) modified alkaline lysis (SDS), 3) cetyltrimethylammonium bromide (CTAB) with chloroform (CHL), and 4) CTAB with phenol/chloroform (PHE). Total DNA, isolated via SPE, showed the least contamination but the lowest mean quantity (9.6 ± 3.4 μg) and highest cost. The highest quantity of DNA was isolated via SDS (117 ± 54.1 μg). SPE and SDS resolved the most individuals on agarose gel, whereas the 2 CTAB methods had poorly resolved gels. All methods except PHE performed well in PCR. Additions to the modified alkaline lysis method increased A260:A230 by up to 59% without affecting yield. With the use of SDS, an average of 1000 μg/g DNA was isolated from fresh leaf tissue of 18 samples in ∼1.5 h at a cost of 0.74 U.S. dollars (USD)/sample. We recommend improved alkaline lysis as a rapid, effective, and cost-efficient method of isolating DNA from Osmanthus species.

  2. Extraction and partial purification of mouse uterine alkaline phosphatase.

    Science.gov (United States)

    Murdoch, R N; Kay, D J; Capper, W J

    1979-04-01

    Alkaline phosphatase in uterine homogenates from day 7 pregnant mice was solubilized using 0.2% (v/v) Triton X-100 and extracted wtih 20% (v/v) n-butanol. The procedure, which resulted in 182-fold purification, included ammonium sulfate precipitation, DEAE-cellulose anion exchange chromatography and Sephadex G200 gel filtration. Solubilization with Triton X-100 was an important step in the procedure since extraction with n-butanol alone only partially solubilized the enzyme and gave low extraction yields, much of the enzyme activity remaining in association with negatively charged residues. However, butanol extraction of Triton X-100-treated homogenates gave high yields of enzyme and eliminated p-nitrophenyl phosphatases which displayed activity in the pH range 3.0--7.5, together with a large proportion of inactive protein. The activity of the purified enzyme preparations was electrophoretically homogeneous on cellulose acetate membranes, suggesting that the alkaline phosphatase in the mouse uterus exists in a single isozymic form. Polyacrylamide-gel electrophoresis revealed that the purified preparations contained at least one protein as an impurity. Attempts to further purify the alkaline phosphatase by isoelectric focusing were unsuccessful since the enzyme was found to have an isoelectric point of about 5.0 and at this pH it was rapidly inactivated.

  3. Alkaline extraction of phenolic compounds from intact sorghum kernels

    Science.gov (United States)

    An aqueous sodium hydroxide solution was employed to extract phenolic compounds from whole grain sorghum without decortication or grinding as determined by Oxygen Radical Absorbance Capacity (ORAC). The alkaline extract ORAC values were more stable over 32 days compared to neutralized and freeze dri...

  4. Kinetic studies of alkaline phosphatase extracted from rabbit (Lepus ...

    African Journals Online (AJOL)

    user

    Studies were carried out to ascertain some kinetic properties of alkaline phosphatase (ALP) extracted from Lepus townsendii liver. Incubation of ALP extract with 4-nitrophenylphosphate (4-NPP) formed the basis for determination of enzyme activity. Spectrophotometric method was used to assay the enzyme activity, and the ...

  5. Kinetic studies of alkaline phosphatase extracted from rabbit ( Lepus ...

    African Journals Online (AJOL)

    Studies were carried out to ascertain some kinetic properties of alkaline phosphatase (ALP) extracted from Lepus townsendii liver. Incubation of ALP extract with 4-nitrophenylphosphate (4-NPP) formed the basis for determination of enzyme activity. Spectrophotometric method was used to assay the enzyme activity, and the ...

  6. Integration of galacturonic acid extraction with alkaline protein extraction from green tea leaf residue

    NARCIS (Netherlands)

    Zhang, Chen; Bozileva, Elvira; Klis, van der Frits; Dong, Yiyuan; Sanders, Johan P.M.; Bruins, Marieke E.

    2016-01-01

    Leaf pectin can be used as a feedstock for galacturonic acid (GA) production, but high extraction costs limit economic feasibility. To improve the extraction efficiency, leaf pectin extraction was integrated with an already cost-effective alkaline protein extraction, focusing on high yield of GA

  7. Kinetic studies of alkaline phosphatase extracted from rabbit (Lepus ...

    African Journals Online (AJOL)

    user

    Double reciprocal plot of ALP assay in the presence of inhibitor NaH2PO4 ( ) and the control ( ) analysis. [I]: concentration of inhibitor = 0.67 mM. Table 2. Kinetic constants of alkaline phosphatase extracted from L. townsendii liver. Km (mM ). Ki (mM). Vmax (µM/min-1). 0.5 ± 0.25. 0.9 ± 0.33. 20 ± 0.63. Values are Mean ± S.D ...

  8. Alkaline extraction of polonium from liquid lead bismuth eutectic

    Science.gov (United States)

    Heinitz, S.; Neuhausen, J.; Schumann, D.

    2011-07-01

    The production of highly radiotoxic polonium isotopes poses serious safety concerns for the development of future nuclear systems cooled by lead bismuth eutectic (LBE). In this paper it is shown that polonium can be extracted efficiently from LBE using a mixture of alkaline metal hydroxides (NaOH + KOH) in a temperature range between 180 and 350 °C. The extraction ratio was analyzed for different temperatures, gas blankets and phase ratios. A strong dependence of the extraction performance on the redox properties of the cover gas was found. While hydrogen facilitates the removal of polonium, oxygen has a negative influence on the extraction. These findings open new possibilities to back up the safety of future LBE based nuclear facilities.

  9. A precise study on effects that trigger alkaline hemicellulose extraction efficiency.

    Science.gov (United States)

    Hutterer, Christian; Schild, Gabriele; Potthast, Antje

    2016-08-01

    The conversion of paper-grade pulps into dissolving pulps requires efficient strategies and process steps to remove low-molecular noncellulosic macromolecules generally known as hemicelluloses. Current strategies include alkaline extractions and enzymatic treatments. This study focused on the evaluation of extraction efficiencies in alkaline extractions of three economically interesting hardwood species: beech (Fagus sylvatica), birch (Betula papyrifera), and eucalyptus (Eucalyptus globulus). Substrate pulps were subjected to alkaline treatments at different temperatures and alkalinities using white liquor as the alkali source, followed by analyses of both pulps and hemicellulose-containing extraction lyes. The extracted hardwood xylans have strong potential as an ingredient in the food and pharmaceutical industries. Subsequent analyses revealed strong dependencies of the extraction efficiencies and molar mass distributions of hemicelluloses on the process variables of temperature and effective alkalinity. The hemicellulose content of the initial pulps, the hardwood species, and the type of applied base played minor roles. Copyright © 2016 Elsevier Ltd. All rights reserved.

  10. Determination of Lutein from Fruit and Vegetables Through an Alkaline Hydrolysis Extraction Method and HPLC Analysis.

    Science.gov (United States)

    Fratianni, Alessandra; Mignogna, Rossella; Niro, Serena; Panfili, Gianfranco

    2015-12-01

    A simple and rapid analytical method for the determination of lutein content, successfully used for cereal matrices, was evaluated in fruit and vegetables. The method involved the determination of lutein after an alkaline hydrolysis of the sample matrix, followed by extraction with solvents and analysis by normal phase HPLC. The optimized method was simple, precise, and accurate and it was characterized by few steps that could prevent loss of lutein and its degradation. The optimized method was used to evaluate the lutein amounts in several fruit and vegetables. Rich sources of lutein were confirmed to be green vegetables such as parsley, spinach, chicory, chard, broccoli, courgette, and peas, even if in a range of variability. Taking into account the suggested reference values these vegetables can be stated as good sources of lutein. © 2015 Institute of Food Technologists®

  11. Critical parameters in cost-effective alkaline extraction for high protein yield from leaves

    NARCIS (Netherlands)

    Zhang, C.; Sanders, J.P.M.; Bruins, M.E.

    2014-01-01

    Leaves are potential resources for feed or food, but their applications are limited due to a high proportion of insoluble protein and inefficient processing. To overcome these problems, parameters of alkaline extraction were evaluated using green tea residue (GTR). Protein extraction could be

  12. Alkaline-side extraction of technetium from tank waste using crown ethers and other extractants

    Energy Technology Data Exchange (ETDEWEB)

    Bonnesen, P.V.; Moyer, B.A.; Presley, D.J.; Armstrong, V.S.; Haverlock, T.J.; Counce, R.M.; Sachleben, R.A.

    1996-06-01

    The chemical development of a new crown-ether-based solvent-extraction process for the separation of (Tc) from alkaline tank-waste supernate is ready for counter-current testing. The process addresses a priority need in the proposed cleanup of Hanford and other tank wastes. This need has arisen from concerns due to the volatility of Tc during vitrification, as well as {sup 99}Tc`s long half-life and environmental mobility. The new process offers several key advantages that direct treatability--no adjustment of the waste composition is needed; economical stripping with water; high efficiency--few stages needed; non-RCRA chemicals--no generation of hazardous or mixed wastes; co-extraction of {sup 90}Sr; and optional concentration on a resin. A key concept advanced in this work entails the use of tandem techniques: solvent extraction offers high selectivity, while a subsequent column sorption process on the aqueous stripping solution serves to greatly concentrate the Tc. Optionally, the stripping solution can be evaporated to a small volume. Batch tests of the solvent-extraction and stripping components of the process have been conducted on actual melton Valley Storage Tank (MVST) waste as well as simulants of MVST and Hanford waste. The tandem process was demonstrated on MVST waste simulants using the three solvents that were selected the final candidates for the process. The solvents are 0.04 M bis-4,4{prime}(5{prime})[(tert-butyl)cyclohexano]-18-crown-6 (abbreviated di-t-BuCH18C6) in a 1:1 vol/vol blend of tributyl phosphate and Isopar{reg_sign} M (an isoparaffinic kerosene); 0.02 M di-t-BuCH18C6 in 2:1 vol/vol TBP/Isopar M and pure TBP. The process is now ready for counter-current testing on actual Hanford tank supernates.

  13. Coupling alkaline pre-extraction with alkaline-oxidative post-treatment of corn stover to enhance enzymatic hydrolysis and fermentability

    Science.gov (United States)

    2014-01-01

    Background A two-stage chemical pretreatment of corn stover is investigated comprising an NaOH pre-extraction followed by an alkaline hydrogen peroxide (AHP) post-treatment. We propose that conventional one-stage AHP pretreatment can be improved using alkaline pre-extraction, which requires significantly less H2O2 and NaOH. To better understand the potential of this approach, this study investigates several components of this process including alkaline pre-extraction, alkaline and alkaline-oxidative post-treatment, fermentation, and the composition of alkali extracts. Results Mild NaOH pre-extraction of corn stover uses less than 0.1 g NaOH per g corn stover at 80°C. The resulting substrates were highly digestible by cellulolytic enzymes at relatively low enzyme loadings and had a strong susceptibility to drying-induced hydrolysis yield losses. Alkaline pre-extraction was highly selective for lignin removal over xylan removal; xylan removal was relatively minimal (~20%). During alkaline pre-extraction, up to 0.10 g of alkali was consumed per g of corn stover. AHP post-treatment at low oxidant loading (25 mg H2O2 per g pre-extracted biomass) increased glucose hydrolysis yields by 5%, which approached near-theoretical yields. ELISA screening of alkali pre-extraction liquors and the AHP post-treatment liquors demonstrated that xyloglucan and β-glucans likely remained tightly bound in the biomass whereas the majority of the soluble polymeric xylans were glucurono (arabino) xylans and potentially homoxylans. Pectic polysaccharides were depleted in the AHP post-treatment liquor relative to the alkaline pre-extraction liquor. Because the already-low inhibitor content was further decreased in the alkaline pre-extraction, the hydrolysates generated by this two-stage pretreatment were highly fermentable by Saccharomyces cerevisiae strains that were metabolically engineered and evolved for xylose fermentation. Conclusions This work demonstrates that this two

  14. Delignification outperforms alkaline extraction for xylan fingerprinting of oil palm empty fruit bunch

    NARCIS (Netherlands)

    Murciano Martínez, Patricia; Kabel, Mirjam A.; Gruppen, Harry

    2016-01-01

    Enzyme hydrolysed (hemi-)celluloses from oil palm empty fruit bunches (EFBs) are a source for production of bio-fuels or chemicals. In this study, after either peracetic acid delignification or alkaline extraction, EFB hemicellulose structures were described, aided by xylanase hydrolysis.

  15. Fungal phytopathogens encode functional homologues of plant rapid alkalinization factor (RALF) peptides.

    Science.gov (United States)

    Thynne, Elisha; Saur, Isabel M L; Simbaqueba, Jaime; Ogilvie, Huw A; Gonzalez-Cendales, Yvonne; Mead, Oliver; Taranto, Adam; Catanzariti, Ann-Maree; McDonald, Megan C; Schwessinger, Benjamin; Jones, David A; Rathjen, John P; Solomon, Peter S

    2017-08-01

    In this article, we describe the presence of genes encoding close homologues of an endogenous plant peptide, rapid alkalinization factor (RALF), within the genomes of 26 species of phytopathogenic fungi. Members of the RALF family are key growth factors in plants, and the sequence of the RALF active region is well conserved between plant and fungal proteins. RALF1-like sequences were observed in most cases; however, RALF27-like sequences were present in the Sphaerulina musiva and Septoria populicola genomes. These two species are pathogens of poplar and, interestingly, the closest relative to their respective RALF genes is a poplar RALF27-like sequence. RALF peptides control cellular expansion during plant development, but were originally defined on the basis of their ability to induce rapid alkalinization in tobacco cell cultures. To test whether the fungal RALF peptides were biologically active in plants, we synthesized RALF peptides corresponding to those encoded by two sequenced genomes of the tomato pathogen Fusarium oxysporum f. sp. lycopersici. One of these peptides inhibited the growth of tomato seedlings and elicited responses in tomato and Nicotiana benthamiana typical of endogenous plant RALF peptides (reactive oxygen species burst, induced alkalinization and mitogen-activated protein kinase activation). Gene expression analysis confirmed that a RALF-encoding gene in F. oxysporum f. sp. lycopersici was expressed during infection on tomato. However, a subsequent reverse genetics approach revealed that the RALF peptide was not required by F. oxysporum f. sp. lycopersici for infection on tomato roots. This study has demonstrated the presence of functionally active RALF peptides encoded within phytopathogens that harbour an as yet undetermined role in plant-pathogen interactions. © 2016 BSPP AND JOHN WILEY & SONS LTD.

  16. Strongyloides venezuelensis alkaline extract for the diagnosis of human strongyloidiasis by enzyme-linked immunosorbent assay

    Directory of Open Access Journals (Sweden)

    Machado Eleuza Rodrigues

    2003-01-01

    Full Text Available The present study was conducted to detected IgG antibodies using Strongyloides venezuelensis alkaline extract for the diagnosis of human strongyloidiasis by the enzyme-linked immunosorbent assay (ELISA. Sera from 90 subjects were analyzed (30 with strongyloidiasis, 30 with other parasites and 30 healthy individuals. Results were expressed in antibody titers, which were considered as positive when titer was > 80. Sensibility and specificity of the assay were 100% and 96.7%, respectively. It can be concluded that the heterologous alkaline extract could be employed in ELISA as a diagnostic aid in human strongyloidiasis, due to its advantages as easiness of obtaining, practicability in preparing, and high indexes of sensitivity and specificity.

  17. Overestimation of organic phosphorus in wetland soils by alkaline extraction and molybdate colorimetry.

    Science.gov (United States)

    Turner, Benjamin L; Newman, Susan; Reddy, K Ramesh

    2006-05-15

    Accurate information on the chemical nature of soil phosphorus is essential for understanding its bioavailability and fate in wetland ecosystems. Solution phosphorus-31 nuclear magnetic resonance (31P NMR) spectroscopy was used to assess the conventional colorimetric procedure for phosphorus speciation in alkaline extracts of organic soils from the Florida Everglades. Molybdate colorimetry markedly overestimated organic phosphorus by between 30 and 54% compared to NMR spectroscopy. This was due in large part to the association of inorganic phosphate with organic matter, although the error was exacerbated in some samples by the presence of pyrophosphate, an inorganic polyphosphate that is not detected by colorimetry. The results have important implications for our understanding of phosphorus biogeochemistry in wetlands and suggest that alkaline extraction and solution 31p NMR spectroscopy is the only accurate method for quantifying organic phosphorus in wetland soils.

  18. Short-time alkaline peroxide pretreatment for rapid pulping and efficient enzymatic hydrolysis of rice straw.

    Science.gov (United States)

    Hideno, Akihiro

    2017-04-01

    To improve utilization of agricultural residues in biorefineries, the effects of alkaline peroxide (AP) pretreatment on thermal degradation and enzymatic digestibility of rice straw were investigated. A high-cellulose (>70%) pulp with a width of a few micrometers was obtained by rapid (10min) treatment with AP, without prior heating or other treatment. Moreover, enzymatic hydrolysis of the pulp produced a high glucose yield (approximately 80%). Microfibril networks were exposed, and many nano-scale pores that are easily penetrated by cellulases were observed on the surface of the AP-treated sample. For enzymatic hydrolysis of the pulp, increasing the dosage of cellulases was more effective for improving the glucose yield than addition of a grinding treatment. This AP treatment has the potential for on-site application because it is simple, highly efficient, and can be performed in a short time. Copyright © 2017. Published by Elsevier Ltd.

  19. Hot-alkaline DNA extraction method for deep-subseafloor archaeal communities.

    Science.gov (United States)

    Morono, Yuki; Terada, Takeshi; Hoshino, Tatsuhiko; Inagaki, Fumio

    2014-03-01

    A prerequisite for DNA-based microbial community analysis is even and effective cell disruption for DNA extraction. With a commonly used DNA extraction kit, roughly two-thirds of subseafloor sediment microbial cells remain intact on average (i.e., the cells are not disrupted), indicating that microbial community analyses may be biased at the DNA extraction step, prior to subsequent molecular analyses. To address this issue, we standardized a new DNA extraction method using alkaline treatment and heating. Upon treatment with 1 M NaOH at 98°C for 20 min, over 98% of microbial cells in subseafloor sediment samples collected at different depths were disrupted. However, DNA integrity tests showed that such strong alkaline and heat treatment also cleaved DNA molecules into short fragments that could not be amplified by PCR. Subsequently, we optimized the alkaline and temperature conditions to minimize DNA fragmentation and retain high cell disruption efficiency. The best conditions produced a cell disruption rate of 50 to 80% in subseafloor sediment samples from various depths and retained sufficient DNA integrity for amplification of the complete 16S rRNA gene (i.e., ∼1,500 bp). The optimized method also yielded higher DNA concentrations in all samples tested compared with extractions using a conventional kit-based approach. Comparative molecular analysis using real-time PCR and pyrosequencing of bacterial and archaeal 16S rRNA genes showed that the new method produced an increase in archaeal DNA and its diversity, suggesting that it provides better analytical coverage of subseafloor microbial communities than conventional methods.

  20. Alkaline extraction of humic substances from peat applied to organic-mineral fertilizer production

    Directory of Open Access Journals (Sweden)

    B. Saito

    2014-09-01

    Full Text Available An organic-mineral fertilizer based on humic substances (HSs and potassium was developed based on the alkaline extraction of HSs from peat. The HSs have interesting properties for use as a fertilizer since they improve the physical and chemical structure of the soil and provide a source of organic carbon which is readily absorbable by the plants, whereas potassium is a primary nutrient for plants. It was found that highly decomposed peats containing a small inorganic fraction are more favorable for the extraction of HSs. Using these peats, organic-mineral fertilizers that meet the Brazilian legislation have been obtained for a peat-extractant mixture containing 2.57 wt% total organic content (TOC, a K2O/TOC ratio of 1 wt% and an extraction time of 12 hours.

  1. Effect of hot-water extraction on alkaline pulping of bagasse.

    Science.gov (United States)

    Lei, Yichao; Liu, Shijie; Li, Jiang; Sun, Runcang

    2010-01-01

    The effect of hot-water extraction on alkaline pulping was investigated. The properties of black liquor and pulp strength of bagasse were analyzed. The extraction was conducted at 160 degrees C for 30min where 13.2% of the mass was dissolved in the extraction liquor. Untreated bagasse and extracted bagasse were digested by soda and soda-AQ processes at 17% and 15.5% (with 0.1% AQ) alkali charge (NaOH). Cooking temperatures were 160 degrees C and 155 degrees C respectively. The pulp from extracted bagasse had a lower Kappa number and a higher viscosity compared to the pulp from the untreated bagasse. The black liquor from pulping extracted bagasse had a lower solid content, a lower viscosity and a lower silica content, but a higher heating value than that from pulping of untreated bagasse. Hot-water extraction resulted in a significant decrease in bleaching chemical consumption and the formation of chlorinated organics. Pulp strength properties such as the tensile index and the burst index were found to be lower, but the tear index, bulk, opacity and pulp freeness were found to be higher when hot-water extraction was applied. Copyright 2010 Elsevier Inc. All rights reserved.

  2. Evaluation of a simple, non-alkaline extraction protocol to quantify soil ergosterol

    NARCIS (Netherlands)

    De Ridder-Duine, A.S.; Smant, W.; Van der Wal, A.; Van Veen, J.A.; De Boer, W.

    2006-01-01

    Quantification of soil ergosterol is increasingly used as an estimate for soil fungal biomass. Several methods for extraction of ergosterol from soil have been published, perhaps the simplest being that described by Gong, P., Guan, X., Witter, E. [2001. A rapid method to extract ergosterol from soil

  3. Structural Features of Alkaline Extracted Polysaccharide from the Seeds of Plantago asiatica L. and Its Rheological Properties

    Directory of Open Access Journals (Sweden)

    Jun-Yi Yin

    2016-09-01

    Full Text Available Polysaccharide from the seeds of Plantago asiatica L. has many bioactivities, but few papers report on the structural and rheological characteristics of the alkaline extract. The alkaline extracted polysaccharide was prepared from seeds of P. asiatica L. and named herein as alkaline extracted polysaccharide from seeds of P. asiatica L. (PLAP. Its structural and rheological properties were characterized by monosaccharide composition, methylation, GC-MS and rheometry. PLAP, as an acidic arabinoxylan, was mainly composed of 1,2,4-linked Xylp and 1,3,4-linked Xylp residues. PLAP solution showed pseudoplastic behavior, and weak gelling properties at high concentration. Sodium and especially calcium ions played a significant role in increasing the apparent viscosity and gel strength.

  4. Effective extraction method through alkaline hydrolysis for the detection of starch maleate in foods

    Directory of Open Access Journals (Sweden)

    Chia-Fen Tsai

    2015-09-01

    Full Text Available A high-performance liquid chromatography (HPLC method was developed for the determination of maleic acid which was released from starch maleate (SM through the alkaline hydrolysis reaction. The proper alkaline hydrolysis conditions and LC separation are reported in this study. The starch samples were treated with 50% methanol for 30 minutes, and then hydrolyzed by 0.5N KOH for 2 hours to release maleic acid. A C18 column and gradient mobile phase consisting of 0.1% phosphoric acid and methanol at a flow rate of 1.0 mL/minute were used for separation. The method showed a good linearity in the range of 0.01–1.0 ìg/mL, with a limit of quantification (LOQ at 10 mg/kg in starch. The recoveries in corn starch, noodle, and fish balls were between 93.9% and 108.4%. The relative standard deviation (RSD of precision was <4.9% (n = 3. This valid method was rapid, sensitive, precise, and suitable for routine monitoring of the illegal adulteration of SM in foods.

  5. Extracting Vanadium from Stone Coal by a Cyclic Alkaline Leaching Method

    Science.gov (United States)

    Hu, Kailong; Liu, Xuheng; Li, Qinggang

    2017-04-01

    In order to achieve an efficient and economical approach on extracting vanadium from stone coal, a cyclic alkaline leaching method was studied in this work. The effects of operating parameters, including the NaOH concentration, temperature, reaction time, and liquid-solid ratio, on vanadium leaching efficiency were investigated. Also, we studied the influence of caustic soda dosage on the cyclic leaching process as well as the effect of increasing ionic strength in leachates and wash water. The results show that this method achieved a 51 pct decrease of the dosage of caustic soda under the optimized conditions compared with the single-step alkaline leaching. The average leaching yield of vanadium reached 82.28 pct. The leachates and wash water in each leaching cycle were utilized for the next leaching cycle, achieving the recycling of alkali as well as waste water. During the cyclic process, the volume of water was not increased, which markedly reduces the discharge of waste water and is also beneficial in terms of cost reduction.

  6. Ellagic Acid Increases Osteocalcin and Alkaline Phosphatase After Tooth Extraction in Nicotinic-Treated Rats.

    Science.gov (United States)

    Al-Obaidi, Mazen M Jamil; Al-Bayaty, Fouad Hussain; Al Batran, Rami; Ibrahim, Omar Emad; Daher, Aqil M

    2016-01-01

    -To examine the effect of nicotine (Ni) on bone socket healing treated with Ellagic acid (EA) after tooth extraction in rat. Thirty-Two Sprague Dawley (SD) male rats were divided into four groups. The group 1 was administrated with distilled water intragastrically and injected sterile saline subcutaneously. The group 2 was administrated with EA orally and injected with sterile saline subcutaneously. The groups 3 & 4 were subcutaneously exposed to Ni for 4 weeks twice daily before tooth extraction procedure, and maintained Ni injection until the animals were sacrificed. After one month Ni exposure, the group 4 was fed with EA while continuing Ni injection. All the groups were anesthetized, and the upper left incisor was extracted. Four rats from each group were sacrificed on 14(th) and 28(th) days. Tumour necrosis factor alpha (TNFα), Interleukin-1 beta (IL-1β) and Interleukin-6 (IL-6) were applied to assess in serum rat at 14th and 28(th) days. Superoxide dismutase (SOD) and Thiobarbituric acid reactive substances (TBRAS) levels were assessed to evaluate the antioxidant status and lipid peroxidation accordingly after tooth extraction in homogenized gingival maxilla tissue of rat at 14(th) and 28(th) days. The socket hard tissue was stained by eosin and hematoxylin (H&E); immunohistochemical technique was used to assess the healing process by Osteocalcin (OCN) and Alkaline Phosphatase (ALP) biomarkers. Ni-induced rats administered with EA compound (Group 4) dropped the elevated concentration of pro-inflammatory cytokines significantly when compared to Ni-induced rats (Group 3) (pextraction in nicotinic rats could be due to the antioxidant activity of EA which lead to upregulate of OCN and ALP proteins which are responsible for osteogenesis.

  7. Different distributions of human bone alkaline phosphatase isoforms in serum and bone tissue extracts.

    Science.gov (United States)

    Magnusson, Per; Sharp, Christopher A; Farley, John R

    2002-11-01

    In vitro, bone alkaline phosphatase (BALP) is released from the osteoblast membrane with its glycosylphosphatidylinositol (GPI) anchor still attached (i.e., in an anchor-intact form); however, in vivo, BALP circulates as a variable mixture of anchorless isoforms, which can be identified by high-performance liquid chromatography (HPLC). Previous studies have shown that the relative abundance of these BALP isoforms in serum may be clinically useful for the diagnosis and management of metabolic bone disease. In the current studies, we describe a method for the determination of anchorless BALP isoforms in extracts of bone and we present novel data on the conversion of anchor-intact to anchorless BALP by incubation with endogenous circulating GPI-specific phospholipase D (GPI-PLD). A 72-h extraction with 0.1% Triton X-100 released approximately 90% of the BALP activity from powdered bone. An average of 19% of this activity was anchorless, but essentially all of the activity could be converted to the anchorless form by incubation with partially purified GPI-PLD from human serum. Using HPLC, we detected four BALP isoforms (B/I, B1x, B1, and B2) in these GPI-PLD-treated extracts of bone. An additional BALP fraction was also detected in the samples during the initial phase of GPI-PLD treatment. The abundance of the BALP isoforms differed between bone and serum, particularly for the B/I isoform, which comprised, on average, 18% of the BALP in GPI-PLD-treated extracts of healthy bone tissue, but only 6% of the total BALP activity in serum from healthy individuals. Based on our recent finding of differences in the number of sialic acid residues between the BALP isoforms, we hypothesize that this difference between BALP isoforms in serum and extracts of bone is due to the different patterns of glycosylation, which results in different biological half-lives in the circulation. A preliminary application of our method to the extraction of BALP isoforms from a small number of human

  8. Alkaline-Side Extraction of Cesium from Savannah River Tank Waste Using a Calixarene-Crown Ether Extractant

    Energy Technology Data Exchange (ETDEWEB)

    Bonnesen, P.V.; Delmau, L.H.; Haverlock, T.J.; Moyer, B.A.

    1998-12-01

    Results are presented supporting the viability of the alkaline-side CSEX process as a potential replacement for the In-Tank Precipitation process for removal of cesium from aqueous high-level waste (HLW) at the Savannah River Site (SRS). Under funding from the USDOE Efficient Separations and Crosscutting program, a flowsheet was suggested in early June of 1998, and in the following four months, this flowsheet underwent extensive testing, both in batch tests at ORNL and ANL and in two centrifugal-contactor tests at ANL. To carry out these tests, the initial ESP funding was augmented by direct funds from Westinghouse Savannah River Corporation. The flowsheet employed a solvent containing a calixarene-crown hybrid compound called BoBCalixC6 that was invented at ORNL and can now be obtained commercially for government use from IBC Advanced Technologies. This special extractant is so powerful and selective that it can be used at only 0.01 M, compensating for its expense, but a modifier is required for use in an aliphatic diluent, primarily to increase the cesium distribution ratio D{sub Cs} in extraction. The modifier selected is a relatively economical fluorinated alcohol called Cs3, invented at ORNL and so far available. only from ORNL. For the flowsheet, the modifier is used at 0.2 M in the branched aliphatic kerosene Isopar{reg_sign} L. Testing at ORNL and ANL involved simulants of the SRS HLW. After extraction of the Cs from the waste simulant, the solvent is scrubbed with 0.05 M HNO{sub 3} and stripped with a solution comprised of 0.0005 M HNO{sub 3} and 0.0001 M CsNO{sub 3}. The selection of these conditions is justified in this report, both on the basis of experimental data and underlying theory.

  9. Rapid alkaline methylene blue supravital staining for assessment of anterior segment infections.

    Science.gov (United States)

    Kiuchi, Katsuji

    2016-01-01

    To present the Löffler's alkaline methylene blue technique of staining eye discharges in eyes with anterior segment infections. The Löffler's alkaline methylene blue staining method is a simple staining technique that can be used to differentiate bacterial, viral, and fungal infections. It is a cationic dye that stains cells blue because the positively charged dye is attracted to negatively charged particles such as polyphosphates, DNAs, and RNAs. Specimens collected from patients by swabbing are smeared onto microscope slides and the methylene blue solution is dropped on the slide. The slide is covered with a glass cover slip and examined under a microscope. The entire time from the collection to the viewing is about 30 seconds. Histopathological images of the conjunctival epithelial cells and neutrophils in eye discharges were dyed blue and the nuclei were stained more intensely blue. Bacterial infections consisted mainly of neutrophils, and viral infections consisted mainly of lymphocytes. Löffler's alkaline methylene blue staining can be done in about 30 seconds for diagnosis. Even though this is a one color stain, it is possible to infer the cause of the infection by detection of the absence of bacteria and/or fungi in context of the differential distribution of neutrophils and lymphocytes.

  10. Lignin isolation process from rice husk by alkaline hydrogen peroxide: Lignin and silica extracted

    Science.gov (United States)

    Ma'ruf, Anwar; Pramudono, Bambang; Aryanti, Nita

    2017-03-01

    Biomass is one of abundance resources in the world. Biomass consists of three main materials such as cellulose, hemicelluloses and lignin. Therefore, biomass can be referred to lignocellulosic material. Both the cellulose and hemicelluloses fractions are polymers of sugars, and thereby a potential source of fermentable sugars, or other processes that convert sugars into products. Lignin is a polymer compound which contains of phenolic compounds. Rice husk is one of biomass, which has high contain of lignin. Rice husk has special characteristics because of silica content. The aim of this paper is to analyze lignin and silica extracted during lignin isolation process of rice husk using alkaline hydrogen peroxide. Three main variables such as solvent/solid ratio, concentration of hydrogen peroxide and pH of the mixture are studied. The optimum conditions for lignin isolation are at solvent/solid ratio 9:1 ml/gr, hydrogen peroxide concentration of 1.5%v and pH of the mixture of 11.

  11. Rapid Column Extraction method for SoilRapid Column Extraction method for Soil

    Energy Technology Data Exchange (ETDEWEB)

    Maxwell, Sherrod, L. III; Culligan, Brian K.

    2005-11-07

    The analysis of actinides in environmental soil and sediment samples is very important for environmental monitoring as well as for emergency preparedness. A new, rapid actinide separation method has been developed and implemented that provides total dissolution of large soil samples, high chemical recoveries and effective removal of matrix interferences. This method uses stacked TEVA Resin{reg_sign}, TRU Resin{reg_sign} and DGA-Resin{reg_sign} cartridges from Eichrom Technologies (Darien, IL, USA) that allows the rapid separation of plutonium (Pu) neptunium (Np), uranium (U), americium (Am), and curium (Cm) using a single multi-stage column combined with alpha spectrometry. The method combines a rapid fusion step for total dissolution to dissolve refractory analytes and matrix removal using cerium fluoride precipitation to remove the difficult soil matrix. By using vacuum box cartridge technology with rapid flow rates, sample preparation time is minimized.

  12. Rapid Formation of 1D Titanate Nanotubes Using Alkaline Hydrothermal Treatment and Its Photocatalytic Performance

    Directory of Open Access Journals (Sweden)

    Chin Wei Lai

    2015-01-01

    Full Text Available One-dimensional (1D titanate nanotubes (TNT were successfully synthesized using alkaline hydrothermal treatment of commercial TiO2 nanopowders in a Teflon lined stainless steel autoclave at 150°C. The minimum time required for the formation of the titanate nanotubes was 9 h significantly. After the hydrothermal processing, the layered titanate was washed with acid and water in order to control the amount of Na+ ions remaining in the sample solutions. In this study, the effect of different reaction durations in a range of 3 h to 24 h on the formation of nanotubes was carried out. As the reaction duration is extended, the changes in structure from particle to tubular shapes of alkaline treated TiO2 were obtained via scanning electron microscope (SEM. Also, the significant impact on the phase transformation and crystal structure of TNT was characterized through XRD and Raman analysis. Indeed, the photocatalytic activity of TNT was investigated through the degradation of methyl orange aqueous solution under the ultraviolet light irradiation. As a result, TNT with reaction duration at 6 h has a better photocatalytic performance than other samples which was correlated to the higher crystallinity of the samples as shown in XRD patterns.

  13. Chitin extraction from blue crab (Portunus segnis) and shrimp (Penaeus kerathurus) shells using digestive alkaline proteases from P. segnis viscera.

    Science.gov (United States)

    Hamdi, Marwa; Hammami, Amal; Hajji, Sawssen; Jridi, Mourad; Nasri, Moncef; Nasri, Rim

    2017-08-01

    Since chitin is closely associated with proteins, deproteinization is a crucial step in the process of extracting chitin. Thus, this research aimed to extract chitin from Portunus segnis and Penaeus kerathurus shells by means of crude digestive alkaline proteases from the viscera of P. segnis, regarding deproteinization step, as an alternative to chemical treatment. Casein zymography revealed that five caseinolytic proteases bands exist, suggesting the presence of at least five different major proteases. The optimum pH and temperature for protease activity were pH 8.0 and 60°C, respectively, using casein as a substrate. The crude enzymes extract was highly stable at low temperatures and over a wide range of pH from 6.0 to 12.0. The crude alkaline protease extract was found to be effective in the deproteinization of blue crab and shrimp shells, to produce chitin. The best efficiency in deproteinization (84.69±0.65% for blue crab shells and 91.06±1.40% for shrimp shells) was achieved with an E/S ratio of 5U/mg of proteins after 3h incubation at 50°C. These results suggest that enzymatic deproteinization of crab and shrimp wastes by fish endogenous alkaline proteases could be a potential alternative in the chitin production process. Copyright © 2017 Elsevier B.V. All rights reserved.

  14. Rapid Statistical Learning Supporting Word Extraction From Continuous Speech.

    Science.gov (United States)

    Batterink, Laura J

    2017-07-01

    The identification of words in continuous speech, known as speech segmentation, is a critical early step in language acquisition. This process is partially supported by statistical learning, the ability to extract patterns from the environment. Given that speech segmentation represents a potential bottleneck for language acquisition, patterns in speech may be extracted very rapidly, without extensive exposure. This hypothesis was examined by exposing participants to continuous speech streams composed of novel repeating nonsense words. Learning was measured on-line using a reaction time task. After merely one exposure to an embedded novel word, learners demonstrated significant learning effects, as revealed by faster responses to predictable than to unpredictable syllables. These results demonstrate that learners gained sensitivity to the statistical structure of unfamiliar speech on a very rapid timescale. This ability may play an essential role in early stages of language acquisition, allowing learners to rapidly identify word candidates and "break in" to an unfamiliar language.

  15. Selective extraction of alkaline phosphatase and 5'-nucleotidase from milk fat globule membranes by a single phase n-butanol procedure.

    Science.gov (United States)

    Ahn, Y S; Snow, L D

    1993-08-01

    A single phase extraction procedure employing 8% (v/v) n-butanol at room temperature extracted over 90% of alkaline phosphatase activity and over 60% of 5'-nucleotidase activity from bovine milk fat globule membranes (MFGM). For 5'-nucleotidase, higher n-butanol concentrations lead to loss of activity, while lower concentrations were ineffective in extracting the enzyme. When extractions were performed at 0 degrees C, similar yields were obtained for alkaline phosphatase extraction with 8% (v/v) n-butanol, but 5'-nucleotidase extraction required 10% (v/v) n-butanol for similar yields. However, 5'-nucleotidase was less susceptible to denaturation during extraction at 0 degrees C. The Km values and substrate specificities for both alkaline phosphatase and 5'-nucleotidase were unchanged by extraction with 8% (v/v) n-butanol. The 8% (v/v) n-butanol extraction procedure provides a 3-fold purification step, and an enzyme preparation suitable for further purification.

  16. A rapid DNA extraction method suitable for human papillomavirus detection.

    Science.gov (United States)

    Brestovac, Brian; Wong, Michelle E; Costantino, Paul S; Groth, David

    2014-04-01

    Infection with oncogenic human papillomavirus (HPV) genotypes is necessary for the development of cervical cancer. Testing for HPV DNA from liquid based cervical samples can be used as an adjunct to traditional cytological screening. In addition there are ongoing viral load, genotyping, and prevalence studies. Therefore, a sensitive DNA extraction method is needed to maximize the efficiency of HPV DNA detection. The XytXtract Tissue kit is a DNA extraction kit that is rapid and so could be useful for HPV testing, particularly in screening protocols. This study was undertaken to determine the suitability of this method for HPV detection. DNA extraction from HeLa and Caski cell lines containing HPV 18 and 16 respectively together with DNA from five liquid based cervical samples were used in a HPV PCR assay. DNA was also extracted using the QIAamp DNA mini kit (Qiagen, Hilden, Germany) as a comparison. DNA extracts were serially diluted and assayed. HPV DNA was successfully detected in cell lines and cervical samples using the XytXtract Tissue kit. In addition, the XytXtract method was found to be more sensitive than the QIAmp method as determined by a dilution series of the extracted DNA. While the XytXtract method is a closed, the QIAamp method uses a spin column with possible loss of DNA through DNA binding competition of the matrix, which could impact on the final extraction efficiency. The XytXtract is a cheap, rapid and efficient method for extracting HPV DNA from both cell lines and liquid based cervical samples. © 2014 Wiley Periodicals, Inc.

  17. Rapid extraction of aflatoxin from creamy and crunchy peanut butter.

    Science.gov (United States)

    Vega, Victor A

    2005-01-01

    A rapid extraction technique was developed for the isolation and subsequent liquid chromatographic determination of aflatoxins B1, B2, G1, and G2 in creamy and crunchy peanut butter. Peanut buftter samples were extracted with a methanol 15% sodium chloride (7 + 3) solution followed by a second extraction with methanol. The extract was subjected to a cleanup using a Vicam Aflatest immunoaffinity column. Control samples for both smooth and crunchy peanut butter were fortified at 4 different levels for aflatoxin B1, B2, G1, and G2. The average aflatoxin B1, B2, G1, and G2 recoveries from smooth peanut buffer were 95.2, 89.9, 94.1, and 62.4%, respectively, and 92.4, 84.3, 85.5, and 53.7%, respectively, from crunchy peanut butter. This extraction method and the official AOAC Method 991.31 produced comparable results for peanut butter samples. This method provides a rapid, specific, and easily controlled assay for the analysis of aflatoxins in peanut butter with minimal solvent usage. Organic solvent consumption was decreased by 85% and hazardous waste production was decreased by 80% in comparison with the AOAC method. Along with the decreased solvent consumption, significant savings in time were observed.

  18. Rapid automatic keyword extraction for information retrieval and analysis

    Science.gov (United States)

    Rose, Stuart J [Richland, WA; Cowley,; E, Wendy [Richland, WA; Crow, Vernon L [Richland, WA; Cramer, Nicholas O [Richland, WA

    2012-03-06

    Methods and systems for rapid automatic keyword extraction for information retrieval and analysis. Embodiments can include parsing words in an individual document by delimiters, stop words, or both in order to identify candidate keywords. Word scores for each word within the candidate keywords are then calculated based on a function of co-occurrence degree, co-occurrence frequency, or both. Based on a function of the word scores for words within the candidate keyword, a keyword score is calculated for each of the candidate keywords. A portion of the candidate keywords are then extracted as keywords based, at least in part, on the candidate keywords having the highest keyword scores.

  19. Preparing Silica Aerogel Monoliths via a Rapid Supercritical Extraction Method

    Science.gov (United States)

    Gorka, Caroline A.

    2014-01-01

    A procedure for the fabrication of monolithic silica aerogels in eight hours or less via a rapid supercritical extraction process is described. The procedure requires 15-20 min of preparation time, during which a liquid precursor mixture is prepared and poured into wells of a metal mold that is placed between the platens of a hydraulic hot press, followed by several hours of processing within the hot press. The precursor solution consists of a 1.0:12.0:3.6:3.5 x 10-3 molar ratio of tetramethylorthosilicate (TMOS):methanol:water:ammonia. In each well of the mold, a porous silica sol-gel matrix forms. As the temperature of the mold and its contents is increased, the pressure within the mold rises. After the temperature/pressure conditions surpass the supercritical point for the solvent within the pores of the matrix (in this case, a methanol/water mixture), the supercritical fluid is released, and monolithic aerogel remains within the wells of the mold. With the mold used in this procedure, cylindrical monoliths of 2.2 cm diameter and 1.9 cm height are produced. Aerogels formed by this rapid method have comparable properties (low bulk and skeletal density, high surface area, mesoporous morphology) to those prepared by other methods that involve either additional reaction steps or solvent extractions (lengthier processes that generate more chemical waste).The rapid supercritical extraction method can also be applied to the fabrication of aerogels based on other precursor recipes. PMID:24637334

  20. Rapid extraction and assay of uranium from environmental surface samples

    Energy Technology Data Exchange (ETDEWEB)

    Barrett, Christopher A.; Chouyyok, Wilaiwan; Speakman, Robert J.; Olsen, Khris B.; Addleman, Raymond Shane

    2017-10-01

    Extraction methods enabling faster removal and concentration of uranium compounds for improved trace and low-level assay are demonstrated for standard surface sampling material in support of nuclear safeguards efforts, health monitoring, and other nuclear analysis applications. A key problem with the existing surface sampling swipes is the requirement for complete digestion of sample and sampling matrix. This is a time-consuming and labour-intensive process that limits laboratory throughput, elevates costs, and increases background levels. Various extraction methods are explored for their potential to quickly and efficiently remove different chemical forms of uranium from standard surface sampling material. A combination of carbonate and peroxide solutions is shown to give the most rapid and complete form of uranyl compound extraction and dissolution. This rapid extraction process is demonstrated to be compatible with standard inductive coupled plasma mass spectrometry methods for uranium isotopic assay as well as screening techniques such as x-ray fluorescence. The general approach described has application beyond uranium to other analytes of nuclear forensic interest (e.g., rare earth elements and plutonium) as well as heavy metals for environmental and industrial hygiene monitoring.

  1. Alternative Alkaline Conditioning of Amidoxime Based Adsorbent for Uranium Extraction from Seawater

    Energy Technology Data Exchange (ETDEWEB)

    Das, S.; Liao, W. -P.; Flicker Byers, M.; Tsouris, C.; Janke, C. J.; Mayes, R. T.; Schneider, E.; Kuo, L. -J.; Wood, J. R.; Gill, G. A.; Dai, S.

    2016-04-20

    Alkaline conditioning of the amidoxime based adsorbents is a significant step in the preparation of the adsorbent for uranium uptake from seawater. The effects of various alkaline conditioning parameters such as the type of alkaline reagent, reaction temperature, and reaction time were investigated with respect to uranium adsorption capacity from simulated seawater (spiked with 8 ppm uranium) and natural seawater (from Sequim Bay, WA). An adsorbent (AF1) was prepared at the Oak Ridge National Laboratory by radiation-induced graft polymerization (RIGP) with acrylonitrile and itaconic acid onto high-surface-area polyethylene fibers. For the AF1 adsorbent, sodium hydroxide emerged as a better reagent for alkaline conditioning over potassium hydroxide, which has typically been used in previous studies, because of higher uranium uptake capacity and lower cost over the other candidate alkaline reagents investigated in this study. Use of sodium hydroxide in place of potassium hydroxide is shown to result in a 21-30% decrease in the cost of uranium recovery.

  2. Selective alkaline stripping of metal ions after solvent extraction by base-stable 1,2,3-triazolium ionic liquids.

    Science.gov (United States)

    Raiguel, Stijn; Depuydt, Daphne; Vander Hoogerstraete, Tom; Thomas, Joice; Dehaen, Wim; Binnemans, Koen

    2017-04-19

    Novel 1,2,3-triazolium ionic liquids with a high base stability were synthesized for use in solvent extraction of first-row transition elements and rare earths from chloride media. The synthesis of these ionic liquids makes use of a recently reported, metal-free multicomponent reaction that allows full substitution of the 1,2,3-triazolium skeleton. The physical and chemical properties of these ionic liquids are compared with those of a trisubstituted analog. Peralkylation of the 1,2,3-triazolium skeleton leads to ionic liquids with superior properties, such as low viscosity, low solubility in water and higher thermal and base stability. Iodide and thiocyanate ionic liquids with peralkylated cations were applied to the solvent extraction of metal ions, and their stability in alkaline media was exploited in the selective stripping of the metals from the loaded ionic liquid phase by alkaline solutions. EXAFS and Raman spectroscopy were performed to gain insight into the extraction mechanism. The applicability of these extraction systems was demonstrated in separations relevant for the recovery of metals from ores and end-of-life products: Fe(iii)/Cu(ii)/Zn(ii) (copper ores, brass scraps) and Fe(iii)/Nd(iii) (rare earth magnets).

  3. Digestive Alkaline Proteases from Zosterisessor ophiocephalus, Raja clavata, and Scorpaena scrofa: Characteristics and Application in Chitin Extraction

    Science.gov (United States)

    Nasri, Rim; Younes, Islem; Lassoued, Imen; Ghorbel, Sofiane; Ghorbel-Bellaaj, Olfa; Nasri, Moncef

    2011-01-01

    The aim of this work was to study some biochemical characteristics of crude alkaline protease extracts from the viscera of goby (Zosterisessor ophiocephalus), thornback ray (Raja clavata), and scorpionfish (Scorpaena scrofa), and to investigate their applications in the deproteinization of shrimp wastes. At least four caseinolytic proteases bands were observed in zymogram of each enzyme preparation. The optimum pH for enzymatic extracts activities of Z. ophiocephalus, R. clavata, and S. scrofa were 8.0-9.0, 8.0, and 10.0, respectively. Interestingly, all the enzyme preparations were highly stable over a wide range of pH from 6.0 to 11.0. The optimum temperatures for enzyme activity were 50°C for Z. ophiocephalus and R. clavata and 55°C for S. scrofa crude alkaline proteases. Proteolytic enzymes showed high stability towards non-ionic surfactants (5% Tween 20, Tween 80, and Triton X-100). In addition, crude proteases of S. scrofa, R. clavata, and Z. ophiocephalus were found to be highly stable towards oxidizing agents, retaining 100%, 70%, and 66%, respectively, of their initial activity after incubation for 1 h in the presence of 1% sodium perborate. They were, however, highly affected by the anionic surfactant SDS. The crude alkaline proteases were tested for the deproteinization of shrimp waste in the preparation of chitin. All proteases were found to be effective in the deproteinization of shrimp waste. The protein removals after 3 h of hydrolysis at 45°C with an enzyme/substrate ratio (E/S) of 10 were about 76%, 76%, and 80%, for Z. ophiocephalus, R. clavata, and S. scrofa crude proteases, respectively. These results suggest that enzymatic deproteinization of shrimp wastes by fish endogenous alkaline proteases could be applicable to the chitin production process. PMID:22312476

  4. Digestive Alkaline Proteases from Zosterisessor ophiocephalus, Raja clavata, and Scorpaena scrofa: Characteristics and Application in Chitin Extraction

    Directory of Open Access Journals (Sweden)

    Rim Nasri

    2011-01-01

    Full Text Available The aim of this work was to study some biochemical characteristics of crude alkaline protease extracts from the viscera of goby (Zosterisessor ophiocephalus, thornback ray (Raja clavata, and scorpionfish (Scorpaena scrofa, and to investigate their applications in the deproteinization of shrimp wastes. At least four caseinolytic proteases bands were observed in zymogram of each enzyme preparation. The optimum pH for enzymatic extracts activities of Z. ophiocephalus, R. clavata, and S. scrofa were 8.0-9.0, 8.0, and 10.0, respectively. Interestingly, all the enzyme preparations were highly stable over a wide range of pH from 6.0 to 11.0. The optimum temperatures for enzyme activity were 50∘C for Z. ophiocephalus and R. clavata and 55∘C for S. scrofa crude alkaline proteases. Proteolytic enzymes showed high stability towards non-ionic surfactants (5% Tween 20, Tween 80, and Triton X-100. In addition, crude proteases of S. scrofa, R. clavata, and Z. ophiocephalus were found to be highly stable towards oxidizing agents, retaining 100%, 70%, and 66%, respectively, of their initial activity after incubation for 1 h in the presence of 1% sodium perborate. They were, however, highly affected by the anionic surfactant SDS. The crude alkaline proteases were tested for the deproteinization of shrimp waste in the preparation of chitin. All proteases were found to be effective in the deproteinization of shrimp waste. The protein removals after 3 h of hydrolysis at 45∘C with an enzyme/substrate ratio (E/S of 10 were about 76%, 76%, and 80%, for Z. ophiocephalus, R. clavata, and S. scrofa crude proteases, respectively. These results suggest that enzymatic deproteinization of shrimp wastes by fish endogenous alkaline proteases could be applicable to the chitin production process.

  5. Rapid extraction and preservation of genomic DNA from human samples.

    Science.gov (United States)

    Kalyanasundaram, D; Kim, J-H; Yeo, W-H; Oh, K; Lee, K-H; Kim, M-H; Ryew, S-M; Ahn, S-G; Gao, D; Cangelosi, G A; Chung, J-H

    2013-02-01

    Simple and rapid extraction of human genomic DNA remains a bottleneck for genome analysis and disease diagnosis. Current methods using microfilters require cumbersome, multiple handling steps in part because salt conditions must be controlled for attraction and elution of DNA in porous silica. We report a novel extraction method of human genomic DNA from buccal swab and saliva samples. DNA is attracted onto a gold-coated microchip by an electric field and capillary action while the captured DNA is eluted by thermal heating at 70 °C. A prototype device was designed to handle four microchips, and a compatible protocol was developed. The extracted DNA using microchips was characterized by qPCR for different sample volumes, using different lengths of PCR amplicon, and nuclear and mitochondrial genes. In comparison with a commercial kit, an equivalent yield of DNA extraction was achieved with fewer steps. Room-temperature preservation for 1 month was demonstrated for captured DNA, facilitating straightforward collection, delivery, and handling of genomic DNA in an environment-friendly protocol.

  6. Recovery of zinc and manganese from spent alkaline batteries by liquid-liquid extraction with Cyanex 272

    Science.gov (United States)

    Salgado, Aline L.; Veloso, Aline M. O.; Pereira, Daniel D.; Gontijo, Glayson S.; Salum, Adriane; Mansur, Marcelo B.

    A hydrometallurgical route based on the liquid-liquid extraction technique using Cyanex 272 as extractant is investigated for the selective separation of metal values, in particular, zinc and manganese from spent alkaline batteries. The recycling route consists of following steps: (1) cryogenic dismantling of the spent batteries, (2) pre-treatment of the internal material consisting of drying, grinding and screening steps in order to produce a dry homogeneous powder, (3) leaching of the powder with sulphuric acid and (4) metal separation by liquid-liquid extraction. Bench scale experiments have shown that zinc and manganese are easily separated (ΔpH 1/2≈2.0) using 20% (v/v) Cyanex 272 dissolved in Escaid 110 at 50 °C. Therefore, the proposed route can treat residues from both zinc-carbon and alkaline batteries because metal composition of these batteries is quite similar. The metal content of other batteries such as Ni-Cd and nickel-metal hydride (NiMH) has been also determined in order to include them in future investigations.

  7. Use of solid phase extraction for the sequential injection determination of alkaline phosphatase activity in dynamic water systems.

    Science.gov (United States)

    Santos, Inês C; Mesquita, Raquel B R; Bordalo, Adriano A; Rangel, António O S S

    2012-08-30

    In this work, a solid phase extraction sequential injection methodology for the determination of alkaline phosphatase activity in dynamic water systems was developed. The determination of the enzymatic activity was based on the spectrophotometric detection of a coloured product, p-nitrophenol, at 405 nm. The p-nitrophenol is the product of the catalytic decomposition of p-nitrophenyl phosphate, a non-coloured substrate. Considering the low levels expected in natural waters and exploiting the fact of alkaline phosphatase being a metalloprotein, the enzyme was pre-concentrated in-line using a NTA Superflow resin charged with Zn(2+) ions. The developed sequential injection method enabled a quantification range of 0.044-0.441 unit mL(-1) of enzyme activity with a detection limit of 0.0082 unit mL(-1) enzyme activity (1.9 μmol L(-1) of pNP) and a determination rate of 17 h(-1). Recovery tests confirmed the accuracy of the developed sequential injection method and it was effectively applied to different natural waters and to plant root extracts. Copyright © 2012 Elsevier B.V. All rights reserved.

  8. Potential of hot water extraction of birch wood to produce high-purity dissolving pulp after alkaline pulping.

    Science.gov (United States)

    Borrega, Marc; Tolonen, Lasse K; Bardot, Fanny; Testova, Lidia; Sixta, Herbert

    2013-05-01

    The potential of hot water extraction of birch wood to produce highly purified dissolving pulp in a subsequent soda-anthraquinone pulping process was evaluated. After intermediate extraction intensities, pulps with low xylan content (3-5%) and high cellulose yield were successfully produced. Increasing extraction intensity further decreased the xylan content in pulp. However, below a xylan content of 3%, the cellulose yield dramatically decreased. This is believed to be due to cleavage of glycosidic bonds in cellulose during severe hot water extractions, followed by peeling reactions during alkaline pulping. Addition of sodium borohydride as well as increased anthraquinone concentration in the pulping liquor increased the cellulose yield, but had no clear effects on pulp purity and viscosity. The low intrinsic viscosity of pulps produced after severe extraction intensities and soda-anthraquinone pulping corresponded to the viscosity at the leveling-off degree of polymerization, suggesting that nearly all amorphous cellulose had been degraded. Copyright © 2012 Elsevier Ltd. All rights reserved.

  9. Corrosion inhibition performance of different bark extracts on aluminium in alkaline solution

    Directory of Open Access Journals (Sweden)

    Namrata Chaubey

    2017-02-01

    Full Text Available The present work shows the effect of stem bark extracts of three trees namely Moringa oleifera (MO, Terminalia arjuna (TA and Mangifera indica (MI on the corrosion behaviour of Aluminium Alloy (AA in 1 M NaOH. The inhibition performance was studied by using gravimetric, potentiodynamic polarization and electrochemical impedance spectroscopy (EIS measurements. Among these extracts, MO exhibited the maximum inhibition efficiency η (% of 85.3% at 0.6 g/L at 303 K. Polarization measurement showed that all the examined extracts are of mixed-type inhibitors. Langmuir’s adsorption isotherm was found to be best fit. Morphology of the surface was examined by scanning electron microscopy (SEM and atomic force microscopy (AFM which confirmed the existence of a protective film of inhibitor molecule on AA surface.

  10. EFFECT OF TEMPERATURE AND PARTICLE SIZE ON THE ALKALINE EXTRACTION OF PROTEIN FROM CHICKEN BONE WASTE

    Directory of Open Access Journals (Sweden)

    Andri Cahyo Kumoro

    2012-02-01

    Full Text Available Chicken bone is a waste of chicken meat processing industry and restaurants that has not been used widely, even though it contains valuable organic compounds that are functionals, such as collagenous and non collagenous protein. This research was conducted to investigate the effect of temperature and particle size on the protein extraction from chicken bones using dilute sodium hydroxide solution. Controlled parameters in this study were the solvent in the form of sodium hydroxide solution, extraction time for 1 hour, pH 10.5, the ratio of chicken bone powder: solvent (1:4 w/v, and stirring speed 200 rpm. While the operating variables included the extraction temperature of 30oC, 55oC, and 80oC, and particle size of 150 and 250 μm. Experiments were carried out by heating of 300 mL of sodium hydroxide solution with pH 10.5 in a three-necked flask equipped with Leibig condenser, thermometer, mechanical agitator and sampling device to reach the desired temperature (30oC, 55oC, and 80oC. Then, a total of 75 g of chicken bone powders with desired particle size (150μm and 250μm was introduced into the sodium hydroxide solution and the stirrer was operated at speed of 200rpm. At every 10 minutes interval, as much as 10 mL samples were withdrawn for total protein analysis using Lowry-Folin method. The experiment was terminated after 1 hour. The results show that both increase in temperature and particle size caused an increase in the amount of extracted protein. Highest concentration of protein extracted was achieved at 630.99 mg/L, when the extraction was carried out using 250mm bone particles and temperature 80oC.

  11. A comparison between alkaline and decomplexing reagents to extract humic acids from low rank coals

    Energy Technology Data Exchange (ETDEWEB)

    Garcia, D.; Cegarra, J.; Abad, M. [CSIC, Madrid (Spain). Centro de Edafologia y Biologia Aplicada del Segura

    1996-07-01

    Humic acids (HAs) were obtained from two low rank coals (lignite and leonardite) by using either alkali extractants (0.1 M NaOH, 0.1 M KOH or 0.25 M KOH) or solutions containing Na{sub 4}P{sub 2}O{sub 7} (0.1 M Na{sub 4}P{sub 2}O{sub 7} or 0.1 M NaOH/Na{sub 4}P{sub 2}O{sub 7}). In both coals, the greatest yields were obtained with 0.25 M KOH and the lowest with the 0.1 M alkalis, whereas the extractions based on Na{sub 4}P{sub 2}O{sub 7} yielded intermediate values and were more effective on the lignite. Chemical analysis showed that the leonardite HAs consisted of molecules that were less oxidized and had fewer functional groups than the HAs released form the lignite. Moreover, the HAs extracted by reagents containing Na{sub 4}P{sub 2}O{sub 7} exhibited more functional groups than those extracted with alkali, this effect being more apparent in lignite because of its greater cation exchange capacity. Gel permeation chromatography indicated that the leonardite HAs contained a greater proportion of higher molecular size compounds than the lignite HAs, and that both solutions containing Na{sub 4}P{sub 2}O{sub 7} released HAs with a greater proportion of smaller molecular compounds from the lignite than did the alkali extractants. 16 refs., 3 figs., 2 tabs.

  12. Chemical Composition and Some Functional Properties of Beef Lung Protein Concentrate Extracted by Alkaline Method

    Directory of Open Access Journals (Sweden)

    Khotibul Umam Al Awwaly

    2017-03-01

    Full Text Available This research was carried out to examine the functional properties of beef lung protein concentrates. The extraction was performed as a function of pH and time. The pI method was applied in the precipitation of proteins from beef lung. Beef lung protein concentrates contained 85.13% protein. The functional properties of the protein concentrates were compared to those of some commercial ingredients as whey protein concentrates, and casein. Protein from beef lung exhibited better foaming property than casein and better emulsifying property than whey protein. The use of beef lung proteins appears to be an interesting opportunity to obtain added value slaughterhouse by-products.

  13. A comparative study of leaves extracts for corrosion inhibition effect on aluminium alloy in alkaline medium

    Directory of Open Access Journals (Sweden)

    Namrata Chaubey

    2017-12-01

    Full Text Available This paper deals with the comparative inhibition study of some plants leaves extract namely Cannabis sativa (CS, Rauwolfia serpentina (RS, Cymbopogon citratus (CC, Annona squamosa (AS and Adhatoda vasica (AV on the corrosion of aluminium alloy (AA in 1 M NaOH. The corrosion tests were performance by using gravimetric, electrochemical impedance spectroscopy (EIS, potentiodynamic polarization and linear polarization resistance (LPR techniques. RS showed maximum inhibition efficiency (η%, 97% at 0.2 g L−1. Potentiodynamic polarization curves justified that all the inhibitors are mixed-type. Surface morphology of AA is carried by scanning electron microscopy (SEM and atomic force microscopy (AFM.

  14. Evaluation of an alkaline-side solvent extraction process for cesium removal from SRS tank waste using laboratory-scale centrifugal contactors

    Energy Technology Data Exchange (ETDEWEB)

    Leonard, R. A.; Conner, C.; Liberatore, M. W.; Sedlet, J.; Aase, S. B.; Vandegrift, G. F.

    1999-11-29

    An alkaline-side solvent extraction process for cesium removal from Savannah River Site (SRS) tank waste was evaluated experimentally using a laboratory-scale centrifugal contactor. Single-stage and multistage tests were conducted with this contactor to determine hydraulic performance, stage efficiency, and general operability of the process flowsheet. The results and conclusions of these tests are reported along with those from various supporting tests. Also discussed is the ability to scale-up from laboratory- to plant-scale operation when centrifugal contractors are used to carry out the solvent extraction process. While some problems were encountered, a promising solution for each problem has been identified. Overall, this alkaline-side cesium extraction process appears to be an excellent candidate for removing cesium from SRS tank waste.

  15. Rapid total sulphur reduction in coal samples using various dilute alkaline leaching reagents under microwave heating: preventing sulphur emissions during coal processing.

    Science.gov (United States)

    Mketo, Nomvano; Nomngongo, Philiswa Nosizo; Ngila, Jane Catherine

    2017-08-01

    Currently in South Africa, online flue gas desulphurisation (FGD) is being utilized as one of the most effective methods for total sulphur reduction in coal samples during the combustion process. However, the main disadvantage associated with FGD is the formation of its by-products (FGD gypsum). The latter is mostly formed in low grade quality, thereby bringing secondary pollution problems and extra disposal costs. Therefore, the current study describes the development of total sulphur extraction in coal under microwave heating using different dilute alkaline solutions such as NaOH, NaOH-H2O2, NH4OH, and NH4OH-H2O2. The experimental conditions were as follows: 150 °C, 5 min and 10% (m/v or v/v) for temperature, extraction time and reagent concentration, respectively. The most effective alkaline reagent for coal desulphurisation was observed to be NaOH-H2O2 with total sulphur reduction of 55% (from the inductively coupled plasma-optical emission spectrometry (ICP-OES) results). The NaOH-H2O2 reagent also showed significant morphological changes in coal as observed from the SEM images and effective demineralisation as revealed by the powder X-ray diffractometer (P-XRD) results. Additionally, desulphurisation results obtained from the developed microwave-assisted dilute alkaline extraction (MW-ADAE) method were quite comparable with the published work. The proposed total sulphur reduction method is advantageous as compared to some of the literature reported coal desulphurisation methods as it requires a short period (5 min) of time to reach its completion. Additionally, the proposed method shows excellent reproducibility (% RSD from 0.5 to 1); therefore, it can be utilized for routine analysis. Graphical abstract ᅟ.

  16. Rapid DNA extraction of bacterial genome using laundry detergents ...

    African Journals Online (AJOL)

    Genomic DNA extraction from bacterial cells involves processes normally performed in most biological laboratories. Therefore, various methods have been offered, manually and kit, but these methods may be time consuming and costly. In this paper, genomic DNA extraction of Pseudomonas aeruginosa was investigated ...

  17. Anti-Halitosis Effect of Toothpaste Supplemented with Alkaline Extract of the Leaves of Sasa senanensis Rehder.

    Science.gov (United States)

    Sakagami, Hiroshi; Sheng, Hong; Ono, Koki; Komine, Yusuke; Miyadai, Tomoharu; Terada, Yuji; Nakada, Daisuke; Tanaka, Shoji; Matsumoto, Masaru; Yasui, Toshikazu; Watanabe, Koichi; Junye, Jia; Natori, Takenori; Suguro-Kitajima, Madoka; Oizumi, Hiroshi; Oizumi, Takaaki

    2016-01-01

    Previous studies have shown activity against viruses, bacteria, inflammation and oral lichenoid dysplasia of alkaline extract of the leaves of Sasa senanensis Rehder (SE), suggesting its possible application to oral diseases. In the present study, we performed a small-scale clinical test to investigate whether SE is effective against halitosis and in oral bacterial reduction. A total of 12 volunteers participated in this study. They brushed their teeth immediately after meals three times each day with SE-containing toothpaste (SETP) or placebo toothpaste. Halitosis in the breath and bacterial number on the tongue were measured by commercially available portable apparatuses at a specified time in the morning. Some relationship was observed between halitosis and bacterial number from each individual, especially when those with severe halitosis were included. Repeated experiments demonstrated that SETP significantly reduced halitosis but not the bacterial number on the tongue. The present study provides for the first time the basis for anti-halitosis activity of SE. Copyright © 2016 International Institute of Anticancer Research (Dr. John G. Delinassios), All rights reserved.

  18. Rapid metal extractability tests from polluted mining soils by ultrasound probe sonication and microwave-assisted extraction systems.

    Science.gov (United States)

    García-Salgado, Sara; Quijano, M Ángeles

    2016-12-01

    Ultrasonic probe sonication (UPS) and microwave-assisted extraction (MAE) were used for rapid single extraction of Cd, Cr, Cu, Ni, Pb, and Zn from soils polluted by former mining activities (Mónica Mine, Bustarviejo, NW Madrid, Spain), using 0.01 mol L-1 calcium chloride (CaCl2), 0.43 mol L-1 acetic acid (CH3COOH), and 0.05 mol L-1 ethylenediaminetetraacetic acid (EDTA) at pH 7 as extracting agents. The optimum extraction conditions by UPS consisted of an extraction time of 2 min for both CaCl2 and EDTA extractions and 15 min for CH3COOH extraction, at 30% ultrasound (US) amplitude, whereas in the case of MAE, they consisted of 5 min at 50 °C for both CaCl2 and EDTA extractions and 15 min at 120 °C for CH3COOH extraction. Extractable concentrations were determined by inductively coupled plasma atomic emission spectrometry (ICP-AES). The proposed methods were compared with a reduced version of the corresponding single extraction procedures proposed by the Standards, Measurements and Testing Programme (SM&T). The results obtained showed a great variability on extraction percentages, depending on the metal, the total concentration level and the soil sample, reaching high values in some areas. However, the correlation analysis showed that total concentration is the most relevant factor for element extractability in these soil samples. From the results obtained, the application of the accelerated extraction procedures, such as MAE and UPS, could be considered a useful approach to evaluate rapidly the extractability of the metals studied.

  19. Rapid new methods for paint collection and lead extraction.

    Science.gov (United States)

    Gutknecht, William F; Harper, Sharon L; Winstead, Wayne; Sorrell, Kristen; Binstock, David A; Salmons, Cynthia A; Haas, Curtis; McCombs, Michelle; Studabaker, William; Wall, Constance V; Moore, Curtis

    2009-01-01

    Chronic exposure of children to lead can result in permanent physiological impairment. In adults, it can cause irritability, poor muscle coordination, and nerve damage to the sense organs and nerves controlling the body. Surfaces coated with lead-containing paints are potential sources of exposure to lead. In April 2008, the U.S. Environmental Protection Agency (EPA) finalized new requirements that would reduce exposure to lead hazards created by renovation, repair, and painting activities, which disturb lead-based paint. On-site, inexpensive identification of lead-based paint is required. Two steps have been taken to meet this challenge. First, this paper presents a new, highly efficient method for paint collection that is based on the use of a modified wood drill bit. Second, this paper presents a novel, one-step approach for quantitatively grinding and extracting lead from paint samples for subsequent lead determination. This latter method is based on the use of a high-revolutions per minute rotor with stator to break up the paint into approximately 50 micron-size particles. Nitric acid (25%, v/v) is used to extract the lead in 95% for real-world paints, National Institute of Standards and Technology's standard reference materials, and audit samples from the American Industrial Hygiene Association's Environmental Lead Proficiency Analytical Testing Program. This quantitative extraction procedure, when paired with quantitative paint sample collection and lead determination, may enable the development of a lead paint test kit that will meet the specifications of the final EPA rule.

  20. Studies on the kinetics and equilibrium of the solvent extraction of chromium(III) from alkaline aqueous solutions of different composition in the system with Aliquat 336.

    Science.gov (United States)

    Wionczyk, Barbara; Cierpiszewski, Ryszard; Mól, Anna; Prochaska, Krystyna

    2011-12-30

    The kinetics and equilibrium of Cr(III) extraction with Aliquat 336 from the alkaline aqueous solutions containing anions of various complexing abilities and solvating properties, as: nitrates, or perchlorates, or sulphates, were studied and interpreted. Stoichiometry of Cr(III) complexes formed in the organic phases was also discussed. It was found that under the same conditions the yield and the rate of Cr(III) extraction as well as values of mass transfer coefficient increase in the following order of anions: perchloratesextraction of Cr(III) in the systems with nitrates and/or perchlorates differs significantly from that one established for the extraction of Cr(III) from the alkaline aqueous solutions of sulphates. Experiments with the modified Lewis cell and analysis of the experimental data by mathematic models appeared that the studied extraction of Cr(III) occurs in the mixed diffusion-kinetic regime, irrespective of the kind of anions present in the aqueous phase. Copyright © 2011 Elsevier B.V. All rights reserved.

  1. Electromembrane extraction as a rapid and selective miniaturized sample preparation technique for biological fluids

    DEFF Research Database (Denmark)

    Gjelstad, Astrid; Pedersen-Bjergaard, Stig; Seip, Knut Fredrik

    2015-01-01

    of organic solvent, and into an aqueous receiver solution. The extraction is promoted by application of an electrical field, causing electrokinetic migration of the charged analytes. The method has shown to perform excellent clean-up and selectivity from complicated aqueous matrices like biological fluids......This special report discusses the sample preparation method electromembrane extraction, which was introduced in 2006 as a rapid and selective miniaturized extraction method. The extraction principle is based on isolation of charged analytes extracted from an aqueous sample, across a thin film...

  2. Furuncular myiasis: a simple and rapid method for extraction of intact Dermatobia hominis larvae.

    Science.gov (United States)

    Boggild, Andrea K; Keystone, Jay S; Kain, Kevin C

    2002-08-01

    We report a case of furuncular myiasis complicated by Staphylococcus aureus infection and beta-hemolytic streptococcal cellulitis. The Dermatobia hominis larva that caused this lesion could not be extracted using standard methods, including suffocation and application of lateral pressure, and surgery was contraindicated because of cellulitis. The botfly maggot was completely and rapidly extracted with an inexpensive, disposable, commercial venom extractor.

  3. Rapid start-up of a bioelectrochemical system under alkaline and saline conditions for efficient oxalate removal.

    Science.gov (United States)

    Weerasinghe Mohottige, Tharanga N; Ginige, Maneesha P; Kaksonen, Anna H; Sarukkalige, Ranjan; Cheng, Ka Yu

    2017-11-07

    This study examined a new approach for starting up a bioelectrochemical system (BES) for oxalate removal from an alkaline (pH > 12) and saline (NaCl 25 g/L) liquor. An oxalotrophic biofilm pre-grown aerobically onto granular graphite carriers was used directly as both the microbial inoculum and the BES anode. At anode potential of +200 mV (Ag/AgCl) the biofilm readily switched from using oxygen to graphite as sole electron acceptor for oxalate oxidation. BES performance was characterised at various hydraulic retention times (HRTs, 3-24 h), anode potentials (-600 to +200 mV vs. Ag/AgCl) and influent oxalate (25 mM) to acetate (0-30 mM) ratios. Maximum current density recorded was 363 A/m3 at 3 h HRT with a high coulombic efficiency (CE) of 70%. The biofilm could concurrently degrade acetate and oxalate (CE 80%) without apparent preference towards acetate. Pyro-sequencing analysis revealed that known oxalate degraders Oxalobacteraceae became abundant signifying their role in this novel bioprocess. Copyright © 2017 Elsevier Ltd. All rights reserved.

  4. Sequential injection analysis with chemiluminescence detection for rapid monitoring of commercial Calendula officinalis extractions.

    Science.gov (United States)

    Hughes, Rachel R; Scown, David; Lenehan, Claire E

    2015-01-01

    Plant extracts containing high levels of antioxidants are desirable due to their reported health benefits. Most techniques capable of determining the antioxidant activity of plant extracts are unsuitable for rapid at-line analysis as they require extensive sample preparation and/or long analysis times. Therefore, analytical techniques capable of real-time or pseudo real-time at-line monitoring of plant extractions, and determination of extraction endpoints, would be useful to manufacturers of antioxidant-rich plant extracts. To develop a reliable method for the rapid at-line extraction monitoring of antioxidants in plant extracts. Calendula officinalis extracts were prepared from dried flowers and analysed for antioxidant activity using sequential injection analysis (SIA) with chemiluminescence (CL) detection. The intensity of CL emission from the reaction of acidic potassium permanganate with antioxidants within the extract was used as the analytical signal. The SIA-CL method was applied to monitor the extraction of C. officinalis over the course of a batch extraction to determine the extraction endpoint. Results were compared with those from ultra high performance liquid chromatography (UHPLC). Pseudo real-time, at-line monitoring showed the level of antioxidants in a batch extract of Calendula officinalis plateaued after 100 min of extraction. These results correlated well with those of an offline UHPLC study. SIA-CL was found to be a suitable method for pseudo real-time monitoring of plant extractions and determination of extraction endpoints with respect to antioxidant concentrations. The method was applied at-line in the manufacturing industry. Copyright © 2015 John Wiley & Sons, Ltd.

  5. Structure and antitumor activity of a branched (1----3)-beta-D-glucan from the alkaline extract of Amanita muscaria.

    Science.gov (United States)

    Kiho, T; Katsuragawa, M; Nagai, K; Ukai, S; Haga, M

    1992-02-07

    A beta-(1----6)-branched (1----3)-beta-D-glucan(AM-ASN) was isolated from the alkaline extract of the fruiting bodies of Amanita muscaria. AM-ASN had [alpha]D - 11 degrees in 0.5 M sodium hydroxide. Its estimated molecular weight was 95,000 in this alkaline solution and 260,000 in a neutral solution. The branches in the glucan were primarily single, (1----6)-linked D-glucopyranosyl groups, two for every seven residues in the (1----3)-linked main chain. AM-ASN exhibited significant antitumor activity against Sarcoma 180 in mice, and a mixture of AM-ASN with mitomycin C was more effective against the tumor than mitomycin C only.

  6. The application of alkaline lysis and pressure cycling technology in the differential extraction of DNA from sperm and epithelial cells recovered from cotton swabs.

    Science.gov (United States)

    Nori, Deepthi V; McCord, Bruce R

    2015-09-01

    This study reports the development of a two-step protocol using pressure cycling technology (PCT) and alkaline lysis for differential extraction of DNA from mixtures of sperm and vaginal epithelial cells recovered from cotton swabs. In controlled experiments, in which equal quantities of sperm and female epithelial cells were added to cotton swabs, 5 min of pressure pulsing in the presence of 0.4 M NaOH resulted in 104 ± 6% recovery of female epithelial DNA present on the swab. Following the pressure treatment, exposing the swabs to a second 5-min alkaline treatment at 95 °C without pressure resulted in the selective recovery of 69 ± 6% of the sperm DNA. The recovery of the vaginal epithelia and sperm DNA was optimized by examining the effect of sodium hydroxide concentration, incubation temperature, and time. Following the alkaline lysis steps, the samples were neutralized with 2 M Tris (pH 7.5) and purified with phenol-chloroform-isoamyl alcohol to permit downstream analysis. The total processing time to remove both fractions from the swab was less than 20 min. Short tandem repeat (STR) analysis of these fractions obtained from PCT treatment and alkaline lysis generated clean profiles of female epithelial DNA and male sperm DNA for 1:1 mixtures of female and male cells and predominant male profiles for mixtures up to 5:1 female to male cells. By reducing the time and increasing the recovery of DNA from cotton swabs, this new method presents a novel and potentially useful procedure for forensic differential extractions.

  7. Rapid Solid-Liquid Dynamic Extraction (RSLDE): a New Rapid and Greener Method for Extracting Two Steviol Glycosides (Stevioside and Rebaudioside A) from Stevia Leaves.

    Science.gov (United States)

    Gallo, Monica; Vitulano, Manuela; Andolfi, Anna; DellaGreca, Marina; Conte, Esterina; Ciaravolo, Martina; Naviglio, Daniele

    2017-06-01

    Stevioside and rebaudioside A are the main diterpene glycosides present in the leaves of the Stevia rebaudiana plant, which is used in the production of foods and low-calorie beverages. The difficulties associated with their extraction and purification are currently a problem for the food processing industries. The objective of this study was to develop an effective and economically viable method to obtain a high-quality product while trying to overcome the disadvantages derived from the conventional transformation processes. For this reason, extractions were carried out using a conventional maceration (CM) and a cyclically pressurized extraction known as rapid solid-liquid dynamic extraction (RSLDE) by the Naviglio extractor (NE). After only 20 min of extraction using the NE, a quantity of rebaudioside A and stevioside equal to 1197.8 and 413.6 mg/L was obtained, respectively, while for the CM, the optimum time was 90 min. From the results, it can be stated that the extraction process by NE and its subsequent purification developed in this study is a simple, economical, environmentally friendly method for producing steviol glycosides. Therefore, this method constitutes a valid alternative to conventional extraction by reducing the extraction time and the consumption of toxic solvents and favouring the use of the extracted metabolites as food additives and/or nutraceuticals. As an added value and of local interest, the experiment was carried out on stevia leaves from the Benevento area (Italy), where a high content of rebaudioside A was observed, which exhibits a sweet taste compared to stevioside, which has a significant bitter aftertaste.

  8. A rapid direct solvent extraction method for the extraction of 2-dodecylcyclobutanone from irradiated ground beef patties using acetonitrile.

    Science.gov (United States)

    Hijaz, Faraj; Kumar, Amit; Smith, J Scott

    2010-08-01

    The amount of irradiated beef in the U.S. market is growing, and a reliable, rapid method is needed to detect irradiated beef and quantify the irradiation dose. The official analytical method (BS EN 1785 2003) that has been adopted by the European Union is time consuming. The objective of this study was to develop a rapid method for the analysis of 2-dodecylcyclobutanone (2-DCB) in irradiated beef. A 5 g sample of commercially irradiated ground beef patty (90/10) was extracted with n-hexane using a Soxhlet apparatus or with acetonitrile via direct solvent extraction. The Soxhlet hexane extract was evaporated to dryness, and the sample was dissolved in a mixture of ethyl acetate and acetonitrile (1:1). The defatted extract was purified with a 1 g silica cartridge. Another 5 g aliquot of the same patty was mixed with 50 mL acetonitrile and either blended for 1 min with a hand blender or crushed for 10 min with a glass rod. The extraction procedure was repeated 3 times, and the acetonitrile was collected and evaporated to dryness. Eluants from both methods were concentrated under nitrogen and injected into a gas chromatography-mass spectrometry. The 2-DCB concentration in the commercial samples was 0.031 +/- 0.0026 ppm (n = 5) for the Soxhlet method and 0.031 +/- 0.0025 ppm (n = 10) for direct solvent extraction. Recovery of 2-DCB from spiked beef samples in the direct solvent extraction method was 93.2 +/- 9.0% (n = 7). This study showed that the direct solvent extraction method is simple and as efficient and reproducible as the Soxhlet method.

  9. Evaluation of antimicrobial activity of selected plant extracts by rapid XTT colorimetry and bacterial enumeration.

    Science.gov (United States)

    Al-Bakri, Amal G; Afifi, Fatma U

    2007-01-01

    The aim of this study was to screen and evaluate the antimicrobial activity of indigenous Jordanian plant extracts, dissolved in dimethylsulfoxide, using the rapid XTT assay and viable count methods. XTT rapid assay was used for the initial screening of antimicrobial activity for the plant extracts. Antimicrobial activity of potentially active plant extracts was further assessed using the "viable plate count" method. Four degrees of antimicrobial activity (high, moderate, weak and inactive) against Bacillus subtilis, Staphylococcus aureus, Escherichia coli and Pseudomonas aeruginosa, respectively, were recorded. The plant extracts of Hypericum triquetrifolium, Ballota undulata, Ruta chalepensis, Ononis natrix, Paronychia argentea and Marrubium vulgare had shown promising antimicrobial activity. This study showed that while both XTT and viable count methods are comparable when estimating the overall antimicrobial activity of experimental substances, there is no strong linear correlation between the two methods.

  10. Parasitic slow extraction of extremely weak beam from a high-intensity proton rapid cycling synchrotron

    Energy Technology Data Exchange (ETDEWEB)

    Zou, Ye [University of Science and Technology of China, Hefei, Anhui 230029 (China); Institute of High Energy Physics, CAS, Yuquan Road 19B, Beijing 100049 (China); Tang, Jingyu, E-mail: tangjy@ihep.ac.cn [University of Science and Technology of China, Hefei, Anhui 230029 (China); Institute of High Energy Physics, CAS, Yuquan Road 19B, Beijing 100049 (China); Yang, Zheng; Jing, Hantao [Institute of High Energy Physics, CAS, Yuquan Road 19B, Beijing 100049 (China)

    2014-02-11

    This paper proposes a novel method to extract extremely weak beam from a high-intensity proton rapid cycling synchrotron (RCS) in the parasitic mode, while maintaining the normal fast extraction. The usual slow extraction method from a synchrotron by employing third-order resonance cannot be applied in a high-intensity RCS due to a very short flat-top at the extraction energy and the strict control on beam loss. The proposed parasitic slow extraction method moves the beam to scrape a scattering foil prior to the fast beam extraction by employing either a local orbit bump or momentum deviation or their combination, so that the halo part of the beam will be scattered. A part of the scattered particles will be extracted from the RCS and guided to the experimental area. The slow extraction process can last about a few milliseconds before the beam is extracted by the fast extraction system. The method has been applied to the RCS of China Spallation Neutron Source. With 1.6 GeV in the extraction energy, 62.5 μA in the average current and 25 Hz in the repetition rate for the RCS, the proton intensity by the slow extraction method can be up to 2×10{sup 4} protons per cycle or 5×10{sup 5} protons per second. The extracted beam has also a good time structure of approximately uniform in a spill which is required for many applications such as detector tests. Detailed studies including the scattering effect in the foil, the local orbit bump by the bump magnets and dispersive orbit bump by modifying the RF pattern, the multi-particle simulations by ORBIT and TURTLE codes, and some technical features for the extraction magnets are presented.

  11. Seed oil polyphenols: rapid and sensitive extraction method and high resolution-mass spectrometry identification.

    Science.gov (United States)

    Koubaa, Mohamed; Mhemdi, Houcine; Vorobiev, Eugène

    2015-05-01

    Phenolic content is a primary parameter for vegetables oil quality evaluation, and directly involved in the prevention of oxidation and oil preservation. Several methods have been reported in the literature for polyphenols extraction from seed oil but the approaches commonly used remain manually handled. In this work, we propose a rapid and sensitive method for seed oil polyphenols extraction and identification. For this purpose, polyphenols were extracted from Opuntia stricta Haw seed oil, using high frequency agitation, separated, and then identified using a liquid chromatography-high resolution mass spectrometry method. Our results showed good sensitivity and reproducibility of the developed methods. Copyright © 2015 Elsevier Inc. All rights reserved.

  12. Rapid and reliable extraction of genomic DNA from various wild-type and transgenic plants

    Directory of Open Access Journals (Sweden)

    Yang Moon-Sik

    2004-09-01

    Full Text Available Abstract Background DNA extraction methods for PCR-quality DNA from calluses and plants are not time efficient, since they require that the tissues be ground in liquid nitrogen, followed by precipitation of the DNA pellet in ethanol, washing and drying the pellet, etc. The need for a rapid and simple procedure is urgent, especially when hundreds of samples need to be analyzed. Here, we describe a simple and efficient method of isolating high-quality genomic DNA for PCR amplification and enzyme digestion from calluses, various wild-type and transgenic plants. Results We developed new rapid and reliable genomic DNA extraction method. With our developed method, plant genomic DNA extraction could be performed within 30 min. The method was as follows. Plant tissue was homogenized with salt DNA extraction buffer using hand-operated homogenizer and extracted by phenol:chloroform:isoamyl alcohol (25:24:1. After centrifugation, the supernatant was directly used for DNA template for PCR, resulting in successful amplification for RAPD from various sources of plants and specific foreign genes from transgenic plants. After precipitating the supernatant, the DNA was completely digested by restriction enzymes. Conclusion This DNA extraction procedure promises simplicity, speed, and efficiency, both in terms of time and the amount of plant sample required. In addition, this method does not require expensive facilities for plant genomic DNA extraction.

  13. Conversion of human placental alkaline phosphatase from a high Mr form to a low Mr form during butanol extraction. An investigation of the role of endogenous phosphoinositide-specific phospholipases.

    OpenAIRE

    Malik, A. S.; Low, M G

    1986-01-01

    Alkaline phosphatase in a wide range of tissues has been shown to be anchored in the membrane by a specific interaction with the polar head group of phosphatidylinositol. It has previously been suggested that the production of low Mr alkaline phosphatase during the commonly used butanol extraction procedure may result from the activation of an endogenous phosphoinositide-specific phospholipase C which removes the 1,2-diacylglycerol responsible for membrane anchoring. This conversion process w...

  14. Managing the social impacts of the rapidly-expanding extractive industries in Greenland

    NARCIS (Netherlands)

    Hansen, Anne Merrild; Vanclay, Frank; Croal, Peter; Skjervedal, Anna Sofie Hurup

    2016-01-01

    The recent rapid expansion of extractive industries in Greenland is both causing high hopes for the future and anxieties among the local population. In the Arctic context, even small projects carry risks of major social impacts at local and national scales, and have the potential to severely affect

  15. Managing the social impacts of the rapidly expanding extractive industries in Greenland

    DEFF Research Database (Denmark)

    Hansen, Anne Merrild; Vanclay, Frank; Croal, Peter

    2016-01-01

    The recent rapid expansion of extractive industries in Greenland is both causing high hopes for the future and anxieties among the local population. In the Arctic context, even small projects carry risks of major social impacts at local and national scales, and have the potential to severely affect...

  16. Rapid, general synthesis of PdPt bimetallic alloy nanosponges and their enhanced catalytic performance for ethanol/methanol electrooxidation in an alkaline medium.

    Science.gov (United States)

    Zhu, Chengzhou; Guo, Shaojun; Dong, Shaojun

    2013-01-14

    We have demonstrated a rapid and general strategy to synthesize novel three-dimensional PdPt bimetallic alloy nanosponges in the absence of a capping agent. Significantly, the as-prepared PdPt bimetallic alloy nanosponges exhibited greatly enhanced activity and stability towards ethanol/methanol electrooxidation in an alkaline medium, which demonstrates the potential of applying these PdPt bimetallic alloy nanosponges as effective electrocatalysts for direct alcohol fuel cells. In addition, this simple method has also been applied for the synthesis of AuPt, AuPd bimetallic, and AuPtPd trimetallic alloy nanosponges. The as-synthesized three-dimensional bimetallic/trimetallic alloy nanosponges, because of their convenient preparation, well-defined sponge-like network, large-scale production, and high electrocatalytic performance for ethanol/methanol electrooxidation, may find promising potential applications in various fields, such as formic acid oxidation or oxygen reduction reactions, electrochemical sensors, and hydrogen-gas sensors. Copyright © 2013 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  17. Microwave assisted extraction-solid phase extraction for high-efficient and rapid analysis of monosaccharides in plants.

    Science.gov (United States)

    Zhang, Ying; Li, Hai-Fang; Ma, Yuan; Jin, Yan; Kong, Guanghui; Lin, Jin-Ming

    2014-11-01

    Monosaccharides are the fundamental composition units of saccharides which are a common source of energy for metabolism. An effective and simple method consisting of microwave assisted extraction (MAE), solid phase extraction (SPE) and high performance liquid chromatography-refractive index detector (HPLC-RID) was developed for rapid detection of monosaccharides in plants. The MAE was applied to break down the structure of the plant cells and release the monosaccharides, while the SPE procedure was adopted to purify the extract before analysis. Finally, the HPLC-RID was employed to separate and analyze the monosaccharides with amino column. As a result, the extraction time was reduced to 17 min, which was nearly 85 times faster than soxhlet extraction. The recoveries of arabinose, xylose, fructose and glucose were 85.01%, 87.79%, 103.17%, and 101.24%, with excellent relative standard deviations (RSDs) of 1.94%, 1.13%, 0.60% and 1.67%, respectively. The proposed method was demonstrated to be efficient and time-saving, and had been applied to analyze monosaccharides in tobacco and tea successfully. Copyright © 2014 Elsevier B.V. All rights reserved.

  18. Combined Extraction of Cesium, Strontium, and Actinides from Alkaline Media: An Extension of the Caustic-Side Solvent Extraction (CSSX) Process Technology

    Energy Technology Data Exchange (ETDEWEB)

    Kenneth Raymond

    2004-11-03

    The wastes present at DOE long-term storage sites are usually highly alkaline, and because of this, much of the actinides in these wastes are in the sludge phase. Enough actinide materials still remain in the supernatant liquid that they require separation followed by long-term storage in a geological repository. The removal of these metals from the liquid waste stream would permit their disposal as low-level waste and dramatically reduce the volume of high-level wastes.

  19. Rapid and effective DNA extraction method with bead grinding for a large amount of fungal DNA.

    Science.gov (United States)

    Watanabe, M; Lee, K; Goto, K; Kumagai, S; Sugita-Konishi, Y; Hara-Kudo, Y

    2010-06-01

    To identify a rapid method for extracting a large amount of DNA from fungi associated with food hygiene, extraction methods were compared using fungal pellets formed rapidly in liquid media. Combinations of physical and chemical methods or commercial kits were evaluated with 3 species of yeast, 10 species of ascomycetous molds, and 4 species of zygomycetous molds. Bead grinding was the physical method, followed by chemical methods involving sodium dodecyl sulfate (SDS), cetyl trimethyl ammonium bromide (CTAB), and benzyl chloride and two commercial kits. Quantity was calculated by UV absorbance at 260 nm, quality was determined by the ratio of UV absorbance at 260 and 280 nm, and gene amplifications and electrophoresis profiles of whole genomes were analyzed. Bead grinding with the SDS method was the most effective for DNA extraction for yeasts and ascomycetous molds, and bead grinding with the CTAB method was most effective with zygomycetous molds. For both groups of molds, bead grinding with the CTAB method was the best approach for DNA extraction. Because this combination also is relatively effective for yeasts, it can be used to extract a large amount of DNA from a wide range of fungi. The DNA extraction methods are useful for developing gene indexes to identify fungi with molecular techniques, such as DNA fingerprinting.

  20. RAPID AND EFFICIENT METHOD FOR ENVIRONMENTAL DNA EXTRACTION AND PURIFICATION FROM SOIL

    Directory of Open Access Journals (Sweden)

    J. Hamedi

    2016-06-01

    Full Text Available Large proportion of microbial population in the world is unculturable. Extraction of total DNA from soil is usually a crucial step considering to the difficulties of study the uncultivable microorganisms. Humic acid is considered as the main inhibitory agent in the environmental DNA studies. Here, we introduced a rapid and efficient method for DNA extraction and purification from soil. Yield of DNA extraction by the presented method was 130 ng/µl. Three conventional methods of DNA extraction including liquid nitrogen incursion, bead beating and sonication were performed as control methods. Yield of DNA extraction by these methods were 110, 90 and 50 ng/µl, respectively. A rapid and efficient one step DNA purification method was introduced instead of hazardous conventional phenol-chloroform methods. Humic acid removal percentage by the introduced method was 95.8 % that is comparable with 97 % gained by the conventional gel extraction method and yield of DNA after purification was 84 % and 73 %, respectively. This study could be useful in molecular ecology and metagenomics study as a fast and reliable method.

  1. Bioproduction of 4-vinylphenol from corn cob alkaline hydrolyzate in two-phase extractive fermentation using free or immobilized recombinant E. coli expressing pad gene.

    Science.gov (United States)

    Salgado, José Manuel; Rodríguez-Solana, Raquel; Curiel, José Antonio; de Las Rivas, Blanca; Muñoz, Rosario; Domínguez, José Manuel

    2014-05-10

    In situ extractive fermentation was used to produce 4-vinyl derivatives from hydroxycinnamic acids extracted from corn cobs by recombinant Escherichia coli cells expressing Lactobacillus plantarum phenolic acid descarboxylase (PAD) gene. This microorganism mainly produced 4-vinylphenol (4VP) from p-coumaric acid (p-CA). In the first study , we observed that the concentrations of 4VP are higher than 1g/L which had a negative impact on decarboxylation of p-CA to 4VP by recombinant E. coli cells. Because of this, and in order to improve the downstream process, a two-phase aqueous-organic solvent system was developed. The results of the extractive fermentation indicated that it was possible to use hydrolyzates as aqueous phase to bioproduce 4VP, and recover simultaneously the product in the organic phase containing hexane. The detoxification of pre-treated corn cob alkaline hydrolyzate improved 4VP production up to 1003.5mg/L after 24h fermentation (QP=41.813mg/Lh). Additionally, preliminary experiments using cells immobilized in calcium alginate showed to be a good system for the biotransform of p-CA to 4VP in extractive fermentation, although the process hindered partially the recovery of 4VP in the organic phase. Copyright © 2014 Elsevier Inc. All rights reserved.

  2. Conversion of human placental alkaline phosphatase from a high Mr form to a low Mr form during butanol extraction. An investigation of the role of endogenous phosphoinositide-specific phospholipases.

    Science.gov (United States)

    Malik, A S; Low, M G

    1986-12-01

    Alkaline phosphatase in a wide range of tissues has been shown to be anchored in the membrane by a specific interaction with the polar head group of phosphatidylinositol. It has previously been suggested that the production of low Mr alkaline phosphatase during the commonly used butanol extraction procedure may result from the activation of an endogenous phosphoinositide-specific phospholipase C which removes the 1,2-diacylglycerol responsible for membrane anchoring. This conversion process was investigated in greater detail with human placenta used as the source of alkaline phosphatase. Mr and hydrophobicity of the alkaline phosphatase were determined by gel filtration on TSK-250 and partitioning in Triton X-114, respectively. Alkaline phosphatase extracted from human placental particulate fraction with butanol at pH 5.4 or released by incubation with Staphylococcus aureus phosphatidylinositol-specific phospholipase C produced a form of alkaline phosphatase of Mr approx. 170,000 and relatively low hydrophobicity. By contrast, the butanol extract prepared at pH 8.3 was an aggregated form of Mr approx. 600,000 and was relatively hydrophobic. The effect of a variety of inhibitors and activators on the amount of low Mr alkaline phosphatase produced during butanol extraction revealed that it was a Ca2+- and thiol-dependent process. Proteinase inhibitors had no effect. [3H]Phosphatidylinositol hydrolysis by the particulate fraction, unlike low Mr alkaline phosphatase production, was relatively sensitive to heat inactivation, indicating that the phosphoinositide-specific phospholipases C from cytosol and lysosomes were unlikely to be responsible for conversion. A butanol-stimulated activity which removed the [3H]myristic acid from the variant surface glycoprotein ( [3H]mfVSG) of Trypanosoma brucei was detectable in the human placental particulate fraction. Since this activity was acid active, Ca2+- and thiol-dependent and relatively heat stable, it may be the same as

  3. Rapid, room-temperature synthesis of amorphous selenium/protein composites using Capsicum annuum L extract

    Science.gov (United States)

    Li, Shikuo; Shen, Yuhua; Xie, Anjian; Yu, Xuerong; Zhang, Xiuzhen; Yang, Liangbao; Li, Chuanhao

    2007-10-01

    We describe the formation of amorphous selenium (α-Se)/protein composites using Capsicum annuum L extract to reduce selenium ions (SeO32-) at room temperature. The reaction occurs rapidly and the process is simple and easy to handle. A protein with a molecular weight of 30 kDa extracted from Capsicum annuum L not only reduces the SeO32- ions to Se0, but also controls the nucleation and growth of Se0, and even participates in the formation of α-Se/protein composites. The size and shell thickness of the α-Se/protein composites increases with high Capsicum annuum L extract concentration, and decreases with low reaction solution pH. The results suggest that this eco-friendly, biogenic synthesis strategy could be widely used for preparing inorganic/organic biocomposites. In addition, we also discuss the possible mechanism of the reduction of SeO32- ions by Capsicum annuum L extract.

  4. Rapid DNA extraction protocol from stool, suitable for molecular genetic diagnosis of colon cancer.

    Science.gov (United States)

    Abbaszadegan, Mohammad Reza; Velayati, Arash; Tavasoli, Alireza; Dadkhah, Ezzat

    2007-07-01

    Colorectal cancer (CRC) is one of the most common forms of cancers in the world and is curable if diagnosed at the early stage. Analysis of DNA extracted from stool specimens is a recent advantage to cancer diagnostics. Many protocols have been recommended for DNA extraction from stool, and almost all of them are difficult and time consuming, dealing with high amount of toxic materials like phenol. Their results vary due to sample collection method and further purification treatment. In this study, an easy and rapid method was optimized for isolating the human DNA with reduced PCR inhibitors present in stool. Fecal samples were collected from 10 colonoscopy-negative adult volunteers and 10 patients with CRC. Stool (1 g) was extracted using phenol/chloroform based protocol. The amplification of P53 exon 9 was examined to evaluate the extraction efficiency for human genomic targets and also compared its efficiency with Machiels et al. and Ito et al. protocols. The amplification of exon 9 of P53 from isolated fecal DNA was possible in most cases in 35 rounds of PCR using no additional purification procedure for elimination of the remaining inhibitors.inhibitors. A useful, rapid and easy protocol for routine extraction of DNA from stool was introduced and compared with two previous protocols.

  5. The rapid determination of sideroxylonals in Eucalyptus foliage by extraction with sonication followed by HPLC.

    Science.gov (United States)

    Wallis, Ian R; Foley, William J

    2005-01-01

    A rapid method is described for the quantification of sideroxylonals, a group of formylated phloroglucinol compounds found in some eucalypts. Samples of dry, ground foliage were extracted by sonication with 20% methanol in acetonitrile, 7% water in acetonitrile or 40% water in acetonitrile and the extracts analysed by reversed phase HPLC. The extracts from the two water-acetonitrile extractions were stable for at least 48 h. All three sonication methods recovered more sideroxylonals than did the Soxhlet extraction with petroleum spirit and acetone. Adding 0.1% trifluoracetic acid to the water-acetonitrile extraction solvents led to even higher recoveries of sideroxylonals. Soaking the sample in extracting solvent for 5 min recovered 70% of the sideroxylonals, whilst sonicating the suspension for 1 min recovered the remainder. The developed method involving sonication of the sample for 5 min in 7% water in acetonitrile with 0.1% trifluoroacetic acid is fast and requires minimal equipment and solvents compared with the traditional methods. With an autosampler it is possible to prepare and run 100 samples a day. More importantly, the technique is ideal for the analysis of small samples, e.g. individual leaves, which is essential when studying the evolutionary ecology of eucalypts.

  6. Environmental friendly alkaline sulfite anthra quinone-methonal (ASAM) pulping with Rumex crispus plant extract of woody materials.

    Science.gov (United States)

    Mertoglu-Elmas, Gulnur; Gunaydin, Keriman; Ozden, Oznur

    2012-09-01

    ASAM with Rumex crispus extract organosolv pulping was developed by using 1,5-dihydroxy-3-methoxy-7-methyl-anthraquinone from Rumex crispus root, instead of anthraquinone. ASAM was also produced as a control pulping. Both pulps were made by handsheets from fast growing P. deltoides clone (Samsun p. clone), Robinia pseudoacacia L. and Pinus pinaster grown in Turkey for wood fibrous raw materials. The mechanical consisting tensile, bursting and tear values and optical values of ASAM handsheets yellowness, brightness and whiteness were compared to ASAM with Rumex crispus L. extracted. It is concluded that ASAM with Rumex crispus extract pulping suits well in the manufacturing of special papers.

  7. Extraction and characterization of gelatin from the feet of Pekin duck (Anas platyrhynchos domestica) as affected by acid, alkaline, and enzyme pretreatment.

    Science.gov (United States)

    Abedinia, Ahmadreza; Ariffin, Fazilah; Huda, Nurul; Nafchi, Abdorreza Mohammadi

    2017-05-01

    The effects of different pretreatments on yield and composition of extraction, physicochemical, and rheological properties of duck feet gelatin (DFG) were investigated. Gelatins were extracted from the whole feet of Pekin duck with an average yield of 4.09%, 3.65%, and 5.75% for acidic (Ac-DFG), alkaline (Al-DFG), and enzymatic (En-DFG) pretreatment on a wet weight basis, respectively. Proteins at 81.38%, 79.41%, 82.55%, and 87.38% were the major composition for Ac-DFG, Al-DFG, En-DFG, and bovine, respectively. Amino acid analysis showed glycine as the predominant amino acid in Ac-DFG, followed by hydroxyproline, proline, and alanine for Ac-DFG, Al-DFG, and En-DFG, respectively. Rheological analysis indicated that the maximum elastic modulus (9972.25Pa) and loss modulus (4956.28Pa) for Ac-DFG gelatin were significantly higher than those of other gelatins. Extracted gelatins contained α1 and α2 chains as the predominant components, and enzymatic gelatin had low molecular weight peptides. Fourier transform infrared spectroscopy showed that the peak of the gelatins was mainly positioned in the amide band region (amides I, II, and III). A considerable loss of molecular-order triple helical structure was also observed after pepsin treatment. In summary, duck feet gelatin has potential to replace as mammalian gelatin in food and pharmaceutical industry. Copyright © 2017 Elsevier B.V. All rights reserved.

  8. Extraction of DNA by magnetic ionic liquids: tunable solvents for rapid and selective DNA analysis.

    Science.gov (United States)

    Clark, Kevin D; Nacham, Omprakash; Yu, Honglian; Li, Tianhao; Yamsek, Melissa M; Ronning, Donald R; Anderson, Jared L

    2015-02-03

    DNA extraction represents a significant bottleneck in nucleic acid analysis. In this study, hydrophobic magnetic ionic liquids (MILs) were synthesized and employed as solvents for the rapid and efficient extraction of DNA from aqueous solution. The DNA-enriched microdroplets were manipulated by application of a magnetic field. The three MILs examined in this study exhibited unique DNA extraction capabilities when applied toward a variety of DNA samples and matrices. High extraction efficiencies were obtained for smaller single-stranded and double-stranded DNA using the benzyltrioctylammonium bromotrichloroferrate(III) ([(C8)3BnN(+)][FeCl3Br(-)]) MIL, while the dicationic 1,12-di(3-hexadecylbenzimidazolium)dodecane bis[(trifluoromethyl)sulfonyl]imide bromotrichloroferrate(III) ([(C16BnIM)2C12(2+)][NTf2(-), FeCl3Br(-)]) MIL produced higher extraction efficiencies for larger DNA molecules. The MIL-based method was also employed for the extraction of DNA from a complex matrix containing albumin, revealing a competitive extraction behavior for the trihexyl(tetradecyl)phosphonium tetrachloroferrate(III) ([P6,6,6,14(+)][FeCl4(-)]) MIL in contrast to the [(C8)3BnN(+)][FeCl3Br(-)] MIL, which resulted in significantly less coextraction of albumin. The MIL-DNA method was employed for the extraction of plasmid DNA from bacterial cell lysate. DNA of sufficient quality and quantity for polymerase chain reaction (PCR) amplification was recovered from the MIL extraction phase, demonstrating the feasibility of MIL-based DNA sample preparation prior to downstream analysis.

  9. Activity increase after extraction of alkaline phosphatase from human osteoblastic membranes by nonionic detergents: influence of age and sex.

    Science.gov (United States)

    Bourrat, C; Radisson, J; Chavassieux, P; Azzar, G; Roux, B; Meunier, P J

    2000-01-01

    The solubilization of alkaline phosphatase (AP) from osteoblastic cell membranes obtained from human primary bone cell cultures was studied according to the age and sex of the donors (17 females, 11 males; age range: 2-77 years). Cell membranes were treated by non-ionic (n-octyl beta-D-glucopyranoside, OG), ionic or zwitterionic detergents, then centrifuged. When OG was used almost all the AP was solubilized. AP activity in supernatant of solubilization was compared to the activity of the suspension before centrifugation. The activity ratio (AR) increased in function of age for subjects between 65 and 74. Neither total nor specific AP activities were influenced by age or sex. Electrophoresis studies showed that the AP released was a GPI (glycosyl phosphatidylinositol)-anchored protein, amphipathic form, with 140 kDa as apparent molecular mass. The activity change of AP in the presence of OG may result from age-related modifications either in the AP structure or in the constituents of the plasma membranes (proteins or phospholipids).

  10. Fatty acids are rapidly delivered to and extracted from membranes by methyl-beta-cyclodextrin.

    Science.gov (United States)

    Brunaldi, Kellen; Huang, Nasi; Hamilton, James A

    2010-01-01

    We performed detailed biophysical studies of transfer of long-chain fatty acids (FAs) from methyl-beta-CD (MBCD) to model membranes (egg-PC vesicles) and cells and the extraction of FA from membranes by MBCD. We used i) fluorescein phosphatidylethanolamine to detect transfer of FA anions arriving in the outer membrane leaflet; ii) entrapped pH dyes to measure pH changes after FA diffusion (flip-flop) across the lipid bilayer; and iii) soluble fluorescent-labeled FA binding protein to measure the concentration of unbound FA in water. FA dissociated from MBCD, bound to the membrane, and underwent flip-flop within milliseconds. In the presence of vesicles, MBCD maintained the aqueous concentration of unbound FA at low levels comparable to those measured with albumin. In studies with cells, addition of oleic acid (OA) complexed with MBCD yielded rapid (seconds) dose-dependent OA transport into 3T3-L1 preadipocytes and HepG2 cells. MBCD extracted OA from cells and model membranes rapidly at concentrations exceeding those required for OA delivery but much lower than concentrations commonly used for extracting cholesterol. Compared with albumin, MBCD can transfer its entire FA load and is less likely to extract cell nutrients and to introduce impurities.

  11. A Rapid and Economical Method for Efficient DNA Extraction from Diverse Soils Suitable for Metagenomic Applications.

    Directory of Open Access Journals (Sweden)

    Selvaraju Gayathri Devi

    Full Text Available A rapid, cost effective method of metagenomic DNA extraction from soil is a useful tool for environmental microbiology. The present work describes an improved method of DNA extraction namely "powdered glass method" from diverse soils. The method involves the use of sterile glass powder for cell lysis followed by addition of 1% powdered activated charcoal (PAC as purifying agent to remove humic substances. The method yielded substantial DNA (5.87 ± 0.04 μg/g of soil with high purity (A260/280: 1.76 ± 0.05 and reduced humic substances (A340: 0.047 ± 0.03. The quality of the extracted DNA was compared against five different methods based on 16S rDNA PCR amplification, BamHI digestion and validated using quantitative PCR. The digested DNA was used for a metagenomic library construction with the transformation efficiency of 4 X 106 CFU mL-1. Besides providing rapid, efficient and economical extraction of metgenomic DNA from diverse soils, this method's applicability is also demonstrated for cultivated organisms (Gram positive B. subtilis NRRL-B-201, Gram negative E. coli MTCC40, and a microalgae C. sorokiniana UTEX#1666.

  12. A Rapid and Economical Method for Efficient DNA Extraction from Diverse Soils Suitable for Metagenomic Applications.

    Science.gov (United States)

    Devi, Selvaraju Gayathri; Fathima, Anwar Aliya; Radha, Sudhakar; Arunraj, Rex; Curtis, Wayne R; Ramya, Mohandass

    2015-01-01

    A rapid, cost effective method of metagenomic DNA extraction from soil is a useful tool for environmental microbiology. The present work describes an improved method of DNA extraction namely "powdered glass method" from diverse soils. The method involves the use of sterile glass powder for cell lysis followed by addition of 1% powdered activated charcoal (PAC) as purifying agent to remove humic substances. The method yielded substantial DNA (5.87 ± 0.04 μg/g of soil) with high purity (A260/280: 1.76 ± 0.05) and reduced humic substances (A340: 0.047 ± 0.03). The quality of the extracted DNA was compared against five different methods based on 16S rDNA PCR amplification, BamHI digestion and validated using quantitative PCR. The digested DNA was used for a metagenomic library construction with the transformation efficiency of 4 X 106 CFU mL-1. Besides providing rapid, efficient and economical extraction of metgenomic DNA from diverse soils, this method's applicability is also demonstrated for cultivated organisms (Gram positive B. subtilis NRRL-B-201, Gram negative E. coli MTCC40, and a microalgae C. sorokiniana UTEX#1666).

  13. Evaluation of wavelet techniques in rapid extraction of ABR variations from underlying EEG.

    Science.gov (United States)

    De Silva, A C; Schier, M A

    2011-11-01

    The aim of this study is to analyse an effective wavelet method for denoising and tracking temporal variations of the auditory brainstem response (ABR). The rapid and accurate extraction of ABRs in clinical practice has numerous benefits, including reductions in clinical test times and potential long-term patient monitoring applications. One method of achieving rapid extraction is through the application of wavelet filtering which, according to earlier research, has shown potential in denoising signals with low signal-to-noise ratios. The research documented in this paper evaluates the application of three such wavelet approaches on a common set of ABR data collected from eight participants. We introduced the use of the latency-intensity curve of ABR wave V for performance evaluation of tracking temporal variations. The application of these methods to the ABR required establishing threshold functions and time windows as an integral part of the research. Results revealed that the cyclic-shift-tree-denoising performed superior compared to other tested approaches. This required an ensemble of only 32 epochs to extract a fully featured ABR compared to the 1024 epochs with conventional ABR extraction based on linear moving time averaging.

  14. A Rapid and Economical Method for Efficient DNA Extraction from Diverse Soils Suitable for Metagenomic Applications

    Science.gov (United States)

    Devi, Selvaraju Gayathri; Fathima, Anwar Aliya; Radha, Sudhakar; Arunraj, Rex; Curtis, Wayne R.; Ramya, Mohandass

    2015-01-01

    A rapid, cost effective method of metagenomic DNA extraction from soil is a useful tool for environmental microbiology. The present work describes an improved method of DNA extraction namely “powdered glass method” from diverse soils. The method involves the use of sterile glass powder for cell lysis followed by addition of 1% powdered activated charcoal (PAC) as purifying agent to remove humic substances. The method yielded substantial DNA (5.87 ± 0.04 μg/g of soil) with high purity (A260/280: 1.76 ± 0.05) and reduced humic substances (A340: 0.047 ± 0.03). The quality of the extracted DNA was compared against five different methods based on 16S rDNA PCR amplification, BamHI digestion and validated using quantitative PCR. The digested DNA was used for a metagenomic library construction with the transformation efficiency of 4 X 106 CFU mL-1. Besides providing rapid, efficient and economical extraction of metgenomic DNA from diverse soils, this method’s applicability is also demonstrated for cultivated organisms (Gram positive B. subtilis NRRL-B-201, Gram negative E. coli MTCC40, and a microalgae C. sorokiniana UTEX#1666). PMID:26167854

  15. New rapid DNA extraction method with Chelex from Venturia inaequalis spores.

    Science.gov (United States)

    Turan, Ceren; Nanni, Irene Maja; Brunelli, Agostino; Collina, Marina

    2015-08-01

    The objective of this study was to develop a rapid method to isolate DNA from Venturia inaequalis spores for use in diagnostic DNA mutation analysis. Chelex-100 resin was evaluated and compared with a well established DNA exctraction method, utilizing CTAB in order to have a robust comparison. In this research we demonstrated that Chelex-100 efficiently makes extraction of the DNA from V. inaequalis spores available for direct use in molecular analyses. Also, the quantity and quality of extracted DNA were shown to be adequate for PCR analysis. Comparatively, the quality of DNA samples isolated using Chelex method was better than those extracted using CTAB. In conclusion, the Chelex method is recommended for PCR experiments considering its simplicity and cost-effectiveness. Copyright © 2015. Published by Elsevier B.V.

  16. A RAPID DNA EXTRACTION METHOD IS SUCCESSFULLY APPLIED TO ITS-RFLP ANALYSIS OF MYCORRHIZAL ROOT TIPS

    Science.gov (United States)

    A rapid method for extracting DNA from intact, single root tips using a Xanthine solution was developed to handle very large numbers of analyses of ectomycorrhizas. By using an extraction without grinding we have attempted to bias the extraction towards the fungal DNA in the man...

  17. Rapid detection of Ganoderma-infected oil palms by microwave ergosterol extraction with HPLC and TLC.

    Science.gov (United States)

    Muniroh, M S; Sariah, M; Zainal Abidin, M A; Lima, N; Paterson, R R M

    2014-05-01

    Detection of basal stem rot (BSR) by Ganoderma of oil palms was based on foliar symptoms and production of basidiomata. Enzyme-Linked Immunosorbent Assays-Polyclonal Antibody (ELISA-PAB) and PCR have been proposed as early detection methods for the disease. These techniques are complex, time consuming and have accuracy limitations. An ergosterol method was developed which correlated well with the degree of infection in oil palms, including samples growing in plantations. However, the method was capable of being optimised. This current study was designed to develop a simpler, more rapid and efficient ergosterol method with utility in the field that involved the use of microwave extraction. The optimised procedure involved extracting a small amount of Ganoderma, or Ganoderma-infected oil palm suspended in low volumes of solvent followed by irradiation in a conventional microwave oven at 70°C and medium high power for 30s, resulting in simultaneous extraction and saponification. Ergosterol was detected by thin layer chromatography (TLC) and quantified using high performance liquid chromatography with diode array detection. The TLC method was novel and provided a simple, inexpensive method with utility in the field. The new method was particularly effective at extracting high yields of ergosterol from infected oil palm and enables rapid analysis of field samples on site, allowing infected oil palms to be treated or culled very rapidly. Some limitations of the method are discussed herein. The procedures lend themselves to controlling the disease more effectively and allowing more effective use of land currently employed to grow oil palms, thereby reducing pressure to develop new plantations. Copyright © 2014 Elsevier B.V. All rights reserved.

  18. Rapid extraction of lexical tone phonology in Chinese characters: a visual mismatch negativity study.

    Directory of Open Access Journals (Sweden)

    Xiao-Dong Wang

    Full Text Available BACKGROUND: In alphabetic languages, emerging evidence from behavioral and neuroimaging studies shows the rapid and automatic activation of phonological information in visual word recognition. In the mapping from orthography to phonology, unlike most alphabetic languages in which there is a natural correspondence between the visual and phonological forms, in logographic Chinese, the mapping between visual and phonological forms is rather arbitrary and depends on learning and experience. The issue of whether the phonological information is rapidly and automatically extracted in Chinese characters by the brain has not yet been thoroughly addressed. METHODOLOGY/PRINCIPAL FINDINGS: We continuously presented Chinese characters differing in orthography and meaning to adult native Mandarin Chinese speakers to construct a constant varying visual stream. In the stream, most stimuli were homophones of Chinese characters: The phonological features embedded in these visual characters were the same, including consonants, vowels and the lexical tone. Occasionally, the rule of phonology was randomly violated by characters whose phonological features differed in the lexical tone. CONCLUSIONS/SIGNIFICANCE: We showed that the violation of the lexical tone phonology evoked an early, robust visual response, as revealed by whole-head electrical recordings of the visual mismatch negativity (vMMN, indicating the rapid extraction of phonological information embedded in Chinese characters. Source analysis revealed that the vMMN was involved in neural activations of the visual cortex, suggesting that the visual sensory memory is sensitive to phonological information embedded in visual words at an early processing stage.

  19. Rapid extraction of lexical tone phonology in Chinese characters: a visual mismatch negativity study.

    Science.gov (United States)

    Wang, Xiao-Dong; Liu, A-Ping; Wu, Yin-Yuan; Wang, Peng

    2013-01-01

    In alphabetic languages, emerging evidence from behavioral and neuroimaging studies shows the rapid and automatic activation of phonological information in visual word recognition. In the mapping from orthography to phonology, unlike most alphabetic languages in which there is a natural correspondence between the visual and phonological forms, in logographic Chinese, the mapping between visual and phonological forms is rather arbitrary and depends on learning and experience. The issue of whether the phonological information is rapidly and automatically extracted in Chinese characters by the brain has not yet been thoroughly addressed. We continuously presented Chinese characters differing in orthography and meaning to adult native Mandarin Chinese speakers to construct a constant varying visual stream. In the stream, most stimuli were homophones of Chinese characters: The phonological features embedded in these visual characters were the same, including consonants, vowels and the lexical tone. Occasionally, the rule of phonology was randomly violated by characters whose phonological features differed in the lexical tone. We showed that the violation of the lexical tone phonology evoked an early, robust visual response, as revealed by whole-head electrical recordings of the visual mismatch negativity (vMMN), indicating the rapid extraction of phonological information embedded in Chinese characters. Source analysis revealed that the vMMN was involved in neural activations of the visual cortex, suggesting that the visual sensory memory is sensitive to phonological information embedded in visual words at an early processing stage.

  20. Rapid green synthesis of silver nanoparticles and nanorods using Piper nigrum extract

    Energy Technology Data Exchange (ETDEWEB)

    Mohapatra, Bandita [Multifunctional Nanomaterials Laboratory, School of Basic and Applied Sciences, Guru Gobind Singh Indraprastha University, Dwarka, New Delhi 110078 (India); Kuriakose, Sini [Multifunctional Nanomaterials Laboratory, School of Basic and Applied Sciences, Guru Gobind Singh Indraprastha University, Dwarka, New Delhi 110078 (India); School of Basic and Applied Sciences, Guru Gobind Singh Indraprastha University, Dwarka, New Delhi 110078 (India); Mohapatra, Satyabrata, E-mail: smiuac@gmail.com [Multifunctional Nanomaterials Laboratory, School of Basic and Applied Sciences, Guru Gobind Singh Indraprastha University, Dwarka, New Delhi 110078 (India); School of Basic and Applied Sciences, Guru Gobind Singh Indraprastha University, Dwarka, New Delhi 110078 (India)

    2015-07-15

    Highlights: • Silver nanorods were synthesized by photoreduction using Piper nigrum extract. • The morphological and structural properties were studied by XRD and AFM. • Silver nanoparticles were formed at lower AgNO{sub 3} concentration. • Increase in AgNO{sub 3} concentration resulted in formation of silver nanorods. - Abstract: We report sun light driven rapid green synthesis of stable aqueous dispersions of silver nanoparticles and nanorods at room temperature using photoreduction of silver ions with Piper nigrum extract. Silver nanoparticles were formed within 3 min of sun light irradiation following addition of Piper nigrum extract to the AgNO{sub 3} solution. The effects of AgNO{sub 3} concentration and irradiation time on the formation and plasmonic properties of biosynthesized silver nanoparticles were studied using UV–visible absorption spectroscopy. The morphology and structure of silver nanoparticles were well characterized by atomic force microscopy (AFM) and X-ray diffraction (XRD). The size of Ag nanoparticles increased with increase in irradiation time, leading to the formation of anisotropic nanostructures. Increasing the AgNO{sub 3} concentration resulted in the formation of Ag nanorods. UV–visible absorption studies revealed the presence of surface plasmon resonance (SPR) peaks which red shift and broaden with increasing AgNO{sub 3} concentration. We have demonstrated a facile, energy efficient and rapid green synthetic route to synthesize stable aqueous dispersions of silver nanoparticles and nanorods.

  1. Phenological Metrics Extraction for Agricultural Land-use Types Using RapidEye and MODIS

    Science.gov (United States)

    Xu, Xingmei; Doktor, Daniel; Conrad, Christopher

    2016-04-01

    Crop phenology involves the various agricultural events, such as planting, emergence, flowering, development of fruit and harvest. These phenological stages of a crop contain essential information for practical agricultural management, crop productivity estimation, investigations of crop-weather relationships, and also play an important role in improving agricultural land-use classification. In this study, we used MODIS and RapidEye images to extract phenological metrics in central Germany between 2010 and 2014. The Best Index Slope Extraction algorithm was used to remove undesirable data noise from Normalized Difference Vegetation Index (NDVI) time series of both satellite data before fast Fourier transformation was applied. Metrics optimization for phenology of major crops in the study area (winter wheat, winter barley, winter oilseed rape and sugar beet) and validation were performed with intensive ground observations from the German Weather Service (2010-2014) and our own measurements of BBCH code (Biologische Bundesanstalt für Land- und Forstwirtschaft, Bundessortenamt und CHemische Industrie) (in 2014). We found that the dates with maximum NDVI have a close link to the heading stage of cereals (RMSE = 9.48 days for MODIS and RMSE = 13.55 days for RapidEye), and the dates of local half maximum during senescence period of winter crops was strongly related to ripeness stage (BBCH: 87) (RMSE = 8.87 days for MODIS and RMSE = 9.62 days for RapidEye). The root-mean-square errors (RMSE) of derived green up dates for both winter and summer crops were larger than 2 weeks, which was caused by limited number of good quality images during the winter season. Comparison between RapidEye and homogeneous MODIS pixels indicated that phenological metrics derived from both satellites were similar to the crop calendar in this region. We also investigated the influence of spatial aggregation of RapidEye-scale phenology to MODIS scale as well as the effect of decreasing the

  2. Extraction and Separation of Vitisin D, Ampelopsin B and cis-Vitisin A from Iris lactea Pall. var. chinensis (Fisch.) Koidz by Alkaline Extraction-Acid Precipitation and High-Speed Counter-Current Chromatography.

    Science.gov (United States)

    Lv, Huanhuan; Zhou, Wenna; Wang, Xiaoyan; Wang, Zhenhua; Suo, Yourui; Wang, Honglun

    2016-01-01

    Naturally occurring oligostilbenes are receiving more attention because they exhibit several beneficial effects for health, including hepatoprotective, antitumor, anti-adipogenic, antioxidant, antiaging, anti-inflammatory, anti-microbial, antiviral, immunosuppressive and neuroprotective activities. Thus, they could be of some potentially therapeutic values for several diseases. In this study, we adopted the alkaline extraction-acid precipitation (AEAP) method for extraction of oligostilbenes from the seed kernel of Iris lactea Then, the high-speed counter-current chromatography (HSCCC) was used for preparative isolation and purification of oligostilbenes from the AEAP extracts. Finally, three oligostilbenes, namely vitisin D (73 mg), ampelopsin B (25 mg) and cis-vitisin A (16 mg), were successfully fractionated by HSCCC with a two-phase solvent system composed of n-hexane-ethyl acetate-methanol-water (2:5:3:6, v/v/v/v) from 300 mg of the AEAP extracts in ∼ 190 min. The purities of the three isolated oligostilbenes were all over 95.0% as analyzed by high performance liquid chromatography. They all were isolated from I. lacteal for the first time.The method of AEAP for the preparation of the oligostilbene-enriched crude sample was simple, and the HSCCC technique for the isolation and purification of oligostilbenes was efficient. © The Author 2016. Published by Oxford University Press. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

  3. Probing metabolic stability of CdSe nanoparticles: Alkaline extraction of free cadmium from liver and kidney samples of rats exposed to CdSe nanoparticles

    Energy Technology Data Exchange (ETDEWEB)

    Arslan, Zikri, E-mail: zikri.arslan@jsums.edu [Jackson State University, Department of Chemistry and Biochemistry, PO Box 17910, Jackson, MS 39217 (United States); Ates, Mehmet; McDuffy, Wanaki; Agachan, M. Sabri [Jackson State University, Department of Chemistry and Biochemistry, PO Box 17910, Jackson, MS 39217 (United States); Farah, Ibrahim O. [Jackson State University, Department of Biology, PO Box 18540, Jackson, MS 39217 (United States); Yu, W. William [BioScience Research Collaborative, Rice University, MS 602, 6500 Main Street, Houston, TX 77030 (United States); Bednar, Anthony J. [US Army Engineer Research and Development Center (ERDC), Waterways Experiment Station, Vicksburg, MS 39180 (United States)

    2011-08-15

    Highlights: {yields} Separation of Cd is examined from tissues containing CdSe nanoparticles (NPs). {yields} TMAH affords extraction of free Cd in tissues without deteriorating intact NPs. {yields} Thiol-capped CdSe NPs degrade in the body to release free Cd. {yields} UV light accelerates NP degradation resulting in elevated Cd levels in the body. -- Abstract: Cadmium selenide nanoparticles (CdSe NPs) exhibit novel optoelectronic properties for potential biomedical applications. However, their metabolic stability is not fully understood because of the difficulties in measurement of free Cd from biological tissues of exposed individuals. In this study, alkaline dissolution with tetramethylammonium hydroxide (TMAH) is demonstrated for selective determination of free Cd and intact NPs from liver and kidney samples of animals that were exposed to thiol-capped CdSe NPs. Aqueous suspensions of CdSe NPs (3.2 nm) were used to optimize the conditions for extracting free Cd without affecting NPs. Nanoparticles were found to aggregate when heated in TMAH without releasing any significant Cd to solution. Performance of the method in discriminating free Cd and intact NPs were verified by Dogfish Liver (DOLT-4) certified reference material. The samples from the animals were digested in 4 mL TMAH at 70 {sup o}C to extract free Cd followed by analysis of aqueous phase by ICP-MS. Both liver and kidney contained significant levels of free Cd. Total Cd was higher in the liver, while kidney accumulated mostly free Cd such that up to 47.9% of total Cd in the kidney was free Cd when NPs were exposed to UV-light before injection.

  4. Application of rapid cloud point extraction method for trace cobalt analysis coupled with spectrophotometric determination

    Science.gov (United States)

    Wen, Xiaodong; He, Lei; Shi, Chunsheng; Deng, Qingwen; Wang, Jiwei; Zhao, Xia

    2013-11-01

    In this work, the analytical performance of conventional spectrophotometer was improved through the coupling of effective preconcentration method with spectrophotometric determination. Rapidly synergistic cloud point extraction (RS-CPE) was used to pre-concentrate ultra trace cobalt and firstly coupled with spectrophotometric determination. The developed coupling was simple, rapid and efficient. The factors influencing RS-CPE and spectrophotometer were optimized. Under the optimal conditions, the limit of detection (LOD) was 0.6 μg L-1, with sensitivity enhancement factor of 23. The relative standard deviation (RSD) for seven replicate measurements of 50 μg L-1 of cobalt was 4.3%. The recoveries for the spiked samples were in the acceptable range of 93.8-105%.

  5. Rapid, room-temperature synthesis of amorphous selenium/protein composites using Capsicum annuum L extract

    Energy Technology Data Exchange (ETDEWEB)

    Li Shikuo; Shen Yuhua; Xie Anjian; Yu Xuerong; Zhang Xiuzhen; Yang Liangbao; Li Chuanhao [School of Chemistry and Chemical Engineering, Anhui University, Hefei 230039 (China)

    2007-10-10

    We describe the formation of amorphous selenium ({alpha}-Se)/protein composites using Capsicum annuum L extract to reduce selenium ions (SeO{sub 3}{sup 2-}) at room temperature. The reaction occurs rapidly and the process is simple and easy to handle. A protein with a molecular weight of 30 kDa extracted from Capsicum annuum L not only reduces the SeO{sub 3}{sup 2-} ions to Se{sup 0}, but also controls the nucleation and growth of Se{sup 0}, and even participates in the formation of {alpha}-Se/protein composites. The size and shell thickness of the {alpha}-Se/protein composites increases with high Capsicum annuum L extract concentration, and decreases with low reaction solution pH. The results suggest that this eco-friendly, biogenic synthesis strategy could be widely used for preparing inorganic/organic biocomposites. In addition, we also discuss the possible mechanism of the reduction of SeO{sub 3}{sup 2-} ions by Capsicum annuum L extract.

  6. A new rapid method for Clostridium difficile DNA extraction and detection in stool: toward point-of-care diagnostic testing

    National Research Council Canada - National Science Library

    Freifeld, Alison G; Simonsen, Kari A; Booth, Christine S; Zhao, Xing; Whitney, Scott E; Karre, Teresa; Iwen, Peter C; Viljoen, Hendrik J

    2012-01-01

    We describe a new method for the rapid diagnosis of Clostridium difficile infection, with stool sample preparation and DNA extraction by heat and physical disruption in a single-use lysis microreactor (LMR...

  7. A Simple and Rapid Data Extraction Method for the Precision Aspheric Optical Surface Height

    Science.gov (United States)

    Xing, Guohua; Peng, Yunfeng; Su, Xing

    2017-10-01

    Nowadays, the application of aspheric optics is becoming more and more popular in the precision optical engineering field. Therefore, it urges the rapid development of the precision machining and measuring technology. Generally, the aspheric optical component is measured by the interferometer. The underlying question is that the figure output by interferometer can’t be always recognized by other analysis software or program though the interferometer has its own unique data processing system. In this paper, a robust, rapid and simple method is presented to interpret the surface height data of the precision machined aspheric optical surface. The optical surface is measured by interferometer. The result figure is split into two parts, one of which is the interferogram picture of the whole aspheric optical surface and the other is the colour reference column indicating the height value. The ratios of the red (R), green (G) and blue (B) are analysed based on the middle of the colour reference column, and the corresponding relationship between the colours and surface height is established and looked as a reference data base. Then the interferogram picture of the whole aspheric optical surface is also analysed and divided according to the red (R), green (G) and blue (B) colours. By comparing the ratios and values of RGB colour, the aspheric optical surface height can be extracted approximately. The feasibility of this method was approved by the extraction processing experiment of a polished aspheric optical surface.

  8. A modified MS2 bacteriophage plaque reduction assay for the rapid screening of antiviral plant extracts.

    Science.gov (United States)

    Cock, Ian; Kalt, F R

    2010-07-01

    Traditional methods of screening plant extracts and purified components for antiviral activity require up to a week to perform, prompting the need to develop more rapid quantitative methods to measure the ability of plant based preparations to block viral replication. We describe an adaption of an MS2 plaque reduction assay for use in S. aureus. MS2 bacteriophage was capable of infecting and replicating in B. cereus, S. aureus and F + E. coli but not F- E. coli. Indeed, both B. cereus and S. aureus were more sensitive to MS2 induced lysis than F+ E. coli. When MS2 bacteriophage was mixed with Camellia sinensis extract (1 mg/ml), Scaevola spinescens extract (1 mg/ml) or Aloe barbadensis juice and the mixtures inoculated into S. aureus, the formation of plaques was reduced to 8.9 ± 3.8%, 5.4 ± 2.4% and 72.7 ± 20.9% of the untreated MS2 control values respectively. The ability of the MS2 plaque reduction assay to detect antiviral activity in these known antiviral plant preparations indicates its suitability as an antiviral screening tool. An advantage of this assay compared with traditionally used cytopathic effect reduction assays and replicon based assays is the more rapid acquisition of results. Antiviral activity was detected within 24 h of the start of testing. The MS2 assay is also inexpensive and non-pathogenic to humans making it ideal for initial screening studies or as a simulant for pathogenic viruses.

  9. Development of a Rapid and Simple Method to Remove Polyphenols from Plant Extracts

    Directory of Open Access Journals (Sweden)

    Imali Ranatunge

    2017-01-01

    Full Text Available Polyphenols are secondary metabolites of plants, which are responsible for prevention of many diseases. Polyvinylpolypyrrolidone (PVPP has a high affinity towards polyphenols. This method involves the use of PVPP column to remove polyphenols under centrifugal force. Standards of gallic acid, epigallocatechin gallate, vanillin, and tea extracts (Camellia sinensis were used in this study. PVPP powder was packed in a syringe with different quantities. The test samples were layered over the PVPP column and subjected to centrifugation. Supernatant was tested for the total phenol content. The presence of phenolic compounds and caffeine was screened by HPLC and measuring the absorbance at 280. The antioxidant capacity of standards and tea extracts was compared with the polyphenol removed fractions using DPPH scavenging assay. No polyphenols were found in polyphenolic standards or tea extracts after PVPP treatment. The method described in the present study to remove polyphenols is simple, inexpensive, rapid, and efficient and can be employed to investigate the contribution of polyphenols present in natural products to their biological activity.

  10. Development of Novel Method for Rapid Extract of Radionuclides from Solution Using Polymer Ligand Film

    Science.gov (United States)

    Rim, Jung H.

    Accurate and fast determination of the activity of radionuclides in a sample is critical for nuclear forensics and emergency response. Radioanalytical techniques are well established for radionuclides measurement, however, they are slow and labor intensive, requiring extensive radiochemical separations and purification prior to analysis. With these limitations of current methods, there is great interest for a new technique to rapidly process samples. This dissertation describes a new analyte extraction medium called Polymer Ligand Film (PLF) developed to rapidly extract radionuclides. Polymer Ligand Film is a polymer medium with ligands incorporated in its matrix that selectively and rapidly extract analytes from a solution. The main focus of the new technique is to shorten and simplify the procedure necessary to chemically isolate radionuclides for determination by alpha spectrometry or beta counting. Five different ligands were tested for plutonium extraction: bis(2-ethylhexyl) methanediphosphonic acid (H2DEH[MDP]), di(2-ethyl hexyl) phosphoric acid (HDEHP), trialkyl methylammonium chloride (Aliquat-336), 4,4'(5')-di-t-butylcyclohexano 18-crown-6 (DtBuCH18C6), and 2-ethylhexyl 2-ethylhexylphosphonic acid (HEH[EHP]). The ligands that were effective for plutonium extraction further studied for uranium extraction. The plutonium recovery by PLFs has shown dependency on nitric acid concentration and ligand to total mass ratio. H2DEH[MDP] PLFs performed best with 1:10 and 1:20 ratio PLFs. 50.44% and 47.61% of plutonium were extracted on the surface of PLFs with 1M nitric acid for 1:10 and 1:20 PLF, respectively. HDEHP PLF provided the best combination of alpha spectroscopy resolution and plutonium recovery with 1:5 PLF when used with 0.1M nitric acid. The overall analyte recovery was lower than electrodeposited samples, which typically has recovery above 80%. However, PLF is designed to be a rapid field deployable screening technique and consistency is more important

  11. A rapid and efficient DNA extraction method suitable for marine macroalgae.

    Science.gov (United States)

    Ramakrishnan, Gautham Subramaniam; Fathima, Anwar Aliya; Ramya, Mohandass

    2017-12-01

    Macroalgae are a diverse group of organisms. Marine macroalgae, in particular, have numerous medicinal and industrial applications. Molecular studies of macroalgae require suitable concentrations of DNA free of contaminants. At present, numerous protocols exist for DNA extraction from macroalgae. However, they are either time consuming, expensive or work only with few species. The method described in this study is rapid and efficient and applicable to different types of marine macroalgae. This method yields an average of 3.85 µg of DNA per 50 mg of algal tissue, with an average purity of 1.88. The isolated DNA was suitable for PCR amplification of universal plastid region of macroalgae.

  12. pH-dependent conversion of liver-membranous alkaline phosphatase to a serum-soluble form by n-butanol extraction.

    Science.gov (United States)

    Miki, A; Kominami, T; Ikehara, Y

    1985-01-16

    Alkaline phosphatase released from rat liver plasma membrane under usual conditions was electrophoretically not identical with a soluble form in serum which was derived from the liver. The liver-membranous alkaline phosphatase, however, was converted to the serum-soluble form when the liver plasma membrane was treated with n-butanol under the acidic conditions lower than pH 6.5. Such pH-dependent conversion of the enzyme was not observed in plasma membrane of rat ascites hepatoma AH-130 cells. The converting activity for alkaline phosphatase was detected not only in plasma membrane but also in lysosomal membrane of rat liver.

  13. Rapid solid-phase extraction and analysis of resveratrol and other polyphenols in red wine.

    Science.gov (United States)

    Hashim, Shima N N S; Schwarz, Lachlan J; Boysen, Reinhard I; Yang, Yuanzhong; Danylec, Basil; Hearn, Milton T W

    2013-10-25

    Red wine has long been credited as a good source of health-beneficial antioxidants, including the bioactive polyphenols catechin, quercetin, and (E)-resveratrol. In this paper, we report the application of reusable molecularly imprinted polymers (MIPs) for the selective and robust solid-phase extraction (SPE) and rapid analysis of (E)-resveratrol (LOD=8.87×10(-3) mg/L, LOQ=2.94×10(-2) mg/L), along with a range of other polyphenols from an Australian Pinot noir red wine. Optimization of the molecularly imprinted solid-phase extraction (MISPE) protocol resulted in the significant enrichment of (E)-resveratrol and several structurally related polyphenols. These secondary metabolites were subsequently identified by RP-HPLC and μLC-ESI ion trap MS/MS methods. The developed MISPE protocol employed low volumes of environmentally benign solvents selected according to the Green Chemistry principles, and resulted in the recovery of 99% of the total (E)-resveratrol present. These results further demonstrate the potential of generic protocols for the analysis of target compound with health beneficial properties within the food and nutraceutical industries using tailor-made MIPs. Copyright © 2013 Elsevier B.V. All rights reserved.

  14. Rapid extraction and high-performance liquid chromatographic determination of parthenolide in feverfew (Tanacetum parthenium).

    Science.gov (United States)

    Zhou, J Z; Kou, X; Stevenson, D

    1999-03-01

    A rapid and sensitive method for quantifying parthenolide in feverfew herb (Tanacetum parthenium) was developed that is significantly faster than those reported in the literature. The extraction system consisted of acetonitrile/water (90:10, v/v) in a bottle with stirring for 30 min. Both Soxhlet and bottle-stirring extractions were studied. Samples were analyzed using high-performance liquid chromatography with a Cosmosil C18-AR column (150 x 4.6 mm, 5 microm, 120 A). The mobile phase consisted of acetonitrile/water (55:45, v/v) with a flow rate of 1.5 mL/min and UV detection at 210 nm. Analysis time was 6 min, with a detection limit of 0.10 ng on column. The calibration curve was linear over a range of 0.160-850 microg/mL parthenolide with R(2) = 0.9999. Replicate tests indicated good reproducibility of the method with an RSD% = 0.88 (n = 10). Spike recovery of parthenolide was found to be 99.3% with an RSD% = 1.6 (n = 6).

  15. Gas purge-microsyringe extraction: a rapid and exhaustive direct microextraction technique of polycyclic aromatic hydrocarbons from plants.

    Science.gov (United States)

    Wang, Juan; Yang, Cui; Li, Huijie; Piao, Xiangfan; Li, Donghao

    2013-12-17

    Gas purge-microsyringe extraction (GP-MSE) is a rapid and exhaustive microextraction technique for volatile and semivolatile compounds. In this study, a theoretical system of GP-MSE was established by directly extracting and analyzing 16 kinds of polycyclic aromatic hydrocarbons (PAHs) from plant samples. On the basis of theoretical consideration, a full factorial experimental design was first used to evaluate the main effects and interactions of the experimental parameters affecting the extraction efficiency. Further experiments were carried out to determine the extraction kinetics and desorption temperature-dependent. The results indicated that three factors, namely desorption temperature (temperature of sample phase) Td, extraction time t, and gas flow rate u, had a significantly positive effect on the extraction efficiency of GP-MSE for PAHs. Extraction processes of PAHs in plant samples followed by first-order kinetics (relative coefficient R(2) of simulation curves were 0.731-1.000, with an average of 0.958 and 4.06% relative standard deviation), and obviously depended on the desorption temperature. Furthermore, the effect of the matrix was determined from the difference in Eapp,d. Finally, satisfactory recoveries of 16 PAHs were obtained using optimal parameters. The study demonstrated that GP-MSE could provide a rapid and exhaustive means of direct extraction of PAHs from plant samples. The extraction kinetics were similar that of the inverse process of the desorption kinetics of the sample phase. Copyright © 2013 Elsevier B.V. All rights reserved.

  16. Droplet centrifugation, droplet DNA extraction, and rapid droplet thermocycling for simpler and faster PCR assay using wire-guided manipulations

    Directory of Open Access Journals (Sweden)

    You David J

    2012-09-01

    Full Text Available Abstract A computer numerical control (CNC apparatus was used to perform droplet centrifugation, droplet DNA extraction, and rapid droplet thermocycling on a single superhydrophobic surface and a multi-chambered PCB heater. Droplets were manipulated using “wire-guided” method (a pipette tip was used in this study. This methodology can be easily adapted to existing commercial robotic pipetting system, while demonstrated added capabilities such as vibrational mixing, high-speed centrifuging of droplets, simple DNA extraction utilizing the hydrophobicity difference between the tip and the superhydrophobic surface, and rapid thermocycling with a moving droplet, all with wire-guided droplet manipulations on a superhydrophobic surface and a multi-chambered PCB heater (i.e., not on a 96-well plate. Serial dilutions were demonstrated for diluting sample matrix. Centrifuging was demonstrated by rotating a 10 μL droplet at 2300 round per minute, concentrating E. coli by more than 3-fold within 3 min. DNA extraction was demonstrated from E. coli sample utilizing the disposable pipette tip to cleverly attract the extracted DNA from the droplet residing on a superhydrophobic surface, which took less than 10 min. Following extraction, the 1500 bp sequence of Peptidase D from E. coli was amplified using rapid droplet thermocycling, which took 10 min for 30 cycles. The total assay time was 23 min, including droplet centrifugation, droplet DNA extraction and rapid droplet thermocycling. Evaporation from of 10 μL droplets was not significant during these procedures, since the longest time exposure to air and the vibrations was less than 5 min (during DNA extraction. The results of these sequentially executed processes were analyzed using gel electrophoresis. Thus, this work demonstrates the adaptability of the system to replace many common laboratory tasks on a single platform (through re-programmability, in rapid succession (using droplets

  17. Rapid Screening of Natural Plant Extracts with Calcium Diacetate for Differential Effects Against Foodborne Pathogens and a Probiotic Bacterium.

    Science.gov (United States)

    Colonna, William; Brehm-Stecher, Byron; Shetty, Kalidas; Pometto, Anthony

    2017-12-01

    This study focused on advancing a rapid turbidimetric bioassay to screen antimicrobials using specific cocktails of targeted foodborne bacterial pathogens. Specifically, to show the relevance of this rapid screening tool, the antimicrobial potential of generally recognized as safe calcium diacetate (DAX) and blends with cranberry (NC) and oregano (OX) natural extracts was evaluated. Furthermore, the same extracts were evaluated against beneficial lactic acid bacteria. The targeted foodborne pathogens evaluated were Escherichia coli O157:H7, Salmonella spp., Listeria monocytogenes, and Staphylococcus aureus using optimized initial cocktails (∼108 colony-forming unit/mL) containing strains isolated from human food outbreaks. Of all extracts evaluated, 0.51% (w/v) DAX in ethanol was the most effective against all four pathogens. However, DAX when reduced to 0.26% and with added blends from ethanol extractions consisting of DAX:OX (3:1), slightly outperformed or was equal to same levels of DAX alone. Subculture of wells in which no growth occurred after 1 week indicated that all water and ethanol extracts were bacteriostatic against the pathogens tested. All the targeted antimicrobials had no effect on the probiotic organism Lactobacillus plantarum. The use of such rapid screening methods combined with the use of multistrain cocktails of targeted foodborne pathogens from outbreaks will allow rapid large-scale screening of antimicrobials and enable further detailed studies in targeted model food systems.

  18. Optimisation of pressurised liquid extraction (PLE) for rapid and efficient extraction of superficial and total mineral oil contamination from dry foods.

    Science.gov (United States)

    Moret, Sabrina; Scolaro, Marianna; Barp, Laura; Purcaro, Giorgia; Sander, Maren; Conte, Lanfranco S

    2014-08-15

    Pressurised liquid extraction (PLE) represents a powerful technique which can be conveniently used for rapid extraction of mineral oil saturated (MOSH) and aromatic hydrocarbons (MOAH) from dry foods with a low fat content, such as semolina pasta, rice, and other cereals. Two different PLE methods, one for rapid determination of superficial contamination mainly from the packaging, the other for efficient extraction of total contamination from different sources, have been developed and optimised. The two methods presented good performance characteristics in terms of repeatability (relative standard deviation lower than 5%) and recoveries (higher than 95%). To show their potentiality, the two methods have been applied in combination on semolina pasta and rice packaged in direct contact with recycled cardboard. In the case of semolina pasta it was possible to discriminate between superficial contamination coming from the packaging, and pre-existing contamination (firmly enclosed into the matrix). Copyright © 2014 Elsevier Ltd. All rights reserved.

  19. A Rapid and Reliable Method for Total Protein Extraction from Succulent Plants for Proteomic Analysis.

    Science.gov (United States)

    Lledías, Fernando; Hernández, Felipe; Rivas, Viridiana; García-Mendoza, Abisaí; Cassab, Gladys I; Nieto-Sotelo, Jorge

    2017-08-01

    Crassulacean acid metabolism plants have some morphological features, such as succulent and reduced leaves, thick cuticles, and sunken stomata that help them prevent excessive water loss and irradiation. As molecular constituents of these morphological adaptations to xeric environments, succulent plants produce a set of specific compounds such as complex polysaccharides, pigments, waxes, and terpenoids, to name a few, in addition to uncharacterized proteases. Since all these compounds interfere with the analysis of proteins by electrophoretic techniques, preparation of high quality samples from these sources represents a real challenge. The absence of adequate protocols for protein extraction has restrained the study of this class of plants at the molecular level. Here, we present a rapid and reliable protocol that could be accomplished in 1 h and applied to a broad range of plants with reproducible results. We were able to obtain well-resolved SDS/PAGE protein patterns in extracts from different members of the subfamilies Agavoideae (Agave, Yucca, Manfreda, and Furcraea), Nolinoideae (Dasylirion and Beucarnea), and the Cactaceae family. This method is based on the differential solubility of contaminants and proteins in the presence of acetone and pH-altered solutions. We speculate about the role of saponins and high molecular weight carbohydrates to produce electrophoretic-compatible samples. A modification of the basic protocol allowed the analysis of samples by bidimensional electrophoresis (2DE) for proteomic analysis. Furostanol glycoside 26-O-β-glucosidase (an enzyme involved in steroid saponin synthesis) was successfully identified by mass spectrometry analysis and de novo sequencing of a 2DE spot from an Agave attenuata sample.

  20. Rapid validated HPTLC method for estimation of betulinic acid in Nelumbo nucifera (Nymphaeaceae) rhizome extract.

    Science.gov (United States)

    Mukherjee, Debajyoti; Kumar, N Satheesh; Khatua, Taraknath; Mukherjee, Pulok K

    2010-01-01

    Betulinic acid (pentacyclic triterpenoid) is an important marker component present in Nelumbo nucifera Gaertn. rhizome. N. nucifera rhizome has several medicinal uses including hypoglycaemic, antidiarrhoeal, antimicrobial, diuretic, antipyretic, psychopharmacological activities. To establish a simple, sensitive, reliable, rapid and validated high-performance thin-layer chromatography method for estimation of betulinic acid in hydro-alcoholic extract of N. nucifera Gaertn. rhizome. The separation was carried out on a thin-layer chromatography aluminium plate pre-coated with silica gel 60F(254) , eluted with chloroform, methanol and formic acid (49 : 1 : 1 v/v). Post chromatographic derivatisation was done with anisaldehyde-sulphuric acid reagent and densitometric scanning was performed using a Camag TLC scanner III, at 420 nm. The system was found to produce a compact spot for betulinic acid (R(f) = 0.30). A good linear precision relationship between the concentrations (2-10 µg) and peak areas were obtained with the correlation coefficient (r) of 0.99698. The limit of detection and limit of quantification of betulinic acid were detected to be 0.4 and 2.30 µg per spot. The percentage of recovery was found to be 98.36%. The percentage relative standard deviations of intra-day and inter-day precisions were 0.82-0.394 and 0.85-0.341, respectively. This validated HPTLC method provides a new and powerful approach to estimate betulinic acid as phytomarker in the extract. Copyright © 2010 John Wiley & Sons, Ltd.

  1. A simple and rapid infrared-assisted self enzymolysis extraction method for total flavonoid aglycones extraction from Scutellariae Radix and mechanism exploration.

    Science.gov (United States)

    Wang, Liping; Duan, Haotian; Jiang, Jiebing; Long, Jiakun; Yu, Yingjia; Chen, Guiliang; Duan, Gengli

    2017-09-01

    A new, simple, and fast infrared-assisted self enzymolysis extraction (IRASEE) approach for the extraction of total flavonoid aglycones (TFA) mainly including baicalein, wogonin, and oroxylin A from Scutellariae Radix is presented to enhance extraction yield. Extraction enzymolysis temperature, enzymolysis liquid-to-solid ratio, enzymolysis pH, enzymolysis time and infrared power, the factors affecting IRASEE procedure, were investigated in a newly designed, temperature-controlled infrared-assisted extraction (TC-IRAE) system to acquire the optimum analysis conditions. The results illustrated that IRASEE possessed great advantages in terms of efficiency and time compared with other conventional extraction techniques. Furthermore, the mechanism of IRASEE was preliminarily explored by observing the microscopic change of the samples surface structures, studying the main chemical compositions change of the samples before and after extraction and investigating the kinetics and thermodynamics at three temperature levels during the IRASEE process. These findings revealed that IRASEE can destroy the surface microstructures to accelerate the mass transfer and reduce the activation energy to intensify the chemical process. This integrative study presents a simple, rapid, efficient, and environmental IRASEE method for TFA extraction which has promising prospects for other similar herbal medicines. Graphical Abstract ᅟ.

  2. Rapid and sensitive diagnosis of fungal keratitis with direct PCR without template DNA extraction.

    Science.gov (United States)

    Zhao, G; Zhai, H; Yuan, Q; Sun, S; Liu, T; Xie, L

    2014-10-01

    This study was aimed at developing a direct PCR assay without template DNA extraction for the rapid and sensitive diagnosis of infectious keratitis. Eighty corneal scrapings from 67 consecutive patients with clinically suspected infectious keratitis were analysed prospectively. Direct PCR was performed with all scrapings, with specific primers for fungi, bacteria, herpes simplex virus-1 (HSV-1) and Acanthamoeba simultaneously. The results were compared with those obtained from culture, smear, and confocal microscopy. Discrepant results were resolved according to the therapeutic effects of the corresponding antimicrobial drugs. The lowest detection limit of direct PCR was ten copies of each pathogen. Sixty-six scrapings yielded positive results with direct PCR, giving a total positive detection rate of 82.5% (66/80). For 34 patients with high suspicion of fungal keratitis, the positive detection rate of direct PCR was 84.8% (39/46). This rate increased to 91.2% (31/34) when repeated scrapings were excluded, and was significantly higher than the rates obtained with culture (35.3%, 12/34) and smear (64.7%, 22/34) (p keratitis with direct PCR and culture were 98.0% and 47.1% (p keratitis, and it is expected to have an impact on the diagnosis and treatment of infectious keratitis in the future. © 2014 The Authors Clinical Microbiology and Infection © 2014 European Society of Clinical Microbiology and Infectious Diseases.

  3. Recyclable bio-reagent for rapid and selective extraction of contaminants from soil

    Energy Technology Data Exchange (ETDEWEB)

    Lomasney, H.L. [ISOTRON Corp., New Orleans, LA (United States)

    1997-10-01

    This Phase I Small Business Innovation Research program is confirming the effectiveness of a bio-reagent to cost-effectively and selectively extract a wide range of heavy metals and radionuclide contaminants from soil. This bioreagent solution, developed by ISOTRON{reg_sign} Corporation (New Orleans, LA), is flushed through the soil and recycled after flowing through an electrokinetic separation module, also developed by ISOTRON{reg_sign}. The process is ex situ, and the soil remains in its transport container through the decontamination process. The transport container can be a fiberglass box, or a bulk bag or {open_quotes}super sack.{close_quotes} Rocks, vegetation, roots, etc. need not be removed. High clay content soils are accommodated. The process provides rapid injection of reagent solution, and when needed, sand is introduced to speed up the heap leach step. The concentrated waste form is eventually solidified. The bio-reagent is essentially a natural product, therefore any solubizer residual in soil is not expected to cause regulatory concern. The Phase I work will confirm the effectiveness of this bio-reagent on a wide range of contaminants, and the engineering parameters that are needed to carry out a full-scale demonstration of the process. ISOTRON{reg_sign} scientists will work with contaminated soil from Los Alamos National Laboratory. LANL is in the process of decontaminating and decommissioning more than 300 sites within its complex, many of which contain heavy metals or radionuclides; some are mixed wastes containing TCE, PCB, and metals.

  4. Development of a micropulverized extraction method for rapid toxicological analysis of methamphetamine in hair.

    Science.gov (United States)

    Miyaguchi, Hajime; Kakuta, Masaya; Iwata, Yuko T; Matsuda, Hideaki; Tazawa, Hidekatsu; Kimura, Hiroko; Inoue, Hiroyuki

    2007-09-07

    We developed a rapid sample preparation method for the toxicological analysis of methamphetamine and amphetamine (the major metabolite of methamphetamine) in human hair by high-performance liquid chromatography-tandem mass spectrometry (HPLC-MS/MS), to facilitate fast screening and quantitation. Two milligrams of hair were mechanically micropulverized for 5 min in a 2-ml plastic tube together with 100 microl of an aqueous solvent containing 10% acetonitrile, 100 mM trifluoroacetic acid and the corresponding deuterium analogues as internal standards. The pulverizing highly disintegrated the hair components, simultaneously allowing the extraction of any drugs present in the hair. After filtering the suspension with a membrane-filter unit, the clear filtrate was directly analyzed by HPLC-MS/MS. No evaporation processes were required for sample preparation. Method optimization and validation study were carried out using real-case specimens and fortified samples in which the drugs had been artificially absorbed, respectively. Concentration ranges for quantitation were 0.040-125 and 0.040-25 ng/mg for methamphetamine and amphetamine, respectively. Real-case specimens were analyzed by the method presented here and by conventional ones to verify the applicability of our method to real-world analysis. Our method took less than 30 min for a set of chromatograms to be obtained from a washed hair sample.

  5. An Alternative and Rapid Method for the Extraction of Nucleic Acids from Ixodid Ticks by Potassium Acetate Procedure

    Directory of Open Access Journals (Sweden)

    Islay Rodríguez

    2014-08-01

    Full Text Available Four variants of the potassium acetate procedure for DNA extraction from ixodid ticks at different stage of their life cycles were evaluated and compared with phenol-chloroform and ammonium hydroxide methods. The most rapid and most efficient variant was validated in the DNA extraction procedure from the engorged ticks collected from bovine, canine as well as from house ticks for the screening of Borrelia burgdorferi sensu lato, Anaplasma spp. and Babesia spp. The ammonium hydroxide procedure was used for non-engorged ticks. All the variants were efficient and allowed obtaining PCR-quality material according to the specific amplification of 16S rRNA gene fragment of the original tick. DNA extracted from the ticks under the study was tested by multiplex PCR for the screening of tick-borne pathogens. Anaplasma spp. and Babesia spp. amplification products were obtained from 29/48 extracts. Ammonium hydroxide protocol was not efficient for two extracts. Detection of amplification products from the PCR indicated that DNA had been successfully extracted. The potassium acetate procedure could be an alternative, rapid, and reliable method for DNA extraction from the ixodid ticks, mainly for poorly-resourced laboratories.

  6. Comparison of rapidly synergistic cloud point extraction and ultrasound-assisted cloud point extraction for trace selenium coupled with spectrophotometric determination.

    Science.gov (United States)

    Wen, Xiaodong; Zhang, Yanyan; Li, Chunyan; Fang, Xiang; Zhang, Xiaocan

    2014-04-05

    In this work, rapidly synergistic cloud point extraction (RS-CPE) and ultrasound-assisted cloud point extraction (UA-CPE) were firstly compared and coupled with spectrophotometer for selenium preconcentration and detection. The established RS-CPE pretreatment was simple, rapid and high effective. The extraction time was only 1min without heating process. Under the effect of ultrasound, UA-CPE accomplished extraction efficiently although the extraction procedure was relatively time-consuming. In this study, RS-CPE and UA-CPE were firstly applied for selenium preconcentration and coupled with conventional spectrophotometer. Their applications were expanded and the analytical performance of spectrophotometric determination for selenium was considerably improved. The influence factors relevant to RS-CPE and UA-CPE were studied in detail. Under the optimal conditions, the limits of detection (LODs) for selenium were respectively 0.2μgL(-1) of RS-CPE and 0.3μgL(-1) of UA-CPE with sensitivity enhancement factors (EFs) of 124 and 103. The developed methods were applied to the determination of trace selenium in real water samples with satisfactory analytical results. Copyright © 2013 Elsevier B.V. All rights reserved.

  7. An enzyme-activatable probe with a self-immolative linker for rapid and sensitive alkaline phosphatase detection and cell imaging through a cascade reaction.

    Science.gov (United States)

    Zhang, Hongmei; Xu, Chenglong; Liu, Jie; Li, Xiaohong; Guo, Lin; Li, Xinming

    2015-04-25

    We report the design and synthesis of a novel probe (1) for ALP assay by incorporating a self-immolative linker between a phosphate moiety and resorufin. Because of its good biocompatibility and rapid cell internalization, this probe also exhibited great potential for real-time monitoring of endogenous phosphatase activity in living cells.

  8. Chemical analysis and study of immunoenhancing and antioxidant property of a glucan isolated from an alkaline extract of a somatic hybrid mushroom of Pleurotus florida and Calocybe indica variety APK2.

    Science.gov (United States)

    Maity, Kousik; Kar Mandal, Eshita; Maity, Saikat; Gantait, Sanjoy K; Das, Debsankar; Maiti, Swatilekha; Maiti, Tapas K; Sikdar, Samir R; Islam, Syed S

    2011-11-01

    A water-soluble glucan isolated from an alkaline extract of fruit bodies of a somatic hybrid mushroom PCH9FB of Pleurotus florida and Calocybe indica var. APK2 strains showed antioxidant properties with immune activation of macrophage, splenocyte, and thymocyte. On the basis of acid hydrolysis, methylation, periodate oxidation and NMR studies ((1)H, (13)C, DEPT-135, DQF-COSY, TOCSY, NOESY, ROESY, HMQC, and HMBC) the structure of the repeating unit of the glucan was established as: [structure: see text]. Copyright © 2011 Elsevier B.V. All rights reserved.

  9. Ball mill assisted rapid mechanochemical extraction method for natural products from plants.

    Science.gov (United States)

    Wang, Man; Bi, Wentao; Huang, Xiaohua; Chen, David Da Yong

    2016-06-03

    A ball mill assisted mechanochemical extraction method was developed to extract compounds of natural product (NP) from plant using ionic liquid (IL). A small volume ball mill, also known as PastPrep(®) Homogenizer, which is often used for high-speed lysis of biological samples and for other applications, was used to dramatically increase the speed, completeness and reproducibility of the extraction process at room temperature to preserve the chemical integrity of the extracted compounds. In this study, tanshinones were selected as target compounds to evaluate the performance of this extraction method. Factors affecting the extraction efficiency, such as the duration, IL concentration and solid/liquid ratio were systematically optimized using the response surface methodology. Under the optimized conditions, the described method was more efficient and much faster than the conventional extraction methods such as methanol based ultrasound assisted extraction (UAE) and heat reflux extraction (HRE) that consumes a lot more organic solvent. In addition, the natural products of interest were enriched by anion metathesis of ionic liquids, combining extraction and preconcentration in the same process. The extractant was analyzed by HPLC and LC-MS. The reproducibility (RSD, n=5), correlation coefficient (r(2)) of the calibration curve, and the limit of detection, were determined to be in the range of 4.7-5.2%, 0.9992-0.9995, and 20-51ng/mL, respectively. Copyright © 2016 Elsevier B.V. All rights reserved.

  10. New extraction technique for alkaloids

    Directory of Open Access Journals (Sweden)

    Djilani Abdelouaheb

    2006-01-01

    Full Text Available A method of extraction of natural products has been developed. Compared with existing methods, the new technique is rapid, more efficient and consumes less solvent. Extraction of alkaloids from natural products such as Hyoscyamus muticus, Datura stramonium and Ruta graveolens consists of the use of a sonicated solution containing a surfactant as extracting agent. The alkaloids are precipitated by Mayer reagent, dissolved in an alkaline solution, and then extracted with chloroform. This article compares the results obtained with other methods showing clearly the advantages of the new method.

  11. The BUME method: a new rapid and simple chloroform-free method for total lipid extraction of animal tissue

    Science.gov (United States)

    Löfgren, Lars; Forsberg, Gun-Britt; Ståhlman, Marcus

    2016-06-01

    In this study we present a simple and rapid method for tissue lipid extraction. Snap-frozen tissue (15-150 mg) is collected in 2 ml homogenization tubes. 500 μl BUME mixture (butanol:methanol [3:1]) is added and automated homogenization of up to 24 frozen samples at a time in less than 60 seconds is performed, followed by a 5-minute single-phase extraction. After the addition of 500 μl heptane:ethyl acetate (3:1) and 500 μl 1% acetic acid a 5-minute two-phase extraction is performed. Lipids are recovered from the upper phase by automated liquid handling using a standard 96-tip robot. A second two-phase extraction is performed using 500 μl heptane:ethyl acetate (3:1). Validation of the method showed that the extraction recoveries for the investigated lipids, which included sterols, glycerolipids, glycerophospholipids and sphingolipids were similar or better than for the Folch method. We also applied the method for lipid extraction of liver and heart and compared the lipid species profiles with profiles generated after Folch and MTBE extraction. We conclude that the BUME method is superior to the Folch method in terms of simplicity, through-put, automation, solvent consumption, economy, health and environment yet delivering lipid recoveries fully comparable to or better than the Folch method.

  12. A rapid and reliable procedure for extraction of cellular polyamines and inorganic ions from plant tissues

    Science.gov (United States)

    Rakesh Minocha; Walter C. Shortle; Stephanie L. Long; Subhash C. Minocha

    1994-01-01

    A fast and reliable method for the extraction of cellular polyamines and major inorganic ions (Ca, Mg, Mn, K, and P) from several plant tissues is described. The method involves repeated freezing and thawing of samples instead of homogenization. The efficiency of extraction of both the polyamines and inorganic ions by these two methods was compared for 10 different...

  13. A rapid and low-cost DNA extraction method for isolating ...

    African Journals Online (AJOL)

    The price of commercial DNA extraction methods makes the routine use of polymerase chain reaction amplification (PCR) based methods rather costly for scientists in developing countries. A guanidium thiocayante-based DNA extraction method was investigated in this study for the isolation of Escherichia coli (E. coli) DNA ...

  14. Terra-Kleen Response Group, Inc. Solvent Extraction Technology Rapid Commercialization Initiative Report

    Science.gov (United States)

    Terra-Kleen Response Group Inc. (Terra-Kleen), has commercialized a solvent extraction technology that uses a proprietary extraction solvent to transfer organic constituents from soil to a liquid phase in a batch process at ambient temperatures. The proprietary solvent has a rel...

  15. Alkaline Phosphatase: An Overview

    National Research Council Canada - National Science Library

    Sharma, Ujjawal; Pal, Deeksha; Prasad, Rajendra

    .... Alkaline phosphatase is divided into four isozymes depending upon the site of tissue expression that are Intestinal ALP, Placental ALP, Germ cell ALP and tissue nonspecific alkaline phosphatase or liver/bone/kidney (L/B/K) ALP...

  16. Towards a method of rapid extraction of strontium-90 from urine: urine pretreatment and alkali metal removal

    Energy Technology Data Exchange (ETDEWEB)

    Hawkins, C. [Argonne National Lab. (ANL), Argonne, IL (United States); Dietz, M. [Argonne National Lab. (ANL), Argonne, IL (United States); Kaminski, M. [Argonne National Lab. (ANL), Argonne, IL (United States); Mertz, C. [Argonne National Lab. (ANL), Argonne, IL (United States); Shkrob, I. [Argonne National Lab. (ANL), Argonne, IL (United States)

    2016-03-01

    A technical program to support the Centers of Disease Control and Prevention is being developed to provide an analytical method for rapid extraction of Sr-90 from urine, with the intent of assessing the general population’s exposure during an emergency response to a radiological terrorist event. Results are presented on the progress in urine sample preparation and chemical separation steps that provide an accurate and quantitative detection of Sr-90 based upon an automated column separation sequence and a liquid scintillation assay. Batch extractions were used to evaluate the urine pretreatment and the column separation efficiency and loading capacity based upon commercial, extractant-loaded resins. An efficient pretreatment process for decolorizing and removing organics from urine without measurable loss of radiostrontium from the sample was demonstrated. In addition, the Diphonix® resin shows promise for the removal of high concentrations of common strontium interferents in urine as a first separation step for Sr-90 analysis.

  17. Rapid validated HPTLC method for estimation of piperine and piperlongumine in root of Piper longum extract and its commercial formulation

    Directory of Open Access Journals (Sweden)

    Anagha A. Rajopadhye

    2012-12-01

    Full Text Available Piperine and piperlongumine, alkaloids having diverse biological activities, commonly occur in roots of Piper longum L., Piperaceae, which have high commercial, economical and medicinal value. In present study, rapid, validated HPTLC method has been established for the determination of piperine and piperlongumine in methanolic root extract and its commercial formulation 'Mahasudarshan churna®' using ICH guidelines. The use of Accelerated Solvent Extraction (ASE as an alternative to conventional techniques has been explored. The methanol extracts of root, its formulation and both standard solutions were applied on silica gel F254 HPTLC plates. The plates were developed in Twin chamber using mobile phase toluene: ethyl acetate (6:4, v/v and scanned at 342 and 325 nm (λmax of piperine and piperlongumine, respectively using Camag TLC scanner 3 with CATS 4 software. A linear relationship was obtained between response (peak area and amount of piperine and piperlongumine in the range of 20-100 and 30-150 ng/spot, respectively; the correlation coefficient was 0.9957 and 0.9941 respectively. Sharp, symmetrical and well resolved peaks of piperine and piperlongumine spots resolved at Rf 0.51 and 0.74, respectively from other components of the sample extracts. The HPTLC method showed good linearity, recovery and high precision of both markers. Extraction of plant using ASE and rapid HPTLC method provides a new and powerful approach to estimate piperine and piperlongumine as phytomarkers in the extract as well as its commercial formulations for routine quality control.

  18. Rapid validated HPTLC method for estimation of piperine and piperlongumine in root of Piper longum extract and its commercial formulation

    Directory of Open Access Journals (Sweden)

    Anagha A. Rajopadhye

    2012-09-01

    Full Text Available Piperine and piperlongumine, alkaloids having diverse biological activities, commonly occur in roots of Piper longum L., Piperaceae, which have high commercial, economical and medicinal value. In present study, rapid, validated HPTLC method has been established for the determination of piperine and piperlongumine in methanolic root extract and its commercial formulation 'Mahasudarshan churna®' using ICH guidelines. The use of Accelerated Solvent Extraction (ASE as an alternative to conventional techniques has been explored. The methanol extracts of root, its formulation and both standard solutions were applied on silica gel F254 HPTLC plates. The plates were developed in Twin chamber using mobile phase toluene: ethyl acetate (6:4, v/v and scanned at 342 and 325 nm (λmax of piperine and piperlongumine, respectively using Camag TLC scanner 3 with CATS 4 software. A linear relationship was obtained between response (peak area and amount of piperine and piperlongumine in the range of 20-100 and 30-150 ng/spot, respectively; the correlation coefficient was 0.9957 and 0.9941 respectively. Sharp, symmetrical and well resolved peaks of piperine and piperlongumine spots resolved at Rf 0.51 and 0.74, respectively from other components of the sample extracts. The HPTLC method showed good linearity, recovery and high precision of both markers. Extraction of plant using ASE and rapid HPTLC method provides a new and powerful approach to estimate piperine and piperlongumine as phytomarkers in the extract as well as its commercial formulations for routine quality control.

  19. A single-step method for rapid extraction of total lipids from green microalgae.

    Directory of Open Access Journals (Sweden)

    Martin Axelsson

    Full Text Available Microalgae produce a wide range of lipid compounds of potential commercial interest. Total lipid extraction performed by conventional extraction methods, relying on the chloroform-methanol solvent system are too laborious and time consuming for screening large numbers of samples. In this study, three previous extraction methods devised by Folch et al. (1957, Bligh and Dyer (1959 and Selstam and Öquist (1985 were compared and a faster single-step procedure was developed for extraction of total lipids from green microalgae. In the single-step procedure, 8 ml of a 2∶1 chloroform-methanol (v/v mixture was added to fresh or frozen microalgal paste or pulverized dry algal biomass contained in a glass centrifuge tube. The biomass was manually suspended by vigorously shaking the tube for a few seconds and 2 ml of a 0.73% NaCl water solution was added. Phase separation was facilitated by 2 min of centrifugation at 350 g and the lower phase was recovered for analysis. An uncharacterized microalgal polyculture and the green microalgae Scenedesmus dimorphus, Selenastrum minutum, and Chlorella protothecoides were subjected to the different extraction methods and various techniques of biomass homogenization. The less labour intensive single-step procedure presented here allowed simultaneous recovery of total lipid extracts from multiple samples of green microalgae with quantitative yields and fatty acid profiles comparable to those of the previous methods. While the single-step procedure is highly correlated in lipid extractability (r² = 0.985 to the previous method of Folch et al. (1957, it allowed at least five times higher sample throughput.

  20. Airborne LIDAR and high resolution satellite data for rapid 3D feature extraction

    Science.gov (United States)

    Jawak, S. D.; Panditrao, S. N.; Luis, A. J.

    2014-11-01

    This work uses the canopy height model (CHM) based workflow for individual tree crown delineation and 3D feature extraction approach (Overwatch Geospatial's proprietary algorithm) for building feature delineation from high-density light detection and ranging (LiDAR) point cloud data in an urban environment and evaluates its accuracy by using very high-resolution panchromatic (PAN) (spatial) and 8-band (multispectral) WorldView-2 (WV-2) imagery. LiDAR point cloud data over San Francisco, California, USA, recorded in June 2010, was used to detect tree and building features by classifying point elevation values. The workflow employed includes resampling of LiDAR point cloud to generate a raster surface or digital terrain model (DTM), generation of a hill-shade image and an intensity image, extraction of digital surface model, generation of bare earth digital elevation model (DEM) and extraction of tree and building features. First, the optical WV-2 data and the LiDAR intensity image were co-registered using ground control points (GCPs). The WV-2 rational polynomial coefficients model (RPC) was executed in ERDAS Leica Photogrammetry Suite (LPS) using supplementary *.RPB file. In the second stage, ortho-rectification was carried out using ERDAS LPS by incorporating well-distributed GCPs. The root mean square error (RMSE) for the WV-2 was estimated to be 0.25 m by using more than 10 well-distributed GCPs. In the second stage, we generated the bare earth DEM from LiDAR point cloud data. In most of the cases, bare earth DEM does not represent true ground elevation. Hence, the model was edited to get the most accurate DEM/ DTM possible and normalized the LiDAR point cloud data based on DTM in order to reduce the effect of undulating terrain. We normalized the vegetation point cloud values by subtracting the ground points (DEM) from the LiDAR point cloud. A normalized digital surface model (nDSM) or CHM was calculated from the LiDAR data by subtracting the DEM from the DSM

  1. [Rapid determination of nine components in the first extraction process of Xingnaojing injection by using ultraviolet spectroscopy].

    Science.gov (United States)

    Huang, Kai-Yi; Wei, Dan-Ni; Fang, Jin-Yang; Li, Xi-Yuan; Yan, Bin-Jun

    2017-10-01

    In this study, an analytical method based on ultraviolet spectroscopy was established for the rapid determination of nine components including isophorone, 4-methylene-isophorone, curcumenone, curcumenol, curdione, curzerenone, furanodienone, curcumol and germacrone in the first extraction process of Xingnaojing injection. 166 distillate samples of Gardeniae Fructus and Radix Curcumae were collected in the first extraction process of Xingnaojing injection. The ultraviolet spectra of these samples were collected, and the contents of the nine components in these samples were determined by high performance liquid chromatography. Least squares support vector machine and radial basis function artificial neural network were used to establish the multivariate calibration models between the ultraviolet spectra and the contents of the nine components. The results showed that the established ultraviolet spectrum analysis method can determine the contents of the nine components in the distillates accurately, with root mean square error of prediction of 0.068, 0.147, 0.215, 0.319, 1.01, 1.27, 0.764, 0.147, 0.610 mg•L⁻¹, respectively. This proposed method is a rapid, simple and low-cost tool for the monitoring and endpoint determination of the extraction process of Xingnaojing injection to reduce quality defects and variations. Copyright© by the Chinese Pharmaceutical Association.

  2. Collision-induced fragmentation accurate mass spectrometric analysis methods to rapidly characterize plant extracts

    Science.gov (United States)

    The rapid advances in analytical chromatography equipment have made the reliable and reproducible measurement of a wide range of plant chemical components possible. Full chemical characterization of a given plant material is possible with the new mass spectrometers currently available. For phytochem...

  3. Collision-induced fragmentation accurate mass spectrometric analysis methods to rapidly characterize phytochemicals in plant extracts

    Science.gov (United States)

    The rapid advances in analytical chromatography equipment have made the reliable and reproducible measurement of a wide range of plant chemical components possible. Full chemical characterization of a given plant material is possible with the new mass spectrometers currently available. New methods a...

  4. rapid mini-prep DNA extraction method in rice (Oryza sativa ...

    African Journals Online (AJOL)

    method, optimized for rice, which was achieved via some modifications in present DNA extraction methods, especially in first step of cell wall lyses and the use of cheap and frequent chemicals found in every laboratory is presented. Normal quality and quantity was obtained by the method. The PCR based assays also ...

  5. A simple and rapid DNA extraction method for Chlamydia trachomatis detection from urogenital swabs.

    Science.gov (United States)

    Butzler, Matthew A; Reed, Jennifer L; McFall, Sally M

    2017-11-01

    A highly sensitive and specific Chlamydia trachomatis (CT) diagnostic test was developed by combining filtration isolation of nucleic acid (FINA) extraction with quantitative polymerase chain reaction including an internal control to identify test inhibition. A pilot study of 40 clinical specimens yielded 100% sensitivity and specificity. Copyright © 2017 Elsevier Inc. All rights reserved.

  6. The Rapid Extraction of Gist-Early Neural Correlates of High-level Visual Processing

    NARCIS (Netherlands)

    Oppermann, F.; Hassler, U.; Jescheniak, J.D.; Gruber, T.

    2012-01-01

    The human cognitive system is highly efficient in extracting information from our visual environment. This efficiency is based on acquired knowledge that guides our attention toward relevant events and promotes the recognition of individual objects as they appear in visual scenes. The

  7. Enumeration and rapid identification of yeasts during extraction processes of extra virgin olive oil in Tuscany.

    Science.gov (United States)

    Mari, Eleonora; Guerrini, Simona; Granchi, Lisa; Vincenzini, Massimo

    2016-06-01

    The aim of this study was to evaluate the occurrence of yeast populations during different olive oil extraction processes, carried out in three consecutive years in Tuscany (Italy), by analysing crushed pastes, kneaded pastes, oil from decanter and pomaces. The results showed yeast concentrations ranging between 10(3) and 10(5) CFU/g or per mL. Seventeen dominant yeast species were identified by random amplified polymorphic DNA with primer M13 and their identification was confirmed by restriction fragments length polymorphism of ribosomal internal transcribed spacer and sequencing rRNA genes. The isolation frequencies of each species in the collected samples pointed out that the occurrence of the various yeast species in olive oil extraction process was dependent not only on the yeasts contaminating the olives but also on the yeasts colonizing the plant for oil extraction. In fact, eleven dominant yeast species were detected from the washed olives, but only three of them were also found in oil samples at significant isolation frequency. On the contrary, the most abundant species in oil samples, Yamadazyma terventina, did not occur in washed olive samples. These findings suggest a phenomenon of contamination of the plant for oil extraction that selects some yeast species that could affect the quality of olive oil.

  8. A simple, rapid and efficient method for the extraction of genomic ...

    African Journals Online (AJOL)

    The isolation of intact, high-molecular-mass genomic DNA is essential for many molecular biology applications including long range PCR, endonuclease restriction digestion, southern blot analysis, and genomic library construction. Many protocols are available for the extraction of DNA from plant material, but obtain it is ...

  9. A simple, rapid and efficient method for the extraction of genomic ...

    African Journals Online (AJOL)

    Litchi chinensis Sonn.) was developed. This modified CTAB protocol include the use of 2 M NaCl, PVP, 5% mercaptoethanol and 80% ethanol in the extraction as well as reducing the centrifugation times during the separation and precipitation of ...

  10. Estimation of alkaline phosphatase in the gingival crevicular fluid during orthodontic tooth movement in premolar extraction cases to predict therapeutic progression.

    Science.gov (United States)

    Jeyraj, Yamini; Katta, Anil Kumar; Vannala, Venkataramana; Lokanathan, Divya; Reddy, S N; Rajasigamani, K

    2015-01-01

    The objective was to estimate the level of alkaline phosphatase (ALP) in gingival crevicular fluid (GCF) during en-masse retraction stage of orthodontic tooth movement. 10 patients in the age group of 15-20 years participated in this study. GCF was sampled from the distal surface of the canine and mesial surface of the second premolar on day 0, 1, 7, 14, 21, and 28 postorthodontic treatment. A marked fall in the level of ALP was evident following force application. A progressive decreasing trend in ALP activity on both distal aspect of canine and mesial aspect of the second premolar was observed. The fall in ALP was more on distal aspect canine when compared to the mesial aspect of the second premolar. Measure of ALP activity in GCF could be an indicator of the biochemical and cellular alterations in bone turnover and hence rate the amount of tooth movement following orthodontic force application.

  11. Rapid investigation of α-glucosidase inhibitory activity of Phaleria macrocarpa extracts using FTIR-ATR based fingerprinting

    Directory of Open Access Journals (Sweden)

    Sabina Easmin

    2017-04-01

    Full Text Available Phaleria macrocarpa, known as “Mahkota Dewa”, is a widely used medicinal plant in Malaysia. This study focused on the characterization of α-glucosidase inhibitory activity of P. macrocarpa extracts using Fourier transform infrared spectroscopy (FTIR-based metabolomics. P. macrocarpa and its extracts contain thousands of compounds having synergistic effect. Generally, their variability exists, and there are many active components in meager amounts. Thus, the conventional measurement methods of a single component for the quality control are time consuming, laborious, expensive, and unreliable. It is of great interest to develop a rapid prediction method for herbal quality control to investigate the α-glucosidase inhibitory activity of P. macrocarpa by multicomponent analyses. In this study, a rapid and simple analytical method was developed using FTIR spectroscopy-based fingerprinting. A total of 36 extracts of different ethanol concentrations were prepared and tested on inhibitory potential and fingerprinted using FTIR spectroscopy, coupled with chemometrics of orthogonal partial least square (OPLS at the 4000–400 cm−1 frequency region and resolution of 4 cm−1. The OPLS model generated the highest regression coefficient with R2Y = 0.98 and Q2Y = 0.70, lowest root mean square error estimation = 17.17, and root mean square error of cross validation = 57.29. A five-component (1+4+0 predictive model was build up to correlate FTIR spectra with activity, and the responsible functional groups, such as –CH, –NH, –COOH, and –OH, were identified for the bioactivity. A successful multivariate model was constructed using FTIR-attenuated total reflection as a simple and rapid technique to predict the inhibitory activity.

  12. Microwave-assisted rapid extracellular synthesis of stable bio-functionalized silver nanoparticles from guava (Psidium guajava) leaf extract

    Energy Technology Data Exchange (ETDEWEB)

    Raghunandan, Deshpande [H.K.E.S' s College of Pharmacy (India); Mahesh, Bedre D. [Gulbarga University, Materials Chemistry Laboratory, Department of Material Science (India); Basavaraja, S. [Jawaharlal Nehru Centre for Advanced Scientific Research, Veeco-India Nanotechnology Laboratory (India); Balaji, S. D. [Gulbarga University, Materials Chemistry Laboratory, Department of Material Science (India); Manjunath, S. Y. [Sri Krupa, Institute of Pharmaceutical Science (India); Venkataraman, A., E-mail: raman_chem@rediffmail.com [Gulbarga University, Materials Chemistry Laboratory, Department of Material Science (India)

    2011-05-15

    Our research interest centers on microwave-assisted rapid extracellular synthesis of bio-functionalized silver nanoparticles of 26 {+-} 5 nm from guava (Psidium guajava) leaf extract with control over dimension and composition. The reaction occurs very rapidly as the formation of spherical nanoparticles almost completed within 90 s. The probable pathway of the biosynthesis is suggested. Appearance, crystalline nature, size and shape of nanoparticles are understood by UV-vis (UV-vis spectroscopy), FTIR (fourier transform infrared spectroscopy), XRD (X-ray diffraction), FESEM (field emission scanning electron microscopy) and TEM (transmission electron microscopy) techniques. Microwave-assisted route is selected for the synthesis of silver nanoparticles to carry out the reaction fast, suppress the enzymatic action and to keep the process environmentally clean and green.

  13. Microwave-assisted rapid extracellular synthesis of stable bio-functionalized silver nanoparticles from guava ( Psidium guajava) leaf extract

    Science.gov (United States)

    Raghunandan, Deshpande; Mahesh, Bedre D.; Basavaraja, S.; Balaji, S. D.; Manjunath, S. Y.; Venkataraman, A.

    2011-05-01

    Our research interest centers on microwave-assisted rapid extracellular synthesis of bio-functionalized silver nanoparticles of 26 ± 5 nm from guava ( Psidium guajava) leaf extract with control over dimension and composition. The reaction occurs very rapidly as the formation of spherical nanoparticles almost completed within 90 s. The probable pathway of the biosynthesis is suggested. Appearance, crystalline nature, size and shape of nanoparticles are understood by UV-vis (UV-vis spectroscopy), FTIR (fourier transform infrared spectroscopy), XRD (X-ray diffraction), FESEM (field emission scanning electron microscopy) and TEM (transmission electron microscopy) techniques. Microwave-assisted route is selected for the synthesis of silver nanoparticles to carry out the reaction fast, suppress the enzymatic action and to keep the process environmentally clean and green.

  14. Rapid yeast DNA extraction by boiling and freeze-thawing without using chemical reagents and DNA purification

    Directory of Open Access Journals (Sweden)

    Gildo Almeida da Silva

    2012-04-01

    Full Text Available The purpose of this work was to study a rapid yeast DNA extraction by boiling and freeze-thawing processes without using chemical reagents or any purification procedures, to obtain a high grade PCR-product. A specific DNA fragment of the 18S region of Dekkera bruxellensis and Saccharomyces cerevisiae was chosen. The described boiling and freeze-thawing protocols generated the PCR-grade product preparations and could be used to process many samples. The amplification of the fragments could be observed after 30 and 35 cycles. These processes of extraction without using any kind of chemical reagents, especial water, and purification procedures proved to be efficient, reproducible, simple, fast, and inexpensive.

  15. Microchip-based one step DNA extraction and real-time PCR in one chamber for rapid pathogen identification.

    Science.gov (United States)

    Lee, Jeong-Gun; Cheong, Kwang Ho; Huh, Nam; Kim, Suhyeon; Choi, Jeong-Woo; Ko, Christopher

    2006-07-01

    Optimal detection of a pathogen present in biological samples depends on the ability to extract DNA molecules rapidly and efficiently. In this paper, we report a novel method for efficient DNA extraction and subsequent real-time detection in a single microchip by combining laser irradiation and magnetic beads. By using a 808 nm laser and carboxyl-terminated magnetic beads, we demonstrate that a single pulse of 40 seconds lysed pathogens including E. coli and Gram-positive bacterial cells as well as the hepatitis B virus mixed with human serum. We further demonstrate that the real-time pathogen detection was performed with pre-mixed PCR reagents in a real-time PCR machine using the same microchip, after laser irradiation in a hand-held device equipped with a small laser diode. These results suggest that the new sample preparation method is well suited to be integrated into lab-on-a-chip application of the pathogen detection system.

  16. Effect of acid- and alkaline-aided extractions on functional and rheological properties of proteins recovered from mechanically separated turkey meat (MSTM).

    Science.gov (United States)

    Hrynets, Yuliya; Omana, Dileep A; Xu, Yan; Betti, Mirko

    2010-09-01

    Functional and rheological characteristics of acid- and alkali-extracted proteins from mechanically separated turkey meat (MSTM) have been investigated. Extractions were carried out at 4 pH values (2.5, 3.5, 10.5, and 11.5). The study demonstrated that alkali and acid extractions resulted in significant (P 0.05) by different extraction pH. The protein extracted at pH 3.5 formed a highly viscoelastic gel network as evidenced by storage modulus (G') values, whereas the gel formed from proteins extracted at pH 10.5 was found to be the weakest. The work also revealed that acid treatments were more effective for removal of total heme pigments from MSTM. Color characteristics of protein isolates were markedly improved compared to the initial material and tended to be better when subjected to acid extractions. Mechanically separated meat is one of the cheapest sources of protein obtained by grinding meat and bones together and forcing the mixture through a perforated drum. The use of mechanically separated turkey meat (MSTM) for the production of further processed poultry products is limited due to its undesirable color and textural properties. Recovery of proteins from MSTM using pH shifting process will help the poultry processors to get better returns and also create opportunity to produce functional food ingredients.

  17. [Rapid determination of eight organic acids in plant tissue by sequential extraction and high performance liquid chromatography].

    Science.gov (United States)

    Huang, Tianzhi; Wang, Shijie; Liu Xiuming; Liu, Hong; Wu, Yanyou; Luo Xuqiang

    2014-12-01

    A sequential extraction method was developed to determine different forms of oxalate and seven oxalate-metabolism-related organic acids (glyoxylic acid, tartaric acid, glycolic acid, malic acid, acetic acid, citric acid, succinic acid) in plant tissue. The ultra-pure water was used as the extraction medium to obtain water-soluble oxalic acid and the other seven water-soluble organic acids. After the extraction of the water-soluble organic acids, the residues were extracted by dilute hydrochloric acid successively to get the acid-soluble oxalate which entered the liquid phase. A Hypersil ODS column was used with 5 mmol/L potassium dihydrogen phosphate buffer solution (pH 2. 8) as the mobile phase. The diode array detector was set at 210 nm and the column temperature at 30 °C with the injection volume of 5 µL. The flow rate was controlled at different times which allowed a good and rapid separation of the organic acids and hydrochloric acid. Under these conditions, the linear ranges of the method were 1-2000 mg/L for oxalic acid, 25-2,000 mg/L for acetic acid, and 10-2,000 mg/L for glyoxylic acid, tartaric acid, glycolic acid, malic acid, citric acid and succinic acid, with the correlation coefficients of the eight organic acids ≥ 0. 9996. The average recoveries of the eight organic acids in leaves and roots were 93. 5%-104. 4% and 85. 3%-105. 4% with RSDs of 0. 15% -2.43% and 0. 31%-2. 9% (n=7), respectively. The limits of detection ranged from 1 to 10 ng (S/N=3). The results indicated that the method is accurate, rapid and reproducible for the determination of organic acids in plant samples.

  18. Rapid Column Extraction Method for Actinides and Sr-89/90 in Water Samples

    Energy Technology Data Exchange (ETDEWEB)

    MAXWELL III, SHERROD L.

    2005-06-15

    The SRS Environmental Laboratory analyzes water samples for environmental monitoring, including river water and ground water samples. A new, faster actinide and strontium 89/90 separation method has been developed and implemented to improve productivity, reduce labor costs and add capacity to this laboratory. This method uses stacked TEVA Resin{reg_sign}, TRU Resin{reg_sign} and Sr-Resin{reg_sign} cartridges from Eichrom Technologies (Darien, IL, USA) that allows the rapid separation of plutonium (Pu), neptunium (Np), uranium (U), americium (Am), curium (Cm) and thorium (Th) using a single multi-stage column combined with alpha spectrometry. By using vacuum box cartridge technology with rapid flow rates, sample preparation time is minimized. The method can be used for routine analysis or as a rapid method for emergency preparedness. Thorium and curium are often analyzed separately due to the interference of the daughter of Th-229 tracer, actinium (Ac)-225, on curium isotopes when measured by alpha spectrometry. This new method also adds a separation step using DGA Resin{reg_sign}, (Diglycolamide Resin, Eichrom Technologies) to remove Ac-225 and allow the separation and analysis of thorium isotopes and curium isotopes at the same time.

  19. Rapid green synthesis of silver nanoparticles by aqueous extract of seeds of Nyctanthes arbor-tristis

    Science.gov (United States)

    Basu, Shibani; Maji, Priyankar; Ganguly, Jhuma

    2016-01-01

    The present study explores that the aqueous extract of the seeds of Nyctanthes arbor-tristis (aka night jasmine) is very efficient for the synthesis of stable AgNPs from aqueous solution of AgNO3. The extract acts as both reducing (from Ag+ to Ag0) and capping agent in the aqueous phase. The constituents in extract are mainly biomolecules like carbohydrates and phenolic compounds, which are responsible for the preparation of stable AgNPs within 20 min of reaction time at 25 °C using without any severe conditions. The synthesized silver nanoparticles were characterized with UV-Visible spectroscopy, FT-IR, XRD and SEM. UV-Vis spectroscopy analysis showed peak at 420 nm, which corresponds to the surface plasmon resonance of AgNPs. XRD results showed peaks at (111), (200), (220), which confirmed the presence of AgNPs with face-centered cubic structure. The uniform spherical nature of the AgNPs and size (between 50 and 80 nm) were further confirmed by SEM analysis.

  20. Extraction and Separation of Vitisin D, Ampelopsin B and cis-Vitisin A from Iris lactea Pall. var. chinensis (Fisch.) Koidz by Alkaline Extraction–Acid Precipitation and High-Speed Counter-Current Chromatography

    Science.gov (United States)

    Lv, Huanhuan; Zhou, Wenna; Wang, Xiaoyan; Wang, Zhenhua; Suo, Yourui; Wang, Honglun

    2016-01-01

    Naturally occurring oligostilbenes are receiving more attention because they exhibit several beneficial effects for health, including hepatoprotective, antitumor, anti-adipogenic, antioxidant, antiaging, anti-inflammatory, anti-microbial, antiviral, immunosuppressive and neuroprotective activities. Thus, they could be of some potentially therapeutic values for several diseases. In this study, we adopted the alkaline extraction–acid precipitation (AEAP) method for extraction of oligostilbenes from the seed kernel of Iris lactea. Then, the high-speed counter-current chromatography (HSCCC) was used for preparative isolation and purification of oligostilbenes from the AEAP extracts. Finally, three oligostilbenes, namely vitisin D (73 mg), ampelopsin B (25 mg) and cis-vitisin A (16 mg), were successfully fractionated by HSCCC with a two-phase solvent system composed of n-hexane–ethyl acetate–methanol–water (2:5:3:6, v/v/v/v) from 300 mg of the AEAP extracts in ∼190 min. The purities of the three isolated oligostilbenes were all over 95.0% as analyzed by high performance liquid chromatography. They all were isolated from I. lactea for the first time. The method of AEAP for the preparation of the oligostilbene-enriched crude sample was simple, and the HSCCC technique for the isolation and purification of oligostilbenes was efficient. PMID:26847919

  1. Rapid DNA extraction for specific detection and quantitation of Mycobacterium tuberculosis DNA in sputum specimens using taqman assays

    Science.gov (United States)

    Gomez, Diana I.; Mullin, Caroline S.; Mora-Guzmán, Francisco; Crespo-Solis, J. Gonzalo; Fisher-Hoch, Susan P.; McCormick, Joseph B.; Restrepo, Blanca I.

    2011-01-01

    SUMMARY Rapid tuberculosis (TB) detection is critical for disease control, and further quantitation of Mycobacterium tuberculosis (Mtb) in sputum is valuable for epidemiological and clinical studies. We evaluated a simple, robust and cost-efficient in-house DNA extraction and downstream taqman approach for detection and quantitation of Mtb genomes from sputum of newly-diagnosed TB patients and non-TB controls. DNA was extracted using guanidine isothiocyanate and silica-based spin columns in less than 2h, stored frozen, and taqman assays were used to detect Mtb with IS6110 and quantify it targeting RD1 and IS1081. The taqmans had a sensitivity > 95% in 108 culture-confirmed TB patients and specificity of 100% in 43 non-TB controls. Genome counts were correlated with the Mycobacterial Growth Indicator Tubes’ (MGIT) time-to-detection values (1/TTD×1000; rho=0.66; p<0.001) in 91 TB patients (33 excluded with MGIT contamination). This linear relationship was nearly identical between mycobacteria isolated from sputum and H37Rv Mtb grown in-vitro to its log phase. TB treatment between 3 and 7 days was associated with lower 1/TTD×1000 values but not with genome counts. Together, our protocol provides rapid, specific, inexpensive and quantitative detection of Mtb DNA in fresh or stored sputa making it a robust tool for prompt TB diagnosis, and with potential use for clinical and epidemiologic studies. PMID:22088321

  2. Rapid fingerprinting and classification of extra virgin olive oil by microjet sampling and extractive electrospray ionization mass spectrometry.

    Science.gov (United States)

    Law, Wai Siang; Chen, Huan Wen; Balabin, Roman; Berchtold, Christian; Meier, Lukas; Zenobi, Renato

    2010-04-01

    Microjet sampling in combination with extractive electrospray ionization (EESI) mass spectrometry (MS) was applied to the rapid characterization and classification of extra virgin olive oil (EVOO) without any sample pretreatment. When modifying the composition of the primary ESI spray solvent, mass spectra of an identical EVOO sample showed differences. This demonstrates the capability of this technique to extract molecules with varying polarities, hence generating rich molecular information of the EVOO. Moreover, with the aid of microjet sampling, compounds of different volatilities (e.g.E-2-hexenal, trans-trans-2,4-heptadienal, tyrosol and caffeic acid) could be sampled simultaneously. EVOO data was also compared with that of other edible oils. Principal Component Analysis (PCA) was performed to discriminate EVOO and EVOO adulterated with edible oils. Microjet sampling EESI-MS was found to be a simple, rapid (less than 2 min analysis time per sample) and powerful method to obtain MS fingerprints of EVOO without requiring any complicated sample pretreatment steps.

  3. Rapid screening of dioxin-contaminated soil by accelerated solvent extraction/purification followed by immunochemical detection

    Energy Technology Data Exchange (ETDEWEB)

    Nording, Malin [Umeaa University, Environmental Chemistry, Umeaa (Sweden); Swedish Defence Research Agency, Umeaa (Sweden); Nichkova, Mikaela; Gee, Shirley J.; Hammock, Bruce D. [University of California, Department of Entomology and Cancer Research Center, Davis, CA (United States); Spinnel, Erik; Persson, Ylva; Haglund, Peter [Umeaa University, Environmental Chemistry, Umeaa (Sweden)

    2006-05-15

    Since soils at industrial sites might be heavily contaminated with polychlorinated dibenzo-p-dioxins (PCDDs) and polychlorinated dibenzofurans (PCDFs), there is a need for large-scale soil pollution surveys and, thus, for cost-efficient, high-throughput dioxin analyses. However, trace analysis of dioxins in complex matrices requires exhaustive extraction, extensive cleanup, and very sensitive detection methods. Traditionally, this has involved the use of Soxhlet extraction and multistep column cleanup, followed by gas chromatography - high-resolution mass spectrometry (GC/HRMS), but bioanalytical techniques may allow much more rapid, cost-effective screening. The study presented here explores the possibility of replacing the conventional method with a novel approach based on simultaneous accelerated solvent extraction (ASE) and purification, followed by an enzyme-linked immunosorbent assay (ELISA). Both the traditional and the novel cleanup and detection approaches were applied to contaminated soil samples, and the results were compared. ELISA and GC/HRMS results for Soxhlet-extracted samples were linearly correlated, although the ELISA method slightly underestimated the dioxin levels. To avoid an unacceptable rate of false-negative results, the use of a safety factor is recommended. It was also noted that the relative abundance of the PCDDs/PCDFs, evaluated by principal component analysis, had an impact on the ELISA performance. To minimize this effect, the results may be corrected for differences between the ELISA cross-reactivities and the corresponding toxic equivalency factor values. Finally, the GC/HRMS and ELISA results obtained following the two sample preparation methods agreed well; and the ELISA and GC/HRMS results for ASE extracts were strongly correlated (correlation coefficient, 0.90). Hence, the ASE procedure combined with ELISA analysis appears to be an efficient approach for high-throughput screening of PCDD-/PCDF-contaminated soil samples. (orig.)

  4. Fatty acids are rapidly delivered to and extracted from membranes by methyl-β-cyclodextrin

    OpenAIRE

    Brunaldi, Kellen; Huang, Nasi; Hamilton, James A.

    2010-01-01

    We performed detailed biophysical studies of transfer of long-chain fatty acids (FAs) from methyl-β-CD (MBCD) to model membranes (egg-PC vesicles) and cells and the extraction of FA from membranes by MBCD. We used i) fluorescein phosphatidylethanolamine to detect transfer of FA anions arriving in the outer membrane leaflet; ii) entrapped pH dyes to measure pH changes after FA diffusion (flip-flop) across the lipid bilayer; and iii) soluble fluorescent-labeled FA binding protein to measure the...

  5. Lipophilic extractives from several nonwoody lignocellulosic crops (flax, hemp, sisal, abaca) and their fate during alkaline pulping and TCF/ECF bleaching.

    Science.gov (United States)

    Marques, Gisela; del Río, José C; Gutiérrez, Ana

    2010-01-01

    The fate of lipophilic extractives from several nonwoody species (flax, hemp, sisal and abaca) used for the manufacturing of cellulose pulps, was studied during soda/anthraquinone (AQ) pulping and totally chorine free (TCF) and elemental chlorine free (ECF) bleaching. With this purpose, the lipophilic extracts from the raw materials and their unbleached and bleached industrial pulps, were analyzed by gas chromatography-mass spectrometry. Aldehydes, hydroxyfatty acids and esterified compounds such as ester waxes, sterol esters and alkylferulates strongly decreased after soda/AQ pulping while alkanes, alcohols, free sterols and sterol glycosides survived the cooking process. Among the lipophilic extractives that remained in the unbleached pulps, some amounts of free sterols were still present in the TCF pulps whereas they were practically absent in the ECF pulps. Sterol glycosides were also removed after both TCF and ECF bleaching. By contrast, saturated fatty acids, fatty alcohols and alkanes were still present in both bleached pulps.

  6. Development of a triple hyphenated HPLC-radical scavenging detection-DAD-SPE-NMR system for the rapid identification of antioxidants in complex plant extracts

    NARCIS (Netherlands)

    Pukalskas, A.; Beek, van T.A.; Waard, de P.

    2005-01-01

    A rapid method for the simultaneous detection and identification of radical scavenging compounds in plant extracts was developed by combining an HPLC with on-line radical scavenging using DPPH as a model radical and an HPLC¿DAD¿SPE¿NMR system. Using this method a commercial rosemary extract was

  7. A new rapid method for Clostridium difficile DNA extraction and detection in stool: toward point-of-care diagnostic testing.

    Science.gov (United States)

    Freifeld, Alison G; Simonsen, Kari A; Booth, Christine S; Zhao, Xing; Whitney, Scott E; Karre, Teresa; Iwen, Peter C; Viljoen, Hendrik J

    2012-01-01

    We describe a new method for the rapid diagnosis of Clostridium difficile infection, with stool sample preparation and DNA extraction by heat and physical disruption in a single-use lysis microreactor (LMR), followed by a rapid PCR amplification step. All steps can be accomplished in stool samples with discordant EIA results (GDH(+)/toxin(-)) were tested by both the LMR/PCR assay and the loop-mediated isothermal amplification test (LAMP) (Illumigene C. difficile; Meridian Bioscience, Cincinnati, OH). In 64/69 EIA-discordant samples, LAMP and LMR/PCR results matched (both positive in 29 sample and both negative in 35 samples); in the remaining 5 samples, results were discrepant between the LAMP assay (all five negative) and the LMR/PCR assay (all 5 positive). Overall, LMR/PCR testing matched the current algorithm of EIA and/or LAMP reflex testing in 193/198 (97.5%) samples. The present proof-of-concept study suggests that the novel LMR/PCR technique described here may be developed as an inexpensive, rapid, and reliable point-of-care diagnostic test for C. difficile infection and other infectious diseases. Copyright © 2012 American Society for Investigative Pathology and the Association for Molecular Pathology. Published by Elsevier Inc. All rights reserved.

  8. Recovery of silver from used X-ray film using alkaline protease from ...

    African Journals Online (AJOL)

    Jane Erike-Etchie

    2016-06-29

    . ... Silver recovery from waste of X-ray films by alkaline protease. Time. (min) .... The time factor is important for the stability of the temperature. Alkaline protease proved its activity in extracting silver from used. X-ray films.

  9. Rapid analysis of methamphetamine in hair by micropulverized extraction and microchip-based competitive ELISA.

    Science.gov (United States)

    Miyaguchi, Hajime; Takahashi, Hiroko; Ohashi, Toshinori; Mawatari, Kazuma; Iwata, Yuko T; Inoue, Hiroyuki; Kitamori, Takehiko

    2009-01-30

    An automated full-range quantitation method for identifying d-methamphetamine in human hair using a microchip-based ELISA system (microELISA) in combination with a micropulverized extraction method for sample preparation has been developed. An antibody and a peroxidase-linked methamphetamine, both are commercially available, were used for the competitive ELISA assay. Method validation was carried out using doped hair samples, and segmental analyses of real-case specimens were carried out by both microELISA and LC/MS/MS to verify the reliability and applicability of this new method. Due to the small size of the system and the lack of an evaporation process, sample preparation and quantitation can be accomplished easily and quickly (less than 30 min) in small-scale contamination-free environments.

  10. RAPID DNA EXTRACTION AND PCR VALIDATION FOR DIRECT DETECTION OF Listeria monocytogenes IN RAW MILK

    Directory of Open Access Journals (Sweden)

    Edith Burbano

    2006-05-01

    Full Text Available Objective. The aim of this study was to validate a method for detecting L. monocytogenes in raw milk.Materials and methods. The extraction procedure carried out using a chaotropic agent like NaI, toreduce fat in the sample to 0.2% w/v, which is the lowest limit for detection in the Gerber method, toavoid the polymerization. The raw milk samples were analyzed by using the traditional gold standardmethod for L. monocytogenes. Detection PCR was done on the specificity of primers that recognize theListeria genus by amplifying a specific fragment of about 938bp of the 16S rDNA. Several primer setswere use: L1 (CTCCATAAAGGTGACCCT, U1 (CAGCMGCCGCGGTAATWC, LF (CAAACGTTAACAACGCAGTAand LR (TCCAGAGTGATCGATGTTAA that recognize the hlyA gene of L. monocytogenes, amplifying a 750bpfragment. Results. The DNA of 39 strains evidenced high specificity of the technique since all the strainsof L. monocytogenes amplified the fragments 938bp and 750bp, specifically for genus and species,respectively. The detection limit of the PCR was 101 CFU/ml. T he PCR reproducibility showed a Kappa of0.85; the specificity and sensitivity of 100% were found, predictive positive and negative values were of100% respectively. Conclusions. These results demonstrate that is possible to detect of Listeria spp. byusing any of the three methods since they share the same sensitivity and specificity. One hundred percentof the predictive value for PCR (alternative method provides high reliability, and allows the detection ofthe positive samples. The extraction procedure combined with a PCR method can reduce in 15 days thetime of identification of L. monocytogenes in raw milk. This PCR technique could be adapted and validatedto be use for other types of food such as poultry, meat products and cheeses

  11. Anodes for alkaline electrolysis

    Science.gov (United States)

    Soloveichik, Grigorii Lev [Latham, NY

    2011-02-01

    A method of making an anode for alkaline electrolysis cells includes adsorption of precursor material on a carbonaceous material, conversion of the precursor material to hydroxide form and conversion of precursor material from hydroxide form to oxy-hydroxide form within the alkaline electrolysis cell.

  12. Persistently elevated alkaline phosphatase.

    Science.gov (United States)

    Verma, Jitin; Gorard, David A

    2012-08-24

    A 32-year-old overweight asymptomatic man was found to have a persistently raised serum alkaline phosphatase at 250-300 U/l (normal range liver function tests were unremarkable apart from an initial marginally elevated alanine transaminase, which normalised with weight reduction. Abdominal imaging revealed a fatty liver but an extensive serological search for significant hepatobiliary disease was negative. Subsequent isoenzyme electrophoresis revealed normal liver and bone fractions of alkaline phosphatase but a grossly elevated intestinal fraction. Elevated intestinal fraction of alkaline phosphatase should be considered in the investigation of unexplained alkaline phosphatase, particularly when the usual associated hepatobiliary and bony pathologies are not present. Although an elevated intestinal fraction of alkaline phosphatase can be linked to significant gastrointestinal pathology, this case report highlights that it can be a benign biochemical finding.

  13. Rapid Computer Aided Ligand Design and Screening of Precious Metal Extractants from TRUEX Raffinate with Experimental Validation

    Energy Technology Data Exchange (ETDEWEB)

    Clark, Aurora Sue [Washington State Univ., Pullman, WA (United States); Wall, Nathalie [Washington State Univ., Pullman, WA (United States); Benny, Paul [Washington State Univ., Pullman, WA (United States)

    2015-11-16

    through the design of a software program that uses state-of-the-art computational combinatorial chemistry, and is developed and validated with experimental data acquisition; the resulting tool allows for rapid design and screening of new ligands for the extraction of precious metals from SNF. This document describes the software that has been produced, ligands that have been designed, and fundamental new understandings of the extraction process of Rh(III) as a function of solution phase conditions (pH, nature of acid, etc.).

  14. Environmentally Benign, Rapid, and Selective Extraction of Gold from Ores and Waste Electronic Materials.

    Science.gov (United States)

    Yue, Chunlin; Sun, Huaming; Liu, Wen-Jing; Guan, Binbin; Deng, Xudong; Zhang, Xu; Yang, Peng

    2017-08-01

    The extraction of gold from ores and electronic waste is an important topic worldwide, as this precious metal has immense value in a variety of fields. However, serious environmental pollution and high energy consumption due to the use of toxic oxidation reagents and harsh reaction conditions is a well-known problem in the gold industry. Herein, we report a new chemical method based on the combined use of N-bromosuccinimide (NBS) and pyridine (Py), which has a greatly decreased environmental impact and reagent cost, as well as mild reaction requirements. This method can directly leach Au0 from gold ore and electronic waste to form AuIII in water. The process is achieved in a yield of approximately 90 % at room temperature and a nearly neutral pH. The minimum dose of NBS/Py is as low as 10 mm, which exhibits low toxicity towards mammalian cells and animals as well as aquatic creatures. The high leaching selectivity of Au over other metals during gold leaching is demonstrated, showing that this method has great potential for practical industrial application towards the sustainable refining of gold from ores and electronic waste. © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

  15. Rapid Biosynthesis of Silver Nanoparticles by Exploiting the Reducing Potential of Trapa bispinosa Peel Extract

    Directory of Open Access Journals (Sweden)

    Sunil Pandey

    2013-01-01

    Full Text Available Present work reports exceptionally high reducing capacity of Trapa bispinosa to synthesize monodispersed silver nanoparticles (SNPs within 120 seconds at 30°C which is the shortest tenure reported for SNP synthesis using plants. Moreover, we also instigated impact of different pH values on fabrication of SNPs using visible spectroscopy with respect to time. Percentage conversion of Ag+ ions into Ag° was calculated using ICP-AES analysis and was found to be 97% at pH = 7. To investigate the reduction of Ag+ ions to SNPs, cyclic voltammetry (CV and open circuit potential (OCP using 0.1 M KNO3 were performed. There was prompt reduction in cathodic and anodic currents after addition of the peel extract which indicates the reducing power of T. bispinosa peel. Stability of the SNPs was studied using flocculation parameter (FP which was found to be least at all the pH values. FP was found to be indirectly proportional to stability of the nanoparticles.

  16. A simple and rapid method for standard preparation of gas phase extract of cigarette smoke.

    Directory of Open Access Journals (Sweden)

    Tsunehito Higashi

    Full Text Available Cigarette smoke consists of tar and gas phase: the latter is toxicologically important because it can pass through lung alveolar epithelium to enter the circulation. Here we attempt to establish a standard method for preparation of gas phase extract of cigarette smoke (CSE. CSE was prepared by continuously sucking cigarette smoke through a Cambridge filter to remove tar, followed by bubbling it into phosphate-buffered saline (PBS. An increase in dry weight of the filter was defined as tar weight. Characteristically, concentrations of CSEs were represented as virtual tar concentrations, assuming that tar on the filter was dissolved in PBS. CSEs prepared from smaller numbers of cigarettes (original tar concentrations ≤ 15 mg/ml showed similar concentration-response curves for cytotoxicity versus virtual tar concentrations, but with CSEs from larger numbers (tar ≥ 20 mg/ml, the curves were shifted rightward. Accordingly, the cytotoxic activity was detected in PBS of the second reservoir downstream of the first one with larger numbers of cigarettes. CSEs prepared from various cigarette brands showed comparable concentration-response curves for cytotoxicity. Two types of CSEs prepared by continuous and puff smoking protocols were similar regarding concentration-response curves for cytotoxicity, pharmacology of their cytotoxicity, and concentrations of cytotoxic compounds. These data show that concentrations of CSEs expressed by virtual tar concentrations can be a reference value to normalize their cytotoxicity, irrespective of numbers of combusted cigarettes, cigarette brands and smoking protocols, if original tar concentrations are ≤15 mg/ml.

  17. Rapid, single-phase extraction of glucosylsphingosine from plasma: A universal screening and monitoring tool.

    Science.gov (United States)

    Fuller, Maria; Szer, Jeff; Stark, Samantha; Fletcher, Janice M

    2015-10-23

    Glucosylsphingosine (GluSph) has emerged as a biomarker for the inherited metabolic disorder, Gaucher disease (GD). We developed a simple laboratory test to measure plasma GluSph and show that elevated GluSph is diagnostic for GD as well as informing on disease burden for monitoring patients on treatment. GluSph was measured from a single-phase total lipid extraction of 0.01 mL of plasma by liquid chromatography-electrospray ionisation-tandem mass spectrometry and concentrations extrapolated from a seven point standard curve (0.04 to 20 pmoL). A total of 1464 samples were tested and longitudinal assessment of an additional 20 GD patients. All patients with GD had elevated GluSph compared to unaffected controls and 16 other metabolic disorders. GluSph was also slightly elevated in three patients with Krabbe disease but not at concentrations to confuse a GD diagnosis. GluSph correlated with chitotriosidase in the majority of GD patients on treatment who were informative for this marker. GluSph can be easily measured from 0.01 mL of plasma and is useful as a diagnostic marker for GD with the current platform suited to high-throughput screening. It outperforms other GD biomarkers for biochemical monitoring of patients receiving enzyme replacement therapy for all individuals. Copyright © 2015 Elsevier B.V. All rights reserved.

  18. You had me at "Hello": Rapid extraction of dialect information from spoken words.

    Science.gov (United States)

    Scharinger, Mathias; Monahan, Philip J; Idsardi, William J

    2011-06-15

    Research on the neuronal underpinnings of speaker identity recognition has identified voice-selective areas in the human brain with evolutionary homologues in non-human primates who have comparable areas for processing species-specific calls. Most studies have focused on estimating the extent and location of these areas. In contrast, relatively few experiments have investigated the time-course of speaker identity, and in particular, dialect processing and identification by electro- or neuromagnetic means. We show here that dialect extraction occurs speaker-independently, pre-attentively and categorically. We used Standard American English and African-American English exemplars of 'Hello' in a magnetoencephalographic (MEG) Mismatch Negativity (MMN) experiment. The MMN as an automatic change detection response of the brain reflected dialect differences that were not entirely reducible to acoustic differences between the pronunciations of 'Hello'. Source analyses of the M100, an auditory evoked response to the vowels suggested additional processing in voice-selective areas whenever a dialect change was detected. These findings are not only relevant for the cognitive neuroscience of language, but also for the social sciences concerned with dialect and race perception. Copyright © 2011 Elsevier Inc. All rights reserved.

  19. A Simple and Rapid Method for Standard Preparation of Gas Phase Extract of Cigarette Smoke

    Science.gov (United States)

    Higashi, Tsunehito; Mai, Yosuke; Noya, Yoichi; Horinouchi, Takahiro; Terada, Koji; Hoshi, Akimasa; Nepal, Prabha; Harada, Takuya; Horiguchi, Mika; Hatate, Chizuru; Kuge, Yuji; Miwa, Soichi

    2014-01-01

    Cigarette smoke consists of tar and gas phase: the latter is toxicologically important because it can pass through lung alveolar epithelium to enter the circulation. Here we attempt to establish a standard method for preparation of gas phase extract of cigarette smoke (CSE). CSE was prepared by continuously sucking cigarette smoke through a Cambridge filter to remove tar, followed by bubbling it into phosphate-buffered saline (PBS). An increase in dry weight of the filter was defined as tar weight. Characteristically, concentrations of CSEs were represented as virtual tar concentrations, assuming that tar on the filter was dissolved in PBS. CSEs prepared from smaller numbers of cigarettes (original tar concentrations ≤15 mg/ml) showed similar concentration-response curves for cytotoxicity versus virtual tar concentrations, but with CSEs from larger numbers (tar ≥20 mg/ml), the curves were shifted rightward. Accordingly, the cytotoxic activity was detected in PBS of the second reservoir downstream of the first one with larger numbers of cigarettes. CSEs prepared from various cigarette brands showed comparable concentration-response curves for cytotoxicity. Two types of CSEs prepared by continuous and puff smoking protocols were similar regarding concentration-response curves for cytotoxicity, pharmacology of their cytotoxicity, and concentrations of cytotoxic compounds. These data show that concentrations of CSEs expressed by virtual tar concentrations can be a reference value to normalize their cytotoxicity, irrespective of numbers of combusted cigarettes, cigarette brands and smoking protocols, if original tar concentrations are ≤15 mg/ml. PMID:25229830

  20. Back to basics: an evaluation of NaOH and alternative rapid DNA extraction protocols for DNA barcoding, genotyping, and disease diagnostics from fungal and oomycete samples.

    Science.gov (United States)

    Osmundson, Todd W; Eyre, Catherine A; Hayden, Katherine M; Dhillon, Jaskirn; Garbelotto, Matteo M

    2013-01-01

    The ubiquity, high diversity and often-cryptic manifestations of fungi and oomycetes frequently necessitate molecular tools for detecting and identifying them in the environment. In applications including DNA barcoding, pathogen detection from plant samples, and genotyping for population genetics and epidemiology, rapid and dependable DNA extraction methods scalable from one to hundreds of samples are desirable. We evaluated several rapid extraction methods (NaOH, Rapid one-step extraction (ROSE), Chelex 100, proteinase K) for their ability to obtain DNA of quantity and quality suitable for the following applications: PCR amplification of the multicopy barcoding locus ITS1/5.8S/ITS2 from various fungal cultures and sporocarps; single-copy microsatellite amplification from cultures of the phytopathogenic oomycete Phytophthora ramorum; probe-based P. ramorum detection from leaves. Several methods were effective for most of the applications, with NaOH extraction favored in terms of success rate, cost, speed and simplicity. Frozen dilutions of ROSE and NaOH extracts maintained PCR viability for over 32 months. DNA from rapid extractions performed poorly compared to CTAB/phenol-chloroform extracts for TaqMan diagnostics from tanoak leaves, suggesting that incomplete removal of PCR inhibitors is an issue for sensitive diagnostic procedures, especially from plants with recalcitrant leaf chemistry. NaOH extracts exhibited lower yield and size than CTAB/phenol-chloroform extracts; however, NaOH extraction facilitated obtaining clean sequence data from sporocarps contaminated by other fungi, perhaps due to dilution resulting from low DNA yield. We conclude that conventional extractions are often unnecessary for routine DNA sequencing or genotyping of fungi and oomycetes, and recommend simpler strategies where source materials and intended applications warrant such use. © 2012 Blackwell Publishing Ltd.

  1. Rapid Mass Spectrometric Analysis of a Novel Fucoidan, Extracted from the Brown Alga Coccophora langsdorfii

    Directory of Open Access Journals (Sweden)

    Stanislav D. Anastyuk

    2014-01-01

    Full Text Available The novel highly sulfated (35% fucoidan fraction Cf2 , which contained, along with fucose, galactose and traces of xylose and uronic acids was purified from the brown alga Coccophora langsdorfii. Its structural features were predominantly determined (in comparison with fragments of known structure by a rapid mass spectrometric investigation of the low-molecular-weight fragments, obtained by “mild” (5 mg/mL and “exhaustive” (maximal concentration autohydrolysis. Tandem matrix-assisted laser desorption/ionization mass spectra (MALDI-TOF/TOFMS of fucooligosaccharides with even degree of polymerization (DP, obtained by “mild” autohydrolysis, were the same as that observed for fucoidan from Fucus evanescens, which have a backbone of alternating (1 → 3- and (1 → 4 linked sulfated at C-2 and sometimes at C-4 of 3-linked α-L-Fucp residues. Fragmentation patterns of oligosaccharides with odd DP indicated sulfation at C-2 and at C-4 of (1 → 3 linked α-L-Fucp residues on the reducing terminus. Minor sulfation at C-3 was also suggested. The “exhaustive” autohydrolysis allowed us to observe the “mixed” oligosaccharides, built up of fucose/xylose and fucose/galactose. Xylose residues were found to occupy both the reducing and nonreducing termini of FucXyl disaccharides. Nonreducing galactose residues as part of GalFuc disaccharides were found to be linked, possibly, by 2-type of linkage to fucose residues and were found to be sulfated, most likely, at position C-2.

  2. Assessment of the arterial input curve for (/sup 99m/Tc)-d,l-HM-PAO by rapid octanol extraction

    Energy Technology Data Exchange (ETDEWEB)

    Andersen, A.R.; Friberg, H.; Lassen, N.A.; Kristensen, K.; Neirinckx, R.D.

    1988-12-01

    The in vitro conversion of the lipophilic molecule (99mTc)-d,l-hexamethylpropyleneamine oxime (( 99mTc)-d,l-HM-PAO) to a hydrophilic form was studied in saline, plasma, and blood at 37 degrees C by paper chromatography and by octanol extraction. The octanol:saline ratio was 79.9. From this value and the corresponding octanol: plasma and octanol:blood partitioning values, an estimate of the transport of the lipophilic compound by various components of blood was made: 20% is carried in hemoglobin, 53% by the plasma proteins and 27% by the water phases of the red blood cell and plasma. Octanol extraction provided a rapid method for measuring the radiochemical purity (RCP) of lipophilic (99mTc)-d,l-HM-PAO. In saline, the RCP declined with a half-life of more than 1 h. In human plasma and whole blood, the conversion of (99mTc)-d,l-HM-PAO was biexponential due to the differences in the conversion rates of the d and l isomeric forms. The initial half-life representing the conversion rate of the l form was 1.7 min in blood and 1.4 min in plasma, while the conversion half-life of the d form was 7.4 and 24.4 min, respectively. In vivo, the RCP of arterial blood sampled after an i.v. bolus injection showed an initial peak value of 75% (68-79%) during the initial, first passage of the bolus. It declined to approximately 35% (29-40%) after 1.5 min and reached very low levels (about 1%) at 6 to 10 min. Quantitative measurements of cerebral blood flow using (99mTc)-d,l-HM-PAO necessitates a rapid method for RCP determination in arterial blood such as the one described here.

  3. MEKANISME PROSES TAHAP EKSTRAKSI KARAGENAN DARI Eucheuma cottonii MENGGUNAKAN PELARUT ALKALI (The Mechanism of Carrageenan Extraction from Eucheuma cottonii Using Alkaline Solvent

    Directory of Open Access Journals (Sweden)

    Sperisa Distantina

    2013-03-01

    Full Text Available Carrageenan recovery process was developed for Eucheuma cottonii by investigating the effects of distilled water, KOH (0.1-0.5 N and NaOH (0.1-1.0 N as the solvent on carrageenan yield and gel properties. Extraction process was carried out with a constant ratio of seaweed weight to solvent volume (1: 50; g/mL at 80oC.  A certain amount of the liquid sample was withdrawn at regular interval time for analysis. Filtrate was separated from residue by pouring ethanol. The precipitated carrageenans were collected and oven dried at 50-60oC to a constant weight. The extraction product was found to have virtually identical infrared spectra to the reference samples of kappa-carrageenan. Distilled water was the most efficient solvent with regard to yield but certainly not gel strength. Increasing KOH concentration led to carrageenan containing less sulfate content. In extraction process using alkali, the ion exchange occurred between cation from alkali solution and anion from sulphate in the seaweed. Compared with cation of sodium, the cation of potassium was able to form helixes aggregation indicated by the higher gel strength value. Alkali concentrations affected the gel strength of the extracted carrageenan significantly. Keywords: Eucheuma cottonii, KOH, NaOH, carrageenan, sulfate   ABSTRAK   Penelitian ini bertujuan mengembangkan proses ekstraksi karagenan dari rumput laut Eucheuma cottonii dengan mempelajari pengaruh jenis pelarut pada tahap ekstraksi, yaitu air suling, KOH, dan NaOH terhadap rendemen dan sifat gel karagenan.  Ekstraksi dilakukan dengan perbandingan bobot rumput laut – volume pelarut dijaga tetap yaitu 1:50 g/mL pada 80oC. Cuplikan diambil setiap interval waktu tertentu untuk dianalisis. Karagenan dalam filtrat diendapkan dengan etanol dan serat yang dihasilkan dikeringkan sampai bobot konstan. Spektrum infra merah menunjukkan bahwa karagenan yang dihasilkan identik dengan jenis kappa. Air suling merupakan pelarut yang efisien

  4. Purification and biochemical characterization of a serine alkaline ...

    African Journals Online (AJOL)

    An extracellular alkaline protease producing strain was isolated from alkaline soil and identified as Bacillus alcalophilus TCCC11004 on the basis of 16S rDNA gene sequencing and biochemical properties. The most appropriate medium for the protease production was composed of (g/l): maltodextrin 110, yeast extract 17.5 ...

  5. Human placental alkaline phosphatase in liver and intestine.

    OpenAIRE

    Garattini, E; Margolis, J; Heimer, E; Felix, A.; Udenfriend, S

    1985-01-01

    Three distinct forms of human alkaline phosphatase, presumably isozymes, are known, each apparently associated with a specific tissue. These are placental, intestinal, and liver (kidney and bone). We have used a specific immunoassay and HPLC to show that placental alkaline phosphatase is also present in extracts of liver and intestine in appreciable amounts.

  6. Purification and characterisation of alkaline phosphotase enzyme ...

    African Journals Online (AJOL)

    Alkaline phosphotase enzyme was purified from bacteria Escherichia coli C90 grown in phosphate-poor medium as stationary phase; using an ion exchange column packed with DEAE-cellulose as matrix and size exclusion chromatography using Sepharcryl S-300HR, equilibrated with Buffer A. The enzyme was extracted ...

  7. Rapid, low level determination of silver(I) in drinking water by colorimetric-solid-phase extraction

    Energy Technology Data Exchange (ETDEWEB)

    Arena, Matteo P.; Porter, Marc D.; Fritz, James S

    2003-04-15

    A rapid, highly sensitive two-step procedure for the trace analysis of silver(I) is described. The method is based on: (1) the solid-phase extraction (SPE) of silver(I) from a water sample onto a disk impregnated with a silver-selective colorimetric reagent, and (2) the determination of the amount of complexed analyte extracted by the disk by diffuse reflectance spectroscopy (DRS). This method, called colorimetric-solid-phase extraction (C-SPE), was recently shown effective in determining low concentrations (0.1-5.0 mg/ml) of iodine and iodide in drinking water. This report extends C-SPE to the trace ({approx}4 {mu}g/l) level monitoring of silver(I) which is a biocide used on the International Space Station (ISS). The determination relies on the manually driven passage of a water sample through a polystyrene-divinylbenzene disk that has been impregnated with the colorimetric reagent 5-(p-dimethylaminobenzylidene) rhodanine (DMABR) and with an additive such as a semi-volatile alcohol (1,2-decanediol) or nonionic surfactant (Brij 30). The amount of concentrated silver(I) is then determined in a few seconds by using a hand-held diffuse reflectance spectrometer, with a total sample workup and readout time of {approx}60 s. Importantly, the additive induces the uptake of water by the disk, which creates a local environment conducive to silver(I) complexation at an extremely high concentration factor ({approx}800). There is no detectable reaction between silver(I) and impregnated DMABR in the absence of the additive. This strategy represents an intriguing new dimension for C-SPE in which additives, directly loaded in the disk material, provide a means to manipulate the reactivity of the impregnated reagent.

  8. Microwave-assisted extraction and rapid isolation of ursolic acid from the leaves of Eucalyptus × hybrida Maiden and its quantification using HPLC-diode array technique.

    Science.gov (United States)

    Verma, Subash C; Jain, Chhoten L; Kumari, Amita; Padhi, Madan M; Devalla, Ramesh B

    2013-04-01

    Ursolic acid (UA) is the most important bioactive phytoconstituent of Eucalyptus × hybrida Maiden leaves and exhibits anticancer, antimutagenic, anti-inflammatory, antioxidative, and antiprotozoal activities. In this study, microwave-assisted extraction technique was employed for rapid isolation of UA from the leaves of Eucalyptus × hybrida and simultaneously HPLC-diode array method was developed for the quantification of UA. Effects of several experimental parameters on the extraction efficiencies of UA, such as type and volume of extraction solvents, microwave power and extraction time, were evaluated. The optimal extraction conditions were found to be 20 mL of a mixture of chloroform/methanol, 60:40; liquid-to-material ratio, 4:1; preleaching time, 10 min; microwave power, 600 W; temperature, 50°C; and microwave irradiation time, 5 min. Under the optimum conditions, the yield of UA was found to be 1.95 ± 0.08% in the dry leaves of Eucalyptus × hybrida. The results showed that microwave-assisted extraction is a more rapid extraction method with higher yield and lower solvent consumptions than the conventional method. It is a faster, convenient, and appropriate method and it may be used for rapid isolation and quantification of UA and other important phytoconstituents present in the leaves of Eucalyptus × hybrida. © 2013 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  9. Uranium in alkaline rocks

    Energy Technology Data Exchange (ETDEWEB)

    Murphy, M.; Wollenberg, H.; Strisower, B.; Bowman, H.; Flexser, S.; Carmichael, I.

    1978-04-01

    Geologic and geochemical criteria were developed for the occurrence of economic uranium deposits in alkaline igneous rocks. A literature search, a limited chemical analytical program, and visits to three prominent alkaline-rock localities (Ilimaussaq, Greenland; Pocos de Caldas, Brazil; and Powderhorn, Colorado) were made to establish criteria to determine if a site had some uranium resource potential. From the literature, four alkaline-intrusive occurrences of differing character were identified as type-localities for uranium mineralization, and the important aspects of these localities were described. These characteristics were used to categorize and evaluate U.S. occurrences. The literature search disclosed 69 U.S. sites, encompassing nepheline syenite, alkaline granite, and carbonatite. It was possible to compare two-thirds of these sites to the type localities. A ranking system identified ten of the sites as most likely to have uranium resource potential.

  10. A rapid, solid phase extraction (SPE technique for the extraction and gas chromatographic determination lindane pesticide residue in tissue and milk

    Directory of Open Access Journals (Sweden)

    Yuningsih

    2006-03-01

    Full Text Available Organochlorine pesticide contamination in feed can cause residue in animal product (tissue and milk, so its become a problem in food safety. Solid phase extraction (SPE has been carried out for determination organochlorine pesticide residues in food animal production. The technique was rapid, not costly and produce limited amount of hazardous-waste. Samples were homogenized with acetonitrile trough cartridge C18, eluted in fluorocyl column with 2% ether-petroleum or acetonitrile fortissue and milk samples respectively. The recoveries of tissue sample by addition lindane standard solution: 0.50 and 1.00 μg are 85.10 and 103.10% respectively, while that of milk with the addition of 0.50, 1.00 and 1.50 μg are 83.80, 88.69 and 91.24% respectively. Three replicates were carried out for every sample. According of validation criteria of FAO/IAEA the recovery for analysis of pesticide residues was 70-110%. Therefore, the method is applicable.

  11. Approach for rapid extraction and speciation of mercury using a microtip ultrasonic probe followed by LC-ICP-MS.

    Science.gov (United States)

    López, Isabel; Cuello, Susana; Cámara, Carmen; Madrid, Yolanda

    2010-07-15

    A fast method for mercury extraction from biological samples based on the use of HCl leaching plus different enzymatic hydrolysis (with and without mercury complexing agents), and the use of focussed ultrasounds (2-mm microtip) is here proposed. Total mercury content in several biological samples was determined by FI-ICP-MS using a carrier solution consisting of 0.1% (v/v) HCl, 0.1% (v/v) 2-mercaptoethanol, to avoid memory effect, and 0.15% (w/v) KCl. For mercury speciation a RP18 chromatographic column coupled to ICP-MS was used. A mobile phase consisting of 0.1% (v/v) formic acid, 0.1% (v/v) HFBA, 2% (v/v) methanol, and 0.02% (w/v) mM L-cysteine at pH 2.1 was used for chromatographic separation of the mercury species in the sample extracts. Extraction procedures were validated by using 50 mg of tuna fish tissue CRM-463 (2.85+/-0.16 mg kg(-1) for methylmercury). The recoveries obtained were 99+/-3% and 93+/-1% after acid leaching (HCl 7 M) and enzymatic extraction (15 mg protease type XIV in 2.5% (v/v) 2-mercaptoethanol), respectively. The optimal sonication conditions (5 min of exposure time and 40% of ultrasound amplitude) were applied to 5 mg of CRM-463 (88+/-5%), 5 mg of mussel tissue (81+/-11%) and to 2 mg of zebra fish embryos (90+/-10%) obtaining good recoveries in all cases. Methylmecury was found to be the most abundant Hg specie in all samples. The developed method is simple and rapid (5 min sample treatment); it is suitable for very small samples and does not alter the original form of the mercury species. Thus, it is of special interest in those cases in which validation of the results may often be hampered by lack of sample availability. Copyright 2010 Elsevier B.V. All rights reserved.

  12. Comparison of rapid solvent extraction systems for the GC-MS/MS characterization of polycyclic aromatic hydrocarbons in aged, contaminated soil.

    Science.gov (United States)

    Haleyur, Nagalakshmi; Shahsavari, Esmaeil; Mansur, Abdulatif A; Koshlaf, Eman; Morrison, Paul D; Osborn, A Mark; Ball, Andrew S

    2016-01-01

    Polycyclic aromatic hydrocarbons (PAHs) are a major class of organic hydrocarbons with high molecular weight that originate from both natural and anthropogenic sources. Sixteen PAHs are included in the U.S Environmental Protection agency list of priority pollutants due to their mutagenic, carcinogenic, toxic and teratogenic properties. In this study, the development and optimization of a simplified and rapid solvent extraction for the characterisation of 16 USEPA priority poly aromatic hydrocarbons (PAHs) in aged contaminated soils was established with subsequent analysis by GC-MS/MS. •Five different extraction solvent systems: dichloromethane: acetone, chloroform: methanol, dichloromethane, acetone: hexane and hexane were assessed in terms of their ability to extract PAHs from aged PAH-contaminated soils.•Highest PAH concentrations were extracted using acetone: hexane and chloroform: methanol. Given the greater toxicity associated with chloroform: methanol, acetone: hexane appears the best choice of solvent extraction system.•This protocol enables efficient extraction of PAHs from aged weathered soils.

  13. Repeated Administration of Korea Red Ginseng Extract Increases Non-Rapid Eye Movement Sleep via GABAAergic Systems.

    Science.gov (United States)

    Lee, Chung-Il; Kim, Chung-Soo; Han, Jin-Yi; Oh, Eun-Hye; Oh, Ki-Wan; Eun, Jae Soon

    2012-10-01

    The current inquiry was conducted to assess the change in sleep architecture after long periods of administration to determine whether ginseng can be used in the therapy of sleeplessness. Following post-surgical recovery, red ginseng extract (RGE, 200 mg/ kg) was orally administrated to rats for 9 d. Data were gathered on the 1st, 5th, and 9th day, and an electroencephalogram was recorded 24 h after RGE administration. Polygraphic signs of unobstructed sleep-wake activities were simultaneously recorded with sleep-wake recording electrodes from 11:00 a.m. to 5:00 p.m. for 6 h. Rodents were generally tamed to freely moving polygraphic recording conditions. Although the 1st and 5th day of RGE treatment showed no effect on power densities in non-rapid eye movement (NREM) and rapid eye movement (REM) sleep, the 9th day of RGE administration showed augmented α-wave (8.0 to 13.0 Hz) power densities in NREM and REM sleep. RGE increased total sleep and NREM sleep. The total percentage of wakefulness was only decreased on the 9th day, and the number of sleep-wake cycles was reduced after the repeated administration of RGE. Thus, the repeated administration of RGE increased NREM sleep in rats. The α-wave activities in the cortical electroencephalograms were increased in sleep architecture by RGE. Moreover, the levels of both α- and β-subunits of the γ-aminobutyric acid (GABA)A receptor were reduced in the hypothalamus of the RGE-treated groups. The level of glutamic acid decarboxylase was over-expressed in the hypothalamus. These results demonstrate that RGE increases NREM sleep via GABAAergic systems.

  14. Rapid synthesis of biocompatible silver nanoparticles using aqueous extract of Rosa damascena petals and evaluation of their anticancer activity.

    Science.gov (United States)

    Venkatesan, Balaji; Subramanian, Vimala; Tumala, Anusha; Vellaichamy, Elangovan

    2014-09-01

    To optimize the process parameters involved in the green synthesis of silver nanoparticles (G-SNPs) by aqueous extract of Rosa damascena petals and to evaluate the biocompatibility and anti cancer activity of the synthesized silver nanoparticles against human lung adenocarcinoma (A549). The process variables that include concentration of extract, mixing ratio of reactants, silver salt concentration and interaction time were analyzed. The compatibility of the G-SNPs was verified by incubating with erythrocytes and the anticancer property of the G-SNPs against A549 cells was performed by MTT assay. Formation of G-SNPs was confirmed by the visual change in the colour of the reaction mixture from pale yellow to brown yellow. Surface plasmon resonance of synthesized G-SNPs was observed at 420 nm; the size of G-SNPs were analyzed by DLS and found to be in the range of (84.00±10.08) nm. Field emission scanning electron microscope and high resolution transmission electron microscopy analysis confirmed that the G-SNPs were fairly spherical. Fourier transform infrared spectroscopy spectroscopy and X-ray diffraction revealed the characteristic peaks of G-SNPs. Energy dispersive X-ray analysis showed a signal of silver around 3 keV. The synthesized G-SNPs exhibited anticancer activity as evidenced by the MTT assay. IC50 value of G-SNPs was found to be 80 μg/mL. The results of the present study suggest that G-SNPs can be synthesized rapidly within first minute of the reaction; they are biocompatible and possess anticancer activity against human lung adenocarcinoma. Copyright © 2014 Hainan Medical College. Published by Elsevier B.V. All rights reserved.

  15. Alkaline phosphatase: an overview.

    Science.gov (United States)

    Sharma, Ujjawal; Pal, Deeksha; Prasad, Rajendra

    2014-07-01

    Alkaline phosphatase (ALP; E.C.3.I.3.1.) is an ubiquitous membrane-bound glycoprotein that catalyzes the hydrolysis of phosphate monoesters at basic pH values. Alkaline phosphatase is divided into four isozymes depending upon the site of tissue expression that are Intestinal ALP, Placental ALP, Germ cell ALP and tissue nonspecific alkaline phosphatase or liver/bone/kidney (L/B/K) ALP. The intestinal and placental ALP loci are located near the end of long arm of chromosome 2 and L/B/K ALP is located near the end of the short arm of chromosome 1. Although ALPs are present in many mammalian tissues and have been studied for the last several years still little is known about them. The bone isoenzyme may be involved in mammalian bone calcification and the intestinal isoenzyme is thought to play a role in the transport of phosphate into epithelial cells of the intestine. In this review, we tried to provide an overview about the various forms, structure and functions of alkaline phosphatase with special focus on liver/bone/kidney alkaline phosphatase.

  16. Rapid Biosynthesis of Silver Nanoparticles Using Pepino (Solanum muricatum Leaf Extract and Their Cytotoxicity on HeLa Cells

    Directory of Open Access Journals (Sweden)

    Mónica Gorbe

    2016-04-01

    Full Text Available Within nanotechnology, gold and silver nanostructures have unique physical, chemical, and electronic properties [1,2], which make them suitable for a number of applications. Moreover, biosynthetic methods are considered to be a safer alternative to conventional physicochemical procedures for both the environmental and biomedical applications, due to their eco-friendly nature and the avoidance of toxic chemicals in the synthesis. For this reason, employing bio routes in the synthesis of functionalized silver nanoparticles (FAgNP have gained importance recently in this field. In the present study, we report the rapid synthesis of FAgNP through the extract of pepino (Solanum muricatum leaves and employing microwave oven irradiation. The core-shell globular morphology and characterization of the different shaped and sized FAgNP, with a core of 20–50 nm of diameter is established using the UV-Visible spectroscopy (UV-vis, field emission scanning electron microscopy (FESEM, transmission electron microscopy (TEM and Zeta potential and dynamic light scanning (DLS studies. Moreover, cytotoxic studies employing HeLa (human cervix carcinoma cells were undertaken to understand FAgNP interactions with cells. HeLa cells showed significant dose dependent antiproliferative activity in the presence of FAgNP at relatively low concentrations. The calculated IC50 value was 37.5 µg/mL, similar to others obtained for FAgNPs against HeLa cells.

  17. Monitoring sea lamprey pheromones and their degradation using rapid stream-side extraction coupled with UPLC-MS/MS

    Science.gov (United States)

    Wang, Huiyong; Johnson, Nicholas; Bernardy, Jeffrey; Hubert, Terry; Li, Weiming

    2013-01-01

    Pheromones guide adult sea lamprey (Petromyzon marinus) to suitable spawning streams and mates, and therefore, when quantified, can be used to assess population size and guide management. Here, we present an efficient sample preparation method where 100 mL of river water was spiked with deuterated pheromone as an internal standard and underwent rapid field-based SPE and elution in the field. The combination of field extraction with laboratory UPLC-MS/MS reduced the sample consumption from 1 to 0.1 L, decreased the sample process time from more than 1 h to 10 min, and increased the precision and accuracy. The sensitivity was improved more than one order of magnitude compared with the previous method. The influences of experimental conditions were assessed to optimize the separation and peak shapes. The analytical method has been validated by studies of stability, selectivity, precision, and linearity and by the determination of the limits of detection and quantification. The method was used to quantify pheromone concentration from five streams tributary to Lake Ontario and to estimate that the environmental half-life of 3kPZS is about 26 h.

  18. Development of rapid bioconversion with integrated recycle technology for ethanol production from extractive ammonia pretreated corn stover.

    Science.gov (United States)

    Jin, Mingjie; Liu, Yanping; da Costa Sousa, Leonardo; Dale, Bruce E; Balan, Venkatesh

    2017-08-01

    High enzyme loading and low productivity are two major issues impeding low cost ethanol production from lignocellulosic biomass. This work applied rapid bioconversion with integrated recycle technology (RaBIT) and extractive ammonia (EA) pretreatment for conversion of corn stover (CS) to ethanol at high solids loading. Enzymes were recycled via recycling unhydrolyzed solids. Enzymatic hydrolysis with recycled enzymes and fermentation with recycled yeast cells were studied. Both enzymatic hydrolysis time and fermentation time were shortened to 24 h. Ethanol productivity was enhanced by two times and enzyme loading was reduced by 30%. Glucan and xylan conversions reached as high as 98% with an enzyme loading of as low as 8.4 mg protein per g glucan. The overall ethanol yield was 227 g ethanol/kg EA-CS (191 g ethanol/kg untreated CS). Biotechnol. Bioeng. 2017;114: 1713-1720. © 2017 Wiley Periodicals, Inc. © 2017 Wiley Periodicals, Inc.

  19. Distribution of Plasmodium species on the island of Grande Comore on the basis of DNA extracted from rapid diagnostic tests

    Directory of Open Access Journals (Sweden)

    Papa Mze Nasserdine

    2016-01-01

    Full Text Available In the Union of Comoros, interventions for combating malaria have contributed to a spectacular decrease in the prevalence of the disease. We studied the current distribution of Plasmodium species on the island of Grande Comore using nested PCR. The rapid diagnostic tests (RDTs currently used in the Comoros are able to identify Plasmodium falciparum but no other Plasmodium species. In this study, we tested 211 RDTs (158 positive and 53 negative. Among the 158 positive RDTs, 22 were positive for HRP2, 3 were positive only for pLDH, and 133 were positive for HRP2 and pLDH. DNA was extracted from a proximal part of the nitrocellulose membrane of RDTs. A total of 159 samples were positive by nested PCR. Of those, 156 (98.11% were positive for P. falciparum, 2 (1.25% were positive for P. vivaxI, and 1 (0.62% was positive for P. malariae. None of the samples were positive for P. ovale. Our results show that P. falciparum is still the most dominant species on the island of Grande Comore, but P. vivax and P. malariae are present at a low prevalence.

  20. Rapid determination of volatile constituents in safflower from Xinjiang and Henan by ultrasonic-assisted solvent extraction and GC–MS

    Directory of Open Access Journals (Sweden)

    Ling-Han Jia

    2011-08-01

    Full Text Available The total volatile components were extracted from safflower by ultrasonic-assisted solvent extraction (USE and their chemical constituents were analyzed by gas chromatography–mass spectrometry (GC–MS to provide scientific basis for the quality control of safflower. Five different solvents (diethyl ether, ethanol, ethyl acetate, dichloromethane and acetone were used and compared in terms of number of volatile components extracted and the peak areas of these components in TIC. The results showed that USE could be used as an efficient and rapid method for extracting the volatile components from safflower. It also could be found that the number of components in the TIC of ethyl acetate extract was more than that in the TIC of other solvent ones. Meanwhile, the volatile components of safflower from Xinjiang Autonomous Region and Henan Province of China were different in chemical components and relative contents. It could be concluded that both the extraction solvents and geographical origin of safflower are responsible for these differences. The experimental results also indicated that USE/GC–MS is a simple, rapid and effective method to analyze the volatile oil components of safflower. Keywords: Safflower, Ultrasonic solvent extraction, Gas chromatography–mass spectrometry (GC–MS

  1. Rapid Determination of Plutonium Isotopes in Environmental Samples Using Sequential Injection Extraction Chromatography and Detection by Inductively Coupled Plasma Mass Spectrometry

    DEFF Research Database (Denmark)

    Qiao, Jixin; Hou, Xiaolin; Roos, Per

    2009-01-01

    This article presents an automated method for the rapid determination of 239Pu and 240Pu in various environmental samples. The analytical method involves the in-line separation of Pu isotopes using extraction chromatography (TEVA) implemented in a sequential injection (SI) network followed by det...

  2. Rapid discrimination of extracts of Chinese propolis and poplar buds by FT-IR and 2D IR correlation spectroscopy

    Science.gov (United States)

    Wu, Yan-Wen; Sun, Su-Qin; Zhao, Jing; Li, Yi; Zhou, Qun

    2008-07-01

    The extract of Chinese propolis (ECP) has recently been adulterated with that of poplar buds (EPB), because most of ECP is derived from the poplar plant, and ECP and EPB have almost identical chemical compositions. It is very difficult to differentiate them by using the chromatographic methods such as high performance liquid chromatography (HPLC) and gas chromatography (GC). Therefore, how to effectively discriminate these two mixtures is a problem to be solved urgently. In this paper, a rapid method for discriminating ECP and EPB was established by the Fourier transform infrared (FT-IR) spectra combined with the two-dimensional infrared correlation (2D IR) analysis. Forty-three ECP and five EPB samples collected from different areas of China were analyzed by the FT-IR spectroscopy. All the ECP and EPB samples tested show similar IR spectral profiles. The significant differences between ECP and EPB appear in the region of 3000-2800 cm -1 of the spectra. Based on such differences, the two species were successfully classified with the soft independent modeling of class analogy (SIMCA) pattern recognition technique. Furthermore, these differences were well validated by a series of temperature-dependent dynamic FT-IR spectra and the corresponding 2D IR plots. The results indicate that the differences in these two natural products are caused by the amounts of long-chain alkyl compounds (including long-chain alkanes, long-chain alkyl esters and long chain alkyl alcohols) in them, rather than the flavonoid compounds, generally recognized as the bioactive substances of propolis. There are much more long-chain alkyl compounds in ECP than those in EPB, and the carbon atoms of the compounds in ECP remain in an order Z-shaped array, but those in EPB are disorder. It suggests that FT-IR and 2D IR spectroscopy can provide a valuable method for the rapid differentiation of similar natural products, ECP and EPB. The IR spectra could directly reflect the integrated chemical

  3. Rapid green synthesis of silver and gold nanoparticles using Dendropanax morbifera leaf extract and their anticancer activities.

    Science.gov (United States)

    Wang, Chao; Mathiyalagan, Ramya; Kim, Yeon Ju; Castro-Aceituno, Veronica; Singh, Priyanka; Ahn, Sungeun; Wang, Dandan; Yang, Deok Chun

    2016-01-01

    Dendropanax morbifera Léveille is an oriental medicinal plant that is traditionally used in folk medicine and grows in a specific region of South Korea. We aimed to enhance the utilization of D. morbifera medicinal plants for synthesis of silver nanoparticles (AgNPs) and gold nanoparticles (AuNPs). D. morbifera leaf extract acted as both a reducing and a stabilizing agent that rapidly synthesized Dendropanax AgNPs (D-AgNPs) and Dendropanax AuNPs (D-AuNPs). The D-AgNPs and D-AuNPs were characterized by ultraviolet-visible spectroscopy, energy dispersive X-ray analysis, elemental mapping, field emission transmission electron microscopy, X-ray diffraction, and dynamic light scattering. The characterizations revealed that the D-AgNPs and D-AuNPs were in polygon and hexagon shapes with average sizes of 100-150 nm and 10-20 nm, respectively. The important outcomes were the synthesis of AgNPs and AuNPs within 1 hour and 3 minutes, respectively, avoiding the subsequent processing for removal of any toxic components or for stabilizing the nanoparticles. Additionally, D-AgNPs and D-AuNPs were examined for cytotoxicity in a human keratinocyte cell line and in A549 human lung cancer cell line. The results indicated that D-AgNPs exhibited less cytotoxicity in the human keratinocyte cell line at 100 µg/mL after 48 hours. On the other hand, D-AgNPs showed potent cytotoxicity in the lung cancer cells at the same concentration after 48 hours, whereas D-AuNPs did not exhibit cytotoxicity in both cell lines at the same concentration. However, both D-AgNPs and D-AuNPs at 50 µg/mL enhanced the cytotoxicity of ginsenoside compound K at 25 µM after 48 hours of treatment compared with CK alone. We believe that this rapid green synthesis of D-AgNPs and D-AuNPs is a valuable addition to the applications of D. morbifera medicinal plant. D-AuNPs can be used as carriers for drug delivery and in cancer therapy due to their lack of normal cell cytotoxicity.

  4. Rapid determination of volatile constituents in safflower from Xinjiang and Henan by ultrasonic-assisted solvent extraction and GC–MS

    Science.gov (United States)

    Jia, Ling-Han; Liu, Yi; Li, Yu-Zhen

    2011-01-01

    The total volatile components were extracted from safflower by ultrasonic-assisted solvent extraction (USE) and their chemical constituents were analyzed by gas chromatography–mass spectrometry (GC–MS) to provide scientific basis for the quality control of safflower. Five different solvents (diethyl ether, ethanol, ethyl acetate, dichloromethane and acetone) were used and compared in terms of number of volatile components extracted and the peak areas of these components in TIC. The results showed that USE could be used as an efficient and rapid method for extracting the volatile components from safflower. It also could be found that the number of components in the TIC of ethyl acetate extract was more than that in the TIC of other solvent ones. Meanwhile, the volatile components of safflower from Xinjiang Autonomous Region and Henan Province of China were different in chemical components and relative contents. It could be concluded that both the extraction solvents and geographical origin of safflower are responsible for these differences. The experimental results also indicated that USE/GC–MS is a simple, rapid and effective method to analyze the volatile oil components of safflower.

  5. Ultrasound-assisted single extraction tests for rapid assessment of metal extractability from soils by total reflection X-ray fluorescence.

    Science.gov (United States)

    De La Calle, I; Cabaleiro, N; Lavilla, I; Bendicho, C

    2013-09-15

    In this work, ultrasound-assisted extraction (UAE) was employed for acceleration of metal extraction from soil samples. After extraction, multielemental analysis (Cr, Mn, Fe, Ni, Cu, Zn and Pb) of EDTA and acetic acid extracts was performed by total reflection X-ray fluorescence spectrometry (TXRF). High-intensity ultrasonic processors, i.e. the ultrasonic probe (50W) and the cup-horn sonoreactor (200W) were applied. Both ultrasonic procedures were compared with a miniaturized version of the single extraction scheme proposed by the Standards, Measurements and Testing program (SM&T). The extraction time with EDTA was reduced from 1h (conventional procedure) to 2 min (ultrasonic probe) or to 10 min (cup-horn sonoreactor). The time required for acetic acid extraction was also reduced from 16 h (conventional procedure) to 6 min (ultrasonic probe) or to 30 min (cup-horn sonoreactor). In addition, the amount of sample and extractants was drastically reduced as a result of the miniaturization implemented in the developed approaches. The combination of UAE and TXRF allows assessing the potential metal mobility and bioavailability in a simple way. Copyright © 2013 Elsevier B.V. All rights reserved.

  6. EXTRACT

    DEFF Research Database (Denmark)

    Pafilis, Evangelos; Buttigieg, Pier Luigi; Ferrell, Barbra

    2016-01-01

    The microbial and molecular ecology research communities have made substantial progress on developing standards for annotating samples with environment metadata. However, sample manual annotation is a highly labor intensive process and requires familiarity with the terminologies used. We have the...... and text-mining-assisted curation revealed that EXTRACT speeds up annotation by 15-25% and helps curators to detect terms that would otherwise have been missed.Database URL: https://extract.hcmr.gr/......., organism, tissue and disease terms. The evaluators in the BioCreative V Interactive Annotation Task found the system to be intuitive, useful, well documented and sufficiently accurate to be helpful in spotting relevant text passages and extracting organism and environment terms. Comparison of fully manual...

  7. Lipid Extract of Mycoplasma penetrans Proteinase K-Digested Lipid-Associated Membrane Proteins Rapidly Activates NF-κB and Activator Protein 1

    Science.gov (United States)

    Feng, Shaw-Huey; Lo, Shyh-Ching

    1999-01-01

    Lipid-associated membrane proteins (LAMPs) of Mycoplasma penetrans rapidly induced macrophages to produce proinflammatory cytokines such as tumor necrosis factor alpha (TNF-α). Our analysis showed that the macrophage-stimulating activity of TNF-α production was mainly attributable to a lipid extractable component(s) in the LAMP preparation. Since induction of gene expression is normally preceded by activation of transcriptional factors that bind to their specific recognition elements located in the upstream promoter region, we examined the activity of transcriptional factors, namely, NF-κB and activator protein 1 (AP-1), in thioglycolate exudate peritoneal (TEP) macrophages treated with M. penetrans lipid extract of proteinase K (PK)-digested LAMPs. Initially, in the nuclei of unstimulated TEP cells, there was only a low basal level of active AP-1, and the active form of NF-κB could not be detected. M. penetrans lipid extract of PK-digested LAMPs activated both NF-κB and AP-1 in TEP macrophages within 15 min. The markedly increased activities of both factors gradually declined and dissipated after 2 h. Parallel to the rapid increase of NF-κB and AP-1, the TNF-α transcript also increased significantly 15 min after the stimulation. The high-level expression of TNF-α persisted over 2 h. Dexamethasone blocked the activation of both NF-κB and AP-1 and suppressed the production of TNF-α in TEP macrophages stimulated by M. penetrans lipid extract of PK-digested LAMPs. Our study demonstrates that the M. penetrans lipid extract of PK-digested LAMP is a potent activator for NF-κB and AP-1 in murine TEP macrophages. Our results also suggest that high-level expression of TNF-α in cells induced by M. penetrans lipid extract of PK-digested LAMPs is associated with rapid activation of transcriptional factors NF-κB and AP-1. PMID:10338504

  8. Lipid extract of Mycoplasma penetrans proteinase K-digested lipid-associated membrane proteins rapidly activates NF-kappaB and activator protein 1.

    Science.gov (United States)

    Feng, S H; Lo, S C

    1999-06-01

    Lipid-associated membrane proteins (LAMPs) of Mycoplasma penetrans rapidly induced macrophages to produce proinflammatory cytokines such as tumor necrosis factor alpha (TNF-alpha). Our analysis showed that the macrophage-stimulating activity of TNF-alpha production was mainly attributable to a lipid extractable component(s) in the LAMP preparation. Since induction of gene expression is normally preceded by activation of transcriptional factors that bind to their specific recognition elements located in the upstream promoter region, we examined the activity of transcriptional factors, namely, NF-kappaB and activator protein 1 (AP-1), in thioglycolate exudate peritoneal (TEP) macrophages treated with M. penetrans lipid extract of proteinase K (PK)-digested LAMPs. Initially, in the nuclei of unstimulated TEP cells, there was only a low basal level of active AP-1, and the active form of NF-kappaB could not be detected. M. penetrans lipid extract of PK-digested LAMPs activated both NF-kappaB and AP-1 in TEP macrophages within 15 min. The markedly increased activities of both factors gradually declined and dissipated after 2 h. Parallel to the rapid increase of NF-kappaB and AP-1, the TNF-alpha transcript also increased significantly 15 min after the stimulation. The high-level expression of TNF-alpha persisted over 2 h. Dexamethasone blocked the activation of both NF-kappaB and AP-1 and suppressed the production of TNF-alpha in TEP macrophages stimulated by M. penetrans lipid extract of PK-digested LAMPs. Our study demonstrates that the M. penetrans lipid extract of PK-digested LAMP is a potent activator for NF-kappaB and AP-1 in murine TEP macrophages. Our results also suggest that high-level expression of TNF-alpha in cells induced by M. penetrans lipid extract of PK-digested LAMPs is associated with rapid activation of transcriptional factors NF-kappaB and AP-1.

  9. Kinetic Studies of Alkaline Phosphatase from the Liver of Agama ...

    African Journals Online (AJOL)

    ABSTRACT: Kinetic studies were carried out on alkaline phosphatase (ALP) extracted from the liver of Agama agama lizard. Incubation of ALP extract with para – nitrophenyl phosphate formed the basis for the determination of enzyme activity. Spectrophotometric method was used to assay the enzyme, and the kinetic ...

  10. Rapid magnetic solid-phase extraction based on monodisperse magnetic single-crystal ferrite nanoparticles for the determination of free fatty acid content in edible oils.

    Science.gov (United States)

    Wei, Fang; Zhao, Qin; Lv, Xin; Dong, Xu-Yan; Feng, Yu-Qi; Chen, Hong

    2013-01-09

    This study proposes a rapid magnetic solid-phase extraction (MSPE) based on monodisperse magnetic single-crystal ferrite (Fe(3)O(4)) nanoparticles (NPs) for determining the quantities of eight free fatty acids (FFAs), including palmitic acid (C16:0), stearic acid (C18:0), oleic acid (C18:1), linoleic acid (C18:2), linolenic acid (C18:3), arachidic acid (C20:0), eicosenoic acid (C20:1), and behenic acid (C22:0) in oil. The amine-functionalized mesoporous Fe(3)O(4) magnetic NPs were applied as a sorbent for MSPE of FFAs from oil samples in a process that is based on hydrophilic interaction. The extraction can be completed rapidly in a dispersive mode with the aid of vigorous vortex. Additional tedious processing steps such as centrifugation and evaporation of organic solvent were not necessary with this procedure. Furthermore, esterification of FFAs can be accomplished during the desorption procedure by using methanol/sulfuric acid (99:1, v/v) as the desorption solvent. Several parameters affecting the extraction efficiency were investigated, including the matrix solvent for extraction, the desorption solvent and desorption time, and the amount of sorbent and extraction time. The pretreatment process was rapid under optimal conditions, being accomplished within 15 min. When coupled with gas chromatography-flame ionization detection (GC-FID), a rapid, simple, and convenient MSPE-GC-FID method for the determination of FFAs in oil samples was established with a total analysis time within 25 min. The limits of detection for the target FFAs were found to be 7.22-26.26 ng/mL. Recoveries in oil samples were in the range of 81.33-117.75%, with RSDs of <6.4% (intraday) and <6.9% (interday). This method was applied successfully to the analysis of dynamic FFA formation in four types of edible oils subjected to an accelerated storage test. The simple, rapid, and cost-effective method developed in the current study offers a potential application for the extraction and

  11. Lipid Extract of Mycoplasma penetrans Proteinase K-Digested Lipid-Associated Membrane Proteins Rapidly Activates NF-κB and Activator Protein 1

    OpenAIRE

    Feng, Shaw-Huey; Lo, Shyh-Ching

    1999-01-01

    Lipid-associated membrane proteins (LAMPs) of Mycoplasma penetrans rapidly induced macrophages to produce proinflammatory cytokines such as tumor necrosis factor alpha (TNF-α). Our analysis showed that the macrophage-stimulating activity of TNF-α production was mainly attributable to a lipid extractable component(s) in the LAMP preparation. Since induction of gene expression is normally preceded by activation of transcriptional factors that bind to their specific recognition elements located ...

  12. Rapid and high-throughput determination of endogenous cytokinins in Oryza sativa by bare Fe3O4 nanoparticles-based magnetic solid-phase extraction.

    Science.gov (United States)

    Cai, Bao-Dong; Zhu, Jiu-Xia; Gao, Qiang; Luo, Dan; Yuan, Bi-Feng; Feng, Yu-Qi

    2014-05-02

    A rapid method was developed for determination of endogenous cytokinins (CKs) based on magnetic solid-phase extraction (MSPE) followed by ultra-performance liquid chromatography-tandem mass spectrometry (UPLC-MS/MS). We illustrated the hydrophilic character of bare Fe3O4 nanoparticles that were directly used as a MSPE sorbent for rapid enrichment of endogenous CKs from complex plant extract. To the best of our knowledge, this is the first report of bare Fe3O4 directly used as efficient extraction sorbent to enrich target CKs based on hydrophilic interaction. Under the optimized conditions, a rapid, sensitive and high-throughput method for the determination of 16 CKs was established by combination of MSPE with UPLC-MS/MS. Good linearity was obtained with correlation coefficients (r) from 0.9902 to 0.9998. The limits of detection (LODs) and quantification (LOQs) ranged from 1.2 pg mL(-1) to 391.3 pg mL(-1) and 4.1 pg mL(-1) to 1304.3 pg mL(-1), respectively. 16 CKs could be successfully determined in spiked sample with 80.6-117.3% recoveries and the relative standard deviations (RSDs) were less than 16.6%. Finally, 10 endogenous CKs were successfully quantified in 50mg Oryza sativa sample using the developed MSPE-UPLC-MS/MS method. Copyright © 2014 Elsevier B.V. All rights reserved.

  13. [A method for rapid extracting three-dimensional root model of vivo tooth from cone beam computed tomography data based on the anatomical characteristics of periodontal ligament].

    Science.gov (United States)

    Zhao, Y J; Wang, S W; Liu, Y; Wang, Y

    2017-02-18

    To explore a new method for rapid extracting and rebuilding three-dimensional (3D) digital root model of vivo tooth from cone beam computed tomography (CBCT) data based on the anatomical characteristics of periodontal ligament, and to evaluate the extraction accuracy of the method. In the study, 15 extracted teeth (11 with single root, 4 with double roots) were collected from oral clinic and 3D digital root models of each tooth were obtained by 3D dental scanner with a high accuracy 0.02 mm in STL format. CBCT data for each patient were acquired before tooth extraction, DICOM data with a voxel size 0.3 mm were input to Mimics 18.0 software. Segmentation, Morphology operations, Boolean operations and Smart expanded function in Mimics software were used to edit teeth, bone and periodontal ligament threshold mask, and root threshold mask were automatically acquired after a series of mask operations. 3D digital root models were extracted in STL format finally. 3D morphology deviation between the extracted root models and corresponding vivo root models were compared in Geomagic Studio 2012 software. The 3D size errors in long axis, bucco-lingual direction and mesio-distal direction were also calculated. The average value of the 3D morphology deviation for 15 roots by calculating Root Mean Square (RMS) value was 0.22 mm, the average size errors in the mesio-distal direction, the bucco-lingual direction and the long axis were 0.46 mm, 0.36 mm and -0.68 mm separately. The average time of this new method for extracting single root was about 2-3 min. It could meet the accuracy requirement of the root 3D reconstruction fororal clinical use. This study established a new method for rapid extracting 3D root model of vivo tooth from CBCT data. It could simplify the traditional manual operation and improve the efficiency and automation of single root extraction. The strategy of this method for complete dentition extraction needs further research.

  14. Rapid determination of oxindole alkaloids in cat's claw by HPLC using ionic liquid-based microwave-assisted extraction and silica monolithic column.

    Science.gov (United States)

    Chang, Chih-Wei; Yeh, Yu-Ying; Chang, Li-Ching; Hsu, Mei-Chich; Wu, Yu-Tse

    2017-08-01

    Cat's claw is a large woody vine with hook-like thorns, and has been traditionally used to treat inflammatory disorders in South and Central America. In this study, a rapid, validated high-performance liquid chromatographic (HPLC) method using a silica monolithic column was developed for the simultaneous determination of oxindole alkaloids, namely rhynchophylline, pteropodine, isomitraphylline and isopteropodine, in cat's claw. The ionic liquid-based microwave-assisted extraction (ILMAE), considered as an environmentally friendly and powerful tool, was first applied in the extraction of oxindole alkaloids. To optimize the HPLC method, the stationary phases, pH values of mobile phase and flow rates were investigated. The validated HPLC method using a Monolithic RP18e column (100 × 4.6 mm) enables these analytes to be separated almost twice as fast as with a conventional particulate column (~16 vs ~30 min) with limits of quantification and detection of 0.5 and 0.15 μg/mL, respectively. The ILMAE conditions were optimized by the Taguchi orthogonal array design. In comparison with conventional water boiling extraction, ILMAE offers almost four times higher yields within an extremely short extraction time. The developed HPLC coupled with ILMAE method could be efficient and practical for rapid determination of oxindole alkaloids in cat's claw. Copyright © 2016 John Wiley & Sons, Ltd.

  15. Rapid evaluation and comparison of natural products and antioxidant activity in calendula, feverfew, and German chamomile extracts.

    Science.gov (United States)

    Agatonovic-Kustrin, Snezana; Babazadeh Ortakand, Davoud; Morton, David W; Yusof, Ahmad P

    2015-03-13

    The present study describes a simple high performance thin layer chromatographic (HPTLC) method for the simultaneous quantification of apigenin, chamazulene, bisabolol and the use of DPPH free radical as a post-chromatographic derivatization agent to compare the free radical scavenging activities of these components in leaf and flower head extracts from feverfew, German chamomile and marigold from the Asteraceae family. Feverfew (Tanacetum parthenium) leaves have been traditionally used in the treatment of migraine with parthenolide being the main bioactive compound. However, due to similar flowers, feverfew is sometimes mistaken for the German chamomile (Matricaria recutita). Bisabolol and chamazulene are the main components in chamomile essential oil. Marigold (Calendula officinalis) was included in the study for comparison, as it belongs to the same family. Parthenolide was found to be present in all leaf extracts but was not detected in calendula flower extract. Chamazulene and bisabolol were found to be present in higher concentrations in chamomile and Calendula flowers. Apigenin was detected and quantified only in chamomile extracts (highest concentration in flower head extracts). Antioxidant activity in sample extracts was compared by superimposing the chromatograms obtained after post-chromatographic derivatization with DPPH and post-chromatographic derivatization with anisaldehyde. It was found that extracts from chamomile flower heads and leaves have the most prominent antioxidant activity, with bisabolol and chamazulene being the most effective antioxidants. Crown Copyright © 2015. Published by Elsevier B.V. All rights reserved.

  16. Toxicity profiling of marine surface sediments: a case study using rapid screening bioassays of exhaustive total extracts, elutriates and passive sampler extracts

    NARCIS (Netherlands)

    Vethaak, A.D.; Hamers, T.; Martinez-Gomez, C.; Kamstra, J.H.; de Weert, J.; Leonards, P.E.G.; Smedes, F.

    2017-01-01

    This study was carried out in the framework of the ICON project (Integrated Assessment of Contaminant Impacts on the North Sea) (Hylland et al., 2015) and aimed (1) to evaluate the toxicity of marine sediments using a battery of rapid toxicity bioassays, and; (2) to explore the applicability and

  17. Rapid extraction of Amomum tsao-ko essential oil and determination of its chemical composition, antioxidant and antimicrobial activities.

    Science.gov (United States)

    Cui, Qi; Wang, Li-Tao; Liu, Ju-Zhao; Wang, Hui-Mei; Guo, Na; Gu, Cheng-Bo; Fu, Yu-Jie

    2017-09-01

    A simple, green and efficient extraction method named modified-solvent free microwave extraction (M-SFME) was employed for the extraction of essential oils (EOs) from Amomun tsao-ko. The process of M-SFME was optimized with the prominent preponderance of such higher extraction yield (1.13%) than those of solvent free microwave extraction (SFME, 0.91%) and hydrodistillation (HD, 0.84%) under the optimal parameters. Thirty-four volatile substances representing 95.4% were identified. The IC 50 values of EOs determined by DPPH radical scavenging activity and β-carotene/linoleic acid bleaching assay were 5.27 and 0.63mg/ml. Furthermore, the EOs exhibited moderate to potent broad-spectrum antimicrobial activity against all tested strains including five gram-positive and two gram-negative bacteria (MIC: 2.94-5.86mg/ml). In general, M-SFME is a potential and desirable alternative for the extraction of EOs from aromatic herbs, and the EOs obtained from A. tsao-ko can be explored as a potent natural antimicrobial and antioxidant preservative ingredient in food industry from the technological and economical points of view. Copyright © 2017 Elsevier B.V. All rights reserved.

  18. Rapid ultrasonic and microwave-assisted micellar extraction of zingiberone, shogaol and gingerols from gingers using biosurfactants.

    Science.gov (United States)

    Peng, Li-Qing; Cao, Jun; Du, Li-Jing; Zhang, Qi-Dong; Xu, Jing-Jing; Chen, Yu-Bo; Shi, Yu-Ting; Li, Rong-Rong

    2017-09-15

    Two kinds of extraction methods ultrasonic-assisted micellar extraction (UAME) and microwave-assisted micellar extraction (MAME) coupled with ultra-high performance liquid chromatography with ultraviolet detector (UHPLC-UV) were developed and evaluated for extraction and determination of zingerone, 6-gingerol, 8-gingerol, 6-shogaol and 10-gingerol in Rhizoma Zingiberis and Rhizoma Zingiberis Preparata. A biosurfactant, hyodeoxycholic acid sodium salt, was used in micellar extraction. Several experimental parameters were studied separately by a univariate method. The result indicated that the MAME was more efficient than UAME. The optimal conditions of MAME were as follows: 100mM of hyodeoxycholic acid sodium salt was used as surfactant, the irradiation time was set at 10s and the extraction temperature was set at 60°C. The validation results indicated that the limits of detection were in the range of 3.80-8.11ng/mL. The average recoveries were in the range of 87.32-103.12% for the two samples at two spiking levels. Compared with other reported methods, the proposed MAME-UHPLC-UV method was more effective, quicker (10s) and more eco-friendly. Copyright © 2017 Elsevier B.V. All rights reserved.

  19. Simple, rapid and cost-effective method for high quality nucleic acids extraction from different strains of Botryococcus braunii.

    Directory of Open Access Journals (Sweden)

    Byung-Hyuk Kim

    Full Text Available This study deals with an effective nucleic acids extraction method from various strains of Botryococcus braunii which possesses an extensive extracellular matrix. A method combining freeze/thaw and bead-beating with heterogeneous diameter of silica/zirconia beads was optimized to isolate DNA and RNA from microalgae, especially from B. braunii. Eukaryotic Microalgal Nucleic Acids Extraction (EMNE method developed in this study showed at least 300 times higher DNA yield in all strains of B. braunii with high integrity and 50 times reduced working volume compared to commercially available DNA extraction kits. High quality RNA was also extracted using this method and more than two times the yield compared to existing methods. Real-time experiments confirmed the quality and quantity of the input DNA and RNA extracted using EMNE method. The method was also applied to other eukaryotic microalgae, such as diatoms, Chlamydomonas sp., Chlorella sp., and Scenedesmus sp. resulting in higher efficiencies. Cost-effectiveness analysis of DNA extraction by various methods revealed that EMNE method was superior to commercial kits and other reported methods by >15%. This method would immensely contribute to area of microalgal genomics.

  20. Magnetic solid phase extraction coupled with desorption corona beam ionization-mass spectrometry for rapid analysis of antidepressants in human body fluids.

    Science.gov (United States)

    Chen, Di; Zheng, Hao-Bo; Huang, Yun-Qing; Hu, Yu-Ning; Yu, Qiong-Wei; Yuan, Bi-Feng; Feng, Yu-Qi

    2015-08-21

    Ambient ionization techniques show good potential in rapid analysis of target compounds. However, a direct application of these ambient ionization techniques for the determination of analytes in a complex matrix is difficult due to the matrix interference and ion suppression. To resolve this problem, here we developed a strategy by coupling magnetic solid phase extraction (MSPE) with desorption corona beam ionization (DCBI)-mass spectrometry (MS). As a proof of concept, the pyrrole-coated Fe3O4 magnetic nanoparticles (Fe3O4@Ppy) were prepared and used for the extraction of antidepressants. After extraction, the Fe3O4@Ppy with trapped antidepressants was then directly subjected to DCBI-MS analysis with the aid of a homemade magnetic glass capillary. As the MSPE process is rapid and the direct DCBI-MS analysis does not need solvent desorption or chromatographic separation processes, the overall analysis can be completed within 3 min. The proposed MSPE-DCBI-MS method was then successfully used to determine antidepressants in human urine and plasma. The calibration curves were obtained in the range of 0.005-0.5 μg mL(-1) for urine and 0.02-1 μg mL(-1) for plasma with reasonable linearity (R(2) > 0.951). The limits of detection of three antidepressants were in the range of 0.2-1 ng mL(-1) for urine and 2-5 ng mL(-1) for plasma. Acceptable reproducibility for rapid analysis was achieved with relative standard deviations less than 19.1% and the relative recoveries were 85.2-118.7%. Taken together, the developed MSPE-DCBI-MS strategy offers a powerful capacity for rapid analysis of target compounds in a complex matrix, which would greatly expand the applications of ambient ionization techniques with plentiful magnetic sorbents.

  1. Development and validation of an HPLC method for the determination of alk(en)ylresorcinols using rapid ultrasound-assisted extraction of mango peels and rye grains.

    Science.gov (United States)

    Geerkens, Christian H; Matejka, Anna E; Carle, Reinhold; Schweiggert, Ralf M

    2015-02-15

    Exhaustive extraction of alk(en)ylresorcinols (ARs) from biological matrices is a prerequisite for economic screening of extensive plant collections including their rapid quantitation. For this purpose, an ultrasound-assisted extraction protocol was developed to facilitate the liberation of ARs from mango peels (Mangifera indica L.) and rye grains (Secale cereale L.). While maintaining or even improving the extraction efficiency of the analytes, the duration of analytical extraction was shortened from more than 1h to only 45s as compared to previous methods. In addition, sample weight and solvent use were significantly reduced. Besides the validation of the extraction procedure, validation parameters for the HPLC-DAD-MS(n) based characterisation and quantitation method are provided. In particular, fully satisfactory recovery rates and quantitation limits were achieved, and coefficients of variation (CV) for repeatability and reproducibility were ⩽8 and mango and three rye cultivars, and the results were compared to previously published data. Copyright © 2014 Elsevier Ltd. All rights reserved.

  2. Rapid extraction and quantitative detection of the herbicide diuron in surface water by a hapten-functionalized carbon nanotubes based electrochemical analyzer.

    Science.gov (United States)

    Sharma, Priyanka; Bhalla, Vijayender; Tuteja, Satish; Kukkar, Manil; Suri, C Raman

    2012-05-21

    A solid phase extraction micro-cartridge containing a non-polar polystyrene absorbent matrix was coupled with an electrochemical immunoassay analyzer (EIA) and used for the ultra-sensitive detection of the phenyl urea herbicide diuron in real samples. The EIA was fabricated by using carboxylated carbon nanotubes (CNTs) functionalized with a hapten molecule (an amine functionalized diuron derivative). Screen printed electrodes (SPE) were modified with these haptenized CNTs and specific in-house generated anti diuron antibodies were used for bio-interface development. The immunodetection was realized in a competitive electrochemical immunoassay format using alkaline phosphatase labeled secondary anti-IgG antibody. The addition of 1-naphthyl phosphate substrate resulted in the production of an electrochemically active product, 1-naphthol, which was monitored by using differential pulse voltammetry (DPV). The assay exhibited excellent sensitivity and specificity having a dynamic response range of 0.01 pg mL(-1) to 10 μg mL(-1) for diuron with a limit of detection of around 0.1 pg mL(-1) (n = 3) in standard water samples. The micro-cartridge coupled hapten-CNTs modified SPE provided an effective and efficient electrochemical immunoassay for the real-time monitoring of pesticides samples with a very high degree of sensitivity.

  3. Rapid and Green Analytical Method for the Determination of Quinoline Alkaloids from Cinchona succirubra Based on Microwave-Integrated Extraction and Leaching (MIEL) Prior to High Performance Liquid Chromatography

    Science.gov (United States)

    Fabiano-Tixier, Anne-Sylvie; Elomri, Abdelhakim; Blanckaert, Axelle; Seguin, Elisabeth; Petitcolas, Emmanuel; Chemat, Farid

    2011-01-01

    Quinas contains several compounds, such as quinoline alkaloids, principally quinine, quinidine, cinchonine and cichonidine. Identified from barks of Cinchona, quinine is still commonly used to treat human malaria. Microwave-Integrated Extraction and Leaching (MIEL) is proposed for the extraction of quinoline alkaloids from bark of Cinchona succirubra. The process is performed in four steps, which ensures complete, rapid and accurate extraction of the samples. Optimal conditions for extraction were obtained using a response surface methodology reached from a central composite design. The MIEL extraction has been compared with a conventional technique soxhlet extraction. The extracts of quinoline alkaloids from C. succirubra obtained by these two different methods were compared by HPLC. The extracts obtained by MIEL in 32 min were quantitatively (yield) and qualitatively (quinine, quinidine, cinchonine, cinchonidine) similar to those obtained by conventional Soxhlet extraction in 3 hours. MIEL is a green technology that serves as a good alternative for the extraction of Cinchona alkaloids. PMID:22174637

  4. Rapid microwave-assisted acid extraction of metals from chromated copper arsenate (CCA)-treated southern pine wood

    Science.gov (United States)

    Bin Yu; Chung Y. Hse; Todd F. Shupe

    2009-01-01

    The effects of acid concentration, reaction time, and temperature in a microwave reactor on recovery of CCA-treated wood were evaluated. Extraction of copper, chromium, and arsenic metals from chromated copper arsenate (CCA)-treated southern pine wood samples with three different acids (i.e., acetic acid, oxalic acid, and phosphoric acid) was investigated using in...

  5. Assessment of the arterial input curve for [99mTc]-d,l-HM-PAO by rapid octanol extraction

    DEFF Research Database (Denmark)

    Andersen, A R; Friberg, H; Lassen, N A

    1988-01-01

    and the corresponding octanol: plasma and octanol:blood partitioning values, an estimate of the transport of the lipophilic compound by various components of blood was made: 20% is carried in hemoglobin, 53% by the plasma proteins and 27% by the water phases of the red blood cell and plasma. Octanol extraction provided...

  6. Hyphenated chromatographic techniques for the rapid screening and identification of antioxidants in methanolic extracts of pharmaceutically used plants .

    NARCIS (Netherlands)

    Exarchou, V.; Fiamegos, Y.C.; Beek, van T.A.; Nanos, C.G.; Vervoort, J.J.M.

    2006-01-01

    Phytochemical analysis is an important scientific research area, which normally relies on a number of rather laborious and time-consuming techniques for compound identification. Isolation of the ingredients of plant extracts in adequate quantities for spectral and biological analysis was the basis

  7. Direct Quantification of Campylobacter jejuni in Chicken Fecal Samples Using Real-Time PCR: Evaluation of Six Rapid DNA Extraction Methods

    DEFF Research Database (Denmark)

    Garcia Clavero, Ana Belén; Kamara, Judy N.; Vigre, Håkan

    2013-01-01

    for their effectiveness for the direct quantification (without enrichment) of Campylobacter jejuni in chicken fecal samples using real-time PCR. The presence of inhibitory substances in chicken fecal samples may reduce or even completely impede the PCR amplification process making quantification very difficult. Six rapid......Direct and accurate quantification of Campylobacter in poultry is crucial for the assessment of public health risks and the evaluation of the effectiveness of control measures against Campylobacter in poultry. The aim of this study was to assess several rapid DNA extraction methods...... of this study, the Easy-DNA (Invitrogen) method generated lower Ct values, the best amplification efficiency (AE = 93.2 %) and good precision (R squared = 0.996). The method NucleoSpin® Tissue was able to detect samples spiked with the lowest Campylobacter concentration level (10 CFU/ml) but the amplification...

  8. Bead Injection Extraction Chromatography using High-capacity Lab-on-Valve as a Front End to Inductively Coupled Plasma Mass Spectrometry for Rapid Urine Radiobioassay

    DEFF Research Database (Denmark)

    Qiao, Jixin; Hou, Xiaolin; Roos, Per

    2013-01-01

    A novel bead injection (BI) extraction chromatographic microflow system exploiting high-capacity lab-on-valve (LOV) platform coupled with inductively coupled plasma mass spectrometric detection is developed for rapid and automated determination of plutonium in human urine. A microconduit (1 m......L) incorporated within the LOV processing unit is loaded on-line with a metered amount of disposable extraction chromatographic resin (up to 330 mg of TEVA) through programmable beads transport. Selective capture and purification of plutonium onto the resin beads is then performed by pressure driven flow after.......319 ± 0.004 g, n=5). The chemical yields of plutonium were averagely better than 90% under the optimal experimental conditions and the entire analytical procedure could be accomplished within a short timeframe (

  9. Rapid determination of major bioactive isoflavonoid compounds during the extraction process of kudzu (Pueraria lobata) by near-infrared transmission spectroscopy

    Science.gov (United States)

    Wang, Pei; Zhang, Hui; Yang, Hailong; Nie, Lei; Zang, Hengchang

    2015-02-01

    Near-infrared (NIR) spectroscopy has been developed into an indispensable tool for both academic research and industrial quality control in a wide field of applications. The feasibility of NIR spectroscopy to monitor the concentration of puerarin, daidzin, daidzein and total isoflavonoid (TIF) during the extraction process of kudzu (Pueraria lobata) was verified in this work. NIR spectra were collected in transmission mode and pretreated with smoothing and derivative. Partial least square regression (PLSR) was used to establish calibration models. Three different variable selection methods, including correlation coefficient method, interval partial least squares (iPLS), and successive projections algorithm (SPA) were performed and compared with models based on all of the variables. The results showed that the approach was very efficient and environmentally friendly for rapid determination of the four quality indices (QIs) in the kudzu extraction process. This method established may have the potential to be used as a process analytical technological (PAT) tool in the future.

  10. Rapid profiling and pharmacokinetic studies of major compounds in crude extract from Polygonum multiflorum by UHPLC-Q-TOF-MS and UPLC-MS/MS.

    Science.gov (United States)

    Wang, Linlin; Sang, Mangmang; Liu, Erwei; Banahene, Prince Osei; Zhang, Yi; Wang, Tao; Han, Lifeng; Gao, Xiumei

    2017-06-05

    A reliable, rapid analytical method was established for characterization of constituents in the ethanol extract of Polygonum multiflorum by combining an ultra-high performance liquid chromatography with quadrupole time-of-flight mass spectrometry (UHPLC-Q-TOF-MS). 131 constituents which including phenolic acids, stilbenes, flavones, anthraquinones, naphthalenes and their derivatives were identified or tentatively identified by using characteristic diagnostic fragment ions and references. The established method was further applied to analyze blood samples, and successfully identified 41 compounds which were absorbed through the gastrointestine in rats after administration the extract of P. multiflorum. Moreover, the pharmacokinetic studies of some major compounds in blood were investigated by using ultra performance liquid chromatography with tandem mass spectrometry (UPLC-MS/MS) method. This study showed a comprehensive research of P. multiflorum, which could provide a meaningful basis for further quality control, pharmacological as well as toxicological researches. Copyright © 2017 Elsevier B.V. All rights reserved.

  11. Rapid extraction and determination of amphetamines in human urine samples using dispersive liquid-liquid microextraction and solidification of floating organic drop followed by high performance liquid chromatography.

    Science.gov (United States)

    Ahmadi-Jouibari, Toraj; Fattahi, Nazir; Shamsipur, Mojtaba

    2014-06-01

    A novel, rapid, simple and sensitive dispersive liquid-liquid microextraction method based on the solidification of floating organic drop (DLLME-SFO) combined with high-performance liquid chromatography-ultraviolet detection (HPLC-UV) was used to determine amphetamine and methamphetamine in urine samples. The factors affecting the extraction efficiency of DLLME-SFO such as the kind and volume of the extraction and the disperser solvents, effect of concentration of K2CO3 and extraction time were investigated and the optimal extraction conditions were established. Under the optimum conditions (extraction solvent: 30.0μl 1-undecanol; disperser solvent: 300μl acetonitrile; buffer concentration: 2% (w/v) K2CO3 and extraction time: 1min), calibration curves are linear in the range of 10-3000μgl(-1) and limit of detections (LODs) are in the range of 2-8μgl(-1). The relative standard deviations (RSDs) for 100μgl(-1) of amphetamine and methamphetamine in diluted urine are in the range of 6.2-7.8% (n=7). The method was successfully applied for the determination of amphetamine and methamphetamine in the actual urine samples. The relative recoveries of urine samples spiked with amphetamine and methamphetamine are 87.8-113.2%. The obtained results show that DLLME-SFO combined with HPLC-UV is a fast and simple method for the determination of amphetamine and methamphetamine in urine. Copyright © 2014 Elsevier B.V. All rights reserved.

  12. Validation and uncertainty assessment of rapid extraction and clean-up methods for the determination of 16 organochlorine pesticide residues in vegetables.

    Science.gov (United States)

    Yenisoy-Karakaş, Serpil

    2006-07-07

    Rapid and practical extraction methods were developed using dichloromethane and ethyl acetate for the routine determination of 16 organochlorine pesticide residues and applied to approximately 30 fresh vegetables (tomato, cucumber and pepper) by using GC-ECD. The procedures were validated. Measurement uncertainties were calculated by applying bottom-up approach. The average recoveries obtained for each pesticide ranged between 65 and 102% at three fortification levels. The uncertainties of the analytical methods were lower than 21 and 16% with and without recovery correction, respectively. The calculated limits of detection and quantification were typically less than 1 ng g(-1) that were much lower than the maximum residue levels.

  13. Rapid determination of 54 pharmaceutical and personal care products in fish samples using microwave-assisted extraction-Hollow fiber-Liquid/solid phase microextraction.

    Science.gov (United States)

    Zhang, Yi; Guo, Wen; Yue, Zhenfeng; Lin, Li; Zhao, Fengjuan; Chen, Peijin; Wu, Weidong; Zhu, Hong; Yang, Bo; Kuang, Yanyun; Wang, Jiong

    2017-04-15

    In this paper, a simple, rapid, solvent-less and environmental friendliness microextraction method, microwave-assisted extraction-hollow fiber-liquid/solid phase microextraction (MAE-HF-L/SME), was developed for simultaneous extraction and enrichment of 54 trace hydrophilic/lipophilic pharmaceutical and personal care products (PPCPs) from fish samples. A solid-phase extraction material, solid-phase microextraction (SPME) fiber, was synthesized. The SPME fiber had a homogeneous, loose structure and good mechanical properties, and they exhibited a good adsorption capacity for most PPCPs selected. The material formed the basis for the method of MAE-HF-L/SME. A method of liquid chromatography-high resolution mass spectroscopy (LC-HRMS) for analysis of 54 PPCPs. Under optimal synthesis and extraction conditions, the limits of detection (LODs, n=3) and the limits of quantitation (LOQs, n=10) for the 54 PPCPs were between 0.01-0.50μg·kg-1 and 0.052.00μg·kg-1, respectively. Percent recoveries and the relative standard deviations (RSDs) in spiked fish samples (n=6) were between 56.3%-119.9% and 0.3%-17.1%, respectively. The microextraction process of 54 PPCPs in MAE-HF-L/SME took approximately 12min. The method has a low matrix interference and high enrichment factor and may be applicable for determination of 54 different PPCPs in fish samples. Copyright © 2017 Elsevier B.V. All rights reserved.

  14. A Rapid Method for the Extraction and Analysis of Carotenoids and Other Hydrophobic Substances Suitable for Systems Biology Studies with Photosynthetic Bacteria

    Directory of Open Access Journals (Sweden)

    Oliver Sawodny

    2013-10-01

    Full Text Available A simple, rapid, and inexpensive extraction method for carotenoids and other non-polar compounds present in phototrophic bacteria has been developed. The method, which has been extensively tested on the phototrophic purple non-sulphur bacterium Rhodospirillum rubrum, is suitable for extracting large numbers of samples, which is common in systems biology studies, and yields material suitable for subsequent analysis using HPLC and mass spectroscopy. The procedure is particularly suitable for carotenoids and other terpenoids, including quinones, bacteriochlorophyll a and bacteriopheophytin a, and is also useful for the analysis of polar phospholipids. The extraction procedure requires only a single step extraction with a hexane/methanol/water mixture, followed by HPLC using a Spherisorb C18 column, with a mobile phase consisting of acetone-water and a non-linear gradient of 50%–100% acetone. The method was employed for examining the carotenoid composition observed during microaerophilic growth of R. rubrum strains, and was able to determine 18 carotenoids, 4 isoprenoid-quinones, bacteriochlorophyll a and bacteriopheophytin a as well as four different phosphatidylglycerol species of different acyl chain compositions. The analytical procedure was used to examine the dynamics of carotenoid biosynthesis in the major and minor pathways operating simultaneously in a carotenoid biosynthesis mutant of R. rubrum.

  15. Optimization of pressurized liquid extraction (PLE) for rapid determination of mineral oil saturated (MOSH) and aromatic hydrocarbons (MOAH) in cardboard and paper intended for food contact.

    Science.gov (United States)

    Moret, Sabrina; Sander, Maren; Purcaro, Giorgia; Scolaro, Marianna; Barp, Laura; Conte, Lanfranco S

    2013-10-15

    Packaging can represent a primary source of food contamination with mineral oil saturated hydrocarbons (MOSH) and aromatic hydrocarbons (MOAH), especially when recycled cardboard or mineral oil based printing inks are used. A pressurized liquid extraction (PLE) method, followed by on-line LC-GC analysis, has been optimized for rapid mineral oil determination in cardboard and paper samples. The proposed method involves extraction with hexane (2 cycles) at 60°C for 5 min, and allows for the processing of up to 6 samples in parallel with minimal sample manipulation and solvent consumption. It gave good repeatability (coefficient of variation lower than 5%) and practically quantitative extraction yield (less than 2% of the total contamination found in a third separate cycle). The method was applied to different cardboards and paper materials intended for food contact. Results obtained were similar to those obtained by applying classical solvent extraction with hexane/ethanol 1:1 (v/v) as described by Lorenzini et al. [20]. Copyright © 2013 Elsevier B.V. All rights reserved.

  16. Rapid microwave-assisted acid extraction of southern pine waste wood to remove metals from chromated copper arsenate (CCA) treatment

    Science.gov (United States)

    Chung-Yun Hse; Todd F. Shupe; Bin Yu

    2013-01-01

    Recovery of metals from chromated copper arsenate (CCA)-treated southern pine wood particles was investigated by extraction in a microwave reactor with binary combinations of acetic acid (AA), oxalic acid (OxA), and phosphoric acid (PhA). Use of OxA was not successful, as insoluble copper oxalate complexes impeded copper removal. The combination of OxA and AA also had...

  17. Alkaline direct alcohol fuel cells

    Science.gov (United States)

    Antolini, E.; Gonzalez, E. R.

    The faster kinetics of the alcohol oxidation and oxygen reduction reactions in alkaline direct alcohol fuel cells (ADAFCs), opening up the possibility of using less expensive metal catalysts, as silver, nickel and palladium, makes the alkaline direct alcohol fuel cell a potentially low cost technology compared to acid direct alcohol fuel cell technology, which employs platinum catalysts. A boost in the research regarding alkaline fuel cells, fuelled with hydrogen or alcohols, was due to the development of alkaline anion-exchange membranes, which allows the overcoming of the problem of the progressive carbonation of the alkaline electrolyte. This paper presents an overview of catalysts and membranes for ADAFCs, and of testing of ADAFCs, fuelled with methanol, ethanol and ethylene glycol, formed by these materials.

  18. Rapid method for DNA extraction from the honey bee Apis mellifera and the parasitic bee mite Varroa destructor using lysis buffer and proteinase K.

    Science.gov (United States)

    Issa, M R C; Figueiredo, V L C; De Jong, D; Sakamoto, C H; Simões, Z L P

    2013-10-22

    We developed a rapid method for extraction of DNA from honey bees, Apis mellifera, and from the parasitic bee mite, Varroa destructor. The advantages include fast processing and low toxicity of the substances that are utilized. We used lysis buffer with nonionic detergents to lyse cell walls and proteinase K to digest proteins. We tested whole thorax, thoracic muscle mass, legs, and antennae from individual bees; the mites were processed whole (1 mite/sample). Each thorax was incubated whole, without cutting, because exocuticle color pigment darkened the extraction solution, interfering with PCR results. The procedure was performed with autoclaved equipment and laboratory gloves. For each sample, we used 100 µL lysis buffer (2 mL stock solution of 0.5 M Tris/HCl, pH 8.5, 10 mL stock solution of 2 M KCl, 500 µL solution of 1 M MgCl2, 2 mL NP40, and 27.6 g sucrose, completed to 200 mL with bidistilled water and autoclaved) and 2 µL proteinase K (10 mg/mL in bidistilled water previously autoclaved, as proteinase K cannot be autoclaved). Tissues were incubated in the solutions for 1-2 h in a water bath (62°-68 °C) or overnight at 37 °C. After incubation, the tissues were removed from the extraction solution (lysis buffer + proteinase K) and the solution heated to 92 °C for 10 min, for proteinase K inactivation. Then, the solution with the extracted DNA was stored in a refrigerator (4°-8 °C) or a freezer (-20 °C). This method does not require centrifugation or phenol/chloroform extraction. The reduced number of steps allowed us to sample many individuals/day. Whole mites and bee antennae were the most rapidly processed. All bee tissues gave the same quality DNA. This method, even using a single bee antenna or a single mite, was adequate for extraction and analysis of bee genomic and mitochondrial DNA and mite genomic DNA.

  19. A rapid and validated HPLC method to quantify racecadotril metabolite, thiorphan, in human plasma using solid-phase extraction.

    Science.gov (United States)

    Xu, Fan; Yang, Lingli; Xu, Guili

    2008-01-01

    A HPLC method with UV detection was developed and validated for the determination of thiorphan in human plasma. Nevirapine was used as the internal standard. Separation was performed by a Waters sunfire C18 reversed-phase column maintained at 35 degrees C. The mobile phase was a mixture of 0.05 M phosphate buffer with the pH adjusted to 2.6 and acetonitrile (74:26, v/v) at a flow rate of 1.0 mL/min. The UV detector was set at 210 nm. An original pre-treatment of plasma samples was developed, based on solid-phase extraction (SPE) with solid-phase extraction cartridges (Oasis HLB 3 mL, 60 mg). The extraction recovery for plasma samples of thiorphan at 0.1, 0.4 and 2.0 microg/mL was 93.5%, 98.2% and 97.8%, respectively. The calibration curve was linear with the correlation coefficient (r) above 0.9998. Linearity was verified over the range of 0.05-4 microg/mL thiorphan in plasma. The limit of quantification (LOQ) is 0.05 microg/mL. The mean accuracy was 92.7-99.6%. The coefficient of variation (precision) in the within- and between-batch was 2.2-8.4% and 4.1-8.1%, respectively. This method is simple, economical and specific, and has been used successfully in a pharmacokinetic study of thiorphan.

  20. Extraction-less, rapid assay for the direct detection of 2,4,6-trichloroanisole (TCA) in cork samples.

    Science.gov (United States)

    Apostolou, Theofylaktos; Pascual, Nuria; Marco, M-Pilar; Moschos, Anastassios; Petropoulos, Anastassios; Kaltsas, Grigoris; Kintzios, Spyridon

    2014-07-01

    2,4,6-trichloroanisole (TCA), the cork taint molecule, has been the target of several analytical approaches over the few past years. In spite of the development of highly efficient and sensitive tools for its detection, ranging from advanced chromatography to biosensor-based techniques, a practical breakthrough for routine cork screening purposes has not yet been realized, in part due to the requirement of a lengthy extraction of TCA in organic solvents, mostly 12% ethanol and the high detectability required. In the present report, we present a modification of a previously reported biosensor system based on the measurement of the electric response of cultured fibroblast cells membrane-engineered with the pAb78 TCA-specific antibody. Samples were prepared by macerating cork tissue and mixing it directly with the cellular biorecognition elements, without any intervening extraction process. By using this novel approach, we were able to detect TCA in just five minutes at extremely low concentrations (down to 0.2 ppt). The novel biosensor offers a number of practical benefits, including a very considerable reduction in the total assay time by one day, and a full portability, enabling its direct employment for on-site, high throughput screening of cork in the field and production facilities, without requiring any type of supporting infrastructure. Copyright © 2014 Elsevier B.V. All rights reserved.

  1. Preparation of magnetic molecularly imprinted polymers by atom transfer radical polymerization for the rapid extraction of avermectin from fish samples.

    Science.gov (United States)

    You, Xiaoxiao; Gao, Lei; Qin, Dongli; Chen, Ligang

    2017-01-01

    A novel and highly efficient approach to obtain magnetic molecularly imprinted polymers is described to detect avermectin in fish samples. The magnetic molecularly imprinted polymers were synthesized by surface imprinting polymerization using magnetic multiwalled carbon nanotubes as the support materials, atom transfer radical polymerization as the polymerization method, avermectin as template, acrylamide as functional monomer, and ethylene glycol dimethacrylate as crosslinker. The characteristics of the magnetic molecularly imprinted polymers were assessed by using transmission electron microscopy, Fourier transform infrared spectroscopy, X-ray photoelectron spectroscopy, vibrating sample magnetometry, X-ray diffraction, and thermogravimetric analysis. The binding characteristics of magnetic molecularly imprinted polymers were researched through isothermal adsorption experiment, kinetics adsorption experiment, and the selectivity experiment. Coupled with ultra high performance liquid chromatography and tandem mass spectrometry, the extraction conditions of the magnetic molecularly imprinted polymers as adsorbents for avermectin were investigated in detail. The recovery of avermectin was 84.2-97.0%, and the limit of detection was 0.075 μg/kg. Relative standard deviations of intra- and inter-day precisions were in the range of 1.7-2.9% and 3.4-5.6%, respectively. The results demonstrated that the extraction method not only has high selectivity and accuracy, but also is convenient for the determination of avermectin in fish samples. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  2. Alkaline phosphatase: beyond the liver.

    Science.gov (United States)

    Fernandez, Nicole J; Kidney, Beverly A

    2007-09-01

    The alkaline phosphatases comprise a heterogeneous group of enzymes that are widely distributed in mammalian cells. They often are associated with cell membranes, but their exact physiologic function is unknown. Despite this, alkaline phosphatase activity is a very useful serum biochemical indicator of liver disease, particularly cholestatic disease. However, increases in the activity of alkaline phosphatase in serum and other body fluids may reflect physiologic or pathologic changes beyond those of hepatic origin. For example, nonhepatic increases in serum alkaline phosphatase activity are found in young animals, in pregnant and lactating females, and in association with high fat diets. Bone disease, endocrine disease, neoplasia, and other disorders can result in increased alkaline phosphatase activity. In addition, alkaline phosphatase activity may be increased due to induction by certain drugs such as glucocorticoids and anticonvulsants. In this article, we will review the physiologic and pathologic factors influencing the activity of alkaline phosphatase in serum and other body fluids, with an emphasis on disorders beyond liver disease.

  3. Cofactor interactions in the activation of tissue non-specific alkaline ...

    African Journals Online (AJOL)

    The interactions of Mg2+ and Zn2+ ions in the activation of non-specific tissue alkaline phosphatase were investigated using crude extracts of rat kidney. Activation of alkaline phosphatase by the metal ions was accompanied by changes in the kinetic parameters of nitrophenylphosphate hydrolysis. The results suggest ...

  4. Rapid Extraction and Identification of Maitotoxin and Ciguatoxin-Like Toxins from Caribbean and Pacific Gambierdiscus Using a New Functional Bioassay.

    Directory of Open Access Journals (Sweden)

    Richard J Lewis

    Full Text Available Ciguatera is a circumtropical disease produced by polyether sodium channel toxins (ciguatoxins that enter the marine food chain and accumulate in otherwise edible fish. Ciguatoxins, as well as potent water-soluble polyethers known as maitotoxins, are produced by certain dinoflagellate species in the genus Gambierdiscus and Fukuyoa spp. in the Pacific but little is known of the potential of related Caribbean species to produce these toxins.We established a simplified procedure for extracting polyether toxins from Gambierdiscus and Fukuyoa spp. based on the ciguatoxin rapid extraction method (CREM. Fractionated extracts from identified Pacific and Caribbean isolates were analysed using a functional bioassay that recorded intracellular calcium changes (Ca2+ in response to sample addition in SH-SY5Y cells. Maitotoxin directly elevated Ca2+i, while low levels of ciguatoxin-like toxins were detected using veratridine to enhance responses.We identified significant maitotoxin production in 11 of 12 isolates analysed, with 6 of 12 producing at least two forms of maitotoxin. In contrast, only 2 Caribbean isolates produced detectable levels of ciguatoxin-like activity despite a detection limit of >30 pM. Significant strain-dependent differences in the levels and types of ciguatoxins and maitotoxins produced by the same Gambierdiscus spp. were also identified.The ability to rapidly identify polyether toxins produced by Gambierdiscus spp. in culture has the potential to distinguish ciguatoxin-producing species prior to large-scale culture and in naturally occurring blooms of Gambierdiscus and Fukuyoa spp. Our results have implications for the evaluation of ciguatera risk associated with Gambierdiscus and related species.

  5. Establishment of a rapid, inexpensive protocol for extraction of high quality RNA from small amounts of strawberry plant tissues and other recalcitrant fruit crops.

    Science.gov (United States)

    Christou, Anastasis; Georgiadou, Egli C; Filippou, Panagiota; Manganaris, George A; Fotopoulos, Vasileios

    2014-03-01

    Strawberry plant tissues and particularly fruit material are rich in polysaccharides and polyphenolic compounds, thus rendering the isolation of nucleic acids a difficult task. This work describes the successful modification of a total RNA extraction protocol, which enables the isolation of high quantity and quality of total RNA from small amounts of strawberry leaf, root and fruit tissues. Reverse-transcription polymerase chain reaction (RT-PCR) amplification of GAPDH housekeeping gene from isolated RNA further supports the proposed protocol efficiency and its use for downstream molecular applications. This novel procedure was also successfully followed using other fruit tissues, such as olive and kiwifruit. In addition, optional treatment with RNase A following initial nucleic acid extraction can provide sufficient quality and quality of genomic DNA for subsequent PCR analyses, as evidenced from PCR amplification of housekeeping genes using extracted genomic DNA as template. Overall, this optimized protocol allows easy, rapid and economic isolation of high quality RNA from small amounts of an important fruit crop, such as strawberry, with extended applicability to other recalcitrant fruit crops. Copyright © 2013 Elsevier B.V. All rights reserved.

  6. Rapid determination of endogenous cytokinins in plant samples by combination of magnetic solid phase extraction with hydrophilic interaction chromatography-tandem mass spectrometry.

    Science.gov (United States)

    Liu, Zhao; Cai, Bao-Dong; Feng, Yu-Qi

    2012-04-01

    A 2-acrylamido-2-methyl-1-propanesulfonic acid-co-ethylene glycol dimethacrylate (Fe₃O₄/SiO₂/P(AMPS-co-EGDMA)) copolymer was prepared and used as a magnetic solid phase extraction (MSPE) medium for recovery of endogenous cytokinins (CKs) from plant extracts. This magnetic porous polymer was characterized by electron microscopy, nitrogen sorption experiments, elemental analysis and Fourier-transformed infrared spectroscopy. It was demonstrated to have high extraction capacity toward CKs in plants due to its specificity, surface area and porous structure. Coupled with hydrophilic interaction chromatography-tandem mass spectrometry (HILIC-MS/MS), a rapid, simple, and effective MSPE-HILIC-MS/MS analytical method for the quantitative analysis of endogenous CKs in Oryza sativa (O. sativa) roots was successfully established. Good linearities were obtained for all CKs investigated with correlation coefficients (R²>0.9975. The results showed that LODs (S/N=3) were ranged from 0.18 to 3.65 pg mL⁻¹. Reproducibility of the method was obtained with intra-day and inter-day relative standard deviations (RSDs) less than 16.1% and the recoveries in plant samples ranged from 72.8% to 115.5%. Finally, the MSPE-HILIC-MS/MS method was applied to several plant samples, and the amounts of endogenous CKs in O. sativa roots, leaves and Arabidopsis thaliana (A. thaliana) were successfully determined. Copyright © 2012 Elsevier B.V. All rights reserved.

  7. One pot synthesis of magnetic graphene/carbon nanotube composites as magnetic dispersive solid-phase extraction adsorbent for rapid determination of oxytetracycline in sewage water.

    Science.gov (United States)

    Sun, Yunyun; Tian, Jing; Wang, Lu; Yan, Hongyuan; Qiao, Fengxia; Qiao, Xiaoqiang

    2015-11-27

    A simple and time-saving one pot synthesis of magnetic graphene/carbon nanotube composites (M-G/CNTs) was developed that could avoid the tedious drying process of graphite oxide, and G/CNTs were modified by Fe3O4 nanoparticles in the reduction procedure. It contributed to a shorten duration of the synthesis process of M-G/CNTs. The obtained M-G/CNTs were characterized and the results indicated that CNTs and Fe3O4 nanoparticles were served as spacer distributing to the layers of graphene, which was beneficial for enlarging surface area and improving extraction efficiency. Moreover, M-G/CNTs showed good magnetic property and outstanding thermal stability. Then M-G/CNTs were applied as adsorbent of magnetic dispersive solid-phase extraction for rapid extraction and determination of oxytetracycline in sewage water. Under the optimum conditions, good linearity was obtained in the range of 20-800ngmL(-1) and the recoveries were ranged from 95.5% to 112.5% with relative standard deviations less than 5.8%. Copyright © 2015 Elsevier B.V. All rights reserved.

  8. A Rapid and Reproducible Genomic DNA Extraction Protocol for Sequence-Based Identification of Archaea, Bacteria, Cyanobacteria, Diatoms, Fungi, and Green Algae

    Directory of Open Access Journals (Sweden)

    Farkhondeh Saba

    2017-01-01

    Full Text Available Background:  Sequence-based identification of various microorganisms including Archaea, Bacteria, Cyanobacteria, Diatoms, Fungi, and green algae necessitates an efficient and reproducible genome extraction procedure though which a pure template DNA is yielded and it can be used in polymerase chain reactions (PCR. Considering the fact that DNA extraction from these microorganisms is time consuming and laborious, we developed and standardized a safe, rapid and inexpensive miniprep protocol. Methods:  According to our results, amplification of various genomic regions including SSU, LSU, ITS, β-tubulin, actin, RPB2, and EF-1 resulted in a reproducible and efficient DNA extraction from a wide range of microorganisms yielding adequate pure genomic material for reproducible PCR-amplifications. Results:   This method relies on a temporary shock of increased concentrations of detergent which can be applied concomitant with multiple freeze-thaws to yield sufficient amount of DNA for PCR amplification of multiple or single fragments(s of the genome. As an advantage, the recipe seems very flexible, thus, various optional steps can be included depending on the samples used.Conclusion:   Having the needed flexibility in each step, this protocol is applicable on a very wide range of samples. Hence, various steps can be included depending on the desired quantity and quality.

  9. Chromatographic separation of alkaline phosphatase from dental enamel

    DEFF Research Database (Denmark)

    Moe, D; Kirkeby, S; Salling, E

    1989-01-01

    Alkaline phosphatase (AP) was prepared from partly mineralized bovine enamel by extraction in phosphate buffer, centrifugation and various chromatographic techniques. Chromatofocusing showed that the enamel enzyme possessed five isoelectric points at the acid pH level ranging from pH 5.7 to pH 4...

  10. Toward mechanistic understanding of nuclear reprocessing chemistries by quantifying lanthanide solvent extraction kinetics via microfluidics with constant interfacial area and rapid mixing.

    Science.gov (United States)

    Nichols, Kevin P; Pompano, Rebecca R; Li, Liang; Gelis, Artem V; Ismagilov, Rustem F

    2011-10-05

    The closing of the nuclear fuel cycle is an unsolved problem of great importance. Separating radionuclides produced in a nuclear reactor is useful both for the storage of nuclear waste and for recycling of nuclear fuel. These separations can be performed by designing appropriate chelation chemistries and liquid-liquid extraction schemes, such as in the TALSPEAK process (Trivalent Actinide-Lanthanide Separation by Phosphorus reagent Extraction from Aqueous Komplexes). However, there are no approved methods for the industrial scale reprocessing of civilian nuclear fuel in the United States. One bottleneck in the design of next-generation solvent extraction-based nuclear fuel reprocessing schemes is a lack of interfacial mass transfer rate constants obtained under well-controlled conditions for lanthanide and actinide ligand complexes; such rate constants are a prerequisite for mechanistic understanding of the extraction chemistries involved and are of great assistance in the design of new chemistries. In addition, rate constants obtained under conditions of known interfacial area have immediate, practical utility in models required for the scaling-up of laboratory-scale demonstrations to industrial-scale solutions. Existing experimental techniques for determining these rate constants suffer from two key drawbacks: either slow mixing or unknown interfacial area. The volume of waste produced by traditional methods is an additional, practical concern in experiments involving radioactive elements, both from disposal cost and experimenter safety standpoints. In this paper, we test a plug-based microfluidic system that uses flowing plugs (droplets) in microfluidic channels to determine absolute interfacial mass transfer rate constants under conditions of both rapid mixing and controlled interfacial area. We utilize this system to determine, for the first time, the rate constants for interfacial transfer of all lanthanides, minus promethium, plus yttrium, under TALSPEAK

  11. Sunlight-induced rapid and efficient biogenic synthesis of silver nanoparticles using aqueous leaf extract of Ocimum sanctum Linn. with enhanced antibacterial activity.

    Science.gov (United States)

    Brahmachari, Goutam; Sarkar, Sajal; Ghosh, Ranjan; Barman, Soma; Mandal, Narayan C; Jash, Shyamal K; Banerjee, Bubun; Roy, Rajiv

    2014-12-01

    , thus offers a cost-effective and environmentally benign route for their large-scale commercial production. The nanoparticles dispersed in the mother solution showed promising antibacterial efficacy. Graphical AbstractSunlight-induced rapid and efficient biogenic synthesis of silver nanoparticles using aqueous leaf extract of Ocimum sanctum Linn. with enhanced antibacterial activity.

  12. Microwave extraction-isotope ratio infrared spectroscopy (ME-IRIS): a novel technique for rapid extraction and in-line analysis of δ18O and δ2H values of water in plants, soils and insects.

    Science.gov (United States)

    Munksgaard, Niels C; Cheesman, Alexander W; Wurster, Chris M; Cernusak, Lucas A; Bird, Michael I

    2014-10-30

    Traditionally, stable isotope analysis of plant and soil water has been a technically challenging, labour-intensive and time-consuming process. Here we describe a rapid single-step technique which combines Microwave Extraction with Isotope Ratio Infrared Spectroscopy (ME-IRIS). Plant, soil and insect water is extracted into a dry air stream by microwave irradiation within a sealed vessel. The water vapor thus produced is carried to a cooled condensation chamber, which controls the water vapor concentration and flow rate to the spectrometer. Integration of the isotope signals over the whole analytical cycle provides quantitative δ(18)O and δ(2) H values for the initial liquid water contained in the sample. Calibration is carried out by the analysis of water standards using the same apparatus. Analysis of leaf and soil water by cryogenic vacuum distillation and IRMS was used to validate the ME-IRIS data. Comparison with data obtained by cryogenic distillation and IRMS shows that the new technique provides accurate water isotope data for leaves from a range of field-grown tropical plant species. However, two exotic nursery plants were found to suffer from spectral interferences from co-extracted organic compounds. The precision for extracted leaf, stem, soil and insect water was typically better than ±0.3 ‰ for δ(18)O and ±2 ‰ for δ(2) H values, and better than ±0.1 ‰ for δ(18)O and ±1 ‰ for δ(2) H values when analyzing water standards. The effects of sample size, microwave power and duration and sample-to-sample memory on isotope values were assessed. ME-IRIS provides rapid and low-cost extraction and analysis of δ(18)O and δ(2) H values in plant, soil and insect water (≈10-15 min for samples yielding ≈ 0.3 mL of water). The technique can accommodate whole leaves of many plant species. Copyright © 2014 John Wiley & Sons, Ltd.

  13. Rapid determination of strontium-90 by solid phase extraction using DGA Resin® for seawater monitoring

    Science.gov (United States)

    Tazoe, H.; Obata, H.; Yamagata, T.; Karube, Z.; Yamada, M.

    2015-12-01

    Strontium-90 concentrations in seawater exceeding the background level have been observed at the accidents of nuclear facilities, such as Chernobyl and Fukushima. However, analytical procedure for strontium-90 in seawater is still quite complicated and challenging. Here we show a simple and rapid analytical technique for the determination of strontium-90 in seawater samples without time-consuming separation of strontium from calcium. The separation with DGA Resin® is used to determine the abundance of strontium-90, which selectively collects yttrium-90, progeny of strontium-90. Naturally occurring radioactive nuclides (such as potassium, lead, bismuth, uranium, and thorium) and anthropogenic radionuclides (such as cesium, barium, lanthanum, and cerium) were separated from yttrium. Through a sample separation procedure, a high chemical yield of yttrium-90 was achieved at 93.9 % for seawater. The result of IAEA 443 certified seawater analysis was in good agreement with the certified value. At 20 hrs counting a lower detection limit of 1.5 mBq L-1 was obtained from 3 L of seawater. The proposed method can finish analyzing 8 samples per day, which is a reasonably fast throughput in actual seawater monitoring. Reproducibility was found to be 3.4 % according to 10 separate analyses of natural seawater samples from the vicinity of Fukushima Daiichi Nuclear Power Plant in September 2013.

  14. [Rapid determination of benzene series in seawater by gas chromatography-mass spectrometry with static headspace extraction].

    Science.gov (United States)

    Bai, Hongyan; Han, Bin; Chen, Junhui; Zheng, Li; Yang, Dongfang; Wang, Xiaoru

    2012-05-01

    A method for the simultaneous determination of 13 benzene series (BTEX) in seawater using gas chromatography-mass spectrometry with static headspace extraction (HS-GC/MS) was developed. To carefully characterize the performance of this method, several factors affecting parameters were studied in detail, such as the type of column, heating procedure, equilibrium temperature, equilibrium time and the volume ratio of gas phase to liquid phase. The optimized conditions were as follows: the polar column of DB-WAX; heating procedure, 40 degrees C kept for 4 min, then raised to 120 degrees C at 10 degrees C/min, to 180 degrees C at 25 degrees C/min; equilibrium temperature, 80 degrees C; equilibrium time, 10 min; and the volume ratio of gas phase to liquid phase, 1:1. Under the optimized conditions, the linear equations were obtained in the concentration range of 0.16-320 microg/L with correlation coefficients greater than 0.999. The limits of detection (S/N = 3) were 0.019-0.033 microg/L. The recoveries at the three spiked levels of 1.6, 16 and 160 microg/L ranged from 81. 25% to 103.73% with the relative standard deviations (RSD, n=6) from 0.3% to 4.4%. The analytical results of the practical seawater samples from Shanghai Huangpu District were satisfactory. The determination of the 13 benzene series can be finished in 12 min. The method is simple, accurate, reliable, efficient and environmental-friendly.

  15. A rapid and sensitive extractive spectrophotometric determination of copper(II) in pharmaceutical and environmental samples using benzildithiosemicarbazone.

    Science.gov (United States)

    Reddy, B K; Kumar, J R; Reddy, K J; Sarma, L S; Reddy, A V

    2003-03-01

    Benzildithiosemicarbazone (BDTSC) is proposed as a sensitive and selective analytical reagent for the extractive spectrophotometric determination of copper(II). BDTSC reacts with copper(II) in the pH range 1.0-7.0 to form a yellowish complex. Beer's law is obeyed in the concentration range 0.5-0.4 microg cm(-3). The yellowish Cu(II)-BDTSC complex in chloroform shows a maximum absorbance at 380 nm, with molar absorptivity and Sandell's sensitivity values of 1.63 x 10(4) dm3 mol(-1) cm(-1) and 0.00389 microg cm(-2), respectively. A repetition of the method is checked by finding the relative standard deviation (RSD) (n = 10), which is 0.6%. The composition of the Cu(II)-BDTSC complex is established as 1:1 by slope analysis, molar ratio and Asmus' methods. An excellent linearity with a correlation coefficient value of 0.98 is obtained for the Cu(II)-BDTSC complex. The instability constant of the complex calculated from Edmond and Birnbaum's method is 7.70 x 10(-4) and that of Asmus' method is 7.66 x 10(-4), at room temperature. The method is successfully employed for the determination copper(II) in pharmaceutical and environmental samples. The reliability of the method is assured by analyzing the standard alloys (BCS 5g, 10g, 19e, 78, 32a, 207 and 179) and by inter-comparison of experimental values, using an atomic absorption spectrometer.

  16. Rapid assessment of iron in blood plasma and serum by spectrophotometry with cloud-point extraction [version 1; referees: 2 approved

    Directory of Open Access Journals (Sweden)

    Tatyana Samarina

    2015-08-01

    Full Text Available Rapid photometric assessment of iron in blood plasma and serum by a simple procedure after the extraction of iron(II complex with 1-nitroso-2-naphthol in the micellar phase of a nonionic surfactant at the cloud point upon heating (pH range is 4.5–6.3 is proposed. The procedure trueness was verified using a standard reference protocol using bathophenanthroline. The advantages of the procedure are higher sensitivity than the reference protocol: the limit of detection is 0.03 μg/mL, the limit of quantitation is 0.1 μg/mL, the determination range is 0.1 – 2.8 μg/mL (RSD 0.02–0.10. Copper does not interfere with the iron assessment.

  17. Rapid Determination of Major Compounds in the Ethanol Extract of Geopropolis from Malaysian Stingless Bees, Heterotrigona itama, by UHPLC-Q-TOF/MS and NMR.

    Science.gov (United States)

    Zhao, Lingling; Yu, Mengjiao; Sun, Minghui; Xue, Xiaofeng; Wang, Tongtong; Cao, Wei; Sun, Liping

    2017-11-10

    A reliable, rapid analytical method was established for the characterization of constituents of the ethanol extract of geopropolis (EEGP) produced by Malaysian stingless bees- Heterotrigona itama -by combining ultra-high-performance liquid chromatography with quadruple time-of-flight mass spectrometry (UHPLC-Q-TOF/MS). Based on known standards, the online METLIN database, and published literature, 28 compounds were confirmed. Phenolic acids, flavones, triterpenes and phytosterol were identified or tentatively identified using characteristic diagnostic fragment ions. The results indicated that terpenoids were the main components of EEGP, accompanied by low levels of phenolic acids, flavonoids, and phytosterol. Two major components were further purified by preparative high-performance liquid chromatography (PHPLC) and identified by nuclear magnetic resonance (NMR) as 24( E )-cycloart-24-ene-26-ol-3-one and 20-hydroxy-24-dammaren-3-one. These two triterpenes, confirmed in this geopropolis for the first time, are potential chemical markers for the identification of geopropolis from Malaysian stingless bees, H. itama .

  18. Preparation of novel curcumin-imprinted polymers based on magnetic multi-walled carbon nanotubes for the rapid extraction of curcumin from ginger powder and kiwi fruit root.

    Science.gov (United States)

    Zhang, Zhaohui; Chen, Xing; Rao, Wei; Long, Fang; Yan, Liang; Yin, Yuli

    2015-01-01

    A novel molecularly imprinted polymer based on magnetic phenyl-modified multi-walled carbon nanotubes was synthesized using curcumin as the template molecule, methacrylic acid as the functional monomer and ethylene glycol dimethacrylate as the cross-linker. The phenyl groups contained in the magnetic imprinted polymers acted as the assisting functional monomer. The magnetic imprinted polymers were characterized by scanning electron microscopy, Fourier-transform infrared spectroscopy and vibrating sample magnetometry. Adsorption studies demonstrated that the magnetic imprinted polymers possessed excellent selectivity toward curcumin with a maximum capacity of 16.80 mg/g. Combining magnetic extraction and high-performance liquid chromatography technology, the magnetic imprinted polymer based on magnetic phenyl-modified multi-walled carbon nanotubes was applied for the rapid separation and enrichment of curcumin from ginger powder and kiwi fruit root successfully. © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  19. Isocratic Solid Phase Extraction-Liquid Chromatography (SPE-LC) Interfaced to High-Performance Tandem Mass Spectrometry for Rapid Protein Identification

    DEFF Research Database (Denmark)

    Hørning, Ole B; Kjeldsen, Frank; Theodorsen, Søren

    2008-01-01

    Reversed-phase liquid chromatography interfaced to electrospray ionization tandem mass spectrometry (LC-ESI-MS/MS) allows analysis of very complex peptide mixtures at great sensitivity, but it can be very time-consuming, typically using 60 min, or more, per sample analysis. We recently introduced...... the isocratic solid phase extraction-liquid chromatography (SPE-LC) technology for rapid separation ( approximately 8 min) of simple peptide samples. We now extend these studies to demonstrate the potential of SPE-LC separation in combination with a hybrid linear ion trap-Orbitrap tandem mass spectrometer...... for efficient analysis of peptide samples in proteomics research. The system performance of SPE-LC-MS/MS was evaluated in terms of sensitivity and efficiency for the analysis of tryptic peptide digests obtained from samples consisting of up to 12 standard proteins. The practical utility of the analytical setup...

  20. A rapid MCM-41 dispersive micro-solid phase extraction coupled with LC/MS/MS for quantification of ketoconazole and voriconazole in biological fluids.

    Science.gov (United States)

    Yahaya, Noorfatimah; Sanagi, Mohd Marsin; Abd Aziz, Noorizan; Wan Ibrahim, Wan Aini; Nur, Hadi; Loh, Saw Hong; Kamaruzaman, Sazlinda

    2017-02-01

    A rapid dispersive micro-solid phase extraction (D-μ-SPE) combined with LC/MS/MS method was developed and validated for the determination of ketoconazole and voriconazole in human urine and plasma samples. Synthesized mesoporous silica MCM-41 was used as sorbent in d-μ-SPE of the azole compounds from biological fluids. Important D-μ-SPE parameters, namely type desorption solvent, extraction time, sample pH, salt addition, desorption time, amount of sorbent and sample volume were optimized. Liquid chromatographic separations were carried out on a Zorbax SB-C 18 column (2.1 × 100 mm, 3.5 μm), using a mobile phase of acetonitrile-0.05% formic acid in 5 mm ammonium acetate buffer (70:30, v/v). A triple quadrupole mass spectrometer with positive ionization mode was used for the determination of target analytes. Under the optimized conditions, the calibration curves showed good linearity in the range of 0.1-10,000 μg/L with satisfactory limit of detection (≤0.06 μg/L) and limit of quantitation (≤0.3 μg/L). The proposed method also showed acceptable intra- and inter-day precisions for ketoconazole and voriconazole from urine and human plasma with RSD ≤16.5% and good relative recoveries in the range 84.3-114.8%. The MCM-41-D-μ-SPE method proved to be rapid and simple and requires a small volume of organic solvent (200 μL); thus it is advantageous for routine drug analysis. Copyright © 2016 John Wiley & Sons, Ltd.

  1. Rapid gas chromatography with flame photometric detection of multiple organophosphorus pesticides in Salvia miltiorrhizae after ultrasonication assisted one-step extraction.

    Science.gov (United States)

    Zhang, Shanshan; Liu, Xiaofei; Qin, Jia'an; Yang, Meihua; Zhao, Hongzheng; Wang, Yong; Guo, Weiying; Ma, Zhijie; Kong, Weijun

    2017-11-15

    A simple and rapid gas chromatography-flame photometric detection (GC-FPD) method was developed for the determination of 12 organophosphorus pesticides (OPPs) in Salvia miltiorrhizae by using ultrasonication assisted one-step extraction (USAE) without any clean-up steps. Some crucial parameters such as type of extraction solvent were optimized to improve the method performance for trace analysis. Any clean-up steps were negligent as no interferences were detected in the GC-FPD chromatograms for sensitive detection. Under the optimized conditions, limits of detection (LODs) and quantitation (LOQs) for all pesticides were in the range of 0.001-0.002mg/kg and 0.002-0.01mg/kg and 0.002-0.01mg/kg, respectively, which were all below the regulatory maximum residue limits suggested. RSDs for method precision (intra- and inter-day variations) were lower than 6.8% in approval with international regulations. Average recovery rates for all pesticides at three fortification levels (0.5, 1.0 and 5.0mg/kg) were in the range of 71.2-101.0% with relative standard deviations (RSDs) pesticide (dimethoate) out of the 12 targets was simultaneously detected in four samples at concentrations of 0.016-0.02mg/kg. Dichlorvos and omethoate were found in the same sample from Sichuan province at 0.004 and 0.027mg/kg, respectively. Malathion and monocrotophos were determined in the other two samples at 0.014 and 0.028mg/kg, respectively. All the positive samples were confirmed by LC-MS/MS. The simple, reliable and rapid USAE-GC-FPD method with many advantages over traditional techniques would be preferred for trace analysis of multiple pesticides in more complex matrices. Copyright © 2017 Elsevier B.V. All rights reserved.

  2. The alkaline and alkaline-carbonatite magmatism from Southern Brazil

    Science.gov (United States)

    Ruberti, E.; Gomes, C. D. B.; Comin-Chiaramonti, P.

    2015-12-01

    Early to Late Cretaceous lasting to Paleocene alkaline magmatism from southern Brazil is found associated with major extensional structural features in and around the Paraná Basin and grouped into various provinces on the basis of several data. Magmatism is variable in size, mode of occurrence and composition. The alkaline rocks are dominantly potassic, a few occurrences showing sodic affinity. The more abundant silicate rocks are evolved undersaturated to saturated in silica syenites, displaying large variation in igneous forms. Less evolved types are restricted to subvolcanic environments and outcrops of effusive suites occur rarely. Cumulatic mafic and ultramafic rock types are very common, particularly in the alkali-carbonatitic complexes. Carbonatite bodies are represented by Ca-carbonatites and Mg-carbonatites and more scarcely by Fe-carbonatites. Available radiometric ages for the alkaline rocks fit on three main chronological groups: around 130 Ma, subcoveal with the Early Cretaceous flood tholeiites of the Paraná Basin, 100-110 Ma and 80-90 Ma (Late Cretaceous). The alkaline magmatism also extends into Paleocene times, as indicated by ages from some volcanic lavas. Geochemically, alkaline potassic and sodic rock types are distinguished by their negative and positive Nb-Ta anomalies, respectively. Negative spikes in Nb-Ta are also a feature common to the associated tholeiitic rocks. Sr-Nd-Pb systematics confirm the contribution of both HIMU and EMI mantle components in the formation of the alkaline rocks. Notably, Early and Late Cretaceous carbonatites have the same isotopic Sr-Nd initial ratios of the associated alkaline rocks. C-O isotopic Sr-Nd isotopic ratios indicate typical mantle signature for some carbonatites and the influence of post-magmatic processes in others. Immiscibility of liquids of phonolitic composition, derived from mafic alkaline parental magmas, has been responsible for the origin of the carbonatites. Close association of alkaline

  3. Rapid and sensitive solid phase extraction-large volume injection-gas chromatography for the analysis of mineral oil saturated and aromatic hydrocarbons in cardboard and dried foods.

    Science.gov (United States)

    Moret, Sabrina; Barp, Laura; Purcaro, Giorgia; Conte, Lanfranco S

    2012-06-22

    A rapid off-line solid phase extraction-large volume injection-gas chromatography-flame ionisation detection (SPE-LVI-GC-FID) method, based on the use of silver silica gel and low solvent consumption, was developed for mineral oil saturated hydrocarbon (MOSH) and mineral oil aromatic hydrocarbon (MOAH) determination in cardboard and dried foods packaged in cardboard. The SPE method was validated using LVI with a conventional on-column injector and the retention gap technique (which allowed to inject up to 50 μL of the sample). Detector response was linear over all the concentration range tested (0.5-250 μg/mL), recoveries were practically quantitative, repeatability was good (coefficients of variation lower than 7%) and limit of quantification adequate to quantify the envisioned limit of 0.15 mg/kg proposed in Germany for MOAH analysis in food samples packaged in recycled cardboard. Rapid heating of the GC oven allowed to increase sample throughput (3-4 samples per hour) and to enhance sensitivity. The proposed method was used for MOSH and MOAH determination in selected food samples usually commercialised in cardboard packaging. The most contaminated was a tea sample (102.2 and 7.9 mg/kg of MOSH and MOAH below n-C25, respectively), followed by a rice and a sugar powder sample, all packaged in recycled cardboard. Copyright © 2012 Elsevier B.V. All rights reserved.

  4. Development of a rapid DNA extraction method and one-step nested PCR for the detection of Naegleria fowleri from the environment.

    Science.gov (United States)

    Ahmad, Arine Fadzlun; Lonnen, James; Andrew, Peter W; Kilvington, Simon

    2011-10-15

    Naegleria fowleri is a small free-living amoebo-flagellate found in natural and manmade thermal aquatic habitats worldwide. The organism is pathogenic to man causing fatal primary amoebic meningoencephalitis (PAM). Infection typically results from bathing in contaminated water and is usually fatal. It is, therefore, important to identify sites containing N. fowleri in the interests of preventive public health microbiology. Culture of environmental material is the conventional method for the isolation of N. fowleri but requires several days incubation and subsequent biochemical or molecular tests to confirm identification. Here, a nested one-step PCR test, in conjunction with a direct DNA extraction from water or sediment material, was developed for the rapid and reliable detection of N. fowleri from the environment. Here, the assay detected N, fowleri in 18/109 river water samples associated with a nuclear power plant in South West France and 0/10 from a similar site in the UK. Although culture of samples yielded numerous thermophilic free-living amoebae, none were N. fowleri or other thermophilic Naegleria spp. The availability of a rapid, reliable and sensitive one-step nested PCR method for the direct detection of N. fowleri from the environment may aid ecological studies and enable intervention to prevent PAM cases. Crown Copyright © 2011. Published by Elsevier Ltd. All rights reserved.

  5. Development and Evaluation of Loop-Mediated Isothermal Amplification Assay for Rapid Detection of Tylenchulus semipenetrans Using DNA Extracted from Soil

    Directory of Open Access Journals (Sweden)

    Zhi-Qiang Song

    2017-04-01

    Full Text Available Tylenchulus semipenetrans is an important and widespread plant-parasitic nematode of citrus worldwide and can cause citrus slow decline disease leading to significant reduction in tree growth and yield. Rapid and accurate detection of T. semipenetrans in soil is important for the disease forecasting and management. In this study, a loop-mediated isothermal amplification (LAMP assay was developed to detect T. semipenetrans using DNA extracted from soil. A set of five primers was designed from the internal transcribed spacer region (ITS1 of rDNA, and was highly specific to T. semipenetrans. The LAMP reaction was performed at 63°C for 60 min. The LAMP product was visualized directly in one reaction tube by adding SYBR Green I. The detection limit of the LAMP assay was 10−2 J2/0.5 g of soil, which was 10 times more sensitive than conventional PCR (10−1 J2/0.5 g of soil. Examination of 24 field soil samples revealed that the LAMP assay was applicable to a range of soils infested naturally with T. semipenetrans, and the total assay time was less than 2.5 h. These results indicated that the developed LAMP assay is a simple, rapid, sensitive, specific and accurate technique for detection of T. semipenetrans in field soil, and contributes to the effective management of citrus slow decline disease.

  6. A rapid and reliable method for discriminating rice products from different regions using MCX-based solid-phase extraction and DI-MS/MS-based metabolomics approach.

    Science.gov (United States)

    Lim, Dong Kyu; Mo, Changyeun; Long, Nguyen Phuoc; Lim, Jongguk; Kwon, Sung Won

    2017-09-01

    The expansion of the global rice marketplace ultimately raises concerns about authenticity control. Several analytical methods for differentiating the geographical origin of rice have been developed, yet a high-throughput method is still in demand. In this study, we developed a rapid approach using direct infusion-mass spectrometry (DI-MS) to distinguish rice products from different countries. Specifically, the elimination of the matrix effect by a polytetrafluoroethylene (PTFE) filter, a mixed-mode cation exchange (MCX) solid-phase extraction (SPE) with 20% methanol, and an MCX SPE with 100% methanol were measured. Afterward, partial least squares discriminant analysis and random forests were applied to seek the optimal discrimination method. The results revealed that the combination of MCX SPE with 100% methanol and DI-MS in positive ion mode (accuracy=1.000, R2=0.916, Q2=0.720, B/W-based p-value=0.015) or the combination of MCX SPE with 20% methanol and targeted DI-MS/MS in positive ion mode (accuracy=1.000, R2=0.931, Q2=0.849, B/W-based p-value=0.002) showed the excellent discriminatory ability. Furthermore, differentially expressed metabolites including sodiated lysophosphatidylcholine, lysophosphatidylcholine, lysophosphatidylethanolamines and lysophosphatidylglycerol classes were found. In conclusion, our study provides a rapid and reliable platform for geographical discrimination of white rice and will contribute to the authenticity control of rice products. Copyright © 2017 Elsevier B.V. All rights reserved.

  7. Capillary electrophoresis coupled with inductively coupled mass spectrometry as an alternative to cloud point extraction based methods for rapid quantification of silver ions and surface coated silver nanoparticles.

    Science.gov (United States)

    Qu, Haiou; Mudalige, Thilak K; Linder, Sean W

    2016-01-15

    Speciation and accurate quantification of ionic silver and metallic silver nanoparticles are critical to investigate silver toxicity and to determine the shelf-life of products that contain nano silver under various storage conditions. We developed a rapid method for quantification of silver ions and silver nanoparticles using capillary electrophoresis (CE) interfaced with inductively-coupled plasma mass spectrometry (ICPMS). The addition of 2-mercaptopropionylglycine (tiopronin) to the background electrolyte was used to facilitate the chromatographic separation of ionic silver and maintain the oxidation state of silver. The obtained limits of detection were 0.05 μg kg(-1) of silver nanoparticles and 0.03 μg kg(-1) of ionic silver. Nanoparticles of varied sizes (10-110 nm) with different surface coating, including citrate acid, lipoic acid, polyvinylpyrrolidone and bovine serum albumin (BSA) were successfully analyzed. Particularly good recoveries (>93%) were obtained for both ionic silver and silver nanoparticle in the presence of excess amount of BSA. The method was further tested with six commercially available dietary supplements which varied in concentration and matrix components. The summed values of silver ions and silver nanoparticles correlated well with the total silver concentration determined by ICPMS after acid digestion. This method can serve as an alternative to cloud point extraction technique when the extraction efficiency for protein coated nanoparticles is low. Copyright © 2015 Elsevier B.V. All rights reserved.

  8. Rapid Identification of Flavonoid Constituents Directly from PTP1B Inhibitive Extract of Raspberry (Rubus idaeus L.) Leaves by HPLC-ESI-QTOF-MS-MS.

    Science.gov (United States)

    Li, Zhuan-Hong; Guo, Han; Xu, Wen-Bin; Ge, Juan; Li, Xin; Alimu, Mireguli; He, Da-Jun

    2016-01-01

    Many potential health benefits of raspberry (Rubus idaeus L.) leaves were attributed to polyphenolic compounds, especially flavonoids. In this study, the methanol extract of R. idaeus leaves showed significant protein tyrosine phosphatase-1B (PTP1B) inhibitory activity with IC50 value of 3.41 ± 0.01 µg mL(-1) Meanwhile, a rapid and reliable method, employed high-performance liquid chromatography coupled with electrospray ionization quadrupole time-of-flight tandem mass spectrometry, was established for structure identification of flavonoids from PTP1B inhibitive extract of R. idaeus leaves using accurate mass measurement and characteristic fragmentation patterns. A total of 16 flavonoids, including 4 quercetin derivatives, 2 luteolin derivatives, 8 kaempferol derivatives and 2 isorhamnetin derivatives, were identified. Compounds 3: and 4: , Compounds 6: and 7: and Compounds 15: and 16: were isomers with different aglycones and different saccharides. Compounds 8: , 9: and 10: were isomers with the same aglycone and the same saccharide but different substituent positions. Compounds 11: and 12: were isomers with the same aglycone but different saccharides. Compounds 2: , 8: , 9: and 10: possessed the same substituent saccharide of glycuronic acid. Most of them were reported inR. idaeus for the first time. © The Author 2016. Published by Oxford University Press. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

  9. Rapid Identification of Flavonoid Constituents Directly from PTP1B Inhibitive Extract of Raspberry (Rubus idaeus L.) Leaves by HPLC–ESI–QTOF–MS-MS

    Science.gov (United States)

    Li, Zhuan-Hong; Guo, Han; Xu, Wen-Bin; Ge, Juan; Li, Xin; Alimu, Mireguli; He, Da-Jun

    2016-01-01

    Many potential health benefits of raspberry (Rubus idaeus L.) leaves were attributed to polyphenolic compounds, especially flavonoids. In this study, the methanol extract of R. idaeus leaves showed significant protein tyrosine phosphatase-1B (PTP1B) inhibitory activity with IC50 value of 3.41 ± 0.01 µg mL−1. Meanwhile, a rapid and reliable method, employed high-performance liquid chromatography coupled with electrospray ionization quadrupole time-of-flight tandem mass spectrometry, was established for structure identification of flavonoids from PTP1B inhibitive extract of R. idaeus leaves using accurate mass measurement and characteristic fragmentation patterns. A total of 16 flavonoids, including 4 quercetin derivatives, 2 luteolin derivatives, 8 kaempferol derivatives and 2 isorhamnetin derivatives, were identified. Compounds 3 and 4, Compounds 6 and 7 and Compounds 15 and 16 were isomers with different aglycones and different saccharides. Compounds 8, 9 and 10 were isomers with the same aglycone and the same saccharide but different substituent positions. Compounds 11 and 12 were isomers with the same aglycone but different saccharides. Compounds 2, 8, 9 and 10 possessed the same substituent saccharide of glycuronic acid. Most of them were reported in R. idaeus for the first time. PMID:26896347

  10. Rapid determination of six carcinogenic primary aromatic amines in mainstream cigarette smoke by two-dimensional online solid phase extraction combined with liquid chromatography tandem mass spectrometry.

    Science.gov (United States)

    Bie, Zhenying; Lu, Wei; Zhu, You; Chen, Yusong; Ren, Hubo; Ji, Lishun

    2017-01-27

    A fully automated, rapid, and reliable method for simultaneous determination of six carcinogenic primary aromatic amines (AAs), including o-toluidine (o-TOL), 2, 6-dimethylaniline (2, 6-DMA), o-anisidine (o-ASD), 1-naphthylamine (1-ANP), 2-naphthylamine (2-ANP), and 4-aminobiphenyl (4-ABP), in mainstream cigarette smoke was established. The proposed method was based on two-dimensional online solid phase extraction combined with liquid chromatography tandem mass spectrometry (SPE/LC-MS/MS). The particulate phase of the mainstream cigarette smoke was collected on a Cambridge filter pad and pretreated via ultrasonic extraction with 2% formic acid (FA), while the gas phase was trapped by 2% FA without pretreatment for determination. The two-dimensional online SPE comprised of two cartridges with different absorption characteristics was applied for sample pretreatment. Analysis was performed by liquid chromatography coupled with tandem mass spectrometry (LC-MS/MS) under multiple reaction monitoring mode. Each sample required about 0.5h for solid phase extraction and analysis. The limit of detections (LODs) for six AAs ranged from 0.04 to 0.58ng/cig and recoveries were within 84.5%-122.9%. The relative standard deviations of intra- and inter-day tests for 3R4F reference cigarette were less than 6% and 7%, respectively, while no more than 7% and 8% separately for a type of Virginia cigarette. The proposed method enabled minimum sample pretreatment, full automation, and high throughput with high selectivity, sensitivity, and accuracy. As a part of the validation procedure, fifteen brands of cigarettes were tested by the designed method. Copyright © 2016 Elsevier B.V. All rights reserved.

  11. Improving the extraction of crisis information in the context of flood, fire, and landslide rapid mapping using SAR and optical remote sensing data

    Science.gov (United States)

    Martinis, Sandro; Clandillon, Stephen; Twele, André; Huber, Claire; Plank, Simon; Maxant, Jérôme; Cao, Wenxi; Caspard, Mathilde; May, Stéphane

    2016-04-01

    Optical and radar satellite remote sensing have proven to provide essential crisis information in case of natural disasters, humanitarian relief activities and civil security issues in a growing number of cases through mechanisms such as the Copernicus Emergency Management Service (EMS) of the European Commission or the International Charter 'Space and Major Disasters'. The aforementioned programs and initiatives make use of satellite-based rapid mapping services aimed at delivering reliable and accurate crisis information after natural hazards. Although these services are increasingly operational, they need to be continuously updated and improved through research and development (R&D) activities. The principal objective of ASAPTERRA (Advancing SAR and Optical Methods for Rapid Mapping), the ESA-funded R&D project being described here, is to improve, automate and, hence, speed-up geo-information extraction procedures in the context of natural hazards response. This is performed through the development, implementation, testing and validation of novel image processing methods using optical and Synthetic Aperture Radar (SAR) data. The methods are mainly developed based on data of the German radar satellites TerraSAR-X and TanDEM-X, the French satellite missions Pléiades-1A/1B as well as the ESA missions Sentinel-1/2 with the aim to better characterize the potential and limitations of these sensors and their synergy. The resulting algorithms and techniques are evaluated in real case applications during rapid mapping activities. The project is focussed on three types of natural hazards: floods, landslides and fires. Within this presentation an overview of the main methodological developments in each topic is given and demonstrated in selected test areas. The following developments are presented in the context of flood mapping: a fully automated Sentinel-1 based processing chain for detecting open flood surfaces, a method for the improved detection of flooded vegetation

  12. Hydrolysis of dinitrobenzamide phosphate prodrugs: the role of alkaline phosphatase.

    Science.gov (United States)

    Lo, Wing-Yee; Balasubramanian, Amit; Helsby, Nuala A

    2009-01-01

    Phosphate prodrugs which undergo hydrolysis in vivo have been used to improve the solubility and pharmacokinetic properties of a number of drugs. Dinitrobenzamide mustards (DNBM) are examples of such drugs. We investigated the ability of purified alkaline phosphatase isoforms to dephosphorylate three DNBM phosphate prodrugs. In addition, the relative rate of dephosphorylation of these phosphate prodrugs in a number of tissues was determined. These phosphate prodrugs are indeed substrates for alkaline phosphatase, with time dependent formation of the hydrolysis product. Intestinal alkaline phosphatase (IAP) and placental alkaline phosphatase (PLAP) had the highest activity for these substrates and compound P2 was the most rapidly metabolised. Similarly, compound P2 had the shortest half life in mouse serum (t1/2 = 1.15 h) compared with P1 (t1/2 = 13.34 h) and P3 (t1/2 = 4.4 h). However, serum has very low dephosphorylase activity for these substrates compared with intestine and liver homogenates. In addition, there is little or no difference in the relative rate of dephosphorylation of each of the three compounds in mouse tissues in contrast to the pattern observed with purified alkaline phosphatase and mouse serum. Hence additional phosphatase enzymes may be involved in the metabolism of phosphate prodrugs in vivo.

  13. DNA DAMAGE QUANTITATION BY ALKALINE GEL ELECTROPHORESIS.

    Energy Technology Data Exchange (ETDEWEB)

    SUTHERLAND,B.M.; BENNETT,P.V.; SUTHERLAND, J.C.

    2004-03-24

    Physical and chemical agents in the environment, those used in clinical applications, or encountered during recreational exposures to sunlight, induce damages in DNA. Understanding the biological impact of these agents requires quantitation of the levels of such damages in laboratory test systems as well as in field or clinical samples. Alkaline gel electrophoresis provides a sensitive (down to {approx} a few lesions/5Mb), rapid method of direct quantitation of a wide variety of DNA damages in nanogram quantities of non-radioactive DNAs from laboratory, field, or clinical specimens, including higher plants and animals. This method stems from velocity sedimentation studies of DNA populations, and from the simple methods of agarose gel electrophoresis. Our laboratories have developed quantitative agarose gel methods, analytical descriptions of DNA migration during electrophoresis on agarose gels (1-6), and electronic imaging for accurate determinations of DNA mass (7-9). Although all these components improve sensitivity and throughput of large numbers of samples (7,8,10), a simple version using only standard molecular biology equipment allows routine analysis of DNA damages at moderate frequencies. We present here a description of the methods, as well as a brief description of the underlying principles, required for a simplified approach to quantitation of DNA damages by alkaline gel electrophoresis.

  14. Development and validation of the first high performance-lateral flow immunoassay (HP-LFIA) for the rapid screening of domoic acid from shellfish extracts.

    Science.gov (United States)

    Jawaid, Waqass; Meneely, Julie; Campbell, Katrina; Hooper, Mark; Melville, Karrie; Holmes, Stephen; Rice, Jennifer; Elliott, Christopher

    2013-11-15

    A lateral flow immunoassay (LFIA) has been developed and fully validated to detect the primary amnesic shellfish poisoning (ASP) toxin, domoic acid (DA). The performance characteristics of two versions of the test were investigated using spiked and naturally contaminated shellfish (mussels, scallops, oysters, clams, and cockles). The tests provide a qualitative result, to indicate the absence or presence of DA in extracts of shellfish tissues, at concentrations that are relevant to regulatory limits. The new rapid assay (LFIA version 2) was designed to overcome the performance limitations identified in the first version of the assay. The improved test uses an electronic reader to remove the subjective nature of the generated results, and the positive cut-off for screening of DA in shellfish was increased from 10 ppm (version 1) to 17.5 ppm (version 2). A simple extraction and test procedure was employed, which required minimal equipment and materials; results were available 15 min after sample preparation. Stability of the aqueous extracts at room temperature (22 °C) at four time points (up to 245 min after extraction) and across a range of DA concentrations was 100.3±1.3% and 98.8±2.4% for pre- and post-buffered extracts, respectively. The assay can be used both within laboratory settings and in remote locations. The accuracy of the new assay, to indicate negative results at or below 10 ppm DA, and positive results at or above 17.5 ppm, was 99.5% (n=216 tests). Validation data were obtained from a 2-day, randomised, blind study consisting of multiple LFIA lots (n=3), readers (n=3) and operators (n=3), carrying out multiple extractions of mussel tissue (n=3) at each concentration (0, 10, 17.5, and 20 ppm). No matrix effects were observed on the performance of the assay with different species (mussels, scallops, oysters, clams, and cockles). There was no impact on accuracy or interference from other phycotoxins, glutamic acid or glutamine with various strip

  15. [Rapid screening of fipronil and its metabolites in egg and egg products by solid phase extraction-liquid chromatography-quadrupole time-of-flight mass spectrometry].

    Science.gov (United States)

    Guo, Dehua; Shi, Yiyin; Li, You; Yi, Xionghai; Deng, Xiaojun; Xiao, Wenqing; Wang, Jian; Li, Xiao; Liu, Han; Shen, Weijian

    2017-12-08

    A method for rapid screening of fipronil and its metabolites in egg and egg products was developed by liquid chromatography coupled with quadrupole time-of-flight mass spectrometry (LC-QTOF MS). The samples were extracted by acid-acetonitrile, cleaned up by PRiME HLB SPE. The separation was performed on a Poroshell 120 EC C18 column (150 mm×3 mm, 2.7 μm) with gradient elution using water and acetonitrile as mobile phases. The target compounds were monitored under negative ionization mode with electrospray ionization (ESI) source and two databases of accurate mass and fragment ions were created. The matrix effects in four kinds of egg and egg products were considered and the quantification was carried out by internal standard method. The results demonstrated that the linear ranges were from 0.1 to 5 μg/L with good correlation coefficients (r2>0.99). The limits of detection (LODs, S/N>3) and limits of quantitation (LOQs, S/N>10) were 0.2 μg/kg and 1 μg/kg, respectively. The recoveries of fipronil and its metabolites in different matrixes spiked with 1, 2 and 5 μg/kg varied from 82.6%-98.1%, and the relative standard deviations (RSDs) were between 3.8%-9.9% (n=6). The method can effectively correct the ionization suppression. It is sensitive, accurate and suitable for the rapid screening of fipronil, fipronil sulfide, fipronil sulfone and fipronil desulfinyl in egg, egg noodle, cake and mayonnaise.

  16. Magnetic covalent triazine framework for rapid extraction of phthalate esters in plastic packaging materials followed by gas chromatography-flame ionization detection.

    Science.gov (United States)

    Yan, Zijun; He, Man; Chen, Beibei; Gui, Bo; Wang, Cheng; Hu, Bin

    2017-11-24

    Covalent triazine frameworks (CTFs), featuring with high surface area, good thermal, chemical and mechanical stability, are good adsorbents in sample pretreatment. Herein, magnetic CTFs/Ni composite was prepared by in situ reduction of nickel ions on CTFs matrix with a solvothermal method. The prepared CTFs/Ni composite exhibited good preparation reproducibility, high chemical stability, and high extraction efficiency for targeted phthalate esters (PAEs) due to π-π interaction and hydrophobic effect. The porous structure of CTFs/Ni composite benefited the fast transfer of target PAEs from aqueous solution to the adsorbents, and the integrated magnetism contributed to the rapid separation of adsorbents from sample and elution solution. Based on it, a novel method of magnetic solid phase extraction (MSPE) combined with gas chromatography-flame ionization detector (GC-FID) was developed for the analysis of PAEs including dimethyl phthalate (DMP), diethyl phthalate (DEP), di-n-butyl phthalate (DBP), benzyl butyl phthalate (BBP), di-2-ethylhexl phthalate (DEHP), and di-n-octyl phthalate (DNOP) in plastic packaging materials. Under the optimal experimental conditions, the limits of detection (LODs, S/N=3) for six PAEs were found to be in the range of 0.024-0.085mg/kg. The linear range was 0.32-16mg/kg for DMP, DEP, 0.08-80mg/kg for DBP, 0.16-32mg/kg for BBP, DEHP, and 0.32-32mg/kg for DNOP, respectively. The enrichment factors ranged from 59 to 88-fold (theoretical enrichment factor was 133-fold). The proposed method was successfully applied to the analysis of PAEs in various plastic packaging materials with recoveries in the range of 70.6-119% for the spiked samples. This method is characterized with short operation time, high sensitivity, low consumption of harmful organic solvents and can be extended to the analysis of other trace aromatic compounds. Copyright © 2017 Elsevier B.V. All rights reserved.

  17. Rapid quantitation of fluoxetine and norfluoxetine in serum by micro-disc solid-phase extraction with high-performance liquid chromatography-ultraviolet absorbance detection.

    Science.gov (United States)

    Li, Kong M; Thompson, Murray R; McGregor, Iain S

    2004-05-25

    A rapid, robust and sensitive method for the extraction and quantitative analysis of serum fluoxetine (FLX) and norfluoxetine (N-FLX) using a solid-phase extraction (SPE) column and high-performance liquid chromatography (HPLC) with ultraviolet (UV) detection was developed and validated. The sample clean-up step was performed by simple micro-disc mixed-mode (non-polar and strong cation exchange (SCX)) SPE cartridges. Separation of analytes and internal standard (IS) clomipramine (CLO) from endogenous matrix interference was achieved using a Waters Symmetry C(8) (150 mm x 2.1 mm i.d., 5 microm) reversed-phase narrow bore column. The relative retention times were 8.5, 9.6 and 10.5 min for FLX, N-FLX and CLO, respectively with a low isocratic flow rate of 0.3 ml/min. Chromatographic run time was completed in 15 min and peak area ratios of analytes to IS were used for regression analysis of the calibration curve. The latter was linear from 10 to 4000 nmol/l using 0.5 ml sample volume of serum. The average recovery was 95.5% for FLX and 96.9% for N-FLX. The lowest limit of quantitation (LLOQ) for serum FLX and N-FLX was 10 nmol/l (on-column amount of 200 fmol). The method described was used to analyse serum samples obtained from rats given chronic FLX treatment and to examine the relationship between steady state serum drug concentrations and neurochemical changes in several brain regions.

  18. Rapid determination of lipophilic vitamins in human serum by ultra-high performance liquid chromatography using a fluorinated column and high-throughput miniaturized liquid-liquid extraction.

    Science.gov (United States)

    Cervinkova, Barbora; Krcmova, Lenka Kujovska; Klabackova, Sava; Solichova, Dagmar; Solich, Petr

    2017-09-01

    A high-throughput miniaturized liquid-liquid extraction procedure followed by a simple ultra-high performance liquid chromatography method coupled with fluorescence detection for bioanalytical analysis of all tocopherol isomers and retinol in human serum has been developed and validated. In the extraction procedure, a synthetic internal standard tocol was used, which does not occur in the human body. The separation of structurally related vitamins was achieved using a new generation of pentafluorophenyl propyl core-shell stationary phase with elution using methanol and an aqueous solution of ammonium acetate. The fluorescence of retinol and tocopherol isomers was detected at λex  = 325, 295 nm and λem  = 480, 325 nm, respectively. The rapid baseline separation of all analytes was accomplished within 4.0 min. The sensitivity of method was demonstrated with lower limits of quantification: retinol 0.01 μM, α-tocopherol 0.38 μM, β-tocopherol 0.18 μM, γ-tocopherol 0.14 μM, and δ-tocopherol 0.01 μM. Possible application of this method in clinical practice was confirmed by the analysis of human serum samples from healthy volunteers. Finally, the simultaneous determination of retinol and all tocopherol isomers in human serum can enable the clarification of their role in metabolism and in diseases such as cancer. © 2017 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  19. A rapid and sensitive method for the simultaneous analysis of aliphatic and polar molecules containing free carboxyl groups in plant extracts by LC-MS/MS

    Directory of Open Access Journals (Sweden)

    Bonaventure Gustavo

    2009-11-01

    Full Text Available Abstract Background Aliphatic molecules containing free carboxyl groups are important intermediates in many metabolic and signalling reactions, however, they accumulate to low levels in tissues and are not efficiently ionized by electrospray ionization (ESI compared to more polar substances. Quantification of aliphatic molecules becomes therefore difficult when small amounts of tissue are available for analysis. Traditional methods for analysis of these molecules require purification or enrichment steps, which are onerous when multiple samples need to be analyzed. In contrast to aliphatic molecules, more polar substances containing free carboxyl groups such as some phytohormones are efficiently ionized by ESI and suitable for analysis by LC-MS/MS. Thus, the development of a method with which aliphatic and polar molecules -which their unmodified forms differ dramatically in their efficiencies of ionization by ESI- can be simultaneously detected with similar sensitivities would substantially simplify the analysis of complex biological matrices. Results A simple, rapid, specific and sensitive method for the simultaneous detection and quantification of free aliphatic molecules (e.g., free fatty acids (FFA and small polar molecules (e.g., jasmonic acid (JA, salicylic acid (SA containing free carboxyl groups by direct derivatization of leaf extracts with Picolinyl reagent followed by LC-MS/MS analysis is presented. The presence of the N atom in the esterified pyridine moiety allowed the efficient ionization of 25 compounds tested irrespective of their chemical structure. The method was validated by comparing the results obtained after analysis of Nicotiana attenuata leaf material with previously described analytical methods. Conclusion The method presented was used to detect 16 compounds in leaf extracts of N. attenuata plants. Importantly, the method can be adapted based on the specific analytes of interest with the only consideration that the

  20. A rapid and sensitive method for the simultaneous analysis of aliphatic and polar molecules containing free carboxyl groups in plant extracts by LC-MS/MS.

    Science.gov (United States)

    Kallenbach, Mario; Baldwin, Ian T; Bonaventure, Gustavo

    2009-11-25

    Aliphatic molecules containing free carboxyl groups are important intermediates in many metabolic and signalling reactions, however, they accumulate to low levels in tissues and are not efficiently ionized by electrospray ionization (ESI) compared to more polar substances. Quantification of aliphatic molecules becomes therefore difficult when small amounts of tissue are available for analysis. Traditional methods for analysis of these molecules require purification or enrichment steps, which are onerous when multiple samples need to be analyzed. In contrast to aliphatic molecules, more polar substances containing free carboxyl groups such as some phytohormones are efficiently ionized by ESI and suitable for analysis by LC-MS/MS. Thus, the development of a method with which aliphatic and polar molecules -which their unmodified forms differ dramatically in their efficiencies of ionization by ESI- can be simultaneously detected with similar sensitivities would substantially simplify the analysis of complex biological matrices. A simple, rapid, specific and sensitive method for the simultaneous detection and quantification of free aliphatic molecules (e.g., free fatty acids (FFA)) and small polar molecules (e.g., jasmonic acid (JA), salicylic acid (SA)) containing free carboxyl groups by direct derivatization of leaf extracts with Picolinyl reagent followed by LC-MS/MS analysis is presented. The presence of the N atom in the esterified pyridine moiety allowed the efficient ionization of 25 compounds tested irrespective of their chemical structure. The method was validated by comparing the results obtained after analysis of Nicotiana attenuata leaf material with previously described analytical methods. The method presented was used to detect 16 compounds in leaf extracts of N. attenuata plants. Importantly, the method can be adapted based on the specific analytes of interest with the only consideration that the molecules must contain at least one free carboxyl group.

  1. 2nd Generation Alkaline Electrolysis

    DEFF Research Database (Denmark)

    Yde, Lars; Kjartansdóttir, Cecilia Kristin; Allebrod, Frank

    This report provides the results of the 2nd Generation Alkaline Electrolysis project which was initiated in 2008. The project has been conducted from 2009-2012 by a consortium comprising Århus University Business and Social Science – Centre for Energy Technologies (CET (former HIRC)), Technical...

  2. Rapid identification and quantification of methamphetamine and amphetamine in hair by gas chromatography/mass spectrometry coupled with micropulverized extraction, aqueous acetylation and microextraction by packed sorbent.

    Science.gov (United States)

    Miyaguchi, Hajime; Iwata, Yuko T; Kanamori, Tatsuyuki; Tsujikawa, Kenji; Kuwayama, Kenji; Inoue, Hiroyuki

    2009-05-01

    We developed a rapid identification and quantification method for the toxicological analysis of methamphetamine and amphetamine in human hair by gas chromatography/mass spectrometry coupled with a novel combination of micropulverized extraction, aqueous acetylation and microextraction by packed sorbent (MEPS) named MiAMi-GC/MS. A washed hair sample (1-5 mg) was micropulverized for 5 min in a 2 mL plastic tube with 250 microL of water. An anion-exchange sorbent was added to adsorb anionic interferences. After removing the residue with a membrane-filter unit, sodium carbonate and acetic anhydride was admixed in turn. Acetylation was completed in approximately 20 min at room temperature. The acetylated analytes in the reaction liquid were concentrated to an octadecylsilica sorbent packed in the needle of a syringe by a CombiPAL autosampler. Elution was carried out with 50 microL of methanol, and the entire eluate injected into a gas chromatograph using a programmable temperature vaporizing (PTV) technique. The time required for sample preparation and GC/MS analysis was approximately 1 h from a washed hair sample, and an evaporation process was not required. Ranges for quantification were 0.20-50 (ng/mg) each for methamphetamine and amphetamine using 1 mg of hair. Accuracy and relative standard deviation (RSD) were evaluated intraday and interday at three concentrations, and the results were within the limit of a guidance issued by U.S. Food and Drug Administration. For identification, full-scan mass spectra of methamphetamine and amphetamine were obtained using 5 mg of fortified hair samples at 0.2 ng/mg. The extraction device of MEPS was durable for at least 300 extractions, whereas the liner of the gas chromatograph should be replaced after 20-30 times use. The carry over was estimated to be about 1-2%. This sample-preparation method coupled with GC/MS is fast and labor-saving in comparison with conventional methods.

  3. Rapid Determination of Major Compounds in the Ethanol Extract of Geopropolis from Malaysian Stingless Bees, Heterotrigona itama, by UHPLC-Q-TOF/MS and NMR

    Directory of Open Access Journals (Sweden)

    Lingling Zhao

    2017-11-01

    Full Text Available A reliable, rapid analytical method was established for the characterization of constituents of the ethanol extract of geopropolis (EEGP produced by Malaysian stingless bees—Heterotrigona itama—by combining ultra-high-performance liquid chromatography with quadruple time-of-flight mass spectrometry (UHPLC-Q-TOF/MS. Based on known standards, the online METLIN database, and published literature, 28 compounds were confirmed. Phenolic acids, flavones, triterpenes and phytosterol were identified or tentatively identified using characteristic diagnostic fragment ions. The results indicated that terpenoids were the main components of EEGP, accompanied by low levels of phenolic acids, flavonoids, and phytosterol. Two major components were further purified by preparative high-performance liquid chromatography (PHPLC and identified by nuclear magnetic resonance (NMR as 24(E-cycloart-24-ene-26-ol-3-one and 20-hydroxy-24-dammaren-3-one. These two triterpenes, confirmed in this geopropolis for the first time, are potential chemical markers for the identification of geopropolis from Malaysian stingless bees, H. itama.

  4. Rapid separation and identification of phenolics in crude red grape skin extracts by high performance liquid chromatography coupled to diode array detection and tandem mass spectrometry.

    Science.gov (United States)

    Ji, Mei; Li, Chen; Li, Qiang

    2015-10-02

    A rapid and efficient method was established for the simultaneous determination of structures and configurations for 45 phenolics isolated from crude red grape skin extracts without extensive sample preparation. Separation and compound assignments were achieved using high performance liquid chromatography coupled to diode array detection and tandem mass spectrometry (HPLC-DAD-MS(2)). A Poroshell 120 EC-C18 (100mm×3.0mm, 2.7μm) column was employed to separate the phenolics, which were eluted using a gradient of acetonitrile and water acidified with 0.2% formic acid. Phenolics were identified by comparison of their UV-vis spectra, mass spectra and MS(2) data with those in the literature. Using this procedure, five compounds were detected for the first time in Vitis amurensis. Good separation of most phenolics was achieved in 26min. The methods described here can be used for the characterization of phenolics in a variety of grapes and grape products. Copyright © 2015 Elsevier B.V. All rights reserved.

  5. Event Patterns Extracted from Transverse Momentum and Rapidity Spectra of Z Bosons and Quarkonium States Produced in pp and Pb-Pb Collisions at LHC

    Directory of Open Access Journals (Sweden)

    Ya-Hui Chen

    2016-01-01

    Full Text Available Transverse momentum (pT and rapidity (y spectra of Z bosons and quarkonium states (some charmonium cc¯ mesons such as J/ψ and ψ(2S and some bottomonium bb¯ mesons such as Υ(1S, Υ(2S, and Υ(3S produced in proton-proton (pp and lead-lead (Pb-Pb collisions at the large hadron collider (LHC are uniformly described by a hybrid model of two-component Erlang distribution for pT spectrum and two-component Gaussian distribution for y spectrum. The former distribution results from a multisource thermal model, and the latter one results from the revised Landau hydrodynamic model. The modelling results are in agreement with the experimental data measured in pp collisions at center-of-mass energies s=2.76 and 7 TeV and in Pb-Pb collisions at center-of-mass energy per nucleon pair sNN=2.76 TeV. Based on the parameter values extracted from pT and y spectra, the event patterns (particle scatter plots in two-dimensional pT-y space and in three-dimensional velocity space are obtained.

  6. On-line solid-phase extraction-short-column liquid chromatography combined with various tandem mass spectrometric scanning strategies for the rapid study of transformation of pesticides in surface water.

    NARCIS (Netherlands)

    Hogenboom, A.C.; Niessen, W.M.A.; Brinkman, U.A.T.

    1999-01-01

    The applicability of solid-phase extraction-short-column liquid chromatography using two short columns (i.e., 10 and 20 mm long) coupled on-line with tandem mass spectrometric detection is demonstrated for the rapid degradation study of pesticides and their transformation products in water at the

  7. Development and validation of a rapid high performance liquid chromatography - photodiode array detection method for estimation of a bioactive compound wedelolactone in extracts of Eclipta alba

    Directory of Open Access Journals (Sweden)

    Satyanshu Kumar

    2013-03-01

    Full Text Available Following optimization of extraction, separation and analytical conditions, a rapid, sensitive and simple reverse-phase high performance liquid chromatography-photo diode array (HPLC-PDA method has been developed for the identification and quantification of wedelolactone in different extracts of Eclipta alba. The separation of wedelolactone was achieved on a C18 column using the solvent system consisting of a mixture of methanol: water: acetic acid (95: 5: 0.04 as a mobile phase in isocratic elution mode followed by photo diode array detection at 352 nm. The developed method was validated as per the guidelines of the International Conference on Harmonization (ICH. Calibration curve presented good linear regression (r²>0.998 within the test range and the maximum relative standard deviation (RSD, % values for intra-day assay were found to be 0.15, 1.30 and 1.1 for low (5 µg/mL, medium (20 µg/mL and high (80 µg/mL concentrations of wedelolactone. For inter-day assay the maximum RSD (% values were found to be 2.83, 1.51 and 2.06 for low, medium and high concentrations, respectively. Limit of detection (LOD and limit of quantification (LOQ were calculated to be 2 and 5 µg/mL respectively. Analytical recovery of wedelolactone was greater than 95%. Wedelolactone in different extracts of Eclipta alba was identified and quantified using the developed HPLC method. The validated HPLC method allowed precise quantitative analysis of wedelolactone in Eclipta. alba extracts.Desenvolveu-se método rápido, sensível e simples de Cromatografia Líquida de Alta Eficiência em fase reversa, utilizando-se arranjo de fotodiodo (HPLC-PDA, visando à separação, extração e às condições analíticas para a identificação e quantificação de wedelolactona em diferentes extratos de Eclipta alba. A separação de wedelolactona foi efetuada por meio de uma coluna C18, utilizando mistura de metanol:água:ácido acético (95:5:0.04 como fase móvel, em sistema de

  8. Application of an efficient strategy based on liquid-liquid extraction, high-speed counter-current chromatography, and preparative HPLC for the rapid enrichment, separation, and purification of four anthraquinones from Rheum tanguticum.

    Science.gov (United States)

    Chen, Tao; Liu, Yongling; Zou, Denglang; Chen, Chen; You, Jinmao; Zhou, Guoying; Sun, Jing; Li, Yulin

    2014-01-01

    This study presents an efficient strategy based on liquid-liquid extraction, high-speed counter-current chromatography, and preparative HPLC for the rapid enrichment, separation, and purification of four anthraquinones from Rheum tanguticum. A new solvent system composed of petroleum ether/ethyl acetate/water (4:2:1, v/v/v) was developed for the liquid-liquid extraction of the crude extract from R. tanguticum. As a result, emodin, aloe-emodin, physcion, and chrysophanol were greatly enriched in the organic layer. In addition, an efficient method was successfully established to separate and purify the above anthraquinones by high-speed counter-current chromatography and preparative HPLC. This study supplies a new alternative method for the rapid enrichment, separation, and purification of emodin, aloe-emodin, physcione, and chrysophanol. © 2013 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  9. [Application of rapid PCR to authenticate medicinal snakes].

    Science.gov (United States)

    Chen, Kang; Jiang, Chao; Yuan, Yuan; Huang, Lu-Qi; Li, Man

    2014-10-01

    To obtained an accurate, rapid and efficient method for authenticate medicinal snakes listed in Chinese Pharmacopoeia (Zaocysd humnades, Bungarus multicinctus, Agkistrodon acutus), a rapid PCR method for authenticate snakes and its adulterants was established based on the classic molecular authentication methods. DNA was extracted by alkaline lysis and the specific primers were amplified by two-steps PCR amplification method. The denatured and annealing temperature and cycle numbers were optimized. When 100 x SYBR Green I was added in the PCR product, strong green fluorescence was visualized under 365 nm UV whereas adulterants without. The whole process can complete in 30-45 minutes. The established method provides the technical support for authentication of the snakes on field.

  10. Development and Validation of a Novel Lateral Flow Immunoassay (LFIA) for the Rapid Screening of Paralytic Shellfish Toxins (PSTs) from Shellfish Extracts.

    Science.gov (United States)

    Jawaid, Waqass; Campbell, Katrina; Melville, Karrie; Holmes, Stephen J; Rice, Jennifer; Elliott, Christopher T

    2015-05-19

    A single-step lateral flow immunoassay (LFIA) was developed and validated for the rapid screening of paralytic shellfish toxins (PSTs) from a variety of shellfish species, at concentrations relevant to regulatory limits of 800 μg STX-diHCl equivalents/kg shellfish meat. A simple aqueous extraction protocol was performed within several minutes from sample homogenate. The qualitative result was generated after a 5 min run time using a portable reader which removed subjectivity from data interpretation. The test was designed to generate noncompliant results with samples containing approximately 800 μg of STX-diHCl/kg. The cross-reactivities in relation to STX, expressed as mean ± SD, were as follows: NEO: 128.9% ± 29%; GTX1&4: 5.7% ± 1.5%; GTX2&3: 23.4% ± 10.4%; dcSTX: 55.6% ± 10.9%; dcNEO: 28.0% ± 8.9%; dcGTX2&3: 8.3% ± 2.7%; C1&C2: 3.1% ± 1.2%; GTX5: 23.3% ± 14.4% (n = 5 LFIA lots). There were no indications of matrix effects from the different samples evaluated (mussels, scallops, oysters, clams, cockles) nor interference from other shellfish toxins (domoic acid, okadaic acid group). Naturally contaminated sample evaluations showed no false negative results were generated from a variety of different samples and profiles (n = 23), in comparison to reference methods (MBA method 959.08, LC-FD method 2005.06). External laboratory evaluations of naturally contaminated samples (n = 39) indicated good correlation with reference methods (MBA, LC-FD). This is the first LFIA which has been shown, through rigorous validation, to have the ability to detect most major PSTs in a reliable manner and will be a huge benefit to both industry and regulators, who need to perform rapid and reliable testing to ensure shellfish are safe to eat.

  11. Development of alkaline fuel cells.

    Energy Technology Data Exchange (ETDEWEB)

    Hibbs, Michael R.; Jenkins, Janelle E.; Alam, Todd Michael; Janarthanan, Rajeswari; Horan, James L.; Caire, Benjamin R.; Ziegler, Zachary C.; Herring, Andrew M.; Yang, Yuan; Zuo, Xiaobing; Robson, Michael H.; Artyushkova, Kateryna; Patterson, Wendy; Atanassov, Plamen Borissov

    2013-09-01

    This project focuses on the development and demonstration of anion exchange membrane (AEM) fuel cells for portable power applications. Novel polymeric anion exchange membranes and ionomers with high chemical stabilities were prepared characterized by researchers at Sandia National Laboratories. Durable, non-precious metal catalysts were prepared by Dr. Plamen Atanassovs research group at the University of New Mexico by utilizing an aerosol-based process to prepare templated nano-structures. Dr. Andy Herrings group at the Colorado School of Mines combined all of these materials to fabricate and test membrane electrode assemblies for single cell testing in a methanol-fueled alkaline system. The highest power density achieved in this study was 54 mW/cm2 which was 90% of the project target and the highest reported power density for a direct methanol alkaline fuel cell.

  12. Urinary alkalinization and smoking cessation.

    Science.gov (United States)

    Fix, A J; Daughton, D; Kass, I; Smith, J L; Wickiser, A; Golden, C J; Wass, A R

    1983-07-01

    Previous studies have shown that large doses of a urinary alkalinizing agent reduced cigarette consumption spontaneously among smokers. After establishing a safe daily dose of an alkalinizing agent, sodium bicarbonate, its effect upon smoking cessation rates among 72 enrollees in a smoking cessation program was studied. In the first study, we determined that sodium bicarbonate (3900 mg per day) significantly increased urinary pH (from 6.0 to 6.7) and lowered titratable acidity. Ascorbic acid (1500 mg per day) had no effect of pH or acidity. In a second study, a group given sodium bicarbonate surpassed a placebo control group (who were given 1500 mg per day ascorbic acid) in total daily cigarette reduction after 5 weeks and in week-to-week smoking reduction. The groups did not, however, differ in the number who achieved total abstinence.

  13. Electromembrane extraction

    DEFF Research Database (Denmark)

    Huang, Chuixiu; Chen, Zhiliang; Gjelstad, Astrid

    2017-01-01

    Electromembrane extraction (EME) was inspired by solid-phase microextraction and developed from hollow fiber liquid-phase microextraction in 2006 by applying an electric field over the supported liquid membrane (SLM). EME provides rapid extraction, efficient sample clean-up and selectivity based...

  14. Non-covalent (iso)guanosine-based ionophores for alkali(ne earth) cations

    NARCIS (Netherlands)

    van Leeuwen, F.W.B.; Davis, Jeffery T.; Davis, J.T.; Verboom, Willem; Reinhoudt, David

    2006-01-01

    Different (iso)guanosine-based self-assembled ionophores give distinctly different results in extraction experiments with alkali(ne earth) cations. A lipophilic guanosine derivative gives good extraction results for K+, Rb+, Ca2+, Sr2+, and Ba2+ and in competition experiments it clearly favors the

  15. Rapid analysis of pyrethroid insecticides in aquaculture seawater samples via membrane-assisted solvent extraction coupled with gas chromatography-electron capture detection

    OpenAIRE

    Shi, X.Z.; Song, S.Q.; Sun, A.L.; Liu, J.H.; Li, D.X.; Chen, J.

    2012-01-01

    A simple, efficient, and environmentally friendly membrane-assisted solvent extraction (MASE) method for the extraction and preconcentration of six pyrethroid insecticides from aquaculture seawater samples followed by gas chromatography-electron capture detection (GC-ECD) was successfully proposed. The operating conditions for MASE, such as the extraction solvent, solvent volume, NaCl concentration, stirring rate, extraction time, and temperature, were optimized. Compared to conventional Flor...

  16. Laboratory Production of Lemon Liqueur (Limoncello) by Conventional Maceration and a Two-Syringe System to Illustrate Rapid Solid-Liquid Dynamic Extraction

    Science.gov (United States)

    Naviglio, Daniele; Montesano, Domenico; Gallo, Monica

    2015-01-01

    Two experimental techniques of solid-liquid extraction are compared relating to the lab-scale production of lemon liqueur, most commonly named "limoncello"; the first is the official method of maceration for the solid-liquid extraction of analytes and is widely used to extract active ingredients from a great variety of natural products;…

  17. Alkaline phosphatase activity in gingival crevicular fluid during canine retraction.

    Science.gov (United States)

    Batra, P; Kharbanda, Op; Duggal, R; Singh, N; Parkash, H

    2006-02-01

    The aim of the study was to investigate alkaline phosphatase activity in the gingival crevicular fluid (GCF) during orthodontic tooth movement in humans. Postgraduate orthodontic clinic. Ten female patients requiring all first premolar extractions were selected and treated with standard edgewise mechanotherapy. Canine retraction was done using 100 g sentalloy springs. Maxillary canine on one side acted as experimental site while the contralateral canine acted as control. Gingival crevicular fluid was collected from mesial and distal of canines before initiation of canine retraction (baseline), immediately after initiation of retraction, and on 1st, 7th, 14th and 21st day and the alkaline phosphatase activity was estimated. The results show significant (p alkaline phosphatase activity on the 7th, 14th and 21st day on both mesial and distal aspects of the compared experimental and control sides. The peak in enzyme activity occurred on the 14th day of initiation of retraction followed by a significant fall in activity especially on the mesial aspect. The study showed that alkaline phosphatase activity could be successfully estimated in the GCF using calorimetric estimation assay kits. The enzyme activity showed variation according to the amount of tooth movement.

  18. Simplified and rapid method for extraction of ergosterol from natural samples and detection with quantitative and semi-quantitative methods using thin-layer chromatography

    OpenAIRE

    Larsen, Cand.scient Thomas; Ravn, Senior scientist Helle; Axelsen, Senior Scientist Jørgen

    2004-01-01

    A new and simplified method for extraction of ergosterol (ergoste-5,7,22-trien-3-beta-ol) from fungi in soil and litter was developed using pre-soaking extraction and paraffin oil for recovery. Recoveries of ergosterol were in the range of 94 - 100% depending on the solvent to oil ratio. Extraction efficiencies equal to heat-assisted extraction treatments were obtained with pre-soaked extraction. Ergosterol was detected with thin-layer chromatography (TLC) using fluorodensitometry with a quan...

  19. Rapid analysis of fungicides in tea infusions using ionic liquid immobilized fabric phase sorptive extraction with the assistance of surfactant fungicides analysis using IL-FPSE assisted with surfactant.

    Science.gov (United States)

    Yang, Miyi; Gu, Yihan; Wu, Xiaoling; Xi, Xuefei; Yang, Xiaoling; Zhou, Wenfeng; Zeng, Haozhe; Zhang, Sanbing; Lu, Runhua; Gao, Haixiang; Li, Jing

    2018-01-15

    A green, simple, inexpensive, and sensitive ionic liquid immobilized fabric phase sorptive extraction method coupled with high performance liquid chromatography was developed for rapid screening and simultaneous determination of four fungicides (azoxystrobin, chlorothalonil, cyprodinil and trifloxystrobin) residues in tea infusions. This IL modified extraction fiber is capable of extracting target analytes directly from complicated tea water matrices with the addition of surfactant. A series of extraction conditions were investigated by one-factor-at-a-time approach and orthogonal test. After a series experiments, the optimum conditions were found to be 10% [HIMIM]NTf2 as coating solution, 2min vortex time, 500μL acetonitrile as dispersive solvent and 2min desorption time. Under the above conditions, the proposed technique was applied to detect fungicides from real tea water samples with satisfactory results. Copyright © 2017. Published by Elsevier Ltd.

  20. Rapid simultaneous determination of eperisone, tolperisone, and tizanidine in human serum by using a MonoSpin® C18 extraction column and liquid chromatography/tandem mass spectrometry.

    Science.gov (United States)

    Miura, Naoya; Saito, Takeshi; Taira, Takayuki; Yamagiwa, Takeshi; Morita, Sein; Inokuchi, Sadaki

    2014-01-01

    A method was developed for rapid toxicological analysis of eperisone, tolperisone, and tizanidine in human serum using a MonoSpin® C18 extraction column and LC/MS/MS. The method was validated for LOD, linearity, precision, and extraction recovery. This method was rapid with an LOD of 0.5 ng/mL, linearity range 1-500.0 ng/mL (r2 = 0.999), and RSD value below 14.6%. Extraction recovery from the sample was greater than 98.6, 98.8, and 88.5% for eperisone, tolperisone, and tizanidine, respectively. Results showed that combination of the MonoSpin C18 extraction column and LC/MS/MS is a simple and rapid method for the analysis of these three analytes, and a method is described for simultaneous quantitative determination of the analytes in human serum by LC/MSIMS. This method was used to determine the serum levels of eperisone in a patient with eperisone poisoning, and could be successfully applied for screening analyses in clinical cases other than poisoning.

  1. Development of a rapid method for the sequential extraction and subsequent quantification of fatty acids and sugars from avocado mesocarp tissue.

    Science.gov (United States)

    Meyer, Marjolaine D; Terry, Leon A

    2008-08-27

    Methods devised for oil extraction from avocado (Persea americana Mill.) mesocarp (e.g., Soxhlet) are usually lengthy and require operation at high temperature. Moreover, methods for extracting sugars from avocado tissue (e.g., 80% ethanol, v/v) do not allow for lipids to be easily measured from the same sample. This study describes a new simple method that enabled sequential extraction and subsequent quantification of both fatty acids and sugars from the same avocado mesocarp tissue sample. Freeze-dried mesocarp samples of avocado cv. Hass fruit of different ripening stages were extracted by homogenization with hexane and the oil extracts quantified for fatty acid composition by GC. The resulting filter residues were readily usable for sugar extraction with methanol (62.5%, v/v). For comparison, oil was also extracted using the standard Soxhlet technique and the resulting thimble residue extracted for sugars as before. An additional experiment was carried out whereby filter residues were also extracted using ethanol. Average oil yield using the Soxhlet technique was significantly (P oil extracts following both methods were very similar. Oil recovery improved with increasing ripeness of the fruit with minor differences observed in the fatty acid composition during postharvest ripening. After lipid removal, methanolic extraction was superior in recovering sucrose and perseitol as compared to 80% ethanol (v/v), whereas mannoheptulose recovery was not affected by solvent used. The method presented has the benefits of shorter extraction time, lower extraction temperature, and reduced amount of solvent and can be used for sequential extraction of fatty acids and sugars from the same sample.

  2. Rapid analysis of the essential oils from dried Illicium verum Hook. f. and Zingiber officinale Rosc. by improved solvent-free microwave extraction with three types of microwave-absorption medium.

    Science.gov (United States)

    Wang, Ziming; Wang, Lu; Li, Tiechun; Zhou, Xin; Ding, Lan; Yu, Yong; Yu, Aimin; Zhang, Hanqi

    2006-11-01

    A new method of extracting essential oils from dried plant materials has been studied. By adding a microwave-absorption medium (MAM) to a reactor, solvent-free microwave extraction (SFME) was improved and can be used to extract essential oils from dried plant material without pretreatment. With a microwave irradiation power of 85 W it took only approximately 30 min to extract the essential oils completely. The whole extraction process is simple, rapid, and economical. Three types of MAM, iron carbonyl powder (ICP), graphite powder (GP), and activated carbon powder (ACP), and two types of dried plant material, Illicium verum Hook. f. and Zingiber officinale Rosc., were studied. The results were compared with those obtained by use of conventional SFME, microwave-assisted hydrodistillation (MAHD), and conventional hydrodistillation (HD), and the conclusion drawn was that improved SFME was a feasible means of extracting essential oils from dried plant materials, because there were few differences between the composition of the essential oils extracted by improved SFME and by the other methods.

  3. Extraction of intracellular protein from Glaciozyma antarctica for proteomics analysis

    Science.gov (United States)

    Faizura, S. Nor; Farahayu, K.; Faizal, A. B. Mohd; Asmahani, A. A. S.; Amir, R.; Nazalan, N.; Diba, A. B. Farah; Muhammad, M. Nor; Munir, A. M. Abdul

    2013-11-01

    Two preparation methods of crude extracts of psychrophilic yeast Glaciozyma antarctica were compared in order to obtain a good recovery of intracellular proteins. Extraction with mechanical procedures using sonication was found to be more effective for obtaining good yield compare to alkaline treatment method. The procedure is simple, rapid, and produce better yield. A total of 52 proteins were identified by combining both extraction methods. Most of the proteins identified in this study involves in the metabolic process including glycolysis pathway, pentose phosphate pathway, pyruyate decarboxylation and also urea cyle. Several chaperons were identified including probable cpr1-cyclophilin (peptidylprolyl isomerase), macrolide-binding protein fkbp12 and heat shock proteins which were postulate to accelerate proper protein folding. Characteristic of the fundamental cellular processes inferred from the expressed-proteome highlight the evolutionary and functional complexity existing in this domain of life.

  4. Alkaline Water and Longevity: A Murine Study

    OpenAIRE

    Massimiliano Magro; Livio Corain; Silvia Ferro; Davide Baratella; Emanuela Bonaiuto; Milo Terzo; Vittorino Corraducci; Luigi Salmaso; Fabio Vianello

    2016-01-01

    The biological effect of alkaline water consumption is object of controversy. The present paper presents a 3-year survival study on a population of 150 mice, and the data were analyzed with accelerated failure time (AFT) model. Starting from the second year of life, nonparametric survival plots suggest that mice watered with alkaline water showed a better survival than control mice. Interestingly, statistical analysis revealed that alkaline water provides higher longevity in terms of “deceler...

  5. Alkaline and alkaline earth metal phosphate halides and phosphors

    Science.gov (United States)

    Lyons, Robert Joseph; Setlur, Anant Achyut; Cleaver, Robert John

    2012-11-13

    Compounds, phosphor materials and apparatus related to nacaphite family of materials are presented. Potassium and rubidium based nacaphite family compounds and phosphors designed by doping divalent rare earth elements in the sites of alkaline earth metals in the nacaphite material families are descried. An apparatus comprising the phosphors based on the nacaphite family materials are presented herein. The compounds presented is of formula A.sub.2B.sub.1-yR.sub.yPO.sub.4X where the elements A, B, R, X and suffix y are defined such that A is potassium, rubidium, or a combination of potassium and rubidium and B is calcium, strontium, barium, or a combination of any of calcium, strontium and barium. X is fluorine, chlorine, or a combination of fluorine and chlorine, R is europium, samarium, ytterbium, or a combination of any of europium, samarium, and ytterbium, and y ranges from 0 to about 0.1.

  6. SOLVENT EXTRACTION OF RUTHENIUM

    Science.gov (United States)

    Hyman, H.H.; Leader, G.R.

    1959-07-14

    The separation of rathenium from aqueous solutions by solvent extraction is described. According to the invention, a nitrite selected from the group consisting of alkali nitrite and alkaline earth nitrite in an equimolecular quantity with regard to the quantity of rathenium present is added to an aqueous solution containing ruthenium tetrantrate to form a ruthenium complex. Adding an organic solvent such as ethyl ether to the resulting mixture selectively extracts the rathenium complex.

  7. Rapid Identification and Quantification of Natural Antioxidants in the Seeds of Rhubarb from Different Habitats in China Using Accelerated Solvent Extraction and HPLC-DAD-ESI-MSn-DPPH Assay.

    Science.gov (United States)

    Tan, Liang; Geng, Dan-dan; Hu, Feng-zu; Dong, Qi

    2016-01-01

    In this study, the 10 accessions of rhubarb seeds from different habitats in China were investigated. Lipids were removed using petroleum ether, and the effective components were then separated using accelerated solvent extraction with 80% aqueous methanol. An off-line 2,2-diphenyl-1-picrylhydrazyl (DPPH) free-radical scavenging method was used as the marker to evaluate the total antioxidant capability of extracts. On-line high-performance liquid chromatography-diode-array detectors-electrospray ionization-tandem mass spectrometry (HPLC-DAD-ESI-MS(n)) and HPLC-DAD-DPPH assays were developed for rapid identification and quantification of individual free-radical scavengers in extracts of rhubarb seeds. Ten free-radical scavengers from methanolic extracts of the rhubarb seeds were screened, five of which were identified and quantitatively analyzed: epicatechin, myricetin, hyperoside, quercitrin and quercetin. All were identified in rhubarb seeds for the first time and can be regarded as the major potent antioxidants in rhubarb seeds due to representing most of the total free-radical scavenging activity. Preliminary analysis of structures was performed for another five antioxidants. Based on our validation results, the developed method can be used for rapid separation, convenient identification and quantification of the multiple antioxidative constituents in rhubarb seeds, featuring good quantification parameters, accuracy and precision. The results are important to clarify the material basis and therapeutic mechanism of rhubarb seeds. © The Author 2015. Published by Oxford University Press. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

  8. Comparison of conventional averaged and rapid averaged, autoregressive-based extracted auditory evoked potentials for monitoring the hypnotic level during propofol induction

    DEFF Research Database (Denmark)

    Litvan, Héctor; Jensen, Erik W; Galan, Josefina

    2002-01-01

    The extraction of the middle latency auditory evoked potentials (MLAEP) is usually done by moving time averaging (MTA) over many sweeps (often 250-1,000), which could produce a delay of more than 1 min. This problem was addressed by applying an autoregressive model with exogenous input (ARX......) that enables extraction of the auditory evoked potentials (AEP) within 15 sweeps. The objective of this study was to show that an AEP could be extracted faster by ARX than by MTA and with the same reliability....

  9. Pollution control and resource reuse for alkaline hydrometallurgy of amphoteric metal hazardous wastes

    CERN Document Server

    Youcai, Zhao

    2017-01-01

    This book provides a comprehensive description of alkaline hydrometallurgy of amphoteric metal hazardous wastes. Topics focus on leaching of zinc and lead hazardous wastes, purification of leach solution of zinc and lead, electrowinning of zinc and lead from purified alkaline solutions, chemical reactions taking place in the production flowsheets, thermodynamic and spent electrolyte regeneration, alkaline hydrometallurgy of low-grade smithsonite ores, recovery of molybdenum and tungsten using ion flotation and solvent extraction processes and their application in chemical synthesis of Nb and Ta inorganic compounds, and industrial scale production of 1500-2000 t/a zinc powder using alkaline leaching–electrowinning processes. Processes described are cost-effective, generate lesser secondary pollutants, and have been applied widely in China. Readers that will find the book appealing include solid waste engineers, environmental managers, technicians, recycling coordinators, government officials, undergraduates ...

  10. Feature extraction from high resolution satellite imagery as an input to the development and rapid update of a METRANS geographic information system (GIS).

    Science.gov (United States)

    2011-06-01

    This report describes an accuracy assessment of extracted features derived from three : subsets of Quickbird pan-sharpened high resolution satellite image for the area of the : Port of Los Angeles, CA. Visual Learning Systems Feature Analyst and D...

  11. Rapid analysis of pyrethroid insecticides in aquaculture seawater samples via membrane-assisted solvent extraction coupled with gas chromatography-electron capture detection.

    Science.gov (United States)

    Shi, X Z; Song, S Q; Sun, A L; Liu, J H; Li, D X; Chen, J

    2012-01-21

    A simple, efficient, and environmentally friendly membrane-assisted solvent extraction (MASE) method for the extraction and preconcentration of six pyrethroid insecticides from aquaculture seawater samples followed by gas chromatography-electron capture detection (GC-ECD) was successfully proposed. The operating conditions for MASE, such as the extraction solvent, solvent volume, NaCl concentration, stirring rate, extraction time, and temperature, were optimized. Compared to conventional Florisil-solid phase extraction (SPE), higher extraction recoveries (85.9% to 105.9%) of three spiked levels of the six pyrethroid pesticides in aquaculture seawater were obtained using MASE, and the RSD values were lower than 7.9%. The limits of detection (LOD, signal-to-noise ratio (S/N)=3) and quantification (LOQ, S/N = 10) were in the range of 0.037-0.166 and 0.12-0.55 μg L(-1), respectively. The results demonstrate the excellent applicability of the MASE method in analyzing the six pyrethroid pesticides in aqueous samples. The proposed method exhibited a high potential for routine monitoring analysis of pyrethroid insecticides in seawater samples.

  12. Pediatric reference intervals for alkaline phosphatase.

    Science.gov (United States)

    Zierk, Jakob; Arzideh, Farhad; Haeckel, Rainer; Cario, Holger; Frühwald, Michael C; Groß, Hans-Jürgen; Gscheidmeier, Thomas; Hoffmann, Reinhard; Krebs, Alexander; Lichtinghagen, Ralf; Neumann, Michael; Ruf, Hans-Georg; Steigerwald, Udo; Streichert, Thomas; Rascher, Wolfgang; Metzler, Markus; Rauh, Manfred

    2017-01-01

    Interpretation of alkaline phosphatase activity in children is challenging due to extensive changes with growth and puberty leading to distinct sex- and age-specific dynamics. Continuous percentile charts from birth to adulthood allow accurate consideration of these dynamics and seem reasonable for an analyte as closely linked to growth as alkaline phosphatase. However, the ethical and practical challenges unique to pediatric reference intervals have restricted the creation of such percentile charts, resulting in limitations when clinical decisions are based on alkaline phosphatase activity. We applied an indirect method to generate percentile charts for alkaline phosphatase activity using clinical laboratory data collected during the clinical care of patients. A total of 361,405 samples from 124,440 patients from six German tertiary care centers and one German laboratory service provider measured between January 2004 and June 2015 were analyzed. Measurement of alkaline phosphatase activity was performed on Roche Cobas analyzers using the IFCC's photometric method. We created percentile charts for alkaline phosphatase activity in girls and boys from birth to 18 years which can be used as reference intervals. Additionally, data tables of age- and sex-specific percentile values allow the incorporation of these results into laboratory information systems. The percentile charts provided enable the appropriate differential diagnosis of changes in alkaline phosphatase activity due to disease and changes due to physiological development. After local validation, integration of the provided percentile charts into result reporting facilitates precise assessment of alkaline phosphatase dynamics in pediatrics.

  13. Handbook of Indigenous Foods Involving Alkaline Fermentation

    NARCIS (Netherlands)

    Sarkar, P.K.; Nout, M.J.R.

    2014-01-01

    This book details the basic approaches of alkaline fermentation, provides a brief history, and offers an overview of the subject. The book discusses the diversity of indigenous fermented foods involving an alkaline reaction, as well as the taxonomy, ecology, physiology, and genetics of predominant

  14. ENHANCED OIL RECOVERY USING LOCAL ALKALINE

    African Journals Online (AJOL)

    user

    secondary recovery processes involves the injection of fluids which ... production wells [18]. Alkaline flooding is not recommended for carbonate reservoirs because of the profusion of calcium and the mixture between the alkaline chemical and the calcium ions can ... role in oil recovery from mixed – wet naturally fractured.

  15. Alkaline Phosphatases From Camel Small Intestine | Fahmy ...

    African Journals Online (AJOL)

    ... activity of camel intestinal IAP2 and IAP5 was studied. The camel intestinal alkaline phosphatase isoenzymes IAP2 and IAP5 were inhibited by EDTA and phenylalanine. Keywords: Camel; Small intestine; Alkaline phosphatase ; Purification; Characterization Egyptian Journal of Biochemistry and Molecular Biology Vol.

  16. Alkaline pH sensor molecules.

    Science.gov (United States)

    Murayama, Takashi; Maruyama, Ichiro N

    2015-11-01

    Animals can survive only within a narrow pH range. This requires continual monitoring of environmental and body-fluid pH. Although a variety of acidic pH sensor molecules have been reported, alkaline pH sensor function is not well understood. This Review describes neuronal alkaline pH sensors, grouped according to whether they monitor extracellular or intracellular alkaline pH. Extracellular sensors include the receptor-type guanylyl cyclase, the insulin receptor-related receptor, ligand-gated Cl- channels, connexin hemichannels, two-pore-domain K+ channels, and transient receptor potential (TRP) channels. Intracellular sensors include TRP channels and gap junction channels. Identification of molecular mechanisms underlying alkaline pH sensing is crucial for understanding how animals respond to environmental alkaline pH and how body-fluid pH is maintained within a narrow range. © 2015 Wiley Periodicals, Inc.

  17. ALKALINE PEROXIDE MECHANICAL PULPING OF FAST GROWTH PAULOWNIA WOOD

    OpenAIRE

    Ahmad Jahan Latibari; K. Pourali,; A. Fakhrian Roghani

    2011-01-01

    Alkaline peroxide mechanical pulping of paulownia wood harvested from exotic tree plantations in northern Iran was investigated. The fiber length, width, and cell wall thickness of this wood were measured as 0.82 mm, 40.3 μm, and 7.1 μm, respectively. The chemical composition including cellulose, lignin, and extractives soluble in ethanol-acetone, 1% NaOH, hot and cold water was determined as 49.5%, 25%, 12.1%, 26.9%, 11.4%, and 8.1% respectively. The ash content of this wood was 0.45%. Pre-w...

  18. Effect of alkaline hydrolysis on the quantity of extractable protein ...

    African Journals Online (AJOL)

    Jatropha curcas seeds were processed and defatted to obtain the seed cake. 60 g of them were separately moistened in 0.1 – 0.5 M NaOH and Ca(OH)2 solutions and autoclaved. Each of the autoclaved samples was separately divided into three portions. A portion was washed with ethanol, another with water and the third ...

  19. Rapid determination of the volatile components in tobacco by ultrasound-microwave synergistic extraction coupled to headspace solid-phase microextraction with gas chromatography-mass spectrometry.

    Science.gov (United States)

    Yang, Yanqin; Chu, Guohai; Zhou, Guojun; Jiang, Jian; Yuan, Kailong; Pan, Yuanjiang; Song, Zhiyu; Li, Zuguang; Xia, Qian; Lu, Xinbo; Xiao, Weiqiang

    2016-03-01

    An ultrasound-microwave synergistic extraction coupled to headspace solid-phase microextraction was first employed to determine the volatile components in tobacco samples. The method combined the advantages of ultrasound, microwave, and headspace solid-phase microextraction. The extraction, separation, and enrichment were performed in a single step, which could greatly simplify the operation and reduce the whole pretreatment time. In the developed method, several experimental parameters, such as fiber type, ultrasound power, and irradiation time, were optimized to improve sampling efficiency. Under the optimal conditions, there were 37, 36, 34, and 36 components identified in tobacco from Guizhou, Hunan, Yunnan, and Zimbabwe, respectively, including esters, heterocycles, alkanes, ketones, terpenoids, acids, phenols, and alcohols. The compound types were roughly the same while the contents were varied from different origins due to the disparity of their growing conditions, such as soil, water, and climate. In addition, the ultrasound-microwave synergistic extraction coupled to headspace solid-phase microextraction method was compared with the microwave-assisted extraction coupled to headspace solid-phase microextraction and headspace solid-phase microextraction methods. More types of volatile components were obtained by using the ultrasound-microwave synergistic extraction coupled to headspace solid-phase microextraction method, moreover, the contents were high. The results indicated that the ultrasound-microwave synergistic extraction coupled to headspace solid-phase microextraction technique was a simple, time-saving and highly efficient approach, which was especially suitable for analysis of the volatile components in tobacco. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  20. Development of an extraction method based on new porous organogel materials coupled with liquid chromatography-mass spectrometry for the rapid quantification of bisphenol A in urine.

    Science.gov (United States)

    ter Halle, Alexandra; Claparols, Catherine; Garrigues, Jean Christophe; Franceschi-Messant, Sophie; Perez, Emile

    2015-10-02

    A new method based on the use of porous organogel materials in combination with liquid chromatography-tandem mass spectrometry (LC-MS-MS) was assessed for the quantification of trace contaminants in complex matrices. As a demonstration of the use of these new materials, the contaminant chosen as a model was bisphenol A (BPA) and its extraction was investigated in urine. Organogel materials consist of an organic solvent immobilized by an organogelator. The composition of the organogel materials was optimized in terms of extraction efficiency and compatibility with LC-MS-MS. Porosity was introduced into the organogel by means of the particulate leaching method using sugar crystals. This new absorbing material is simple to use; the extraction method is reduced to a few steps. The originality of the method lies in the complete dissolution of the material for analysis by LC-MS-MS. The matrix effect of the organogel components was studied and was found to be minimal in atmospheric-pressure chemical ionization (APCI) compared to electrospray ionization (ESI) in negative mode. The influence of matrix components on the extraction was investigated by working with different media (acidified water, synthetic urine, horse urine and human urine). The partition coefficient was not affected within the margin of error (±0.1). After optimization, bisphenol A recoveries from urine samples reached 80%. The actual concentration factor was 10. The relative standard deviation (RSD, n=6) for the extraction and determination of BPA in horse urine spiked at 10ngmL(-1) was 9%. Tests with spiked human urine showed that the extraction performances were the same as with the solutions tested previously. The use of porous organogel allowed a fast, simple, sensitive, robust, green method to be developed for the determination of trace contaminants in complex matrices. Copyright © 2015 Elsevier B.V. All rights reserved.

  1. Multisystemic functions of alkaline phosphatases.

    Science.gov (United States)

    Buchet, René; Millán, José Luis; Magne, David

    2013-01-01

    Human and mouse alkaline phosphatases (AP) are encoded by a multigene family expressed ubiquitously in multiple tissues. Gene knockout (KO) findings have helped define some of the precise exocytic functions of individual isozymes in bone, teeth, the central nervous system, and in the gut. For instance, deficiency in tissue-nonspecific alkaline phosphatase (TNAP) in mice (Alpl (-/-) mice) and humans leads to hypophosphatasia (HPP), an inborn error of metabolism characterized by epileptic seizures in the most severe cases, caused by abnormal metabolism of pyridoxal-5'-phosphate (the predominant form of vitamin B6) and by hypomineralization of the skeleton and teeth featuring rickets and early loss of teeth in children or osteomalacia and dental problems in adults caused by accumulation of inorganic pyrophosphate (PPi). Enzyme replacement therapy with mineral-targeting TNAP prevented all the manifestations of HPP in mice, and clinical trials with this protein therapeutic are showing promising results in rescuing life-threatening HPP in infants. Conversely, TNAP induction in the vasculature during generalized arterial calcification of infancy (GACI), type II diabetes, obesity, and aging can cause medial vascular calcification. TNAP inhibitors, discussed extensively in this book, are in development to prevent pathological arterial calcification. The brush border enzyme intestinal alkaline phosphatase (IAP) plays an important role in fatty acid (FA) absorption, in protecting gut barrier function, and in determining the composition of the gut microbiota via its ability to dephosphorylate lipopolysaccharide (LPS). Knockout mice (Akp3 (-/-)) deficient in duodenal-specific IAP (dIAP) become obese, and develop hyperlipidemia and hepatic steatosis when fed a high-fat diet (HFD). These changes are accompanied by upregulation in the jejunal-ileal expression of the Akp6 IAP isozyme (global IAP, or gIAP) and concomitant upregulation of FAT/CD36, a phosphorylated fatty acid

  2. INTRACELLULAR DISTRIBUTION OF ALKALINE PHOSPHATASE IN RAT LIVER CELLS

    Science.gov (United States)

    Emery, Arthur J.; Dounce, Alexander L.

    1955-01-01

    1. Cytochemical studies of the intracellular distribution of alkaline phosphatase in rat liver have been made, using a fractionation procedure recently developed in this laboratory (8) and a similar but modified method not described previously. Aqueous media were used in both cases. 2. The alkaline phosphatase was found to consist of two forms, one of which is strongly activated by magnesium and one of which is not sensitive to this metal. 3. The form of the enzyme that is not activated by magnesium occurs mainly in the nuclear fraction, where it seems to be rather firmly bound. Some of this form of the enzyme is also found in the microsomes, but very little if any occurs in the soluble supernatant fraction. 4. The form of alkaline phosphatase which is activated by magnesium occurs mainly in the soluble supernatant fraction, but what is believed are significant amounts also occur in nuclei. A significant portion of this form of the enzyme can be extracted from the isolated nuclei with cold, isotonic saline solution. Some activity of this form of the enzyme is also found in the microsomal fraction. 5. Mitochondria appear to contain relatively little alkaline phosphatase of either kind. 6. The concept of a porous nuclear membrane has been invoked to explain some of the results obtained in this work. It is postulated that part at least of the form of the enzyme that is activated by magnesium is free to diffuse back and forth through pores in the nuclear membrane, whereas this is considered not to be possible for the form of the enzyme that is insensitive to magnesium as a result of the firm binding of the latter to nuclear substance. PMID:13242596

  3. Pipette tip solid-phase extraction and ultra-performance liquid chromatography/mass spectrometry based rapid analysis of picrosides from Picrorhiza scrophulariiflora.

    Science.gov (United States)

    Shen, Qing; Dong, Wei; Wang, Yixuan; Gong, Like; Dai, Zhiyuan; Cheung, Hon-Yeung

    2013-06-01

    Pipette tip solid-phase extraction (PT-SPE) is a technique popular in sample preparation of biological fluids and protein hydrolysates. In this study, we developed a microtechnic using a pipette tip packed with C18 as sorbent for extraction and purification of bioactive compounds, picroside-I, II and III, in crude herbal extracts from Picrorhiza scrophulariiflora (P. scrophulariiflora). Compared to conventional SPE, PT-SPE is fast, easy to operate, and the tools are very accessible (pipette tip and tube, without expensive SPE set-up). Moreover, it is also cost-effective because significant amount of sorbent and solvents can be saved. The eluate was analyzed by ultra-performance liquid chromatography and tandem mass spectrometry (UPLC-MS/MS). Afterwards, the method was fully validated and the results demonstrated that the PT-SPE-UPLC-MS/MS method is an excellent technique for analysis of the herbal medicine. Finally, this PT-SPE-UPLC-MS/MS strategy was successfully applied to analyze the crude extracts from P. scrophulariiflora samples within 10min (2min for PT-SPE and 8min for UPLC), 3.5mL solvents (including water, 0.3mL for PT-SPE and 3.2mL for UPLC), and 2mg C18 sorbent for each sample. We believe this method to be very practical and, in particular, to be suitable for widespread herbal medicine analysis. Copyright © 2013 Elsevier B.V. All rights reserved.

  4. A rapid and validated HPLC method to quantify sphingosine 1-phosphate in human plasma using solid-phase extraction followed by derivatization with fluorescence detection

    NARCIS (Netherlands)

    Butter, Jan J.; Koopmans, Richard P.; Michel, Martin C.

    2005-01-01

    We describe the development and validation of analytical methodology for the determination of sphingosine 1-phosphate (S1P) in plasma. It uses solid-phase extraction (SPE) followed by an automated reversed-phase gradient HPLC column-switching system with a pre-column derivatization with

  5. A Rapid Magnetic Solid Phase Extraction Method Followed by Liquid Chromatography-Tandem Mass Spectrometry Analysis for the Determination of Mycotoxins in Cereals

    Directory of Open Access Journals (Sweden)

    Giorgia La Barbera

    2017-04-01

    Full Text Available Mycotoxins can contaminate various food commodities, including cereals. Moreover, mycotoxins of different classes can co-contaminate food, increasing human health risk. Several analytical methods have been published in the literature dealing with mycotoxins determination in cereals. Nevertheless, in the present work, the aim was to propose an easy and effective system for the extraction of six of the main mycotoxins from corn meal and durum wheat flour, i.e., the main four aflatoxins, ochratoxin A, and the mycoestrogen zearalenone. The developed method exploited magnetic solid phase extraction (SPE, a technique that is attracting an increasing interest as an alternative to classical SPE. Therefore, the use of magnetic graphitized carbon black as a suitable extracting material was tested. The same magnetic material proved to be effective in the extraction of mycoestrogens from milk, but has never been applied to complex matrices as cereals. Ultra high–performance liquid chromatography tandem mass spectrometry was used for detection. Recoveries were >60% in both cereals, even if the matrix effects were not negligible. The limits of quantification of the method results were comparable to those obtained by other two magnetic SPE-based methods applied to cereals, which were limited to one or two mycotoxins, whereas in this work the investigated mycotoxins belonged to three different chemical classes.

  6. Rapid and sensitive analysis of nine fungicide residues in chrysanthemum by matrix extraction-vortex-assisted dispersive liquid-liquid microextraction.

    Science.gov (United States)

    Xue, Jiaying; Chen, Xiaochu; Jiang, Wenqing; Liu, Fengmao; Li, Huichen

    2015-01-15

    A simple sample pretreatment for simultaneous determination of nine fungicides (triadimefon, picoxystrobin, kresoxim-methyl, diniconazole, epoxiconazole, trifloxystrobin, triticonazole, difenoconazole, and azoxystrobin) in chrysanthemum was developed using matrix extraction-vortex-assisted dispersive liquid-liquid microextraction (ME-VADLLME) prior to gas chromatography with electron capture detection. The target fungicides were firstly extracted with acetonitrile and cleaned with the mixture of primary secondary amine and graphite carbon black. The VADLLME procedure was performed by using toluene with lower density than water as the extraction solvent and the acetonitrile extract as the dispersive solvent, respectively. After vortexing and centrifugation, the fine droplet of toluene was collected on the upper of the mixed toluene/acetonitrile/water system using a 0.1-mL pipettor. Under the optimum conditions, the relative recoveries ranged from 73.9 to 95.1% with relative standard deviations of 3.5-9.7% for all of the analytes. The limits of detection were in the range of (0.005-0.05)×10(-3) mg kg(-1). In the proposed method, the ME step provides more effective cleanup for the chrysanthemum matrix, and VADLLME introduces higher sensitivity with the remarkable enrichment factors up to 88-fold compared with the conventional QuEChERS or SPE. The good performance has demonstrated that ME-VADLLME has a strong potential for application in the multi-residue analysis of complex matrices. Copyright © 2014 Elsevier B.V. All rights reserved.

  7. Comparison of conventional averaged and rapid averaged, autoregressive-based extracted auditory evoked potentials for monitoring the hypnotic level during propofol induction

    DEFF Research Database (Denmark)

    Litvan, Héctor; Jensen, Erik W; Galan, Josefina

    2002-01-01

    The extraction of the middle latency auditory evoked potentials (MLAEP) is usually done by moving time averaging (MTA) over many sweeps (often 250-1,000), which could produce a delay of more than 1 min. This problem was addressed by applying an autoregressive model with exogenous input (ARX) that...

  8. Rapid High Performance Liquid Chromatography Determination and Optimization of Extraction Parameters of the α-Asarone Isolated from Perilla frutescens L.

    Directory of Open Access Journals (Sweden)

    Seung Hwan Hwang

    2017-02-01

    Full Text Available Response surface methodology (RSM, based on a central composite design, was used to determine the best liquid-to-raw material ratio (10:3–15 mL/g, extraction time (1–3 h, and ethanol concentration (50%–100% for maximum content of α-asarone from Perilla frutescens (PF extract. Experimental values of α-asarone were 9.51–46.36 mg/g; the results fitted a second-order quadratic polynomial model and correlated with the proposed model (R2 > 0.9354. The best conditions were obtained with extraction time of 1.76 h, liquid-to-raw material ratio of 10:13.5 mL/g, and ethanol concentration of 90.37%. Under these conditions, the model predicted extraction content of 40.56 mg/g, while experimental PF content of α-asarone was 43.84 mg/g dried plant. Optimized conditions determined for maximum content of α-asarone were similar to the experimental range. Experimental values agreed with those predicted, thus validating and indicating suitability of both the model and the RSM approach for optimizing extraction conditions. In addition, a reliable, reproducible and accurate method for the quantitative determination of α-asarone by High Performance Liquid Chromatography (HPLC analysis was developed with limit of detection (LOD, limit of quantitation (LOQ values of 0.10 and 0.29 µg/mL and excellent linearity (R2 > 0.9999.

  9. A rapid and versatile combined DNA/RNA extraction protocol and its application to the analysis of a novel DNA marker set polymorphic between Arabidopsis thaliana ecotypes Col-0 and Landsberg erecta

    Directory of Open Access Journals (Sweden)

    Coupland George

    2005-08-01

    Full Text Available Abstract Background Many established PCR-based approaches in plant molecular biology rely on lengthy and expensive methods for isolation of nucleic acids. Although several rapid DNA isolation protocols are available, they have not been tested for simultaneous RNA isolation for RT-PCR applications. In addition, traditional map-based cloning technologies often use ill-proportioned marker regions even when working with the model plant Arabidopsis thaliana, where the availability of the full genome sequence can now be exploited for the creation of a high-density marker systems. Results We designed a high-density polymorphic marker set between two frequently used ecotypes. This new polymorphic marker set allows size separation of PCR products on agarose gels and provides an initial resolution of 10 cM in linkage mapping experiments, facilitated by a rapid plant nucleic acid extraction protocol using minimal amounts of A. thaliana tissue. Using this extraction protocol, we have also characterized segregating T-DNA insertion mutations. In addition, we have shown that our rapid nucleic acid extraction protocol can also be used for monitoring transcript levels by RT-PCR amplification. Finally we have demonstrated that our nucleic acid isolation method is also suitable for other plant species, such as tobacco and barley. Conclusion To facilitate high-throughput linkage mapping and other genomic applications, our nucleic acid isolation protocol yields sufficient quality of DNA and RNA templates for PCR and RT-PCR reactions, respectively. This new technique requires considerably less time compared to other purification methods, and in combination with a new polymorphic PCR marker set dramatically reduces the workload required for linkage mapping of mutations in A. thaliana utilizing crosses between Col-0 and Landsberg erecta (Ler ecotypes.

  10. Isolation and purification of alkaline keratinase from Bacillus sp. 50-3

    African Journals Online (AJOL)

    A new alkaline keratinase extracted from Bacillus sp. 50-3 was isolated and purified in this study. Solid ammonium sulfate was selected to precipitate the enzyme. Its proper adding mass was also determined. Through solid ammonium sulfate precipitation and liquid chromatography via the DEAE-Sephadex-A50 column ...

  11. Characterisation of alkaline tailings from a lead/zinc mine in South ...

    African Journals Online (AJOL)

    Tailings from a lead/zinc (Pb/Zn) mine were characterised and their revegetation potential investigated under glasshouse conditions using five grass species with three rates of inorganic fertiliser. The tailings were alkaline with low nutrient concentrations but high total and extractable Zn. The yield of all grass species ...

  12. A Rapid Centrifugation-Assisted Solid-Phase Extraction and Liquid Chromatography Method for Determination of Loureirin A and Loureirin B of Dragon's Blood Capsules in Rat Plasma and Urine After Oral Administration.

    Science.gov (United States)

    Chen, Xiaoshuang; Li, Gaofeng; Ma, Shangfang; Hu, Xujia

    2015-07-01

    A simple, sensitive and rapid centrifugation-assisted solid-phase extraction (SPE) with high-performance liquid chromatography (SPE-HPLC) method was developed for simultaneous determination of the metabolites loureirin A and loureirin B from Dragon's blood in rat plasma and urine. The development of the extraction procedure included optimization of some important extraction phases. After evaluation, the metabolites of Dragon's blood were extracted by centrifugation-assisted SPE and separated by using HPLC. This method showed good linearity (r(2) > 0.99), and in the rat plasma and urine, the recoveries were 93.1 and 95.7% for loureirin A and were 90.1 and 94.2% for loureirin B. The relative standard deviation (RSD) values of intraday and interday precision in rat plasma and urine for loureirin A were <3.84 and 2.01%, respectively. The RSD values of the intraday and interday precision in rat plasma and urine for loureirin B were below 4.25 and 5.83%, respectively. Thus, the established method is suitable for metabolism studies of loureirin A and loureirin B in rat plasma and urine. © The Author 2015. Published by Oxford University Press. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

  13. Sunlight based irradiation strategy for rapid green synthesis of highly stable silver nanoparticles using aqueous garlic (Allium sativum) extract and their antibacterial potential

    Energy Technology Data Exchange (ETDEWEB)

    Rastogi, Lori [National Center for Chemical Characterization of Materials, Bhabha Atomic Research Centre, ECIL-PO, Hyderabad 500 062 (India); Arunachalam, J., E-mail: aruncccm@rediffmail.com [National Center for Chemical Characterization of Materials, Bhabha Atomic Research Centre, ECIL-PO, Hyderabad 500 062 (India)

    2011-09-15

    Highlights: {yields} We report green synthetic route for the production crystalline silver nanoparticles using garlic as both reducing and stabilizing agent. {yields} Synthesis has been achieved by exposing the solution mixture of [Ag(NH{sub 3}){sub 2}]{sup +} and aqueous garlic extract under sunlight. {yields} Role of light in the synthesis process has been investigated and is discussed in detail. {yields} The antibacterial effect of the synthesized silver nanoparticles has been assessed against both Gram classes of bacteria. {yields} Synthesized silver colloidal solutions were found to be stable for a very long period and retained their bactericidal potential. - Abstract: A green synthetic route for the production of highly stable silver nanoparticles using aqueous garlic extract is being reported for the first time. The silver nanoparticles were synthesized by exposing a mixture of 0.1 M [Ag(NH{sub 3}){sub 2}]{sup +} and diluted aqueous garlic extract under bright sunlight for 15 min. The garlic extract components served as both reducing and capping agents in the synthesis of silver nanoparticles while the sunlight acted as catalyst in the synthesis process. The synthesized nanoparticles were characterized using UV-visible (UV-vis) spectrophotometer; transmission electron microscopy (TEM), glancing angle X-ray diffraction (GA-XRD) and Fourier transform infra red (FTIR) spectrometry. The nanoparticles were found to be poly-dispersed in nature, spherical in shape and of 7.3 {+-} 4.4 nm in size. The FTIR analysis was suggestive of proteins as capping agents around the nanoparticles. The yield of synthesized nanoparticles was calculated to be approximately 80% by dry weight and 85% ICP-AES method. The synthesized silver nanoparticles exhibited good antibacterial potential against both Gram positive and Gram negative bacterial strains, as measured using well diffusion assay. Most importantly, the silver colloidal solutions thus synthesized were found to be stable for

  14. Studies of second phase particles in different zirconium alloys using extractive carbon replica and an electrolytic anodic dissolution procedure [rapid communication

    Science.gov (United States)

    Toffolon-Masclet, Caroline; Brachet, Jean-Christophe; Jago, Gilles

    2002-10-01

    Zirconium alloys are widely studied for applications as cladding tubes and structural components of PWR fuel assemblies. Due to their influence on some of the alloys properties (corrosion resistance, irradiation growth, …), the crystallographic structure and the chemical stoichiometry of the second phase particles (SPP) precipitated in these alloys have to be well established. The aim of this paper is to present the results obtained using two methods of SPP extractions. The first one, the extractive carbon replica method, allowed us to determine the chemical composition of SPP in different zirconium alloys: Zr-Sn-Fe-Cr (Zircaloy-4 ®), Zr-Sn-Fe-Cr-(V,Mo), Zr-Nb and Zr-Nb-Fe alloys. The second one, an anodic dissolution procedure of the matrix, is an interesting way of isolating SPP from the surrounding α-Zr matrix, giving access to a precise determination of the crystallographic structure and lattice parameters of the SPP by X-ray diffraction. This procedure was validated for Zy-4 by comparing the SPP size distribution obtained by extraction with that directly measured on a massive Zy-4 alloy (i.e. the SPP size distributions were the same for both measurements).

  15. One simple DNA extraction device and its combination with modified visual loop-mediated isothermal amplification for rapid on-field detection of genetically modified organisms.

    Science.gov (United States)

    Zhang, Miao; Liu, Yinan; Chen, Lili; Quan, Sheng; Jiang, Shimeng; Zhang, Dabing; Yang, Litao

    2013-01-02

    Quickness, simplicity, and effectiveness are the three major criteria for establishing a good molecular diagnosis method in many fields. Herein we report a novel detection system for genetically modified organisms (GMOs), which can be utilized to perform both on-field quick screening and routine laboratory diagnosis. In this system, a newly designed inexpensive DNA extraction device was used in combination with a modified visual loop-mediated isothermal amplification (vLAMP) assay. The main parts of the DNA extraction device included a silica gel membrane filtration column and a modified syringe. The DNA extraction device could be easily operated without using other laboratory instruments, making it applicable to an on-field GMO test. High-quality genomic DNA (gDNA) suitable for polymerase chain reaction (PCR) and isothermal amplification could be quickly isolated from plant tissues using this device within 15 min. In the modified vLAMP assay, a microcrystalline wax encapsulated detection bead containing SYBR green fluorescent dye was introduced to avoid dye inhibition and cross-contaminations from post-LAMP operation. The system was successfully applied and validated in screening and identification of GM rice, soybean, and maize samples collected from both field testing and the Grain Inspection, Packers, and Stockyards Administration (GIPSA) proficiency test program, which demonstrated that it was well-adapted to both on-field testing and/or routine laboratory analysis of GMOs.

  16. A Rapid LC-HRMS Method for the Determination of Domoic Acid in Urine Using a Self-Assembly Pipette Tip Solid-Phase Extraction.

    Science.gov (United States)

    Zhang, Yiping; Chen, Dawei; Hong, Zhuan

    2015-12-29

    In this study, we developed a self-assembly pipette tip solid-phase extraction (PTSPE) method using a high molecular weight polymer material (PAX) as the adsorbent for the determination of domoic acid (DA) in human urine samples by liquid chromatography high-resolution mass spectrometry (LC-HRMS) analysis. The PTSPE cartridge, assembled by packing 9.1 mg of PAX as sorbent into a 200 μL pipette tip, showed high adsorption capacity for DA owing to the strong cationic properties of PAX. Compared with conventional SPE, the PTSPE is simple and fast, and shows some advantages in the aspects of less solvent consumption, low cost, the absence of the evaporation step, and short time requirement. All the parameters influencing the extraction efficiency such as pH, the amount of sorbent, the number of aspirating/dispensing cycles, and the type and volume of eluent in PTSPE were carefully investigated and optimized. Under the optimized conditions, the limit of detection (LOD) and limit of quantification (LOQ) values of DA were 0.12 μg/L and 0.37 μg/L respectively. The extraction recoveries of DA from the urine samples spiked at four different concentrations were in a range from 88.4% to 102.5%. The intra- and inter-day precisions varied from 2.1% to 7.6% and from 2.6% to 12.7%, respectively. The accuracy ranged from -1.9% to -7.4%.

  17. A Rapid and Optimized LC-MS/MS Method for the Simultaneous Extraction and Determination of Sofosbuvir and Ledipasvir in Human Plasma.

    Science.gov (United States)

    Elkady, Ehab F; Aboelwafa, Ahmed A

    2016-09-01

    A new validated bioanalytical method based on LC tandem MS has been developed for the simultaneous extraction and determination of sofosbuvir and ledipasvir in human plasma using antiviral daclatasvir as an internal standard (IS). Liquid-liquid extraction of samples was used for the purification and preconcentration of the analytes from a human plasma matrix. Good and consistent recoveries were obtained, with average extraction recoveries of 91.61 and 88.93% for sofosbuvir and ledipasvir, respectively. The chromatographic separation of the three analytes was achieved within only 2.8 min by an isocratic mobile phase consisting of 10 mM ammonium acetate, which was then adjusted to pH 4.0 by acetic acid-acetonitrile-0.1% methanolic formic acid (12 + 25 + 63, v/v/v) flowing through a C18 Zorbax eclipse plus column (5 μm, 100 × 4.6 mm; Agilent). Multiple reaction monitoring transitions were measured in positive ion mode for sofosbuvir, ledipasvir, and daclatasvir (IS). A detailed validation of the method was performed and the standard curves were found to be linear in the range of 0.5 to 2500 and 5 to 2100 ng/mL for sofosbuvir and ledipasvir, respectively, applying weighted (1/X(2)) linear regression. The developed method was applied to the analysis of the two drugs after a single oral administration of Harvoni 400/90 mg film-coated tablets containing 400 mg sofosbuvir and 90 mg ledipasvir to four healthy volunteers.

  18. A rapid genotyping method for an obligate fungal pathogen, Puccinia striiformis f.sp. tritici, based on DNA extraction from infected leaf and Multiplex PCR genotyping

    Directory of Open Access Journals (Sweden)

    Enjalbert Jérôme

    2011-07-01

    Full Text Available Abstract Background Puccinia striiformis f.sp. tritici (PST, an obligate fungal pathogen causing wheat yellow/stripe rust, a serious disease, has been used to understand the evolution of crop pathogen using molecular markers. However, numerous questions regarding its evolutionary history and recent migration routes still remains to be addressed, which need the genotyping of a large number of isolates, a process that is limited by both DNA extraction and genotyping methods. To address the two issues, we developed here a method for direct DNA extraction from infected leaves combined with optimized SSR multiplexing. Findings We report here an efficient protocol for direct fungal DNA extraction from infected leaves, avoiding the costly and time consuming step of spore multiplication. The genotyping strategy we propose, amplified a total of 20 SSRs in three Multiplex PCR reactions, which were highly polymorphic and were able to differentiate different PST populations with high efficiency and accuracy. Conclusion These two developments enabled a genotyping strategy that could contribute to the development of molecular epidemiology of yellow rust disease, both at a regional or worldwide scale.

  19. Qualitative Carbohydrate Analysis using Alkaline Potassium ...

    Indian Academy of Sciences (India)

    Home; Journals; Resonance – Journal of Science Education; Volume 21; Issue 3. Qualitative Carbohydrate Analysis using Alkaline Potassium Ferricyanide. Sangeeta Pandita Saral Baweja. Classroom Volume 21 Issue 3 March 2016 pp 285-288 ...

  20. Alkaline Water and Longevity: A Murine Study

    National Research Council Canada - National Science Library

    Magro, Massimiliano; Corain, Livio; Ferro, Silvia; Baratella, Davide; Bonaiuto, Emanuela; Terzo, Milo; Corraducci, Vittorino; Salmaso, Luigi; Vianello, Fabio

    2016-01-01

    The biological effect of alkaline water consumption is object of controversy. The present paper presents a 3-year survival study on a population of 150 mice, and the data were analyzed with accelerated failure time (AFT) model...

  1. Serum and tissue alkaline phosphatases in pigs.

    Science.gov (United States)

    Kierek-Jaszczuk, D; Geldermann, H

    1985-01-01

    The alkaline phosphatases from serum, liver, bone and intestine of pigs were separated by starch and polyacrylamide gel electrophoresis. Treatments with neuraminidase, urea, heat, L-homoarginine and L-phenylalanine were performed. Variants of serum alkaline phosphatases were derived from different tissues and hence must be under the control of at least two different loci. Within the intestinal phosphatases, polymorphic electrophoretic patterns were observed among 195 animals.

  2. Technetium recovery from high alkaline solution

    Energy Technology Data Exchange (ETDEWEB)

    Nash, Charles A.

    2016-07-12

    Disclosed are methods for recovering technetium from a highly alkaline solution. The highly alkaline solution can be a liquid waste solution from a nuclear waste processing system. Methods can include combining the solution with a reductant capable of reducing technetium at the high pH of the solution and adding to or forming in the solution an adsorbent capable of adsorbing the precipitated technetium at the high pH of the solution.

  3. Alkaline phosphatase retained in HepG2 hepatocarcinoma cells vs. alkaline phosphatase released to culture medium: difference of aberrant glycosylation.

    Science.gov (United States)

    Nowrouzi, Azin; Yazdanparast, Razieh

    2005-05-06

    Liver tissue is the source of 90% of serum alkaline phosphatase (AP). The serum levels and structures of tumor marker proteins change under many disease conditions as well as cancer. The study was aimed at determining the type of alkaline phosphatase (AP) present in HepG2 hepatocellular carcinoma cell line. Alkaline phosphatase rich extracts of healthy human liver, HepG2 hepatocarcinoma cells, as well as the condition medium of HepG2 cells were prepared by extraction with 40% n-butanol and 30-50% acetone precipitation, and subjected to various chromatographic procedures. Lectin affinity chromatography of the samples with concanavalin A-Sepharose 4B showed considerable differences in the elution patterns. Non-denaturing polyacrylamide gel electrophoresis of the culture medium yielded a relatively slow migrating band of activity that coincided with none of the three bands of activity produced by the normal liver extract, nor with the bands of the cell pellet extract. Inhibition patterns were established by measuring the enzyme activities in the presence of varying concentrations of L-phenylalanine, L-leucine, L-homoarginine, and levamisole. The APs from the cell line were neuraminidase sensitive. According to the results the main AP produced and released to the medium by HepG2 cell line is an aberrantly glycosylated tissue non-specific AP. In addition, the differences between the cell-pellet AP and the culture medium AP seemed to stem from different sugar moieties in their structures.

  4. Characterization and quantification of biochar alkalinity.

    Science.gov (United States)

    Fidel, Rivka B; Laird, David A; Thompson, Michael L; Lawrinenko, Michael

    2017-01-01

    Lack of knowledge regarding the nature of biochar alkalis has hindered understanding of pH-sensitive biochar-soil interactions. Here we investigate the nature of biochar alkalinity and present a cohesive suite of methods for its quantification. Biochars produced from cellulose, corn stover and wood feedstocks had significant low-pKa organic structural (0.03-0.34 meq g(-1)), other organic (0-0.92 meq g(-1)), carbonate (0.02-1.5 meq g(-1)), and other inorganic (0-0.26 meq g(-1)) alkalinities. All four categories of biochar alkalinity contributed to total biochar alkalinity and are therefore relevant to pH-sensitive soil processes. Total biochar alkalinity was strongly correlated with base cation concentration, but biochar alkalinity was not a simple function of elemental composition, soluble ash, fixed carbon, or volatile matter content. More research is needed to characterize soluble biochar alkalis other than carbonates and to establish predictive relationships among biochar production parameters and the composition of biochar alkalis. Copyright © 2016 Elsevier Ltd. All rights reserved.

  5. Alkaline Water and Longevity: A Murine Study

    Directory of Open Access Journals (Sweden)

    Massimiliano Magro

    2016-01-01

    Full Text Available The biological effect of alkaline water consumption is object of controversy. The present paper presents a 3-year survival study on a population of 150 mice, and the data were analyzed with accelerated failure time (AFT model. Starting from the second year of life, nonparametric survival plots suggest that mice watered with alkaline water showed a better survival than control mice. Interestingly, statistical analysis revealed that alkaline water provides higher longevity in terms of “deceleration aging factor” as it increases the survival functions when compared with control group; namely, animals belonging to the population treated with alkaline water resulted in a longer lifespan. Histological examination of mice kidneys, intestine, heart, liver, and brain revealed that no significant differences emerged among the three groups indicating that no specific pathology resulted correlated with the consumption of alkaline water. These results provide an informative and quantitative summary of survival data as a function of watering with alkaline water of long-lived mouse models.

  6. Alkaline Waterflooding Demonstration Project, Ranger Zone, Long Beach Unit, Wilmington Field, California. Fourth annual report, June 1979-May 1980. Volume 3. Appendices II-XVII

    Energy Technology Data Exchange (ETDEWEB)

    Carmichael, J.D.

    1981-03-01

    Volume 3 contains Appendices II through XVII: mixing instructions for sodium orthosilicate; oil displacement studies using THUMS C-331 crude oil and extracted reservoir core material from well B-110; clay mineral analysis of B-827-A cores; sieve analysis of 4 Fo sand samples from B-110-IA and 4 Fo sand samples from B-827-A; core record; delayed secondary caustic consumption tests; long-term alkaline consumption in reservoir sands; demulsification study for THUMS Long Beach Company, Island White; operating plans and instructions for DOE injection demonstration project, alkaline injection; caustic pilot-produced water test graphs; well test irregularities (6/1/79-5/31/80); alkaline flood pump changes (6/1/79-5/31/80); monthly DOE pilot chemical waterflood injection reports (preflush injection, alkaline-salt injection, and alkaline injection without salt); and caustic safety procedures-alkaline chemicals.

  7. A Rapid LC-HRMS Method for the Determination of Domoic Acid in Urine Using a Self-Assembly Pipette Tip Solid-Phase Extraction

    Directory of Open Access Journals (Sweden)

    Yiping Zhang

    2015-12-01

    Full Text Available In this study, we developed a self-assembly pipette tip solid-phase extraction (PTSPE method using a high molecular weight polymer material (PAX as the adsorbent for the determination of domoic acid (DA in human urine samples by liquid chromatography high-resolution mass spectrometry (LC-HRMS analysis. The PTSPE cartridge, assembled by packing 9.1 mg of PAX as sorbent into a 200 μL pipette tip, showed high adsorption capacity for DA owing to the strong cationic properties of PAX. Compared with conventional SPE, the PTSPE is simple and fast, and shows some advantages in the aspects of less solvent consumption, low cost, the absence of the evaporation step, and short time requirement. All the parameters influencing the extraction efficiency such as pH, the amount of sorbent, the number of aspirating/dispensing cycles, and the type and volume of eluent in PTSPE were carefully investigated and optimized. Under the optimized conditions, the limit of detection (LOD and limit of quantification (LOQ values of DA were 0.12 μg/L and 0.37 μg/L respectively. The extraction recoveries of DA from the urine samples spiked at four different concentrations were in a range from 88.4% to 102.5%. The intra- and inter-day precisions varied from 2.1% to 7.6% and from 2.6% to 12.7%, respectively. The accuracy ranged from −1.9% to −7.4%.

  8. Rapid and Simultaneous Detection of Mycobacterium tuberculosis Complex and Beijing/W Genotype in Sputum by an Optimized DNA Extraction Protocol and a Novel Multiplex Real-Time PCR ▿

    Science.gov (United States)

    Leung, Eric T. Y.; Zheng, L.; Wong, Rity Y. K.; Chan, Edward W. C.; Au, T. K.; Chan, Raphael C. Y.; Lui, Grace; Lee, Nelson; Ip, Margaret

    2011-01-01

    Rapid diagnosis and genotyping of Mycobacterium tuberculosis by molecular methods are often limited by the amount and purity of DNA extracted from body fluids. In this study, we evaluated 12 DNA extraction methods and developed a highly sensitive protocol for mycobacterial DNA extraction directly from sputa using surface-coated magnetic particles. We have also developed a novel multiplex real-time PCR for simultaneous identification of M. tuberculosis complex and the Beijing/W genotype (a hypervirulent sublineage of M. tuberculosis) by using multiple fluorogenic probes targeting both the M. tuberculosis IS6110 and the Rv0927c-pstS3 intergenic region. With reference strains and clinical isolates, our real-time PCR accurately identified 20 non-Beijing/W and 20 Beijing/W M. tuberculosis strains from 17 different species of nontuberculosis Mycobacterium (NTM). Further assessment of our DNA extraction protocol and real-time PCR with 335 nonduplicate sputum specimens correctly identified all 74 M. tuberculosis culture-positive specimens. In addition, 15 culture-negative specimens from patients with confirmed tuberculosis were also identified. No cross-reactivity was detected with NTM specimens (n = 31). The detection limit of the assay is 10 M. tuberculosis bacilli, as determined by endpoint dilution analysis. In conclusion, an optimized DNA extraction protocol coupled with a novel multiprobe multiplex real-time PCR for the direct detection of M. tuberculosis, including Beijing/W M. tuberculosis, was found to confer high sensitivity and specificity. The combined procedure has the potential to compensate for the drawbacks of conventional mycobacterial culture in routine clinical laboratory setting, such as the lengthy incubation period and the limitation to viable organisms. PMID:21593264

  9. Preparation of magnetic graphene/mesoporous silica composites with phenyl-functionalized pore-walls as the restricted access matrix solid phase extraction adsorbent for the rapid extraction of parabens from water-based skin toners.

    Science.gov (United States)

    Feng, Jianan; He, Xinying; Liu, Xiaodan; Sun, Xueni; Li, Yan

    2016-09-23

    In this work, phenyl-functionalized magnetic graphene/mesoporous silica composites (MG-mSiO2-Ph) were prepared and applied as restricted access matrix solid phase extraction (RAM-SPE) adsorbents to determine the parabens in commercially available retail cosmetics. MG-mSiO2-Ph composites were synthesized by a surfactant-mediated co-condensation reaction in which mesoporous silica with phenyl-functionalized pore-walls was coated on a magnetic graphene sheet. The obtained nano-composites were proven to be of sufficient quality for an ideal RAM-SPE adsorbent with a large specific surface area of 369m(2)g(-1), uniform mesopores of 2.8nm, and special phenyl-functionalized pore-walls. Parabens, such as methyl paraben, ethyl paraben and propyl paraben, were extracted from water-based skin toners using one step of the RAM-SPE and were then analysed by a HPLC-DAD system. The SPE conditions were optimized by studying the parameters, such as the adsorbent amount, elution solvent type, adsorption time and desorption time, that influence the extraction efficiency. For each analyte, there were good linearities of approximately 0.10-120μgmL(-1) with determination coefficients (R(2))>0.995. The sensitivity was as low as 0.01-0.025μgmL(-1) for the LOD, and the percent recoveries were 98.37-105.84%. The intra-day and inter-day RSDs were 1.44-6.11% (n=6) and 3.12-11.70% (n=6), respectively. The results indicated that this method with novel RAM-SPE adsorbents is sensitive and convenient. The results also offered an attractive alternative for the extraction and determination of paraben preservatives in a complex matrix, such as cosmetics. Copyright © 2016 Elsevier B.V. All rights reserved.

  10. Production of alkaline proteases by alkalophilic Bacillus subtilis ...

    African Journals Online (AJOL)

    The production of extracellular alkaline protease by Bacillus subtilis was studied with submerged fermentation. A new strain of Bacillus sp. was isolated from alkaline soil, which was able to produce extracellular alkaline protease. The production of alkaline protease involved the use of agricultural or animal wastes at pH 8 ...

  11. 21 CFR 864.7660 - Leukocyte alkaline phosphatase test.

    Science.gov (United States)

    2010-04-01

    ... 21 Food and Drugs 8 2010-04-01 2010-04-01 false Leukocyte alkaline phosphatase test. 864.7660... Leukocyte alkaline phosphatase test. (a) Identification. A leukocyte alkaline phosphatase test is a device used to identify the enzyme leukocyte alkaline phosphatase in neutrophilic granulocytes (granular...

  12. A Rapid Protocol of Crude RNA/DNA Extraction for RT-qPCR Detection and Quantification of 'Candidatus Phytoplasma prunorum'.

    Directory of Open Access Journals (Sweden)

    Stefano Minguzzi

    Full Text Available Many efforts have been made to develop a rapid and sensitive method for phytoplasma and virus detection. Taking our cue from previous works, different rapid sample preparation methods have been tested and applied to Candidatus Phytoplasma prunorum ('Ca. P. prunorum' detection by RT-qPCR. A duplex RT-qPCR has been optimized using the crude sap as a template to simultaneously amplify a fragment of 16S rRNA of the pathogen and 18S rRNA of the host plant. The specific plant 18S rRNA internal control allows comparison and relative quantification of samples. A comparison between DNA and RNA contribution to qPCR detection is provided, showing higher contribution of the latter. The method presented here has been validated on more than a hundred samples of apricot, plum and peach trees. Since 2013, this method has been successfully applied to monitor 'Ca. P. prunorum' infections in field and nursery. A triplex RT-qPCR assay has also been optimized to simultaneously detect 'Ca. P. prunorum' and Plum pox virus (PPV in Prunus.

  13. Rapid trace level determination of sulfonamide residues in honey with online extraction using short C-18 column by high-performance liquid chromatography with fluorescence detection.

    Science.gov (United States)

    Sajid, Muhammad; Na, Na; Safdar, Muhammad; Lu, Xin; Ma, Lin; He, Lan; Ouyang, Jin

    2013-11-01

    A sensitive and inexpensive quantification method with online extraction using a short C-18 column for sulfonamide residues in honey by high performance liquid chromatography with fluorescence detector was developed and validated. In sample preparation, acid hydrolysis was used to break the N-glycoside bond between the honey sugar and sulfonamide drugs and derivatization of sulfonamide residues with fluorescamine was conducted at pH 3.5 using a citrate buffer (0.5M) in the honey matrix. The chromatography was carried out on Zorbax Extended C-18 (250mm×4.6mm; 5μm) column, using a mixture of acetonitrile and an acetate buffer (pH 4.50, 20mM) as a mobile phase. A Zorbax Extended C-18 (12mm×4.6mm; 5μm) column was used for online extraction of fifteen sulfonamide residues from honey sample with the help of a two position valve. The limit of quantification of sulfonamide residues in honey was less than 3ngg(-1), and the percentage recovery of study compounds in spiked honey sample was from 80% for sulfacetamide to 100% of sulfachloropyridazine. The developed method has excellent linearity for all studied sulfonamides with a correlation coefficient 0.993. Copyright © 2013 Elsevier B.V. All rights reserved.

  14. Rapid selective accelerated solvent extraction and simultaneous determination of herbicide atrazine and its metabolites in fruit by ultra high performance liquid chromatography.

    Science.gov (United States)

    Jia, Licong; Su, Ming; Wu, Xingqiang; Sun, Hanwen

    2016-12-01

    A selective accelerated solvent extraction procedure achieved one step extraction and cleanup for analysis of herbicide atrazine and its metabolites in fruit. Using a BEH C18 analytical column and the gradient mode with 2 mM ammonium acetate aqueous solution/acetonitrile as a mobile phase achieved effective chromatographic separation of the five analytes within 4 min. The calibration curves were linear over two orders of magnitude of concentration with correlation coefficients (r) of 0.9996-0.9999. The method limit of quantification was 1, 2, 1.5, 3, and 2 μg/kg for atrazine, desethylatrazine, desisopropylatrazine, desethyldesisopropylatrazine, and hydroxyatrazine, respectively, in the case of atrazine it is at least two orders of magnitude lower than the maximum residue limit (0.25 mg/kg). The intra-day and inter-day precisions of the five analytes were in the range of 2.1-3.5 and 3.1-4.8 %, respectively. The recoveries of the five analytes at three spiked levels varied from 85.9 to 107% with a relative standard deviation of 1.8-4.9% for pear and apple samples. The ultra high performance liquid chromatography with diode array detection method was proved to be fast, inexpensive, selective, sensitive, and accurate for the quantification of the analytes in pear and apple samples. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  15. Rapid and simultaneous determination of neptunium and plutonium isotopes in environmental samples by extraction chromatography using sequential injection analysis and ICP-MS

    DEFF Research Database (Denmark)

    Qiao, Jixin; Hou, Xiaolin; Roos, Per

    2010-01-01

    procedures were investigated and compared for the adjustment of oxidation states of plutonium and neptunium to Pu(IV) and Np(IV), respectively. A two-step protocol using sulfite and concentrated nitric acid as redox reagents was proven to be the most effective method. The analytical results for both...... plutonium and neptunium in three reference materials were in agreement with the recommended or literature values at the 0.05 significance level. The developed method is suitable for the analysis of up to 10 g of soil and 20 g of seaweed samples. The extraction chromatographic separation within the SI system...... for a single sample takes less than 1.5 h. As compared to batchwise procedures, the developed method significantly improves the analysis efficiency, reduces the labor intensity and expedites the simultaneous determination of plutonium and neptunium as demanded in emergency actions....

  16. MUPET-Mouse Ultrasonic Profile ExTraction: A Signal Processing Tool for Rapid and Unsupervised Analysis of Ultrasonic Vocalizations.

    Science.gov (United States)

    Van Segbroeck, Maarten; Knoll, Allison T; Levitt, Pat; Narayanan, Shrikanth

    2017-05-03

    Vocalizations play a significant role in social communication across species. Analyses in rodents have used a limited number of spectro-temporal measures to compare ultrasonic vocalizations (USVs), which limits the ability to address repertoire complexity in the context of behavioral states. Using an automated and unsupervised signal processing approach, we report the development of MUPET (Mouse Ultrasonic Profile ExTraction) software, an open-access MATLAB tool that provides data-driven, high-throughput analyses of USVs. MUPET measures, learns, and compares syllable types and provides an automated time stamp of syllable events. Using USV data from a large mouse genetic reference panel and open-source datasets produced in different social contexts, MUPET analyzes the fine details of syllable production and repertoire use. MUPET thus serves as a new tool for USV repertoire analyses, with the capability to be adapted for use with other species. Copyright © 2017 Elsevier Inc. All rights reserved.

  17. Rapid, synergistic extractive spectrophotometric determination of copper(II) by using sensitive chromogenic reagent N″,N″'-bis[(E)-(4-fluorophenyl) methylidene]thiocarbonohydrazide.

    Science.gov (United States)

    Nalawade, Rekha A; Nalawade, Avinash M; Kamble, Ganesh S; Anuse, Mansing A

    2015-07-05

    A rapid and simple spectrophotometric method was developed for the determination of copper(II) by using newly synthesized chromogenic reagent, N″,N″'-bis[(E)-(4-fluorophenyl)methylidene]thiocarbonohydrazide [bis(4-fluoroPM)TCH]. The reagent is highly sensitive and it forms yellow colored ternary complex with copper(II) in presence pyridine having composition 1:1:2 (M:L:Py) in the acidic pH range. Absorption of colored complex in amyl acetate is measured with reagent as a blank at λmax 375 nm. The synergistic effect is observed due to pyridine forming adduct with reagent in the organic phase. Beer's law was obeyed in the concentration range from 2.0 to 14 μg mL(-1) for copper(II)-[bis(4-fluoroPM)TCH]-Py complex. Molar absorptivity and Sandell's sensitivity values for Cu(II)-bis(4-fluoroPM)TCH]-Py complex are 0.42545×10(5) and 0.0014 μg/cm(2), respectively. The selectivity of the developed method was checked in the presence of various foreign ions. The developed method showed relative standard deviation (R.S.D.) of 0.13% for n=10. The composition of Cu(II)-[bis(4-fluoroPM)TCH]-Py complex was determined by known methods such as Job's method of continuous variation, mole ratio method and slope ratio method. It is found that the ternary complex is stable for more than 24h. Various factors influencing on the degree of complexation, such as, effect of pH, reagent concentration, synergent concentration, solvent etc. were studied. The accuracy and reliability of method was verified by AAS. This method is found to be simple, rapid and reproducible. Copyright © 2015. Published by Elsevier B.V.

  18. Dissolution of glass wool, rock wool and alkaline earth silicate wool: morphological and chemical changes in fibers.

    Science.gov (United States)

    Campopiano, Antonella; Cannizzaro, Annapaola; Angelosanto, Federica; Astolfi, Maria Luisa; Ramires, Deborah; Olori, Angelo; Canepari, Silvia; Iavicoli, Sergio

    2014-10-01

    The behavior of alkaline earth silicate (AES) wool and of other biosoluble wools in saline solution simulating physiological fluids was compared with that of a traditional wool belonging to synthetic vitreous fibers. Morphological and size changes of fibers were studied by scanning electron microscopy (SEM). The elements extracted from fibers were analyzed by inductively coupled plasma atomic emission spectrometry. SEM analysis showed a larger reduction of length-weighted geometric mean fiber diameter at 4.5 pH than at 7.4 pH. At the 7.4 pH, AES wool showed a higher dissolution rate and a dissolution time less than a few days. Their dissolution was highly non-congruent with rapid leaching of calcium. Unlike rock wool, glass wool dissolved more rapidly at physiological pH than at acid pH. Dissolution of AES and biosoluble rock wool is accompanied by a noticeable change in morphology while by no change for glass wool. Biosoluble rock wool developed a leached surface with porous honeycomb structure. SEM analysis showed the dissolution for glass wool is mainly due to breakage transverse of fiber at pH 7.4. AES dissolution constant (Kdis) was the highest at pH 7.4, while at pH 4.5 only biosoluble rockwool 1 showed a higher Kdis. Copyright © 2014 Elsevier Inc. All rights reserved.

  19. Improvement of protein extraction from sunflower meal by hydrolysis with alcalase

    OpenAIRE

    Vioque, J; Millán, F.; Alaiz, M.; Girón-Calle, J.; Megías, C.; Pedroche, J.; Yust, M. M.

    2003-01-01

    Extraction of proteins from defatted sunflower meal has been improved by addition of the protease alcalase during alkaline extraction. This method offers several additional advantages as compared to the traditional alkaline extraction without alcalase, which is usually carried out after a sedimentation/flotation step to remove the lignocellulosic fraction. As compared to extraction without alcalase, addition of 0.1% (v/v) alcalase improved the yield of protein extraction from 57.5% to 87.4%, ...

  20. The effect of alkaline earth titanates on the rechargeability of manganese dioxide in alkaline electrolyte

    Energy Technology Data Exchange (ETDEWEB)

    Kloss, M.; Rahner, D.; Plieth, W. [Dresden Univ. of Technology, Inst. of Physical Chemistry and Electrochemistry, Dresden (Germany)

    1997-11-01

    Various alkaline earth titanates were tested as the additives for manganese dioxide electrodes in aqueous electrolyte (9 mol/1 KOH) at room temperature. The influence of the additives on the discharge capacity of primary cells and especially on cycling behaviour of rechargeable alkaline batteries is discussed. (orig.)

  1. Prophylactic treatment with alkaline phosphatase in cardiac surgery induces endogenous alkaline phosphatase release

    NARCIS (Netherlands)

    Kats, Suzanne; Brands, Ruud; Hamad, Mohamed A. Soliman; Seinen, Willem; Schamhorst, Volkher; Wulkan, Raymond W.; Schoenberger, Jacques P.; van Oeveren, Wim

    Introduction: Laboratory and clinical data have implicated endotoxin as an important factor in the inflammatory response to cardiopulmonary bypass. We assessed the effects of the administration of bovine intestinal alkaline phosphatase (bIAP), an endotoxin detoxifier, on alkaline phosphatase levels

  2. Disintegration of brown coal using alkaline solution

    Energy Technology Data Exchange (ETDEWEB)

    Vydra, J.; Skalicka, J.

    1985-01-01

    Investigations carried out by the Institute of Geology and Geotechnics of the Academy of Sciences of Czechoslovakia are discussed. The investigations were aimed at determining the optimum conditions for in situ solution mining of brown coal using alkaline solutions. Twelve brown coal samples with carbon content ranging from 64.5 to 90.7% were treated with sodium hydroxide solution with concentration ranging from 1 to 5%. Effects of hydrogen peroxide (15%) and ethanolamine (5%) also were investigated. Proportion of the 3 compounds in water was the following: 500 ml sodium hydroxide, 100 ml ethanolamine and 20 ml hydrogen peroxide. Effects of coal grain size on its disintegration in the alkaline solution also were analyzed. Conditions of in situ solution mining were simulated in the laboratory. Investigations showed that the optimum coal grain size was 2 mm, in which case disintegration efficiency depended on carbon content in coal. The lower the carbon content was, the more efficient was the alkaline disintegration. Alkaline solutions did not influence brown coal with carbon content higher than 85%. The optimum concentration of sodium hydroxide was 3%. Addition of hydrogen peroxide and ethanolamine did not influence disintegration. When alkaline solution was pumped 96 h long into a borehole, it penetrated coal to a depth of 2 mm causing swelling of the borehole walls but not coal disintegration. 8 references.

  3. Influence of Coexisting Crude Drugs on the Inhibitory Activity of Sinomeni Caulis et Rhizoma on Mouse Plasma Alkaline Phosphatase

    OpenAIRE

    MASAMI, HOUGA; FUMIHIKO, YOSHIZAKI; Mie, Suzuki; TOSHIO, ANDO; Tohoku College of Pharmacy

    1995-01-01

    A hot water extract of Sinomeni Caulis et Rhizoma inhibited the mouse plasma alkaline phosphatase (ALP) activity. Sinomenine and other alkaloids in this crude drug were found as the active principles. In this work, to study the influence of coexisting crude drugs in Chinese medicinal prescriptions, a mixture of Sinomeni Caulis et Rhizoma and one of 28 crude drugs was extracted with hot water and the ALP inhibiting activities of the extracts were compared. Angelicae Radix, Astragali Radix, Atr...

  4. Determination of unbound vismodegib (GDC-0449) concentration in human plasma using rapid equilibrium dialysis followed by solid phase extraction and high-performance liquid chromatography coupled to mass spectrometry.

    Science.gov (United States)

    Deng, Yuzhong; Wong, Harvey; Graham, Richard A; Liu, Wenbin; Shen, Heuy-shin; Shi, Yao; Wang, Laixin; Meng, Min; Malhi, Vikram; Ding, Xiao; Dean, Brian

    2011-07-15

    A rapid equilibrium dialysis (RED) assay followed by a solid phase extraction (SPE) high-performance liquid chromatography tandem mass spectrometry (LC-MS/MS) assay for the quantitative determination of unbound vismodegib in human plasma was developed and validated. The equilibrium dialysis was carried out using 0.3 mL plasma samples in the single-use plate RED system at 37°C for 6h. The dialysis samples (0.1 mL) were extracted using a Strata-X-C 33u Polymeric Strong Cation SPE plate and the resulting extracts were analyzed using reverse-phase chromatography and positive electrospray ionization (ESI) mass spectrometry. The standard curve, which ranged from 0.100 to 100 ng/mL for vismodegib, was fitted to a 1/x(2) weighted linear regression model. The lower limit of quantitation (LLOQ, 0.100 ng/mL) was sufficient to quantify unbound concentrations of vismodegib after dialysis. The intra-assay precision of the LC-MS/MS assay, based on the four analytical QC levels (LLOQ, low, medium and high), was within 7.7% CV and inter-assay precision was within 5.5% CV. The assay accuracy, expressed as %Bias, was within ±4.0% of the nominal concentration values. Extraction recovery of vismodegib was between 77.9 and 84.0%. The assay provides a means for accurate assessment of unbound vismodegib plasma concentrations in clinical studies. Copyright © 2011 Elsevier B.V. All rights reserved.

  5. Beam-based compensation of extracted-beam displacement caused by field ringing of pulsed kicker magnets in the 3 GeV rapid cycling synchrotron of the Japan Proton Accelerator Research Complex

    Science.gov (United States)

    Harada, Hiroyuki; Saha, Pranab Kumar; Tamura, Fumihiko; Meigo, Shin-ichiro; Hotchi, Hideaki; Hayashi, Naoki; Kinsho, Michikazu; Hasegawa, Kazuo

    2017-09-01

    Commissioned in October 2007, the 3 GeV rapid cycling synchrotron (RCS) of the Japan Proton Accelerator Research Complex was designed for a high-intensity output beam power of 1 MW. The RCS extracts 3 GeV proton beams of two bunches by using eight pulsed kicker magnets and three DC septum magnets with 25 Hz repetition. These beams are delivered to a materials and life science experimental facility (MLF) and a 50 GeV main ring synchrotron (MR). However, the flat-top fields of the kicker magnets experience ringing that displaces the position of the extracted beam. This displacement is a major issue from the viewpoint of target integrity at the MLF and emittance growth at MR injection. To understand the flat-top uniformity of the total field of all the kickers, the uniformity was measured as the displacement of the extracted beams by using a shorter bunched beam and scanning the entire trigger timing of the kickers. The beam displacement of the first bunch exceeded the required range. Therefore, we performed beam-based measurements kicker by kicker to understand each field-ringing effect, and then we understood the characteristics (strength and temporal structure) of each ringing field. We managed to cancel out the ringing by using all the beam-based measurement data and optimizing each trigger timing. As a result, the field-ringing effect of the kickers was successfully compensated by optimizing the trigger timing of each kicker without hardware upgrades or improvements to the kicker system. By developing an automatic monitoring and correction system, we now have a higher stability of extracted beams during routine user operation. In this paper, we report our procedure for ringing compensation and present supporting experimental results.

  6. Novel route for rapid biosynthesis of copper nanoparticles using aqueous extract of Calotropis procera L. latex and their cytotoxicity on tumor cells.

    Science.gov (United States)

    Harne, Shrikant; Sharma, Ashwinikumar; Dhaygude, Mayur; Joglekar, Shreeram; Kodam, Kisan; Hudlikar, Manish

    2012-06-15

    This paper accounts for novel, low-cost, eco-friendly route for rapid biosynthesis of copper nanoparticles. Cysteine proteases present in the latex of Calotropis procera L. were used to fabricate copper nanoparticles from copper acetate. Copper nanoparticles were initially characterized by transmission electron microscopy (TEM) and X-ray diffraction technique (XRD). Transmission electron microscopy (TEM) was used to estimate the size and shape of nanoparticles. The average size of copper nanoparticles was found to be 15 ± 1.7 nm. Energy dispersive analysis of X-rays (EDAX) showed distinct peaks of copper. Fourier transform infrared spectroscopy (FTIR) was performed to confirm capping behavior of the latex proteins that contributed to long term stability of copper nanoparticles (6 months) in aqueous medium. Copper nanoparticles synthesized by above method were monodisperse type. Cytotoxicity studies of latex stabilized copper nanoparticles were carried out on HeLa, A549 and BHK21 cell lines by MTT dye conversion assay. HeLa, A549 and BHK21 cells showed excellent viability even at 120 μM concentration of copper nanoparticles. This shows that copper nanoparticles synthesized by above method hold excellent biocompatibility. Copyright © 2012 Elsevier B.V. All rights reserved.

  7. A rapid extractive spectrophotometric determination of copper(II) in environmental samples, alloys, complexes and pharmaceutical samples using 4-[N,N(dimethyl)amino]benzaldehyde thiosemicarbazone.

    Science.gov (United States)

    Karthikeyan, J; Naik, P Parameshwara; Shetty, A Nityananda

    2011-05-01

    4-[N,N-(Dimethyl)amino]benzaldehyde thiosemicarbazone (DMABT) is proposed as an analytical reagent for the extractive spectrophotometric determination of copper(II). DMABT forms yellow colored complex with copper(II) in the pH range 4.4-5.4. Beer's law is obeyed in the concentration range up to 4.7 μg mL(-1). The optimum concentration range for minimum photometric error as determined by Ringbom plot method is 1.2-3.8 μg mL(-1). The yellowish Cu(II)-DMABT complex shows a maximum absorbance at 420 nm, with molar absorptivity of 1.72 × 10(4)dm(3) mol(-1) cm(-1) and Sandell's sensitivity of the complex obtained from Beer's data is 0.0036 μg cm(-2). The composition of the Cu(II)-DMABT complex is found to be 1:2 (M/L). The interference of various cations and anions in the method were studied. Thus the method can be employed for the determination of trace amount of copper(II) in water, alloys and other natural samples of significant importance.

  8. Development and Validation of a Lateral Flow Immunoassay for the Rapid Screening of Okadaic Acid and All Dinophysis Toxins from Shellfish Extracts.

    Science.gov (United States)

    Jawaid, Waqass; Meneely, Julie P; Campbell, Katrina; Melville, Karrie; Holmes, Stephen J; Rice, Jennifer; Elliott, Christopher T

    2015-09-30

    A single-step lateral flow immunoassay was developed and validated to detect okadaic acid (OA) and dinophysis toxins (DTXs), which cause diarrhetic shellfish poisoning. The performance characteristics of the test were investigated, in comparison to reference methods (liquid chromatography tandem mass spectrometry and/or bioassay), using both spiked and naturally contaminated shellfish. A portable reader was used to generate a qualitative result, indicating the absence or presence of OA-group toxins, at concentrations relevant to the maximum permitted level (MPL). Sample homogenates could be screened in 20 min (including extraction and assay time) for the presence of free toxins (OA, DTX1, DTX2). DTX3 detection could be included with the addition of a hydrolysis procedure. No matrix effects were observed from the species evaluated (mussels, scallops, oysters, and clams). Results from naturally contaminated samples (n = 72) indicated no false compliant results and no false noncompliant results at <50% MPL. Thus, the development of a new low-cost but highly effective tool for monitoring a range of important phycotoxins has been demonstrated.

  9. Effects of sonication on the extraction of free-amino acids from moromi and application to the laboratory scale rapid fermentation of soy sauce.

    Science.gov (United States)

    Goh, Kok Ming; Lai, Oi Ming; Abas, Faridah; Tan, Chin Ping

    2017-01-15

    Soy sauce fermentation was simulated in a laboratory and subjected to 10min of sonication. A full factorial design, including different cycles, probe size, and amplitude was used. The composition of 17 free-amino acids (FAAs) was determined by the AccQ-Tag method with fluorescent detection. Main effect plots showed total FAAs extraction was favoured under continuous sonication at 100% amplitude using a 14mm diameter transducer probe, reaching 1214.2±64.3mg/100ml of total FAAs. Moreover, after 7days of fermentation, sonication treatment caused significantly higher levels (p<0.05) of glutamic acids (343.0±22.09mg/100g), total FAAs (1720.0±70.6mg/100g), and essential FAAs (776.3±7.0mg/100g) 3days sooner than the control. Meanwhile, enzymatic and microbial behaviours remained undisturbed. Collectively, the sonication to moromi resulted in maturation 57% faster than the untreated control. Copyright © 2016 Elsevier Ltd. All rights reserved.

  10. Rapid determination of five antibiotic residues in swine wastewater by online solid-phase extraction-high performance liquid chromatography-tandem mass spectrometry.

    Science.gov (United States)

    Tagiri-Endo, Misako; Suzuki, Shigeru; Nakamura, Tomoyuki; Hatakeyama, Takashi; Kawamukai, Kazuo

    2009-02-01

    A simple and quick online solid-phase extraction (SPE) coupled to liquid chromatography (LC)/tandem mass spectrometry (MS/MS) for the determination of the five antibiotics (florfenicol, FF; lincomycin, LCM; oxytetracyclin, OTC; tylosin, TS; valnemulin, VLM) in swine wastewater has been developed. After filtration, aliquots (100 microl) of wastewater samples were directly injected to a column-switching LC system. Some matrix interference was removed by washing up SPE column with 0.2% formic acid solution and acetonitrile. Antibiotics eluted from SPE column were separated on analytical column by converting switching valve and were detected by MS/MS. Calibration curves using the method of standard addition had very good correlation coefficients (r > 0.99) in the range of 0.1 to 2 ng/ml. The intra-day precision of the method was less than 12% and the inter-day precision was between 6 to 17%. The detection limits were 0.01-0.1 ng/ml. When this method was applied to wastewater samples in swine facilities, four compounds (LCM, OTC, TS, and VLM) were detected.

  11. Mercury speciation in seafood samples by LC-ICP-MS with a rapid ultrasound-assisted extraction procedure: Application to the determination of mercury in Brazilian seafood samples.

    Science.gov (United States)

    Batista, Bruno Lemos; Rodrigues, Jairo L; de Souza, Samuel S; Oliveira Souza, Vanessa C; Barbosa, Fernando

    2011-06-15

    This paper describes a simple method for mercury speciation in seafood samples by LC-ICP-MS with a fast sample preparation procedure. Prior to analysis, mercury species were extracted from food samples with a solution containing mercaptoethanol, l-cysteine and HCl and sonication for 15min. Separation of mercury species was accomplished in less than 5min on a C8 reverse phase column with a mobile phase containing 0.05%-v/v mercaptoethanol, 0.4%m/v l-cysteine and 0.06molL(-1) ammonium acetate. The method detection limits were found to be 0.25, 0.20 and 0.1ngg(-1) for inorganic mercury, ethylmercury and methylmercury, respectively. Method accuracy is traceable to Certified Reference Materials (DOLT-3 and DORM-3) from the National Research Council Canada (NRCC). With the proposed method there is a considerable reduction of the time of sample preparation. Finally, the method was applied for the speciation of mercury in seafood samples purchased from the Brazilian market. Copyright © 2010 Elsevier Ltd. All rights reserved.

  12. Rapid and novel discrimination and quantification of oleanolic and ursolic acids in complex plant extracts using two-dimensional nuclear magnetic resonance spectroscopy-Comparison with HPLC methods

    Energy Technology Data Exchange (ETDEWEB)

    Kontogianni, Vassiliki G. [Section of Organic Chemistry and Biochemistry, Department of Chemistry, University of Ioannina, Ioannina GR-45110 (Greece); Exarchou, Vassiliki [NMR Center, University of Ioannina, Ioannina GR-45110 (Greece); Troganis, Anastassios [Department of Biological Applications and Technology, University of Ioannina, Ioannina GR-45110 (Greece); Gerothanassis, Ioannis P. [Section of Organic Chemistry and Biochemistry, Department of Chemistry, University of Ioannina, Ioannina GR-45110 (Greece)], E-mail: igeroth@cc.uoi.gr

    2009-03-09

    A novel strategy for NMR analysis of mixtures of oleanolic and ursolic acids that occur in natural products is described. These important phytochemicals have similar structure and their discrimination and quantification is rather difficult. We report herein the combined use of proton-carbon heteronuclear single-quantum coherence ({sup 1}H-{sup 13}C HSQC) and proton-carbon heteronuclear multiple-bond correlation ({sup 1}H-{sup 13}C HMBC) NMR spectroscopy, in the identification and quantitation of oleanolic acid (OA) and ursolic acid (UA)in plant extracts of the Lamiaceae and Oleaceae family. The combination of {sup 1}H-{sup 13}C HSQC and {sup 1}H-{sup 13}C HMBC techniques allows the connection of the proton and carbon-13 spins across the molecular backbone resulting in the identification and, thus, discrimination of oleanolic and ursolic acid without resorting to physicochemical separation of the components. The quantitative results provided by 2D {sup 1}H-{sup 13}C HSQC NMR data were obtained within a short period of time ({approx}14 min) and are in excellent agreement with those obtained by HPLC, which support the efficiency of the suggested methodology.

  13. A facile synthesis of novel three-dimensional magnetic imprinted polymers for rapid extraction of bovine serum albumin in bovine calf serum.

    Science.gov (United States)

    Yan, Liang; Wang, Jing; Lv, Piaopiao; Xie, Dandan; Zhang, Zhaohui

    2017-05-01

    A novel three-dimensional (3D) magnetic imprinted polymer was prepared with bovine serum albumin as the template molecule, dopamine as the functional monomer, and a graphene oxide and carbon nanotube hybrid 3D nanocomposite as the carrier. The preparation conditions for the 3D magnetic molecularly imprinted polymers were optimized. The 3D magnetic molecularly imprinted polymers were characterized in detail by scanning electron microscopy, Fourier transform infrared spectroscopy, and vibrating sample magnetometry. The 3D magnetic molecularly imprinted polymers possessed a fast adsorption rate and excellent adsorption performance toward bovine serum albumin, with a maximum adsorption capacity of 78.12 mg g-1. The extraction conditions, including the washing solvent, the pH of the eluent, and the desorption time, were also optimized. Combined with high-performance liquid chromatography, the 3D magnetic molecularly imprinted polymers were successfully applied to enrich and separate bovine serum albumin from bovine calf serum samples with recoveries of 84.0-94.5%. Graphical Abstract ᅟ.

  14. Rapid and simple method by combining FTA™ card DNA extraction with two set multiplex PCR for simultaneous detection of non-O157 Shiga toxin-producing Escherichia coli strains and virulence genes in food samples.

    Science.gov (United States)

    Kim, S A; Park, S H; Lee, S I; Ricke, S C

    2017-12-01

    The aim of this research was to optimize two multiplex polymerase chain reaction (PCR) assays that could simultaneously detect six non-O157 Shiga toxin-producing Escherichia coli (STEC) as well as the three virulence genes. We also investigated the potential of combining the FTA™ card-based DNA extraction with the multiplex PCR assays. Two multiplex PCR assays were optimized using six primer pairs for each non-O157 STEC serogroup and three primer pairs for virulence genes respectively. Each STEC strain specific primer pair only amplified 155, 238, 321, 438, 587 and 750 bp product for O26, O45, O103, O111, O121 and O145 respectively. Three virulence genes were successfully multiplexed: 375 bp for eae, 655 bp for stx1 and 477 bp for stx2. When two multiplex PCR assays were validated with ground beef samples, distinctive bands were also successfully produced. Since the two multiplex PCR examined here can be conducted under the same PCR conditions, the six non-O157 STEC and their virulence genes could be concurrently detected with one run on the thermocycler. In addition, all bands clearly appeared to be amplified by FTA card DNA extraction in the multiplex PCR assay from the ground beef sample, suggesting that an FTA card could be a viable sampling approach for rapid and simple DNA extraction to reduce time and labour and therefore may have practical use for the food industry. Two multiplex polymerase chain reaction (PCR) assays were optimized for discrimination of six non-O157 Shiga toxin-producing Escherichia coli (STEC) and identification of their major virulence genes within a single reaction, simultaneously. This study also determined the successful ability of the FTA™ card as an alternative to commercial DNA extraction method for conducting multiplex STEC PCR assays. The FTA™ card combined with multiplex PCR holds promise for the food industry by offering a simple and rapid DNA sample method for reducing time, cost and labour for detection of STEC in

  15. Prebiotic Synthesis of Glycine from Ethanolamine in Simulated Archean Alkaline Hydrothermal Vents

    Science.gov (United States)

    Zhang, Xianlong; Tian, Ge; Gao, Jing; Han, Mei; Su, Rui; Wang, Yanxiang; Feng, Shouhua

    2017-12-01

    Submarine hydrothermal vents are generally considered as the likely habitats for the origin and evolution of early life on Earth. In recent years, a novel hydrothermal system in Archean subseafloor has been proposed. In this model, highly alkaline and high temperature hydrothermal fluids were generated in basalt-hosted hydrothermal vents, where H2 and CO2 could be abundantly provided. These extreme conditions could have played an irreplaceable role in the early evolution of life. Nevertheless, sufficient information has not yet been obtained for the abiotic synthesis of amino acids, which are indispensable components of life, at high temperature and alkaline condition. This study aims to propose a new method for the synthesis of glycine in simulated Archean submarine alkaline vent systems. We investigated the formation of glycine from ethanolamine under conditions of high temperature (80-160 °C) and highly alkaline solutions (pH = 9.70). Experiments were performed in an anaerobic environment under mild pressure (0.1-8.0 MPa) at the same time. The results suggested that the formation of glycine from ethanolamine occurred rapidly and efficiently in the presence of metal powders, and was favored by high temperatures and high pressures. The experiment provides a new pathway for prebiotic glycine formation and points out the phenomenal influence of high-temperature alkaline hydrothermal vents in origin of life in the early ocean.

  16. An extremophile Microbacterium strain and its protease production under alkaline conditions.

    Science.gov (United States)

    Lü, Jin; Wu, Xiaodan; Jiang, Yali; Cai, Xiaofeng; Huang, Luyao; Yang, Yongbo; Wang, Huili; Zeng, Aibing; Li, Aiying

    2014-05-01

    Extremophiles are potential resources for alkaline protease production. In order to search for alkaline protease producers, we isolated and screened alkaliphilic microorganisms from alkaline saline environments. The microorganism HSL10 was identified as a member of the genus Microbacterium by morphological observation, Gram staining and sequence analysis of the 16S rRNA gene and the 16S-23S rRNA intergenic spacer region. By colony-forming unit counting under alkali or salt stress, it was further identified as an alkaliphilic microbe with mild halotolerance. In addition, it was capable of secreting alkaline proteases, evidenced by larger hydrolyzation zones in the skim milk-containing medium at pH 9.0 than at pH 7.0. Subsequently, we demonstrated that both NaCl and yeast extract significantly promoted protease production by HSL10. Finally, we established a sensitive colorimetric method for the detection of protease production by HSL10 under neutral and alkaline conditions, by using the Bradford reagent for substrate staining to improve the contrast between the hydrolyzation zone and the substrate background on agar plates. HSL10 was the first example of an alkaliphilic protease-producing member in Microbacterium, and its isolation and characterization have both academic and commercial importance. © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  17. Assessing ocean alkalinity for carbon sequestration

    Science.gov (United States)

    Renforth, Phil; Henderson, Gideon

    2017-09-01

    Over the coming century humanity may need to find reservoirs to store several trillions of tons of carbon dioxide (CO2) emitted from fossil fuel combustion, which would otherwise cause dangerous climate change if it were left in the atmosphere. Carbon storage in the ocean as bicarbonate ions (by increasing ocean alkalinity) has received very little attention. Yet recent work suggests sufficient capacity to sequester copious quantities of CO2. It may be possible to sequester hundreds of billions to trillions of tons of C without surpassing postindustrial average carbonate saturation states in the surface ocean. When globally distributed, the impact of elevated alkalinity is potentially small and may help ameliorate the effects of ocean acidification. However, the local impact around addition sites may be more acute but is specific to the mineral and technology. The alkalinity of the ocean increases naturally because of rock weathering in which >1.5 mol of carbon are removed from the atmosphere for every mole of magnesium or calcium dissolved from silicate minerals (e.g., wollastonite, olivine, and anorthite) and 0.5 mol for carbonate minerals (e.g., calcite and dolomite). These processes are responsible for naturally sequestering 0.5 billion tons of CO2 per year. Alkalinity is reduced in the ocean through carbonate mineral precipitation, which is almost exclusively formed from biological activity. Most of the previous work on the biological response to changes in carbonate chemistry have focused on acidifying conditions. More research is required to understand carbonate precipitation at elevated alkalinity to constrain the longevity of carbon storage. A range of technologies have been proposed to increase ocean alkalinity (accelerated weathering of limestone, enhanced weathering, electrochemical promoted weathering, and ocean liming), the cost of which may be comparable to alternative carbon sequestration proposals (e.g., $20-100 tCO2-1). There are still many

  18. [Alkaline phosphatase activity and properties in the organs of swine].

    Science.gov (United States)

    Antonov, S

    1980-01-01

    The activity and the physico-chemical properties of alkaline phosphatase in the liver, lung, spleen, kidney, intestine, bone and placenta of a total of 24 clinically healthy swine was investigated. Liver, spleen, kidney, lung, bone and placental alkaline phosphatase proved to be thermostable, not sensitive to 1-phenylalanine, but sensitive to 1-arginine, 1-homoarginine and imidazol. Intestinal alkaline phosphatase is thermostable, sensitive to 1-phenylalanine, 1-arginine, 1-homoarginine and imidazol resistant. Urea inhibits more bone alkaline phosphatase and less alkaline phosphatase of the remaining organs. Following electrophoresis on agarose gel alkaline phosphatase of swine liver and kidney is divided into two fractions, while alkaline phosphatase of the remaining organs has only one fraction. Liver alkaline phosphatase is fastest, while kidney alkaline phosphatase is the slowest.

  19. Mid-infrared and near-infrared spectroscopy for rapid detection of Gardeniae Fructus by a liquid-liquid extraction process.

    Science.gov (United States)

    Tao, Lingyan; Lin, Zhonglin; Chen, Jiashan; Wu, Yongjiang; Liu, Xuesong

    2017-10-25

    Gardeniae Fructus is widely used in the pharmaceutical industry, and many studies have confirmed its medical and economic value. In this study, samples collected from different liquid-liquid extraction batches of Gardeniae Fructus were detected by mid-infrared (MIR) and near-infrared (NIR) spectroscopy. Seven analytes, neochlorogenic acid (5-CQA), cryptochlorogenic acid (4-CQA), chlorogenic acid (3-CQA), geniposidic acid (GEA), deacetyl-asperulosidic acid methyl ester (DAAME), genipin-gentiobioside (GGB), and gardenoside (GA), were chosen as quality property indexes of Gardeniae Fructus. The two kinds of spectra were each used to build models by single partial least squares (PLS). Additionally, both spectral data were combined and modeled by multiblock PLS. For single spectroscopy modeling results, NIR had a better prediction for high-concentration analytes (3-CQA, DAAME, GGB, and GA) whereas MIR performed better for low-concentration analytes (5-CQA, 4-CQA, and GEA). The multiblock methodology was found to be better compared to single spectroscopy models for all seven analytes. Specifically, the coefficients of determination (R2) of the NIR, MIR, and multiblock PLS calibration models of all seven components were higher than 0.95. Relative standard errors of prediction (RSEP) were all less than 7%, except for models of GGB, which were 10.36%, 13.24%, and 8.15% for the NIR-PLS, MIR-PLS, and multiblock models, respectively. These results indicate that MIR and NIR spectrographic techniques could provide a new choice for quality control in industrial production of Gardeniae Fructus. Copyright © 2017 Elsevier B.V. All rights reserved.

  20. Alkaline earth filled nickel skutterudite antimonide thermoelectrics

    Science.gov (United States)

    Singh, David Joseph

    2013-07-16

    A thermoelectric material including a body centered cubic filled skutterudite having the formula A.sub.xFe.sub.yNi.sub.zSb.sub.12, where A is an alkaline earth element, x is no more than approximately 1.0, and the sum of y and z is approximately equal to 4.0. The alkaline earth element includes guest atoms selected from the group consisting of Be, Mb, Ca, Sr, Ba, Ra and combinations thereof. The filled skutterudite is shown to have properties suitable for a wide variety of thermoelectric applications.

  1. Fission product solvent extraction

    Energy Technology Data Exchange (ETDEWEB)

    Moyer, B.A.; Bonnesen, P.V.; Sachleben, R.A. [and others

    1998-02-01

    Two main objectives concerning removal of fission products from high-level tank wastes will be accomplished in this project. The first objective entails the development of an acid-side Cs solvent-extraction (SX) process applicable to remediation of the sodium-bearing waste (SBW) and dissolved calcine waste (DCW) at INEEL. The second objective is to develop alkaline-side SX processes for the combined removal of Tc, Cs, and possibly Sr and for individual separation of Tc (alone or together with Sr) and Cs. These alkaline-side processes apply to tank wastes stored at Hanford, Savannah River, and Oak Ridge. This work exploits the useful properties of crown ethers and calixarenes and has shown that such compounds may be economically adapted to practical processing conditions. Potential benefits for both acid- and alkaline-side processing include order-of-magnitude concentration factors, high rejection of bulk sodium and potassium salts, and stripping with dilute (typically 10 mM) nitric acid. These benefits minimize the subsequent burden on the very expensive vitrification and storage of the high-activity waste. In the case of the SRTALK process for Tc extraction as pertechnetate anion from alkaline waste, such benefits have now been proven at the scale of a 12-stage flowsheet tested in 2-cm centrifugal contactors with a Hanford supernatant waste simulant. SRTALK employs a crown ether in a TBP-modified aliphatic kerosene diluent, is economically competitive with other applicable separation processes being considered, and has been successfully tested in batch extraction of actual Hanford double-shell slurry feed (DSSF).

  2. Rapid ultra-trace analysis of sucralose in multiple-origin aqueous samples by online solid-phase extraction coupled to high-resolution mass spectrometry.

    Science.gov (United States)

    Batchu, Sudha Rani; Ramirez, Cesar E; Gardinali, Piero R

    2015-05-01

    Because of its widespread consumption and its persistence during wastewater treatment, the artificial sweetener sucralose has gained considerable interest as a proxy to detect wastewater intrusion into usable water resources. The molecular resilience of this compound dictates that coastal and oceanic waters are the final recipient of this compound with unknown effects on ecosystems. Furthermore, no suitable methodologies have been reported for routine, ultra-trace detection of sucralose in seawater as the sensitivity of traditional liquid chromatography-tandem mass spectrometry (LC-MS/MS) analysis is limited by a low yield of product ions upon collision-induced dissociation (CID). In this work, we report the development and field test of an alternative analysis tool for sucralose in environmental waters, with enough sensitivity for the proper quantitation and confirmation of this analyte in seawater. The methodology is based on automated online solid-phase extraction (SPE) and high-resolving-power orbitrap MS detection. Operating in full scan (no CID), detection of the unique isotopic pattern (100:96:31 for [M-H](-), [M-H+2](-), and [M-H+4](-), respectively) was used for ultra-trace quantitation and analyte identification. The method offers fast analysis (14 min per run) and low sample consumption (10 mL per sample) with method detection and confirmation limits (MDLs and MCLs) of 1.4 and 5.7 ng/L in seawater, respectively. The methodology involves low operating costs due to virtually no sample preparation steps or consumables. As an application example, samples were collected from 17 oceanic and estuarine sites in Broward County, FL, with varying salinity (6-40 PSU). Samples included the ocean outfall of the Southern Regional Wastewater Treatment Plant (WWTP) that serves Hollywood, FL. Sucralose was detected above MCL in 78% of the samples at concentrations ranging from 8 to 148 ng/L, with the exception of the WWTP ocean outfall (at pipe end, 28 m below the surface

  3. Ultra-high performance liquid chromatography with linear ion trap-Orbitrap hybrid mass spectrometry combined with a systematic strategy based on fragment ions for the rapid separation and characterization of components in Stellera chamaejasme extracts.

    Science.gov (United States)

    Wang, Zhixin; Qu, Yang; Wang, Li; Zhang, Xiaozhe; Xiao, Hongbin

    2016-04-01

    Stellera chamaejasme, a famous toxic herb, has been used in traditional Chinese medicine to treat various diseases. For decades, increasing attention in modern pharmacological studies has been drawn to S. chamaejasme because of its potential anti-tumor, anti-virus, and anti-fungus activities. However, due to the intrinsic complexity of chemical constitutes, hardly any investigations formed an overall recognition for the chemical profiles of this herb. In this study, a rapid and sensitive ultra-high performance liquid chromatography coupled with linear ion trap-Orbitrap mass spectrometry method was developed to characterize the chemical components of S. chamaejasme extracts. Based on optimized ultra-high performance liquid chromatography and mass spectrometry conditions and systematic fragment ions-based strategy, a total of 47 components including flavones, diterpenes, coumarins, and lignans were simultaneously detected and identified or tentatively identified for the first time. The MS(n) fragmentation patterns of all the characterized compounds in positive or negative electrospray ionization modes were also explored and summarized. These results provided essential data for further pharmacological research on S. chamaejasme. Moreover, the method was demonstrated to be an efficient tool for rapid qualitative analysis of secondary metabolites from natural resources. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  4. Automated extraction of lysergic acid diethylamide (LSD) and N-demethyl-LSD from blood, serum, plasma, and urine samples using the Zymark RapidTrace with LC/MS/MS confirmation.

    Science.gov (United States)

    de Kanel, J; Vickery, W E; Waldner, B; Monahan, R M; Diamond, F X

    1998-05-01

    A forensic procedure for the quantitative confirmation of lysergic acid diethylamide (LSD) and the qualitative confirmation of its metabolite, N-demethyl-LSD, in blood, serum, plasma, and urine samples is presented. The Zymark RapidTrace was used to perform fully automated solid-phase extractions of all specimen types. After extract evaporation, confirmations were performed using liquid chromatography (LC) followed by positive electrospray ionization (ESI+) mass spectrometry/mass spectrometry (MS/MS) without derivatization. Quantitation of LSD was accomplished using LSD-d3 as an internal standard. The limit of quantitation (LOQ) for LSD was 0.05 ng/mL. The limit of detection (LOD) for both LSD and N-demethyl-LSD was 0.025 ng/mL. The recovery of LSD was greater than 95% at levels of 0.1 ng/mL and 2.0 ng/mL. For LSD at 1.0 ng/mL, the within-run and between-run (different day) relative standard deviation (RSD) was 2.2% and 4.4%, respectively.

  5. Rapid analysis of pesticide residues in drinking water samples by dispersive solid-phase extraction based on multiwalled carbon nanotubes and pulse glow discharge ion source ion mobility spectrometry.

    Science.gov (United States)

    Zou, Nan; Gu, Kejia; Liu, Shaowen; Hou, Yanbing; Zhang, Jialei; Xu, Xiang; Li, Xuesheng; Pan, Canping

    2016-03-01

    An analytical method based on dispersive solid-phase extraction with a multiwalled carbon nanotubes sorbent coupled with positive pulse glow discharge ion mobility spectrometry was developed for analysis of 30 pesticide residues in drinking water samples. Reduced ion mobilities and the mass-mobility correlation of 30 pesticides were measured. The pesticides were divided into five groups to verify the separation capability of pulse glow discharge in mobility spectrometry. The extraction conditions such as desorption solvent, ionic strength, conditions of adsorption and desorption, the amounts of multiwalled carbon nanotubes, and solution pH were optimized. The enrichment factors of pesticides were 5.4- to 48.7-fold (theoretical enrichment factor was 50-fold). The detection limits of pesticides were 0.01∼0.77 μg/kg. The linear range was 0.005-0.2 mg/L for pesticide standard solutions, with determination coefficients from 0.9616 to 0.9999. The method was applied for the analysis of practical and spiked drinking water samples. All results were confirmed by high-performance liquid chromatography with tandem mass spectrometry. The proposed method was proven to be a commendably rapid screening qualitative and semiquantitative technique for the analysis of pesticide residues in drinking water samples on site. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  6. Preconcentration and sensitive determination of hexabromocyclododecane diastereomers in environmental water samples using solid phase extraction with bamboo charcoal cartridge prior to rapid resolution liquid chromatography-electrospray tandem mass spectrometry.

    Science.gov (United States)

    Zhao, Ru-Song; Hu, Cong; Zhou, Jia-Bin; Yuan, Jin-Peng; Wang, Shan-Shan; Wang, Xia

    2011-05-01

    In this paper, a simple and cheap method for the simultaneous preconcentration and sensitive determination of three hexabromocyclododecane (HBCD) diastereomers (α-, β-, and γ-HBCD) in environmental water samples has been developed. It was based on solid phase extraction (SPE) and rapid resolution liquid chromatography-electrospray tandem mass spectrometry. Bamboo charcoal, one kind of cheap material, was investigated and used as SPE adsorbent for the enrichment and determination of HBCD diastereomers. Related important parameters affecting extraction efficiencies, including type and volume of eluant, amount of sorbent, sample pH, flow rate, and sample volume, were investigated and optimized in detail. Under the optimum conditions, experimental data exhibited excellent linear relationships between peak area and concentrations over the range 0.1-10 μg L(-1). The limits of detection and precision were in the range of 0.005-0.015 μg L(-1) and 4.59-7.47%, respectively. The proposed method has been successfully applied for the trace analysis of HBCD diastereomers in real-world environmental water samples.

  7. A rapid profiling of gallotannins and flavonoids of the aqueous extract of Rhus coriaria L. by flow injection analysis with high-resolution mass spectrometry assisted with database searching.

    Science.gov (United States)

    Regazzoni, Luca; Arlandini, Emanuele; Garzon, Davide; Santagati, Natale Alfredo; Beretta, Giangiacomo; Maffei Facino, Roberto

    2013-01-01

    Hydrolysable tannins appear to have some extremely important biological roles including antioxidant, antibacterial, anti-inflammatory, anti-hypoglycemic, anti-angiogenic, and anticancer activities. The aim of this work was to set up a flow injection high-resolution mass spectrometric approach combined with database searching to obtain rapidly a profiling of gallotannins and other phenolics in a crude extract from plant tissue. The flow injection analysis (FIA) takes place in an electrospray ionization source of an hybrid orbitrap high resolution mass spectrometry system (ESI-HR-MS/MS(2), resolution 100,000, negative ion mode) and polyphenols are tentatively identified by matching the monoisotopic masses of the spectra with those of polyphenols databases. This leads to the most probable molecular formulas and to the possible structures among those reported in the database. The structures confirmation occurs by the compliance of MS(2) fragments with those of a prediction fragment commercial database. With this method we identified in the aqueous extract of sumac leaves, with a maximum error of 1.7 ppm, a group of ten gallotannins from mono- to deca-galloyl glycosides of the class of hydrolysable tannins and a set of coextracted flavonoid derivatives including myricetin, quercetin-3-O-rhamnoside, myricetin-3-O-glucoside, myricetin-3-O-glucuronide, and myricetin-3-O-rhamnoglucoside. The separation of isomers of gallotannins and flavonoids present in the same extract occurred by high-performance liquid chromatography with electrospray ionization tandem mass spectrometry (HPLC/ESI-HR-MS(2)); this approach allowed the structure resolution of the isobaric flavonoids quercetin-3-O-glucoside and myricetin-3-O-rhamnoside. Copyright © 2012 Elsevier B.V. All rights reserved.

  8. Alkaline Activator Impact on the Geopolymer Binders

    Science.gov (United States)

    Błaszczyński, Tomasz Z.; Król, Maciej R.

    2017-10-01

    Concrete structures are constantly moving in the direction of improving the durability. Durability depends on many factors, which are the composition of concrete mix, the usage of additives and admixtures and the place, where material will work and carry the load. The introduction of new geopolymer binders for geopolymer structures adds a new aspect that is type of used activator. This substance with strongly alkaline reaction is divided because of the physical state, the alkaline degree and above all the chemical composition. Taking into account, that at present the geopolymer binders are made essentially from waste materials or by-products from the combustion of coal or iron ore smelting, unambiguous determination of the effect of the activator on the properties of the geopolymer material requires a number of trials, researches and observation. This paper shows the influence of the most alkaline activators on the basic parameters of the durability of geopolymer binders. In this study there were used highly alkaline hydroxides, water glasses and granules, which are waste materials in a variety of processes taking place in chemical plants. As the substrate of geopolymer binders there were used fly ash which came from coal and high calcareous ash from the burning of lignite.

  9. RES Hydrogen: efficient pressurised alkaline electrolysers

    DEFF Research Database (Denmark)

    Bowen, Jacob R.; Bentzen, Janet Jonna; Jørgensen, Peter Stanley

    The RESelyser project addresses issues associated with coupling alkaline electrolysis to renewable energy sources such as electrode stability and gas purity by implementing improved electrodes and a new separator membrane concept. The project aims to improve performance, operation pressure and re...

  10. Activities of alkaline phosphatase, glutamate oxaloacetate ...

    African Journals Online (AJOL)

    Alkaline phosphatase, glutamate oxaloacetate transaminase and glutamate pyruvate transaminase activities were assessed in rats highly infected with federe strain of Trypanosoma brucei and treated with honey. Therapeutic effect of honey on parasitaemia was also assessed. Results show an extension in the life span of ...

  11. Qualitative Carbohydrate Analysis using Alkaline Potassium ...

    Indian Academy of Sciences (India)

    IAS Admin

    Carbohydrates form a distinct class of organic compounds often identified by their characteristic behaviour towards a host of reagents [1–4]. Based on a kinetic study on the oxidation of carbohydrates with alkaline potassium ferricyanide [5], we had reported, in the April 2007 issue of Resonance, an unambiguous.

  12. Optimization of alkaline protease production from Pseudomonas ...

    African Journals Online (AJOL)

    PRECIOUS

    2009-12-15

    Dec 15, 2009 ... A protease producing bacteria was isolated from meat waste contaminated soil and identified as. Pseudomonas ... Key words: Alkaline protease, casein agar, meat waste contaminated soil, Pseudomonas fluorescens. INTRODUCTION ... advent of new frontiers in biotechnology, the spectrum of protease ...

  13. Persistently increased intestinal fraction of alkaline phosphatase

    DEFF Research Database (Denmark)

    Nathan, E; Baatrup, G; Berg, H

    1984-01-01

    Persistent elevation of the intestinal fraction of the alkaline phosphatase (API) as an isolated finding has to our knowledge not been reported previously. It was found in a boy followed during a period of 5.5 years. The only symptom was transient periodic fatigue observed at home, but not apparent...

  14. A constructed alkaline consortium and its dynamics in treating alkaline black liquor with very high pollution load.

    Directory of Open Access Journals (Sweden)

    Chunyu Yang

    Full Text Available Paper pulp wastewater resulting from alkaline extraction of wheat straw, known as black liquor, is very difficult to be treated and causes serious environmental problems due to its high pH value and chemical oxygen demand (COD pollution load. Lignin, semicellulose and cellulose are the main contributors to the high COD values in black liquor. Very few microorganisms can survive in such harsh environments of the alkaline wheat straw black liquor. A naturally developed microbial community was found accidentally in a black liquor storing pool in a paper pulp mill of China. The community was effective in pH decreasing, color and COD removing from the high alkaline and high COD black liquor.Thirty-eight strains of bacteria were isolated from the black liquor storing pool, and were grouped as eleven operational taxonomy units (OTUs using random amplified polymorphic DNA-PCR profiles (RAPD. Eleven representative strains of each OTU, which were identified as genera of Halomonas and Bacillus, were used to construct a consortium to treat black liquor with a high pH value of 11.0 and very high COD pollution load of 142,600 mg l(-1. After treatment by the constructed consortium, about 35.4% of color and 39,000 mg l(-1 (27.3% COD(cr were removed and the pH decreased to 7.8. 16S rRNA gene polymerase chain reaction denaturant gradient gel electrophoresis (PCR-DGGE and gas chromatography/mass spectrometry (GC/MS analysis suggested a two-stage treatment mechanism to elucidate the interspecies collaboration: Halomonas isolates were important in the first stage to produce organic acids that contributed to the pH decline, while Bacillus isolates were involved in the degradation of lignin derivatives in the second stage under lower pH conditions.Tolerance to the high alkaline environment and good controllability of the simple consortium suggested that the constructed consortium has good potential for black liquor treatment. Facilitating the treatment process by the

  15. Rapid sample processing for intracellular metabolite studies in Penicillium ochrochloron CBS 123.824: the FiltRes-device combines cold filtration of methanol quenched biomass with resuspension in extraction solution.

    Science.gov (United States)

    Vrabl, Pamela; Artmann, Desiree J; Schinagl, Christoph W; Burgstaller, Wolfgang

    2016-01-01

    Many issues concerning sample processing for intracellular metabolite studies in filamentous fungi still need to be solved, e.g. how to reduce the contact time of the biomass to the quenching solution in order to minimize metabolite leakage. Since the required time to separate the biomass from the quenching solution determines the contact time, speeding up this step is thus of utmost interest. Recently, separation approaches based on cold-filtration were introduced as promising alternative to cold-centrifugation, which exhibit considerably reduced contact times. In previous works we were unable to obtain a compact pellet from cold methanol quenched samples of the filamentous fungus Penicillium ochrochloron CBS 123.824 via centrifugation. Therefore our aim was to establish for this organism a separation technique based on cold-filtration to determine intracellular levels of a selected set of nucleotides. We developed a cold-filtration based technique as part of our effort to revise the entire sample processing method and analytical procedure. The Filtration-Resuspension (FiltRes) device combined in a single apparatus (1) a rapid cold-filtration and (2) a rapid resuspension of the biomass in hot extraction solution. Unique to this is the injection of the extraction solution from below the membrane filter (FiltRes-principle). This caused the mycelial cake to detach completely from the filter membrane and to float upwards so that the biomass could easily be transferred into preheated tubes for metabolite extraction. The total contact time of glucose-limited chemostat mycelium to the quenching solution could be reduced to 15.7 ± 2.5 s, whereby each washing step added another 10-15 s. We evaluated critical steps like filtration time, temperature profile, reproducibility of results, and using the energy charge (EC) as a criterion, effectiveness of enzyme destruction during the transition in sample temperature from cold to hot. As control we used total broth samples

  16. Osteocalcin and bone-specific alkaline phosphatase in Sickle cell ...

    African Journals Online (AJOL)

    specific alkaline phosphatase (b-AP) total protein levels were evaluated as indicators of bone turnover in twenty patients with sickle cell haemoglobinopathies and in twenty normal healthy individuals. The serum bonespecific alkaline phosphatase ...

  17. Improved electrodes and gas impurity investigations on alkaline electrolysers

    DEFF Research Database (Denmark)

    Reissner, R.; Schiller, G.; Knoeri, T.

    Alkaline water electrolysis for hydrogenproduction is a well-established techniquebut some technological issues regarding thecoupling of alkaline water electrolysis andRenewable Energy Sources (RES) remain tobe improved....

  18. Comparison Of Six Extractants For Assessing Available Phosphorus ...

    African Journals Online (AJOL)

    particularly zinc (Zn) and manganese (Mn)] are becoming increasingly significant for sustainable crop production in many countries of the world (including Nigeria) with highly weathered acid or calcareous alkaline soils. The nutrient extraction methods ...

  19. In Vitro Determination of Bicarbonate Dosage to Alkalinize Local Anesthetics to Physiologic pH

    Science.gov (United States)

    1997-05-01

    extradural caesarean section . British Journal of Anesthesia 67,699-703. Galindo, A. (1983). pH Adjusted local anesthetics: clinical experience. Regional...converse is true for sodium. At rest, the membrane’s semipermeable nature to potassium only, allows for a slow, continual intracellular to extracellular... naturally has a rapid onset and the benefits of alkalinization may not be clinically apparent. Bupivacaine in all concentrations studied, both with and

  20. Levels of antioxidant enzymes and alkaline protease from pulp and peel of sunflower

    OpenAIRE

    Wesen Adel Mehdi; Faridah Yusof; Layla O. Farhan; Atheer Awad Mehde; Raha Ahmed Raus

    2017-01-01

    Objective: The activity of enzymes participating in the systems of antioxidant protection was assayed in the peel and pulp of sunflower. The essential roles of proteases in food stimulate research to find other sources of the enzyme especially from non-conventional sources. In the present work, we study several biochemical parameters in the pulp and peel of sunflower. Methods: Pulp and peel of sunflower was extracted, antioxidant enzymes and non-enzymatic antioxidant were measured. Alkalin...

  1. A three step approach for the purification of alkaline phosphatase from non-pasteurized milk

    OpenAIRE

    Upadhyay, Lata Sheo Bachan; Verma, Nishant

    2014-01-01

    In this study, a three step purification of alkaline phosphatase from non-pasteurized milk has been described. It included cream extraction, n-butanol treatment and acetone precipitation. Different parameters such as buffer concentration, temperature, pH, substrate concentration, acetone and n-butanol treatment were optimized to maximize the enzyme activity. The enzyme was fruitfully purified up to homogeneity from the milk, with percentage recovery and fold purification of 56.17 and 17.67 re...

  2. Distinct alkaline phosphatase in serum of patients with lymphatic leukemia and infectious mononucleosis

    Energy Technology Data Exchange (ETDEWEB)

    Neumann, H.; Moran, E.M.; Russell, R.M.; Rosenberg, I.H.

    1974-10-11

    A distinct alkaline phosphatase (phosphatase N) was demonstrated in the serum of patients with acute lymphatic leukemia, chronic lymphatic leukemia, and infectious mononucleosis. This enzyme closely resembles that extracted from the thymus of mice with lymphoma or lymphatic leukemia, both in its electrophoretic mobility and its substrate specificity. The phosphatase N activity was related to the clinical state of patients with lymphatic leukemia and disappeared with recovery from infectious mononucleosis.

  3. Tubulin polymerization by paclitaxel (taxol) phosphate prodrugs after metabolic activation with alkaline phosphatase.

    Science.gov (United States)

    Mamber, S W; Mikkilineni, A B; Pack, E J; Rosser, M P; Wong, H; Ueda, Y; Forenza, S

    1995-08-01

    Paclitaxel (taxol) phosphate derivatives BMY46366, BMY-46489, BMS180661 and BMS180820 were used to determine the ability of alkaline phosphatase to convert these water-soluble potential prodrugs to tubulin-polymerizing metabolites (i.e., paclitaxel). Compounds were treated up to 180 min with an in vitro metabolic activation system composed of 10% bovine alkaline phosphatase in 0.2 M tris, pH 7.4, or in 0.2 M glycine, pH 8.8, plus 0.05 M MgCl2. Samples were tested (either by direct addition or after methylene chloride extraction/dimethyl-sulfoxide resuspension) in spectrophotometric tubulin polymerization assays utilizing bovine-derived microtubule protein. Pretreatment of 2'- and 7-phosphonoxyphenylpropionate prodrugs BMS180661 and BMS180820 with alkaline phosphatase for 30 to 120 min yielded relative initial slopes of about 20 to 100% at test concentrations equimolar to paclitaxel. High-performance liquid chromatography/mass spectrometry of BMS180661 treated with alkaline phosphatase confirmed the production of paclitaxel from the prodrug. In contrast, 2'- and 7-phosphate analogs BMY46366 and BMY46489 treated with alkaline phosphatase were not active in tubulin assays. None of the paclitaxel phosphate prodrugs polymerized tubulin in the absence of metabolic activation. The differences in tubulin polymerization with metabolic activation may be related both to accessibility of the phosphate group to the enzyme and to anionic charge effects. These results demonstrate that certain paclitaxel phosphate prodrugs can be metabolized by alkaline phosphatase to yield effective tubulin polymerization.

  4. The sulphate-reduction alkalinity pump tested

    Science.gov (United States)

    Meister, Patrick; Petrishcheva, Elena

    2016-04-01

    Carbonate precipitation has been suggested to be induced by alkalinity increase during sulphate reduction under anoxic conditions. This mechanism may explain the formation of carbonate deposits in shallow marine environments, either within a redox stratified sediment inhabited by phototrophic microbial mats or in shallow water within the photic zone where sulphidic water is upwelling onto the shelf. The alkalinity pump may work as long as the sulphide is not reoxidized to sulphate, a process that would acidify the surrounding. The alkalinity effect of sulphate reduction was recently tested by Aloisi (2008) for microbial mats using a model approach. He found that sulphate reduction does not significantly increase or even decrease carbonate saturation and is unlikely to have played a significant role through Earth history. The model considers many environmental factors, including the effect of carbonate precipitation itself on the carbonate equilbrium and on the alkalinity. We used a modified version of Aloisi's (2008) model to simulate the saturation states of aragonite, calcite and dolomite without the effects of carbonate precipitation. This is necessary to evaluate the effect of microbial metabolisms exclusively on carbonate saturation, since carbonate precipitation is only the consequence, but not the cause of oversaturation. First results show that the saturation state is increased in the zone of phototrophic CO2 uptake. In contrast, the saturation state is strongly decreased in the zone where dissolved oxygen overlaps with dissolved sulphide. Aerobic sulphide oxidation consumes most of the HS- and dissipates most of the alkalinity produced in the sulphate reduction zone below. Hence, our results are consistent with the findings of Aloisi (2008), and they even more clearly show that sulphate reduction does not induce carbonate precipitation nor contributes to carbonate precipitation in combination with phototrophic CO2 uptake. The alkalinity effect of sulphate

  5. Utilization of phosphorus loaded alkaline residue to immobilize lead in a shooting range soil.

    Science.gov (United States)

    Yan, Yubo; Qi, Fangjie; Seshadri, Balaji; Xu, Yilu; Hou, Jiexi; Ok, Yong Sik; Dong, Xiaoli; Li, Qiao; Sun, Xiuyun; Wang, Lianjun; Bolan, Nanthi

    2016-11-01

    The alkaline residue generated from the production of soda ash using the ammonia-soda method has been successfully used in removing phosphorus (P) from aqueous solution. But the accumulation of P-containing solid after P removal is an undesirable menace to the environment. To achieve the goal of recycling, this study explored the feasibility of reusing the P loaded alkaline residue as an amendment for immobilization of lead (Pb) in a shooting range soil. The main crystalline phase and micromorphology of amendments were determined using X-ray diffraction (XRD) and scanning electron microscopy-electron dispersion spectroscopy (SEM-EDS) methods. The toxicity characteristic leaching procedure (TCLP), sequential extraction procedure, and physiologically based extraction test (PBET) were employed to evaluate the effectiveness of Pb immobilization in soil after 45 d incubation. Treatment with P loaded alkaline residue was significantly effective in reducing the TCLP and PBET extractable Pb concentrations in contrast to the untreated soil. Moreover, a positive change in the distribution of Pb fractions was observed in the treated soil, i.e., more than 60% of soil-Pb was transformed to the residual fraction compared to the original soil. On the other hand, P loaded amendments also resulted in a drastic reduction in phytoavailable Pb to the winter wheat and a mild release of P as a nutrient in treated soil, which also confirmed the improvement of soil quality. Copyright © 2016 Elsevier Ltd. All rights reserved.

  6. Fresh water leaching of alkaline bauxite residue after sea water neutralization.

    Science.gov (United States)

    Menzies, Neal W; Fulton, Ian M; Kopittke, Rosemary A; Kopittke, Peter M

    2009-01-01

    Processing of bauxite to extract alumina produces a strongly alkaline waste, bauxite refining residue, which is commonly stored in engineered structures. Once full, these waste dumps must be revegetated. In many alumina refineries, the waste is separated into fine-textured red mud and coarse-textured residue sand (RS). The sand component has physical characteristics that make it a suitable plant growth medium, provided the adverse chemical characteristics can be addressed. Neutralization of the highly saline-sodic RS with sea water lowers pH, reduces Na saturation, and adds plant nutrients. However, sea water-neutralized RS remains saline sodic and needs fresh water leaching before use as a plant growth medium. Columns containing sea water-neutralized RS were leached with 30 m depth-equivalent of fresh water to evaluate the effects of rainfall on the RS and its leachate. Entrained cations were rapidly displaced by the fresh water, lowering salinity to non-plant-limiting levels (< or =0.3 dS m(-1)). The percentage of the effective cation exchange capacity (ECEC) saturated by Na decreased from 71 to 62% due to a reduction in soil solution ionic strength (causing a decrease in the ECEC) and the preferential displacement of Na(+) (and K(+)) from the exchange. Fresh water leaching increased pH (leachate pH increased from 8.0 to 10.1). This pH increase is attributed to the slow dissolution of the Na-containing mineral sodalite. Under the current experimental conditions, the application of 30 m depth-equivalent of leaching reduced the total RS sodalite content by <10%.

  7. Hydrolysis of alkaline pretreated banana peel

    Science.gov (United States)

    Fatmawati, A.; Gunawan, K. Y.; Hadiwijaya, F. A.

    2017-11-01

    Banana peel is one of food wastes that are rich in carbohydrate. This shows its potential as fermentation substrate including bio-ethanol. This paper presented banana peel alkaline pretreatment and enzymatic hydrolysis. The pretreatment was intended to prepare banana peel in order to increase hydrolysis performance. The alkaline pretreatment used 10, 20, and 30% w/v NaOH solution and was done at 60, 70 and 80°C for 1 hour. The hydrolysis reaction was conducted using two commercial cellulose enzymes. The reaction time was varied for 3, 5, and 7 days. The best condition for pretreatment process was one conducted using 30% NaOH solution and at 80°C. This condition resulted in cellulose content of 90.27% and acid insoluble lignin content of 2.88%. Seven-day hydrolysis time had exhibited the highest reducing sugar concentration, which was7.2869 g/L.

  8. A rapid solid-phase extraction method for measurement of non-metabolised peripheral benzodiazepine receptor ligands, [{sup 18}F]PBR102 and [{sup 18}F]PBR111, in rat and primate plasma

    Energy Technology Data Exchange (ETDEWEB)

    Katsifis, Andrew, E-mail: andrew.katsifis@ansto.gov.a [ANSTO LifeSciences, Sydney, 2234 (Australia); Loc' h, Christian [ANSTO LifeSciences, Sydney, 2234 (Australia); Henderson, David [Department of PET and Nuclear Medicine, Royal Prince Alfred Hospital, Sydney, 2050 (Australia); Bourdier, Thomas; Pham, Tien; Greguric, Ivan [ANSTO LifeSciences, Sydney, 2234 (Australia); Lam, Peter [Department of PET and Nuclear Medicine, Royal Prince Alfred Hospital, Sydney, 2050 (Australia); Callaghan, Paul; Mattner, Filomena [ANSTO LifeSciences, Sydney, 2234 (Australia); Eberl, Stefan [Department of PET and Nuclear Medicine, Royal Prince Alfred Hospital, Sydney, 2050 (Australia); School of Information Technology, University of Sydney, Sydney, 2006 (Australia); Fulham, Michael [Department of PET and Nuclear Medicine, Royal Prince Alfred Hospital, Sydney, 2050 (Australia); School of Information Technology, University of Sydney, Sydney, 2006 (Australia); Sydney Medical School, University of Sydney, Sydney, 2006 (Australia)

    2011-01-15

    Objectives: To develop a rapid and reliable method for estimating non-metabolised PBR ligands fluoroethoxy ([{sup 18}F]PBR102)- and fluoropropoxy ([{sup 18}F]PBR111)-substituted 2-(6-chloro-2-phenyl)imidazo[1,2-a]pyridine-3-yl)-N,N-diethylacetamides in plasma. Methods: Rats and baboons were imaged with PET up to 2 h postinjection of [{sup 18}F]PBR102 and [{sup 18}F]PBR111 under baseline conditions, after pre-blocking or displacement with PK11195. Arterial plasma samples were directly analysed by reverse-phase solid-phase extraction (RP-SPE) and RP-HPLC and by normal-phase TLC. SPE cartridges were successively washed with acetonitrile/water mixtures. SPE eluant radioactivity was measured in a {gamma}-counter to determine the parent compound fraction and then analysed by HPLC and TLC for validation. Results: In SPE, hydrophilic and lipophilic radiolabelled metabolites were eluted in water and 20% acetonitrile/water. All non-metabolised [{sup 18}F]PBR102 and [{sup 18}F]PBR111 were in SPE acetonitrile fraction as confirmed by HPLC and TLC analysis. Unchanged (%) [{sup 18}F]PBR102 and [{sup 18}F]PBR111 from SPE analysis in rat and baboon plasma agreed with those from HPLC and TLC analysis. In rats and baboons, the fraction of unchanged tracer followed a bi-exponential decrease, with half-lives of 7 to 10 min for the fast component and >80 min for the slow component for both tracers. Conclusions: Direct plasma SPE analysis of [{sup 18}F]PBR102 and [{sup 18}F]PBR111 can reliably estimate parent compound fraction. SPE was superior to HPLC for samples with low activity; it allows rapid and accurate metabolite analysis of a large number of plasma samples for improved estimation of metabolite-corrected input function during quantitative PET imaging studies.

  9. Magnetic Solid-phase Extraction with Fe3O4/Molecularly Imprinted Polymers Modified by Deep Eutectic Solvents and Ionic Liquids for the Rapid Purification of Alkaloid Isomers (Theobromine and Theophylline from Green Tea

    Directory of Open Access Journals (Sweden)

    Guizhen Li

    2017-06-01

    Full Text Available Different kinds of deep eutectic solvents (DES based on choline chloride (ChCl and ionic liquids (ILs based on 1-methylimidazole were used to modify Fe3O4/molecularly imprinted polymers (Fe3O4/MIPs, and the resulting materials were applied for the rapid purification of alkaloid isomers (theobromine and theophylline from green tea with magnetic solid-phase extraction (M-SPE. The M-SPE procedure was optimized using the response surface methodology (RSM to analyze the maximum conditions. The materials were characterized by Fourier transform infrared spectroscopy (FI-IR and field emission scanning electron microscopy (FE-SEM. Compared to the ILs-Fe3O4/MIPs, the DESs-Fe3O4/MIPs were developed for the stronger recognition and higher recoveries of the isomers (theophylline and theobromine from green tea, particularly DES-7-Fe3O4/MIPs. With RSM, the optimal recovery condition for theobromine and theophylline in the M-SPE were observed with ratio of methanol (80% as the washing solution, methanol/acetic acid (HAc (8:2 as the eluent at pH 3, and an eluent volume of 4 mL. The practical recoveries of theobromine and theophylline in green tea were 92.27% and 87.51%, respectively, with a corresponding actual extraction amount of 4.87 mg•g−1 and 5.07 mg•g−1. Overall, the proposed approach with the high affinity of Fe3O4/MIPs might offer a novel method for the purification of complex isomer samples.

  10. Magnetic Solid-phase Extraction with Fe₃O₄/Molecularly Imprinted Polymers Modified by Deep Eutectic Solvents and Ionic Liquids for the Rapid Purification of Alkaloid Isomers (Theobromine and Theophylline) from Green Tea.

    Science.gov (United States)

    Li, Guizhen; Wang, Xiaoqin; Row, Kyung Ho

    2017-06-25

    Different kinds of deep eutectic solvents (DES) based on choline chloride (ChCl) and ionic liquids (ILs) based on 1-methylimidazole were used to modify Fe3O4/molecularly imprinted polymers (Fe3O4/MIPs), and the resulting materials were applied for the rapid purification of alkaloid isomers (theobromine and theophylline) from green tea with magnetic solid-phase extraction (M-SPE). The M-SPE procedure was optimized using the response surface methodology (RSM) to analyze the maximum conditions. The materials were characterized by Fourier transform infrared spectroscopy (FI-IR) and field emission scanning electron microscopy (FE-SEM). Compared to the ILs-Fe3O4/MIPs, the DESs-Fe3O4/MIPs were developed for the stronger recognition and higher recoveries of the isomers (theophylline and theobromine) from green tea, particularly DES-7-Fe3O4/MIPs. With RSM, the optimal recovery condition for theobromine and theophylline in the M-SPE were observed with ratio of methanol (80%) as the washing solution, methanol/acetic acid (HAc) (8:2) as the eluent at pH 3, and an eluent volume of 4 mL. The practical recoveries of theobromine and theophylline in green tea were 92.27% and 87.51%, respectively, with a corresponding actual extraction amount of 4.87 mg•g-1 and 5.07 mg•g-1. Overall, the proposed approach with the high affinity of Fe3O4/MIPs might offer a novel method for the purification of complex isomer samples.

  11. Substâncias húmicas de turfa: estudo dos parâmetros que influenciam no processo de extração alcalina Humic substances of peat: study of the parameters that influence on the process of alkaline e extraction

    Directory of Open Access Journals (Sweden)

    André Henrique Rosa

    2000-08-01

    Full Text Available This study reports the parameters which influence on extraction of humic substances (HS from peat. The yield, organic and inorganic contend, E4/E6 ratio and elemental composition (C,H,N of the extracted HS have been determined. The functional groups were identified by Fourier-transform infrared espectroscopy. The results showed influence of the extractor type, concentration, time, temperature and granular texture of the sample in the extraction. This work contributes to better understanding of the extraction process showing the necessity of the standard method to extract humic substances from soil

  12. Conventional Treatment of Surface Water Using Moringa Oleifera Seeds Extract as a Primary Coagulant

    Directory of Open Access Journals (Sweden)

    Suleyman A. Muyibi, Ahmed Hissein M Birima, Thamer A. Mohammed

    2012-10-01

    Full Text Available The present study involved the use of a model pilot scale water treatment plant to treat turbid surface water from a stream using processed Moringa oleifera seed with 25 % w/w oil extracted as primary coagulant. The water treatment plant was made up of four unit operations: coagulation, flocculation, sedimentation, and filtration (rapid sand filter. Test runs were carried out for three hours per run over a three-month period with turbidities ranging from 18 to 261 NTU. The turbidity, pH, and alkalinity as well as the filter head loss were measured every 30 minutes during the experimental runs. Average turbidity removal of up to 96 % at an effective doses of 20 and 30 mg/l of oil extracted M. oleifera for low (< 50 NTU and moderate turbidity (< 100 NTU water respectively was observed doses 50 – 80 mg/l for high turbidity (> 100 NTU water. M. oleifera seed extract was found to have no significant effect on pH or alkalinity of the water. The residual turbidities measured during most of the test runs satisfied the Malaysian Guideline for Drinking Water Supplies. Key Words: Moringa oleifera, primary coagulant, coagulation, pilot plant, filtration.

  13. Oxidation catalysts on alkaline earth supports

    Science.gov (United States)

    Mohajeri, Nahid

    2017-03-21

    An oxidation catalyst includes a support including particles of an alkaline earth salt, and first particles including a palladium compound on the support. The oxidation catalyst can also include precious metal group (PMG) metal particles in addition to the first particles intermixed together on the support. A gas permeable polymer that provides a continuous phase can completely encapsulate the particles and the support. The oxidation catalyst may be used as a gas sensor, where the first particles are chemochromic particles.

  14. Alkaline thermostable and halophilic endoglucanase from Bacillus ...

    African Journals Online (AJOL)

    An endoglucanase was purified from halophilic alkaline Bacillus licheniformis isolated from soils of Lake Van in Turkey. The optimal pH and temperature of the endoglucanase produced by B.licheniformis C108 were 10.0 and 30°C, respectively. The enzyme was highly stable up to 100°C at pH 10.0 and the enzyme ...

  15. Alkaline injection for enhanced oil recovery: a status report

    Energy Technology Data Exchange (ETDEWEB)

    Mayer, E.H.; Berg, R.L.; Carmichael, J.D.; Weinbrandt, R.M.

    1983-01-01

    In the past several years, there has been renewed interest in enhanced oil recovery (EOR) by alkaline injection. Alkaline solutions also are being used as preflushes in micellar/polymer projects. Several major field tests of alkaline flooding are planned, are in progress, or recently have been completed. Considerable basic research on alkaline injection has been published recently, and more is in progress. This paper summarizes known field tests and, where available, the amount of alkali injected and the performance results. Recent laboratory work, much sponsored by the U.S. DOE, and the findings are described. Alkaline flood field test plans for new projects are summarized.

  16. Alkaline flooding for enhanced oil recovery

    Energy Technology Data Exchange (ETDEWEB)

    Gittler, W.E.

    1983-09-01

    There are over 12 active projects of varying size using one of 3 major types of alkaline agents. These include sodium silicate, caustic soda, and soda ash. Among the largest pilots currently is the THUMS project in the Wilmington field, California. Plans called for the injection of a 4% weight concentration of sodium orthosilicate over a 60% PV. Through the first 3 yr, over 27 million bbl of chemicals have been injected. Gulf Oil is operating several alkaline floods, one of which is located off shore in the Quarantine Bay field, Louisiana. In this pilot, sodium hydroxide in a weight concentration of 5 to 12% is being injected. Belco Petroleum Corp. has reported that their pilot operating in the Isenhour Unit in Wyoming is using a .5% weight concentration of soda ash in conjunction with a polymer. Other uses for alkaline agents in chemical flooding include the use of silicate as a preflush or sacrificial agent in micellar/polymer and surfactant recovery systems. In addition, caustic has been tested in the surface-mixed caustic emulsion process while orthosilicate has been tested in a recovery method known as mobility-controlled caustic floods.

  17. Activity of alkaline phosphatase adsorbed and grafted on "polydopamine" films.

    Science.gov (United States)

    Ball, Vincent

    2014-09-01

    The oxidation of dopamine in slightly basic solutions and in the presence of oxygen as an oxidant allows for the deposition of dopamine-eumelanin ("polydopamine") films on almost all kinds of materials allowing for an easy secondary functionalization. Molecules carrying nucleophilic groups like thiols and amines can be easily grafted on those films. Herein we show that alkaline phosphatase (ALP), as a model enzyme, adsorbs to "polydopamine" films and part of the adsorbed enzyme is rapidly desorbed in contact with Tris buffer. However a significant part of the enzyme remains irreversibly adsorbed and keeps some enzymatic activity for at least 2 weeks whereas ALP adsorbed on quartz slides is rapidly and quantitatively deactivated. In addition we estimated the Michaelis constant Km of the enzyme irreversibly bound to the "polydopamine" film. The Michaelis constant, and hence the affinity constant between paranitrophenol phosphate and ALP are almost identical between the enzyme bound on the film and the free enzyme in solution. Complementarily, it was found that "polydopamine" films display some phosphatase like catalytic activity. Copyright © 2014 Elsevier Inc. All rights reserved.

  18. Alkaline and ultrasound assisted alkaline pretreatment for intensification of delignification process from sustainable raw-material.

    Science.gov (United States)

    Subhedar, Preeti B; Gogate, Parag R

    2014-01-01

    Alkaline and ultrasound-assisted alkaline pretreatment under mild operating conditions have been investigated for intensification of delignification. The effect of NaOH concentration, biomass loading, temperature, ultrasonic power and duty cycle on the delignification has been studied. Most favorable conditions for only alkaline pretreatment were alkali concentration of 1.75 N, solid loading of 0.8% (w/v), temperature of 353 K and pretreatment time of 6 h and under these conditions, 40.2% delignification was obtained. In case of ultrasound-assisted alkaline approach, most favorable conditions obtained were alkali concentration of 1N, paper loading of 0.5% (w/v), sonication power of 100 W, duty cycle of 80% and pretreatment time of 70 min and the delignification obtained in ultrasound-assisted alkaline approach under these conditions was 80%. The material samples were characterized by FTIR, SEM, XRD and TGA technique. The lignin was recovered from solution by precipitation method and was characterized by FTIR, GPC and TGA technique. Copyright © 2013 Elsevier B.V. All rights reserved.

  19. Alkaline phosphatase activity in dental pulp of orthodontically treated teeth.

    Science.gov (United States)

    Perinetti, Giuseppe; Varvara, Giuseppe; Salini, Luisa; Tetè, Stefano

    2005-10-01

    The aim of this study was to examine alkaline phosphatase (ALP) activity in the dental pulp of orthodontically treated teeth. Sixteen healthy subjects (mean age 17.0 +/-1.6 years) who required extraction of 4 first premolars for orthodontic reasons participated. One maxillary first premolar subjected to orthodontic force was the test tooth. The contralateral first premolar, bracketed but not subjected to mechanical stress, was the control tooth. After a week of treatment, the first premolars were extracted and the dental pulp removed from the teeth. ALP activity was determined spectrophotometrically and the results expressed as units/liter per milligram of pulp tissue [U/(L x mg)]. ALP activity was 89 +/- 26 U/(L x mg) in the test teeth and 142 +/- 33 U/(L x mg) in the control teeth. The difference between the groups was statistically significant (P < .01). Orthodontic treatment can lead to significant early-phase reduction in ALP activity in human dental pulp tissue.

  20. Temporary Sutureless Amniotic Membrane Patch for Acute Alkaline Burns

    Science.gov (United States)

    Kheirkhah, Ahmad; Johnson, Daniel A.; Paranjpe, Deval R.; Raju, V.K.; Casas, Victoria; Tseng, Scheffer C. G.

    2010-01-01

    Objective To evaluate the clinical outcome of a new sutureless approach for a temporary amniotic membrane patch (ProKera; Bio-Tissue, Inc, Miami, Florida) in eyes with acute burns. Methods Retrospective review of 5 eyes of 5 patients with grades I to III acute alkaline burns, receiving ProKera insertion within 8 days of injury. Results These eyes had either total (2 cases) or extensive (60%–75%, 3 cases) corneal epithelial defects with limbal (120°–360°) and conjunctival (30%–60%) epithelial defects. ProKera was inserted within a mean (SD) of 3.7 (3.1) days after burn and repeated 1 to 3 times for 3 cases. Conjunctival defects reepithelialized in 8.2 (5) days (range, 5–17 days), while limbal and corneal defects healed in 13.6 (8.3) days (range, 5–25 days). The latter was completed with circumferential closure of limbal defects followed by centripetal healing of corneal defects. In 3 eyes, early peripheral corneal neovascularization was followed by marked regression on completion of healing. During 16.8 (10.8) months of follow-up, all eyes retained a stable surface with improved corneal clarity, and without limbal deficiency or symblepharon. Conclusion This sutureless application of an amniotic membrane patch allows for early delivery of its biologic actions, which may help preserve remaining limbal stem cells for rapid expansion and prevent late cicatricial complications in eyes with mild and moderate acute alkaline burns. PMID:18695099

  1. Rapid and sensitive analysis of phthalate metabolites, bisphenol A, and endogenous steroid hormones in human urine by mixed-mode solid-phase extraction, dansylation, and ultra-performance liquid chromatography coupled with triple quadrupole mass spectrometry.

    Science.gov (United States)

    Wang, He-xing; Wang, Bin; Zhou, Ying; Jiang, Qing-wu

    2013-05-01

    Steroid hormone levels in human urine are convenient and sensitive indicators for the impact of phthalates and/or bisphenol A (BPA) exposure on the human steroid hormone endocrine system. In this study, a rapid and sensitive method for determination of 14 phthalate metabolites, BPA, and ten endogenous steroid hormones in urine was developed and validated on the basis of ultra-performance liquid chromatography coupled with electrospray ionization triple quadrupole mass spectrometry. The optimized mixed-mode solid phase-extraction separated the weakly acidic or neutral BPA and steroid hormones from acidic phthalate metabolites in urine: the former were determined in positive ion mode with a methanol/water mobile phase containing 10 mM ammonium formate; the latter were determined in negative ion mode with a acetonitrile/water mobile phase containing 0.1 % acetic acid, which significantly alleviated matrix effects for the analysis of BPA and steroid hormones. Dansylation of estrogens and BPA realized simultaneous and sensitive analysis of the endogenous steroid hormones and BPA in a single chromatographic run. The limits of detection were less than 0.84 ng/mL for phthalate metabolites and less than 0.22 ng/mL for endogenous steroid hormones and BPA. This proposed method had satisfactory precision and accuracy, and was successfully applied to the analyses of human urine samples. This method could be valuable when investigating the associations among endocrine-disrupting chemicals, endogenous steroid hormones, and relevant adverse outcomes in epidemiological studies.

  2. Effects of biodegradable Mg-6Zn alloy extracts on apoptosis of intestinal epithelial cells

    Energy Technology Data Exchange (ETDEWEB)

    Wang Zhanhui [Shanghai Jiao Tong University School of Medicine, 227 South Chongqing Road, Shanghai 200025 (China); Yan Jun [Department of General Surgery, Sixth People' s Hospital, Shanghai Jiao Tong University, 600 Yishan Road, Shanghai 200233 (China); Li Jianan [State Key Laboratory of Metal Matrix Composites, Institute of Biomedical Materials, School of Materials Science and Engineering, Shanghai Jiao Tong University, Shanghai 200240 (China); Zheng Qi, E-mail: greatzhengqi@gmail.com [Shanghai Jiao Tong University School of Medicine, 227 South Chongqing Road, Shanghai 200025 (China); Department of General Surgery, Sixth People' s Hospital, Shanghai Jiao Tong University, 600 Yishan Road, Shanghai 200233 (China); Wang Zhigang [Department of General Surgery, Sixth People' s Hospital, Shanghai Jiao Tong University, 600 Yishan Road, Shanghai 200233 (China); Zhang Xiaonong, E-mail: xnzhang@sjtu.edu.cn [State Key Laboratory of Metal Matrix Composites, Institute of Biomedical Materials, School of Materials Science and Engineering, Shanghai Jiao Tong University, Shanghai 200240 (China); Zhang Shaoxiang [Suzhou Origin Medical Technology Co. Ltd., Jiangsu 215513 (China)

    2012-03-15

    Highlights: Black-Right-Pointing-Pointer We evaluated the effects of Mg-6Zn alloys on apoptosis of IEC-6 cells. Black-Right-Pointing-Pointer The apoptosis was evaluated by investigating the expression of caspase-1 and Bcl-2. Black-Right-Pointing-Pointer The IEC-6 cells displayed better cell functions in 60% or 20% extract. Black-Right-Pointing-Pointer The conspicuous alkaline environment is disadvantageous to apoptosis of IEC cells. Black-Right-Pointing-Pointer The excessive Mg concentration is disadvantageous to apoptosis of IEC-6 cells. - Abstract: In this study, intestinal epithelial cells (IEC)-6 were cultured in different concentration extracts of Mg-6Zn alloys for different time periods. To achieve a total of three concentrations (100%, 60% and 20% concentration), the extracts were serially diluted with Dulbecco's modified Eagle medium High Glucose to observe a dose-response relationship. We studied the indirect effects of Mg-6Zn alloys on IEC-6 cells apoptosis. The apoptosis of IEC-6 cells was measured using flow cytometry. And the apoptosis of IEC-6 cells was evaluated by investigating the expression of caspase-1and Bcl-2 using real-time polymerase chain reaction (PCR) and Western blotting tests. It was found that the levels of apoptosis in IEC-6 cells cultured in 100% Mg-6Zn alloy extracts were significantly higher than those in 60% and 20% extracts; the 100% extract can down-regulate expression of Bcl-2 after culture. The in vitro results indicated that the conspicuous alkaline environment and excessive Mg concentration, even Zn concentration caused by rapid corrosion of Mg-6Zn alloys promote IEC-6 cells apoptosis, although further experiments will be necessary to formally prove our conclusions. Therefore, the adjustment of the degradation rate is needed for using Mg-Zn alloy as a surgical suture material.

  3. Comparative evaluation of Schistosoma mansoni, Schistosoma intercalatum, and Schistosoma haematobium alkaline phosphatase antigenicity by the alkaline phosphatase immunoassay (APIA).

    Science.gov (United States)

    Cesari, I M; Ballén, D E; Mendoza, L; Ferrer, A; Pointier, J-P; Kombila, M; Richard-Lenoble, D; Théron, A

    2014-04-01

    To know if alkaline phosphatase (AP) from schistosomes other than Schistosoma mansoni can be used as diagnostic marker for schistosomiasis in alkaline phosphatase immunocapture assay (APIA), we comparatively tested n-butanol extracts of adult worm membranes from a Venezuelan (JL) strain of S. mansoni (Ven/AWBE/Sm); a Cameroonian (EDEN) strain of Schistosoma intercalatum (Cam/AWBE/Si) and a Yemeni strain of Schistosoma haematobium (Yem/AWBE/Sh). APIA was evaluated with sera of patients from Venezuela, Senegal, and Gabon infected with S. mansoni, from Gabon infected with S. intercalatum or S. haematobium, from Chine infected with Schistosoma japonicum and from Cambodian patients infected with Schistosoma mekongi. Results indicate that 92.5% (37/40) of Venezuela sera, 75% (15/20) of Senegal sera, 39.5% (17/43) of S. haematobium sera, and 19.2% (5/26) S. intercalatum sera were APIA-positive with the Ven/AWBE/Sm preparation. APIA with the Cam/AWBE/Si preparation showed that 53.8% of S. intercalatum-positive sera had anti-AP antibodies, and 51.2% S. haematobium-positive sera cross-immunocapturing the S. intercalatum AP. APIA performed with Yem/AWBE/Sh showed that 55.8% S. haematobium sera were positive. Only two out of nine S. japonicum sera were APIA-positive with the Ven/AWBE/Sm and Cam/AWBE/Si, and no reaction was observed with Cambodian S. mekongi-positive sera. AP activity was shown to be present in all the schistosome species/strains studied. The use of APIA as a tool to explore the APs antigenicity and the presence of Schistosoma sp. infections through the detection of anti-Schistosoma sp. AP antibodies in a host, allowed us to demonstrate the antigenicity of APs of S. mansoni, S. intercalatum, and S. haematobium.

  4. Composition of benzene fraction separated from alkaline hydrolysis product of bituminized non-weathered Shurabsk brown coal

    Energy Technology Data Exchange (ETDEWEB)

    Gartsman, B.B.; Rumyantseva, Z.A.; Perednikova, Z.M.

    1987-01-01

    Componental composition is studied of benzene fraction obtained from hydrolysis of non-weathered bituminized Shurabsk brown coal. Benzene fraction was hydrolized with 3% methanol solution KOH and extracted with various polarity solvents. Chromato-mass spectral analysis indicates that benzene fraction of alkaline hydrolysis products contains about 2/3 neutral substances (aliphatic hydrocarbons, aromatic acid anhydrides, dibutylphthalates) and 1/3 benzene-, oxybenzene-carboxylic and aliphatic acids. Weathering brings about oxidation of aliphatic unsaturated and seemingly some saturated hydrocarbons forming organic coal mass as well as accumulation of benzene- and oxybenzene-carboxylic acids in alkaline hydrolysis of coal products. 10 refs.

  5. Integrated hydrometallurgical process for production of zinc from electric arc furnace dust in alkaline medium.

    Science.gov (United States)

    Youcai, Z; Stanforth, R

    2000-12-30

    In this study, a novel and integrated hydrometallurgical process for the production of zinc powder from electric arc furnace (EAF) dust in alkaline medium is reported. The dust is firstly hydrolysed in water, and then fused in caustic soda at 350 degrees C for 1h, followed by leaching in alkaline solution in which both zinc and lead are effectively extracted. Zinc powder is then produced by electrowinning from the leach solution after the lead is selectively removed by precipitation using sodium sulphide as precipitant. The EAF dust tested contained 25% Zn, 1.8% Pb and 33% Fe. It was found that 38% of zinc and 68% of lead could be extracted from the dust when leached directly in caustic soda solution. Leaching of zinc increased to 80% when dust was directly fused with caustic soda followed by alkaline leaching. However, the leaching further increased to 95% when the dust was hydrolysed first with water before fusion. Zinc powder with a purity of 99.95% was then produced by electrowinning from the lead depleted solution. Stainless electrodes were used as both anode and cathode.

  6. Evidence for the Formation of Benzacridine Derivatives in Alkaline-Treated Sunflower Meal and Model Solutions

    Directory of Open Access Journals (Sweden)

    Verena Bongartz

    2016-01-01

    Full Text Available Sunflower extraction meal (SEM is an economically interesting protein source. During alkaline extraction of proteins, the presence of chlorogenic acid (CQA in the meal gives rise to the formation of o-quinones. Reactions with nucleophiles present in proteins can lead to green discoloration. Although such reactions have been known for a long time, there is a lack of information on the chemical nature of the reaction products. SEM and model systems consisting of amino acids and CQA were subjected to alkaline treatment and, for comparison, to oxidation of CQA by polyphenoloxidase (PPO. Several green trihydroxy benzacridine (TBA derivatives were tentatively identified in all samples by UHPLC-DAD-MS/MS. Surprisingly, in alkaline-treated samples of particular amino acids as well as in SEM, the same six TBA isomers were detected. In contrast, the enzymatically oxidized samples resulted in only three TBA derivatives. Contrary to previous findings, neither peptide nor amino acid residues were attached to the resultant benzacridine core. The results indicate that the formation of TBA derivatives is caused by the reaction between CQA quinones and free NH2 groups. Further research is necessary to elucidate the structure of the addition products for a comprehensive evaluation of food and feed safety aspects.

  7. Alkaline carbonates in blast furnace process

    Directory of Open Access Journals (Sweden)

    P. Besta

    2014-10-01

    Full Text Available The production of iron in blast furnaces is a complex of physical, chemical and mechanical processes. The input raw materials contain not only metallic components, but also a number of negative elements. The most important negative elements include alkaline carbonates. They can significantly affect the course of the blast furnace process and thus the overall performance of the furnace. As a result of that, it is essential to accurately monitor the alkali content in the blast furnace raw materials. The article analyzes the alkali content in input and output raw materials and their impact on the blast furnace process.

  8. Transport phenomena in alkaline direct ethanol fuel cells for sustainable energy production

    Science.gov (United States)

    An, L.; Zhao, T. S.

    2017-02-01

    Alkaline direct ethanol fuel cells (DEFC), which convert the chemical energy stored in ethanol directly into electricity, are one of the most promising energy-conversion devices for portable, mobile and stationary power applications, primarily because this type of fuel cell runs on a carbon-neutral, sustainable fuel and the electrocatalytic and membrane materials that constitute the cell are relatively inexpensive. As a result, the alkaline DEFC technology has undergone a rapid progress over the last decade. This article provides a comprehensive review of transport phenomena of various species in this fuel cell system. The past investigations into how the design and structural parameters of membrane electrode assemblies and the operating parameters affect the fuel cell performance are discussed. In addition, future perspectives and challenges with regard to transport phenomena in this fuel cell system are also highlighted.

  9. A simple and rapid analytical method based on solid-phase extraction and liquid chromatography-tandem mass spectrometry for the simultaneous determination of free catecholamines and metanephrines in urine and its application to routine clinical analysis.

    Science.gov (United States)

    Woo, Hye In; Yang, Jeong Soo; Oh, Hyeon Ju; Cho, Yoon Young; Kim, Jae Hyeon; Park, Hyung-Doo; Lee, Soo-Youn

    2016-05-01

    Urinary catecholamines and metanephrines are biochemical indicators of pheochromocytoma. We developed and validated a rapid and precise analytical method based on solid-phase extraction (SPE) and liquid chromatography separation coupled to tandem mass spectrometry (LC-MS/MS) for measuring urinary free catecholamines and metanephrines in a clinical setting. Following SPE purification of catecholamines and metanephrines from urine specimens, chromatographic separation and quantitative detection were performed using LC-MS/MS. The developed method for simultaneous measurement of urinary free catecholamines and metanephrines was validated with clinical urine specimens and was compared with other clinical and biochemical results, including urinary total metanephrines, vanillylmandelic acid (VMA), and plasma free metanephrines. The performance of our newly developed method for measuring urinary free epinephrine (EPI), norepinephrine (NE), dopamine (DA), metanephrine (MN), and normetanephrine (NMN), was acceptable. The recoveries and matrix effects of analytes were 61-107% and 84.5-130.7%. The linear ranges of each analyte were 3.8-2163μg/L, 7.4-2,359μg/L, 5.4-2,825μg/L, 3.5-2,466μg/L, and 3.7-2,569μg/L, and the coefficients of variation (CV) were less than 10% with respect to imprecision. Carryover and sample stability were also validated. Validation using clinical urine specimens by comparison with various biochemical results showed that urinary free metanephrines had comparable sensitivity (100%) and superior specificity (97.1%) to urinary total and plasma free metanephrines. The facile and reliable simultaneous measurement method for urinary free catecholamines and metanephrines using LC-MS/MS developed in this study is helpful in obtaining information about multiple metabolites and is applicable to routine clinical settings for the screening of pheochromocytoma. Copyright © 2016 The Canadian Society of Clinical Chemists. Published by Elsevier Inc. All rights

  10. Lignin recovery from alkaline hydrolysis and glycerolysis of oil palm fiber

    Science.gov (United States)

    Hassan, Nur Syakilla; Badri, Khairiah Haji

    2014-09-01

    In the present work, two types of treatment namely alkaline hydrolysis and glycerolysis have been conducted for lignin extraction from oil palm empty fruit bunch (EFB) fiber. Lignin has been retrieved from two sequential methods, which was the klason lignin from residue and lignin from precipitation of the filtrate. Alkaline hydrolysis was performed using 10% NaOH solution at room condition. This has extracted 13.0 % lignin. On the other hand, glycerolysis was carried out using 70% glycerol catalyzed with 5% of 1 M NaOH at 60-70 °C. This has successfully extracted 16.0% lignin. The SEM micrographs exhibited some physical changes on the surface where the impurities and waxes have been removed, exposing the, lumen. Besides that, FTIR analysis was conducted on untreated EFB, treated EFB and extracted lignin. Delignification of EFB fiber was confirmed based on the intensity reduction at 1245 cm-1 that showed lignin was removed from the fiber. The presence of CO, CC and CC aromatic peaks in the FTIR spectra of the dried filtrate gave an evidence on the presence of lignin.

  11. Serum alkaline phosphatase and mortality in hemodialysis patients.

    Science.gov (United States)

    Beddhu, S; Baird, B; Ma, X; Cheung, A K; Greene, T

    2010-08-01

    Alkaline phosphatase is typically considered as an innocent by-stander, but emerging data suggest that alkaline phosphatase might play a pathogenic role in vascular calcification and thus contribute to increased mortality in hemodialysis patients. Longitudinal analyses of the existing HEMO Study database. 1,827 HEMO Study participants. Serum alkaline phosphatase level. OUTCOME AND MEASUREMENTS: All-cause and cardiovascular mortality. Based on the median serum alkaline phosphatase of 97 IU/l, participants were divided into low ( or = 97 IU/l) serum alkaline phosphatase groups. The lower serum alkaline phosphatase group was associated with older age, male gender, non-black race and shorter dialysis years as well as higher serum calcium, higher serum calcium-phosphorus product and lower parathyroid hormone levels. Mean serum liver enzyme values were in the normal range in both groups, but the high alkaline phosphatase group had slightly higher values. In a multivariate time-dependent Cox model using baseline and follow-up values of serum alkaline phosphatase levels, adjusted for demographics, HEMO Study groups, comorbidity, bone metabolism parameters and liver enzymes, each doubling of serum alkaline phosphatase was significantly associated with increased hazard of all-cause (hazard ratio 1.44, 95% CI 1.30 - 1.59) and cardiovascular mortality (hazard ratio 1.35, 95% CI 1.16 - 1.57). Nonstandardized measurements of alkaline phosphatase. Serum alkaline phosphatase is associated with increased mortality in hemodialysis patients, independent of bone metabolism parameters and liver enzymes. Alkaline phosphatase might be a potential therapeutic target in hemodialysis patients.

  12. Thermodynamic model for an alkaline fuel cell

    Science.gov (United States)

    Verhaert, Ivan; De Paepe, Michel; Mulder, Grietus

    Alkaline fuel cells are low temperature fuel cells for which stationary applications, e.g. cogeneration in buildings, are a promising market. In order to guarantee a long life, water and thermal management has to be done in a careful way. In order to better understand the water, alkali and thermal flows, a two-dimensional model for an Alkaline Fuel Cell is developed using a control volume approach. In each volume the electrochemical reactions together with the mass and energy balance are solved. The model is created in Aspen Custom Modeller, the development environment of Aspen Plus, where special attention is given to the physical flow of hydrogen, water and air in the system. In this way the developed component, the AFC-cell, can be built into stack configurations to understand its effect on the overall performance. The model is validated by experimental data from measured performance by VITO with their Cell Voltage Monitor at a test case, where the AFC-unit is used as a cogeneration unit.

  13. Activation of Alkaline Irrigation Fluids in Endodontics.

    Science.gov (United States)

    Walsh, Laurence J; George, Roy

    2017-10-23

    In conventional endodontic treatment, alkaline solutions of sodium hypochlorite (NaOCl) and ethylenediaminetetraacetic acid (EDTA) are used in combination to disinfect the root canal system and to eliminate debris and smear layers. An important concept that has emerged over recent years is the use of active physical methods for agitating these fluids to improve their penetration within areas that are not reached by endodontic instruments and to accelerate the chemical actions of these alkaline fluids against planktonic microorganisms, biofilms, soft tissue remnants and smear layers. Ultrasonic agitation and more recently pulsed lasers have emerged as two promising methods for activating endodontic irrigation fluids. Ultrasonic agitation with piezoelectric devices employs a moving tip, while laser agitation uses a stationary tip. Both methods cause cavitation, followed by implosions and shear forces which assist with debridement. Fluid streaming further enhances the activity of the fluids. While agitation enhances performance of irrigants, extrusion of fluids from the root canal during activation is a hazard that must be controlled.

  14. Activation of Alkaline Irrigation Fluids in Endodontics

    Directory of Open Access Journals (Sweden)

    Laurence J. Walsh

    2017-10-01

    Full Text Available In conventional endodontic treatment, alkaline solutions of sodium hypochlorite (NaOCl and ethylenediaminetetraacetic acid (EDTA are used in combination to disinfect the root canal system and to eliminate debris and smear layers. An important concept that has emerged over recent years is the use of active physical methods for agitating these fluids to improve their penetration within areas that are not reached by endodontic instruments and to accelerate the chemical actions of these alkaline fluids against planktonic microorganisms, biofilms, soft tissue remnants and smear layers. Ultrasonic agitation and more recently pulsed lasers have emerged as two promising methods for activating endodontic irrigation fluids. Ultrasonic agitation with piezoelectric devices employs a moving tip, while laser agitation uses a stationary tip. Both methods cause cavitation, followed by implosions and shear forces which assist with debridement. Fluid streaming further enhances the activity of the fluids. While agitation enhances performance of irrigants, extrusion of fluids from the root canal during activation is a hazard that must be controlled.

  15. Rapid Prototyping

    Science.gov (United States)

    1999-01-01

    Javelin, a Lone Peak Engineering Inc. Company has introduced the SteamRoller(TM) System as a commercial product. The system was designed by Javelin during a Phase II NASA funded small commercial product. The purpose of the invention was to allow automated-feed of flexible ceramic tapes to the Laminated Object Manufacturing rapid prototyping equipment. The ceramic material that Javelin was working with during the Phase II project is silicon nitride. This engineered ceramic material is of interest for space-based component.

  16. Modifications to EPA Method 3060A to Improve Extraction of Cr(VI) from Chromium Ore Processing Residue-Contaminated Soils

    Science.gov (United States)

    Mills, Christopher T.; Bern, Carleton R.; Wolf, Ruth E.; Foster, Andrea L.; Morrison, Jean M.; Benzel, William M.

    2017-01-01

    It has been shown that EPA Method 3060A does not adequately extract Cr(VI) from chromium ore processing residue (COPR). We modified various parameters of EPA 3060A toward understanding the transformation of COPR minerals in the alkaline extraction and improving extraction of Cr(VI) from NIST SRM 2701, a standard COPR-contaminated soil. Aluminum and Si were the major elements dissolved from NIST 2701, and their concentrations in solution were correlated with Cr(VI). The extraction fluid leached additional Al and Si from the method-prescribed borosilicate glass vessels which appeared to suppress the release of Cr(VI). Use of polytetrafluoroethylene vessels and intensive grinding of NIST 2701 increased the amount of Cr(VI) extracted. These modifications, combined with an increased extraction fluid to sample ratio of ≥900 mL g–1 and 48-h extraction time resulted in a maximum release of 1274 ± 7 mg kg–1 Cr(VI). This is greater than the NIST 2701 certified value of 551 ± 35 mg kg–1 but less than 3050 mg kg–1 Cr(VI) previously estimated by X-ray absorption near edge structure spectroscopy. Some of the increased Cr(VI) may have resulted from oxidation of Cr(III) released from brownmillerite which rapidly transformed during the extractions. Layered-double hydroxides remained stable during extractions and represent a potential residence for unextracted Cr(VI).

  17. Modifications to EPA Method 3060A to Improve Extraction of Cr(VI) from Chromium Ore Processing Residue-Contaminated Soils.

    Science.gov (United States)

    Mills, Christopher T; Bern, Carleton R; Wolf, Ruth E; Foster, Andrea L; Morrison, Jean M; Benzel, William M

    2017-10-03

    It has been shown that EPA Method 3060A does not adequately extract Cr(VI) from chromium ore processing residue (COPR). We modified various parameters of EPA 3060A toward understanding the transformation of COPR minerals in the alkaline extraction and improving extraction of Cr(VI) from NIST SRM 2701, a standard COPR-contaminated soil. Aluminum and Si were the major elements dissolved from NIST 2701, and their concentrations in solution were correlated with Cr(VI). The extraction fluid leached additional Al and Si from the method-prescribed borosilicate glass vessels which appeared to suppress the release of Cr(VI). Use of polytetrafluoroethylene vessels and intensive grinding of NIST 2701 increased the amount of Cr(VI) extracted. These modifications, combined with an increased extraction fluid to sample ratio of ≥900 mL g(-1) and 48-h extraction time resulted in a maximum release of 1274 ± 7 mg kg(-1) Cr(VI). This is greater than the NIST 2701 certified value of 551 ± 35 mg kg(-1) but less than 3050 mg kg(-1) Cr(VI) previously estimated by X-ray absorption near edge structure spectroscopy. Some of the increased Cr(VI) may have resulted from oxidation of Cr(III) released from brownmillerite which rapidly transformed during the extractions. Layered-double hydroxides remained stable during extractions and represent a potential residence for unextracted Cr(VI).

  18. Preparation and Evaluation of Alcohol-Alkaline-Treated Rice Starch ...

    African Journals Online (AJOL)

    Preparation and Evaluation of Alcohol-Alkaline-Treated Rice Starch as a Tablet Disintegrant. Yanisa Boonwatcharapan, Pathomthat Srisuk, Pasquale Palladino, Saengrawee Sutthiparinyanont, Padungkwan Chitropas ...

  19. Hericium erinaceus mushroom extracts protect infected mice against Salmonella typhimurium induced liver damage and mortality by activation of innate immune cells

    Science.gov (United States)

    The present study investigated the antibacterial effect of four extracts from the fruitbody of the edible medicinal mushroom Hericium erinaceus (Hot water extract, HWE; Microwave/50% ethanol extract, MWE; Acid extract, ACE; and Alkaline extract, AKE) against murine salmonellosis. The extracts had no...

  20. Ectopic Expression of a Glycine soja myo-Inositol Oxygenase Gene (GsMIOX1a in Arabidopsis Enhances Tolerance to Alkaline Stress.

    Directory of Open Access Journals (Sweden)

    Chen Chen

    Full Text Available Myo-inositol participates in various aspects of plant physiology, and myo-inositol oxygenase is the key enzyme of the myo-inositol oxygenation pathway. Previous studies indicated that myo-inositol oxygenase may play a role in plant responses to abiotic stresses. In this study, we focused on the functional characterization of GsMIOX1a, a remarkable alkaline stress-responsive gene of Glycine soja 07256, based on RNA-seq data. Using quantitative real-time PCR, we demonstrated that GsMIOX1a is rapidly induced by alkaline stress and expressed predominantly in flowers. We also elucidated the positive function of GsMIOX1a in the alkaline response in the wild type, atmiox1 mutant as well as GsMIOX1a-overexpressing Arabidopsis. We determined that atmiox1 mutant decreased Arabidopsis tolerance to alkaline stress, whereas GsMIOX1a overexpression increased tolerance. Moreover, the expression levels of some alkaline stress-responsive and inducible marker genes, including H+-Ppase, NADP-ME, KIN1 and RD29B, were also up-regulated in GsMIOX1a overexpression lines compared with the wild type and atmiox1 mutant. Together, these results suggest that the GsMIOX1a gene positively regulates plant tolerance to alkaline stress. This is the first report to demonstrate that ectopic expression of myo-inositol oxygenase improves alkaline tolerance in plants.

  1. Effect of Proteolysis with Alkaline Protease Following High Hydrostatic Pressure Treatment on IgE Binding of Buckwheat Protein.

    Science.gov (United States)

    Lee, Chaeyoon; Lee, Wonhui; Han, Youngshin; Oh, Sangsuk

    2017-03-01

    Buckwheat is a popular food material in many Asian countries and it contains major allergenic proteins. This study was performed to analyze the effects of hydrolysis with alkaline protease following high hydrostatic pressure (HHP) treatment on the IgE binding of buckwheat protein. Extracted buckwheat protein was treated with HHP at 600 MPa for 30 min and hydrolyzed with alkaline protease for 240 min. IgE binding was examined using an enzyme-linked immunosorbent assay (ELISA) with serum samples from 14 patients who were allergic to buckwheat. Depending on the serum samples, HHP treatment of buckwheat protein without enzymatic hydrolysis decreased the IgE binding by 8.9% to 73.2% or increased by 31% to 78%. The IgE binding of buckwheat protein hydrolyzed with alkaline protease decreased by 73.8% to 100%. The IgE binding of buckwheat protein hydrolyzed with alkaline protease following HHP treatment decreased by 83.8% to 100%. This suggested that hydrolysis with alkaline protease following HHP treatment could be applied to reduce the IgE binding of buckwheat protein. © 2017 Institute of Food Technologists®.

  2. Expression of recombinant alkaline phosphatase conjugates in Escherichia coli.

    Science.gov (United States)

    Boulain, Jean-Claude; Ducancel, Frédéric

    2004-01-01

    The methods described in this article are relative to the use of a positive cloning/screening recombinant system for the generation in Escherichia coli of foreign proteins fused to a highly active bacterial alkaline phosphatase (PhoA) variant as reporter enzyme. Appropriate insertion of the DNA encoding the foreign peptides, proteic domains, or proteins between codons +6 and +7 of the phoa gene restores the initial frame of the phoa gene in the vector. Consequently, only recombinant clones appear as blue colonies when plating onto an agar medium containing a chromogenic substrate for PhoA. The presence of an intact PhoA signal peptide yields to a systematic secretion of the fusion proteins into the periplasm where the PhoA dimerises to its active form, and disulfides can be formed if necessary. The resultant PhoA-tagged proteins are particularly convenient novel tools that can be used in a wide range of applications, including expression, epitope mapping, histochemistry, immunoblotting, mutant analysis, and competition or sandwich ELISAs. Expression of an scFv antibody fragment derived from an IgG2a/kappa immunoglobulin specific for curaremimetic toxins from snake (named M-alpha2-3), will be used to illustrate the methods utilized for its cloning, expression in E.coli, extraction, and functional characterization.

  3. Long-term landscape evolution of the southeast Brazilian highlands: comparison of two alkaline intrusions areas

    Science.gov (United States)

    Doranti Tiritan, Carolina; Hackspacher, Peter Christian; Glasmacher, Ulrich Anton

    2016-04-01

    The southeast Brazilian highlands records a long history of tectonic and magmatic events that were consequence of the South Atlantic Ocean opening. After the rifting process has ceased, an epeirogenic uplift of the continental crust has started in response to the drifting of the South American Platform over a thermal anomaly that accompanied an intense alkaline and basaltic magmatism. Related Late Cretaceous alkaline intrusions are distributed from the southeast Brazilian coast to the interior of the South American Platform. The landscape evolution is associated with several distinct exhumation events at the South American passive continental margin (Hackspacher 2004; Doranti et al, 2014). The present study intent providing insights on the behaviour of the coupled magmatic tectonic-erosional system, comparing thermochronological data from two alkaline intrusions, Poços de Caldas Alkaline Massif (PCAM) and São Sebastião Island (SSI). The PCAM is the biggest alkaline structure located in the interior of the continent, 300km from the coastline (Rio de Janeiro). The structure is formed as a caldera, covering over 800km2, intruding Precambrian basement around 83Ma, nepheline syenites, phonolites and tinguaites intruded in a continuous and rapid sequence lasting between 1 to 2 Ma. Meanwhile, the SSI (236km²) is located at the coast, 200 km southeast of the city of São Paulo and is characterized by an intrusion in Precambrian granitic-gnaissic rocks affected by the Panafrican/Brazilian Orogen. This crystalline basement is intruded by Early Cretaceous subalkaline basic and acid dykes, as well as by Late Cretaceous alkaline stocks (syenites) and dykes (basanite to phonolite). The Apatite Fission-Track ages for PCAM range from 333.3±27.6 to 94.0±13.7 Ma at the surrounded metamorphic basement area, and 76.8±10.9 to 48.7±10.7 Ma in the alkaline Massif. The older ages, are concentrated on the lower topography region (700 until 1200m) in the north side alkaline massif

  4. Extraction methods and food uses of a natural red colorant from dye sorghum.

    Science.gov (United States)

    Akogou, Folachodé Ug; Kayodé, Ap Polycarpe; den Besten, Heidy Mw; Linnemann, Anita R

    2018-01-01

    The interest in stable natural colorants for food applications continues to grow. A red pigment extracted from the leaf sheaths of a sorghum variety (Sorghum bicolor) with a high content of apigeninidin is widely used as a biocolorant in processed foods in West Africa. This study compared the colour and anthocyanin composition from traditional extraction methods to determine options for improvement and use of the red biocolorant from dye sorghum in the food sector. Sorghum biocolorant was commonly applied in fermented and heated foods. Traditional extraction methods predominantly differed in two aspects, namely the use of an alkaline rock salt (locally known as kanwu) and the temperature of the extraction water. Cool extraction using the alkaline ingredient was more efficient than hot alkaline and hot aqueous extractions in extracting anthocyanins. The apigeninidin content was three times higher in the cool and hot alkaline extracts than in the aqueous extract. Cool and hot alkaline extractions at pH 8-9 were the most efficient methods for extracting apigeninidin from dye sorghum leaf sheaths. Broader use of the sorghum biocolorant in foods requires further research on its effects on nutrient bioavailability and antioxidant activity. © 2017 Society of Chemical Industry. © 2017 Society of Chemical Industry.

  5. Alkaline pulping of some eucalypts from Sudan.

    Science.gov (United States)

    Khristova, P; Kordsachia, O; Patt, R; Dafaalla, S

    2006-03-01

    Four eucalypts (Eucalyptus camaldulensis, Eucalyptus microtheca, Eucalyptus tereticornis and Eucalyptus citriodora) grown in Sudan were examined for their suitability for pulping and papermaking with different alkaline methods. Their physical, morphological and chemical characteristics are reported. The pulping trials with E. citriodora and E. tereticornis were carried out using the kraft-AQ, soda-AQ, modified AS/AQ (ASA), ASAM and kraft methods. For the other two species, only the ASAM and the kraft process were applied. ASAM pulping gave the best results in terms of yield, degree of delignification, mechanical and optical pulp properties. The best pulps, obtained in kraft and ASAM cooking of E. citriodora, were bleached to 88% ISO brightness in a totally chlorine free bleaching sequence (OQ1O/PQ2P). The bleached pulps, especially the ASAM pulp, showed good papermaking properties and would be suitable for manufacture of writing and printing grades of paper.

  6. Production of alkaline protease from Cellulosimicrobium cellulans

    Science.gov (United States)

    Ferracini-Santos, Luciana; Sato, Hélia H

    2009-01-01

    Cellulosimicrobium cellulans is one of the microorganisms that produces a wide variety of yeast cell wall-degrading enzymes, β-1,3-glucanase, protease and chitinase. Dried cells of Saccharomyces cerevisiae were used as carbon and nitrogen source for cell growth and protease production. The medium components KH2PO4, KOH and dried yeast cells showed a significant effect (pproduction of protease was 0.2 g/l of MgSO4.7H2O, 2.0 g/l of (NH4)2SO4 and 8% of dried yeast cells in 0.15M phosphate buffer at pH 8.0. The maximum alkaline protease production was 7.0 ± 0.27 U/ml over the center point. Crude protease showed best activity at 50ºC and pH 7.0-8.0, and was stable at 50ºC. PMID:24031317

  7. Hydrogen production by alkaline water electrolysis

    Directory of Open Access Journals (Sweden)

    Diogo M. F. Santos

    2013-01-01

    Full Text Available Water electrolysis is one of the simplest methods used for hydrogen production. It has the advantage of being able to produce hydrogen using only renewable energy. To expand the use of water electrolysis, it is mandatory to reduce energy consumption, cost, and maintenance of current electrolyzers, and, on the other hand, to increase their efficiency, durability, and safety. In this study, modern technologies for hydrogen production by water electrolysis have been investigated. In this article, the electrochemical fundamentals of alkaline water electrolysis are explained and the main process constraints (e.g., electrical, reaction, and transport are analyzed. The historical background of water electrolysis is described, different technologies are compared, and main research needs for the development of water electrolysis technologies are discussed.

  8. Corrosion of copper in alkaline chloride environments

    Energy Technology Data Exchange (ETDEWEB)

    King, F. [Integrity Corrosion Consulting Ltd., Calgary (Canada)

    2002-08-01

    The available literature information on the corrosion and electrochemical behaviour of copper in alkaline environments has been reviewed. The purpose of the review was to assess the impact of an alkaline plume from cementitious material on the corrosion behaviour of a copper canister in an SKB-3 type repository. The effect of the evolution of the environmental conditions within the repository have been considered, including the effects of temperature, redox conditions, pore-water salinity and pH. If the pore-water pH increases prior to the establishment of anoxic conditions, the canister surface will passivate as the pore-water pH exceeds a value of {approx} pH 9. Passivation will result from the formation of a duplex Cu{sub 2}O/Cu(OH){sub 2} film. The corrosion potential will be determined by the equilibrium potential for the Cu{sub 2}O/Cu(OH){sub 2} couple under oxic conditions, or by the Cu/Cu{sub 2}O redox couple under anoxic conditions (in the absence of sulphide). Pitting corrosion is only likely to occur early in the evolution of the repository environment, whilst the canister is still relatively cool (<40 deg C), whilst there is still O{sub 2} available to support localised corrosion, and prior to the increase in pore-water pH and salinity. The subsequent increase in canister surface temperature, pore-water pH and salinity, and decrease in O{sub 2} will make pit initiation less likely, although the canister will remain passive provided the pore-water pH is maintained above pH 9. The higher the pore-water pH, the more strongly the canister is passivated and the less likely the surface is to undergo localised attack. If the pore-water salinity increases prior to the increase in pH, there could be a period of active canister corrosion before passivation occurs.Under these circumstances, the corrosion potential will be a true mixed potential, determine by the relative kinetics of Cu dissolution as CuCl{sub 2} - and of the reduction of O{sub 2}. The development

  9. Polyvinyl alcohol membranes as alkaline battery separators

    Science.gov (United States)

    Sheibley, D. W.; Gonzalez-Sanabria, O.; Manzo, M. A.

    1982-01-01

    Polyvinly alcohol (PVA) cross-linked with aldehyde reagents yields membranes that demonstrate properties that make them suitable for use as alkaline battery separators. Film properties can be controlled by the choice of cross-linker, cross-link density and the method of cross-linking. Three methods of cross-linking and their effects on film properties are discussed. Film properties can also be modified by using a copolymer of vinyl alcohol and acrylic acid as the base for the separator and cross-linking it similarly to the PVA. Fillers can be incorporated into the films to further modify film properties. Results of separator screening tests and cell tests for several variations of PBA films are discussed.

  10. Temperature Dependence of Mineral Solubility in Water. Part I. Alkaline and Alkaline Earth Chlorides

    Science.gov (United States)

    Krumgalz, B. S.

    2017-12-01

    A database of alkaline and alkaline earth chloride solubilities in water at various temperatures was created using data from more than 670 publications over about the last two centuries. Statistical critical evaluations of the created database were produced since there were enough independent data sources to justify such evaluations. The reliable experimental data were adequately described by polynomial expressions over various temperature ranges. Using the Pitzer approach for ionic activity and osmotic coefficients, the thermodynamic solubility products for the discussed minerals have been calculated at various temperature intervals and also represented by polynomial expressions. The solubility products calculated in the current study yield excellent agreement between the predicted and experimental mineral solubility values in natural waters over a wide range of temperature and ionic solution matrices.

  11. Alkaline protease production on date waste by an alkalophilic ...

    African Journals Online (AJOL)

    This research focused on isolation and characterization of a new strain of Bacillus sp. from alkaline soil, which was able to producing extracellular alkaline protease and amylase from date waste at pH ranging from 8 to 11 and temperatures of 20 to 50°C. Purification was conducted by fractionation, concentration, and cation ...

  12. Dynamic properties of the alkaline vesicle population at hippocampal synapses.

    Directory of Open Access Journals (Sweden)

    Mareike Röther

    Full Text Available In compensatory endocytosis, scission of vesicles from the plasma membrane to the cytoplasm is a prerequisite for intravesicular reacidification and accumulation of neurotransmitter molecules. Here, we provide time-resolved measurements of the dynamics of the alkaline vesicle population which appears upon endocytic retrieval. Using fast perfusion pH-cycling in live-cell microscopy, synapto-pHluorin expressing rat hippocampal neurons were electrically stimulated. We found that the relative size of the alkaline vesicle population depended significantly on the electrical stimulus size: With increasing number of action potentials the relative size of the alkaline vesicle population expanded. In contrast to that, increasing the stimulus frequency reduced the relative size of the population of alkaline vesicles. Measurement of the time constant for reacification and calculation of the time constant for endocytosis revealed that both time constants were variable with regard to the stimulus condition. Furthermore, we show that the dynamics of the alkaline vesicle population can be predicted by a simple mathematical model. In conclusion, here a novel methodical approach to analyze dynamic properties of alkaline vesicles is presented and validated as a convenient method for the detection of intracellular events. Using this method we show that the population of alkaline vesicles is highly dynamic and depends both on stimulus strength and frequency. Our results implicate that determination of the alkaline vesicle population size may provide new insights into the kinetics of endocytic retrieval.

  13. Production of alkaline protease by Teredinobacter turnirae cells ...

    African Journals Online (AJOL)

    The conditions for immobilizing the new alkaline protease-producing bacteria strain Teredinobacter turnirae by entrapment in calcium alginate gel were investigated. The influence of alginate concentration (20, 25 and 30 g/l) and initial cell loading (ICL) on enzyme production were studied. The production of alkaline ...

  14. Alkaline cleaner replacement for printed wiring board fabrication

    Energy Technology Data Exchange (ETDEWEB)

    Goldammer, S.E.; Pemberton, S.E.; Tucker, D.R.

    1997-04-01

    A replacement alkaline cleaning chemistry was qualified for the copper cleaning process used to support printed wiring board fabrication. The copper cleaning process was used to prepare copper surfaces for enhancing the adhesion of dry film photopolymers (photoresists and solder masks) and acrylic adhesives. The alkaline chemistry was used to remove organic contaminates such as fingerprints.

  15. Enhancement of alkaline protease production by Bacillus clausii ...

    African Journals Online (AJOL)

    SERVER

    2007-11-19

    Nov 19, 2007 ... Full Length Research Paper. Enhancement of alkaline protease production by. Bacillus clausii using Taguchi ... inorganic nitrogen sources, agitation and metal ion, each at four levels were selected and an orthogonal array layout of L16 (45) were performed. The proposed medium for alkaline protease ...

  16. Effects of Cadmium Exposure on Bone and Kidney Alkaline ...

    African Journals Online (AJOL)

    This paper examines the effects of varying doses of cadmium on bone and kidney alkaline phosphatase and on testis and prostate acid phosphatase after 4 weeks of administration to separate groups of rats. Relative to the cadmium-free control rats femur bone alkaline phosphatase activity was significantly (P<0.05) ...

  17. Potency of aqueous stem bark extract of Khaya senegalensis ...

    African Journals Online (AJOL)

    In order to assess the potency of aqueous stem bark extract of Khaya senegalensis (KS) against liver diseases, serum aspartate transaminase (AST), alanine transaminase (ALT) and alkaline phosphatase (ALP) were assayed in rats treated with two (2) different doses of the extract after the induction of liver damage in the ...

  18. Effect of subchronic administration of ethanolic leaf extract of croton ...

    African Journals Online (AJOL)

    The biochemical effcts of ethanolic leaf extract of Croton zambesicus on serum alkaline phosphatase(SAP),aspartate aminotransferase (AST) ,alanine aminotransferase(ALT),serum total protein and albumin were studied.The levels of these enzymes and that of total protein and albumin in the extract treated rats were not ...

  19. Experimental Simulation of Long Term Weathering in Alkaline Bauxite Residue Tailings

    Directory of Open Access Journals (Sweden)

    Talitha C. Santini

    2015-07-01

    Full Text Available Bauxite residue is an alkaline, saline tailings material generated as a byproduct of the Bayer process used for alumina refining. Developing effective plans for the long term management of potential environmental impacts associated with storage of these tailings is dependent on understanding how the chemical and mineralogical properties of the tailings will change during weathering and transformation into a soil-like material. Hydrothermal treatment of bauxite residue was used to compress geological weathering timescales and examine potential mineral transformations during weathering. Gibbsite was rapidly converted to boehmite; this transformation was examined with in situ synchrotron XRD. Goethite, hematite, and calcite all precipitated over longer weathering timeframes, while tricalcium aluminate dissolved. pH, total alkalinity, and salinity (electrical conductivity all decreased during weathering despite these experiments being performed under “closed” conditions (i.e., no leaching. This indicates the potential for auto-attenuation of the high alkalinity and salinity that presents challenges for long term environmental management, and suggests that management requirements will decrease during weathering as a result of these mineral transformations.

  20. Microwave synthesis of catalyst spinel MnCo 2O 4 for alkaline fuel cell

    Science.gov (United States)

    Nissinen, Terhi; Valo, Taina; Gasik, Michael; Rantanen, Jyri; Lampinen, Markku

    Spinels, AB 2O 4, are promising catalysts for the oxygen reduction reaction in alkaline fuel cells since they have no noble metals and can be prepared by rather simple methods. In this work the spinel MnCo 2O 4 was fabricated from decomposition of salts and subsequent heat treatment in microwave and conventional ovens. The catalytic activity of spinels for the oxygen reduction reaction was examined in alkaline conditions in a specially designed test bed. XRD, SEM, surface area, and carbon content measurements were used to analyze the prepared powders. Spinel was not detected for treatment in a microwave oven at 650 W power without carbon, but in the presence of carbon it was formed at 125 W rapidly (in a few minutes). These spinels have smaller particles and higher specific surface area and they have demonstrated higher catalytic activity for the oxygen reduction reaction than the spinels prepared in a conventional oven. The Microwave technique proved to be a favorable and fast way to prepare catalytically active spinel MnCo 2O 4 for alkaline fuel cells. Tested fuel cells are being adapted for transport applications in vehicles.

  1. Phosphatidylinositol anchor of HeLa cell alkaline phosphatase

    Energy Technology Data Exchange (ETDEWEB)

    Jemmerson, R.; Low, M.G.

    1987-09-08

    Alkaline phosphatase from cancer cells, HeLa TCRC-1, was biosynthetically labeled with either /sup 3/H-fatty acids or (/sup 3/H)ethanolamine as analyzed by sodium dodecyl sulfate-polyacrylamide gel electrophoresis and fluorography of immunoprecipitated material. Phosphatidylinositol-specific phospholipase C (PI-PLC) released a substantial proportion of the /sup 3/H-fatty acid label from immunoaffinity-purified alkaline phosphatase but had no effect on the radioactivity of (/sup 3/H)ethanolamine-labeled material. PI-PLC also liberated catalytically active alkaline phosphatase from viable cells, and this could be selectively blocked by monoclonal antibodies to alkaline phosphatase. However, the alkaline phosphatase released from /sup 3/H-fatty acid labeled cells by PI-PLC was not radioactive. By contrast, treatment with bromelain removed both the /sup 3/H-fatty acid and the (/sup 3/H)ethanolamine label from purified alkaline phosphatase. Subtilisin was also able to remove the (/sup 3/H)ethanolamine label from the purified alkaline phosphatase. The /sup 3/H radioactivity in alkaline phosphatase purified from (/sup 3/H)ethanolamine-labeled cells comigrated with authentic (/sup 3/H)ethanolamine by anion-exchange chromatography after acid hydrolysis. The data suggest that the /sup 3/H-fatty acid and (/sup 3/H)ethanolamine are covalently attached to the carboxyl-terminal segment since bromelain and subtilisin both release alkaline phosphatase from the membrane by cleavage at that end of the polypeptide chain. The data are consistent with findings for other proteins recently shown to be anchored in the membrane through a glycosylphosphatidylinositol structure and indicate that a similar structure contributes to the membrane anchoring of alkaline phosphatase.

  2. Spectrophotometric total protein assay with copper(II)-neocuproine reagent in alkaline medium.

    Science.gov (United States)

    Sözgen, Kevser; Cekic, Sema Demirci; Tütem, Esma; Apak, Resat

    2006-02-28

    Total protein assay was made using copper(II)-neocuproine (Nc) reagent in alkaline medium (with the help of a hydroxide-carbonate-tartarate solution) after 30min incubation at 40 degrees C. The absorbance of the reduction product, Cu(I)-Nc complex, was recorded at 450nm against a reagent blank. The absorptivity of the developed method for bovine serum albumin (BSA) was 0.023lmg(-1)cm(-1), greater than that of Lowry assay (0.0098), and much greater than that of Cu(II)-bicinchoninic acid (BCA) assay (0.00077). The linear range of the developed method (8-100mgl(-1) BSA) was as wide as that of Lowry, and much wider than that of BCA (200-1000mgl(-1) BSA) assay. The sensitivity of the method was greater than those of Cu-based assays (biuret, Lowry, and BCA) with a LOD of 1mgl(-1) BSA. The within-run and between-run precisions as RSD were 0.73 and 1.01%, respectively. The selectivity of the proposed method for protein was much higher than those of dye-binding and Lowry assays: Most common interferents to other protein assays such as tris, ethanolamine, deoxycholate, CsCl, citrate, and triton X-100 were tolerated at 100-fold concentrations in the analysis of 10mgl(-1) BSA, while the tolerance limits for other interferents, e.g., (NH(4))(2)SO(4) and acetylsalicylic acid (50-fold), SDS (25-fold), and glycerol (20-fold) were at acceptable levels. The redox reaction of Cu(II)-Nc as an outer-sphere electron transfer agent with the peptide bond and with four amino acid residues (cystine, cysteine, tryptophan, and tyrosine) was kinetically more favourable than that of Cu(II) alone in the biuret assay. Since the reduction product of Cu(II) with protein, i.e., Cu(I), was coordinatively saturated with Nc in the stable Cu(Nc)(2)(+) chelate, re-oxidation of the formed Cu(I) with Fenton-like reactions was not possible, thereby preventing a loss of chromophore. After conventional protein extraction, precipitation, and redissolution procedures, the protein contents of the minced meat

  3. Physicochemical Properties of Defatted Rambutan (Nephelium lappaceum) Seed Flour after Alkaline Treatment.

    Science.gov (United States)

    Eiamwat, Jirawat; Wanlapa, Sorada; Kampruengdet, Sukit

    2016-03-31

    Rambutan seeds were subjected to SC-CO₂ extraction at 35 MPa, 45 °C to obtain defatted rambutan seed flour. Its physicochemical properties before and after treatment with alkali solution using 0.075 N NaOH were investigated. Alkali-treated flour had a significant increment in bulk density, swelling power, water adsorption capacity, emulsion capacity and stability but a reduction in turbidity, solubility and oil absorption capacity. Pasting measurements showed peak viscosity, breakdown, setback and final viscosity increased significantly for the alkali-treated flour, while pasting temperature decreased. The alkaline treatment decreased the least gelation concentration, but increased the apparent viscosity.

  4. Physicochemical Properties of Defatted Rambutan (Nephelium lappaceum Seed Flour after Alkaline Treatment

    Directory of Open Access Journals (Sweden)

    Jirawat Eiamwat

    2016-03-01

    Full Text Available Rambutan seeds were subjected to SC-CO2 extraction at 35 MPa, 45 °C to obtain defatted rambutan seed flour. Its physicochemical properties before and after treatment with alakali solution using 0.075 N NaOH were investigated. Alkali-treated flour had a significant increment in bulk density, swelling power, water adsorption capacity, emulsion capacity and stability but a reduction in turbidity, solubility and oil absorption capacity. Pasting measurements showed peak viscosity, breakdown, setback and final viscosity increased significantly for the alkali-treated flour, while pasting temperature decreased. The alkaline treatment decreased the least gelation concentration, but increased the apparent viscosity.

  5. The effect of irrigated rice cropping on the alkalinity of two alkaline rice soils in the Sahel

    NARCIS (Netherlands)

    Asten, van P.J.A.; Zelfde, van 't J.A.; Zee, van der S.E.A.T.M.; Hammecker, C.

    2004-01-01

    Irrigated rice cropping is practiced to reclaim alkaline-sodic soils in many parts of the world. This practice is in apparent contrast with earlier studies in the Sahel, which suggests that irrigated rice cropping may lead to the formation of alkaline-sodic soils. Soil column experiments were done

  6. Batteries: from alkaline to zinc-air.

    Science.gov (United States)

    Dondelinger, Robert M

    2004-01-01

    There is no perfect disposable battery--one that will sit on the shelf for 20 years, then continually provide unlimited current, at a completely constant voltage until exhausted, without producing heat. There is no perfect rechargeable battery--one with all of the above characteristics and will also withstand an infinite overcharge while providing an equally infinite cycle life. There are only compromises. Every battery selection is a compromise between the ideally required characteristics, the advantages, and the limitations of each battery type. General selection of a battery type to power a medical device is largely outside the purview of the biomed. Initially, these are engineering decisions made at the time of medical equipment design and are intended to be followed in perpetuity. However, since newer cell types evolve and the manufacturer's literature is fixed at the time of printing, some intelligent substitutions may be made as long as the biomed understands the characteristics of both the recommended cell and the replacement cell. For example, when the manufacturer recommends alkaline, it is usually because of the almost constant voltage it produces under the devices' design load. Over time, other battery types may be developed that will meet the intent of the manufacturer, at a lower cost, providing longer operational life, at a lower environmental cost, or with a combination of these advantages. In the Obstetrical Doppler cited at the beginning of this article, the user had put in carbon-zinc cells, and the biomed had unknowingly replaced them with carbonzinc cells. If the alkaline cells recommended by the manufacturer had been used, there would have been the proper output voltage at the battery terminals when the [table: see text] cells were at their half-life. Instead, the device refused to operate since the battery voltage was below presumed design voltage. While battery-type substitutions may be easily and relatively successfully made in disposable

  7. Shallow and deep crustal control on differentiation of calc-alkaline and tholeiitic magma

    Science.gov (United States)

    Hora, John M.; Singer, Brad S.; Wörner, Gerhard; Beard, Brian L.; Jicha, Brian R.; Johnson, Clark M.

    2009-07-01

    The role of changing crustal interaction and plumbing geometry in modulating calc-alkaline vs. tholeiitic magma affinity is well illustrated by the influence of 70 km thick crust beneath Volcán Parinacota. Changes in petrologic affinity correlate with periods of cone-building, sector collapse, and rebuilding of the volcano over the last 52 ka, and are well explained by changes in magma recharge regime. With increasing recharge and magma output, lavas transition from low-Fe, strongly calc-alkaline, phenocryst-rich silicic compositions to medium-Fe, near-tholeiitic, mafic, and aphanitic characteristics. Strontium isotope data show that the change in magma regime did not affect all parts of the system simultaneously; these are characterized by distinctive 87Sr/ 86Sr ratios, which suggest an initially compartmentalized system. Relatively high ( 230Th/ 232Th) activity ratios of ~ 0.72 in early-erupted calc-alkaline lavas are consistent with interaction with high-U upper crust. Low ( 230Th/ 232Th) activity ratios of ~ 0.55 and up to 33% Th-excess in younger near-tholeiitic lavas correlate with steep REE patterns, indicating lower-crustal interaction. Thorium-excesses at the time of eruption approach the maximum that can be generated via small-degree garnet-residual melting in the lower crust or mantle and imply that transit time through the crustal column for the most tholeiitic magmas had to be short, on the order of secular equilibrium, suggesting stagnation times > 3 × 10 5 yr in the upper crust. In addition to more traditional explanations tied to magma source, expression of low-Fe 'calc-alkaline' (CA) vs. medium-Fe 'near-tholeiitic' (TH) magma series at the scale of individual volcanoes is likely to be modulated by transitions from compartmentalized, stagnant, assimilation-prone 'dirty' systems (CA) to 'clean' systems (TH) that are characterized by rapid magma throughput and minimal opportunity for upper-crustal contamination.

  8. [Determination of physiological indices in Albizzia julibrissin Durazz seedlings under alkaline stress with visible spectrophotometry].

    Science.gov (United States)

    Zhou, Jian; Zhang, Lin; Yuan, De-Yi; Qi, An-Guo

    2008-02-01

    There is a large area of saline-alkali soil in our country, and soil alkalization is always a problem affecting urban gardening. To examine the capacity of alkaline resistance of Albizzia julibrissin Durazz seedlings, the contents of MDA, soluble sugar and proline, and the activity of POD and SOD in Albizzia julibrissin durazz tree body were measured by means of visible spectrophotometry. Also, the change patterns of the five indexes with different treatment concentration and time were analyzed. Attempts were then made to elucidate the physiological mechanism of how alkaline stress affects the growth of the Albizzia julibrissin durazz tree, which could provide theoretical foundation for planting and gardening and an approach to dealing with the difficulties in planting and gardening in saline and alkaline area. The results showed that with the increase in Na2 CO3 concentration, the contents of MDA and soluble sugar in the leaves slowly ascended when the treatment concentration was lower than 75 mmol x L(-1), and then rapidly increased when the treatment concentration was higher than 75 mmol x L(-1); There were significant differences between different treatments. Proline content exhibited the same change pattern with MDA and soluble sugar. It slowly ascended when the treatment concentration was lower than 100 mmol x L(-1), whereas it sharply increased when the treatment concentration was above 100 mmol x L(-1); The changes in SOD and POD were similar, showing a unimodal pattern. However, the treatment concentration corresponding to the maximum of SOD and POD was 50 and 75 mmol x L(-1), respectively. With the changes in stress time, in addition, the contents of MDA treated with the same concentration increased gradually. However, praline, soluble sugar, SOD and POD changed irregularly. These results indicated that Albizzia julibrissin Durazz could resist the alkaline stress by modulating values of physical indexes such as the contents of MDA, soluble sugar and

  9. Microbial thiocyanate utilization under highly alkaline conditions.

    Science.gov (United States)

    Sorokin, D Y; Tourova, T P; Lysenko, A M; Kuenen, J G

    2001-02-01

    Three kinds of alkaliphilic bacteria able to utilize thiocyanate (CNS-) at pH 10 were found in highly alkaline soda lake sediments and soda soils. The first group included obligate heterotrophs that utilized thiocyanate as a nitrogen source while growing at pH 10 with acetate as carbon and energy sources. Most of the heterotrophic strains were able to oxidize sulfide and thiosulfate to tetrathionate. The second group included obligately autotrophic sulfur-oxidizing alkaliphiles which utilized thiocyanate nitrogen during growth with thiosulfate as the energy source. Genetic analysis demonstrated that both the heterotrophic and autotrophic alkaliphiles that utilized thiocyanate as a nitrogen source were related to the previously described sulfur-oxidizing alkaliphiles belonging to the gamma subdivision of the division Proteobacteria (the Halomonas group for the heterotrophs and the genus Thioalkalivibrio for autotrophs). The third group included obligately autotrophic sulfur-oxidizing alkaliphilic bacteria able to utilize thiocyanate as a sole source of energy. These bacteria could be enriched on mineral medium with thiocyanate at pH 10. Growth with thiocyanate was usually much slower than growth with thiosulfate, although the biomass yield on thiocyanate was higher. Of the four strains isolated, the three vibrio-shaped strains were genetically closely related to the previously described sulfur-oxidizing alkaliphiles belonging to the genus Thioalkalivibrio. The rod-shaped isolate differed from the other isolates by its ability to accumulate large amounts of elemental sulfur inside its cells and by its ability to oxidize carbon disulfide. Despite its low DNA homology with and substantial phenotypic differences from the vibrio-shaped strains, this isolate also belonged to the genus Thioalkalivibrio according to a phylogenetic analysis. The heterotrophic and autotrophic alkaliphiles that grew with thiocyanate as an N source possessed a relatively high level of cyanase

  10. Electromembrane recycling of highly mineralized alkaline blowdown water from evaporative water treatment plants at thermal power stations

    Science.gov (United States)

    Chichirova, N. D.; Chichirov, A. A.; Lyapin, A. I.; Minibaev, A. I.; Silov, I. Yu.; Tolmachev, L. I.

    2016-12-01

    Thermal power stations (TPS) are the main source of highly mineralized effluents affecting the environment. An analysis of their water systems demonstrates that alkaline effluents prevail at TPSs. Extraction of an alkali from highly mineralized effluents can make the recycling of effluents economically feasible. A method is proposed of electromembrane recycling of liquid alkaline highly mineralized wastes from TPSs. The process includes electromembrane apparatuses of two types, namely, a diffusion dialysis extractor (DDE) intended for extraction of the alkali from a highly mineralized solution having a complex composition and an electrodialysis concentrator for increasing the concentration of the extracted solution to a value suitable for use in water treatment plants at TPSs. For implementation of the first process (i.e. the extraction of alkali from alkaline-salt solution) various membranes from various manufacturers were studied: CM-PAD and AM-PAD (Ralex, Czechia), MK-40, MA-40, MA-41, MA-414, and MB-2 (OOO OKhK "Shchekinoazot", Russia), AR103-QDF and CR61-CMP (Ionies Inc., USA). The experiments demonstrate that the acceptable degree of separation of the alkali and the salt is achieved in a pair of cation-exchange membranes with the efficiency of separation being higher without an electric field. The highest efficiency was attained with Russian-made membranes (MK-40, OOO OKhK "Shchekinoazot"). A full scale experiment on recycling of highly-mineralized blowdown water from the evaporating water treatment system at the Kazan cogeneration power station No. 3 (TETs-3) was performed in a pilot unit consisting of two electromembrane apparatuses made by UAB "Membraninės Technologijos LT". In the experiments every ton of blowdown water yielded 0.1 t of concentrated alkaline solution with an alkali content of up to 4 wt % and 0.9 t of the softened salt solution suitable for the reuse in the TPS cycle. The power rate is 6 kWh / ton of blowdown water.

  11. pSKAP/S: An expression vector for the production of single-chain Fv alkaline phosphatase fusion proteins.

    Science.gov (United States)

    Griep, R A; van Twisk, C; Kerschbaumer, R J; Harper, K; Torrance, L; Himmler, G; van der Wolf, J M; Schots, A

    1999-06-01

    The vector pSKAP/S was constructed to enable overexpression of single-chain variable fragment antibody (scFv)-alkaline phosphatase fusion proteins. In pSKAP/S, the scFv were genetically fused to the mutated Escherichia coli PhoA/S gene that encodes an alkaline phosphatase with increased specific activity. The restriction sites incorporated into pSKAP/S allowed the scFv genes to be easily transferred from pUC119-derived phagemid vectors that are used frequently in phage display antibody library technology. Strong transcriptional control of expression was achieved using the tetracycline promoter, and induction of different individual clones with anhydrotetracycline resulted in secretion of most of the scFv-alkaline phosphatase fusion proteins into the culture medium. Although some of the clones secreted fusion proteins that were retained in the periplasm, these proteins could be isolated with a simple extraction procedure. Increased amounts of a scFv-alkaline phosphatase fusion protein were obtained when expressed in the pSKAP/S vector compared with expression in a vector incorporating the lac promoter. Testing for binding of the scFv-alkaline phosphatase fusion proteins to antigen was possible in an ELISA without the need for additional enzyme-conjugated antibodies. The pSKAP/S vector was successfully used to obtain scFv fragments from a preparation of phage-antibody clones after subcloning and expression of individual clones as scFv-alkaline phosphatase fusions, whereas fewer clones (and clones with different properties) were obtained from the same phage-antibody preparations when expressed as soluble scFv fragments. Therefore, the pSKAP/S vector was shown to be useful in extending the range of scFv obtained from phage display libraries. Copyright 1999 Academic Press.

  12. Rapid Detection of Pathogens

    Energy Technology Data Exchange (ETDEWEB)

    David Perlin

    2005-08-14

    Pathogen identification is a crucial first defense against bioterrorism. A major emphasis of our national biodefense strategy is to establish fast, accurate and sensitive assays for diagnosis of infectious diseases agents. Such assays will ensure early and appropriate treatment of infected patients. Rapid diagnostics can also support infection control measures, which monitor and limit the spread of infectious diseases agents. Many select agents are highly transmissible in the early stages of disease, and it is critical to identify infected patients and limit the risk to the remainder of the population and to stem potential panic in the general population. Nucleic acid-based molecular approaches for identification overcome many of the deficiencies associated with conventional culture methods by exploiting both large- and small-scale genomic differences between organisms. PCR-based amplification of highly conserved ribosomal RNA (rRNA) genes, intergenic sequences, and specific toxin genes is currently the most reliable approach for bacterial, fungal and many viral pathogenic agents. When combined with fluorescence-based oligonucleotide detection systems, this approach provides real-time, quantitative, high fidelity analysis capable of single nucleotide allelic discrimination (4). These probe systems offer rapid turn around time (<2 h) and are suitable for high throughput, automated multiplex operations that are critical for clinical diagnostic laboratories. In this pilot program, we have used molecular beacon technology invented at the Public health Research Institute to develop a new generation of molecular probes to rapidly detect important agents of infectious diseases. We have also developed protocols to rapidly extract nucleic acids from a variety of clinical specimen including and blood and tissue to for detection in the molecular assays. This work represented a cooperative research development program between the Kramer-Tyagi/Perlin labs on probe development

  13. Ultrasound Assisted Extraction of capsaicinoids from peppers

    OpenAIRE

    Fernández Barbero, Gerardo; Liazid, Ali; Palma Lovillo, Miguel; García Barroso, Carmelo

    2008-01-01

    The development of a rapid, reproducible and simple method of extraction of the majority capsaicinoids (nordihydrocapsaicin, capsaicin, dihydrocapsaicin, homocapsaicin and homodihydrocapsaicin) present in hot peppers by the employment of ultrasound-assisted extraction is reported.

  14. Alkaline Materials and Regenerative Endodontics: A Review

    Directory of Open Access Journals (Sweden)

    Bill Kahler

    2017-12-01

    Full Text Available Periapical health is the primary goal of endodontic treatment in mature and immature teeth. In addition, the goals of treatment of immature teeth with arrested root development include root growth to length and maturation of the apex, as well as thickening of the canal wall. These goals are valid for immature teeth that have been subjected to trauma and dental caries or that are the result of developmental anomalies that expose the tooth to the risk of pulp necrosis and consequently result in the cessation of root maturation. Regenerative endodontic procedures (REPs have been described as a “paradigm shift” in the treatment of immature teeth with pulp necrosis and underdeveloped roots, as there is the potential for further root maturation and return of vitality. Treatment with REPs is advocated as the treatment of choice for immature teeth with pulp necrosis. REP protocols involve the use of alkaline biomaterials, primarily sodium hypochlorite, calcium hydroxide, mineral trioxide aggregates and Biodentine, and are the essential components of a successful treatment regimen.

  15. Characterization of alkaline xylanases from Bacillus pumilus

    Directory of Open Access Journals (Sweden)

    Duarte Marta Cristina Teixeira

    2000-01-01

    Full Text Available Alkaline xylanases produced by four different strains of Bacillus pumilus were characterized. The optimal pH and temperature were pH 9.0 and 60ºC for strain 13a, and pH 8.0 and 55ºC for strains 5(2, 5(14, and 4a. Under these conditions the following activities were found after 10 min in the presence of 1% xylan (birchwood: 328 U.ml-1, 131 U.ml-1, 90 U.ml-1, and 167 U.ml-1, respectively, for the four strains. The enzymes were stable at 40ºC, with 40% of the xylanase activity remaining after 2 hours for the enzymes of strain 5(2 and 60% for the other three strains. Stability at 50ºC was improved by addition of glycerol. Taking into account the conditions under which kraft pulps are bleached during the manufacture of paper, xylanases from B. pumilus exhibit favorable potential for application to bleaching in the paper making process.

  16. Alkaline fuel cell with nitride membrane

    Science.gov (United States)

    Sun, Shen-Huei; Pilaski, Moritz; Wartmann, Jens; Letzkus, Florian; Funke, Benedikt; Dura, Georg; Heinzel, Angelika

    2017-06-01

    The aim of this work is to fabricate patterned nitride membranes with Si-MEMS-technology as a platform to build up new membrane-electrode-assemblies (MEA) for alkaline fuel cell applications. Two 6-inch wafer processes based on chemical vapor deposition (CVD) were developed for the fabrication of separated nitride membranes with a nitride thickness up to 1 μm. The mechanical stability of the perforated nitride membrane has been adjusted in both processes either by embedding of subsequent ion implantation step or by optimizing the deposition process parameters. A nearly 100% yield of separated membranes of each deposition process was achieved with layer thickness from 150 nm to 1 μm and micro-channel pattern width of 1μm at a pitch of 3 μm. The process for membrane coating with electrolyte materials could be verified to build up MEA. Uniform membrane coating with channel filling was achieved after the optimization of speed controlled dip-coating method and the selection of dimethylsulfoxide (DMSO) as electrolyte solvent. Finally, silver as conductive material was defined for printing a conductive layer onto the MEA by Ink-Technology. With the established IR-thermography setup, characterizations of MEAs in terms of catalytic conversion were performed successfully. The results of this work show promise for build up a platform on wafer-level for high throughput experiments.

  17. Reduction of Proteinuria through Podocyte Alkalinization*

    Science.gov (United States)

    Altintas, Mehmet M.; Moriwaki, Kumiko; Wei, Changli; Möller, Clemens C.; Flesche, Jan; Li, Jing; Yaddanapudi, Suma; Faridi, Mohd Hafeez; Gödel, Markus; Huber, Tobias B.; Preston, Richard A.; Jiang, Jean X.; Kerjaschki, Dontscho; Sever, Sanja; Reiser, Jochen

    2014-01-01

    Podocytes are highly differentiated cells and critical elements for the filtration barrier of the kidney. Loss of their foot process (FP) architecture (FP effacement) results in urinary protein loss. Here we show a novel role for the neutral amino acid glutamine in structural and functional regulation of the kidney filtration barrier. Metabolic flux analysis of cultured podocytes using genetic, toxic, and immunologic injury models identified increased glutamine utilization pathways. We show that glutamine uptake is increased in diseased podocytes to couple nutrient support to increased demand during the disease state of FP effacement. This feature can be utilized to transport increased amounts of glutamine into damaged podocytes. The availability of glutamine determines the regulation of podocyte intracellular pH (pHi). Podocyte alkalinization reduces cytosolic cathepsin L protease activity and protects the podocyte cytoskeleton. Podocyte glutamine supplementation reduces proteinuria in LPS-treated mice, whereas acidification increases glomerular injury. In summary, our data provide a metabolic opportunity to combat urinary protein loss through modulation of podocyte amino acid utilization and pHi. PMID:24817115

  18. 2nd Generation alkaline electrolysis. Final report

    Energy Technology Data Exchange (ETDEWEB)

    Yde, L. [Aarhus Univ. Business and Social Science - Centre for Energy Technologies (CET), Aarhus (Denmark); Kjartansdottir, C.K. [Technical Univ. of Denmark. DTU Mechanical Engineering, Kgs. Lyngby (Denmark); Allebrod, F. [Technical Univ. of Denmark. DTU Energy Conversion, DTU Risoe Campus, Roskilde (Denmark)] [and others

    2013-03-15

    The overall purpose of this project has been to contribute to this load management by developing a 2{sup nd} generation of alkaline electrolysis system characterized by being compact, reliable, inexpensive and energy efficient. The specific targets for the project have been to: 1) Increase cell efficiency to more than 88% (according to the higher heating value (HHV)) at a current density of 200 mA /cm{sup 2}; 2) Increase operation temperature to more than 100 degree Celsius to make the cooling energy more valuable; 3) Obtain an operation pressure more than 30 bar hereby minimizing the need for further compression of hydrogen for storage; 4) Improve stack architecture decreasing the price of the stack with at least 50%; 5) Develop a modular design making it easy to customize plants in the size from 20 to 200 kW; 6) Demonstrating a 20 kW 2{sup nd} generation stack in H2College at the campus of Arhus University in Herning. The project has included research and development on three different technology tracks of electrodes; an electrochemical plating, an atmospheric plasma spray (APS) and finally a high temperature and pressure (HTP) track with operating temperature around 250 deg. C and pressure around 40 bar. The results show that all three electrode tracks have reached high energy efficiencies. In the electrochemical plating track a stack efficiency of 86.5% at a current density of 177mA/cm{sup 2} and a temperature of 74.4 deg. C has been shown. The APS track showed cell efficiencies of 97%, however, coatings for the anode side still need to be developed. The HTP cell has reached 100 % electric efficiency operating at 1.5 V (the thermoneutral voltage) with a current density of 1. 1 A/cm{sup 2}. This track only tested small cells in an externally heated laboratory set-up, and thus the thermal loss to surroundings cannot be given. The goal set for the 2{sup nd} generation electrolyser system, has been to generate 30 bar pressure in the cell stack. An obstacle to be

  19. High temperature and pressure alkaline electrolysis

    DEFF Research Database (Denmark)

    Allebrod, Frank; Chatzichristodoulou, Christodoulos; Mogensen, Mogens Bjerg

    2013-01-01

    for immobilization of aqueous KOH solutions. Electrolysis cells with this electrolyte and metal foam based gas diffusion electrodes were successfully demonstrated at temperatures up to 250 °C at 40 bar. Different electro-catalysts were tested in order to reduce the oxygen and hydrogen overpotentials. Current...... the operational temperature and pressure to produce pressurized hydrogen at high rate (m3 H2·h-1·m-2 cell area) and high electrical efficiency. This work describes an exploratory technical study of the possibility to produce hydrogen and oxygen with a new type of alkaline electrolysis cell at high temperatures...... densities of 1.1 A cm-2 and 2.3 A cm-2 have been measured at a cell voltage of 1.5 V and 1.75 V, respectively, without noble metal catalysts. Electrical efficiencies of almost 99 % at 1.1 A cm-2 and 85 % at 2.3 A cm-2 were obtained....

  20. Response of Desulfovibrio vulgaris to Alkaline Stress

    Energy Technology Data Exchange (ETDEWEB)

    Stolyar, S.; He, Q.; He, Z.; Yang, Z.; Borglin, S.E.; Joyner, D.; Huang, K.; Alm, E.; Hazen, T.C.; Zhou, J.; Wall, J.D.; Arkin, A.P.; Stahl, D.A.

    2007-11-30

    The response of exponentially growing Desulfovibrio vulgarisHildenborough to pH 10 stress was studied using oligonucleotidemicroarrays and a study set of mutants with genes suggested by microarraydata to be involved in the alkaline stress response deleted. The datashowed that the response of D. vulgaris to increased pH is generallysimilar to that of Escherichia coli but is apparently controlled byunique regulatory circuits since the alternative sigma factors (sigma Sand sigma E) contributing to this stress response in E. coli appear to beabsent in D. vulgaris. Genes previously reported to be up-regulated in E.coli were up-regulated in D. vulgaris; these genes included three ATPasegenes and a tryptophan synthase gene. Transcription of chaperone andprotease genes (encoding ATP-dependent Clp and La proteases and DnaK) wasalso elevated in D. vulgaris. As in E. coli, genes involved in flagellumsynthesis were down-regulated. The transcriptional data also identifiedregulators, distinct from sigma S and sigma E, that are likely part of aD. vulgaris Hildenborough-specific stress response system.Characterization of a study set of mutants with genes implicated inalkaline stress response deleted confirmed that there was protectiveinvolvement of the sodium/proton antiporter NhaC-2, tryptophanase A, andtwo putative regulators/histidine kinases (DVU0331 andDVU2580).

  1. Alkaline Materials and Regenerative Endodontics: A Review.

    Science.gov (United States)

    Kahler, Bill; Chugal, Nadia; Lin, Louis M

    2017-12-05

    Periapical health is the primary goal of endodontic treatment in mature and immature teeth. In addition, the goals of treatment of immature teeth with arrested root development include root growth to length and maturation of the apex, as well as thickening of the canal wall. These goals are valid for immature teeth that have been subjected to trauma and dental caries or that are the result of developmental anomalies that expose the tooth to the risk of pulp necrosis and consequently result in the cessation of root maturation. Regenerative endodontic procedures (REPs) have been described as a "paradigm shift" in the treatment of immature teeth with pulp necrosis and underdeveloped roots, as there is the potential for further root maturation and return of vitality. Treatment with REPs is advocated as the treatment of choice for immature teeth with pulp necrosis. REP protocols involve the use of alkaline biomaterials, primarily sodium hypochlorite, calcium hydroxide, mineral trioxide aggregates and Biodentine, and are the essential components of a successful treatment regimen.

  2. Alkaline Phosphatase, an Unconventional Immune Protein

    Directory of Open Access Journals (Sweden)

    Bethany A. Rader

    2017-08-01

    Full Text Available Recent years have seen an increase in the number of studies focusing on alkaline phosphatases (APs, revealing an expanding complexity of function of these enzymes. Of the four human AP (hAP proteins, most is known about tissue non-specific AP (TNAP and intestinal AP (IAP. This review highlights current understanding of TNAP and IAP in relation to human health and disease. TNAP plays a role in multiple processes, including bone mineralization, vitamin B6 metabolism, and neurogenesis, is the genetic cause of hypophosphatasia, influences inflammation through regulation of purinergic signaling, and has been implicated in Alzheimer’s disease. IAP regulates fatty acid absorption and has been implicated in the regulation of diet-induced obesity and metabolic syndrome. IAP and TNAP can dephosphorylate bacterial-derived lipopolysaccharide, and IAP has been identified as a potential regulator of the composition of the intestinal microbiome, an evolutionarily conserved function. Endogenous and recombinant bovine APs and recombinant hAPs are currently being explored for their potential as pharmacological agents to treat AP-associated diseases and mitigate multiple sources of inflammation. Continued research on these versatile proteins will undoubtedly provide insight into human pathophysiology, biochemistry, and the human holobiont.

  3. Polyvinyl alcohol battery separator containing inert filler. [alkaline batteries

    Science.gov (United States)

    Sheibley, D. W.; Hsu, L. C.; Manzo, M. A. (Inventor)

    1981-01-01

    A cross-linked polyvinyl alcohol battery separator is disclosed. A particulate filler, inert to alkaline electrolyte of an alkaline battery, is incorporated in the separator in an amount of 1-20% by weight, based on the weight of the polyvinyl alcohol, and is dispersed throughout the product. Incorporation of the filler enhances performance and increases cycle life of alkaline batteries when compared with batteries containing a similar separator not containing filler. Suitable fillers include titanates, silicates, zirconates, aluminates, wood floor, lignin, and titania. Particle size is not greater than about 50 microns.

  4. Alkaline liquid chromatography/electrospray ionization skimmer collision-induced dissociation mass spectrometry for phosphopeptide screening.

    Science.gov (United States)

    Beck, A; Deeg, M; Moeschel, K; Schmidt, E K; Schleicher, E D; Voelter, W; Häring, H U; Lehmann, R

    2001-01-01

    A rapid on-line method for the identification of phosphorylated peptides in enzymatic protein digests by specific marker ion signals is described. In our study we investigated the use of alkaline conditions together with a previously described method for selective and sensitive detection of phosphopeptide ions combining high-performance capillary liquid chromatography (LC) and electrospray ionization mass spectrometry (ESI-MS). Phosphorylation-specific marker ions (m/z 79, PO(3)(-), and m/z 97, H(2)PO(4)(-)) were generated by skimmer collision-induced dissociation (sCID) in the negative-ion mode. The method was evaluated and validated for mono-phosphorylated synthetic peptides using different alkaline pH values and CID offsets. Alkaline conditions (pH 10.5) enhance the generation of phosphopeptide-specific fragment ions from serine- and tyrosine-phosphorylated peptides, and enable the use of m/z 79 (PO(3)(-)) and m/z 97 (H(2)PO(4)(-)) as phosphorylation-specific marker traces. Note that HPLC separation in trifluoroacetic acid containing solvents impairs the use of m/z 97 (C(2)F(3)O(-) fragment ion at m/z 97) as a phosphorylation-specific marker. The optimized method was applied for the detection of phosphorylated peptides in a tryptic beta-casein digest. The expected mono- and tetra-phosphorylated peptides were detected and rapidly identified by (mu)LC/ESI-sCID-MS and (mu)LC/ESI-MS analysis. Copyright 2001 John Wiley & Sons, Ltd.

  5. The solubilization of tetrameric alkaline phosphatase from human liver and its conversion into various forms by phosphatidylinositol phospholipase C or proteolysis.

    Science.gov (United States)

    Hawrylak, K; Stinson, R A

    1988-10-05

    When membrane-bound human liver alkaline phosphatase was treated with a phosphatidylinositol (PI) phospholipase C obtained from Bacillus cereus, or with the proteases ficin and bromelain, the enzyme released was dimeric. Butanol extraction of the plasma membranes at pH 7.6 yielded a water-soluble, aggregated form that PI phospholipase C could also convert to dimers. When the membrane-bound enzyme was solubilized with a non-ionic detergent (Nonidet P-40), it had the Mr of a tetramer; this, too, was convertible to dimers with PI phospholipase C or a protease. Butanol extraction of whole liver tissue at pH 6.6 and subsequent purification yielded a dimeric enzyme on electrophoresis under nondenaturing conditions, whereas butanol extraction at pH values of 7.6 or above and subsequent purification by immunoaffinity chromatography yielded an enzyme with a native Mr twice that of the dimeric form. This high molecular weight form showed a single Coomassie-stained band (Mr = 83,000) on electrophoresis under denaturing conditions in sodium dodecyl sulfate, as did its PI phospholipase C cleaved product; this Mr was the same as that obtained with the enzyme purified from whole liver using butanol extraction at pH 6.6. These results are highly suggestive of the presence of a butanol-activated endogenous enzyme activity (possibly a phospholipase) that is optimally active at an acidic pH. Inhibition of this activity by maintaining an alkaline pH during extraction and purification results in a tetrameric enzyme. Alkaline phosphatase, whether released by phosphatidylinositol (PI) phospholipase C or protease treatment of intact plasma membranes, or purified in a dimeric form, would not adsorb to a hydrophobic medium. PI phospholipase C treatment of alkaline phosphatase solubilized from plasma membranes by either detergent or butanol at pH 7.6 yielded a dimeric enzyme that did not absorb to the hydrophobic medium, whereas the untreated preparations did. This adsorbed activity was

  6. Rapid determination of capsaicinoids by colorimetric method

    OpenAIRE

    Ryu, Wang-Kyun; Kim, Hee-Woong; Kim, Geun-Dong; Rhee, Hae-Ik

    2016-01-01

    Capsaicinoids, the pungent component of chili peppers, are generally analyzed by precise analytical techniques, such as gas chromatography and high-performance liquid chromatography (HPLC), but these are not practical for the mass analyses of samples. To analyze mass samples rapidly, a colorimetric method was suggested. In this work, pigments and capsaicinoids were efficiently separated from chili pepper extract by sequential solid–liquid extraction and liquid–liquid extraction in test tubes ...

  7. Rapid chemical separations

    CERN Document Server

    Trautmann, N

    1976-01-01

    A survey is given on the progress of fast chemical separation procedures during the last few years. Fast, discontinuous separation techniques are illustrated by a procedure for niobium. The use of such techniques for the chemical characterization of the heaviest known elements is described. Other rapid separation methods from aqueous solutions are summarized. The application of the high speed liquid chromatography to the separation of chemically similar elements is outlined. The use of the gas jet recoil transport method for nuclear reaction products and its combination with a continuous solvent extraction technique and with a thermochromatographic separation is presented. Different separation methods in the gas phase are briefly discussed and the attachment of a thermochromatographic technique to an on-line mass separator is shown. (45 refs).

  8. Protective effect of high alkalinity against the deleterious effects of chronic waterborne cadmium exposure on the detection of alarm cues by juvenile silver catfish (Rhamdia quelen).

    Science.gov (United States)

    Kochhann, Daiani; Benaduce, Ana Paula S; Copatti, Carlos E; Lorenzatto, Karina R; Mesko, Márcia F; Flores, Erico M M; Dressler, Valderi L; Baldisserotto, Bernardo

    2009-05-01

    The objective of the present study was to analyze the effect of chronic cadmium (Cd) exposure at two alkalinity levels (63 and 92 mg l(-1) CaCO(3)) on the antipredatory behavior of juvenile silver catfish (Rhamdia quelen) exposed to conspecific skin extract and predator odor. At an alkalinity of 63 mg l(-1) CaCO(3), 30 days of exposure to either 4.5 or 8.0 microg l(-1) Cd impaired the catfish's antipredatory response to alarm cues. However, silver catfish exposed to 4.5 microg l(-1) Cd at an alkalinity of 92 mg l(-1) CaCO(3) responded to skin extract and predator odor. In catfish exposed to 8.0 microg l(-1) Cd at the same alkalinity, only the number of feeding bites decreased, and this occurred only for specimens exposed to predator odor. Our results show that higher alkalinity protected against the deleterious effects of Cd on alarm cue detection but only in the larvae exposed to the lowest waterborne Cd level.

  9. Alkaline flood prediction studies, Ranger VII pilot, Wilmington Field, California

    Energy Technology Data Exchange (ETDEWEB)

    Mayer, E.H.; Breit, V.S.

    1982-01-01

    The paper discusses: (1) The design of a simulator to model alkaline displacement mechanisms and the current state-of-the-art understanding of in-situ caustic consumption. (2) Assimilation of laboratory core flood and rock consumption data. Use of this data in 1-D and 2-D limited area simulations, and a 3-D model of the entire pilot project. (3) Simulation studies of alkaline flood behavior in a small 2-D area of the field for various concentrations, slug sizes, long term consumption functions and two relative permeability adjustment mechanisms. (4) Scale up of 2-D simulation results, and their use in a 271 acre 1.097 x 10/sup 6/m/sup 2/), 7 layered 3-D model of the pilot. (5) Comparison of 3-D simulator results with initial field alkaline flood performance. (6) Recommended additional application of the simulator methods developed in this pilot and in other alkaline floods. 10 refs.

  10. Bipolar membrane electrodialysis for the alkalinization of ethanolamine salts

    NARCIS (Netherlands)

    de Groot, Matheus T.; de Rooij, Ralph M.; Bos, Ardina A.C.M.; Bargeman, Gerrald

    2011-01-01

    Bipolar membrane electrodialysis for the production of organic bases, in contrast to organic acids, has received little attention in the scientific literature. In the present work we have investigated and compared different membrane configurations for the alkalinization of monoethanolamine salts

  11. Microbial alkaline proteases: Optimization of production parameters and their properties

    Directory of Open Access Journals (Sweden)

    Kanupriya Miglani Sharma

    2017-06-01

    Full Text Available Proteases are hydrolytic enzymes capable of degrading proteins into small peptides and amino acids. They account for nearly 60% of the total industrial enzyme market. Proteases are extensively exploited commercially, in food, pharmaceutical, leather and detergent industry. Given their potential use, there has been renewed interest in the discovery of proteases with novel properties and a constant thrust to optimize the enzyme production. This review summarizes a fraction of the enormous reports available on various aspects of alkaline proteases. Diverse sources for isolation of alkaline protease producing microorganisms are reported. The various nutritional and environmental parameters affecting the production of alkaline proteases in submerged and solid state fermentation are described. The enzymatic and physicochemical properties of alkaline proteases from several microorganisms are discussed which can help to identify enzymes with high activity and stability over extreme pH and temperature, so that they can be developed for industrial applications.

  12. Combined wet oxidation and alkaline hydrolysis of polyvinylchloride

    DEFF Research Database (Denmark)

    Sørensen, E.; Bjerre, A.B.

    1992-01-01

    In view of the widespread aversion to burning polyvinylchloride (PVC) together with municipal waste, we have attempted an alternative approach to its decomposition. This paper describes a combined wet oxidation/alkaline hydrolysis yielding water soluble, biodegradable products. Experiments were...

  13. Review and assessment of technologies for the separation of strontium from alkaline and acidic media

    Energy Technology Data Exchange (ETDEWEB)

    Orth, R.J.; Kurath, D.E.

    1994-01-01

    A literature survey has been conducted to identify and evaluate methods for the separation of strontium from acidic and alkaline media as applied to Hanford tank waste. The most promising methods of solvent extraction, precipitation, and ion exchange are described. The following criteria were used for evaluating the separation methods: Appreciable strontium removal must be demonstrated; Strontium selectivity over bulk components must be demonstrated; The method must show promise for evolving into a practical and fairly simple process; The process should be safe to operate; The method must be robust (i.e., capable of separating strontium from various waste types); Secondary waste generation must be minimized; and The method must show resistance to radiation damage. The methods discussed did not necessarily satisfy all of the above criteria; thus, key areas requiring further development are also given for each method. Less promising solvent extraction, precipitation, and ion exchange methods were also identified; areas for potential development are included in this report.

  14. Rapid extraction of uranium from sea water using Fe{sub 3}O{sub 4} and humic acid coated Fe{sub 3}O{sub 4} nanoparticles

    Energy Technology Data Exchange (ETDEWEB)

    Singhal, Pallavi, E-mail: psinghal@barc.gov.in [Homi Bhabha National Institute, Mumbai 400094 (India); Health Physics Division, Bhabha Atomic Research Centre, Mumbai 400085 (India); Jha, Sanjay K. [Homi Bhabha National Institute, Mumbai 400094 (India); Health Physics Division, Bhabha Atomic Research Centre, Mumbai 400085 (India); Pandey, Shailaja P. [Analytical Chemistry Division, Bhabha Atomic Research Centre, Mumbai 400085 (India); Neogy, Suman [Mechanical Metallurgy Division, Bhabha Atomic Research Centre, Mumbai 400085 (India)

    2017-08-05

    Highlights: • Uranium extraction using Fe{sub 3}O{sub 4} and HA coated Fe{sub 3}O{sub 4} NPs has been demonstrated. • Result indicates uranium extraction from both water and sea water matrix. • With increase in HA coating uranium extraction increases. • Fe{sub 3}O{sub 4}/HA 1 is the best material among synthesized one for uranium extraction. - Abstract: Uranium is one of the most toxic elements present in the environment and a number of methods have been developed for its extraction. Herein we have demonstrated a new method using magnetic nanoparticles (NPs) that can be used for uranium extraction from water and sea water matrix. Fe{sub 3}O{sub 4} and humic acid (HA) coated Fe{sub 3}O{sub 4} NPs with different amount of HA coating were synthesized and uranium sorption from water and sea water matrix was demonstrated. It was observed that sorption increases with increase in amount of HA coating. NPs settlement in presence of magnetic field was monitored where only bare Fe{sub 3}O{sub 4} and Fe{sub 3}O{sub 4}/HA 1 NPs settles while no settlement was observed for Fe{sub 3}O{sub 4}/HA 2 and Fe{sub 3}O{sub 4}/HA 3 NPs. Considering both sorption and particle separation from the matrix Fe{sub 3}O{sub 4}/HA 1 NPs are the best among synthesized ones with maximum sorption capacity of 10.5 mg of U/g of NPs. The results presented here reveal the exceptional potential of magnetic NPs and functionalized magnetic NPs for environmental remediation of uranium and to extract uranium from sea water on which to the best of our knowledge no report is available till now.

  15. Chlorine solubility in evolved alkaline magmas

    Directory of Open Access Journals (Sweden)

    M. R. Carroll

    2005-06-01

    Full Text Available Experimental studies of Cl solubility in trachytic to phonolitic melts provide insights into the capacity of alkaline magmas to transport Cl from depth to the earth?s surface and atmosphere, and information on Cl solubility variations with pressure, temperature and melt or fluid composition is crucial for understanding the reasons for variations in Cl emissions at active volcanoes. This paper provides a brief review of Cl solubility experiments conducted on a range of trachytic to phonolitic melt compositions. Depending on the experimental conditions the melts studied were in equilibrium with either a Cl-bearing aqueous fluid or a subcritical assemblage of low- Cl aqueous fluid + Cl-rich brine. The nature of the fluid phase(s was identified by examination of fluid inclusions present in run product glasses and the fluid bulk composition was calculated by mass balance. Chlorine concentrations in the glass increase with increasing Cl molality in the fluid phase until a plateau in Cl concentration is reached when melt coexists with aqueous fluid + brine. With fluids of similar Cl molality, higher Cl concentrations are observed in peralkaline phonolitic melts compared with peraluminous phonolitic melts; overall the Cl concentrations observed in phonolitic and trachytic melts are approximately twice those found in calcalkaline rhyolitic melts under similar conditions. The observed negative pressure dependence of Cl solubility implies that Cl contents of melts may actually increase during magma decompression if the magma coexists with aqueous fluid and Cl-rich brine (assuming melt-vapor equilibrium is maintained. The high Cl contents (approaching 1 wt% Cl observed in some melts/glasses from the Vesuvius and Campi Flegrei areas suggest saturation with a Cl-rich brine prior to eruption.

  16. Photovoltaic hydrogen production with commercial alkaline electrolysers

    Energy Technology Data Exchange (ETDEWEB)

    Ursua, A.; Lopez, J.; Gubia, E.; Marroyo, L.; Sanchis, P. [Public Univ. of Navarra, Pamplona (Spain). Dept. of Electric and Electronic Engineering

    2010-07-01

    Renewable energy sources and Electrolysis generate the so-called green Hydrogen, a zero-emission and potentially fossil fuel independent energy source. However, the inherent variability of the renewable energy sources implies a mode of operation for which most current electrolysers have not been designed. This paper analyses the operation of a water electrolyser fed with photovoltaic (PV) generator electric profile. The system, Integrated by a 1 Nm{sup 3}/h Hydrogenics alkaline electrolyser and a 5100 W PV generator with 60 BP585 modules, is installed at the Public University of Navarra (Spain). The PV generator profile fed to the electrolyser is emulated by a custom-made apparatus designed and built by the authors of this paper. The profile is designed according to real irradiance data measured by a calibration cell. The irradiance data are converted to the electric power profile that the PV generator would have delivered in case of having been connected to the electrolyser by means of a DC/DC converter with maximum power point tracking (MPPT). Finally, from previously measured power-current electrolyser characteristic curves, the current profile to be delivered to the electrolyser is obtained and programmed to the electronic device. The electrolyser was tested for two types of days. During the first day, the irradiance was very stable, whereas during the second day, the irradiance was very variable. The experimental results show an average power consumption rate and an efficiency of 4908 Wh/Nm{sup 3} and 72.1%, on the first day, and 4842 Wh/Nm{sup 3} and 73.3% on the second day. The electrolyser performance was particularly good in spite of the high variability of the electric supply of the second day. (orig.)

  17. Fluorescence quenching based alkaline phosphatase activity detection.

    Science.gov (United States)

    Mei, Yaqi; Hu, Qiong; Zhou, Baojing; Zhang, Yonghui; He, Minhui; Xu, Ting; Li, Feng; Kong, Jinming

    2018-01-01

    Simple and fast detection of alkaline phosphatase (ALP) activity is of great importance for diagnostic and analytical applications. In this work, we report a turn-off approach for the real-time detection of ALP activity on the basis of the charge transfer induced fluorescence quenching of the Cu(BCDS)22- (BCDS = bathocuproine disulfonate) probe. Initially, ALP can enzymatically hydrolyze the substrate ascorbic acid 2-phosphate to release ascorbic acid (AA). Subsequently, the AA-mediated reduction of the Cu(BCDS)22- probe, which displays an intense photoluminescence band at the wavelength of 402nm, leads to the static quenching of fluorescence of the probe as a result of charge transfer. The underlying mechanism of the fluorescence quenching was demonstrated by quantum mechanical calculations. The Cu(BCDS)22- probe features a large Stokes shift (86nm) and is highly immune to photo bleaching. In addition, this approach is free of elaborately designed fluorescent probes and allows the detection of ALP activity in a real-time manner. Under optimal conditions, it provides a fast and sensitive detection of ALP activity within the dynamic range of 0-220mUmL-1, with a detection limit down to 0.27mUmL-1. Results demonstrate that it is highly selective, and applicable to the screening of ALP inhibitors in drug discovery. More importantly, it shows a good analytical performance for the direct detection of the endogenous ALP levels of undiluted human serum and even whole blood samples. Therefore, the proposed charge transfer based approach has great potential in diagnostic and analytical applications. Copyright © 2017 Elsevier B.V. All rights reserved.

  18. Alkaline Peroxide Delignification of Corn Stover

    Energy Technology Data Exchange (ETDEWEB)

    Mittal, Ashutosh [Biosciences; Katahira, Rui [National; Donohoe, Bryon S. [Biosciences; Black, Brenna A. [National; Pattathil, Sivakumar [Complex; Stringer, Jack M. [National; Beckham, Gregg T. [National

    2017-05-30

    Selective biomass fractionation into carbohydrates and lignin is a key challenge in the conversion of lignocellulosic biomass to fuels and chemicals. In the present study, alkaline hydrogen peroxide (AHP) pretreatment was investigated to fractionate lignin from polysaccharides in corn stover (CS), with a particular emphasis on the fate of the lignin for subsequent valorization. The influence of peroxide loading on delignification during AHP pretreatment was examined over the range of 30-500 mg H2O2/g dry CS at 50 degrees C for 3 h. Mass balances were conducted on the solid and liquid fractions generated after pretreatment for each of the three primary components, lignin, hemicellulose, and cellulose. AHP pretreatment at 250 mg H2O2/g dry CS resulted in the pretreated solids with more than 80% delignification consequently enriching the carbohydrate fraction to >90%. Two-dimensional nuclear magnetic resonance (2D-NMR) spectroscopy of the AHP pretreated residue shows that, under high peroxide loadings (>250 mg H2O2/g dry CS), most of the side chain structures were oxidized and the aryl-ether bonds in lignin were partially cleaved, resulting in significant delignification of the pretreated residues. Gel permeation chromatography (GPC) analysis shows that AHP pretreatment effectively depolymerizes CS lignin into low molecular weight (LMW) lignin fragments in the aqueous fraction. Imaging of AHP pretreated residues shows a more granular texture and a clear lamellar pattern in secondary walls, indicative of layers of varying lignin removal or relocalization. Enzymatic hydrolysis of this pretreated residue at 20 mg/g of glucan resulted in 90% and 80% yields of glucose and xylose, respectively, after 120 h. Overall, AHP pretreatment is able to selectively remove more than 80% of the lignin from biomass in a form that has potential for downstream valorization processes and enriches the solid pulp into a highly digestible material.

  19. Effectiveness of Alkaline Pretreatment and Acetic Acid Hydrolysis on the Characteristics of Collagen from Fish Skin of Snakehead

    Directory of Open Access Journals (Sweden)

    Wulandari Wulandari

    2015-12-01

    Full Text Available Fish skin is one of marine byproducts potential for alternative source of collagen. This studyinvestigated the effectiveness of alkaline and acetic acid pretreatment on the characteristics ofcollagen from skin snakehead fish. The concentrations of alkaline pretreatment were 0.05; 0.1; 0.15and 0.2 M for 2, 4, 6, 8, 10 and 12 hours, acetic acid concentrations were 0.05 M, 0.1 M, 0.15 M and0.2 M for 1 and 2 hours. The experimental design used for alkaline and acetic acid pretreatmentwas factorial completely randomized design. The result showed that the concentration of alkaline0.05 M for 6 hours have significant effect on the elimination of non-collagen protein (p<0.05,whereas for the optimum acetic acid at a concentration 0.1 M for 2 hours significantly differenton solubility and swelling. Extraction yields of collagen was 16%, with characteristics of whiteness66.67%, protein content 96.21%, viscosity 10 cP, Tmax 159.9oC and glass transition temperature78.55oC. The dominant amino acid composition were glycine (27.11%, proline (13.87% andalanine (12.58%. Functional groups collagen from skin snakehead fish has β-sheet structurewhich is a characteristic of collagen.

  20. Emplacement of Amba Dongar Carbonatite-alkaline Complex at ...

    Indian Academy of Sciences (India)

    40Ar-39Ar analyses of three fresh alkaline rock samples and a phlogopite separate from a carbonatite from Amba Dongar carbonatite-alkaline complex of the Deccan Flood Basalt Province, India, yield indistinguishable precise plateau ages of 64.8 ± 0.6, 64.7 ± 0.5, 65.5 ± 0.8 and 65.3 ± 0.6 Ma, giving a mean plateau age ...