WorldWideScience

Sample records for randomly integrated transgenic

  1. Transgenic plants as vital components of integrated pest management

    NARCIS (Netherlands)

    Kos, Martine; van Loon, J.J.A.; Dicke, M.; Vet, L.E.M.

    2009-01-01

    Although integrated pest management (IPM) strategies have been developed worldwide, further improvement of IPM effectiveness is required. The use of transgenic technology to create insect-resistant plants can offer a solution to the limited availability of highly insect-resistant cultivars.

  2. Analysis of T-DNA integration and generative segregation in transgenic winter triticale (x Triticosecale Wittmack

    Directory of Open Access Journals (Sweden)

    Hensel Goetz

    2012-09-01

    Full Text Available Abstract Background While the genetic transformation of the major cereal crops has become relatively routine, to date only a few reports were published on transgenic triticale, and robust data on T-DNA integration and segregation have not been available in this species. Results Here, we present a comprehensive analysis of stable transgenic winter triticale cv. Bogo carrying the selectable marker gene HYGROMYCIN PHOSPHOTRANSFERASE (HPT and a synthetic green fluorescent protein gene (gfp. Progeny of four independent transgenic plants were comprehensively investigated with regard to the number of integrated T-DNA copies, the number of plant genomic integration loci, the integrity and functionality of individual T-DNA copies, as well as the segregation of transgenes in T1 and T2 generations, which also enabled us to identify homozygous transgenic lines. The truncation of some integrated T-DNAs at their left end along with the occurrence of independent segregation of multiple T-DNAs unintendedly resulted in a single-copy segregant that is selectable marker-free and homozygous for the gfp gene. The heritable expression of gfp driven by the maize UBI-1 promoter was demonstrated by confocal laser scanning microscopy. Conclusions The used transformation method is a valuable tool for the genetic engineering of triticale. Here we show that comprehensive molecular analyses are required for the correct interpretation of phenotypic data collected from the transgenic plants.

  3. Rapid Integration of Multi-copy Transgenes Using Optogenetic Mutagenesis in Caenorhabditis elegans

    Directory of Open Access Journals (Sweden)

    Kentaro Noma

    2018-06-01

    Full Text Available Stably transmitted transgenes are indispensable for labeling cellular components and manipulating cellular functions. In Caenorhabditis elegans, transgenes are generally generated as inheritable multi-copy extrachromosomal arrays, which can be stabilized in the genome through a mutagenesis-mediated integration process. Standard methods to integrate extrachromosomal arrays primarily use protocols involving ultraviolet light plus trimethylpsoralen or gamma- or X-ray irradiation, which are laborious and time-consuming. Here, we describe a one-step integration method, following germline-mutagenesis induced by mini Singlet Oxygen Generator (miniSOG. Upon blue light treatment, miniSOG tagged to histone (Histone-miniSOG generates reactive oxygen species (ROS and induces heritable mutations, including DNA double-stranded breaks. We demonstrate that we can bypass the need to first establish extrachromosomal transgenic lines by coupling microinjection of desired plasmids with blue light illumination on Histone-miniSOG worms to obtain integrants in the F3 progeny. We consistently obtained more than one integrant from 12 injected animals in two weeks. This optogenetic approach significantly reduces the amount of time and labor for transgene integration. Moreover, it enables to generate stably expressed transgenes that cause toxicity in animal growth.

  4. Integrating Transgenic Vector Manipulation with Clinical Interventions to Manage Vector-Borne Diseases.

    Directory of Open Access Journals (Sweden)

    Kenichi W Okamoto

    2016-03-01

    Full Text Available Many vector-borne diseases lack effective vaccines and medications, and the limitations of traditional vector control have inspired novel approaches based on using genetic engineering to manipulate vector populations and thereby reduce transmission. Yet both the short- and long-term epidemiological effects of these transgenic strategies are highly uncertain. If neither vaccines, medications, nor transgenic strategies can by themselves suffice for managing vector-borne diseases, integrating these approaches becomes key. Here we develop a framework to evaluate how clinical interventions (i.e., vaccination and medication can be integrated with transgenic vector manipulation strategies to prevent disease invasion and reduce disease incidence. We show that the ability of clinical interventions to accelerate disease suppression can depend on the nature of the transgenic manipulation deployed (e.g., whether vector population reduction or replacement is attempted. We find that making a specific, individual strategy highly effective may not be necessary for attaining public-health objectives, provided suitable combinations can be adopted. However, we show how combining only partially effective antimicrobial drugs or vaccination with transgenic vector manipulations that merely temporarily lower vector competence can amplify disease resurgence following transient suppression. Thus, transgenic vector manipulation that cannot be sustained can have adverse consequences-consequences which ineffective clinical interventions can at best only mitigate, and at worst temporarily exacerbate. This result, which arises from differences between the time scale on which the interventions affect disease dynamics and the time scale of host population dynamics, highlights the importance of accounting for the potential delay in the effects of deploying public health strategies on long-term disease incidence. We find that for systems at the disease-endemic equilibrium, even

  5. Fast integration using quasi-random numbers

    International Nuclear Information System (INIS)

    Bossert, J.; Feindt, M.; Kerzel, U.

    2006-01-01

    Quasi-random numbers are specially constructed series of numbers optimised to evenly sample a given s-dimensional volume. Using quasi-random numbers in numerical integration converges faster with a higher accuracy compared to the case of pseudo-random numbers. The basic properties of quasi-random numbers are introduced, various generators are discussed and the achieved gain is illustrated by examples

  6. Fast integration using quasi-random numbers

    Science.gov (United States)

    Bossert, J.; Feindt, M.; Kerzel, U.

    2006-04-01

    Quasi-random numbers are specially constructed series of numbers optimised to evenly sample a given s-dimensional volume. Using quasi-random numbers in numerical integration converges faster with a higher accuracy compared to the case of pseudo-random numbers. The basic properties of quasi-random numbers are introduced, various generators are discussed and the achieved gain is illustrated by examples.

  7. TALE nickase mediates high efficient targeted transgene integration at the human multi-copy ribosomal DNA locus.

    Science.gov (United States)

    Wu, Yong; Gao, Tieli; Wang, Xiaolin; Hu, Youjin; Hu, Xuyun; Hu, Zhiqing; Pang, Jialun; Li, Zhuo; Xue, Jinfeng; Feng, Mai; Wu, Lingqian; Liang, Desheng

    2014-03-28

    Although targeted gene addition could be stimulated strikingly by a DNA double strand break (DSB) created by either zinc finger nucleases (ZFNs) or TALE nucleases (TALENs), the DSBs are really mutagenic and toxic to human cells. As a compromised solution, DNA single-strand break (SSB) or nick has been reported to mediate high efficient gene addition but with marked reduction of random mutagenesis. We previously demonstrated effective targeted gene addition at the human multicopy ribosomal DNA (rDNA) locus, a genomic safe harbor for the transgene with therapeutic potential. To improve the transgene integration efficiency by using TALENs while lowering the cytotoxicity of DSBs, we created both TALENs and TALE nickases (TALENickases) targeting this multicopy locus. A targeting vector which could integrate a GFP cassette at the rDNA locus was constructed and co-transfected with TALENs or TALENickases. Although the fraction of GFP positive cells using TALENs was greater than that using TALENickases during the first few days after transfection, it reduced to a level less than that using TALENickases after continuous culture. Our findings showed that the TALENickases were more effective than their TALEN counterparts at the multi-copy rDNA locus, though earlier studies using ZFNs and ZFNickases targeting the single-copy loci showed the reverse. Besides, TALENickases mediated the targeted integration of a 5.4 kb fragment at a frequency of up to 0.62% in HT1080 cells after drug selection, suggesting their potential application in targeted gene modification not being limited at the rDNA locus. Copyright © 2014 Elsevier Inc. All rights reserved.

  8. Integrative analysis of transgenic alfalfa (Medicago sativa L. suggests new metabolic control mechanisms for monolignol biosynthesis.

    Directory of Open Access Journals (Sweden)

    Yun Lee

    2011-05-01

    Full Text Available The entanglement of lignin polymers with cellulose and hemicellulose in plant cell walls is a major biological barrier to the economically viable production of biofuels from woody biomass. Recent efforts of reducing this recalcitrance with transgenic techniques have been showing promise for ameliorating or even obviating the need for costly pretreatments that are otherwise required to remove lignin from cellulose and hemicelluloses. At the same time, genetic manipulations of lignin biosynthetic enzymes have sometimes yielded unforeseen consequences on lignin composition, thus raising the question of whether the current understanding of the pathway is indeed correct. To address this question systemically, we developed and applied a novel modeling approach that, instead of analyzing the pathway within a single target context, permits a comprehensive, simultaneous investigation of different datasets in wild type and transgenic plants. Specifically, the proposed approach combines static flux-based analysis with a Monte Carlo simulation in which very many randomly chosen sets of parameter values are evaluated against kinetic models of lignin biosynthesis in different stem internodes of wild type and lignin-modified alfalfa plants. In addition to four new postulates that address the reversibility of some key reactions, the modeling effort led to two novel postulates regarding the control of the lignin biosynthetic pathway. The first posits functionally independent pathways toward the synthesis of different lignin monomers, while the second postulate proposes a novel feedforward regulatory mechanism. Subsequent laboratory experiments have identified the signaling molecule salicylic acid as a potential mediator of the postulated control mechanism. Overall, the results demonstrate that mathematical modeling can be a valuable complement to conventional transgenic approaches and that it can provide biological insights that are otherwise difficult to obtain.

  9. Rapid development of stable transgene CHO cell lines by CRISPR/Cas9-mediated site-specific integration into C12orf35.

    Science.gov (United States)

    Zhao, Menglin; Wang, Jiaxian; Luo, Manyu; Luo, Han; Zhao, Meiqi; Han, Lei; Zhang, Mengxiao; Yang, Hui; Xie, Yueqing; Jiang, Hua; Feng, Lei; Lu, Huili; Zhu, Jianwei

    2018-07-01

    Chinese hamster ovary (CHO) cells are the most widely used mammalian hosts for recombinant protein production. However, by conventional random integration strategy, development of a high-expressing and stable recombinant CHO cell line has always been a difficult task due to the heterogenic insertion and its caused requirement of multiple rounds of selection. Site-specific integration of transgenes into CHO hot spots is an ideal strategy to overcome these challenges since it can generate isogenic cell lines with consistent productivity and stability. In this study, we investigated three sites with potential high transcriptional activities: C12orf35, HPRT, and GRIK1, to determine the possible transcriptional hot spots in CHO cells, and further construct a reliable site-specific integration strategy to develop recombinant cell lines efficiently. Genes encoding representative proteins mCherry and anti-PD1 monoclonal antibody were targeted into these three loci respectively through CRISPR/Cas9 technology. Stable cell lines were generated successfully after a single round of selection. In comparison with a random integration control, all the targeted integration cell lines showed higher productivity, among which C12orf35 locus was the most advantageous in both productivity and cell line stability. Binding affinity and N-glycan analysis of the antibody revealed that all batches of product were of similar quality independent on integrated sites. Deep sequencing demonstrated that there was low level of off-target mutations caused by CRISPR/Cas9, but none of them contributed to the development process of transgene cell lines. Our results demonstrated the feasibility of C12orf35 as the target site for exogenous gene integration, and strongly suggested that C12orf35 targeted integration mediated by CRISPR/Cas9 is a reliable strategy for the rapid development of recombinant CHO cell lines.

  10. Germline transgenic pigs by Sleeping Beauty transposition in porcine zygotes and targeted integration in the pig genome.

    Directory of Open Access Journals (Sweden)

    Wiebke Garrels

    Full Text Available Genetic engineering can expand the utility of pigs for modeling human diseases, and for developing advanced therapeutic approaches. However, the inefficient production of transgenic pigs represents a technological bottleneck. Here, we assessed the hyperactive Sleeping Beauty (SB100X transposon system for enzyme-catalyzed transgene integration into the embryonic porcine genome. The components of the transposon vector system were microinjected as circular plasmids into the cytoplasm of porcine zygotes, resulting in high frequencies of transgenic fetuses and piglets. The transgenic animals showed normal development and persistent reporter gene expression for >12 months. Molecular hallmarks of transposition were confirmed by analysis of 25 genomic insertion sites. We demonstrate germ-line transmission, segregation of individual transposons, and continued, copy number-dependent transgene expression in F1-offspring. In addition, we demonstrate target-selected gene insertion into transposon-tagged genomic loci by Cre-loxP-based cassette exchange in somatic cells followed by nuclear transfer. Transposase-catalyzed transgenesis in a large mammalian species expands the arsenal of transgenic technologies for use in domestic animals and will facilitate the development of large animal models for human diseases.

  11. Integration of biological control and transgenic insect protection for mitigation of mycotoxins in corn

    Science.gov (United States)

    Biological control is known to be effective in reducing aflatoxin contamination of corn and some transgenic corn hybrids incur greatly reduced damage from corn earworm (Helicoverpa zea). We conducted seven field trials over two years to test the hypothesis that transgenic insect protection and biol...

  12. T-DNA integration patterns in transgenic maize lines mediated by ...

    African Journals Online (AJOL)

    Jane

    2011-10-03

    Oct 3, 2011 ... locus can have profound effects on the level and stability of transgene ..... Thane N, Henke J, Wang T, Ruppert J, Shah N, Rotter K, Hodges J, ... Chia JM, Deragon JM, Estill JC, Fu Y, Jeddeloh JA, Han YJ, Lee H,. Li PH, Lisch ...

  13. Integral Histogram with Random Projection for Pedestrian Detection.

    Directory of Open Access Journals (Sweden)

    Chang-Hua Liu

    Full Text Available In this paper, we give a systematic study to report several deep insights into the HOG, one of the most widely used features in the modern computer vision and image processing applications. We first show that, its magnitudes of gradient can be randomly projected with random matrix. To handle over-fitting, an integral histogram based on the differences of randomly selected blocks is proposed. The experiments show that both the random projection and integral histogram outperform the HOG feature obviously. Finally, the two ideas are combined into a new descriptor termed IHRP, which outperforms the HOG feature with less dimensions and higher speed.

  14. Continuity of Integrated Density of States - Independent Randomness

    Indian Academy of Sciences (India)

    In this paper we discuss the continuity properties of the integrated density of states for random models based on that of the single site distribution. Our results are valid for models with independent randomness with arbitrary free parts. In particular in the case of the Anderson type models (with stationary, growing, decaying ...

  15. Fluorescent In Situ Hybridization to Detect Transgene Integration into Plant Genomes

    Science.gov (United States)

    Schwarzacher, Trude

    Fluorescent chromosome analysis technologies have advanced our understanding of genome organization during the last 30 years and have enabled the investigation of DNA organization and structure as well as the evolution of chromosomes. Fluorescent chromosome staining allows even small chromosomes to be visualized, characterized by their composition and morphology, and counted. Aneuploidies and polyploidies can be established for species, breeding lines, and individuals, including changes occurring during hybridization or tissue culture and transformation protocols. Fluorescent in situ hybridization correlates molecular information of a DNA sequence with its physical location on chromosomes and genomes. It thus allows determination of the physical position of sequences and often is the only means to determine the abundance and distribution of DNA sequences that are difficult to map with any other molecular method or would require segregation analysis, in particular multicopy or repetitive DNA. Equally, it is often the best way to establish the incorporation of transgenes, their numbers, and physical organization along chromosomes. This chapter presents protocols for probe and chromosome preparation, fluorescent in situ hybridization, chromosome staining, and the analysis of results.

  16. An integrable low-cost hardware random number generator

    Science.gov (United States)

    Ranasinghe, Damith C.; Lim, Daihyun; Devadas, Srinivas; Jamali, Behnam; Zhu, Zheng; Cole, Peter H.

    2005-02-01

    A hardware random number generator is different from a pseudo-random number generator; a pseudo-random number generator approximates the assumed behavior of a real hardware random number generator. Simple pseudo random number generators suffices for most applications, however for demanding situations such as the generation of cryptographic keys, requires an efficient and a cost effective source of random numbers. Arbiter-based Physical Unclonable Functions (PUFs) proposed for physical authentication of ICs exploits statistical delay variation of wires and transistors across integrated circuits, as a result of process variations, to build a secret key unique to each IC. Experimental results and theoretical studies show that a sufficient amount of variation exits across IC"s. This variation enables each IC to be identified securely. It is possible to exploit the unreliability of these PUF responses to build a physical random number generator. There exists measurement noise, which comes from the instability of an arbiter when it is in a racing condition. There exist challenges whose responses are unpredictable. Without environmental variations, the responses of these challenges are random in repeated measurements. Compared to other physical random number generators, the PUF-based random number generators can be a compact and a low-power solution since the generator need only be turned on when required. A 64-stage PUF circuit costs less than 1000 gates and the circuit can be implemented using a standard IC manufacturing processes. In this paper we have presented a fast and an efficient random number generator, and analysed the quality of random numbers produced using an array of tests used by the National Institute of Standards and Technology to evaluate the randomness of random number generators designed for cryptographic applications.

  17. The Role of Heterologous Chloroplast Sequence Elements in Transgene Integration and Expression1[W][OA

    Science.gov (United States)

    Ruhlman, Tracey; Verma, Dheeraj; Samson, Nalapalli; Daniell, Henry

    2010-01-01

    Heterologous regulatory elements and flanking sequences have been used in chloroplast transformation of several crop species, but their roles and mechanisms have not yet been investigated. Nucleotide sequence identity in the photosystem II protein D1 (psbA) upstream region is 59% across all taxa; similar variation was consistent across all genes and taxa examined. Secondary structure and predicted Gibbs free energy values of the psbA 5′ untranslated region (UTR) among different families reflected this variation. Therefore, chloroplast transformation vectors were made for tobacco (Nicotiana tabacum) and lettuce (Lactuca sativa), with endogenous (Nt-Nt, Ls-Ls) or heterologous (Nt-Ls, Ls-Nt) psbA promoter, 5′ UTR and 3′ UTR, regulating expression of the anthrax protective antigen (PA) or human proinsulin (Pins) fused with the cholera toxin B-subunit (CTB). Unique lettuce flanking sequences were completely eliminated during homologous recombination in the transplastomic tobacco genomes but not unique tobacco sequences. Nt-Ls or Ls-Nt transplastomic lines showed reduction of 80% PA and 97% CTB-Pins expression when compared with endogenous psbA regulatory elements, which accumulated up to 29.6% total soluble protein PA and 72.0% total leaf protein CTB-Pins, 2-fold higher than Rubisco. Transgene transcripts were reduced by 84% in Ls-Nt-CTB-Pins and by 72% in Nt-Ls-PA lines. Transcripts containing endogenous 5′ UTR were stabilized in nonpolysomal fractions. Stromal RNA-binding proteins were preferentially associated with endogenous psbA 5′ UTR. A rapid and reproducible regeneration system was developed for lettuce commercial cultivars by optimizing plant growth regulators. These findings underscore the need for sequencing complete crop chloroplast genomes, utilization of endogenous regulatory elements and flanking sequences, as well as optimization of plant growth regulators for efficient chloroplast transformation. PMID:20130101

  18. The role of heterologous chloroplast sequence elements in transgene integration and expression.

    Science.gov (United States)

    Ruhlman, Tracey; Verma, Dheeraj; Samson, Nalapalli; Daniell, Henry

    2010-04-01

    Heterologous regulatory elements and flanking sequences have been used in chloroplast transformation of several crop species, but their roles and mechanisms have not yet been investigated. Nucleotide sequence identity in the photosystem II protein D1 (psbA) upstream region is 59% across all taxa; similar variation was consistent across all genes and taxa examined. Secondary structure and predicted Gibbs free energy values of the psbA 5' untranslated region (UTR) among different families reflected this variation. Therefore, chloroplast transformation vectors were made for tobacco (Nicotiana tabacum) and lettuce (Lactuca sativa), with endogenous (Nt-Nt, Ls-Ls) or heterologous (Nt-Ls, Ls-Nt) psbA promoter, 5' UTR and 3' UTR, regulating expression of the anthrax protective antigen (PA) or human proinsulin (Pins) fused with the cholera toxin B-subunit (CTB). Unique lettuce flanking sequences were completely eliminated during homologous recombination in the transplastomic tobacco genomes but not unique tobacco sequences. Nt-Ls or Ls-Nt transplastomic lines showed reduction of 80% PA and 97% CTB-Pins expression when compared with endogenous psbA regulatory elements, which accumulated up to 29.6% total soluble protein PA and 72.0% total leaf protein CTB-Pins, 2-fold higher than Rubisco. Transgene transcripts were reduced by 84% in Ls-Nt-CTB-Pins and by 72% in Nt-Ls-PA lines. Transcripts containing endogenous 5' UTR were stabilized in nonpolysomal fractions. Stromal RNA-binding proteins were preferentially associated with endogenous psbA 5' UTR. A rapid and reproducible regeneration system was developed for lettuce commercial cultivars by optimizing plant growth regulators. These findings underscore the need for sequencing complete crop chloroplast genomes, utilization of endogenous regulatory elements and flanking sequences, as well as optimization of plant growth regulators for efficient chloroplast transformation.

  19. T-DNA integration patterns in transgenic maize lines mediated by ...

    African Journals Online (AJOL)

    These results demonstrate that cleavage occurs not only during the T-DNA borders but also inside or outside the borders. The border sequences and some inside sequences can be deleted, and filler sequences can be inserted. Illegitimate recombination is a major pattern of T-DNA integration, while some hot spots and ...

  20. Event-specific qualitative and quantitative PCR detection of the GMO carnation (Dianthus caryophyllus) variety Moonlite based upon the 5'-transgene integration sequence.

    Science.gov (United States)

    Li, P; Jia, J W; Jiang, L X; Zhu, H; Bai, L; Wang, J B; Tang, X M; Pan, A H

    2012-04-27

    To ensure the implementation of genetically modified organism (GMO)-labeling regulations, an event-specific detection method was developed based on the junction sequence of an exogenous integrant in the transgenic carnation variety Moonlite. The 5'-transgene integration sequence was isolated by thermal asymmetric interlaced PCR. Based upon the 5'-transgene integration sequence, the event-specific primers and TaqMan probe were designed to amplify the fragments, which spanned the exogenous DNA and carnation genomic DNA. Qualitative and quantitative PCR assays were developed employing the designed primers and probe. The detection limit of the qualitative PCR assay was 0.05% for Moonlite in 100 ng total carnation genomic DNA, corresponding to about 79 copies of the carnation haploid genome; the limit of detection and quantification of the quantitative PCR assay were estimated to be 38 and 190 copies of haploid carnation genomic DNA, respectively. Carnation samples with different contents of genetically modified components were quantified and the bias between the observed and true values of three samples were lower than the acceptance criterion (GMO detection method. These results indicated that these event-specific methods would be useful for the identification and quantification of the GMO carnation Moonlite.

  1. Efficient genetic transformation of okra (Abelmoschus esculentus (L.) Moench) and generation of insect-resistant transgenic plants expressing the cry1Ac gene.

    Science.gov (United States)

    Narendran, M; Deole, Satish G; Harkude, Satish; Shirale, Dattatray; Nanote, Asaram; Bihani, Pankaj; Parimi, Srinivas; Char, Bharat R; Zehr, Usha B

    2013-08-01

    Agrobacterium -mediated transformation system for okra using embryos was devised and the transgenic Bt plants showed resistance to the target pest, okra shoot, and fruit borer ( Earias vittella ). Okra is an important vegetable crop and progress in genetic improvement via genetic transformation has been impeded by its recalcitrant nature. In this paper, we describe a procedure using embryo explants for Agrobacterium-mediated transformation and tissue culture-based plant regeneration for efficient genetic transformation of okra. Twenty-one transgenic okra lines expressing the Bacillus thuringiensis gene cry1Ac were generated from five transformation experiments. Molecular analysis (PCR and Southern) confirmed the presence of the transgene and double-antibody sandwich ELISA analysis revealed Cry1Ac protein expression in the transgenic plants. All 21 transgenic plants were phenotypically normal and fertile. T1 generation plants from these lines were used in segregation analysis of the transgene. Ten transgenic lines were selected randomly for Southern hybridization and the results confirmed the presence of transgene integration into the genome. Normal Mendelian inheritance (3:1) of cry1Ac gene was observed in 12 lines out of the 21 T0 lines. We selected 11 transgenic lines segregating in a 3:1 ratio for the presence of one transgene for insect bioassays using larvae of fruit and shoot borer (Earias vittella). Fruit from seven transgenic lines caused 100 % larval mortality. We demonstrate an efficient transformation system for okra which will accelerate the development of transgenic okra with novel agronomically useful traits.

  2. Some open problems in random matrix theory and the theory of integrable systems

    OpenAIRE

    Deift, Percy

    2007-01-01

    We describe a list of open problems in random matrix theory and integrable systems which was presented at the conference ``Integrable Systems, Random Matrices, and Applications'' at the Courant Institute in May 2006.

  3. The random cluster model and a new integration identity

    International Nuclear Information System (INIS)

    Chen, L C; Wu, F Y

    2005-01-01

    We evaluate the free energy of the random cluster model at its critical point for 0 -1 (√q/2) is a rational number. As a by-product, our consideration leads to a closed-form evaluation of the integral 1/(4π 2 ) ∫ 0 2π dΘ ∫ 0 2π dΦ ln[A+B+C - AcosΘ - BcosΦ - Ccos(Θ+Φ)] = -ln(2S) + (2/π)[Ti 2 (AS) + Ti 2 (BS) + Ti 2 (CS)], which arises in lattice statistics, where A, B, C ≥ 0 and S=1/√(AB + BC + CA)

  4. Expression of bgt gene in transgenic birch (Betula platyphylla Suk ...

    African Journals Online (AJOL)

    Study on the characteristics of integration and expression is the basis of genetic stability of foreign genes in transgenic trees. To obtain insight into the relationship of transgene copy number and expression level, we screened 22 transgenic birch lines. Southern blot analysis of the transgenic birch plants indicated that the ...

  5. Expression of bgt gene in transgenic birch (Betula platyphylla Suk.)

    African Journals Online (AJOL)

    STORAGESEVER

    2009-08-04

    Aug 4, 2009 ... Study on the characteristics of integration and expression is the basis of genetic stability of foreign genes in transgenic trees. To obtain insight into the relationship of transgene copy number and expression level, we screened 22 transgenic birch lines. Southern blot analysis of the transgenic birch.

  6. Biotechnology network promotes knowledge of transgenics

    International Nuclear Information System (INIS)

    Blanco Picado, Patricia; Valdez Melara, Marta

    2015-01-01

    Red de Ingenieria Genetica Aplicada al Mejoramiento de Cultivos Tropicales (Rigatrop) integrated by a group of scientists from the Universidad de Costa Rica (UCR), Universidad Nacional (UNA) and of the Instituto Tecnologico de Costa Rica (TEC) have organized two forums on the topic of transgenics. The first forum has shown successful experiences of development of transgenic crops in Latin America, as for example: the transgenic bean, project realized in Brazil and transgenic eggplant in Bangladesh. The second forum has been about transgenics and environment effected at the UCR, on the occasion of World Environment Day. Rigatrop members are working currently in two projects applying biotechnological tools to coffee [es

  7. Inclusion of Moloney murine leukemia virus elements upstream of the transgene cassette in an E1-deleted adenovirus leads to an unusual genomic integration in epithelial cells

    International Nuclear Information System (INIS)

    Zheng Changyu; O'Connell, Brian C.; Baum, Bruce J.

    2003-01-01

    Classically, the 5' and 3' long terminal repeats (LTRs) are considered necessary but not sufficient for retroviral integration. Recently, we reported that inclusion of these and additional elements from Moloney murine leukemia virus (MoMLV) facilitated transgene integration, without retroviral integrase, when placed in an adenoviral context (AdLTR-luc vector) (Nat. Biotech. 18 (2000), 176; Biochem. Biophys. Res. Commun. 300 (2003), 115). To help understand this nonhomologous DNA recombination event, we constructed another vector, AdELP-luc, with 2.7 kb of MoMLV elements identically placed into an E1-deleted adenovirus type 5 backbone upstream of a luciferase cDNA reporter gene. Unlike AdLTR-luc, no MoMLV elements were placed downstream of the expression cassette. AdELP-luc readily infected epithelial cells in vitro. Southern hybridizations with DNA from cloned cells showed that disruption of the MoMLV sequences occurred. One cell clone, grown in vitro without any special selection medium for 9 months, exhibited stable vector integration and luciferase activity. Importantly, both Southern hybridization and FISH analyses showed that in addition to the MoMLV elements and expression cassette, substantial adenoviral sequence downstream of the luciferase cDNA was genomically integrated. These results suggest that the 2.7 kb of MoMLV sequence included in AdELP-luc have cis-acting functions and mediates an unusual integration event

  8. ZyFISH: a simple, rapid and reliable zygosity assay for transgenic mice.

    Directory of Open Access Journals (Sweden)

    Donal McHugh

    Full Text Available Microinjection of DNA constructs into fertilized mouse oocytes typically results in random transgene integration at a single genomic locus. The resulting transgenic founders can be used to establish hemizygous transgenic mouse lines. However, practical and experimental reasons often require that such lines be bred to homozygosity. Transgene zygosity can be determined by progeny testing assays which are expensive and time-consuming, by quantitative Southern blotting which is labor-intensive, or by quantitative PCR (qPCR which requires transgene-specific design. Here, we describe a zygosity assessment procedure based on fluorescent in situ hybridization (zyFISH. The zyFISH protocol entails the detection of transgenic loci by FISH and the concomitant assignment of homozygosity using a concise and unbiased scoring system. The method requires small volumes of blood, is scalable to at least 40 determinations per assay, and produces results entirely consistent with the progeny testing assay. This combination of reliability, simplicity and cost-effectiveness makes zyFISH a method of choice for transgenic mouse zygosity determinations.

  9. The clinically-integrated randomized trial: proposed novel method for conducting large trials at low cost

    Directory of Open Access Journals (Sweden)

    Scardino Peter T

    2009-03-01

    Full Text Available Abstract Introduction Randomized controlled trials provide the best method of determining which of two comparable treatments is preferable. Unfortunately, contemporary randomized trials have become increasingly expensive, complex and burdened by regulation, so much so that many trials are of doubtful feasibility. Discussion Here we present a proposal for a novel, streamlined approach to randomized trials: the "clinically-integrated randomized trial". The key aspect of our methodology is that the clinical experience of the patient and doctor is virtually indistinguishable whether or not the patient is randomized, primarily because outcome data are obtained from routine clinical data, or from short, web-based questionnaires. Integration of a randomized trial into routine clinical practice also implies that there should be an attempt to randomize every patient, a corollary of which is that eligibility criteria are minimized. The similar clinical experience of patients on- and off-study also entails that the marginal cost of putting an additional patient on trial is negligible. We propose examples of how the clinically-integrated randomized trial might be applied in four distinct areas of medicine: comparisons of surgical techniques, "me too" drugs, rare diseases and lifestyle interventions. Barriers to implementing clinically-integrated randomized trials are discussed. Conclusion The proposed clinically-integrated randomized trial may allow us to enlarge dramatically the number of clinical questions that can be addressed by randomization.

  10. Generation of single-copy transgenic mouse embryos directly from ES cells by tetraploid embryo complementation

    Directory of Open Access Journals (Sweden)

    Zhao Roong

    2001-12-01

    Full Text Available Abstract Background Transgenic mice have been used extensively to analyze gene function. Unfortunately, traditional transgenic procedures have only limited use in analyzing alleles that cause lethality because lines of founder mice cannot be established. This is frustrating given that such alleles often reveal crucial aspects of gene function. For this reason techniques that facilitate the generation of embryos expressing such alleles would be of enormous benefit. Although the transient generation of transgenic embryos has allowed limited analysis of lethal alleles, it is expensive, time consuming and technically challenging. Moreover a fundamental limitation with this approach is that each embryo generated is unique and transgene expression is highly variable due to the integration of different transgene copy numbers at random genomic sites. Results Here we describe an alternative method that allows the generation of clonal mouse embryos harboring a single-copy transgene at a defined genomic location. This was facilitated through the production of Hprt negative embryonic stem cells that allow the derivation of embryos by tetraploid embryo complementation. We show that targeting transgenes to the hprt locus in these ES cells by homologous recombination can be efficiently selected by growth in HAT medium. Moreover, embryos derived solely from targeted ES cells containing a single copy LacZ transgene under the control of the α-myosin heavy chain promoter exhibited the expected cardiac specific expression pattern. Conclusion Our results demonstrate that tetraploid embryo complementation by F3 hprt negative ES cells facilitates the generation of transgenic mouse embryos containing a single copy gene at a defined genomic locus. This approach is simple, extremely efficient and bypasses any requirement to generate chimeric mice. Moreover embryos generated by this procedure are clonal in that they are all derived from a single ES cell lines. This

  11. Continuity of integrated density of states – independent randomness

    Indian Academy of Sciences (India)

    Abstract. In this paper we discuss the continuity properties of the integrated density ... Density of states; Wegner estimate; Hölder continuous. 1. Introduction ..... and inverse spectral theory (Goa, 2000), Proc. Indian Acad. Sci. (Math. Sci.) 112(1).

  12. [Progress in transgenic fish techniques and application].

    Science.gov (United States)

    Ye, Xing; Tian, Yuan-Yuan; Gao, Feng-Ying

    2011-05-01

    Transgenic technique provides a new way for fish breeding. Stable lines of growth hormone gene transfer carps, salmon and tilapia, as well as fluorescence protein gene transfer zebra fish and white cloud mountain minnow have been produced. The fast growth characteristic of GH gene transgenic fish will be of great importance to promote aquaculture production and economic efficiency. This paper summarized the progress in transgenic fish research and ecological assessments. Microinjection is still the most common used method, but often resulted in multi-site and multi-copies integration. Co-injection of transposon or meganuclease will greatly improve the efficiency of gene transfer and integration. "All fish" gene or "auto gene" should be considered to produce transgenic fish in order to eliminate misgiving on food safety and to benefit expression of the transferred gene. Environmental risk is the biggest obstacle for transgenic fish to be commercially applied. Data indicates that transgenic fish have inferior fitness compared with the traditional domestic fish. However, be-cause of the genotype-by-environment effects, it is difficult to extrapolate simple phenotypes to the complex ecological interactions that occur in nature based on the ecological consequences of the transgenic fish determined in the laboratory. It is critical to establish highly naturalized environments for acquiring reliable data that can be used to evaluate the environ-mental risk. Efficacious physical and biological containment strategies remain to be crucial approaches to ensure the safe application of transgenic fish technology.

  13. ATLAS, an integrated structural analysis and design system. Volume 4: Random access file catalog

    Science.gov (United States)

    Gray, F. P., Jr. (Editor)

    1979-01-01

    A complete catalog is presented for the random access files used by the ATLAS integrated structural analysis and design system. ATLAS consists of several technical computation modules which output data matrices to corresponding random access file. A description of the matrices written on these files is contained herein.

  14. Neuroanatomy and transgenic technologies

    Science.gov (United States)

    This is a short review that introduces recent advances of neuroanatomy and transgenic technologies. The anatomical complexity of the nervous system remains a subject of tremendous fascination among neuroscientists. In order to tackle this extraordinary complexity, powerful transgenic technologies a...

  15. Integrals of random fields treated by the model correction factor method

    DEFF Research Database (Denmark)

    Franchin, P.; Ditlevsen, Ove Dalager; Kiureghian, Armen Der

    2002-01-01

    The model correction factor method (MCFM) is used in conjunction with the first-order reliability method (FORM) to solve structural reliability problems involving integrals of non-Gaussian random fields. The approach replaces the limit-state function with an idealized one, in which the integrals ...

  16. Model correction factor method for reliability problems involving integrals of non-Gaussian random fields

    DEFF Research Database (Denmark)

    Franchin, P.; Ditlevsen, Ove Dalager; Kiureghian, Armen Der

    2002-01-01

    The model correction factor method (MCFM) is used in conjunction with the first-order reliability method (FORM) to solve structural reliability problems involving integrals of non-Gaussian random fields. The approach replaces the limit-state function with an idealized one, in which the integrals ...

  17. Integrating CHWs as part of the team leading diabetes group visits: A randomized controlled feasibility study

    Science.gov (United States)

    The purpose of the study was to evaluate the feasibility of integrating Community Health Workers (CHWs) as part of the team leading diabetes group visits. This was a randomized controlled study that integrated CHWs as part of the team leading diabetes group visits for low-income Hispanic adults (n=5...

  18. Ectopic over-expression of peroxisomal ascorbate peroxidase (SbpAPX) gene confers salt stress tolerance in transgenic peanut (Arachis hypogaea).

    Science.gov (United States)

    Singh, Natwar; Mishra, Avinash; Jha, Bhavanath

    2014-08-15

    Peroxisomal ascorbate peroxidase gene (SbpAPX) of an extreme halophyte Salicornia brachiata imparts abiotic stress endurance and plays a key role in the protection against oxidative stress. The cloned SbpAPX gene was transformed to local variety of peanut and about 100 transgenic plants were developed using optimized in vitro regeneration and Agrobacterium mediated genetic transformation method. The T0 transgenic plants were confirmed for the gene integration; grown under controlled condition in containment green house facility; seeds were harvested and T1 plants were raised. Transgenic plants (T1) were further confirmed by PCR using gene specific primers and histochemical GUS assay. About 40 transgenic plants (T1) were selected randomly and subjected for salt stress tolerance study. Transgenic plants remained green however non-transgenic plants showed bleaching and yellowish leaves under salt stress conditions. Under stress condition, transgenic plants continued normal growth and completed their life cycle. Transgenic peanut plants exhibited adequate tolerance under salt stress condition and thus could be explored for the cultivation in salt affected areas for the sustainable agriculture. Copyright © 2014 Elsevier B.V. All rights reserved.

  19. Golden Ratio Versus Pi as Random Sequence Sources for Monte Carlo Integration

    Science.gov (United States)

    Sen, S. K.; Agarwal, Ravi P.; Shaykhian, Gholam Ali

    2007-01-01

    We discuss here the relative merits of these numbers as possible random sequence sources. The quality of these sequences is not judged directly based on the outcome of all known tests for the randomness of a sequence. Instead, it is determined implicitly by the accuracy of the Monte Carlo integration in a statistical sense. Since our main motive of using a random sequence is to solve real world problems, it is more desirable if we compare the quality of the sequences based on their performances for these problems in terms of quality/accuracy of the output. We also compare these sources against those generated by a popular pseudo-random generator, viz., the Matlab rand and the quasi-random generator ha/ton both in terms of error and time complexity. Our study demonstrates that consecutive blocks of digits of each of these numbers produce a good random sequence source. It is observed that randomly chosen blocks of digits do not have any remarkable advantage over consecutive blocks for the accuracy of the Monte Carlo integration. Also, it reveals that pi is a better source of a random sequence than theta when the accuracy of the integration is concerned.

  20. Insect resistance to Nilaparvata lugens and Cnaphalocrocis medinalis in transgenic indica rice and the inheritance of gna+sbti transgenes.

    Science.gov (United States)

    Li, Guiying; Xu, Xinping; Xing, Hengtai; Zhu, Huachen; Fan, Qin

    2005-04-01

    Molecular genetic analysis and insect bioassay of transgenic indica rice 'Zhuxian B' plants carrying snowdrop lectin gene (gna) and soybean trypsin inhibitor gene (sbti) were investigated in detail. PCR, 'dot' blot and PCR-Southern blot analysis showed that both transgenes had been incorporated into the rice genome and transmitted up to R3 progeny in most lines tested. Some transgenic lines exhibited Mendelian segregation, but the other showed either 1:1 (positive: negative for the transgenes) or other aberrant segregation patterns. The segregation patterns of gna gene crossed between R2 and R3 progeny. In half of transgenic R3 lines, gna and sbti transgenes co-segregated. Two independent homozygous lines expressing double transgenes were identified in R3 progeny. Southern blot analysis demonstrated that the copy numbers of integrated gna and sbti transgenes varied from one to ten in different lines. Insect bioassay data showed that most transgenic plants had better resistance to both Nilaparvata lugens (Stahl) and Cnaphalocrocis medinalis (Guenee) than wild-type plants. The insect resistance of transgenic lines increased with the increase in transgene positive ratio in most of the transgenic lines. In all, we obtained nine lines of R3 transgenic plants, including one pure line, which had better resistance to both N lugens and C medinalis than wild-type plants. Copyright 2005 Society of Chemical Industry.

  1. [New advances in animal transgenic technology].

    Science.gov (United States)

    Sun, Zhen-Hong; Miao, Xiang-Yang; Zhu, Rui-Liang

    2010-06-01

    Animal transgenic technology is one of the fastest growing biotechnology in the 21st century. It is used to integrate foreign genes into the animal genome by genetic engineering technology so that foreign genes can be expressed and inherited to the offspring. The transgenic efficiency and precise control of gene expression are the key limiting factors on preparation of transgenic animals. A variety of transgenic techniques are available, each of which has its own advantages and disadvantages and still needs further study because of unresolved technical and safety issues. With the in-depth research, the transgenic technology will have broad application prospects in the fields of exploration of gene function, animal genetic improvement, bioreactor, animal disease models, organ transplantation and so on. This article reviews the recently developed animal gene transfer techniques, including germline stem cell mediated method to improve the efficiency, gene targeting to improve the accuracy, RNA interference (RNAi)-mediated gene silencing technology, and the induced pluripotent stem cells (iPS) transgenic technology. The new transgenic techniques can provide a better platform for the study of trans-genic animals and promote the development of medical sciences, livestock production, and other fields.

  2. Note: Fully integrated 3.2 Gbps quantum random number generator with real-time extraction

    International Nuclear Information System (INIS)

    Zhang, Xiao-Guang; Nie, You-Qi; Liang, Hao; Zhang, Jun; Pan, Jian-Wei; Zhou, Hongyi; Ma, Xiongfeng

    2016-01-01

    We present a real-time and fully integrated quantum random number generator (QRNG) by measuring laser phase fluctuations. The QRNG scheme based on laser phase fluctuations is featured for its capability of generating ultra-high-speed random numbers. However, the speed bottleneck of a practical QRNG lies on the limited speed of randomness extraction. To close the gap between the fast randomness generation and the slow post-processing, we propose a pipeline extraction algorithm based on Toeplitz matrix hashing and implement it in a high-speed field-programmable gate array. Further, all the QRNG components are integrated into a module, including a compact and actively stabilized interferometer, high-speed data acquisition, and real-time data post-processing and transmission. The final generation rate of the QRNG module with real-time extraction can reach 3.2 Gbps.

  3. Note: Fully integrated 3.2 Gbps quantum random number generator with real-time extraction

    Energy Technology Data Exchange (ETDEWEB)

    Zhang, Xiao-Guang; Nie, You-Qi; Liang, Hao; Zhang, Jun, E-mail: zhangjun@ustc.edu.cn; Pan, Jian-Wei [Hefei National Laboratory for Physical Sciences at the Microscale and Department of Modern Physics, University of Science and Technology of China, Hefei, Anhui 230026 (China); CAS Center for Excellence and Synergetic Innovation Center in Quantum Information and Quantum Physics, University of Science and Technology of China, Hefei, Anhui 230026 (China); Zhou, Hongyi; Ma, Xiongfeng [Center for Quantum Information, Institute for Interdisciplinary Information Sciences, Tsinghua University, Beijing 100084 (China)

    2016-07-15

    We present a real-time and fully integrated quantum random number generator (QRNG) by measuring laser phase fluctuations. The QRNG scheme based on laser phase fluctuations is featured for its capability of generating ultra-high-speed random numbers. However, the speed bottleneck of a practical QRNG lies on the limited speed of randomness extraction. To close the gap between the fast randomness generation and the slow post-processing, we propose a pipeline extraction algorithm based on Toeplitz matrix hashing and implement it in a high-speed field-programmable gate array. Further, all the QRNG components are integrated into a module, including a compact and actively stabilized interferometer, high-speed data acquisition, and real-time data post-processing and transmission. The final generation rate of the QRNG module with real-time extraction can reach 3.2 Gbps.

  4. A Transgenic Tri-Modality Reporter Mouse

    OpenAIRE

    Yan, Xinrui; Ray, Pritha; Paulmurugan, Ramasamy; Tong, Ricky; Gong, Yongquan; Sathirachinda, Ataya; Wu, Joseph C.; Gambhir, Sanjiv S.

    2013-01-01

    Transgenic mouse with a stably integrated reporter gene(s) can be a valuable resource for obtaining uniformly labeled stem cells, tissues, and organs for various applications. We have generated a transgenic mouse model that ubiquitously expresses a tri-fusion reporter gene (fluc2-tdTomato-ttk) driven by a constitutive chicken β-actin promoter. This "Tri-Modality Reporter Mouse" system allows one to isolate most cells from this donor mouse and image them for bioluminescent (fluc2), fluorescent...

  5. Number-conserving random phase approximation with analytically integrated matrix elements

    International Nuclear Information System (INIS)

    Kyotoku, M.; Schmid, K.W.; Gruemmer, F.; Faessler, A.

    1990-01-01

    In the present paper a number conserving random phase approximation is derived as a special case of the recently developed random phase approximation in general symmetry projected quasiparticle mean fields. All the occurring integrals induced by the number projection are performed analytically after writing the various overlap and energy matrices in the random phase approximation equation as polynomials in the gauge angle. In the limit of a large number of particles the well-known pairing vibration matrix elements are recovered. We also present a new analytically number projected variational equation for the number conserving pairing problem

  6. On randomized algorithms for numerical solution of applied Fredholm integral equations of the second kind

    Science.gov (United States)

    Voytishek, Anton V.; Shipilov, Nikolay M.

    2017-11-01

    In this paper, the systematization of numerical (implemented on a computer) randomized functional algorithms for approximation of a solution of Fredholm integral equation of the second kind is carried out. Wherein, three types of such algorithms are distinguished: the projection, the mesh and the projection-mesh methods. The possibilities for usage of these algorithms for solution of practically important problems is investigated in detail. The disadvantages of the mesh algorithms, related to the necessity of calculation values of the kernels of integral equations in fixed points, are identified. On practice, these kernels have integrated singularities, and calculation of their values is impossible. Thus, for applied problems, related to solving Fredholm integral equation of the second kind, it is expedient to use not mesh, but the projection and the projection-mesh randomized algorithms.

  7. [Chromosomal localization of foreign genes in transgenic mice using dual-color fluorescence in situ hybridization].

    Science.gov (United States)

    Lin, Dan; Gong, Xiu-li; Li, Wei; Guo, Xin-bing; Zhu, Yi-wen; Huang, Ying

    2008-02-01

    To establish a highly sensitive and specific dual-color fluorescence in situ hybridization (D-FISH) method used for chromosomal localization of foreign genes in double transgenic mice. Two strains of double transgenic mice were used in this experiment, one was integrated with the herpes simplex virus thymidine kinase (HSV-tk) and the enhanced green fluorescence protein (eGFP), the other was with the short hairpin RNA interference(RNAi) and beta(654). Splenic cells cultured in vitro were arrested in metaphase by colchicine and hybridized with digoxigenin-labeled and biotinylated DNA probes, then detected by rhodamine-conjugated avidin and FITC-conjugated anti-digoxigenin. Dual-color fluorescence signals were detected on the same metaphase in both transgenic mice strains. In HSV-tk/eGFP double transgenic mice, strong green fluorescence for HSV-tk and red for eGFP were observed and localized at 2E5-G3 and 8A2-A4 respectively. In beta(654)/RNAi mice, beta(654) was detected as red fluorescence on chromosome 7D3-E2, and RNAi showed random integration on chromosomes. It was detected as green fluorescence on chromosome 12B1 in one mouse, while on 1E2.3-1F and 3A3 in the other. Highly sensitive and specific D-FISH method was established using the self-prepared DNA probes, and chromosomal localization of the foreign genes was also performed in combination with G-banding in double transgenic mice. This technology will facilitate the researches in transgenic animals and gene therapy models.

  8. Random matrix theory and higher genus integrability: the quantum chiral Potts model

    International Nuclear Information System (INIS)

    Angles d'Auriac, J.Ch.; Maillard, J.M.; Viallet, C.M.

    2002-01-01

    We perform a random matrix theory (RMT) analysis of the quantum four-state chiral Potts chain for different sizes of the chain up to size L 8. Our analysis gives clear evidence of a Gaussian orthogonal ensemble (GOE) statistics, suggesting the existence of a generalized time-reversal invariance. Furthermore, a change from the (generic) GOE distribution to a Poisson distribution occurs when the integrability conditions are met. The chiral Potts model is known to correspond to a (star-triangle) integrability associated with curves of genus higher than zero or one. Therefore, the RMT analysis can also be seen as a detector of 'higher genus integrability'. (author)

  9. A modern theory of random variation with applications in stochastic calculus, financial mathematics, and Feynman integration

    CERN Document Server

    Muldowney, Patrick

    2012-01-01

    A Modern Theory of Random Variation is a new and radical re-formulation of the mathematical underpinnings of subjects as diverse as investment, communication engineering, and quantum mechanics. Setting aside the classical theory of probability measure spaces, the book utilizes a mathematically rigorous version of the theory of random variation that bases itself exclusively on finitely additive probability distribution functions. In place of twentieth century Lebesgue integration and measure theory, the author uses the simpler concept of Riemann sums, and the non-absolute Riemann-type integration of Henstock. Readers are supplied with an accessible approach to standard elements of probability theory such as the central limmit theorem and Brownian motion as well as remarkable, new results on Feynman diagrams and stochastic integrals. Throughout the book, detailed numerical demonstrations accompany the discussions of abstract mathematical theory, from the simplest elements of the subject to the most complex. I...

  10. Principles and application of transgenic technology in marine organisms

    Science.gov (United States)

    Marine organisms into which a foreign gene or noncoding DNA fragment is artificially introduced and stably integrated in their genomes are termed transgenic marine organisms. Since the first report in 1985, a wide range of transgenic fish and marine bivalve mollusks have been produced by microinjec...

  11. Path integral methods for primordial density perturbations - sampling of constrained Gaussian random fields

    International Nuclear Information System (INIS)

    Bertschinger, E.

    1987-01-01

    Path integrals may be used to describe the statistical properties of a random field such as the primordial density perturbation field. In this framework the probability distribution is given for a Gaussian random field subjected to constraints such as the presence of a protovoid or supercluster at a specific location in the initial conditions. An algorithm has been constructed for generating samples of a constrained Gaussian random field on a lattice using Monte Carlo techniques. The method makes possible a systematic study of the density field around peaks or other constrained regions in the biased galaxy formation scenario, and it is effective for generating initial conditions for N-body simulations with rare objects in the computational volume. 21 references

  12. Spectra of random operators with absolutely continuous integrated density of states

    Energy Technology Data Exchange (ETDEWEB)

    Rio, Rafael del, E-mail: delrio@iimas.unam.mx, E-mail: delriomagia@gmail.com [Departamento de Fisica Matematica, Instituto de Investigaciones en Matemáticas Aplicadas y en Sistemas, Universidad Nacional Autónoma de México, C.P. 04510, México D.F. (Mexico)

    2014-04-15

    The structure of the spectrum of random operators is studied. It is shown that if the density of states measure of some subsets of the spectrum is zero, then these subsets are empty. In particular follows that absolute continuity of the integrated density of states implies singular spectra of ergodic operators is either empty or of positive measure. Our results apply to Anderson and alloy type models, perturbed Landau Hamiltonians, almost periodic potentials, and models which are not ergodic.

  13. Spectra of random operators with absolutely continuous integrated density of states

    International Nuclear Information System (INIS)

    Rio, Rafael del

    2014-01-01

    The structure of the spectrum of random operators is studied. It is shown that if the density of states measure of some subsets of the spectrum is zero, then these subsets are empty. In particular follows that absolute continuity of the integrated density of states implies singular spectra of ergodic operators is either empty or of positive measure. Our results apply to Anderson and alloy type models, perturbed Landau Hamiltonians, almost periodic potentials, and models which are not ergodic

  14. In Vivo Zinc Finger Nuclease-mediated Targeted Integration of a Glucose-6-phosphatase Transgene Promotes Survival in Mice With Glycogen Storage Disease Type IA

    Science.gov (United States)

    Landau, Dustin J; Brooks, Elizabeth Drake; Perez-Pinera, Pablo; Amarasekara, Hiruni; Mefferd, Adam; Li, Songtao; Bird, Andrew; Gersbach, Charles A; Koeberl, Dwight D

    2016-01-01

    Glycogen storage disease type Ia (GSD Ia) is caused by glucose-6-phosphatase (G6Pase) deficiency in association with severe, life-threatening hypoglycemia that necessitates lifelong dietary therapy. Here we show that use of a zinc-finger nuclease (ZFN) targeted to the ROSA26 safe harbor locus and a ROSA26-targeting vector containing a G6PC donor transgene, both delivered with adeno-associated virus (AAV) vectors, markedly improved survival of G6Pase knockout (G6Pase-KO) mice compared with mice receiving the donor vector alone (P Ia, as compared with normal littermates, at 8 months following vector administration (P Ia. PMID:26865405

  15. in transgenic cucumber

    African Journals Online (AJOL)

    Jane

    2011-07-18

    Jul 18, 2011 ... College of Horticulture, South China Agriculture University, Guangzhou 510642, Guangdong ... The pattern of expression vector pBI-PacPAP. ..... Disease scale ... These transgenic T0 plants were self-pollinated and the.

  16. Transgene mus som sygdomsmodeller

    DEFF Research Database (Denmark)

    Schuster, Mikkel Bruhn; Porse, Bo Torben

    2003-01-01

    Transgenic animal models have proven to be useful tools in understanding both basic biology and the events associated with disease. Recent technical advances in the area of genomic manipulation in combination with the availability of the human and murine genomic sequences now allow the precise...... tailoring of the mouse genome. In this review we describe a few systems in which transgenic animal models have been employed for the purpose of studying the etiology of human diseases. Udgivelsesdato: 2003-Feb-17...

  17. Genomic localization of the Z/EG transgene in the mouse genome.

    Science.gov (United States)

    Colombo, Sophie; Kumasaka, Mayuko; Lobe, Corrinne; Larue, Lionel

    2010-02-01

    The Z/EG transgenic mouse line, produced by Novak et al., displays tissue-specific EGFP expression after Cre-mediated recombination. The autofluorescence of EGFP allows the visualization of cells of interest displaying Cre recombination. The initial construct was designed such that cells without Cre recombination express the beta-galactosidase marker, facilitating counterselection. We used inverse PCR to identify the site of integration of the Z/EG transgene, to improve the efficiency of homozygous Z/EG mouse production. Recombined cells produced large amounts of EGFP protein, resulting in higher levels of fluorescence and therefore greater contrast with nonrecombined cells. We mapped the transgene to the G1 region of chromosome 5. This random insertion was found to have occurred 230-bp upstream from the start codon of the Rasa4 gene. The insertion of the Z/EG transgene in the C57BL/6 genetic background had no effect on Rasa4 expression. Homozygous Z/EG mice therefore had no obvious phenotype. (c) 2009 Wiley-Liss, Inc.

  18. Feasibility study of a clinically-integrated randomized trial of modifications to radical prostatectomy

    Directory of Open Access Journals (Sweden)

    Vickers Andrew J

    2012-02-01

    Full Text Available Abstract Background Numerous technical modifications to radical prostatectomy have been proposed. Such modifications are likely to lead to only slight improvements in outcomes. Although small differences would be worthwhile, an appropriately powered randomized trial would need to be very large, and thus of doubtful feasibility given the expense, complexity and regulatory burden of contemporary clinical trials. We have proposed a novel methodology, the clinically-integrated randomized trial, which dramatically streamlines trial procedures in order to reduce the marginal cost of an additional patient towards zero. We aimed to determine the feasibility of implementing such a trial for radical prostatectomy. Methods Patients undergoing radical prostatectomy as initial treatment for prostate cancer were randomized in a factorial design to involvement of the fascia during placement of the anastomotic sutures, urethral irrigation, both or neither. Endpoint data were obtained from routine clinical documentation. Accrual and compliance rates were monitored to determine the feasibility of the trial. Results From a total of 260 eligible patients, 154 (59% consented; 56 patients declined to participate, 20 were not approached on recommendation of the treating surgeon, and 30 were not approached for logistical reasons. Although recording by surgeons of the procedure used was incomplete (~80%, compliance with randomization was excellent when it was recorded, with only 6% of procedures inconsistent with allocation. Outcomes data was received from 71% of patients at one year. This improved to 83% as the trial progressed. Conclusions A clinically-integrated randomized trial was conducted at low cost, with excellent accrual, and acceptable compliance with treatment allocation and outcomes reporting. This demonstrates the feasibility of the methodology. Improved methods to ensure documentation of surgical procedures would be required before wider implementation

  19. Glycinebetaine synthesizing transgenic potato plants exhibit enhanced tolerance to salt and cold stresses

    International Nuclear Information System (INIS)

    Ahmad, R.; Hussain, J.

    2014-01-01

    Abiotic stresses are the most important contributors towards low productivity of major food crops. Various attempts have been made to enhance abiotic stress tolerance of crop plants by classical breeding and genetic transformation. Genetic transformation with glycinebetaine (GB) synthesizing enzymes' gene(s) in naturally non accumulating plants has resulted in enhanced tolerance against variety of abiotic stresses. Present study was aimed to evaluate the performance of GB synthesizing transgenic potato plants against salt and cold stresses. Transgenic potato plants were challenged against salt and cold stresses at whole plant level. Transgenic lines were characterized to determine the transgene copy number. Different parameters like integrity, chlorophyll contents, tuber yield and vegetative biomass were studied to monitor the stress tolerance of transgenic potato plants. The results were compared with Non-transgenic (NT) plants and statistically analyzed to evaluate significant differences. Multi-copy insertion of expression cassette was found in both transgenic lines. Upon salt stress, transgenic plants maintained better growth as compared to NT plants. The tuber yield of transgenic plants was significantly greater than NT plants in salt stress. Transgenic plants showed improved membrane integrity against cold stress by depicting appreciably reduced ion leakage as compared to NT plants. Moreover, transgenic plants showed significantly less chlorophyll bleaching than NT plants upon cold stress. In addition, NT plants accumulated significantly less biomass, and yielded fewer tubers as compared to transgenic plants after cold stress treatment. The study will be a committed step for field evaluation of transgenic plants with the aim of commercialization. (author)

  20. Large deviations and Lifshitz singularity of the integrated density of states of random Hamiltonians

    International Nuclear Information System (INIS)

    Kirsch, W.; Martinelli, F.

    1983-01-01

    We consider the integrated density of states (IDS) rhosub(infinite)(lambda) of random Hamiltonian Hsub#betta#=-δ+Vsub#betta#, Vsub#betta# being a random field on Rsup(d) which satisfies a mixing condition. We prove that the probability of large fluctuations of the finite volume IDSvertical stroke#betta#vertical stroke - 1 rho(lambda,Hsub(lambda)(#betta#)), #betta#is contained inRsup(d), around the thermodynamic limit rhosub(infinite)(lambda) is bounded from above by exp[-kvertical stroke#betta#vertical stroke], k>0. In this case rhosub(infinite)(lambda) can be recovered from a variational principle. Furthermore we show the existence of a Lifshitz-type of singularity of rhosub(infinite)(lambda) as lambda->0 + in the case where Vsub#betta# is non-negative. More precisely we prove the following bound: rhosub(infinite)(lambda) 0 + k>0. This last result is then discussed in some examples. (orig.)

  1. A homodyne detector integrated onto a photonic chip for measuring quantum states and generating random numbers

    Science.gov (United States)

    Raffaelli, Francesco; Ferranti, Giacomo; Mahler, Dylan H.; Sibson, Philip; Kennard, Jake E.; Santamato, Alberto; Sinclair, Gary; Bonneau, Damien; Thompson, Mark G.; Matthews, Jonathan C. F.

    2018-04-01

    Optical homodyne detection has found use as a characterisation tool in a range of quantum technologies. So far implementations have been limited to bulk optics. Here we present the optical integration of a homodyne detector onto a silicon photonics chip. The resulting device operates at high speed, up 150 MHz, it is compact and it operates with low noise, quantified with 11 dB clearance between shot noise and electronic noise. We perform on-chip quantum tomography of coherent states with the detector and show that it meets the requirements for characterising more general quantum states of light. We also show that the detector is able to produce quantum random numbers at a rate of 1.2 Gbps, by measuring the vacuum state of the electromagnetic field and applying off-line post processing. The produced random numbers pass all the statistical tests provided by the NIST test suite.

  2. Approximations to the Probability of Failure in Random Vibration by Integral Equation Methods

    DEFF Research Database (Denmark)

    Nielsen, Søren R.K.; Sørensen, John Dalsgaard

    Close approximations to the first passage probability of failure in random vibration can be obtained by integral equation methods. A simple relation exists between the first passage probability density function and the distribution function for the time interval spent below a barrier before...... passage probability density. The results of the theory agree well with simulation results for narrow banded processes dominated by a single frequency, as well as for bimodal processes with 2 dominating frequencies in the structural response....... outcrossing. An integral equation for the probability density function of the time interval is formulated, and adequate approximations for the kernel are suggested. The kernel approximation results in approximate solutions for the probability density function of the time interval, and hence for the first...

  3. Epigenetic variants of a transgenic petunia line show hypermethylation in transgene DNA: an indication for specific recognition of foreign DNA in transgenic plants.

    Science.gov (United States)

    Meyer, P; Heidmann, I

    1994-05-25

    We analysed de novo DNA methylation occurring in plants obtained from the transgenic petunia line R101-17. This line contains one copy of the maize A1 gene that leads to the production of brick-red pelargonidin pigment in the flowers. Due to its integration into an unmethylated genomic region the A1 transgene is hypomethylated and transcriptionally active. Several epigenetic variants of line 17 were selected that exhibit characteristic and somatically stable pigmentation patterns, displaying fully coloured, marbled or colourless flowers. Analysis of the DNA methylation patterns revealed that the decrease in pigmentation among the epigenetic variants was correlated with an increase in methylation, specifically of the transgene DNA. No change in methylation of the hypomethylated integration region could be detected. A similar increase in methylation, specifically in the transgene region, was also observed among progeny of R101-17del, a deletion derivative of R101-17 that no longer produces pelargonidin pigments due to a deletion in the A1 coding region. Again de novo methylation is specifically directed to the transgene, while the hypomethylated character of neighbouring regions is not affected. Possible mechanisms for transgene-specific methylation and its consequences for long-term use of transgenic material are discussed.

  4. Overexpression of TaLEA gene from Tamarix androssowii improves salt and drought tolerance in transgenic poplar (Populus simonii × P. nigra.

    Directory of Open Access Journals (Sweden)

    Weidong Gao

    Full Text Available Late embryogenesis abundant (LEA genes were confirmed to confer resistance to drought and water deficiency. An LEA gene from Tamarixandrossowii (named TaLEA was transformed into Xiaohei poplar (Populussimonii × P. nigra via Agrobacterium. Twenty-five independent transgenic lines were obtained that were resistant to kanamycin, and 11 transgenic lines were randomly selected for further analysis. The polymerase chain reaction (PCR and ribonucleic acid (RNA gel blot indicated that the TaLEA gene had been integrated into the poplar genome. The height growth rate, malondialdehyde (MDA content, relative electrolyte leakage and damages due to salt or drought to transgenic and non-transgenic plants were compared under salt and drought stress conditions. The results showed that the constitutive expression of the TaLEA gene in transgenic poplars could induce an increase in height growth rate and a decrease in number and severity of wilted leaves under the salt and drought stresses. The MDA content and relative electrolyte leakage in transgenic lines under salt and drought stresses were significantly lower compared to those in non-transgenic plants, indicating that the TaLEA gene may enhance salt and drought tolerance by protecting cell membranes from damage. Moreover, amongst the lines analyzed for stress tolerance, the transgenic line 11 (T11 showed the highest tolerance levels under both salinity and drought stress conditions. These results indicated that the TaLEA gene could be a salt and drought tolerance candidate gene and could confer a broad spectrum of tolerance under abiotic stresses in poplars.

  5. Overexpression of TaLEA gene from Tamarix androssowii improves salt and drought tolerance in transgenic poplar (Populus simonii × P. nigra).

    Science.gov (United States)

    Gao, Weidong; Bai, Shuang; Li, Qingmei; Gao, Caiqiu; Liu, Guifeng; Li, Guangde; Tan, Feili

    2013-01-01

    Late embryogenesis abundant (LEA) genes were confirmed to confer resistance to drought and water deficiency. An LEA gene from Tamarixandrossowii (named TaLEA) was transformed into Xiaohei poplar (Populussimonii × P. nigra) via Agrobacterium. Twenty-five independent transgenic lines were obtained that were resistant to kanamycin, and 11 transgenic lines were randomly selected for further analysis. The polymerase chain reaction (PCR) and ribonucleic acid (RNA) gel blot indicated that the TaLEA gene had been integrated into the poplar genome. The height growth rate, malondialdehyde (MDA) content, relative electrolyte leakage and damages due to salt or drought to transgenic and non-transgenic plants were compared under salt and drought stress conditions. The results showed that the constitutive expression of the TaLEA gene in transgenic poplars could induce an increase in height growth rate and a decrease in number and severity of wilted leaves under the salt and drought stresses. The MDA content and relative electrolyte leakage in transgenic lines under salt and drought stresses were significantly lower compared to those in non-transgenic plants, indicating that the TaLEA gene may enhance salt and drought tolerance by protecting cell membranes from damage. Moreover, amongst the lines analyzed for stress tolerance, the transgenic line 11 (T11) showed the highest tolerance levels under both salinity and drought stress conditions. These results indicated that the TaLEA gene could be a salt and drought tolerance candidate gene and could confer a broad spectrum of tolerance under abiotic stresses in poplars.

  6. Integration of motion energy from overlapping random background noise increases perceived speed of coherently moving stimuli.

    Science.gov (United States)

    Chuang, Jason; Ausloos, Emily C; Schwebach, Courtney A; Huang, Xin

    2016-12-01

    The perception of visual motion can be profoundly influenced by visual context. To gain insight into how the visual system represents motion speed, we investigated how a background stimulus that did not move in a net direction influenced the perceived speed of a center stimulus. Visual stimuli were two overlapping random-dot patterns. The center stimulus moved coherently in a fixed direction, whereas the background stimulus moved randomly. We found that human subjects perceived the speed of the center stimulus to be significantly faster than its veridical speed when the background contained motion noise. Interestingly, the perceived speed was tuned to the noise level of the background. When the speed of the center stimulus was low, the highest perceived speed was reached when the background had a low level of motion noise. As the center speed increased, the peak perceived speed was reached at a progressively higher background noise level. The effect of speed overestimation required the center stimulus to overlap with the background. Increasing the background size within a certain range enhanced the effect, suggesting spatial integration. The speed overestimation was significantly reduced or abolished when the center stimulus and the background stimulus had different colors, or when they were placed at different depths. When the center- and background-stimuli were perceptually separable, speed overestimation was correlated with perceptual similarity between the center- and background-stimuli. These results suggest that integration of motion energy from random motion noise has a significant impact on speed perception. Our findings put new constraints on models regarding the neural basis of speed perception. Copyright © 2016 the American Physiological Society.

  7. Nematode neuropeptides as transgenic nematicides.

    Directory of Open Access Journals (Sweden)

    Neil D Warnock

    2017-02-01

    Full Text Available Plant parasitic nematodes (PPNs seriously threaten global food security. Conventionally an integrated approach to PPN management has relied heavily on carbamate, organophosphate and fumigant nematicides which are now being withdrawn over environmental health and safety concerns. This progressive withdrawal has left a significant shortcoming in our ability to manage these economically important parasites, and highlights the need for novel and robust control methods. Nematodes can assimilate exogenous peptides through retrograde transport along the chemosensory amphid neurons. Peptides can accumulate within cells of the central nerve ring and can elicit physiological effects when released to interact with receptors on adjoining cells. We have profiled bioactive neuropeptides from the neuropeptide-like protein (NLP family of PPNs as novel nematicides, and have identified numerous discrete NLPs that negatively impact chemosensation, host invasion and stylet thrusting of the root knot nematode Meloidogyne incognita and the potato cyst nematode Globodera pallida. Transgenic secretion of these peptides from the rhizobacterium, Bacillus subtilis, and the terrestrial microalgae Chlamydomonas reinhardtii reduce tomato infection levels by up to 90% when compared with controls. These data pave the way for the exploitation of nematode neuropeptides as a novel class of plant protective nematicide, using novel non-food transgenic delivery systems which could be deployed on farmer-preferred cultivars.

  8. Structure of Exogenous Gene Integration and Event-Specific Detection in the Glyphosate-Tolerant Transgenic Cotton Line BG2-7.

    Science.gov (United States)

    Zhang, Xiaobing; Tang, Qiaoling; Wang, Xujing; Wang, Zhixing

    2016-01-01

    In this study, the flanking sequence of an inserted fragment conferring glyphosate tolerance on transgenic cotton line BG2-7 was analyzed by thermal asymmetric interlaced polymerase chain reaction (TAIL-PCR) and standard PCR. The results showed apparent insertion of the exogenous gene into chromosome D10 of the Gossypium hirsutum L. genome, as the left and right borders of the inserted fragment are nucleotides 61,962,952 and 61,962,921 of chromosome D10, respectively. In addition, a 31-bp cotton microsatellite sequence was noted between the genome sequence and the 5' end of the exogenous gene. In total, 84 and 298 bp were deleted from the left and right borders of the exogenous gene, respectively, with 30 bp deleted from the cotton chromosome at the insertion site. According to the flanking sequence obtained, several pairs of event-specific detection primers were designed to amplify sequence between the 5' end of the exogenous gene and the cotton genome junction region as well as between the 3' end and the cotton genome junction region. Based on screening tests, the 5'-end primers GTCATAACGTGACTCCCTTAATTCTCC/CCTATTACACGGCTATGC and 3'-end primers TCCTTTCGCTTTCTTCCCTT/ACACTTACATGGCGTCTTCT were used to detect the respective BG2-7 event-specific primers. The limit of detection of the former primers reached 44 copies, and that of the latter primers reached 88 copies. The results of this study provide useful data for assessment of BG2-7 safety and for accelerating its industrialization.

  9. Transgenics in Agriculture

    Indian Academy of Sciences (India)

    Home; Journals; Resonance – Journal of Science Education; Volume 6; Issue 2. Transgenics in Agriculture. D Rex Arunraj B Gajendra Babu. Classroom Volume 6 Issue 2 February 2001 pp 83-92. Fulltext. Click here to view fulltext PDF. Permanent link: https://www.ias.ac.in/article/fulltext/reso/006/02/0083-0092 ...

  10. Recent advances in the development of new transgenic animal technology.

    Science.gov (United States)

    Miao, Xiangyang

    2013-03-01

    Transgenic animal technology is one of the fastest growing biotechnology areas. It is used to integrate exogenous genes into the animal genome by genetic engineering technology so that these genes can be inherited and expressed by offspring. The transgenic efficiency and precise control of gene expression are the key limiting factors in the production of transgenic animals. A variety of transgenic technologies are available. Each has its own advantages and disadvantages and needs further study because of unresolved technical and safety issues. Further studies will allow transgenic technology to explore gene function, animal genetic improvement, bioreactors, animal disease models, and organ transplantation. This article reviews the recently developed animal transgenic technologies, including the germ line stem cell-mediated method to improve efficiency, gene targeting to improve accuracy, RNA interference-mediated gene silencing technology, zinc-finger nuclease gene targeting technology and induced pluripotent stem cell technology. These new transgenic techniques can provide a better platform to develop transgenic animals for breeding new animal varieties and promote the development of medical sciences, livestock production, and other fields.

  11. Integrating CHWs as Part of the Team Leading Diabetes Group Visits: A Randomized Controlled Feasibility Study.

    Science.gov (United States)

    Vaughan, Elizabeth M; Johnston, Craig A; Cardenas, Victor J; Moreno, Jennette P; Foreyt, John P

    2017-12-01

    Purpose The purpose of the study was to evaluate the feasibility of integrating Community Health Workers (CHWs) as part of the team leading diabetes group visits. Methods This was a randomized controlled study that integrated CHWs as part of the team leading diabetes group visits for low-income Hispanic adults (n = 50). Group visits met for 3 hours each month for a 6-month duration. Main measures included baseline and 6-month clinical outcomes (ie, A1C, lipids), concordance with 8 standard of care guidelines (ie, screens for cervical, breast, and colon cancer) from the US Preventive Task Force and American Diabetes Association, and participant acceptability. Results Compared to control participants, the intervention group resulted in significantly better clinical outcomes or guideline concordance for the following areas: target A1C levels, retinal eye exams, diabetes foot exams, mammograms, and urine microalbumin. Significantly more individuals in the control group gained weight, whereas a greater number of participants in the intervention group lost weight. Intervention participants found the group visits highly acceptable. Conclusions Integrating CHWs as part a comprehensive diabetes group visit program is a feasible and effective system-level intervention to improve glycemic control and achieve guideline concordance.

  12. Accelerated Homology-Directed Targeted Integration of Transgenes in Chinese Hamster Ovary Cells Via CRISPR/Cas9 and Fluorescent Enrichment

    DEFF Research Database (Denmark)

    Lee, Jae Seong; Grav, Lise Marie; Pedersen, Lasse Ebdrup

    2016-01-01

    Targeted gene integration into site-specific loci can be achieved in Chinese hamster ovary (CHO) cells via CRISPR/Cas9 genome editing technology and the homology-directed repair (HDR) pathway. The low efficiency of HDR often requires antibiotic selection, which limits targeted integration...

  13. An integrated approach to consumer representation and involvement in a multicentre randomized controlled trial.

    Science.gov (United States)

    Langston, Anne L; McCallum, Marilyn; Campbell, Marion K; Robertson, Clare; Ralston, Stuart H

    2005-01-01

    Although, consumer involvement in individual studies is often limited, their involvement in guiding health research is generally considered to be beneficial. This paper outlines our experiences of an integrated relationship between the organisers of a clinical trial and a consumer organisation. The PRISM trial is a UK multicentre, randomized controlled trial comparing treatment strategies for Paget's disease of the bone. The National Association for the Relief of Paget's Disease (NARPD) is the only UK support group for sufferers of Paget's disease and has worked closely with the PRISM team from the outset. NARPD involvement is integral to the conduct of the trial and specific roles have included: peer-review; trial steering committee membership; provision of advice to participants, and promotion of the trial amongst Paget's disease patients. The integrated relationship has yielded benefits to both the trial and the consumer organisation. The benefits for the trial have included: recruitment of participants via NARPD contacts; well-informed participants; unsolicited patient advocacy of the trial; and interested and pro-active collaborators. For the NARPD and Paget's disease sufferers, benefits have included: increased awareness of Paget's disease; increased access to relevant health research; increased awareness of the NARPD services; and wider transfer of diagnosis and management knowledge to/from health care professionals. Our experience has shown that an integrated approach between a trial team and a consumer organisation is worthwhile. Adoption of such an approach in other trials may yield significant improvements in recruitment and quality of participant information flow. There are, however, resource implications for both parties.

  14. Genetic load and transgenic mitigating genes in transgenic Brassica rapa (field mustard × Brassica napus (oilseed rape hybrid populations

    Directory of Open Access Journals (Sweden)

    Warwick Suzanne I

    2009-10-01

    Full Text Available Abstract Background One theoretical explanation for the relatively poor performance of Brassica rapa (weed × Brassica napus (crop transgenic hybrids suggests that hybridization imparts a negative genetic load. Consequently, in hybrids genetic load could overshadow any benefits of fitness enhancing transgenes and become the limiting factor in transgenic hybrid persistence. Two types of genetic load were analyzed in this study: random/linkage-derived genetic load, and directly incorporated genetic load using a transgenic mitigation (TM strategy. In order to measure the effects of random genetic load, hybrid productivity (seed yield and biomass was correlated with crop- and weed-specific AFLP genomic markers. This portion of the study was designed to answer whether or not weed × transgenic crop hybrids possessing more crop genes were less competitive than hybrids containing fewer crop genes. The effects of directly incorporated genetic load (TM were analyzed through transgene persistence data. TM strategies are proposed to decrease transgene persistence if gene flow and subsequent transgene introgression to a wild host were to occur. Results In the absence of interspecific competition, transgenic weed × crop hybrids benefited from having more crop-specific alleles. There was a positive correlation between performance and number of B. napus crop-specific AFLP markers [seed yield vs. marker number (r = 0.54, P = 0.0003 and vegetative dry biomass vs. marker number (r = 0.44, P = 0.005]. However under interspecific competition with wheat or more weed-like conditions (i.e. representing a situation where hybrid plants emerge as volunteer weeds in subsequent cropping systems, there was a positive correlation between the number of B. rapa weed-specific AFLP markers and seed yield (r = 0.70, P = 0.0001, although no such correlation was detected for vegetative biomass. When genetic load was directly incorporated into the hybrid genome, by inserting a

  15. Simulating propagation of coherent light in random media using the Fredholm type integral equation

    Science.gov (United States)

    Kraszewski, Maciej; Pluciński, Jerzy

    2017-06-01

    Studying propagation of light in random scattering materials is important for both basic and applied research. Such studies often require usage of numerical method for simulating behavior of light beams in random media. However, if such simulations require consideration of coherence properties of light, they may become a complex numerical problems. There are well established methods for simulating multiple scattering of light (e.g. Radiative Transfer Theory and Monte Carlo methods) but they do not treat coherence properties of light directly. Some variations of these methods allows to predict behavior of coherent light but only for an averaged realization of the scattering medium. This limits their application in studying many physical phenomena connected to a specific distribution of scattering particles (e.g. laser speckle). In general, numerical simulation of coherent light propagation in a specific realization of random medium is a time- and memory-consuming problem. The goal of the presented research was to develop new efficient method for solving this problem. The method, presented in our earlier works, is based on solving the Fredholm type integral equation, which describes multiple light scattering process. This equation can be discretized and solved numerically using various algorithms e.g. by direct solving the corresponding linear equations system, as well as by using iterative or Monte Carlo solvers. Here we present recent development of this method including its comparison with well-known analytical results and a finite-difference type simulations. We also present extension of the method for problems of multiple scattering of a polarized light on large spherical particles that joins presented mathematical formalism with Mie theory.

  16. Multilevel compression of random walks on networks reveals hierarchical organization in large integrated systems.

    Directory of Open Access Journals (Sweden)

    Martin Rosvall

    Full Text Available To comprehend the hierarchical organization of large integrated systems, we introduce the hierarchical map equation, which reveals multilevel structures in networks. In this information-theoretic approach, we exploit the duality between compression and pattern detection; by compressing a description of a random walker as a proxy for real flow on a network, we find regularities in the network that induce this system-wide flow. Finding the shortest multilevel description of the random walker therefore gives us the best hierarchical clustering of the network--the optimal number of levels and modular partition at each level--with respect to the dynamics on the network. With a novel search algorithm, we extract and illustrate the rich multilevel organization of several large social and biological networks. For example, from the global air traffic network we uncover countries and continents, and from the pattern of scientific communication we reveal more than 100 scientific fields organized in four major disciplines: life sciences, physical sciences, ecology and earth sciences, and social sciences. In general, we find shallow hierarchical structures in globally interconnected systems, such as neural networks, and rich multilevel organizations in systems with highly separated regions, such as road networks.

  17. Gene flow from transgenic common beans expressing the bar gene.

    Science.gov (United States)

    Faria, Josias C; Carneiro, Geraldo E S; Aragão, Francisco J L

    2010-01-01

    Gene flow is a common phenomenon even in self-pollinated plant species. With the advent of genetically modified plants this subject has become of the utmost importance due to the need for controlling the spread of transgenes. This study was conducted to determine the occurrence and intensity of outcrossing in transgenic common beans. In order to evaluate the outcross rates, four experiments were conducted in Santo Antonio de Goiás (GO, Brazil) and one in Londrina (PR, Brazil), using transgenic cultivars resistant to the herbicide glufosinate ammonium and their conventional counterparts as recipients of the transgene. Experiments with cv. Olathe Pinto and the transgenic line Olathe M1/4 were conducted in a completely randomized design with ten replications for three years in one location, whereas the experiments with cv. Pérola and the transgenic line Pérola M1/4 were conducted at two locations for one year, with the transgenic cultivar surrounded on all sides by the conventional counterpart. The outcross occurred at a negligible rate of 0.00741% in cv. Pérola, while none was observed (0.0%) in cv. Olathe Pinto. The frequency of gene flow was cultivar dependent and most of the observed outcross was within 2.5 m from the edge of the pollen source. Index terms: Phaseolus vulgaris, outcross, glufosinate ammonium.

  18. Transfection of Eimeria mitis with yellow fluorescent protein as reporter and the endogenous development of the transgenic parasite.

    Directory of Open Access Journals (Sweden)

    Mei Qin

    Full Text Available BACKGROUND: Advancements have been made in the genetic manipulation of apicomplexan parasites. Both the in vitro transient and in vivo stable transfection of Eimeria tenella have been developed successfully. Herein, we report the transient and stable transfection of Eimeria mitis. METHODS AND FINDINGS: Sporozoites of E. mitis transfected with enhanced yellow fluorescent protein (EYFP expression plasmid were inoculated into chickens via the cloacal route. The recovered fluorescent oocysts were sorted by fluorescence activated cell sorting (FACS and then passaged 6 generations successively in chickens. The resulting population was analyzed by genome walking and Western blot. The endogenous development of the transgenic E. mitis was observed and its reproduction potential was tested. The stable transfection of E. mitis was developed. Genome walking confirmed the random integration of plasmid DNA into the genome; while Western blot analysis demonstrated the expression of foreign proteins. Constitutive expression of EYFP was observed in all stages of merogony, gametogony and sporogony. The peak of the transgenic oocyst output was delayed by 24 h and the total oocyst reproduction was reduced by 7-fold when compared to the parental strain. CONCLUSION: Stable transfection of E. mitis was successfully developed. The expression of foreign antigens in the transgenic parasites will facilitate the development of transgenic E. mitis as a vaccine vector.

  19. Efficient Recombinase-Mediated Cassette Exchange in hPSCs to Study the Hepatocyte Lineage Reveals AAVS1 Locus-Mediated Transgene Inhibition

    Directory of Open Access Journals (Sweden)

    Laura Ordovás

    2015-11-01

    Full Text Available Tools for rapid and efficient transgenesis in “safe harbor” loci in an isogenic context remain important to exploit the possibilities of human pluripotent stem cells (hPSCs. We created hPSC master cell lines suitable for FLPe recombinase-mediated cassette exchange (RMCE in the AAVS1 locus that allow generation of transgenic lines within 15 days with 100% efficiency and without random integrations. Using RMCE, we successfully incorporated several transgenes useful for lineage identification, cell toxicity studies, and gene overexpression to study the hepatocyte lineage. However, we observed unexpected and variable transgene expression inhibition in vitro, due to DNA methylation and other unknown mechanisms, both in undifferentiated hESC and differentiating hepatocytes. Therefore, the AAVS1 locus cannot be considered a universally safe harbor locus for reliable transgene expression in vitro, and using it for transgenesis in hPSC will require careful assessment of the function of individual transgenes.

  20. Transgenic algae engineered for higher performance

    Science.gov (United States)

    Unkefer, Pat J; Anderson, Penelope S; Knight, Thomas J

    2014-10-21

    The present disclosure relates to transgenic algae having increased growth characteristics, and methods of increasing growth characteristics of algae. In particular, the disclosure relates to transgenic algae comprising a glutamine phenylpyruvate transaminase transgene and to transgenic algae comprising a glutamine phenylpyruvate transaminase transgene and a glutamine synthetase.

  1. The MedSeq Project: a randomized trial of integrating whole genome sequencing into clinical medicine.

    Science.gov (United States)

    Vassy, Jason L; Lautenbach, Denise M; McLaughlin, Heather M; Kong, Sek Won; Christensen, Kurt D; Krier, Joel; Kohane, Isaac S; Feuerman, Lindsay Z; Blumenthal-Barby, Jennifer; Roberts, J Scott; Lehmann, Lisa Soleymani; Ho, Carolyn Y; Ubel, Peter A; MacRae, Calum A; Seidman, Christine E; Murray, Michael F; McGuire, Amy L; Rehm, Heidi L; Green, Robert C

    2014-03-20

    Whole genome sequencing (WGS) is already being used in certain clinical and research settings, but its impact on patient well-being, health-care utilization, and clinical decision-making remains largely unstudied. It is also unknown how best to communicate sequencing results to physicians and patients to improve health. We describe the design of the MedSeq Project: the first randomized trials of WGS in clinical care. This pair of randomized controlled trials compares WGS to standard of care in two clinical contexts: (a) disease-specific genomic medicine in a cardiomyopathy clinic and (b) general genomic medicine in primary care. We are recruiting 8 to 12 cardiologists, 8 to 12 primary care physicians, and approximately 200 of their patients. Patient participants in both the cardiology and primary care trials are randomly assigned to receive a family history assessment with or without WGS. Our laboratory delivers a genome report to physician participants that balances the needs to enhance understandability of genomic information and to convey its complexity. We provide an educational curriculum for physician participants and offer them a hotline to genetics professionals for guidance in interpreting and managing their patients' genome reports. Using varied data sources, including surveys, semi-structured interviews, and review of clinical data, we measure the attitudes, behaviors and outcomes of physician and patient participants at multiple time points before and after the disclosure of these results. The impact of emerging sequencing technologies on patient care is unclear. We have designed a process of interpreting WGS results and delivering them to physicians in a way that anticipates how we envision genomic medicine will evolve in the near future. That is, our WGS report provides clinically relevant information while communicating the complexity and uncertainty of WGS results to physicians and, through physicians, to their patients. This project will not only

  2. An Efficient Method for Generation of Transgenic Rats Avoiding Embryo Manipulation

    Directory of Open Access Journals (Sweden)

    Bhola Shankar Pradhan

    2016-01-01

    Full Text Available Although rats are preferred over mice as an animal model, transgenic animals are generated predominantly using mouse embryos. There are limitations in the generation of transgenic rat by embryo manipulation. Unlike mouse embryos, most of the rat embryos do not survive after male pronuclear DNA injection which reduces the efficiency of generation of transgenic rat by this method. More importantly, this method requires hundreds of eggs collected by killing several females for insertion of transgene to generate transgenic rat. To this end, we developed a noninvasive and deathless technique for generation of transgenic rats by integrating transgene into the genome of the spermatogonial cells by testicular injection of DNA followed by electroporation. After standardization of this technique using EGFP as a transgene, a transgenic disease model displaying alpha thalassemia was successfully generated using rats. This efficient method will ease the generation of transgenic rats without killing the lives of rats while simultaneously reducing the number of rats used for generation of transgenic animal.

  3. Plant biotechnology: transgenic crops.

    Science.gov (United States)

    Shewry, Peter R; Jones, Huw D; Halford, Nigel G

    2008-01-01

    Transgenesis is an important adjunct to classical plant breeding, in that it allows the targeted manipulation of specific characters using genes from a range of sources. The current status of crop transformation is reviewed, including methods of gene transfer, the selection of transformed plants and control of transgene expression. The application of genetic modification technology to specific traits is then discussed, including input traits relating to crop production (herbicide tolerance and resistance to insects, pathogens and abiotic stresses) and output traits relating to the composition and quality of the harvested organs. The latter include improving the nutritional quality for consumers as well as the improvement of functional properties for food processing.

  4. Integrated Behavior Therapy for Selective Mutism: a randomized controlled pilot study.

    Science.gov (United States)

    Bergman, R Lindsey; Gonzalez, Araceli; Piacentini, John; Keller, Melody L

    2013-10-01

    To evaluate the feasibility, acceptability, and preliminary efficacy of a novel behavioral intervention for reducing symptoms of selective mutism and increasing functional speech. A total of 21 children ages 4 to 8 with primary selective mutism were randomized to 24 weeks of Integrated Behavior Therapy for Selective Mutism (IBTSM) or a 12-week Waitlist control. Clinical outcomes were assessed using blind independent evaluators, parent-, and teacher-report, and an objective behavioral measure. Treatment recipients completed a three-month follow-up to assess durability of treatment gains. Data indicated increased functional speaking behavior post-treatment as rated by parents and teachers, with a high rate of treatment responders as rated by blind independent evaluators (75%). Conversely, children in the Waitlist comparison group did not experience significant improvements in speaking behaviors. Children who received IBTSM also demonstrated significant improvements in number of words spoken at school compared to baseline, however, significant group differences did not emerge. Treatment recipients also experienced significant reductions in social anxiety per parent, but not teacher, report. Clinical gains were maintained over 3 month follow-up. IBTSM appears to be a promising new intervention that is efficacious in increasing functional speaking behaviors, feasible, and acceptable to parents and teachers. Copyright © 2013 Elsevier Ltd. All rights reserved.

  5. On the estimation of multiple random integrals and U-statistics

    CERN Document Server

    Major, Péter

    2013-01-01

    This work starts with the study of those limit theorems in probability theory for which classical methods do not work. In many cases some form of linearization can help to solve the problem, because the linearized version is simpler. But in order to apply such a method we have to show that the linearization causes a negligible error. The estimation of this error leads to some important large deviation type problems, and the main subject of this work is their investigation. We provide sharp estimates of the tail distribution of multiple integrals with respect to a normalized empirical measure and so-called degenerate U-statistics and also of the supremum of appropriate classes of such quantities. The proofs apply a number of useful techniques of modern probability that enable us to investigate the non-linear functionals of independent random variables. This lecture note yields insights into these methods, and may also be useful for those who only want some new tools to help them prove limit theorems when stand...

  6. [TSA improve transgenic porcine cloned embryo development and transgene expression].

    Science.gov (United States)

    Kong, Qing-Ran; Zhu, Jiang; Huang, Bo; Huan, Yan-Jun; Wang, Feng; Shi, Yong-Qian; Liu, Zhong-Feng; Wu, Mei-Ling; Liu, Zhong-Hua

    2011-07-01

    Uncompleted epigenetic reprogramming is attributed to the low efficiency of producing transgenic cloned animals. Histone modification associated with epigenetics can directly influence the embryo development and transgene expression. Trichostatin A (TSA), as an inhibitor of histone deacetylase, can change the status of histone acetylation, improve somatic cell reprogramming, and enhance cloning efficiency. TSA prevents the chromatin structure from being condensed, so that transcription factor could binds to DNA sequence easily and enhance transgene expression. Our study established the optimal TSA treatment on porcine donor cells and cloned embryos, 250 nmol/L, 24 h and 40 nmol/L, 24 h, respectively. Furthermore, we found that both the cloned embryo and the donor cell treated by TSA resulted in the highest development efficiency. Meanwhile, TSA can improve transgene expression in donor cell and cloned embryo. In summary, TSA can significantly improve porcine reconstructed embryo development and transgene expression.

  7. Impulsive synchronization of Markovian jumping randomly coupled neural networks with partly unknown transition probabilities via multiple integral approach.

    Science.gov (United States)

    Chandrasekar, A; Rakkiyappan, R; Cao, Jinde

    2015-10-01

    This paper studies the impulsive synchronization of Markovian jumping randomly coupled neural networks with partly unknown transition probabilities via multiple integral approach. The array of neural networks are coupled in a random fashion which is governed by Bernoulli random variable. The aim of this paper is to obtain the synchronization criteria, which is suitable for both exactly known and partly unknown transition probabilities such that the coupled neural network is synchronized with mixed time-delay. The considered impulsive effects can be synchronized at partly unknown transition probabilities. Besides, a multiple integral approach is also proposed to strengthen the Markovian jumping randomly coupled neural networks with partly unknown transition probabilities. By making use of Kronecker product and some useful integral inequalities, a novel Lyapunov-Krasovskii functional was designed for handling the coupled neural network with mixed delay and then impulsive synchronization criteria are solvable in a set of linear matrix inequalities. Finally, numerical examples are presented to illustrate the effectiveness and advantages of the theoretical results. Copyright © 2015 Elsevier Ltd. All rights reserved.

  8. TL transgenic mouse strains

    International Nuclear Information System (INIS)

    Obata, Y.; Matsudaira, Y.; Hasegawa, H.; Tamaki, H.; Takahashi, T.; Morita, A.; Kasai, K.

    1993-01-01

    As a result of abnormal development of the thymus of these mice, TCR αβ lineage of the T cell differentiation is disturbed and cells belonging to the TCR γδ CD4 - CD8 - double negative (DN) lineage become preponderant. The γδ DN cells migrate into peripheral lymphoid organs and constitute nearly 50% of peripheral T cells. Immune function of the transgenic mice is severely impaired, indicating that the γδ cells are incapable of participating in these reactions. Molecular and serological analyses of T-cell lymphomas reveal that they belong to the γδ lineage. Tg.Tla a -3-1 mice should be useful in defining the role of TL in normal and abnormal T cell differentiation as well as in the development of T-cell lymphomas, and further they should facilitate studies on the differentiation and function of γδ T cells. We isolated T3 b -TL gene from B6 mice and constructed a chimeric gene in which T3 b -TL is driven by the promoter of H-2K b . With the chimeric gene, two transgenic mouse strains, Tg. Con.3-1 and -2 have been derived in C3H background. Both strains express TL antigen in various tissues including skin. The skin graft of transgenic mice on C3H and (B6 X C3H)F 1 mice were rejected. In the mice which rejected the grafts, CD8 + TCRαβ cytotoxic T cells (CTL) against TL antigens were recognized. The recognition of TL by CTL did not require the antigen presentation by H-2 molecules. The results indicated that TL antigen in the skin becomes a transplantation antigen and behaves like a typical allogeneic MHC class I antigen. The facts that (B6 X C3H)F 1 mice rejected the skin expressing T3 b -TL antigen and induced CTL that killed TL + lymphomas of B6 origin revealed that TL antigen encoded by T3 b -TL is recognized as non-self in B6 mice. Experiments are now extended to analyze immune responses to TL antigen expressed on autochthonous T cell lymphomas. (J.P.N.)

  9. Segregation and expression of transgenes in the progenies of Bt ...

    African Journals Online (AJOL)

    DR. NJ TONUKARI

    2012-04-17

    Apr 17, 2012 ... segregation was observed in BC1F1, BC1F2 and F2 populations derived .... randomly chosen at the tillering stage respectively and were ground .... Figure 2. Southern blot of Hind III-digested DNA from Bt transgenic rice line ...

  10. Multiple Kernel Learning with Random Effects for Predicting Longitudinal Outcomes and Data Integration

    Science.gov (United States)

    Chen, Tianle; Zeng, Donglin

    2015-01-01

    Summary Predicting disease risk and progression is one of the main goals in many clinical research studies. Cohort studies on the natural history and etiology of chronic diseases span years and data are collected at multiple visits. Although kernel-based statistical learning methods are proven to be powerful for a wide range of disease prediction problems, these methods are only well studied for independent data but not for longitudinal data. It is thus important to develop time-sensitive prediction rules that make use of the longitudinal nature of the data. In this paper, we develop a novel statistical learning method for longitudinal data by introducing subject-specific short-term and long-term latent effects through a designed kernel to account for within-subject correlation of longitudinal measurements. Since the presence of multiple sources of data is increasingly common, we embed our method in a multiple kernel learning framework and propose a regularized multiple kernel statistical learning with random effects to construct effective nonparametric prediction rules. Our method allows easy integration of various heterogeneous data sources and takes advantage of correlation among longitudinal measures to increase prediction power. We use different kernels for each data source taking advantage of the distinctive feature of each data modality, and then optimally combine data across modalities. We apply the developed methods to two large epidemiological studies, one on Huntington's disease and the other on Alzheimer's Disease (Alzheimer's Disease Neuroimaging Initiative, ADNI) where we explore a unique opportunity to combine imaging and genetic data to study prediction of mild cognitive impairment, and show a substantial gain in performance while accounting for the longitudinal aspect of the data. PMID:26177419

  11. Integration of family planning services into HIV care clinics: Results one year after a cluster randomized controlled trial in Kenya.

    Directory of Open Access Journals (Sweden)

    Craig R Cohen

    Full Text Available To determine if integration of family planning (FP and HIV services led to increased use of more effective contraception (i.e. hormonal and permanent methods, and intrauterine devices and decreased pregnancy rates.Cohort analysis following cluster randomized trial, when the Kenya Ministry of Health led integration of the remaining control (delayed integration sites and oversaw integrated services at the original intervention (early integration sites.Eighteen health facilities in Kenya.Women aged 18-45 receiving care: 5682 encounters at baseline, and 11628 encounters during the fourth quarter of year 2."One-stop shop" approach to integrating FP and HIV services.Use of more effective contraceptive methods and incident pregnancy across two years of follow-up.Following integration of FP and HIV services at the six delayed integration clinics, use of more effective contraception increased from 31.7% to 44.2% of encounters (+12.5%; Prevalence ratio (PR = 1.39 (1.19-1.63. Among the twelve early integration sites, the proportion of encounters at which women used more effective contraceptive methods was sustained from the end of the first to the second year of follow-up (37.5% vs. 37.0%. Pregnancy incidence including all 18 integrated sites in year two declined in comparison to the control arm in year one (rate ratio: 0.72; 95% CI 0.60-0.87.Integration of FP services into HIV clinics led to a sustained increase in the use of more effective contraceptives and decrease in pregnancy incidence 24 months following implementation of the integrated service model.ClinicalTrials.gov NCT01001507.

  12. Psychotherapy integration under scrutiny: investigating the impact of integrating emotion-focused components into a CBT-based approach: a study protocol of a randomized controlled trial.

    Science.gov (United States)

    Babl, Anna; Grosse Holtforth, Martin; Heer, Sara; Lin, Mu; Stähli, Annabarbara; Holstein, Dominique; Belz, Martina; Egenolf, Yvonne; Frischknecht, Eveline; Ramseyer, Fabian; Regli, Daniel; Schmied, Emma; Flückiger, Christoph; Brodbeck, Jeannette; Berger, Thomas; Caspar, Franz

    2016-11-24

    This currently recruiting randomized controlled trial investigates the effects of integrating components of Emotion-Focused Therapy (EFT) into Psychological Therapy (PT), an integrative form of cognitive-behavioral therapy in a manner that is directly mirroring common integrative practice in the sense of assimilative integration. Aims of the study are to understand how both, an existing therapy approach as well as the elements to be integrated, are affected by the integration and to clarify the role of emotional processing as a mediator of therapy outcome. A total of 130 adults with a diagnosed unipolar depressive, anxiety or adjustment disorder (seeking treatment at a psychotherapy outpatient clinic) are randomized to either treatment as usual (PT) with integrated emotion-focused components (TAU + EFT) or PT (TAU). Primary outcome variables are psychopathology and symptom severity at the end of therapy and at follow up; secondary outcome variables are interpersonal problems, psychological wellbeing, quality of life, attainment of individual therapy goals, and emotional competency. Furthermore, process variables such as the quality of the therapeutic relationship are studied as well as aptitude-treatment interactions. Variables are assessed at baseline, after 8 and 16 sessions, at the end of therapy, after 25 ± 3 sessions, and at 6, 12 and 36 month follow-up. Underlying mechanisms of change are investigated. Statistical analyses will be conducted using the appropriate multilevel approaches, mainly two-level regression and growth analysis. The results of this study will indicate whether the integration of emotion-focused elements into treatment as usual increases the effectiveness of Psychological Therapy. If advantages are found, which may be limited to particular variables or subgroups of patients, recommendations for a systematic integration, and caveats if also disadvantages are detected, can be formulated. On a more abstract level, a cognitive

  13. Principles and strategies for monitoring data collection integrity in a multi-site randomized clinical trial of a behavioral intervention.

    Science.gov (United States)

    Phillips-Salimi, Celeste R; Donovan Stickler, Molly A; Stegenga, Kristin; Lee, Melissa; Haase, Joan E

    2011-08-01

    Although treatment fidelity strategies for enhancing the integrity of behavioral interventions have been well described, little has been written about monitoring data collection integrity. This article describes the principles and strategies developed to monitor data collection integrity of the "Stories and Music for Adolescent/Young Adult Resilience During Transplant" study (R01NR008583, U10CA098543, and U10CA095861)-a multi-site Children's Oncology Group randomized clinical trial of a music therapy intervention for adolescents and young adults undergoing stem cell transplant. The principles and strategies outlined in this article provide one model for development and evaluation of a data collection integrity monitoring plan for behavioral interventions that may be adapted by investigators and may be useful to funding agencies and grant application reviewers in evaluating proposals. Copyright © 2011 Wiley Periodicals, Inc.

  14. Genetic transformation and gene silencing mediated by multiple copies of a transgene in eastern white pine.

    Science.gov (United States)

    Tang, Wei; Newton, Ronald J; Weidner, Douglas A

    2007-01-01

    An efficient transgenic eastern white pine (Pinus strobus L.) plant regeneration system has been established using Agrobacterium tumefaciens strain GV3850-mediated transformation and the green fluorescent protein (gfp) gene as a reporter in this investigation. Stable integration of transgenes in the plant genome of pine was confirmed by polymerase chain reaction (PCR), Southern blot, and northern blot analyses. Transgene expression was analysed in pine T-DNA transformants carrying different numbers of copies of T-DNA insertions. Post-transcriptional gene silencing (PTGS) was mostly obtained in transgenic lines with more than three copies of T-DNA, but not in transgenic lines with one copy of T-DNA. In situ hybridization chromosome analysis of transgenic lines demonstrated that silenced transgenic lines had two or more T-DNA insertions in the same chromosome. These results suggest that two or more T-DNA insertions in the same chromosome facilitate efficient gene silencing in transgenic pine cells expressing green fluorescent protein. There were no differences in shoot differentiation and development between transgenic lines with multiple T-DNA copies and transgenic lines with one or two T-DNA copies.

  15. A Data Management System Integrating Web-Based Training and Randomized Trials

    Science.gov (United States)

    Muroff, Jordana; Amodeo, Maryann; Larson, Mary Jo; Carey, Margaret; Loftin, Ralph D.

    2011-01-01

    This article describes a data management system (DMS) developed to support a large-scale randomized study of an innovative web-course that was designed to improve substance abuse counselors' knowledge and skills in applying a substance abuse treatment method (i.e., cognitive behavioral therapy; CBT). The randomized trial compared the performance…

  16. Transgenics, agroindustry and food sovereignty

    Directory of Open Access Journals (Sweden)

    Xavier Alejandro León Vega

    2014-10-01

    Full Text Available Food sovereignty has been implemented constitutionally in Ecuador; however, many of the actions and policies are designed to benefit the dominant model of food production, based in agroindustry, intensive monocultures, agrochemicals and transgenics. This article reflects upon the role of family farming as a generator of food sovereignty, and secondly the threat to them by agroindustry agriculture based in transgenic. The role played by food aid in the introduction of transgenic in Latin America and other regions of the world is also analyzed.

  17. Development of transgenic wheat (Triticum aestivum L.) expressing avidin gene conferring resistance to stored product insects.

    Science.gov (United States)

    Abouseadaa, Heba H; Osman, Gamal H; Ramadan, Ahmed M; Hassanein, Sameh E; Abdelsattar, Mohamed T; Morsy, Yasser B; Alameldin, Hussien F; El-Ghareeb, Doaa K; Nour-Eldin, Hanan A; Salem, Reda; Gad, Adel A; Elkhodary, Soheir E; Shehata, Maher M; Mahfouz, Hala M; Eissa, Hala F; Bahieldin, Ahmed

    2015-07-22

    Wheat is considered the most important cereal crop all over the world. The wheat weevil Sitophilus granarius is a serious insect pests in much of the wheat growing area worldwide and is responsible for significant loss of yield. Avidin proteins has been proposed to function as plant defense agents against insect pests. A synthetic avidin gene was introduced into spring wheat (Triticum aestivum L.) cv. Giza 168 using a biolistic bombardment protocol. The presence and expression of the transgene in six selected T0 transgenic wheat lines were confirmed at the molecular level. Accumulation of avidin protein was detected in transgenic plants compared to non-transgenic plants. Avidin transgene was stably integrated, transcribed and translated as indicated by Southern blot, ELISA, and dot blot analyses, with a high level of expression in transgenic wheat seeds. However, no expression was detected in untransformed wheat seeds. Functional integrity of avidin was confirmed by insect bioassay. The results of bioassay using transgenic wheat plants challenged with wheat weevil revealed 100 % mortality of the insects reared on transgenic plants after 21 days. Transgenic wheat plants had improved resistance to Sitophilus granarius.

  18. A Data Management System Integrating Web-based Training and Randomized Trials: Requirements, Experiences and Recommendations.

    Science.gov (United States)

    Muroff, Jordana; Amodeo, Maryann; Larson, Mary Jo; Carey, Margaret; Loftin, Ralph D

    2011-01-01

    This article describes a data management system (DMS) developed to support a large-scale randomized study of an innovative web-course that was designed to improve substance abuse counselors' knowledge and skills in applying a substance abuse treatment method (i.e., cognitive behavioral therapy; CBT). The randomized trial compared the performance of web-course-trained participants (intervention group) and printed-manual-trained participants (comparison group) to determine the effectiveness of the web-course in teaching CBT skills. A single DMS was needed to support all aspects of the study: web-course delivery and management, as well as randomized trial management. The authors briefly reviewed several other systems that were described as built either to handle randomized trials or to deliver and evaluate web-based training. However it was clear that these systems fell short of meeting our needs for simultaneous, coordinated management of the web-course and the randomized trial. New England Research Institute's (NERI) proprietary Advanced Data Entry and Protocol Tracking (ADEPT) system was coupled with the web-programmed course and customized for our purposes. This article highlights the requirements for a DMS that operates at the intersection of web-based course management systems and randomized clinical trial systems, and the extent to which the coupled, customized ADEPT satisfied those requirements. Recommendations are included for institutions and individuals considering conducting randomized trials and web-based training programs, and seeking a DMS that can meet similar requirements.

  19. Complex genomic rearrangement in CCS-LacZ transgenic mice.

    Science.gov (United States)

    Stroud, Dina Myers; Darrow, Bruce J; Kim, Sang Do; Zhang, Jie; Jongbloed, Monique R M; Rentschler, Stacey; Moskowitz, Ivan P G; Seidman, Jonathan; Fishman, Glenn I

    2007-02-01

    The cardiac conduction system (CCS)-lacZ insertional mouse mutant strain genetically labels the developing and mature CCS. This pattern of expression is presumed to reflect the site of transgene integration rather than regulatory elements within the transgene proper. We sought to characterize the genomic structure of the integration locus and identify nearby gene(s) that might potentially confer the observed CCS-specific transcription. We found rearrangement of chromosome 7 between regions D1 and E1 with altered transcription of multiple genes in the D1 region. Several lines of evidence suggested that regulatory elements from at least one gene, Slco3A1, influenced CCS-restricted reporter gene expression. In embryonic hearts, Slco3A1 was expressed in a spatial pattern similar to the CCS-lacZ transgene and was similarly neuregulin-responsive. At later stages, however, expression patterns of the transgene and Slco3A1 diverged, suggesting that the Slco3A1 locus may be necessary, but not sufficient to confer CCS-specific transgene expression in the CCS-lacZ line. (c) 2007 Wiley-Liss, Inc.

  20. Cloning of transgenic tobacco BY-2 cells; an efficient method to analyse and reduce high natural heterogeneity of transgene expression.

    Science.gov (United States)

    Nocarova, Eva; Fischer, Lukas

    2009-04-22

    Phenotypic characterization of transgenic cell lines, frequently used in plant biology studies, is complicated because transgene expression in individual cells is often heterogeneous and unstable. To identify the sources and to reduce this heterogeneity, we transformed tobacco (Nicotiana tabacum L.) BY-2 cells with a gene encoding green fluorescent protein (GFP) using Agrobacterium tumefaciens, and then introduced a simple cloning procedure to generate cell lines derived from the individual transformed cells. Expression of the transgene was monitored by analysing GFP fluorescence in the cloned lines and also in lines obtained directly after transformation. The majority ( approximately 90%) of suspension culture lines derived from calli that were obtained directly from transformation consisted of cells with various levels of GFP fluorescence. In contrast, nearly 50% of lines generated by cloning cells from the primary heterogeneous suspensions consisted of cells with homogenous GFP fluorescence. The rest of the lines exhibited "permanent heterogeneity" that could not be resolved by cloning. The extent of fluorescence heterogeneity often varied, even among genetically identical clones derived from the primary transformed lines. In contrast, the offspring of subsequent cloning of the cloned lines was uniform, showing GFP fluorescence intensity and heterogeneity that corresponded to the original clone. The results demonstrate that, besides genetic heterogeneity detected in some lines, the primary lines often contained a mixture of epigenetically different cells that could be separated by cloning. This indicates that a single integration event frequently results in various heritable expression patterns, which are probably accidental and become stabilized in the offspring of the primary transformed cells early after the integration event. Because heterogeneity in transgene expression has proven to be a serious problem, it is highly advisable to use transgenes tagged with

  1. Transgene teknikker erstatter problematisk avl

    DEFF Research Database (Denmark)

    Alstrup, Aage Kristian Olsen; Hansen, Axel Kornerup

    2016-01-01

    Dyremodeller har ofte været baseret på avl, der ud fra et alment velfærdsmæssigt synspunkt var problematisk. Transgene teknikker kan ofte forbedre dyrevelfærden ved at erstatte disse traditionelle avlsmetoder.......Dyremodeller har ofte været baseret på avl, der ud fra et alment velfærdsmæssigt synspunkt var problematisk. Transgene teknikker kan ofte forbedre dyrevelfærden ved at erstatte disse traditionelle avlsmetoder....

  2. Integration of family planning services into HIV care and treatment in Kenya: a cluster-randomized trial.

    Science.gov (United States)

    Grossman, Daniel; Onono, Maricianah; Newmann, Sara J; Blat, Cinthia; Bukusi, Elizabeth A; Shade, Starley B; Steinfeld, Rachel L; Cohen, Craig R

    2013-10-01

    To determine whether integrating family planning services into HIV care is associated with increased use of more effective contraceptive methods (sterilization, intrauterine device, implant, injectable or oral contraceptives). Cluster-randomized trial. Eighteen public HIV clinics in Nyanza Province, Kenya. Women aged 18-45 years receiving care at participating HIV clinics; 5682 clinical encounters from baseline period (December 2009-February 2010) and 12,531 encounters from end-line period (July 2011-September 2011, 1 year after site training). Twelve sites were randomized to integrate family planning services into the HIV clinic, whereas six clinics were controls where clients desiring contraception were referred to family planning clinics at the same facility. Increase in use of more effective contraceptive methods between baseline and end-line periods. Pregnancy rates during the follow-up year (October 2010-September 2011) were also compared. Women seen at integrated sites were significantly more likely to use more effective contraceptive methods at the end of the study [increased from 16.7 to 36.6% at integrated sites, compared to increase from 21.1 to 29.8% at controls; odds ratio (OR) 1.81, 95% confidence interval (CI) 1.24-2.63]. Condom use decreased non-significantly at intervention sites compared to controls (OR 0.64, 95% CI 0.35-1.19). No difference was observed in incident pregnancy in the first year after integration comparing intervention to control sites (incidence rate ratio 0.90; 95% CI 0.68-1.20). Integration of family planning services into HIV care clinics increased use of more effective contraceptive methods with a non-significant reduction in condom use. Although no significant reduction in pregnancy incidence was observed during the study, 1 year may be too short a period of observation for this outcome.

  3. Drought tolerance in transgenic tropical maize ( Zea mays L.) by ...

    African Journals Online (AJOL)

    Successful integration of XvPrx2 gene into maize we achieved and recovered 10 independent transgenic events. Transformation and regeneration frequencies were 12.9 and 31.3%, respectively. Reverse transcription polymerase chain reaction (PCR) revealed the expression of the XvPrx2 gene in transformed plants under ...

  4. Development of transgenic watermelon resistant to Cucumber mosaic virus and Watermelon mosaic virus by using a single chimeric transgene construct.

    Science.gov (United States)

    Lin, Ching-Yi; Ku, Hsin-Mei; Chiang, Yi-Hua; Ho, Hsiu-Yin; Yu, Tsong-Ann; Jan, Fuh-Jyh

    2012-10-01

    Watermelon, an important fruit crop worldwide, is prone to attack by several viruses that often results in destructive yield loss. To develop a transgenic watermelon resistant to multiple virus infection, a single chimeric transgene comprising a silencer DNA from the partial N gene of Watermelon silver mottle virus (WSMoV) fused to the partial coat protein (CP) gene sequences of Cucumber mosaic virus (CMV), Cucumber green mottle mosaic virus (CGMMV) and Watermelon mosaic virus (WMV) was constructed and transformed into watermelon (cv. Feeling) via Agrobacterium-mediated transformation. Single or multiple transgene copies randomly inserted into various locations in the genome were confirmed by Southern blot analysis. Transgenic watermelon R(0) plants were individually challenged with CMV, CGMMV or WMV, or with a mixture of these three viruses for resistance evaluation. Two lines were identified to exhibit resistance to CMV, CGMMV, WMV individually, and a mixed inoculation of the three viruses. The R(1) progeny of the two resistant R(0) lines showed resistance to CMV and WMV, but not to CGMMV. Low level accumulation of transgene transcripts in resistant plants and small interfering (si) RNAs specific to CMV and WMV were readily detected in the resistant R(1) plants by northern blot analysis, indicating that the resistance was established via RNA-mediated post-transcriptional gene silencing (PTGS). Loss of the CGMMV CP-transgene fragment in R1 progeny might be the reason for the failure to resistant CGMMV infection, as shown by the absence of a hybridization signal and no detectable siRNA specific to CGMMV in Southern and northern blot analyses. In summary, this study demonstrated that fusion of different viral CP gene fragments in transgenic watermelon contributed to multiple virus resistance via PTGS. The construct and resistant watermelon lines developed in this study could be used in a watermelon breeding program for resistance to multiple viruses.

  5. Integrative treatment for low back pain: An exploratory systematic review and meta-analysis of randomized controlled trials.

    Science.gov (United States)

    Hu, Xiao-Yang; Chen, Ni-Ni; Chai, Qian-Yun; Yang, Guo-Yan; Trevelyan, Esmé; Lorenc, Ava; Liu, Jian-Ping; Robinson, Nicola

    2015-10-26

    Low back pain (LBP) is a common musculoskeletal condition often treated using integrative medicine (IM). Most reviews have focused on a single complementary and alternative medicine (CAM) therapy for LBP rather than evaluating wider integrative approaches. This exploratory systematic review aimed to identify randomized controlled trials (RCTs) and provide evidence on the effectiveness, cost effectiveness and adverse effects of integrative treatment for LBP. A literature search was conducted in 12 English and Chinese databases. RCTs evaluating an integrative treatment for musculoskeletal related LBP were included. Reporting, methodological quality and relevant clinical characteristics were assessed and appraised. Metaanalyses were performed for outcomes where trials were sufficiently homogenous. Fifty-six RCTs were identified evaluating integrative treatment for LBP. Although reporting and methodological qualities were poor, meta-analysis showed a favourable effect for integrative treatment over conventional and CAM treatment for back pain and function at 3 months or less follow-up. Two trials investigated costs, reporting £ 5332 per quality adjusted life years with 6 Alexander technique lessons plus exercise at 12 months follow-up; and an increased total costs of $244 when giving an additional up to 15 sessions of CAM package of care at 12 weeks. Sixteen trials mentioned safety; no severe adverse effects were reported. Integrative treatment that combines CAM with conventional therapies appeared to have beneficial effects on pain and function. However, evidence is limited due to heterogeneity, the relatively small numbers available for subgroup analyses and the low methodological quality of the included trials. Identification of studies of true IM was not possible due to lack of reporting of the intervention details (registration No. CRD42013003916).

  6. The design and performance evaluation of the ultrasonic random coil identity-integrity element for underwater safeguards seals

    International Nuclear Information System (INIS)

    Allen, V.H.; Backer, S.; Smith, M.T.

    1983-06-01

    Irradiated fuel discharged from CANDU power reactors is stored underwater and, in order to comply with the requirements of International Safe-guards, the fuel is stacked in sealed containers which are examined at intervals by IAEA inspectors. The seals are verified for identity and integrity and this report describes the design of an identity/integrity element for the seals. The element is in the form of a random coil of wire which is interrogated by ultrasonic methods. An evaluation of thirty-six seals is reported. The application of seals to stacks of fuel was simulated in a water-filled bay at CRNL and repetitive verification measurements were made which simulated inspection procedures. The seal identity signatures were compared using cross-correlation methods and the results show that a broken or tampered seal can be identified with a high level of confidence

  7. Bean Yellow Dwarf Virus replicons for high-level transgene expression in transgenic plants and cell cultures.

    Science.gov (United States)

    Zhang, Xiuren; Mason, Hugh

    2006-02-05

    A novel stable transgenic plant expression system was developed using elements of the replication machinery of Bean Yellow Dwarf Virus (BeYDV). The system contains two transgenes: 1) The BeYDV replicon vector with an expression cassette flanked by cis-acting DNA elements of BeYDV, and 2) The viral replication initiator protein (Rep) controlled by an alcohol-inducible promoter. When Rep expression was triggered by treatment with ethanol, it induced release of the BeYDV replicon from stably integrated T-DNA and episomal replication to high copy number. Replicon amplification resulted in substantially increased transgene mRNA levels (up to 80-fold) and translation products (up to 10-fold) after induction of Rep expression by ethanol treatment in tobacco NT1 cells and leaves of whole potato plants. Thus, the BeYDV stable transformant replicon system is a powerful tool for plant-based production of recombinant proteins. (c) 2005 Wiley Periodicals, Inc.

  8. Random integration of SV40 in SV40-transformed, immortalized human fibroblasts.

    Science.gov (United States)

    Hara, H; Kaji, H

    1987-02-01

    We have studied the relationship between immortalization of SV40-transformed human embryonic fibroblasts and their SV40 integration sites. From several independently transformed cell pools, we have isolated clones which do not harbor unintegrated SV40 DNA. We have analysed whole-cell DNA from these clones, using the Southern blot method. Our results suggest that no specific integration sites in the cellular genome exist which are a prerequisite for the immortalization process. Although some integration sites were found to be predominant in pre-crisis clones, they could not be detected in the post-crisis clones. This suggests that none of these predominating sites is selected for during the crisis period.

  9. Systematic Review of Integrative Health Care Research: Randomized Control Trials, Clinical Controlled Trials, and Meta-Analysis

    Directory of Open Access Journals (Sweden)

    Raheleh Khorsan

    2011-01-01

    Full Text Available A systematic review was conducted to assess the level of evidence for integrative health care research. We searched PubMed, Allied and Complementary Medicine (AMED, BIOSIS Previews, EMBASE, the entire Cochrane Library, MANTIS, Social SciSearch, SciSearch Cited Ref Sci, PsychInfo, CINAHL, and NCCAM grantee publications listings, from database inception to May 2009, as well as searches of the “gray literature.” Available studies published in English language were included. Three independent reviewers rated each article and assessed the methodological quality of studies using the Scottish Intercollegiate Guidelines Network (SIGN 50. Our search yielded 11,891 total citations but 6 clinical studies, including 4 randomized, met our inclusion criteria. There are no available systematic reviews/meta-analyses published that met our inclusion criteria. The methodological quality of the included studies was assessed independently using quality checklists of the SIGN 50. Only a small number of RCTs and CCTs with a limited number of patients and lack of adequate control groups assessing integrative health care research are available. These studies provide limited evidence of effective integrative health care on some modalities. However, integrative health care regimen appears to be generally safe.

  10. Integration of SrBi2Ta2O9 thin films for high density ferroelectric random access memory

    Science.gov (United States)

    Wouters, D. J.; Maes, D.; Goux, L.; Lisoni, J. G.; Paraschiv, V.; Johnson, J. A.; Schwitters, M.; Everaert, J.-L.; Boullart, W.; Schaekers, M.; Willegems, M.; Vander Meeren, H.; Haspeslagh, L.; Artoni, C.; Caputa, C.; Casella, P.; Corallo, G.; Russo, G.; Zambrano, R.; Monchoix, H.; Vecchio, G.; Van Autryve, L.

    2006-09-01

    Ferroelectric random access memory (FeRAM) is an attractive candidate technology for embedded nonvolatile memory, especially in applications where low power and high program speed are important. Market introduction of high-density FeRAM is, however, lagging behind standard complementary metal-oxide semiconductor (CMOS) because of the difficult integration technology. This paper discusses the major integration issues for high-density FeRAM, based on SrBi2Ta2O9 (strontium bismuth tantalate or SBT), in relation to the fabrication of our stacked cell structure. We have worked in the previous years on the development of SBT-FeRAM integration technology, based on a so-called pseudo-three-dimensional (3D) cell, with a capacitor that can be scaled from quasi two-dimensional towards a true three-dimensional capacitor where the sidewalls will importantly contribute to the signal. In the first phase of our integration development, we integrated our FeRAM cell in a 0.35μm CMOS technology. In a second phase, then, possibility of scaling of our cell is demonstrated in 0.18μm technology. The excellent electrical and reliability properties of the small integrated ferroelectric capacitors prove the feasibility of the technology, while the verification of the potential 3D effect confirms the basic scaling potential of our concept beyond that of the single-mask capacitor. The paper outlines the different material and technological challenges, and working solutions are demonstrated. While some issues are specific to our own cell, many are applicable to different stacked FeRAM cell concepts, or will become more general concerns when more developments are moving into 3D structures.

  11. Detailed characterization of Mirafiori lettuce virus-resistant transgenic lettuce.

    Science.gov (United States)

    Kawazu, Yoichi; Fujiyama, Ryoi; Noguchi, Yuji; Kubota, Masaharu; Ito, Hidekazu; Fukuoka, Hiroyuki

    2010-04-01

    Lettuce big-vein disease is caused by Mirafiori lettuce virus (MiLV), which is vectored by the soil-borne fungus Olpidium brassicae. A MiLV-resistant transgenic lettuce line was developed through introducing inverted repeats of the MiLV coat protein (CP) gene. Here, a detailed characterization study of this lettuce line was conducted by comparing it with the parental, non-transformed 'Kaiser' cultivar. There were no significant differences between transgenic and non-transgenic lettuce in terms of pollen fertility, pollen dispersal, seed production, seed dispersal, dormancy, germination, growth of seedlings under low or high temperature, chromatographic patterns of leaf extracts, or effects of lettuce on the growth of broccoli or soil microflora. A significant difference in pollen size was noted, but the difference was small. The length of the cotyledons of the transgenic lettuce was shorter than that of 'Kaiser,' but there were no differences in other morphological characteristics. Agrobacterium tumefaciens used for the production of transgenic lettuce was not detected in transgenic seeds. The transgenic T(3), T(4), and T(5) generations showed higher resistance to MiLV and big-vein symptoms expression than the resistant 'Pacific' cultivar, indicating that high resistance to lettuce big-vein disease is stably inherited. PCR analysis showed that segregation of the CP gene was nearly 3:1 in the T(1) and T(2) generations, and that the transgenic T(3) generation was homozygous for the CP gene. Segregation of the neomycin phosphotransferase II (npt II) gene was about 3:1 in the T(1) generation, but the full length npt II gene was not detected in the T(2) or T(3) generation. The segregation pattern of the CP and npt II genes in the T(1) generation showed the expected 9:3:3:1 ratio. These results suggest that the fragment including the CP gene and that including the npt II gene have been integrated into two unlinked loci, and that the T(1) plant selected in our study did

  12. How To Produce and Characterize Transgenic Plants.

    Science.gov (United States)

    Savka, Michael A.; Wang, Shu-Yi; Wilson, Mark

    2002-01-01

    Explains the process of establishing transgenic plants which is a very important tool in plant biology and modern agriculture. Produces transgenic plants with the ability to synthesize opines. (Contains 17 references.) (YDS)

  13. Random Sampling with Interspike-Intervals of the Exponential Integrate and Fire Neuron: A Computational Interpretation of UP-States.

    Directory of Open Access Journals (Sweden)

    Andreas Steimer

    Full Text Available Oscillations between high and low values of the membrane potential (UP and DOWN states respectively are an ubiquitous feature of cortical neurons during slow wave sleep and anesthesia. Nevertheless, a surprisingly small number of quantitative studies have been conducted only that deal with this phenomenon's implications for computation. Here we present a novel theory that explains on a detailed mathematical level the computational benefits of UP states. The theory is based on random sampling by means of interspike intervals (ISIs of the exponential integrate and fire (EIF model neuron, such that each spike is considered a sample, whose analog value corresponds to the spike's preceding ISI. As we show, the EIF's exponential sodium current, that kicks in when balancing a noisy membrane potential around values close to the firing threshold, leads to a particularly simple, approximative relationship between the neuron's ISI distribution and input current. Approximation quality depends on the frequency spectrum of the current and is improved upon increasing the voltage baseline towards threshold. Thus, the conceptually simpler leaky integrate and fire neuron that is missing such an additional current boost performs consistently worse than the EIF and does not improve when voltage baseline is increased. For the EIF in contrast, the presented mechanism is particularly effective in the high-conductance regime, which is a hallmark feature of UP-states. Our theoretical results are confirmed by accompanying simulations, which were conducted for input currents of varying spectral composition. Moreover, we provide analytical estimations of the range of ISI distributions the EIF neuron can sample from at a given approximation level. Such samples may be considered by any algorithmic procedure that is based on random sampling, such as Markov Chain Monte Carlo or message-passing methods. Finally, we explain how spike-based random sampling relates to existing

  14. Random Sampling with Interspike-Intervals of the Exponential Integrate and Fire Neuron: A Computational Interpretation of UP-States.

    Science.gov (United States)

    Steimer, Andreas; Schindler, Kaspar

    2015-01-01

    Oscillations between high and low values of the membrane potential (UP and DOWN states respectively) are an ubiquitous feature of cortical neurons during slow wave sleep and anesthesia. Nevertheless, a surprisingly small number of quantitative studies have been conducted only that deal with this phenomenon's implications for computation. Here we present a novel theory that explains on a detailed mathematical level the computational benefits of UP states. The theory is based on random sampling by means of interspike intervals (ISIs) of the exponential integrate and fire (EIF) model neuron, such that each spike is considered a sample, whose analog value corresponds to the spike's preceding ISI. As we show, the EIF's exponential sodium current, that kicks in when balancing a noisy membrane potential around values close to the firing threshold, leads to a particularly simple, approximative relationship between the neuron's ISI distribution and input current. Approximation quality depends on the frequency spectrum of the current and is improved upon increasing the voltage baseline towards threshold. Thus, the conceptually simpler leaky integrate and fire neuron that is missing such an additional current boost performs consistently worse than the EIF and does not improve when voltage baseline is increased. For the EIF in contrast, the presented mechanism is particularly effective in the high-conductance regime, which is a hallmark feature of UP-states. Our theoretical results are confirmed by accompanying simulations, which were conducted for input currents of varying spectral composition. Moreover, we provide analytical estimations of the range of ISI distributions the EIF neuron can sample from at a given approximation level. Such samples may be considered by any algorithmic procedure that is based on random sampling, such as Markov Chain Monte Carlo or message-passing methods. Finally, we explain how spike-based random sampling relates to existing computational

  15. Photon echo quantum random access memory integration in a quantum computer

    International Nuclear Information System (INIS)

    Moiseev, Sergey A; Andrianov, Sergey N

    2012-01-01

    We have analysed an efficient integration of multi-qubit echo quantum memory (QM) into the quantum computer scheme based on squids, quantum dots or atomic resonant ensembles in a quantum electrodynamics cavity. Here, one atomic ensemble with controllable inhomogeneous broadening is used for the QM node and other nodes characterized by the homogeneously broadened resonant line are used for processing. We have found the optimal conditions for the efficient integration of the multi-qubit QM modified for the analysed scheme, and we have determined the self-temporal modes providing a perfect reversible transfer of the photon qubits between the QM node and arbitrary processing nodes. The obtained results open the way for realization of a full-scale solid state quantum computing based on the efficient multi-qubit QM. (paper)

  16. Integration of Radiation-Hard Magnetic Random Access Memory with CMOS ICs

    CERN Document Server

    Cerjan, C J

    2000-01-01

    The research undertaken in this LDRD-funded project addressed the joint development of magnetic material-based nonvolatile, radiation-hard memory cells with Sandia National Laboratory. Specifically, the goal of this project was to demonstrate the intrinsic radiation-hardness of Giant Magneto-Resistive (GMR) materials by depositing representative alloy combinations upon radiation-hardened silicon-based integrated circuits. All of the stated goals of the project were achieved successfully. The necessary films were successfully deposited upon typical integrated circuits; the materials retained their magnetic field response at the highest radiation doses; and a patterning approach was developed that did not degrade the as-fabricated properties of the underlying circuitry. These results establish the feasibility of building radiation-hard magnetic memory cells.

  17. Progress on researches of transgenic alfalfa

    International Nuclear Information System (INIS)

    Guo Huiqin; Wang Mi; Ren Weibo; Xu Zhu; Chen Libo

    2010-01-01

    In this paper, the progress on the researches of transgenic alfalfa in the past two decades had been reviewed in the aspects of regeneration system, transformation, improvement of the important traits and so on. Moreover, such problems as variation of transgene expression and safety of transgenic plant had also been discussed and propose had been given for the future research work. (authors)

  18. Randomized Trial of Supported Employment Integrated With Assertive Community Treatment for Rural Adults With Severe Mental Illness

    Science.gov (United States)

    Gold, Paul B; Meisler, Neil; Santos, Alberto B; Carnemolla, Mark A; Williams, Olivia H; Keleher, Jennie

    2006-01-01

    Urban-based randomized clinical trials of integrated supported employment (SE) and mental health services in the United States on average have doubled the employment rates of adults with severe mental illness (SMI) compared to traditional vocational rehabilitation. However, studies have not yet explored if the service integrative functions of SE will be effective in coordinating rural-based services that are limited, loosely linked, and geographically dispersed. In addition, SE's ability to replicate the work outcomes of urban programs in rural economies with scarce and less diverse job opportunities remains unknown. In a rural South Carolina county, we designed and implemented a program blending Assertive Community Treatment (ACT) with an SE model, Individual Placement and Support (IPS). The ACT-IPS program operated with ACT and IPS subteams that tightly integrated vocational with mental health services within each self-contained team. In a 24-month randomized clinical trial, we compared ACT-IPS to a traditional program providing parallel vocational and mental health services on competitive work outcomes for adults with SMI (N = 143; 69% schizophrenia, 77% African American). More ACT-IPS participants held competitive jobs (64 versus 26%; p < .001, effect size [ES] = 0.38) and earned more income (median [Mdn] = $549, interquartile range [IQR] = $0–$5,145, versus Mdn = $0, IQR = $0–$40; p < .001, ES = 0.70) than comparison participants. The competitive work outcomes of this rural ACT-IPS program closely resemble those of urban SE programs. However, achieving economic self-sufficiently and developing careers probably require increasing access to higher education and jobs imparting marketable technical skills. PMID:16177278

  19. Handmade cloned transgenic sheep rich in omega-3 Fatty acids.

    Directory of Open Access Journals (Sweden)

    Peng Zhang

    Full Text Available Technology of somatic cell nuclear transfer (SCNT has been adapted worldwide to generate transgenic animals, although the traditional procedure relies largely on instrumental micromanipulation. In this study, we used the modified handmade cloning (HMC established in cattle and pig to produce transgenic sheep with elevated levels of omega-3 (n-3 fatty acids. Codon-optimized nematode mfat-1 was inserted into a eukaryotic expression vector and was transferred into the genome of primary ovine fibroblast cells from a male Chinese merino sheep. Reverse transcriptase PCR, gas chromatography, and chromosome analyses were performed to select nuclear donor cells capable of converting omega-6 (n-6 into n-3 fatty acids. Blastocysts developed after 7 days of in vitro culture were surgically transplanted into the uterus of female ovine recipients of a local sheep breed in Xinjiang. For the HMC, approximately 8.9% (n  =925 of reconstructed embryos developed to the blastocyst stage. Four recipients became pregnant after 53 blastocysts were transplanted into 29 naturally cycling females, and a total of 3 live transgenic lambs were produced. Detailed analyses on one of the transgenic lambs revealed a single integration of the modified nematode mfat-1 gene at sheep chromosome 5. The transgenic sheep expressed functional n-3 fatty acid desaturase, accompanied by more than 2-folds reduction of n-6/n-3 ratio in the muscle (p<0.01 and other major organs/tissues (p<0.05. To our knowledge, this is the first report of transgenic sheep produced by the HMC. Compared to the traditional SCNT method, HMC showed an equivalent efficiency but proved cheaper and easier in operation.

  20. Quantitative analysis of lentiviral transgene expression in mice over seven generations.

    Science.gov (United States)

    Wang, Yong; Song, Yong-tao; Liu, Qin; Liu, Cang'e; Wang, Lu-lu; Liu, Yu; Zhou, Xiao-yang; Wu, Jun; Wei, Hong

    2010-10-01

    Lentiviral transgenesis is now recognized as an extremely efficient and cost-effective method to produce transgenic animals. Transgenes delivered by lentiviral vectors exhibited inheritable expression in many species including those which are refractory to genetic modification such as non-human primates. However, epigenetic modification was frequently observed in lentiviral integrants, and transgene expression found to be inversely correlated with methylation density. Recent data showed that about one-third lentiviral integrants exhibited hypermethylation and low expression, but did not demonstrate whether those integrants with high expression could remain constant expression and hypomethylated during long term germline transmission. In this study, using lentiviral eGFP transgenic mice as the experimental animals, lentiviral eGFP expression levels and its integrant numbers in genome were quantitatively analyzed by fluorescent quantitative polymerase-chain reaction (FQ-PCR), using the house-keeping gene ribosomal protein S18 (Rps18) and the single copy gene fatty acid binding protein of the intestine (Fabpi) as the internal controls respectively. The methylation densities of the integrants were quantitatively analyzed by bisulfite sequencing. We found that the lentiviral integrants with high expression exhibited a relative constant expression level per integrant over at least seven generations. Besides, the individuals containing these integrants exhibited eGFP expression levels which were positively and almost linearly correlated with the integrant numbers in their genomes, suggesting that no remarkable position effect on transgene expression of the integrants analyzed was observed. In addition, over seven generations the methylation density of these integrants did not increase, but rather decreased remarkably, indicating that these high expressing integrants were not subjected to de novo methylation during at least seven generations of germline transmission. Taken

  1. Optimal Detection of a Localized Perturbation in Random Networks of Integrate-and-Fire Neurons

    Science.gov (United States)

    Bernardi, Davide; Lindner, Benjamin

    2017-06-01

    Experimental and theoretical studies suggest that cortical networks are chaotic and coding relies on averages over large populations. However, there is evidence that rats can respond to the short stimulation of a single cortical cell, a theoretically unexplained fact. We study effects of single-cell stimulation on a large recurrent network of integrate-and-fire neurons and propose a simple way to detect the perturbation. Detection rates obtained from simulations and analytical estimates are similar to experimental response rates if the readout is slightly biased towards specific neurons. Near-optimal detection is attained for a broad range of intermediate values of the mean coupling between neurons.

  2. An integrated digital/clinical approach to smoking cessation in lung cancer screening: study protocol for a randomized controlled trial.

    Science.gov (United States)

    Graham, Amanda L; Burke, Michael V; Jacobs, Megan A; Cha, Sarah; Croghan, Ivana T; Schroeder, Darrell R; Moriarty, James P; Borah, Bijan J; Rasmussen, Donna F; Brookover, M Jody; Suesse, Dale B; Midthun, David E; Hays, J Taylor

    2017-11-28

    Delivering effective tobacco dependence treatment that is feasible within lung cancer screening (LCS) programs is crucial for realizing the health benefits and cost savings of screening. Large-scale trials and systematic reviews have demonstrated that digital cessation interventions (i.e. web-based and text message) are effective, sustainable over the long-term, scalable, and cost-efficient. Use of digital technologies is commonplace among older adults, making this a feasible approach within LCS programs. Use of cessation treatment has been improved with models that proactively connect smokers to treatment rather than passive referrals. Proactive referral to cessation treatment has been advanced through healthcare systems changes such as modifying the electronic health record to automatically link smokers to treatment. This study evaluates the impact of a proactive enrollment strategy that links LCS-eligible smokers with an evidence-based intervention comprised of a web-based (WEB) program and integrated text messaging (TXT) in a three-arm randomized trial with repeated measures at one, three, six, and 12 months post randomization. The primary outcome is biochemically confirmed abstinence at 12 months post randomization. We will randomize 1650 smokers who present for a clinical LCS to: (1) a usual care control condition (UC) which consists of Ask-Advise-Refer; (2) a digital (WEB + TXT) cessation intervention; or (3) a digital cessation intervention combined with tobacco treatment specialist (TTS) counseling (WEB + TXT + TTS). The scalability and sustainability of a digital intervention may represent the most cost-effective and feasible approach for LCS programs to proactively engage large numbers of smokers in effective cessation treatment. We will also evaluate the impact and cost-effectiveness of adding proven clinical intervention provided by a TTS. We expect that a combined digital/clinical intervention will yield higher quit rates than digital

  3. A randomized controlled trial of a multifaceted integrated complementary-alternative therapy for chronic herpes zoster-related pain.

    Science.gov (United States)

    Hui, Fred; Boyle, Eleanor; Vayda, Eugene; Glazier, Richard H

    2012-03-01

    Our objective was to determine whether a three-week complementary and alternative medicine (CAM) approach integrating several therapies from Traditional Chinese Medicine (TCM) along with neural therapy (injection of 1% procaine as local anesthesia) reduces the level of unresolved pain associated with herpes zoster. The design was a randomized controlled clinical trial in a community-based primary care clinic in Toronto, Ontario. We studied individuals 18 years of age and older with a confirmed diagnosis of herpes zoster of at least 30 days duration and with at least moderate postherpetic neuralgia pain (≥4) on a 10-point Likert scale. The CAM therapies used were acupuncture, neural therapy (1% procaine injection as a local anesthetic), cupping and bleeding, and TCM herbs. An immediate treatment group (n=32) received the CAM intervention once daily, five days per week, for three weeks. A wait-list (delayed treatment) group (n=27) was used as a control and received the same treatment starting three weeks after randomization. This three-week time period, when one group was receiving active CAM treatment and the other was not, was used as basis of comparison for treatment effects between groups. Pain, quality of life, and depression were measured at baseline, and three, six, and nine weeks post-randomization. Patients were followed for up to two years. Participants had a mean age of 69.8 years (SD=11.1) and had had herpes zoster-related pain for a median of 4.8 months (range: 1 month to 15 years). The immediate treatment and control groups had similar pain levels at baseline (treatment = 7.5; control = 7.8; p=0.5; scores based on the 10-point Likert pain scale). At three weeks post-randomization (i.e., after the immediate treatment group completed treatment) pain scores differed significantly (treatment = 2.3; control = 7.2; ppain in the immediate treatment group was maintained at nine weeks and at long-term follow-up (one to two years later). The delayed treatment

  4. Transgenic rice plants expressing a Bacillus subtilis protoporphyrinogen oxidase gene are resistant to diphenyl ether herbicide oxyfluorfen.

    Science.gov (United States)

    Lee, H J; Lee, S B; Chung, J S; Han, S U; Han, O; Guh, J O; Jeon, J S; An, G; Back, K

    2000-06-01

    Protoporphyrinogen oxidase (Protox), the penultimate step enzyme of the branch point for the biosynthetic pathway of Chl and hemes, is the target site of action of diphenyl ether (DPE) herbicides. However, Bacillus subtilis Protox is known to be resistant to the herbicides. In order to develop the herbicide-resistant plants, the transgenic rice plants were generated via expression of B. subtilis Protox gene under ubiquitin promoter targeted to the cytoplasm or to the plastid using Agrobacterium-mediated gene transformation. The integration and expression of the transgene were investigated at T0 generation by DNA and RNA blots. Most transgenic rice plants revealed one copy transgene insertion into the rice genome, but some with 3 copies. The expression levels of B. subtilis Protox mRNA appeared to correlate with the copy number. Furthermore, the plastidal transgenic lines exhibited much higher expression of the Protox mRNA than the cytoplasmic transgenic lines. The transgenic plants expressing the B. subtilis Protox gene at T0 generation were found to be resistant to oxyfluorfen when judged by cellular damage with respect to cellular leakage, Chl loss, and lipid peroxidation. The transgenic rice plants targeted to the plastid exhibited higher resistance to the herbicide than the transgenic plants targeted to the cytoplasm. In addition, possible resistance mechanisms in the transgenic plants to DPE herbicides are discussed.

  5. Transgene Expression and Repression in Transgenic Rats Bearing the Phosphoenolpyruvate Carboxykinase-Simian Virus 40 T Antigen or the Phosphoenolpyruvate Carboxykinase-Transforming Growth Factor-α Constructs

    Science.gov (United States)

    Haas, Michael J.; Dragan, Yvonne P.; Hikita, Hiroshi; Shimel, Randee; Takimoto, Koichi; Heath, Susan; Vaughan, Jennifer; Pitot, Henry C.

    1999-01-01

    Transgenic Sprague-Dawley rats expressing either human transforming growth factor-α (TGFα) or simian virus 40 large and small T antigen (TAg), each under the control of the phosphoenolpyruvate carboxykinase (PEPCK) promoter, were developed as an approach to the study of the promotion of hepatocarcinogenesis in the presence of a transgene regulatable by diet and/or hormones. Five lines of PEPCK-TGFα transgenic rats were established, each genetic line containing from one to several copies of the transgene per haploid genome. Two PEPCK-TAg transgenic founder rats were obtained, each with multiple copies of the transgene. Expression of the transgene was undetectable in the TGFα transgenic rats and could not be induced when the animals were placed on a high-protein, low-carbohydrate diet. The transgene was found to be highly methylated in all of these lines. No pathological alterations in the liver and intestine were observed at any time (up to 2 years) during the lives of these rats. One line of transgenic rats expressing the PEPCK-TAg transgene developed pancreatic islet cell hyperplasias and carcinomas, with few normal islets evident in the pancreas. This transgene is integrated as a hypomethylated tandem array of 10 to 12 copies on chromosome 8q11. Expression of large T antigen is highest in pancreatic neoplasms, but is also detectable in the normal brain, kidney, and liver. Mortality is most rapid in males, starting at 5 months of age and reaching 100% by 8 months. Morphologically, islet cell differentiation in the tumors ranges from poor to well differentiated, with regions of necrosis and fibrosis. Spontaneous metastasis of TAg-positive tumor cells to regional lymph nodes was observed. These studies indicate the importance of DNA methylation in the repression of specific transgenes in the rat. However, the expression of the PEPCK-TAg induces neoplastic transformation in islet cells, probably late in neuroendocrine cell differentiation. T antigen expression

  6. Effective generation of transgenic pigs and mice by linker based sperm-mediated gene transfer.

    Directory of Open Access Journals (Sweden)

    Shih Ping Yao

    2002-04-01

    Full Text Available Abstract Background Transgenic animals have become valuable tools for both research and applied purposes. The current method of gene transfer, microinjection, which is widely used in transgenic mouse production, has only had limited success in producing transgenic animals of larger or higher species. Here, we report a linker based sperm-mediated gene transfer method (LB-SMGT that greatly improves the production efficiency of large transgenic animals. Results The linker protein, a monoclonal antibody (mAb C, is reactive to a surface antigen on sperm of all tested species including pig, mouse, chicken, cow, goat, sheep, and human. mAb C is a basic protein that binds to DNA through ionic interaction allowing exogenous DNA to be linked specifically to sperm. After fertilization of the egg, the DNA is shown to be successfully integrated into the genome of viable pig and mouse offspring with germ-line transfer to the F1 generation at a highly efficient rate: 37.5% of pigs and 33% of mice. The integration is demonstrated again by FISH analysis and F2 transmission in pigs. Furthermore, expression of the transgene is demonstrated in 61% (35/57 of transgenic pigs (F0 generation. Conclusions Our data suggests that LB-SMGT could be used to generate transgenic animals efficiently in many different species.

  7. Fast computation of molecular random phase approximation correlation energies using resolution of the identity and imaginary frequency integration

    Science.gov (United States)

    Eshuis, Henk; Yarkony, Julian; Furche, Filipp

    2010-06-01

    The random phase approximation (RPA) is an increasingly popular post-Kohn-Sham correlation method, but its high computational cost has limited molecular applications to systems with few atoms. Here we present an efficient implementation of RPA correlation energies based on a combination of resolution of the identity (RI) and imaginary frequency integration techniques. We show that the RI approximation to four-index electron repulsion integrals leads to a variational upper bound to the exact RPA correlation energy if the Coulomb metric is used. Auxiliary basis sets optimized for second-order Møller-Plesset (MP2) calculations are well suitable for RPA, as is demonstrated for the HEAT [A. Tajti et al., J. Chem. Phys. 121, 11599 (2004)] and MOLEKEL [F. Weigend et al., Chem. Phys. Lett. 294, 143 (1998)] benchmark sets. Using imaginary frequency integration rather than diagonalization to compute the matrix square root necessary for RPA, evaluation of the RPA correlation energy requires O(N4 log N) operations and O(N3) storage only; the price for this dramatic improvement over existing algorithms is a numerical quadrature. We propose a numerical integration scheme that is exact in the two-orbital case and converges exponentially with the number of grid points. For most systems, 30-40 grid points yield μH accuracy in triple zeta basis sets, but much larger grids are necessary for small gap systems. The lowest-order approximation to the present method is a post-Kohn-Sham frequency-domain version of opposite-spin Laplace-transform RI-MP2 [J. Jung et al., Phys. Rev. B 70, 205107 (2004)]. Timings for polyacenes with up to 30 atoms show speed-ups of two orders of magnitude over previous implementations. The present approach makes it possible to routinely compute RPA correlation energies of systems well beyond 100 atoms, as is demonstrated for the octapeptide angiotensin II.

  8. Effects of integrated chronic care models on hypertension outcomes and spending: a multi-town clustered randomized trial in China.

    Science.gov (United States)

    Zhang, Yuting; Tang, Wenxi; Zhang, Yan; Liu, Lulu; Zhang, Liang

    2017-03-11

    Hypertension affects one billion people globally and is one of the leading risk factors for cardiovascular and renal diseases. However, hypertension management remains poor, especially in rural China. A clustered randomized controlled trial was conducted in six towns in China's Qianjiang county between 7/2012 and 6/2014, including 5462 hypertension patients above 35 years old. Six towns were randomly assigned to three groups: Group 1 had the integrated care model including a multidisciplinary team and continuous care coordination, Group 2 had both the integrated care model and provider-level financial incentives, and the control group had the usual care. Primary outcomes were systolic blood pressure and health-related quality of life measured by SF36; secondary outcomes included hypertension-related hospitalization rate and inpatient spending. Blood pressure was measured sixteen times bimonthly between 12/1/2011 and 6/30/2014, and quality of life was measured on 7/1/2012 and 6/30/2014. Inpatient data between 7/1/2010 and 8/31/2014 were used. This trial is registered at the World Health Organization's International Clinical Trials Registry, number ChiCTR-OOR-14005563. We found that the integrated care model effectively lowered blood pressure by 1.93 mmHg (95% CI 0.063-3.8), improved self-assessed health-related quality of life, and reduced the rate of hypertension-related hospitalization by 0.17 percentage points (95% CI 0.094-0.24). We also found that the provider-level financial contract further lowered blood pressure by 1.76 mmHg (95% CI 0.73-2.79) and reduced rates of hospitalization and inpatient spending, but it also reduced patients' self-assessed health-related quality of life. Integrated care and financial incentives are effective in lowering blood pressure and reducing hospitalization rate, but financial contracts may hurt patient quality of life. This trial was registered at the Chinese Clinical Trial Registry (ChiCTR-OOR-14005563) on November 23, 2014

  9. Effects of integrated chronic care models on hypertension outcomes and spending: a multi-town clustered randomized trial in China

    Directory of Open Access Journals (Sweden)

    Yuting Zhang

    2017-03-01

    Full Text Available Abstract Background Hypertension affects one billion people globally and is one of the leading risk factors for cardiovascular and renal diseases. However, hypertension management remains poor, especially in rural China. Methods A clustered randomized controlled trial was conducted in six towns in China’s Qianjiang county between 7/2012 and 6/2014, including 5462 hypertension patients above 35 years old. Six towns were randomly assigned to three groups: Group 1 had the integrated care model including a multidisciplinary team and continuous care coordination, Group 2 had both the integrated care model and provider-level financial incentives, and the control group had the usual care. Primary outcomes were systolic blood pressure and health-related quality of life measured by SF36; secondary outcomes included hypertension-related hospitalization rate and inpatient spending. Blood pressure was measured sixteen times bimonthly between 12/1/2011 and 6/30/2014, and quality of life was measured on 7/1/2012 and 6/30/2014. Inpatient data between 7/1/2010 and 8/31/2014 were used. This trial is registered at the World Health Organization’s International Clinical Trials Registry, number ChiCTR-OOR-14005563. Results We found that the integrated care model effectively lowered blood pressure by 1.93 mmHg (95% CI 0.063–3.8, improved self-assessed health-related quality of life, and reduced the rate of hypertension-related hospitalization by 0.17 percentage points (95% CI 0.094–0.24. We also found that the provider-level financial contract further lowered blood pressure by 1.76 mmHg (95% CI 0.73–2.79 and reduced rates of hospitalization and inpatient spending, but it also reduced patients’ self-assessed health-related quality of life. Conclusions Integrated care and financial incentives are effective in lowering blood pressure and reducing hospitalization rate, but financial contracts may hurt patient quality of life. This trial was registered at

  10. Hybrid Lentivirus-transposon Vectors With a Random Integration Profile in Human Cells

    DEFF Research Database (Denmark)

    Staunstrup, Nicklas H; Moldt, Brian; Mátés, Lajos

    2009-01-01

    Gene delivery by human immunodeficiency virus type 1 (HIV-1)-based lentiviral vectors (LVs) is efficient, but genomic integration of the viral DNA is strongly biased toward transcriptionally active loci resulting in an increased risk of insertional mutagenesis in gene therapy protocols. Nonviral...... Sleeping Beauty (SB) transposon vectors have a significantly safer insertion profile, but efficient delivery into relevant cell/tissue types is a limitation. In an attempt to combine the favorable features of the two vector systems we established a novel hybrid vector technology based on SB transposase......-mediated insertion of lentiviral DNA circles generated during transduction of target cells with integrase (IN)-defective LVs (IDLVs). By construction of a lentivirus-transposon hybrid vector allowing transposition exclusively from circular viral DNA substrates, we demonstrate that SB transposase added in trans...

  11. Transgenic Epigenetics: Using Transgenic Organisms to Examine Epigenetic Phenomena

    Directory of Open Access Journals (Sweden)

    Lori A. McEachern

    2012-01-01

    Full Text Available Non-model organisms are generally more difficult and/or time consuming to work with than model organisms. In addition, epigenetic analysis of model organisms is facilitated by well-established protocols, and commercially-available reagents and kits that may not be available for, or previously tested on, non-model organisms. Given the evolutionary conservation and widespread nature of many epigenetic mechanisms, a powerful method to analyze epigenetic phenomena from non-model organisms would be to use transgenic model organisms containing an epigenetic region of interest from the non-model. Interestingly, while transgenic Drosophila and mice have provided significant insight into the molecular mechanisms and evolutionary conservation of the epigenetic processes that target epigenetic control regions in other model organisms, this method has so far been under-exploited for non-model organism epigenetic analysis. This paper details several experiments that have examined the epigenetic processes of genomic imprinting and paramutation, by transferring an epigenetic control region from one model organism to another. These cross-species experiments demonstrate that valuable insight into both the molecular mechanisms and evolutionary conservation of epigenetic processes may be obtained via transgenic experiments, which can then be used to guide further investigations and experiments in the species of interest.

  12. Cloud-based BP system integrated with CPOE improves self-management of the hypertensive patients: A randomized controlled trial.

    Science.gov (United States)

    Lee, Peisan; Liu, Ju-Chi; Hsieh, Ming-Hsiung; Hao, Wen-Rui; Tseng, Yuan-Teng; Liu, Shuen-Hsin; Lin, Yung-Kuo; Sung, Li-Chin; Huang, Jen-Hung; Yang, Hung-Yu; Ye, Jong-Shiuan; Zheng, He-Shun; Hsu, Min-Huei; Syed-Abdul, Shabbir; Lu, Richard; Nguyen, Phung-Anh; Iqbal, Usman; Huang, Chih-Wei; Jian, Wen-Shan; Li, Yu-Chuan Jack

    2016-08-01

    Less than 50% of patients with hypertensive disease manage to maintain their blood pressure (BP) within normal levels. The aim of this study is to evaluate whether cloud BP system integrated with computerized physician order entry (CPOE) can improve BP management as compared with traditional care. A randomized controlled trial done on a random sample of 382 adults recruited from 786 patients who had been diagnosed with hypertension and receiving treatment for hypertension in two district hospitals in the north of Taiwan. Physicians had access to cloud BP data from CPOE. Neither patients nor physicians were blinded to group assignment. The study was conducted over a period of seven months. At baseline, the enrollees were 50% male with a mean (SD) age of 58.18 (10.83) years. The mean sitting BP of both arms was no different. The proportion of patients with BP control at two, four and six months was significantly greater in the intervention group than in the control group. The average capture rates of blood pressure in the intervention group were also significantly higher than the control group in all three check-points. Cloud-based BP system integrated with CPOE at the point of care achieved better BP control compared to traditional care. This system does not require any technical skills and is therefore suitable for every age group. The praise and assurance to the patients from the physicians after reviewing the Cloud BP records positively reinforced both BP measuring and medication adherence behaviors. Copyright © 2016. Published by Elsevier Ireland Ltd.

  13. An integrated production inventory model of deteriorating items subject to random machine breakdown with a stochastic repair time

    Directory of Open Access Journals (Sweden)

    Huynh Trung Luong

    2016-11-01

    Full Text Available In a continuous manufacturing environment where production and consumption occur simultaneously, one of the biggest challenges is the efficient management of production and inventory system. In order to manage the integrated production inventory system economically it is necessary to identify the optimal production time and the optimal production reorder point that either maximize the profit or minimize the cost. In addition, during production the process has to go through some natural phenomena like random breakdown of machine, deterioration of product over time, uncertainty in repair time that eventually create the possibility of shortage. In this situation, efficient management of inventory & production is crucial. This paper addresses the situation where a perishable (deteriorated product is manufactured and consumed simultaneously, the demand of this product is stable over the time, machine that produce the product also face random failure and the time to repair this machine is also uncertain. In order to describe this scenario more appropriately, the continuously reviewed Economic Production Quantity (EPQ model is considered in this research work. The main goal is to identify the optimal production uptime and the production reorder point that ultimately minimize the expected value of total cost consisting of machine setup, deterioration, inventory holding, shortage and corrective maintenance cost.

  14. Path-integral approach to the dynamics of a random chain with rigid constraints

    International Nuclear Information System (INIS)

    Ferrari, Franco; Paturej, Jaroslaw; Vilgis, Thomas A.

    2008-01-01

    In this work the dynamics of a chain consisting of a set of beads attached to the ends of segments of fixed lengths is investigated. The chain fluctuates at constant temperature in a viscous medium. For simplicity, all interactions among the beads have been switched off and the number of spatial dimensions has been limited to two. In the limit in which the chain becomes a continuous system, its behavior may be described by a path integral, in which the rigid constraints coming from the infinitesimally small segments are imposed by means of a functional δ function. In this way a model of the dynamics of the chain is obtained, which closely resembles a two-dimensional nonlinear σ model. The partition function of this generalized nonlinear σ model is computed explicitly for a ring-shaped chain in the semiclassical approximation. The behavior of the chain at both long and short scales of time and distances is investigated. The connection between the generalized nonlinear σ model presented here and the Rouse model is discussed

  15. Effect of integrated treatment on the use of coercive measures in first-episode schizophrenia-spectrum disorder. A randomized clinical trial

    DEFF Research Database (Denmark)

    Ohlenschlaeger, Johan; Nordentoft, Merete; Thorup, Anne

    2008-01-01

    The effect of integrated treatment on the use of coercive measures in first-episode schizophrenia-spectrum disorder in Denmark is not known. A total of 328 patients were randomly assigned to integrated treatment (167 patients) or standard treatment (161 patients). Integrated treatment consisted...... of assertive community treatment, psycho-educational multi-family groups, and social skills training. Data on coercion were extracted from the register from the National Board of Health, and data on continuity from medical records. Even though the level of continuity seemed higher in integrated treatment...

  16. Whole brain helical Tomotherapy with integrated boost for brain metastases in patients with malignant melanoma–a randomized trial

    International Nuclear Information System (INIS)

    Hauswald, Henrik; Habl, Gregor; Krug, David; Kehle, Denise; Combs, Stephanie E; Bermejo, Justo Lorenzo; Debus, Jürgen; Sterzing, Florian

    2013-01-01

    Patients with malignant melanoma may develop brain metastases during the course of the disease, requiring radiotherapeutic treatment. In patients with 1–3 brain metastases, radiosurgery has been established as a treatment option besides surgery. For patients with 4 or more brain metastases, whole brain radiotherapy is considered the standard treatment. In certain patients with brain metastases, radiation treatment using whole brain helical Tomotherapy with integrated boost and hippocampal-sparing may improve prognosis of these patients. The present prospective, randomized two-armed trial aims to exploratory investigate the treatment response to conventional whole brain radiotherapy applying 30 Gy in 10 fractions versus whole brain helical Tomotherapy applying 30 Gy in 10 fractions with an integrated boost of 50 Gy to the brain metastases as well as hippocampal-sparing in patients with brain metastases from malignant melanoma. The main inclusion criteria include magnetic resonance imaging confirmed brain metastases from a histopathologically confirmed malignant melanoma in patients with a minimum age of 18 years. The main exclusion criteria include a previous radiotherapy of the brain and not having recovered from acute high-grade toxicities of prior therapies. The primary endpoint is treatment-related toxicity. Secondary endpoints include imaging response, local and loco-regional progression-free survival, overall survival and quality of life

  17. Transgenic Arabidopsis Gene Expression System

    Science.gov (United States)

    Ferl, Robert; Paul, Anna-Lisa

    2009-01-01

    The Transgenic Arabidopsis Gene Expression System (TAGES) investigation is one in a pair of investigations that use the Advanced Biological Research System (ABRS) facility. TAGES uses Arabidopsis thaliana, thale cress, with sensor promoter-reporter gene constructs that render the plants as biomonitors (an organism used to determine the quality of the surrounding environment) of their environment using real-time nondestructive Green Fluorescent Protein (GFP) imagery and traditional postflight analyses.

  18. Influence of Phytase Transgenic Corn on the Intestinal Microflora and the Fate of Transgenic DNA and Protein in Digesta and Tissues of Broilers

    Science.gov (United States)

    Li, Sufen; Li, Ang; Zhang, Liyang; Liu, Zhenhua; Luo, Xugang

    2015-01-01

    An experiment was conducted to investigate the effect of phytase transgenic corn (PTC) on intestinal microflora, and the fate of transgenic DNA and protein in the digesta and tissues of broilers. A total of 160 1-day-old Arbor Acres commercial male broilers were randomly assigned to 20 cages (8 chicks per cage) with 10 cages (replicates) for each treatment. Birds were fed with a diet containing either PTC (54.0% during 1–21 days and 61.0% during 22–42 days) or non-transgenic isogenic control corn (CC) for a duration of 42 days. There were no significant differences (P>0.05) between birds fed with the PTC diets and those fed with the CC diets in the quantities of aerobic bacteria, anaerobic bacteria, colibacillus and lactobacilli, or microbial diversities in the contents of ileum and cecum. Transgenic phyA2 DNA was not detected, but phyA2 protein was detected in the digesta of duodenum and jejunum of broilers fed with the PTC diets. Both transgenic phyA2 DNA and protein fragments were not found in the digesta of the ileum and rectum, heart, liver, kidney, and breast or thigh muscles of broilers fed with the PTC diets. It was concluded that PTC had no adverse effect on the quantity and diversity of gut microorganisms; Transgenic phyA2 DNA or protein was rapidly degraded in the intestinal tract and was not transferred to the tissues of broilers. PMID:26599444

  19. Integrated, multidisciplinary care for hand eczema: design of a randomized controlled trial and cost-effectiveness study

    Directory of Open Access Journals (Sweden)

    Boot Cécile RL

    2009-12-01

    Full Text Available Abstract Background The individual and societal burden of hand eczema is high. Literature indicates that moderate to severe hand eczema is a disease with a poor prognosis. Many patients are hampered in their daily activities, including work. High costs are related to high medical consumption, productivity loss and sick leave. Usual care is suboptimal, due to a lack of optimal instruction and coordination of care, and communication with the general practitioner/occupational physician and people involved at the workplace. Therefore, an integrated, multidisciplinary intervention involving a dermatologist, a care manager, a specialized nurse and a clinical occupational physician was developed. This paper describes the design of a study to investigate the effectiveness and cost-effectiveness of integrated care for hand eczema by a multidisciplinary team, coordinated by a care manager, consisting of instruction on avoiding relevant contact factors, both in the occupational and in the private environment, optimal skin care and treatment, compared to usual, dermatologist-led care. Methods The study is a multicentre, randomized, controlled trial with an economic evaluation alongside. The study population consists of patients with chronic, moderate to severe hand eczema, who visit an outpatient clinic of one of the participating 5 (three university and two general hospitals. Integrated, multidisciplinary care, coordinated by a care manager, including allergo-dermatological evaluation by a dermatologist, occupational intervention by a clinical occupational physician, and counselling by a specialized nurse on optimizing topical treatment and skin care will be compared with usual care by a dermatologist. The primary outcome measure is the cumulative difference in reduction of the clinical severity score HECSI between the groups. Secondary outcome measures are the patient's global assessment, specific quality of life with regard to the hands, generic quality

  20. Implementation and results of an integrated data quality assurance protocol in a randomized controlled trial in Uttar Pradesh, India.

    Science.gov (United States)

    Gass, Jonathon D; Misra, Anamika; Yadav, Mahendra Nath Singh; Sana, Fatima; Singh, Chetna; Mankar, Anup; Neal, Brandon J; Fisher-Bowman, Jennifer; Maisonneuve, Jenny; Delaney, Megan Marx; Kumar, Krishan; Singh, Vinay Pratap; Sharma, Narender; Gawande, Atul; Semrau, Katherine; Hirschhorn, Lisa R

    2017-09-07

    There are few published standards or methodological guidelines for integrating Data Quality Assurance (DQA) protocols into large-scale health systems research trials, especially in resource-limited settings. The BetterBirth Trial is a matched-pair, cluster-randomized controlled trial (RCT) of the BetterBirth Program, which seeks to improve quality of facility-based deliveries and reduce 7-day maternal and neonatal mortality and maternal morbidity in Uttar Pradesh, India. In the trial, over 6300 deliveries were observed and over 153,000 mother-baby pairs across 120 study sites were followed to assess health outcomes. We designed and implemented a robust and integrated DQA system to sustain high-quality data throughout the trial. We designed the Data Quality Monitoring and Improvement System (DQMIS) to reinforce six dimensions of data quality: accuracy, reliability, timeliness, completeness, precision, and integrity. The DQMIS was comprised of five functional components: 1) a monitoring and evaluation team to support the system; 2) a DQA protocol, including data collection audits and targets, rapid data feedback, and supportive supervision; 3) training; 4) standard operating procedures for data collection; and 5) an electronic data collection and reporting system. Routine audits by supervisors included double data entry, simultaneous delivery observations, and review of recorded calls to patients. Data feedback reports identified errors automatically, facilitating supportive supervision through a continuous quality improvement model. The five functional components of the DQMIS successfully reinforced data reliability, timeliness, completeness, precision, and integrity. The DQMIS also resulted in 98.33% accuracy across all data collection activities in the trial. All data collection activities demonstrated improvement in accuracy throughout implementation. Data collectors demonstrated a statistically significant (p = 0.0004) increase in accuracy throughout

  1. Spatio Temporal Expression Pattern of an Insecticidal Gene (cry2A in Transgenic Cotton Lines

    Directory of Open Access Journals (Sweden)

    Allah BAKHSH

    2012-11-01

    Full Text Available The production of transgenic plants with stable, high-level transgene expression is important for the success of crop improvement programs based on genetic engineering. The present study was conducted to evaluate genomic integration and spatio temporal expression of an insecticidal gene (cry2A in pre-existing transgenic lines of cotton. Genomic integration of cry2A was evaluated using various molecular approaches. The expression levels of cry2A were determined at vegetative and reproductive stages of cotton at regular intervals. These lines showed a stable integration of insecticidal gene in advance lines of transgenic cotton whereas gene expression was found variable with at various growth stages as well as in different plant parts throughout the season. The leaves of transgenic cotton were found to have maximum expression of cry2A gene followed by squares, bolls, anthers and petals. The protein level in fruiting part was less as compared to other parts showing inconsistency in gene expression. It was concluded that for culturing of transgenic crops, strategies should be developed to ensure the foreign genes expression efficient, consistent and in a predictable manner.

  2. ANALYSIS OF IMMUNE RESPONSES ON TRANSGENIC TIGER SHRIMP (Penaeus monodon AGAINST PATHOGENIC BACTERIUM Vibrio harveyi

    Directory of Open Access Journals (Sweden)

    Andi Parenrengi

    2014-06-01

    Full Text Available Vibriosis is one of main diseases of the black tiger shrimp Penaeus monodon infected by pathogenic bioluminous bacterium Vibrio harveyi that can cause mass mortalities in shrimp culture. The bacteria can also trigger the disease white spot syndrome virus (WSSV. An effort to produce shrimp disease-resistant strains has been done through transgenesis technology with antiviral gene transfection. By this technology, it is expected an increase in the immune response of shrimp in a variety of diseasecausing pathogens. This study aimed to determine the immune responses (total haemocytes, haemocyte differentiation, and phenoloxydase activity of transgenic tiger shrimp against pathogenic bacterium V. harveyi. Research using completely randomized design, which consists of two treatments and three replications. Test animals being used were transgenic and non-transgenic shrimp with size, weight 3.93±1.25 g and a total length of 7.59±0.87 cm. Treatments being tested were the injection of bacterium V. harveyi (density of 5x106 cfu/mL of 0.1 mL/individual on transgenic (A and non-transgenic shrimp (B. Immune response parameters such as total haemocytes, haemocyte differentiation, and phenoloxydase activity were observed on day 1, 3, and 6 days after challenging. Data were analyzed using t-test by SPSS software. The results showed that the total haemocyte of transgenic shrimp was not significantly different (P>0.05 from non-transgenic shrimp, but haemocyte differentiation and phenoloxydase activity were significantly different (P<0.05 especially on sixth days after being exposed to the bioluminescent bacteria. The study results implied that transgenic shrimp has a better immune response compared than non-transgenic shrimp.

  3. A Randomized Controlled Comparison of Integrative Cognitive-Affective Therapy and Cognitive-Behavioral Therapy-Enhanced for Bulimia Nervosa

    Science.gov (United States)

    Wonderlich, Stephen A.; Peterson, Carol B.; Crosby, Ross D.; Smith, Tracey L.; Klein, Marjorie H.; Mitchell, James E.; Crow, Scott J.

    2016-01-01

    Background The purpose of this investigation was to compare a new psychotherapy for bulimia nervosa, Integrative Cognitive-Affective Therapy (ICAT), with an established treatment, Cognitive-Behavioral Therapy-Enhanced (CBT-E). Method Eighty adults with symptoms of bulimia nervosa were randomized to ICAT or CBT-E for 21 sessions over 19 weeks. Bulimic symptoms, measured by the Eating Disorder Examination, were assessed at baseline, end of treatment, and 4-month follow-up. Treatment outcome, as measured by binge eating frequency, purging frequency, global eating disorder severity, emotion regulation, self-oriented cognition, depression, anxiety, and self-esteem, was determined using generalized estimating equations, logistic regression, and a general linear model (intent-to-treat). Results Both treatments were associated with significant improvement in bulimic symptoms as well as all measures of outcome, and no statistically significant differences were observed between the two conditions at end of treatment or follow-up. Intent-to-treat abstinence rates for ICAT (37.5% at end of treatment, 32.5% at follow-up) and CBT-E (22.5% at both end of treatment and follow-up) were not significantly different. Conclusions ICAT was associated with significant improvements in bulimic and associated symptoms that did not differ from those obtained with CBT-E. This initial randomized controlled trial of a new individual psychotherapy for bulimia nervosa suggests that targeting emotion and self-oriented cognition in the context of nutritional rehabilitation may be efficacious and worthy of further study. PMID:23701891

  4. Sampling Strategies for Evaluating the Rate of Adventitious Transgene Presence in Non-Genetically Modified Crop Fields.

    Science.gov (United States)

    Makowski, David; Bancal, Rémi; Bensadoun, Arnaud; Monod, Hervé; Messéan, Antoine

    2017-09-01

    According to E.U. regulations, the maximum allowable rate of adventitious transgene presence in non-genetically modified (GM) crops is 0.9%. We compared four sampling methods for the detection of transgenic material in agricultural non-GM maize fields: random sampling, stratified sampling, random sampling + ratio reweighting, random sampling + regression reweighting. Random sampling involves simply sampling maize grains from different locations selected at random from the field concerned. The stratified and reweighting sampling methods make use of an auxiliary variable corresponding to the output of a gene-flow model (a zero-inflated Poisson model) simulating cross-pollination as a function of wind speed, wind direction, and distance to the closest GM maize field. With the stratified sampling method, an auxiliary variable is used to define several strata with contrasting transgene presence rates, and grains are then sampled at random from each stratum. With the two methods involving reweighting, grains are first sampled at random from various locations within the field, and the observations are then reweighted according to the auxiliary variable. Data collected from three maize fields were used to compare the four sampling methods, and the results were used to determine the extent to which transgene presence rate estimation was improved by the use of stratified and reweighting sampling methods. We found that transgene rate estimates were more accurate and that substantially smaller samples could be used with sampling strategies based on an auxiliary variable derived from a gene-flow model. © 2017 Society for Risk Analysis.

  5. An integral topical gel for cellulite reduction: results from a double-blind, randomized, placebo-controlled evaluation of efficacy

    Directory of Open Access Journals (Sweden)

    Dupont E

    2014-02-01

    Full Text Available Eric Dupont,1 Michel Journet,2 Marie-Laure Oula,3 Juan Gomez,1 Claude Léveillé,4 Estelle Loing,5 Diane Bilodeau6 1Immanence IDC Inc, Québec, QC, Canada; 2Clinique de Dermatologie St-Joseph, Montréal, QC, Canada; 3Evalulab Inc, Mont-Royal, QC, Canada; 4Clinique de Chirurgie Esthétique du Québec Métropolitain, Lévis, QC, Canada; 5Lucas Meyer Cosmetics, Québec, QC, Canada; 6CosmeConsult, Québec, QC, Canada Background: Cellulite is a serious cosmetic concern for most of the 90% of women affected by it. Objective: To assess the clinical efficacy of a complex integral anti-cellulite gel. Methods: This double-blind, randomized, placebo-controlled study involved 44 healthy women, aged 25–55 years. Subjects had a normal to slightly overweight body mass index and presented slight to moderate cellulite on their thighs, buttocks, and/or hips at baseline. Subjects were randomly assigned to either the treated or placebo group and accordingly applied the active product or placebo on their hips, stomach, buttocks, and thighs, twice daily for 3 months. Skin tonicity, orange-peel aspect, and stubborn cellulite were assessed at day 0, 28, 56, and 84. A self-evaluation questionnaire was completed by all volunteers. Results: At the end of the study, an average of 81% of the subjects applying the active product presented improvement in their cellulite condition versus 32% for the placebo group (all descriptors and sites combined. At day 84, skin tonicity, orange-peel appearance, and stubborn cellulite were improved in a significant manner (P<0.05 over placebo, on all studied areas. Skin tonicity improved on average by +41% for buttocks, +35% for hips, and +31% for thighs. Orange peel appearance was reduced on average by -25% for buttocks, -22% for hips, and -22% for thighs. Stubborn cellulite was reduced on average by -19% for buttocks, -24% for hips, and -22% for thighs. Circumference measurements decreased in a significant manner (P<0.05 over placebo

  6. Comparison of nutrition composition of transgenic maize (chitinase gene) with its non-transgenic counterpart

    OpenAIRE

    Ping-mei, Yan; Yu-kui, Rui; Xiao-yan, Yan; Zheng, Chai; Qing, Wang; Jian-zhong, Du; Yi, Sun

    2011-01-01

    In order to compare the nutrition components of transgenic maize seeds (chitinase gene), achieved by the pollen-mediated approach, with its non-transgenic counterpart, Vitamin B1, vitamin B2, fatty acids and essential amino acids of transgenic maize seeds and their counterparts were analyzed by the Chinese national standard methods or AOAC methods. The results showed that the contents of all the six kinds of fatty acids detected in transgenic maize seeds were significantly higher than those i...

  7. Comparing the performance of cluster random sampling and integrated threshold mapping for targeting trachoma control, using computer simulation.

    Directory of Open Access Journals (Sweden)

    Jennifer L Smith

    Full Text Available Implementation of trachoma control strategies requires reliable district-level estimates of trachomatous inflammation-follicular (TF, generally collected using the recommended gold-standard cluster randomized surveys (CRS. Integrated Threshold Mapping (ITM has been proposed as an integrated and cost-effective means of rapidly surveying trachoma in order to classify districts according to treatment thresholds. ITM differs from CRS in a number of important ways, including the use of a school-based sampling platform for children aged 1-9 and a different age distribution of participants. This study uses computerised sampling simulations to compare the performance of these survey designs and evaluate the impact of varying key parameters.Realistic pseudo gold standard data for 100 districts were generated that maintained the relative risk of disease between important sub-groups and incorporated empirical estimates of disease clustering at the household, village and district level. To simulate the different sampling approaches, 20 clusters were selected from each district, with individuals sampled according to the protocol for ITM and CRS. Results showed that ITM generally under-estimated the true prevalence of TF over a range of epidemiological settings and introduced more district misclassification according to treatment thresholds than did CRS. However, the extent of underestimation and resulting misclassification was found to be dependent on three main factors: (i the district prevalence of TF; (ii the relative risk of TF between enrolled and non-enrolled children within clusters; and (iii the enrollment rate in schools.Although in some contexts the two methodologies may be equivalent, ITM can introduce a bias-dependent shift as prevalence of TF increases, resulting in a greater risk of misclassification around treatment thresholds. In addition to strengthening the evidence base around choice of trachoma survey methodologies, this study illustrates

  8. Integrating smoking cessation and alcohol use treatment in homeless populations: study protocol for a randomized controlled trial.

    Science.gov (United States)

    Ojo-Fati, Olamide; John, Florence; Thomas, Janet; Joseph, Anne M; Raymond, Nancy C; Cooney, Ned L; Pratt, Rebekah; Rogers, Charles R; Everson-Rose, Susan A; Luo, Xianghua; Okuyemi, Kolawole S

    2015-08-29

    Despite progress in reducing cigarette smoking in the general U.S. population, smoking rates, cancer morbidity and related heart disease remain strikingly high among the poor and underserved. Homeless individuals' cigarette smoking rate remains an alarming 70% or greater, and this population is generally untreated with smoking cessation interventions. Furthermore, the majority of homeless smokers also abuse alcohol and other drugs, which makes quitting more difficult and magnifies the health consequences of tobacco use. Participants will be randomized to one of three groups, including (1) an integrated intensive smoking plus alcohol intervention using cognitive behavioral therapy (CBT), (2) intensive smoking intervention using CBT or (3) usual care (i.e., brief smoking cessation and brief alcohol counseling). All participants will receive 12-week treatment with a nicotine patch plus nicotine gum or lozenge. Counseling will include weekly individual sessions for 3 months, followed by monthly booster group sessions for 3 months. The primary smoking outcome is cotinine-verified 7-day smoking abstinence at follow-up week 52, and the primary alcohol outcome will be breathalyzer-verified 90-day alcohol abstinence at week 52. This study protocol describes the design of the first community-based controlled trial (n = 645) designed to examine the efficacy of integrating alcohol abuse treatment with smoking cessation among homeless smokers. To further address the gap in effectiveness of evidence-based smoking cessation interventions in the homeless population, we are conducting a renewed smoking cessation clinical trial called Power to Quit among smokers experiencing homelessness. ClinicalTrials.gov Identifier: NCT01932996. Date of registration: 20 November 2014.

  9. A pilot randomized clinical trial testing integrated 12-Step facilitation (iTSF) treatment for adolescent substance use disorder.

    Science.gov (United States)

    Kelly, John F; Kaminer, Yifrah; Kahler, Christopher W; Hoeppner, Bettina; Yeterian, Julie; Cristello, Julie V; Timko, Christine

    2017-12-01

    The integration of 12-Step philosophy and practices is common in adolescent substance use disorder (SUD) treatment programs, particularly in North America. However, although numerous experimental studies have tested 12-Step facilitation (TSF) treatments among adults, no studies have tested TSF-specific treatments for adolescents. We tested the efficacy of a novel integrated TSF. Explanatory, parallel-group, randomized clinical trial comparing 10 sessions of either motivational enhancement therapy/cognitive-behavioral therapy (MET/CBT; n = 30) or a novel integrated TSF (iTSF; n = 29), with follow-up assessments at 3, 6 and 9 months following treatment entry. Out-patient addiction clinic in the United States. Adolescents [n = 59; mean age = 16.8 (1.7) years; range = 14-21; 27% female; 78% white]. The iTSF integrated 12-Step with motivational and cognitive-behavioral strategies, and was compared with state-of-the-art MET/CBT for SUD. Primary outcome: percentage days abstinent (PDA); secondary outcomes: 12-Step attendance, substance-related consequences, longest period of abstinence, proportion abstinent/mostly abstinent, psychiatric symptoms. Primary outcome: PDA was not significantly different across treatments [b = 0.08, 95% confidence interval (CI) = -0.08 to 0.24, P = 0.33; Bayes' factor = 0.28). during treatment, iTSF patients had substantially greater 12-Step attendance, but this advantage declined thereafter (b = -0.87; 95% CI = -1.67 to 0.07, P = 0.03). iTSF did show a significant advantage at all follow-up points for substance-related consequences (b = -0.42; 95% CI = -0.80 to -0.04, P Step meeting attendance was associated significantly with longer abstinence during (r = 0.39, P = 0.008), and early following (r = 0.30, P = 0.049), treatment. Compared with motivational enhancement therapy/cognitive-behavioral therapy (MET/CBT), in terms of abstinence, a novel integrated 12-Step facilitation treatment for adolescent

  10. The effect of integrated emotion-oriented care versus usual care on elderly persons with dementia in the nursing home and on nursing assistants: a randomized clinical trial

    NARCIS (Netherlands)

    Finnema, E.J.; Dr�es, R.M.; Ettema, T.P.; Ooms, M.E.; Adèr, H.J.; Ribbe, M.W.; van Tilburg, W.

    2005-01-01

    Objectives: To examine the effect of integrated emotion-oriented care on nursing home residents with dementia and nursing assistants. Design: A multi-site randomized clinical trial with matched groups, and measurements at baseline and after seven months. Setting: Sixteen psychogeriatric wards in

  11. The effect of integrated emotion-oriented care versus usual care on elderly persons with dementia in the nursing home and on nursing assistants: a randomized clinical trial

    NARCIS (Netherlands)

    Finnema, E.J.; Dr�es, R.M.; Ettema, T.P.; Ooms, M.E.; Adèr, H.J.; Ribbe, M.W.; Tilburg, van W.

    2005-01-01

    OBJECTIVES: To examine the effect of integrated emotion-oriented care on nursing home residents with dementia and nursing assistants. DESIGN: A multi-site randomized clinical trial with matched groups, and measurements at baseline and after seven months. SETTING: Sixteen psychogeriatric wards in

  12. Molecular Characterization of Transgenic Events Using Next Generation Sequencing Approach.

    Science.gov (United States)

    Guttikonda, Satish K; Marri, Pradeep; Mammadov, Jafar; Ye, Liang; Soe, Khaing; Richey, Kimberly; Cruse, James; Zhuang, Meibao; Gao, Zhifang; Evans, Clive; Rounsley, Steve; Kumpatla, Siva P

    2016-01-01

    Demand for the commercial use of genetically modified (GM) crops has been increasing in light of the projected growth of world population to nine billion by 2050. A prerequisite of paramount importance for regulatory submissions is the rigorous safety assessment of GM crops. One of the components of safety assessment is molecular characterization at DNA level which helps to determine the copy number, integrity and stability of a transgene; characterize the integration site within a host genome; and confirm the absence of vector DNA. Historically, molecular characterization has been carried out using Southern blot analysis coupled with Sanger sequencing. While this is a robust approach to characterize the transgenic crops, it is both time- and resource-consuming. The emergence of next-generation sequencing (NGS) technologies has provided highly sensitive and cost- and labor-effective alternative for molecular characterization compared to traditional Southern blot analysis. Herein, we have demonstrated the successful application of both whole genome sequencing and target capture sequencing approaches for the characterization of single and stacked transgenic events and compared the results and inferences with traditional method with respect to key criteria required for regulatory submissions.

  13. Molecular Characterization of Transgenic Events Using Next Generation Sequencing Approach.

    Directory of Open Access Journals (Sweden)

    Satish K Guttikonda

    Full Text Available Demand for the commercial use of genetically modified (GM crops has been increasing in light of the projected growth of world population to nine billion by 2050. A prerequisite of paramount importance for regulatory submissions is the rigorous safety assessment of GM crops. One of the components of safety assessment is molecular characterization at DNA level which helps to determine the copy number, integrity and stability of a transgene; characterize the integration site within a host genome; and confirm the absence of vector DNA. Historically, molecular characterization has been carried out using Southern blot analysis coupled with Sanger sequencing. While this is a robust approach to characterize the transgenic crops, it is both time- and resource-consuming. The emergence of next-generation sequencing (NGS technologies has provided highly sensitive and cost- and labor-effective alternative for molecular characterization compared to traditional Southern blot analysis. Herein, we have demonstrated the successful application of both whole genome sequencing and target capture sequencing approaches for the characterization of single and stacked transgenic events and compared the results and inferences with traditional method with respect to key criteria required for regulatory submissions.

  14. Integration

    DEFF Research Database (Denmark)

    Emerek, Ruth

    2004-01-01

    Bidraget diskuterer de forskellige intergrationsopfattelse i Danmark - og hvad der kan forstås ved vellykket integration......Bidraget diskuterer de forskellige intergrationsopfattelse i Danmark - og hvad der kan forstås ved vellykket integration...

  15. Development of a transgenic tobacco plant for phytoremediation of methylmercury pollution.

    Science.gov (United States)

    Nagata, Takeshi; Morita, Hirofumi; Akizawa, Toshifumi; Pan-Hou, Hidemitsu

    2010-06-01

    To develop the potential of plant for phytoremediation of methylmercury pollution, a genetically engineered tobacco plant that coexpresses organomercurial lyase (MerB) with the ppk-specified polyphosphate (polyP) and merT-encoding mercury transporter was constructed by integrating a bacterial merB gene into ppk/merT-transgenic tobacco. A large number of independent transgenic tobaccos was obtained, in some of which the merB gene was stably integrated in the plant genome and substantially translated to the expected MerB enzyme in the transgenic tobacco. The ppk/merT/merB-transgenic tobacco callus showed more resistance to methylmercury (CH3Hg+) and accumulated more mercury from CH3Hg+-containing medium than the ppk/merT-transgenic and wild-type progenitors. These results suggest that the MerB enzyme encoded by merB degraded the incorporated CH3Hg+ to Hg2+, which then accumulated as a less toxic Hg-polyP complex in the tobacco cells. Phytoremediation of CH3Hg+ and Hg2+ in the environment with this engineered ppk/merT/merB-transgenic plant, which prevents the release mercury vapor (Hg0) into the atmosphere in addition to generating potentially recyclable mercury-rich plant residues, is believed to be more acceptable to the public than other competing technologies, including phytovolatilization.

  16. Oviduct-Specific Expression of Human Neutrophil Defensin 4 in Lentivirally Generated Transgenic Chickens

    Science.gov (United States)

    Liu, Tongxin; Wu, Hanyu; Cao, Dainan; Li, Qingyuan; Zhang, Yaqiong; Li, Ning; Hu, Xiaoxiang

    2015-01-01

    The expression of oviduct-specific recombinant proteins in transgenic chickens is a promising technology for the production of therapeutic biologics in eggs. In this study, we constructed a lentiviral vector encoding an expression cassette for human neutrophil defensin 4 (HNP4), a compound that displays high activity against Escherichia coli, and produced transgenic chickens that expressed the recombinant HNP4 protein in egg whites. After the antimicrobial activity of the recombinant HNP4 protein was tested at the cellular level, a 2.8-kb ovalbumin promoter was used to drive HNP4 expression specifically in oviduct tissues. From 669 injected eggs, 218 chickens were successfully hatched. Ten G0 roosters, with semens identified as positive for the transgene, were mated with wild-type hens to generate G1 chickens. From 1,274 total offspring, fifteen G1 transgenic chickens were positive for the transgene, which was confirmed by PCR and Southern blotting. The results of the Southern blotting and genome walking indicated that a single copy of the HNP4 gene was integrated into chromosomes 1, 2, 3, 4, 6 and 24 of the chickens. As expected, HNP4 expression was restricted to the oviduct tissues, and the levels of both transcriptional and translational HNP4 expression varied greatly in transgenic chickens with different transgene insertion sites. The amount of HNP4 protein expressed in the eggs of G1 and G2 heterozygous transgenic chickens ranged from 1.65 μg/ml to 10.18 μg/ml. These results indicated that the production of transgenic chickens that expressed HNP4 protein in egg whites was successful. PMID:26020529

  17. Recent progress on technologies and applications of transgenic ...

    African Journals Online (AJOL)

    USER

    2010-06-14

    Jun 14, 2010 ... this, the methods for producing transgenic poultry must become routine. ... and spermatogonial stem cells (SSCs) have been developed to generate transgenic chickens. ... any procedure aimed at generating transgenic birds.

  18. A Randomized Controlled Trial Comparing Integrated Cognitive Behavioral Therapy Versus Individual Addiction Counseling for Co-occurring Substance Use and Posttraumatic Stress Disorders.

    Science.gov (United States)

    McGovern, Mark P; Lambert-Harris, Chantal; Alterman, Arthur I; Xie, Haiyi; Meier, Andrea

    2011-01-01

    OBJECTIVE: Co-occurring posttraumatic stress (PTSD) and substance use disorders provide clinical challenges to addiction treatment providers. Interventions are needed that are effective, well-tolerated by patients, and capable of being delivered by typical clinicians in community settings. This is a randomized controlled trial of integrated cognitive behavioral therapy for co-occurring PTSD and substance use disorders. METHODS: Fifty-three participants sampled from seven community addiction treatment programs were randomized to integrated cognitive behavioral therapy plus standard care or individual addiction counseling plus standard care. Fourteen community therapists employed by these programs delivered both manual-guided therapies. Primary outcomes were PTSD symptoms, substance use symptoms and therapy retention. Participants were assessed at baseline, 3- and 6-month follow-up. RESULTS: Integrated cognitive behavioral therapy was more effective than individual addiction counseling in reducing PTSD re-experiencing symptoms and PTSD diagnosis. Individual addiction counseling was comparably effective to integrated cognitive behavioral therapy in substance use outcomes and on other measures of psychiatric symptom severity. Participants assigned to individual addiction counseling with severe PTSD were less likely to initiate and engage in the therapy than those assigned to integrated cognitive behavioral therapy. In general, participants with severe PTSD were more likely to benefit from integrated cognitive behavioral therapy. CONCLUSIONS: The findings support the promise of efficacy of integrated cognitive behavioral therapy in improving outcomes for persons in addiction treatment with PTSD. Community counselors delivered both interventions with satisfactory adherence and competence. Despite several limitations to this research, a larger randomized controlled trial of integrated cognitive behavioral therapy appears warranted.

  19. Transgenic cassava lines carrying heterologous alternative oxidase ...

    African Journals Online (AJOL)

    Afuape

    2013-07-03

    Jul 3, 2013 ... production of flowers, apomixis (Nassar et al., 2000; ... In order to increase the stress tolerance capacity of ... stress-related procedure due to the activities of auxin ... the evaluation of the transgenic lines for rate of OES .... Some transgenic lines carrying the 35S-AOX fragment amplified using 35S303F1 and.

  20. [Integrity].

    Science.gov (United States)

    Gómez Rodríguez, Rafael Ángel

    2014-01-01

    To say that someone possesses integrity is to claim that that person is almost predictable about responses to specific situations, that he or she can prudentially judge and to act correctly. There is a closed interrelationship between integrity and autonomy, and the autonomy rests on the deeper moral claim of all humans to integrity of the person. Integrity has two senses of significance for medical ethic: one sense refers to the integrity of the person in the bodily, psychosocial and intellectual elements; and in the second sense, the integrity is the virtue. Another facet of integrity of the person is la integrity of values we cherish and espouse. The physician must be a person of integrity if the integrity of the patient is to be safeguarded. The autonomy has reduced the violations in the past, but the character and virtues of the physician are the ultimate safeguard of autonomy of patient. A field very important in medicine is the scientific research. It is the character of the investigator that determines the moral quality of research. The problem arises when legitimate self-interests are replaced by selfish, particularly when human subjects are involved. The final safeguard of moral quality of research is the character and conscience of the investigator. Teaching must be relevant in the scientific field, but the most effective way to teach virtue ethics is through the example of the a respected scientist.

  1. Paternal inheritance of plastid-encoded transgenes in Petunia hybrida in the greenhouse and under field conditions.

    Science.gov (United States)

    Horn, Patricia; Nausch, Henrik; Baars, Susanne; Schmidtke, Jörg; Schmidt, Kerstin; Schneider, Anja; Leister, Dario; Broer, Inge

    2017-12-01

    As already demonstrated in greenhouse trials, outcrossing of transgenic plants can be drastically reduced via transgene integration into the plastid. We verified this result in the field with Petunia , for which the highest paternal leakage has been observed. The variety white 115 (W115) served as recipient and Pink Wave (PW) and the transplastomic variant PW T16, encoding the uid A reporter gene, as pollen donor. While manual pollination in the greenhouse led to over 90% hybrids for both crossings, the transgenic donor resulted only in 2% hybrids in the field. Nevertheless paternal leakage was detected in one case which proves that paternal inheritance of plastid-located transgenes is possible under artificial conditions. In the greenhouse, paternal leakage occurred in a frequency comparable to published results. As expected natural pollination reduced the hybrid formation in the field from 90 to 7.6% and the transgenic donor did not result in any hybrid.

  2. Biotic and abiotic stress tolerance in transgenic tomatoes by constitutive expression of S-adenosylmethionine decarboxylase gene.

    Science.gov (United States)

    Hazarika, Pranjal; Rajam, Manchikatla Venkat

    2011-04-01

    Recent findings have implicated the role of polyamines (putrescine, spermidine and spermine) in stress tolerance. Therefore, the present work was carried out with the goal of generating transgenic tomato plants with human S-adenosylmethionine decarboxylase (samdc) gene, a key gene involved in biosynthesis of polyamines, viz. spermidine and spermine and evaluating the transgenic plants for tolerance to both biotic and abiotic stresses. Several putative transgenic tomato plants with normal phenotype were obtained, and the transgene integration and expression was validated by PCR, Southern blot analysis and RT-PCR analysis, respectively. The transgenic plants exhibited high levels of polyamines as compared to the untransformed control plants. They also showed increased resistance against two important fungal pathogens of tomato, the wilt causing Fusarium oxysporum and the early blight causing Alternaria solani and tolerance to multiple abiotic stresses such as salinity, drought, cold and high temperature. These results suggest that engineering polyamine accumulation can confer tolerance to both biotic and abiotic stresses in plants.

  3. Generation of a new bioluminescent model for visualisation of mammary tumour development in transgenic mice

    LENUS (Irish Health Repository)

    Zagozdzon, Agnieszka M

    2012-05-30

    AbstractBackgroundNumerous transgenic models have been generated to study breast cancer. However, despite many advantages, traditional transgenic models for breast cancer are also burdened with difficulties in early detection and longitudinal observation of transgene-induced tumours, which in most cases are randomly located and occur at various time points. Methods such as palpation followed by mechanical measurement of the tumours are of limited value in transgenic models. There is a crucial need for making these previously generated models suitable for modern methods of tumour visualisation and monitoring, e.g. by bioluminescence-based techniques. This approach was successfully used in the current study.ResultsA new mouse strain (MMTV-Luc2 mice) expressing Luc2 luciferase primarily in mammary tissue in females, with low-level background expression in internal organs, was generated and bred to homozygosity. After these mice were intercrossed with MMTV-PyVT mice, all double transgenic females developed mammary tumours by the age of 10 weeks, the localisation and progression of which could be effectively monitored using the luminescence-based in vivo imaging. Luminescence-based readout allowed for early visualisation of the locally overgrown mammary tissue and for longitudinal evaluation of local progression of the tumours. When sampled ex vivo at the age of 10 weeks, all tumours derived from MMTV-Luc2PyVT females displayed robust bioluminescent signal.ConclusionsWe have created a novel transgenic strain for visualisation and longitudinal monitoring of mammary tumour development in transgenic mice as an addition and\\/or a new and more advanced alternative to manual methods. Generation of this mouse strain is vital for making many of the existing mammary tumour transgenic models applicable for in vivo imaging techniques.

  4. Generation of a new bioluminescent model for visualisation of mammary tumour development in transgenic mice

    Directory of Open Access Journals (Sweden)

    Zagozdzon Agnieszka M

    2012-05-01

    Full Text Available Abstract Background Numerous transgenic models have been generated to study breast cancer. However, despite many advantages, traditional transgenic models for breast cancer are also burdened with difficulties in early detection and longitudinal observation of transgene-induced tumours, which in most cases are randomly located and occur at various time points. Methods such as palpation followed by mechanical measurement of the tumours are of limited value in transgenic models. There is a crucial need for making these previously generated models suitable for modern methods of tumour visualisation and monitoring, e.g. by bioluminescence-based techniques. This approach was successfully used in the current study. Results A new mouse strain (MMTV-Luc2 mice expressing Luc2 luciferase primarily in mammary tissue in females, with low-level background expression in internal organs, was generated and bred to homozygosity. After these mice were intercrossed with MMTV-PyVT mice, all double transgenic females developed mammary tumours by the age of 10 weeks, the localisation and progression of which could be effectively monitored using the luminescence-based in vivo imaging. Luminescence-based readout allowed for early visualisation of the locally overgrown mammary tissue and for longitudinal evaluation of local progression of the tumours. When sampled ex vivo at the age of 10 weeks, all tumours derived from MMTV-Luc2PyVT females displayed robust bioluminescent signal. Conclusions We have created a novel transgenic strain for visualisation and longitudinal monitoring of mammary tumour development in transgenic mice as an addition and/or a new and more advanced alternative to manual methods. Generation of this mouse strain is vital for making many of the existing mammary tumour transgenic models applicable for in vivo imaging techniques.

  5. Field performance of transgenic citrus trees: assessment of the long-term expression of uidA and nptII transgenes and its impact on relevant agronomic and phenotypic characteristics.

    Science.gov (United States)

    Pons, Elsa; Peris, Josep E; Peña, Leandro

    2012-07-15

    The future of genetic transformation as a tool for the improvement of fruit trees depends on the development of proper systems for the assessment of unintended effects in field-grown GM lines. In this study, we used eight transgenic lines of two different citrus types (sweet orange and citrange) transformed with the marker genes β-glucuronidase (uidA) and neomycin phosphotransferase II (nptII) as model systems to study for the first time in citrus the long-term stability of transgene expression and whether transgene-derived pleiotropic effects occur with regard to the morphology, development and fruit quality of orchard-grown GM citrus trees. The stability of the integration and expression of the transgenes was confirmed in 7-year-old, orchard-grown transgenic lines by Southern blot analysis and enzymatic assays (GUS and ELISA NPTII), respectively. Little seasonal variation was detected in the expression levels between plants of the same transgenic line in different organs and over the 3 years of analysis, confirming the absence of rearrangements and/or silencing of the transgenes after transferring the plants to field conditions. Comparisons between the GM citrus lines with their non-GM counterparts across the study years showed that the expression of these transgenes did not cause alterations of the main phenotypic and agronomic plant and fruit characteristics. However, when comparisons were performed between diploid and tetraploid transgenic citrange trees and/or between juvenile and mature transgenic sweet orange trees, significant and consistent differences were detected, indicating that factors other than their transgenic nature induced a much higher phenotypic variability. Our results indicate that transgene expression in GM citrus remains stable during long-term agricultural cultivation, without causing unexpected effects on crop characteristics. This study also shows that the transgenic citrus trees expressing the selectable marker genes that are most

  6. Vast potential for using the piggyBac transposon to engineer transgenic plants

    Science.gov (United States)

    The acceptance of bioengineered plants by some nations is hampered by a number of factors, including the random insertion of a transgene into the host genome. Emerging technologies, such as site-specific nucleases, are enabling plant scientists to promote recombination or mutations at specific plant...

  7. Targeted transgene insertion into the CHO cell genome using Cre recombinase-incorporating integrase-defective retroviral vectors.

    Science.gov (United States)

    Kawabe, Yoshinori; Shimomura, Takuya; Huang, Shuohao; Imanishi, Suguru; Ito, Akira; Kamihira, Masamichi

    2016-07-01

    Retroviral vectors have served as efficient gene delivery tools in various biotechnology fields. However, viral DNA is randomly inserted into the genome, which can cause problems, such as insertional mutagenesis and gene silencing. Previously, we reported a site-specific gene integration system, in which a transgene is integrated into a predetermined chromosomal locus of Chinese hamster ovary (CHO) cells using integrase-defective retroviral vectors (IDRVs) and Cre recombinase. In this system, a Cre expression plasmid is transfected into founder cells before retroviral transduction. In practical applications of site-specific gene modification such as for hard-to-transfect cells or for in vivo gene delivery, both the transgene and the Cre protein into retroviral virions should be encapsulate. Here, we generated novel hybrid IDRVs in which viral genome and enzymatically active Cre can be delivered (Cre-IDRVs). Cre-IDRVs encoding marker genes, neomycin resistance and enhanced green fluorescent protein (EGFP), flanked by wild-type and mutated loxP sites were produced using an expression plasmid for a chimeric protein of Cre and retroviral gag-pol. After analyzing the incorporation of the Cre protein into retroviral virions by Western blotting, the Cre-IDRV was infected into founder CHO cells, in which marker genes (hygromycin resistance and red fluorescent protein) flanked with corresponding loxP sites are introduced into the genome. G418-resistant colonies expressing GFP appeared and the site-specific integration of the transgene into the expected chromosomal site was confirmed by PCR and sequencing of amplicons. Moreover, when Cre-IDRV carried a gene expression unit for a recombinant antibody, the recombinant cells in which the antibody expression cassette was integrated in a site-specific manner were generated and the cells produced the recombinant antibody. This method may provide a promising tool to perform site-specific gene modification according to Cre

  8. Status and risk assessment of the use of transgenic arthropods in plant protection. Proceedings of a technical meeting

    International Nuclear Information System (INIS)

    2006-03-01

    New developments in the modern biotechnology have opened up the possibility of introducing genes into the germline of many insect species, including those of agricultural importance. This technology offers the potential to improve current pest control strategies that incorporate the Sterile Insect Technique (SIT). Potential improvements include the development of strains that (1) produce only male insects for sterilization and release and (2) carry a marker that distinguishes them from wild insects. There are many institutions involved in the development of transgenic insect technology both for studies on basic gene regulation and for the creation of transgenic strains for use in a wide range of insect control programmes. It has been realized that the release into the environment of transgenic insects will not be an easy process considering the current public sensitivities in this area. The fact that insects are mobile and that once released cannot be recalled creates much concern. If fertile transgenic insects were to be released in any type of control programme, then the transgene would enter the wild population through mating. This strategy is fraught with, as yet, unknown risks and it is inconceivable that regulatory approval will be given for such a release in the near future. However, when transgenic strains are integrated into a sterile insect release then the concerns about transmission of the transgene to the wild population disappear as the matings between the released and the wild insects are sterile. This scenario is likely to be the first type of transgenic release. Insects that are currently released in SIT programmes experience no significant regulatory problems, but this will not be the case if the insects that are released are transgenic, even if they are sterile. The meeting Status and Risk Assessment of the Use of Transgenic Arthropods in Plant Protection held in FAO Headquarters, Rome, in April 2002 was the first effort to bring together

  9. Transformation of pecan and regeneration of transgenic plants.

    Science.gov (United States)

    McGranahan, G H; Leslie, C A; Dandekar, A M; Uratsu, S L; Yates, I E

    1993-09-01

    A gene transfer system developed for walnut (Juglans regia L.) was successfully applied to pecan (Carya illinoensis [Wang] K. Koch). Repetitively embryogenic somatic embryos derived from open-pollinated seed of 'Elliott', 'Wichita', and 'Schley' were co-cultivated with Agrobacterium strain EHA 101/pCGN 7001, which contains marker genes for beta-glucuronidase activity and resistance to kanamycin. Several modifications of the standard walnut transformation techniques were tested, including a lower concentration of kanamycin and a modified induction medium, but these treatments had no measurable effect on efficiency of transformation. Nineteen of the 764 viable inoculated embryos produced transgenic subclones; 13 of these were from the line 'Elliott'6, 3 from 'Schley'5/3, and 3 from 'Wichita'9. Transgenic embryos of 'Wichita'9 germinated most readily and three subclones were successfully micropropagated. Three transgenic plants of one of these subclones were obtained by grafting the tissue cultured shoots to seedling pecan rootstock in the greenhouse. Gene insertion, initially detected by GUS activity, was confirmed by detection of integrated T-DNA sequences using Southern analysis.

  10. Construction and Quality Analysis of Transgenic Rehmannia glutinosa Containing TMV and CMV Coat Protein

    Directory of Open Access Journals (Sweden)

    Zhongqiu Teng

    2016-08-01

    Full Text Available Plant viruses, especially tobacco mosaic virus (TMV and cucumber mosaic virus (CMV are serious threats to Rehmannia glutinosa which is a “top grade” herb in China. In the present study, TMV- and CMV-resistant Rehmannia glutinosa Libosch. plants were constructed by transforming the protein (CP genes of TMV and CMV into Rehmannia glutinosa via a modified procedure of Agrobacterium tumefaciens-mediated transformation. Integration and expression of TMV CP and CMV CP transgenes in 2 lines, LBA-1 and LBA-2, were confirmed by PCR, Southern blot and RT-PCR. Both LBA-1 and LBA-2 were resistant to infection of homologous TMV and CMV strains. The quality of transgenic Rehmanniae Radix was evaluated based on fingerprint analysis and components quantitative analysis comparing with control root tubes. These results showed that chemical composition of transgenic Rehmanniae Radix were similar to non-transgenic ones, which demonstrated that the medical quality and biosafety of transgenic Rehmanniae Radix were equivalent to non-transgenic material when consumed as traditional Chinese medicinal (TCM.

  11. Rapid characterization of transgenic and non-transgenic soybean oils by chemometric methods using NIR spectroscopy

    Science.gov (United States)

    Luna, Aderval S.; da Silva, Arnaldo P.; Pinho, Jéssica S. A.; Ferré, Joan; Boqué, Ricard

    Near infrared (NIR) spectroscopy and multivariate classification were applied to discriminate soybean oil samples into non-transgenic and transgenic. Principal Component Analysis (PCA) was applied to extract relevant features from the spectral data and to remove the anomalous samples. The best results were obtained when with Support Vectors Machine-Discriminant Analysis (SVM-DA) and Partial Least Squares-Discriminant Analysis (PLS-DA) after mean centering plus multiplicative scatter correction. For SVM-DA the percentage of successful classification was 100% for the training group and 100% and 90% in validation group for non transgenic and transgenic soybean oil samples respectively. For PLS-DA the percentage of successful classification was 95% and 100% in training group for non transgenic and transgenic soybean oil samples respectively and 100% and 80% in validation group for non transgenic and transgenic respectively. The results demonstrate that NIR spectroscopy can provide a rapid, nondestructive and reliable method to distinguish non-transgenic and transgenic soybean oils.

  12. Improving access to geriatric mental health services: a randomized trial comparing treatment engagement with integrated versus enhanced referral care for depression, anxiety, and at-risk alcohol use.

    Science.gov (United States)

    Bartels, Stephen J; Coakley, Eugenie H; Zubritsky, Cynthia; Ware, James H; Miles, Keith M; Areán, Patricia A; Chen, Hongtu; Oslin, David W; Llorente, Maria D; Costantino, Giuseppe; Quijano, Louise; McIntyre, Jack S; Linkins, Karen W; Oxman, Thomas E; Maxwell, James; Levkoff, Sue E

    2004-08-01

    The authors sought to determine whether integrated mental health services or enhanced referral to specialty mental health clinics results in greater engagement in mental health/substance abuse services by older primary care patients. This multisite randomized trial included 10 sites consisting of primary care and specialty mental health/substance abuse clinics. Primary care patients 65 years old or older (N=24,930) were screened. The final study group consisted of 2,022 patients (mean age=73.5 years; 26% female; 48% ethnic minority) with depression (N=1,390), anxiety (N=70), at-risk alcohol use (N=414), or dual diagnosis (N=148) who were randomly assigned to integrated care (mental health and substance abuse providers co-located in primary care; N=999) or enhanced referral to specialty mental health/substance abuse clinics (i.e., facilitated scheduling, transportation, payment; N=1,023). Seventy-one percent of patients engaged in treatment in the integrated model compared with 49% in the enhanced referral model. Integrated care was associated with more mental health and substance abuse visits per patient (mean=3.04) relative to enhanced referral (mean=1.91). Overall, greater engagement was predicted by integrated care and higher mental distress. For depression, greater engagement was predicted by integrated care and more severe depression. For at-risk alcohol users, greater engagement was predicted by integrated care and more severe problem drinking. For all conditions, greater engagement was associated with closer proximity of mental health/substance abuse services to primary care. Older primary care patients are more likely to accept collaborative mental health treatment within primary care than in mental health/substance abuse clinics. These results suggest that integrated service arrangements improve access to mental health and substance abuse services for older adults who underuse these services.

  13. Addressing challenges in scaling up TB and HIV treatment integration in rural primary healthcare clinics in South Africa (SUTHI): a cluster randomized controlled trial protocol.

    Science.gov (United States)

    Naidoo, Kogieleum; Gengiah, Santhanalakshmi; Yende-Zuma, Nonhlanhla; Padayatchi, Nesri; Barker, Pierre; Nunn, Andrew; Subrayen, Priashni; Abdool Karim, Salim S

    2017-11-13

    A large and compelling clinical evidence base has shown that integrated TB and HIV services leads to reduction in human immunodeficiency virus (HIV)- and tuberculosis (TB)-associated mortality and morbidity. Despite official policies and guidelines recommending TB and HIV care integration, its poor implementation has resulted in TB and HIV remaining the commonest causes of death in several countries in sub-Saharan Africa, including South Africa. This study aims to reduce mortality due to TB-HIV co-infection through a quality improvement strategy for scaling up of TB and HIV treatment integration in rural primary healthcare clinics in South Africa. The study is designed as an open-label cluster randomized controlled trial. Sixteen clinic supervisors who oversee 40 primary health care (PHC) clinics in two rural districts of KwaZulu-Natal, South Africa will be randomized to either the control group (provision of standard government guidance for TB-HIV integration) or the intervention group (provision of standard government guidance with active enhancement of TB-HIV care integration through a quality improvement approach). The primary outcome is all-cause mortality among TB-HIV patients. Secondary outcomes include time to antiretroviral therapy (ART) initiation among TB-HIV co-infected patients, as well as TB and HIV treatment outcomes at 12 months. In addition, factors that may affect the intervention, such as conditions in the clinic and staff availability, will be closely monitored and documented. This study has the potential to address the gap between the establishment of TB-HIV care integration policies and guidelines and their implementation in the provision of integrated care in PHC clinics. If successful, an evidence-based intervention comprising change ideas, tools, and approaches for quality improvement could inform the future rapid scale up, implementation, and sustainability of improved TB-HIV integration across sub-Sahara Africa and other resource

  14. Optical modulation of transgene expression in retinal pigment epithelium

    Science.gov (United States)

    Palanker, D.; Lavinsky, D.; Chalberg, T.; Mandel, Y.; Huie, P.; Dalal, R.; Marmor, M.

    2013-03-01

    Over a million people in US alone are visually impaired due to the neovascular form of age-related macular degeneration (AMD). The current treatment is monthly intravitreal injections of a protein which inhibits Vascular Endothelial Growth Factor, thereby slowing progression of the disease. The immense financial and logistical burden of millions of intravitreal injections signifies an urgent need to develop more long-lasting and cost-effective treatments for this and other retinal diseases. Viral transfection of ocular cells allows creation of a "biofactory" that secretes therapeutic proteins. This technique has been proven successful in non-human primates, and is now being evaluated in clinical trials for wet AMD. However, there is a critical need to down-regulate gene expression in the case of total resolution of retinal condition, or if patient has adverse reaction to the trans-gene products. The site for genetic therapy of AMD and many other retinal diseases is the retinal pigment epithelium (RPE). We developed and tested in pigmented rabbits, an optical method to down-regulate transgene expression in RPE following vector delivery, without retinal damage. Microsecond exposures produced by a rapidly scanning laser vaporize melanosomes and destroy a predetermined fraction of the RPE cells selectively. RPE continuity is restored within days by migration and proliferation of adjacent RPE, but since the transgene is not integrated into the nucleus it is not replicated. Thus, the decrease in transgene expression can be precisely determined by the laser pattern density and further reduced by repeated treatment without affecting retinal structure and function.

  15. Overexpression of persimmon DkXTH1 enhanced tolerance to abiotic stress and delayed fruit softening in transgenic plants.

    Science.gov (United States)

    Han, Ye; Han, Shoukun; Ban, Qiuyan; He, Yiheng; Jin, Mijing; Rao, Jingping

    2017-04-01

    DkXTH1 promoted cell elongation and more strength to maintain structural integrity by involving in cell wall assembly, thus enhanced tolerance to abiotic stress with broader phenotype in transgenic plants. Xyloglucan endotransglucosylase/hydrolase (XTH) is thought to play a key role in cell wall modifications by cleaving and re-joining xyloglucan, and participates in the diverse physiological processes. DkXTH1 was found to peak in immature expanding persimmon fruit, and its higher expression level exhibited along with firmer fruit during storage. In the present study, transgenic Arabidopsis and tomato plants were generated with DkXTH1 constitutively expressed. Overexpression of DkXTH1 enhanced tolerance to salt, ABA and drought stresses in transgenic Arabidopsis plants with respect to root and leaf growth, and survival. Transgenic tomatoes collected at the mature green stage, presented delayed fruit softening coupled with postponed color change, a later and lower ethylene peak, and higher firmness in comparison with the wild-type tomatoes during storage. Furthermore, broader leaves and tomato fruit with larger diameter were gained in transgenic Arabidopsis and tomato, respectively. Most importantly, transgenic plants exhibited more large and irregular cells with higher density of cell wall and intercellular spaces, resulting from the overactivity of XET enzymes involving in cell wall assembly. We suggest that DkXTH1 expression resulted in cells with more strength and thickness to maintain structural integrity, and thus enhanced tolerance to abiotic stress and delayed fruit softening in transgenic plants.

  16. Expression of multiple proteins in transgenic plants

    Science.gov (United States)

    Vierstra, Richard D.; Walker, Joseph M.

    2002-01-01

    A method is disclosed for the production of multiple proteins in transgenic plants. A DNA construct for introduction into plants includes a provision to express a fusion protein of two proteins of interest joined by a linking domain including plant ubiquitin. When the fusion protein is produced in the cells of a transgenic plant transformed with the DNA construction, native enzymes present in plant cells cleave the fusion protein to release both proteins of interest into the cells of the transgenic plant. Since the proteins are produced from the same fusion protein, the initial quantities of the proteins in the cells of the plant are approximately equal.

  17. Glyphostate-drift but not herbivory alters the rate of transgene flow from single and stacked trait transgenic canola (Brassica napus L.) to non-transgenic B. napus and B. rapa

    Science.gov (United States)

    While transgenic plants can offer agricultural benefits, the escape of transgenes out of crop fields is a major environmental concern. Escape of transgenic herbicide resistance has occurred between transgenic Brassica napus (canola) and weedy species in numerous locations. In t...

  18. Effects and feasibility of an Integrative Medicine program for geriatric patients– a cluster-randomized pilot study

    Directory of Open Access Journals (Sweden)

    Teut M

    2013-07-01

    Full Text Available Michael Teut, Katharina Schnabel, Roland Baur, Annette Kerckhoff, Frauke Reese, Niels Pilgram, Franziska Berger, Rainer Luedtke, Claudia M Witt Institute for Social Medicine, Epidemiology and Health Economics, Charité – Universitätsmedizin Berlin, Berlin, Germany Background: Older adults often use complementary medicine; however, very few interventional studies have focused on them. The aim of this study was to evaluate the feasibility and to obtain preliminary data on effectiveness of an Integrative Medicine (IM program compared to usual medical care. Methods: The study consisted of older adults living in shared apartment communities including caregiving. The shared apartments were cluster-randomized to the IM program or Usual Care (UC. IM consisted of additional lifestyle modification (exercise and diet, external naturopathic applications, homeopathic treatment, and modification of conventional drug therapy for 12 months. The UC group received conventional care alone. The following outcomes were used: Nurses Observation Scale for Geriatric Patients (NOSGER; Assessment of Motor and Process Skills; Barthel Index; Qualidem; Profile of Wellbeing; and Mini-mental State Examination. Exploratory effect sizes (Cohen’s d, means adjusted for differences of baseline values were calculated to analyze group differences. Results: A total of eight shared apartment communities were included; four were allocated to IM (29 patients, median seven patients; [mean ± standard deviation] 82.7 ± 8.6 years and four to UC (29 patients, median eight patients; 76.0 ± 12.8 years of age. After 12 months, effect sizes ≥0.3 were observed for activities of daily living on the NOSGER-Activities of Daily Living subscale (0.53, Barthel Index (0.30, Qualidem total sum score (0.39, Profile of Wellbeing (0.36, NOSGER-Impaired Social Behavior (0.47, and NOSGER-Depressed Mood subscales (0.40. Smaller or no effects were observed for all other outcomes. The intervention

  19. A group randomized controlled trial integrating obesity prevention and control for postpartum adolescents in a home visiting program.

    Science.gov (United States)

    Haire-Joshu, Debra L; Schwarz, Cynthia D; Peskoe, Sarah B; Budd, Elizabeth L; Brownson, Ross C; Joshu, Corinne E

    2015-06-26

    Adolescence represents a critical period for the development of overweight that tracks into adulthood. This risk is significantly heightened for adolescents that become pregnant, many of whom experience postpartum weight retention. The aim of this study was to evaluate Balance Adolescent Lifestyle Activities and Nutrition Choices for Energy (BALANCE), a multicomponent obesity prevention intervention targeting postpartum adolescents participating in a national home visiting child development-parent education program. A group randomized, nested cohort design was used with 1325 adolescents, 694 intervention and 490 control, (mean age = 17.8 years, 52 % underrepresented minorities) located across 30 states. Participatory methods were used to integrate lifestyle behavior change strategies within standard parent education practice. Content targeted replacement of high-risk obesogenic patterns (e.g. sweetened drink and high fat snack consumption, sedentary activity) with positive behaviors (e.g. water intake, fruit and vegetables, increased walking). Parent educators delivered BALANCE through home visits, school based classroom-group meetings, and website activities. Control adolescents received standard child development information. Phase I included baseline to posttest (12 months); Phase II included baseline to follow-up (24 months). When compared to the control group, BALANCE adolescents who were ≥12 weeks postpartum were 89 % more likely (p = 0.02) to maintain a normal BMI or improve an overweight/obese BMI by 12 months; this change was not sustained at 24 months. When compared to the control group, BALANCE adolescents significantly improved fruit and vegetable intake (p = .03). In stratified analyses, water intake improved among younger BALANCE teens (p = .001) and overweight/obese BALANCE teens (p = .05) when compared to control counterparts. There were no significant differences between groups in sweetened drink and snack consumption

  20. AN APPROACH TO TRANSGENIC CROP MONITORING

    Science.gov (United States)

    Remote sensing by aerial or satellite images may provide a method of identifying transgenic pesticidal crop distribution in the landscape. Genetically engineered crops containing bacterial gene(s) that express an insecticidal protein from Bacillus thuringiensis (Bt) are regulated...

  1. Transgenic plants with enhanced growth characteristics

    Energy Technology Data Exchange (ETDEWEB)

    Unkefer, Pat J.; Anderson, Penelope S.; Knight, Thomas J.

    2018-01-09

    The invention relates to transgenic plants exhibiting dramatically enhanced growth rates, greater seed and fruit/pod yields, earlier and more productive flowering, more efficient nitrogen utilization, increased tolerance to high salt conditions, and increased biomass yields. In one embodiment, transgenic plants engineered to over-express both glutamine phenylpyruvate transaminase (GPT) and glutamine synthetase (GS) are provided. The GPT+GS double-transgenic plants of the invention consistently exhibit enhanced growth characteristics, with T0 generation lines showing an increase in biomass over wild type counterparts of between 50% and 300%. Generations that result from sexual crosses and/or selfing typically perform even better, with some of the double-transgenic plants achieving an astounding four-fold biomass increase over wild type plants.

  2. Transgenic plants with enhanced growth characteristics

    Energy Technology Data Exchange (ETDEWEB)

    Unkefer, Pat J.; Anderson, Penelope S.; Knight, Thomas J.

    2016-09-06

    The invention relates to transgenic plants exhibiting dramatically enhanced growth rates, greater seed and fruit/pod yields, earlier and more productive flowering, more efficient nitrogen utilization, increased tolerance to high salt conditions, and increased biomass yields. In one embodiment, transgenic plants engineered to over-express both glutamine phenylpyruvate transaminase (GPT) and glutamine synthetase (GS) are provided. The GPT+GS double-transgenic plants of the invention consistently exhibit enhanced growth characteristics, with T0 generation lines showing an increase in biomass over wild type counterparts of between 50% and 300%. Generations that result from sexual crosses and/or selfing typically perform even better, with some of the double-transgenic plants achieving an astounding four-fold biomass increase over wild type plants.

  3. Accumulation of nickel in transgenic tobacco

    Science.gov (United States)

    Sidik, Nik Marzuki; Othman, Noor Farhan

    2013-11-01

    The accumulation of heavy metal Ni in the roots and leaves of four T1 transgenic lines of tobacco (T(1)20E, T(1)24C, T(1)18B1 and T(1)20B) expressing eiMT1 from E.indica was assessed. The aim of the study was to investigate the level of Ni accumulation in the leaves and roots of each transgenic lines and to evaluate the eligibility of the plants to be classified as a phytoremediation agent. All of the transgenic lines showed different ability in accumulating different metals and has translocation factor (TF) less than 1 (TFtransgenic lines, transgenic line T(1)24C showed the highest accumulation of Ni (251.9 ± 0.014 mg/kg) and the lowest TF value (TFT(1)24C=0.0875) at 60 ppm Ni.

  4. A- or C-chromosomes, does it matter for the transfer of transgenes from ¤Brassica napus¤

    DEFF Research Database (Denmark)

    Tomiuk, J.; Hauser, T.P.; Bagger Jørgensen, Rikke

    2000-01-01

    of herbicide-tolerant plants was explained by selection against the C-chromosomes of B. napus in favor of the homeologous ii-chromosomes. Obviously, such C-chromosomes could be potential candidates as safe integration sites for transgenes. We considered these safety aspects using a simple population genetic...... model. Theory and experiments, however, do not favor the chromosomes of B. napus as safe candidates with respect to the introgression of transgenes into wild populations of B. rapa....

  5. Ethics and Transgenic Crops: a Review

    OpenAIRE

    Robinson, Jonathan

    1999-01-01

    This article represents a review of some of the ethical dilemmas that have arisen as a result of the development and deployment of transgenic crop plants. The potential for transgenic crops to alleviate human hunger and the possible effects on human health are discussed. Risks and benefits to the environment resulting from genetic engineering of crops for resistance to biotic and abiotic stresses are considered, in addition to effects on biodiversity. The socio-economic impacts and distributi...

  6. Transgenic Wheat, Barley and Oats: Future Prospects

    Science.gov (United States)

    Dunwell, Jim M.

    Following the success of transgenic maize and rice, methods have now been developed for the efficient introduction of genes into wheat, barley and oats. This review summarizes the present position in relation to these three species, and also uses information from field trial databases and the patent literature to assess the future trends in the exploitation of transgenic material. This analysis includes agronomic traits and also discusses opportunities in expanding areas such as biofuels and biopharming.

  7. Transgenic animals and their application in medicine

    OpenAIRE

    Bagle TR, Kunkulol RR, Baig MS, More SY

    2013-01-01

    Transgenic animals are animals that are genetically altered to have traits that mimic symptoms of specific human pathologies. They provide genetic models of various human diseases which are important in understanding disease and developing new targets. In early 1980 Gordon and co-workers described the first gene addition experiment using the microinjection technology and since then the impact of transgenic technology on basic research has been significant. Within 20 years of its inception, AT...

  8. Transgene Expression in Microalgae-From Tools to Applications.

    Science.gov (United States)

    Doron, Lior; Segal, Na'ama; Shapira, Michal

    2016-01-01

    Microalgae comprise a biodiverse group of photosynthetic organisms that reside in water sources and sediments. The green microalgae Chlamydomonas reinhardtii was adopted as a useful model organism for studying various physiological systems. Its ability to grow under both photosynthetic and heterotrophic conditions allows efficient growth of non-photosynthetic mutants, making Chlamydomonas a useful genetic tool to study photosynthesis. In addition, this green alga can grow as haploid or diploid cells, similar to yeast, providing a powerful genetic system. As a result, easy and efficient transformation systems have been developed for Chlamydomonas, targeting both the chloroplast and nuclear genomes. Since microalgae comprise a rich repertoire of species that offer variable advantages for biotech and biomed industries, gene transfer technologies were further developed for many microalgae to allow for the expression of foreign proteins of interest. Expressing foreign genes in the chloroplast enables the targeting of foreign DNA to specific sites by homologous recombination. Chloroplast transformation also allows for the introduction of genes encoding several enzymes from a complex pathway, possibly as an operon. Expressing foreign proteins in the chloroplast can also be achieved by introducing the target gene into the nuclear genome, with the protein product bearing a targeting signal that directs import of the transgene-product into the chloroplast, like other endogenous chloroplast proteins. Integration of foreign genes into the nuclear genome is mostly random, resulting in large variability between different clones, such that extensive screening is required. The use of different selection modalities is also described, with special emphasis on the use of herbicides and metabolic markers which are considered to be friendly to the environment, as compared to drug-resistance genes that are commonly used. Finally, despite the development of a wide range of transformation

  9. Transgene expression in microalgae – from tools to applications

    Directory of Open Access Journals (Sweden)

    Lior eDoron

    2016-04-01

    Full Text Available Microalgae comprise a biodiverse group of photosynthetic organisms that reside in water sources and sediments. The green microalgae Chlamydomonas reinhardtii was adopted as a useful model organism for studying various physiological systems. Its ability to grow under both photosynthetic and heterotrophic conditions allows efficient growth of non-photosynthetic mutants, making Chlamydomonas a useful genetic tool to study photosynthesis. In addition, this green alga can grow as haploid or diploid cells, similar to yeast, providing a powerful genetic system. As a result, easy and efficient transformation systems have been developed for Chlamydomonas, targeting both the chloroplast and nuclear genomes. Since microalgae comprise a rich repertoire of species that offer variable advantages for biotech and biomed industries, gene transfer technologies were further developed for many microalgae to allow for the expression of foreign proteins of interest. Expressing foreign genes in the chloroplast enables the targeting of foreign DNA to specific sites by homologous recombination. Chloroplast transformation also allows for the introduction of genes encoding several enzymes from a complex pathway, possibly as an operon. Expressing foreign proteins in the chloroplast can also be achieved by introducing the target gene into the nuclear genome, with the protein product bearing a targeting signal that directs import of the transgene-product into the chloroplast, like other endogenous chloroplast proteins. Integration of foreign genes into the nuclear genome is mostly random, resulting in large variability between different clones, such that extensive screening is required. The use of different selection modalities is also described, with special emphasis on the use of herbicides and metabolic markers which are considered to be friendly to the environment, as compared to drug-resistance genes that are commonly used. Finally, despite the development of a wide

  10. CMOS integration of high-k/metal gate transistors in diffusion and gate replacement (D&GR) scheme for dynamic random access memory peripheral circuits

    Science.gov (United States)

    Dentoni Litta, Eugenio; Ritzenthaler, Romain; Schram, Tom; Spessot, Alessio; O’Sullivan, Barry; Machkaoutsan, Vladimir; Fazan, Pierre; Ji, Yunhyuck; Mannaert, Geert; Lorant, Christophe; Sebaai, Farid; Thiam, Arame; Ercken, Monique; Demuynck, Steven; Horiguchi, Naoto

    2018-04-01

    Integration of high-k/metal gate stacks in peripheral transistors is a major candidate to ensure continued scaling of dynamic random access memory (DRAM) technology. In this paper, the CMOS integration of diffusion and gate replacement (D&GR) high-k/metal gate stacks is investigated, evaluating four different approaches for the critical patterning step of removing the N-type field effect transistor (NFET) effective work function (eWF) shifter stack from the P-type field effect transistor (PFET) area. The effect of plasma exposure during the patterning step is investigated in detail and found to have a strong impact on threshold voltage tunability. A CMOS integration scheme based on an experimental wet-compatible photoresist is developed and the fulfillment of the main device metrics [equivalent oxide thickness (EOT), eWF, gate leakage current density, on/off currents, short channel control] is demonstrated.

  11. Comparison of nutritional value of transgenic peanut expressing bar and rcg3 genes with non-transgenic counterparts

    International Nuclear Information System (INIS)

    Robab, U.E.; )

    2014-01-01

    The transgenic peanut plants expressing bar and rcg3 genes were subjected to assessment of any change in nutritional value of the crop at various locations. The protein and fat contents of transgenic lines were compared with the non-transgenic parent varieties. Protein content in the transgenic lines was higher as compared to that in non-transgenic counterparts and differences among locations for fat and protein content were significant. No differences among fatty acids were recorded for genes, events and locations. Irrespective of small differences, all the values were in range described for this crop and transgenic lines appeared to be substantially equivalent to non-transgenic parent varieties. (author)

  12. Transgene flow: Facts, speculations and possible countermeasures

    Science.gov (United States)

    Ryffel, Gerhart U

    2014-01-01

    Convincing evidence has accumulated that unintended transgene escape occurs in oilseed rape, maize, cotton and creeping bentgrass. The escaped transgenes are found in variant cultivars, in wild type plants as well as in hybrids of sexually compatible species. The fact that in some cases stacked events are present that have not been planted commercially, implies unintended recombination of transgenic traits. As the consequences of this continuous transgene escape for the ecosystem cannot be reliably predicted, I propose to use more sophisticated approaches of gene technology in future. If possible GM plants should be constructed using either site-directed mutagenesis or cisgenic strategies to avoid the problem of transgene escape. In cases where a transgenic trait is needed, efficient containment should be the standard approach. Various strategies available or in development are discussed. Such a cautious approach in developing novel types of GM crops will enhance the sustainable potential of GM crops and thus increase the public trust in green gene technology. PMID:25523171

  13. Immunoglobulin gene expression and regulation of rearrangement in kappa transgenic mice

    International Nuclear Information System (INIS)

    Ritchie, K.A.

    1986-01-01

    Transgenic mice were produced by microinjection of the functionally rearranged immunoglobulin kappa gene from the myeloma MOPC-21 into the male pronucleus of fertilized mouse eggs, and implantation of the microinjected embryos into foster mothers. Mice that integrated the injected gene were detected by hybridizing tail DNA dots with radioactively labelled pBR322 plasmid DNA, which detects pBR322 sequences left as a tag on the microinjected DNA. Mice that integrated the injected gene (six males) were mated and the DNA, RNA and serum kappa chains of their offspring were analyzed. A rabbit anti-mouse kappa chain antiserum was also produced for use in detection of mouse kappa chains on protein blots. Hybridomas were produced from the spleen cells of these kappa transgenic mice to immortalize representative B cells and to investigate expression of the transgenic kappa gene, its effect on allelic exclusion, and its effect on the control of light chain gene rearrangement and expression. The results show that the microinjected DNA is integrated as concatamers in unique single or, rarely, two separate sites in the genome. The concatamers are composed of several copies (16 to 64) of injected DNA arranged in a head to tail fashion. The transgene is expressed into protein normally and in a tissue specific fashion. For the first time in these transgenic mice, all tissues contain a functionally rearranged and potentially expressible immunoglobulin gene. The transgene is expressed only in B cells and not in hepatocytes, for example. This indicates that rearrangement of immunoglobulin genes is necessary but not sufficient for the tissue specific expression of these genes by B cells

  14. Integrated Care for Older Adults Improves Perceived Quality of Care : Results of a Randomized Controlled Trial of Embrace

    NARCIS (Netherlands)

    Uittenbroek, Ronald J; Kremer, Hubertus P H; Spoorenberg, Sophie L W; Reijneveld, Sijmen A; Wynia, Klaske

    BACKGROUND: All community-living older adults might benefit from integrated care, but evidence is lacking on the effectiveness of such services for perceived quality of care. To examine the impact of Embrace, a community-based integrated primary care service, on perceived quality of care. Stratified

  15. Generation of transgenic goats by pronuclear microinjection: a retrospective analysis of a commercial operation (1995-2012).

    Science.gov (United States)

    Gavin, W; Blash, S; Buzzell, N; Pollock, D; Chen, L; Hawkins, N; Howe, J; Miner, K; Pollock, J; Porter, C; Schofield, M; Echelard, Y; Meade, H

    2018-02-01

    Production of transgenic founder goats involves introducing and stably integrating an engineered piece of DNA into the genome of the animal. At LFB USA, the ultimate use of these transgenic goats is for the production of recombinant human protein therapeutics in the milk of these dairy animals. The transgene or construct typically links a milk protein specific promoter sequence, the coding sequence for the gene of interest, and the necessary downstream regulatory sequences thereby directing expression of the recombinant protein in the milk during the lactation period. Over the time period indicated (1995-2012), pronuclear microinjection was used in a number of programs to insert transgenes into 18,120, 1- or 2- cell stage fertilized embryos. These embryos were transferred into 4180 synchronized recipient females with 1934 (47%) recipients becoming pregnant, 2594 offspring generated, and a 109 (4.2%) of those offspring determined to be transgenic. Even with new and improving genome editing tools now available, pronuclear microinjection is still the predominant and proven technology used in this commercial setting supporting regulatory filings and market authorizations when producing founder transgenic animals with large transgenes (> 10 kb) such as those necessary for directing monoclonal antibody production in milk.

  16. Transgenic rice plants expressing synthetic cry2AX1 gene exhibits resistance to rice leaffolder (Cnaphalocrosis medinalis).

    Science.gov (United States)

    Manikandan, R; Balakrishnan, N; Sudhakar, D; Udayasuriyan, V

    2016-06-01

    Bacillus thuringiensis is a major source of insecticidal genes imparting insect resistance in transgenic plants. Level of expression of transgenes in transgenic plants is important to achieve desirable level of resistance against target insects. In order to achieve desirable level of expression, rice chloroplast transit peptide sequence was fused with synthetic cry2AX1 gene to target its protein in chloroplasts. Sixteen PCR positive lines of rice were generated by Agrobacterium mediated transformation using immature embryos. Southern blot hybridization analysis of T 0 transgenic plants confirmed the integration of cry2AX1 gene in two to five locations of rice genome and ELISA demonstrated its expression. Concentration of Cry2AX1 in transgenic rice events ranged 5.0-120 ng/g of fresh leaf tissue. Insect bioassay of T 0 transgenic rice plants against neonate larvae of rice leaffolder showed larval mortality ranging between 20 and 80 % in comparison to control plant. Stable inheritance and expression of cry2AX1 gene was demonstrated in T 1 progenies through Southern and ELISA. In T 1 progenies, the highest concentration of Cry2AX1 and mortality of rice leaffolder larvae were recorded as 150 ng/g of fresh leaf tissue and 80 %, respectively. The Cry2AX1 expression even at a very low concentration (120-150 ng/g) in transgenic rice plants was found effective against rice leaffolder larvae.

  17. Overexpression of rice thaumatin-like protein (Ostlp gene in transgenic cassava results in enhanced tolerance to Colletotrichum gloeosporioides f. sp. manihotis

    Directory of Open Access Journals (Sweden)

    Patroba Odeny Ojola

    2018-06-01

    Full Text Available Cassava (Manihot esculenta Crantz is the most important staple food for more than 300 million people in Africa, and anthracnose disease caused by Colletotrichum gloeosporioides f. sp. manihotis is the most destructive fungal disease affecting cassava production in sub-Saharan Africa. The main objective of this study was to improve anthracnose resistance in cassava through genetic engineering. Transgenic cassava plants harbouring rice thaumatin-like protein (Ostlp gene, driven by the constitutive CaMV35S promoter, were generated using Agrobacterium-mediated transformation of friable embryogenic calli (FEC of cultivar TMS 60444. Molecular analysis confirmed the presence, integration, copy number of the transgene all the independent transgenic events. Semi-quantitative RT-PCR confirmed high expression levels of Ostlp in six transgenic lines tested. The antifungal activity of the transgene against Colletotrichum gloeosporioides pathogen was evaluated using the leaves and stem cuttings bioassay. The results demonstrated significantly delayed disease development and reduced size of necrotic lesions in leaves and stem cuttings of all transgenic lines compared to the leaves and stem cuttingss of non-transgenic control plants. Therefore, constitutive overexpression of rice thaumatin-like protein in transgenic cassava confers enhanced tolerance to the fungal pathogen C. gloeosporioides f. sp. manihotis. These results can therefore serve as an initial step towards genetic engineering of farmer-preffered cassava cultivars for resistance to anthracnose disease. Keywords: Colletotrichum gloeosporioides f. sp. manihotis, Thaumatin-like protein, Transgenic cassava

  18. Creating Transgenic shRNA Mice by Recombinase-Mediated Cassette Exchange

    Science.gov (United States)

    Premsrirut, Prem K.; Dow, Lukas E.; Park, Youngkyu; Hannon, Gregory J.; Lowe, Scott W.

    2014-01-01

    RNA interference (RNAi) enables sequence-specific, experimentally induced silencing of virtually any gene by tapping into innate regulatory mechanisms that are conserved among most eukaryotes. The principles that enable transgenic RNAi in cell lines can also be used to create transgenic animals, which express short-hairpin RNAs (shRNAs) in a regulated or tissue-specific fashion. However, RNAi in transgenic animals is somewhat more challenging than RNAi in cultured cells. The activities of promoters that are commonly used for shRNA expression in cell culture can vary enormously in different tissues, and founder lines also typically vary in transgene expression due to the effects of their single integration sites. There are many ways to produce mice carrying shRNA transgenes and the method described here uses recombinase-mediated cassette exchange (RMCE). RMCE permits insertion of the shRNA transgene into a well-characterized locus that gives reproducible and predictable expression in each founder and enhances the probability of potent expression in many cell types. This procedure is more involved and complex than simple pronuclear injection, but if even a few shRNA mice are envisioned, for example, to probe the functions of several genes, the effort of setting up the processes outlined below are well worthwhile. Note that when creating a transgenic mouse, one should take care to use the most potent shRNA possible. As a rule of thumb, the sequence chosen should provide >90% knockdown when introduced into cultured cells at single copy (e.g., on retroviral infection at a multiplicity of ≤0.3). PMID:24003198

  19. Red rot resistant transgenic sugarcane developed through expression of β-1,3-glucanase gene.

    Directory of Open Access Journals (Sweden)

    Shivani Nayyar

    Full Text Available Sugarcane (Saccharum spp. is a commercially important crop, vulnerable to fungal disease red rot caused by Colletotrichum falcatum Went. The pathogen attacks sucrose accumulating parenchyma cells of cane stalk leading to severe losses in cane yield and sugar recovery. We report development of red rot resistant transgenic sugarcane through expression of β-1,3-glucanase gene from Trichoderma spp. The transgene integration and its expression were confirmed by quantitative reverse transcription-PCR in first clonal generation raised from T0 plants revealing up to 4.4-fold higher expression, in comparison to non-transgenic sugarcane. Bioassay of transgenic plants with two virulent C. falcatum pathotypes, Cf 08 and Cf 09 causing red rot disease demonstrated that some plants were resistant to Cf 08 and moderately resistant to Cf 09. The electron micrographs of sucrose storing stalk parenchyma cells from these plants displayed characteristic sucrose-filled cells inhibiting Cf 08 hyphae and lysis of Cf 09 hyphae; in contrast, the cells of susceptible plants were sucrose depleted and prone to both the pathotypes. The transgene expression was up-regulated (up to 2.0-fold in leaves and 5.0-fold in roots after infection, as compared to before infection in resistant plants. The transgene was successfully transmitted to second clonal generation raised from resistant transgenic plants. β-1,3-glucanase protein structural model revealed that active sites Glutamate 628 and Aspartate 569 of the catalytic domain acted as proton donor and nucleophile having role in cleaving β-1,3-glycosidic bonds and pathogen hyphal lysis.

  20. Immediate therapist self-disclosure bolsters the effect of brief integrative psychotherapy on psychiatric symptoms and the perceptions of therapists: A randomized clinical trial.

    Science.gov (United States)

    Ziv-Beiman, Sharon; Keinan, Giora; Livneh, Elad; Malone, Patrick S; Shahar, Golan

    2017-09-01

    We report a first randomized clinical trial examining the effect of immediate and non-immediate therapist self-disclosure in the context of a brief integrative psychotherapy for mild to moderate distress. A total of 86 patients with mild to moderate forms of distress were randomly divided into three 12-session integrative psychotherapy conditions based primarily on [Hill, C. E. (2009). Helping skills: Facilitating, exploration, insight, and action (3rd ed.). Washington, DC: American Psychological Association.] three-stage model. Therapists trained in this treatment modality were instructed to use either immediate self-disclosure (expressing feelings towards the patient/treatment/therapeutic relationship) or non-immediate self-disclosure (expressing personal or factual information regarding the therapist's life outside the treatment). In the comparison condition, the therapists were instructed to refrain from self-disclosure altogether. Immediate therapist self-disclosure reduced psychiatric symptoms among patients with elevated pretreatment symptoms (as assessed by the Brief Symptoms Inventory) and bolstered a favorable perception of the therapist. Therapists in both the immediate and non-immediate self-disclosure group evaluated themselves more favorably than their counterparts in the non-disclosure group. Therapist self-disclosure, particularly of the immediate type, might enhance the effect of brief integrative treatment on psychiatric symptoms of high symptomatic patients and contribute to favorable perception of therapists.

  1. Evaluation of an integrated treatment for active duty service members with comorbid posttraumatic stress disorder and major depressive disorder: Study protocol for a randomized controlled trial.

    Science.gov (United States)

    Walter, Kristen H; Glassman, Lisa H; Michael Hunt, W; Otis, Nicholas P; Thomsen, Cynthia J

    2018-01-01

    Posttraumatic stress disorder (PTSD) commonly co-occurs with major depressive disorder (MDD) in both civilian and military/veteran populations. Existing, evidence-based PTSD treatments, such as cognitive processing therapy (CPT), often reduce symptoms of both PTSD and depression; however, findings related to the influence of comorbid MDD on PTSD treatment outcomes are mixed, and few studies use samples of individuals with both conditions. Behavioral activation (BA), an approach that relies on behavioral principles, is an effective treatment for depression. We have integrated BA into CPT (BA+CPT), a more cognitive approach, to address depressive symptoms among active duty service members with both PTSD and comorbid MDD. We describe an ongoing randomized controlled trial investigating the efficacy of our innovative, integrated BA+CPT intervention, compared with standard CPT, for active duty service members with PTSD and comorbid MDD. We detail the development of this integrated treatment, as well as the design and implementation of the randomized controlled trial, to evaluate its effect on symptoms. Copyright © 2017 Elsevier Inc. All rights reserved.

  2. 'Integration'

    DEFF Research Database (Denmark)

    Olwig, Karen Fog

    2011-01-01

    , while the countries have adopted disparate policies and ideologies, differences in the actual treatment and attitudes towards immigrants and refugees in everyday life are less clear, due to parallel integration programmes based on strong similarities in the welfare systems and in cultural notions...... of equality in the three societies. Finally, it shows that family relations play a central role in immigrants’ and refugees’ establishment of a new life in the receiving societies, even though the welfare society takes on many of the social and economic functions of the family....

  3. Protocol for a randomized comparison of integrated versus consecutive dual task practice in Parkinson's disease: the DUALITY trial

    NARCIS (Netherlands)

    Strouwen, C.; Molenaar, E.A.L.M.; Keus, S.H.J.; Munks, L.; Munneke, M.; Vandenberghe, W.; Bloem, B.R.; Nieuwboer, A.

    2014-01-01

    BACKGROUND: Multiple tasking is an integral part of daily mobility. Patients with Parkinson's disease have dual tasking difficulties due to their combined motor and cognitive deficits. Two contrasting physiotherapy interventions have been proposed to alleviate dual tasking difficulties: either to

  4. Development of transgenic finger millet (Eleusine coracana (L.) Gaertn.) resistant to leaf blast disease.

    Science.gov (United States)

    Ignacimuthu, S; Ceasar, S Antony

    2012-03-01

    Finger millet plants conferring resistance to leaf blast disease have been developed by inserting a rice chitinase (chi11) gene through Agrobacterium-mediated transformation. Plasmid pHyg-Chi.11 harbouring the rice chitinase gene under the control of maize ubiquitin promoter was introduced into finger millet using Agrobacterium strain LBA4404 (pSB1). Transformed plants were selected and regenerated on hygromycin-supplemented medium. Transient expression of transgene was confirmed by GUS histochemical staining. The incorporation of rice chitinase gene in R0 and R1 progenies was confirmed by PCR and Southern blot analyses. Expression of chitinase gene in finger millet was confirmed by Western blot analysis with a barley chitinase antibody. A leaf blast assay was also performed by challenging the transgenic plants with spores of Pyricularia grisea. The frequency of transient expression was 16.3% to 19.3%. Stable frequency was 3.5% to 3.9%. Southern blot analysis confirmed the integration of 3.1 kb chitinase gene. Western blot analysis detected the presence of 35 kDa chitinase enzyme. Chitinase activity ranged from 19.4 to 24.8. In segregation analysis, the transgenic R1 lines produced three resistant and one sensitive for hygromycin, confirming the normal Mendelian pattern of transgene segregation. Transgenic plants showed high level of resistance to leaf blast disease compared to control plants. This is the first study reporting the introduction of rice chitinase gene into finger millet for leaf blast resistance.

  5. Cell suspension culture-mediated incorporation of the rice bel gene into transgenic cotton.

    Directory of Open Access Journals (Sweden)

    Liping Ke

    Full Text Available Cotton plants engineered for resistance to the herbicides, glyphosate or glufosinate have made a considerable impact on the production of the crop worldwide. In this work, embryogenic cell cultures derived from Gossypium hirsutum L. cv Coker 312 hypocotyl callus were transformed via Agrobacterium tumefaciens with the rice cytochrome P450 gene, CYP81A6 (bel. In rice, bel has been shown to confer resistance to both bentazon and sulfanylurea herbicides. Transformed cells were selected on a liquid medium supplemented alternately or simultaneously with kanamycin (50mg/L and bentazon (4.2 µmol. A total of 17 transgenic cotton lines were recovered, based on the initial resistance to bentazon and on PCR detection of the bel transgene. Bel integration into the cotton genome was confirmed by Southern blot and expression of the transgene was verified by RT-PCR. In greenhouse and experimental plot trials, herbicide (bentazon tolerance of up to 1250 mg/L was demonstrated in the transgenic plants. Transgenic lines with a single copy of the bel gene showed normal Mendelian inheritance of the characteristic. Importantly, resistance to bentazon was shown to be stably incorporated in the T1, T2 and T3 generations of self-fertilised descendents and in plants outcrossed to another upland cotton cultivar. Engineering resistance to bentazon in cotton through the heterologous expression of bel opens the possibility of incorporating this trait into elite cultivars, a strategy that would give growers a more flexible alternative to weed management in cotton crops.

  6. Marker Removal in Transgenic Plants Using Cre Recombinase Delivered with Potato Virus X.

    Science.gov (United States)

    Kopertekh, Lilya; Schiemann, Joachim

    2017-01-01

    In this chapter we present an alternative method to develop marker-free transgenic plants. It makes use of the Cre/loxP recombination system from bacteriophage P1 and consists of two essential components. The first component is the transgenic plant containing a loxP-flanked marker gene. The second component is a cre transient expression vector based on potato virus X. The great benefit of this transient delivery method consists in the avoidance of stable integration of the cre recombinase gene into the plant genome. Upon infection of the loxP-target plant with PVX-Cre, the virus spreads systemically through the plant and causes the recombinase-mediated excision of the marker gene. Marker-free transgenic loci can be transmitted to the progeny by plant regeneration from PVX-Cre systemically infected leaves or self-pollination of virus-infected plants. The protocol covers generation of loxP-target transgenic plants, PVX-mediated delivery of Cre recombinase protein, phenotypic and molecular analysis of recombination events, and transmission of marker-free transgenic loci to the next generation. The transient expression system described in this chapter can be adapted for marker gene removal in other plant species that are amenable for virus infection.

  7. Enhanced resistance to stripe rust disease in transgenic wheat expressing the rice chitinase gene RC24.

    Science.gov (United States)

    Huang, Xuan; Wang, Jian; Du, Zhen; Zhang, Chen; Li, Lan; Xu, Ziqin

    2013-10-01

    Stripe rust is a devastating fungal disease of wheat worldwide which is primarily caused by Puccinia striiformis f. sp tritici. Transgenic wheat (Triticum aestivum L.) expressing rice class chitinase gene RC24 were developed by particle bombardment of immature embryos and tested for resistance to Puccinia striiformis f.sp tritici. under greenhouse and field conditions. Putative transformants were selected on kanamycin-containing media. Polymease chain reaction indicated that RC24 was transferred into 17 transformants obtained from bombardment of 1,684 immature embryos. Integration of RC24 was confirmed by Southern blot with a RC24-labeled probe and expression of RC24 was verified by RT-PCR. Nine transgenic T1 lines exhibited enhanced resistance to stripe rust infection with lines XN8 and BF4 showing the highest level of resistance. Southern blot hybridization confirmed the stable inheritance of RC24 in transgenic T1 plants. Resistance to stripe rust in transgenic T2 and T3 XN8 and BF4 plants was confirmed over two consecutive years in the field. Increased yield (27-36 %) was recorded for transgenic T2 and T3 XN8 and BF4 plants compared to controls. These results suggest that rice class I chitinase RC24 can be used to engineer stripe rust resistance in wheat.

  8. The ecological risks of transgenic plants.

    Science.gov (United States)

    Giovannetti, Manuela

    2003-01-01

    Biotechnologies have been utilized "ante litteram" for thousands of years to produce food and drink and genetic engineering techniques have been widely applied to produce many compounds for human use, from insulin to other medicines. The debate on genetically modified (GM) organisms broke out all over the world only when GM crops were released into the field. Plant ecologists, microbiologists and population geneticists carried out experiments aimed at evaluating the environmental impact of GM crops. The most significant findings concern: the spread of transgenes through GM pollen diffusion and its environmental impact after hybridisation with closely related wild species or subspecies; horizontal gene transfer from transgenic plants to soil microbes; the impact of insecticide proteins released into the soil by transformed plants on non-target microbial soil communities. Recent developments in genetic engineering produced a technology, dubbed "Terminator", which protects patented genes introduced in transgenic plants by killing the seeds in the second generation. This genetic construct, which interferes so heavily with fundamental life processes, is considered dangerous and should be ex-ante evaluated taking into account the data on "unexpected events", as here discussed, instead of relying on the "safe until proven otherwise" claim. Awareness that scientists, biotechnologists and genetic engineers cannot answer the fundamental question "how likely is that transgenes will be transferred from cultivated plants into the natural environment?" should foster long-term studies on the ecological risks and benefits of transgenic crops.

  9. The Study of HIV and Antenatal Care Integration in Pregnancy in Kenya: Design, Methods, and Baseline Results of a Cluster-Randomized Controlled Trial

    Science.gov (United States)

    Turan, Janet M.; Steinfeld, Rachel L.; Onono, Maricianah; Bukusi, Elizabeth A.; Woods, Meghan; Shade, Starley B.; Washington, Sierra; Marima, Reson; Penner, Jeremy; Ackers, Marta L.; Mbori-Ngacha, Dorothy; Cohen, Craig R.

    2012-01-01

    Background Despite strong evidence for the effectiveness of anti-retroviral therapy for improving the health of women living with HIV and for the prevention of mother-to-child transmission (PMTCT), HIV persists as a major maternal and child health problem in sub-Saharan Africa. In most settings antenatal care (ANC) services and HIV treatment services are offered in separate clinics. Integrating these services may result in better uptake of services, reduction of the time to treatment initiation, better adherence, and reduction of stigma. Methodology/Principal Findings A prospective cluster randomized controlled trial design was used to evaluate the effects of integrating HIV treatment into ANC clinics at government health facilities in rural Kenya. Twelve facilities were randomized to provide either fully integrated services (ANC, PMTCT, and HIV treatment services all delivered in the ANC clinic) or non-integrated services (ANC clinics provided ANC and basic PMTCT services and referred clients to a separate HIV clinic for HIV treatment). During June 2009– March 2011, 1,172 HIV-positive pregnant women were enrolled in the study. The main study outcomes are rates of maternal enrollment in HIV care and treatment, infant HIV testing uptake, and HIV-free infant survival. Baseline results revealed that the intervention and control cohorts were similar with respect to socio-demographics, male partner HIV testing, sero-discordance of the couple, obstetric history, baseline CD4 count, and WHO Stage. Challenges faced while conducting this trial at low-resource rural health facilities included frequent staff turnover, stock-outs of essential supplies, transportation challenges, and changes in national guidelines. Conclusions/Significance This is the first randomized trial of ANC and HIV service integration to be conducted in rural Africa. It is expected that the study will provide critical evidence regarding the implementation and effectiveness of this service delivery

  10. The study of HIV and antenatal care integration in pregnancy in Kenya: design, methods, and baseline results of a cluster-randomized controlled trial.

    Directory of Open Access Journals (Sweden)

    Janet M Turan

    Full Text Available Despite strong evidence for the effectiveness of anti-retroviral therapy for improving the health of women living with HIV and for the prevention of mother-to-child transmission (PMTCT, HIV persists as a major maternal and child health problem in sub-Saharan Africa. In most settings antenatal care (ANC services and HIV treatment services are offered in separate clinics. Integrating these services may result in better uptake of services, reduction of the time to treatment initiation, better adherence, and reduction of stigma.A prospective cluster randomized controlled trial design was used to evaluate the effects of integrating HIV treatment into ANC clinics at government health facilities in rural Kenya. Twelve facilities were randomized to provide either fully integrated services (ANC, PMTCT, and HIV treatment services all delivered in the ANC clinic or non-integrated services (ANC clinics provided ANC and basic PMTCT services and referred clients to a separate HIV clinic for HIV treatment. During June 2009- March 2011, 1,172 HIV-positive pregnant women were enrolled in the study. The main study outcomes are rates of maternal enrollment in HIV care and treatment, infant HIV testing uptake, and HIV-free infant survival. Baseline results revealed that the intervention and control cohorts were similar with respect to socio-demographics, male partner HIV testing, sero-discordance of the couple, obstetric history, baseline CD4 count, and WHO Stage. Challenges faced while conducting this trial at low-resource rural health facilities included frequent staff turnover, stock-outs of essential supplies, transportation challenges, and changes in national guidelines.This is the first randomized trial of ANC and HIV service integration to be conducted in rural Africa. It is expected that the study will provide critical evidence regarding the implementation and effectiveness of this service delivery strategy, with important implications for programs striving

  11. Studies of the LBL CMOS integrated amplifier/discriminator for randomly timed inputs from fixed target experiments

    International Nuclear Information System (INIS)

    Russ, J.S.; Yarema, R.J.; Zimmerman, T.

    1988-12-01

    A group at Lawrence Berkeley Laboratory has reported an elegant CMOS VLSI circuit for amplifying, discriminating, and encoding the signals from highly-segmented charge output devices, e.g., silicon strip detectors or pad readout structures in gaseous detectors. The design exploits switched capacitor circuits and the well-known time structure of data acquisition in colliding beam accelerators to cancel leakage effects and switching noise. For random inputs, these methods are not directly applicable. However, the high speed of the reset switches makes possible a mode of operation for fixed target experiments that uses fast resets to erase unwanted data from random triggers. Data acquisition in this mode has been performed. Details of operation and measurements of noise and rate capability will be presented. 8 refs., 6 figs

  12. Integrated care for comorbid alcohol dependence and anxiety and/or depressive disorder: study protocol for an assessor-blind, randomized controlled trial.

    Science.gov (United States)

    Morley, Kirsten C; Baillie, Andrew; Sannibale, Claudia; Teesson, Maree; Haber, Paul S

    2013-11-19

    A major barrier to successful treatment in alcohol dependence is psychiatric comorbidity. During treatment, the time to relapse is shorter, the drop-out rate is increased, and long-term alcohol consumption is greater for those with comorbid major depression or anxiety disorder than those with an alcohol use disorder with no comorbid mental disorder. The treatment of alcohol dependence and psychological disorders is often the responsibility of different services, and this can hinder the treatment process. Accordingly, there is a need for an effective integrated treatment for alcohol dependence and comorbid anxiety and/or depression. We aim to assess the effectiveness of a specialized, integrated intervention for alcohol dependence with comorbid anxiety and/or mood disorder using a randomized design in an outpatient hospital setting. Following a three-week stabilization period (abstinence or significantly reduced consumption), participants will undergo complete formal assessment for anxiety and depression. Those patients with a diagnosis of an anxiety and/or depressive disorder will be randomized to either 1) integrated intervention (cognitive behavioral therapy) for alcohol, anxiety, and/or depression; or 2) usual counseling care for alcohol problems. Patients will then be followed up at weeks 12, 16, and 24. The primary outcome measure is alcohol consumption (total abstinence, time to lapse, and time to relapse). Secondary outcome measures include changes in alcohol dependence severity, depression, or anxiety symptoms and changes in clinician-rated severity of anxiety and depression. The study findings will have potential implications for clinical practice by evaluating the implementation of specialized integrated treatment for comorbid anxiety and/or depression in an alcohol outpatient service. ClinicalTrials.gov Identifier: NCT01941693.

  13. Toxins for Transgenic Resistance to Hemipteran Pests

    Science.gov (United States)

    Chougule, Nanasaheb P.; Bonning, Bryony C.

    2012-01-01

    The sap sucking insects (Hemiptera), which include aphids, whiteflies, plant bugs and stink bugs, have emerged as major agricultural pests. The Hemiptera cause direct damage by feeding on crops, and in some cases indirect damage by transmission of plant viruses. Current management relies almost exclusively on application of classical chemical insecticides. While the development of transgenic crops expressing toxins derived from the bacterium Bacillus thuringiensis (Bt) has provided effective plant protection against some insect pests, Bt toxins exhibit little toxicity against sap sucking insects. Indeed, the pest status of some Hemiptera on Bt-transgenic plants has increased in the absence of pesticide application. The increased pest status of numerous hemipteran species, combined with increased prevalence of resistance to chemical insecticides, provides impetus for the development of biologically based, alternative management strategies. Here, we provide an overview of approaches toward transgenic resistance to hemipteran pests. PMID:22822455

  14. Integrating support vector machines and random forests to classify crops in time series of Worldview-2 images

    Science.gov (United States)

    Zafari, A.; Zurita-Milla, R.; Izquierdo-Verdiguier, E.

    2017-10-01

    Crop maps are essential inputs for the agricultural planning done at various governmental and agribusinesses agencies. Remote sensing offers timely and costs efficient technologies to identify and map crop types over large areas. Among the plethora of classification methods, Support Vector Machine (SVM) and Random Forest (RF) are widely used because of their proven performance. In this work, we study the synergic use of both methods by introducing a random forest kernel (RFK) in an SVM classifier. A time series of multispectral WorldView-2 images acquired over Mali (West Africa) in 2014 was used to develop our case study. Ground truth containing five common crop classes (cotton, maize, millet, peanut, and sorghum) were collected at 45 farms and used to train and test the classifiers. An SVM with the standard Radial Basis Function (RBF) kernel, a RF, and an SVM-RFK were trained and tested over 10 random training and test subsets generated from the ground data. Results show that the newly proposed SVM-RFK classifier can compete with both RF and SVM-RBF. The overall accuracies based on the spectral bands only are of 83, 82 and 83% respectively. Adding vegetation indices to the analysis result in the classification accuracy of 82, 81 and 84% for SVM-RFK, RF, and SVM-RBF respectively. Overall, it can be observed that the newly tested RFK can compete with SVM-RBF and RF classifiers in terms of classification accuracy.

  15. 27-GAUGE VITRECTOMY WOUND INTEGRITY: A Randomized Pilot Study Comparing Angled Versus Straight Entry in Fluid-Filled Vitrectomized Eyes.

    Science.gov (United States)

    Khan, M Ali; Durrani, Alia K; Hsu, Jason; Regillo, Carl D

    2018-04-01

    To compare clinical outcomes using angled versus straight trocar insertion during 27-gauge pars plana vitrectomy for epiretinal membrane. Pilot randomized controlled trial. Thirty eyes of 30 patients undergoing 27-gauge pars plana vitrectomy with membrane peeling for epiretinal membrane were randomized 1:1 to receive angled or straight trocar insertion. Intraocular pressure (IOP) and postoperative wound-related complications were compared. Fifteen eyes were randomized to each the angled and straight incision groups. No significant difference in phakic status (P = 0.71) or preoperative IOP (15.1 ± 3.4 vs. 14.6 ± 3.0 mmHg, P = 0.67) existed between groups. On postoperative Day 1, eyes in the straight group had lower IOP compared with the angled group (11.8 ± 3.9 vs. 15.3 ± 5.2 mmHg, P = 0.04) and a relative decrease in IOP compared with preoperative values (11.8 ± 3.9 vs. 15.1 ± 3.4 mmHg, P straight group) and serous choroidal detachment (1 eye, angled group). Eyes with straight incisions had transiently lower IOP on postoperative Day 1, possibly suggestive of subclinical wound leak in the very early postoperative period. Overall, rates of hypotony and sclerotomy-related complications were similarly low between wound construction strategies.

  16. Expression of the Native Cholera Toxin B Subunit Gene and Assembly as Functional Oligomers in Transgenic Tobacco Chloroplasts

    Science.gov (United States)

    Daniell, Henry; Lee, Seung-Bum; Panchal, Tanvi; Wiebe, Peter O.

    2012-01-01

    The B subunits of enterotoxigenic Escherichia coli (LTB) and cholera toxin of Vibrio cholerae (CTB) are candidate vaccine antigens. Integration of an unmodified CTB-coding sequence into chloroplast genomes (up to 10,000 copies per cell), resulted in the accumulation of up to 4.1% of total soluble tobacco leaf protein as functional oligomers (410-fold higher expression levels than that of the unmodified LTB gene expressed via the nuclear genome). However, expresssion levels reported are an underestimation of actual accumulation of CTB in transgenic chloroplasts, due to aggregation of the oligomeric forms in unboiled samples similar to the aggregation observed for purified bacterial antigen. PCR and Southern blot analyses confirmed stable integration of the CTB gene into the chloroplast genome. Western blot analysis showed that the chloroplast-synthesized CTB assembled into oligomers and were antigenically identical with purified native CTB. Also, binding assays confirmed that chloroplast- synthesized CTB binds to the intestinal membrane GM1-ganglioside receptor, indicating correct folding and disulfide bond formation of CTB pentamers within transgenic chloroplasts. In contrast to stunted nuclear transgenic plants, chloroplast transgenic plants were morphologically indistinguishable from untransformed plants, when CTB was constitutively expressed in chloroplasts. Introduced genes were inherited stably in subsequent generations, as confirmed by PCR and Southern blot analyses. Increased production of an efficient transmucosal carrier molecule and delivery system, like CTB, in transgenic chloroplasts makes plant-based oral vaccines and fusion proteins with CTB needing oral administration commercially feasible. Successful expression of foreign genes in transgenic chromoplasts and availability of marker-free chloroplast transformation techniques augurs well for development of vaccines in edible parts of transgenic plants. Furthermore, since the quaternary structure of

  17. Vector-free and transgene-free human iPS cells differentiate into functional neurons and enhance functional recovery after ischemic stroke in mice.

    Directory of Open Access Journals (Sweden)

    Osama Mohamad

    Full Text Available Stroke is a leading cause of human death and disability in the adult population in the United States and around the world. While stroke treatment is limited, stem cell transplantation has emerged as a promising regenerative therapy to replace or repair damaged tissues and enhance functional recovery after stroke. Recently, the creation of induced pluripotent stem (iPS cells through reprogramming of somatic cells has revolutionized cell therapy by providing an unlimited source of autologous cells for transplantation. In addition, the creation of vector-free and transgene-free human iPS (hiPS cells provides a new generation of stem cells with a reduced risk of tumor formation that was associated with the random integration of viral vectors seen with previous techniques. However, the potential use of these cells in the treatment of ischemic stroke has not been explored. In the present investigation, we examined the neuronal differentiation of vector-free and transgene-free hiPS cells and the transplantation of hiPS cell-derived neural progenitor cells (hiPS-NPCs in an ischemic stroke model in mice. Vector-free hiPS cells were maintained in feeder-free and serum-free conditions and differentiated into functional neurons in vitro using a newly developed differentiation protocol. Twenty eight days after transplantation in stroke mice, hiPS-NPCs showed mature neuronal markers in vivo. No tumor formation was seen up to 12 months after transplantation. Transplantation of hiPS-NPCs restored neurovascular coupling, increased trophic support and promoted behavioral recovery after stroke. These data suggest that using vector-free and transgene-free hiPS cells in stem cell therapy are safe and efficacious in enhancing recovery after focal ischemic stroke in mice.

  18. Transgenic cultures: from the economic viewpoint

    Directory of Open Access Journals (Sweden)

    Mauricio Mosquera

    2001-01-01

    Full Text Available The introduction of transgenic seeds for agricultural purposes poses modification to their production, due to the potential for reaching desired characteristics such as greater yield, this being fundamental in an economic environment characterised by open market conditions. However, acceptance of products resulting from genetic engineering is far from becoming a simple process; discussion relating to the predominance of private sector interests, the monopoly of knowledge and the safety of such seeds/food is currently in the spotlight. This article presents the main points of debate regarding adoption of transgenic cultures, contributing to discussion about this topic for Colombia.

  19. Generation of BAC transgenic epithelial organoids.

    Directory of Open Access Journals (Sweden)

    Gerald Schwank

    Full Text Available Under previously developed culture conditions, mouse and human intestinal epithelia can be cultured and expanded over long periods. These so-called organoids recapitulate the three-dimensional architecture of the gut epithelium, and consist of all major intestinal cell types. One key advantage of these ex vivo cultures is their accessibility to live imaging. So far the establishment of transgenic fluorescent reporter organoids has required the generation of transgenic mice, a laborious and time-consuming process, which cannot be extended to human cultures. Here we present a transfection protocol that enables the generation of recombinant mouse and human reporter organoids using BAC (bacterial artificial chromosome technology.

  20. Use of the viral 2A peptide for bicistronic expression in transgenic mice

    Directory of Open Access Journals (Sweden)

    Trichas Georgios

    2008-09-01

    that the transgene has integrated into the X chromosome in this line. Conclusion The 2A peptide efficiently mediates co-translational cleavage in transgenic mice in which it has been inherited through the germ-line. Mice expressing it ubiquitously throughout development and into adulthood appear normal. It is therefore a viable tool for use in genetically engineered mice and represents a superior alternative to the widely used internal ribosomal entry site.

  1. Randomized trial of the effect of an integrative medicine approach to the management of asthma in adults on disease-related quality of life and pulmonary function.

    Science.gov (United States)

    Kligler, Benjamin; Homel, Peter; Blank, Arthur E; Kenney, Jeanne; Levenson, Hanniel; Merrell, Woodson

    2011-01-01

    The purpose of this study was to test the effectiveness of an integrative medicine approach to the management of asthma compared to standard clinical care on quality of life (QOL) and clinical outcomes. This was a prospective parallel group repeated measurement randomized design. Participants were adults aged 18 to 80 years with asthma. The intervention consisted of six group sessions on the use of nutritional manipulation, yoga techniques, and journaling. Participants also received nutritional supplements: fish oil, vitamin C, and a standardized hops extract. The control group received usual care. Primary outcome measures were the Asthma Quality of Life Questionnaire (AQLQ), The Medical Outcomes Study Short Form-12 (SF-12), and standard pulmonary function tests (PFTs). In total, 154 patients were randomized and included in the intention-to-treat analysis (77 control, 77 treatment). Treatment participants showed greater improvement than controls at 6 months for the AQLQ total score (PMental health (P= .003 and .02, respectively). There was no change in PFTs in either group. A low-cost group-oriented integrative medicine intervention can lead to significant improvement in QOL in adults with asthma.

  2. Lectin cDNA and transgenic plants derived therefrom

    Science.gov (United States)

    Raikhel, Natasha V.

    2000-10-03

    Transgenic plants containing cDNA encoding Gramineae lectin are described. The plants preferably contain cDNA coding for barley lectin and store the lectin in the leaves. The transgenic plants, particularly the leaves exhibit insecticidal and fungicidal properties.

  3. A community-engaged randomized controlled trial of an integrative intervention with HIV-positive, methamphetamine-using men who have sex with men

    Directory of Open Access Journals (Sweden)

    Adam W. Carrico

    2016-07-01

    Full Text Available Abstract Background Contingency management (CM is an evidence-based intervention providing tangible rewards as positive reinforcement for abstinence from stimulants such as methamphetamine. Integrative approaches targeting affect regulation could boost the effectiveness of CM in community-based settings and optimize HIV/AIDS prevention efforts. Methods/Design This randomized controlled trial with HIV-positive, methamphetamine-using men who have sex with men (MSM is examining the efficacy of a 5-session, individually delivered positive affect regulation intervention – Affect Regulation Treatment to Enhance Methamphetamine Intervention Success (ARTEMIS. ARTEMIS is designed to sensitize individuals to non-drug-related sources of reward as well as assist with managing depression and other symptoms of stimulant withdrawal during CM. HIV-positive, methamphetamine-using MSM who are enrolled in a community-based, 12-week CM program are randomized to receive ARTEMIS or an attention-matched control condition. Follow-up assessments are conducted at 3, 6, 12, and 15 months after enrollment in CM. Four peripheral venous blood samples are collected over the 15-month follow-up with specimen banking for planned biomarker sub-studies. The primary outcome is mean HIV viral load. Secondary outcomes include: sustained HIV viral suppression, T-helper cell count, psychological adjustment, stimulant use, and potentially amplified transmission risk behavior. Discussion Implementation of this randomized controlled trial highlights the importance of delineating boundaries between research activities and community-based service provision. It also provides insights into best practices for integrating the distinct agendas of academic and community partners in clinical research. This trial is currently enrolling and data collection is anticipated to be completed in September of 2018. Trial registration This trial was registered on clinicaltrials.gov ( NCT01926184 on

  4. Systematic Review of Integrative Health Care Research: Randomized Control Trials, Clinical Controlled Trials, and Meta-Analysis

    OpenAIRE

    Khorsan, Raheleh; Coulter, Ian D.; Crawford, Cindy; Hsiao, An-Fu

    2010-01-01

    A systematic review was conducted to assess the level of evidence for integrative health care research. We searched PubMed, Allied and Complementary Medicine (AMED), BIOSIS Previews, EMBASE, the entire Cochrane Library, MANTIS, Social SciSearch, SciSearch Cited Ref Sci, PsychInfo, CINAHL, and NCCAM grantee publications listings, from database inception to May 2009, as well as searches of the “gray literature.” Available studies published in English language were included. Three independent re...

  5. IDENTIFICATION OF ESCAPED TRANSGENIC CREEPING BENTGRASS IN OREGON

    Science.gov (United States)

    When transgenic plants are cultivated near wild species that are sexually compatible with the crop, gene flow between the crop and wild plants is possible. A resultant concern is that transgene flow and transgene introgression within wild populations could have unintended ecologi...

  6. Effect of an integrated approach of yoga therapy on quality of life in osteoarthritis of the knee joint: A randomized control study

    Directory of Open Access Journals (Sweden)

    John Ebnezar

    2011-01-01

    Full Text Available Aim: This study was designed to evaluate the efficacy of addition of integrated yoga therapy to therapeutic exercises in osteoarthritis (OA of knee joints. Materials and Methods: This was a prospective randomized active control trial. A total of t participants with OA of knee joints between 35 and 80 years (yoga, 59.56 ± 9.54 and control, 59.42 ± 10.66 from the outpatient department of Dr. John′s Orthopedic Center, Bengaluru, were randomly assigned to receive yoga or physiotherapy exercises after transcutaneous electrical stimulation and ultrasound treatment of the affected knee joints. Both groups practiced supervised intervention (40 min per day for 2 weeks (6 days per week with followup for 3 months. The module of integrated yoga consisted of shithilikaranavyayama (loosening and strengthening, asanas, relaxation techniques, pranayama, meditation and didactic lectures on yama, niyama, jnana yoga, bhakti yoga, and karma yoga for a healthy lifestyle change. The control group also had supervised physiotherapy exercises. A total of 118 (yoga and 117 (control were available for final analysis. Results: Significant differences were observed within (P < 0.001, Wilcoxon′s and between groups (P < 0.001, Mann-Whitney U-test on all domains of the Short Form-36 (P < 0.004, with better results in the yoga group than in the control group, both at 15 th day and 90 th day. Conclusion: An integrated approach of yoga therapy is better than therapeutic exercises as an adjunct to transcutaneous electrical stimulation and ultrasound treatment in improving knee disability and quality of life in patients with OA knees.

  7. PPAR-gamma agonist pioglitazone modifies craving intensity and brain white matter integrity in patients with primary cocaine use disorder: a double-blind randomized controlled pilot trial.

    Science.gov (United States)

    Schmitz, Joy M; Green, Charles E; Hasan, Khader M; Vincent, Jessica; Suchting, Robert; Weaver, Michael F; Moeller, F Gerard; Narayana, Ponnada A; Cunningham, Kathryn A; Dineley, Kelly T; Lane, Scott D

    2017-10-01

    Pioglitazone (PIO), a potent agonist of PPAR-gamma, is a promising candidate treatment for cocaine use disorder (CUD). We tested the effects of PIO on targeted mechanisms relevant to CUD: cocaine craving and brain white matter (WM) integrity. Feasibility, medication compliance and tolerability were evaluated. Two-arm double-blind randomized controlled proof-of-concept pilot trial of PIO or placebo (PLC). Single-site out-patient treatment research clinic in Houston, TX, USA. Thirty treatment-seeking adults, 18 to 60 years old, with CUD. Eighteen participants (8 = PIO; 10 = PLC) completed diffusion tensor imaging (DTI) of WM integrity at pre-/post-treatment. Study medication was dispensed at thrice weekly visits along with once-weekly cognitive behavioral therapy for 12 weeks. Measures of target engagement mechanisms of interest included cocaine craving assessed by the Brief Substance Craving Scale (BSCS), the Obsessive Compulsive Drug Use Scale (OCDUS), a visual analog scale (VAS) and change in WM integrity. Feasibility measures included number completing treatment, medication compliance (riboflavin detection) and tolerability (side effects, serious adverse events). Target engagement change in mechanisms of interest, defined as a ≥ 0.75 Bayesian posterior probability of an interaction existing favoring PIO over PLC, was demonstrated on measures of craving (BSCS, VAS) and WM integrity indexed by fractional anisotropy (FA) values. Outcomes indicated greater decrease in craving and greater increase in FA values in the PIO group. Feasibility was demonstrated by high completion rates among those starting treatment (21/26 = 80%) and medication compliance (≥ 80%). There were no reported serious adverse events for PIO. Compared with placebo, patients receiving pioglitazone show a higher likelihood of reduced cocaine craving and improved brain white matter integrity as a function of time in treatment. Pioglitazone shows good feasibility as a treatment for cocaine

  8. First-Generation Transgenic Plants and Statistics

    NARCIS (Netherlands)

    Nap, Jan-Peter; Keizer, Paul; Jansen, Ritsert

    1993-01-01

    The statistical analyses of populations of first-generation transgenic plants are commonly based on mean and variance and generally require a test of normality. Since in many cases the assumptions of normality are not met, analyses can result in erroneous conclusions. Transformation of data to

  9. Generation of antiviral transgenic chicken using spermatogonial ...

    African Journals Online (AJOL)

    This study was conducted in order to generate anti-viral transgenic chickens through transfected spermatogonial stem cell with fusion gene EGFP-MMx. After injecting fusion gene EGFP-MMx into testes, tissues frozen section, polymerase chain reaction (PCR) and dot blot of testes was performed at 30, 40, 50, 60, 70 and 80 ...

  10. A transgenic mouse model for trilateral retinoblastoma

    NARCIS (Netherlands)

    O'Brien, J.M.; Marcus, D.M.; Bernards, R.A.; Carpenter, J.L.; Windle, J.J.; Mellon, P.; Albert, D.M.

    1990-01-01

    We present a murine model of trilateral retinoblastoma. Ocular retinoblastoma and central nervous system tumors are observed in a line of mice formed by the transgenic expression of SV40 T-antigen. An oncogenic protein known to bind to the retinoblastoma gene product (p105-Rb) is specifically

  11. Transgenic strategies for improving rice disease resistance

    African Journals Online (AJOL)

    STORAGESEVER

    2009-05-04

    May 4, 2009 ... practice. However, the useful life-span of many resistant cultivars is only a few years, due to the breakdown of the .... Thus, suppression of insect feeding by transgenic .... different types of defense-responsive genes were found.

  12. Assessing the value of transgenic crops.

    Science.gov (United States)

    Lacey, Hugh

    2002-10-01

    In the current controversy about the value of transgenic crops, matters open to empirical inquiry are centrally at issue. One such matter is a key premise in a common argument (that I summarize) that transgenic crops should be considered to have universal value. The premise is that there are no alternative forms of agriculture available to enable the production of sufficient food to feed the world. The proponents of agroecology challenge it, claiming that agroecology provides an alternative, and they deny the claim that it is well founded on empirical evidence. It is, therefore, a matter of both social and scientific importance that this premise and the criticisms of it be investigated rigorously and empirically, so that the benefits and disadvantages of transgenic-intensive agriculture and agroecology can be compared in a reliable way. Conducting adequate investigation about the potential contribution of agroecology requires that the cultural conditions of its practice (and, thus, of the practices and movements of small-scale farmers in the "third world") be strengthened--and this puts the interests of investigation into tension with the socio-economic interests driving the development of transgenics. General issues about relationship between ethical argument and empirical (scientific) investigation are raised throughout the article.

  13. Cancer immunotherapy : insights from transgenic animal models

    NARCIS (Netherlands)

    McLaughlin, PMJ; Kroesen, BJ; Harmsen, MC; de Leij, LFMH

    2001-01-01

    A wide range of strategies in cancer immunotherapy has been developed in the last decade, some of which are currently being used in clinical settings. The development of these immunotherapeutical strategies has been facilitated by the generation of relevant transgenic animal models. Since the

  14. Metal resistance sequences and transgenic plants

    Science.gov (United States)

    Meagher, Richard Brian; Summers, Anne O.; Rugh, Clayton L.

    1999-10-12

    The present invention provides nucleic acid sequences encoding a metal ion resistance protein, which are expressible in plant cells. The metal resistance protein provides for the enzymatic reduction of metal ions including but not limited to divalent Cu, divalent mercury, trivalent gold, divalent cadmium, lead ions and monovalent silver ions. Transgenic plants which express these coding sequences exhibit increased resistance to metal ions in the environment as compared with plants which have not been so genetically modified. Transgenic plants with improved resistance to organometals including alkylmercury compounds, among others, are provided by the further inclusion of plant-expressible organometal lyase coding sequences, as specifically exemplified by the plant-expressible merB coding sequence. Furthermore, these transgenic plants which have been genetically modified to express the metal resistance coding sequences of the present invention can participate in the bioremediation of metal contamination via the enzymatic reduction of metal ions. Transgenic plants resistant to organometals can further mediate remediation of organic metal compounds, for example, alkylmetal compounds including but not limited to methyl mercury, methyl lead compounds, methyl cadmium and methyl arsenic compounds, in the environment by causing the freeing of mercuric or other metal ions and the reduction of the ionic mercury or other metal ions to the less toxic elemental mercury or other metals.

  15. Transgenic plants with increased calcium stores

    Science.gov (United States)

    Wyatt, Sarah (Inventor); Tsou, Pei-Lan (Inventor); Robertson, Dominique (Inventor); Boss, Wendy (Inventor)

    2004-01-01

    The present invention provides transgenic plants over-expressing a transgene encoding a calcium-binding protein or peptide (CaBP). Preferably, the CaBP is a calcium storage protein and over-expression thereof does not have undue adverse effects on calcium homeostasis or biochemical pathways that are regulated by calcium. In preferred embodiments, the CaBP is calreticulin (CRT) or calsequestrin. In more preferred embodiments, the CaBP is the C-domain of CRT, a fragment of the C-domain, or multimers of the foregoing. In other preferred embodiments, the CaBP is localized to the endoplasmic reticulum by operatively associating the transgene encoding the CaBP with an endoplasmic reticulum localization peptide. Alternatively, the CaBP is targeted to any other sub-cellular compartment that permits the calcium to be stored in a form that is biologically available to the plant. Also provided are methods of producing plants with desirable phenotypic traits by transformation of the plant with a transgene encoding a CaBP. Such phenotypic traits include increased calcium storage, enhanced resistance to calcium-limiting conditions, enhanced growth and viability, increased disease and stress resistance, enhanced flower and fruit production, reduced senescence, and a decreased need for fertilizer production. Further provided are plants with enhanced nutritional value as human food or animal feed.

  16. Transgenic cassava lines carrying heterologous alternative oxidase ...

    African Journals Online (AJOL)

    Afuape

    2013-07-03

    Jul 3, 2013 ... Organized embryogenic callus development: In our experiment, somatic embryos were developed from leaf lobes collected from transgenic cassava lines carrying the AtAOX1a gene. Immature leaf lobes measuring about 1 to 6 mm obtained from about six weeks old in vitro derived plants were used.

  17. Condensation of chromatin in transcriptional regions of an inactivated plant transgene: evidence for an active role of transcription in gene silencing.

    Science.gov (United States)

    van Blokland, R; ten Lohuis, M; Meyer, P

    1997-12-01

    The chromatin structures of two epigenetic alleles of a transgene were investigated by measuring the local accessibility of transgene chromatin to endonucleases. The two epialleles represented the active, hypomethylated state of a transgene in line 17-I of Petunia hybrida, and a transcriptionally inactive, hypermethylated derivative of the same transgene in line 17-IV. In nuclear preparations the inactive epiallele was significantly less sensitive to DNasel digestion and nuclease S7 digestion than the transcriptionally active epiallele, whereas no significant differences in accessibility were observed between naked DNA samples of the two epialleles. Our data suggest that a condensed chromatin structure is specifically imposed on transcribed regions of the construct in line 17-IV. In contrast, in both epialleles the plasmid region of the transgene, which is not transcriptionally active in plants, retains the same accessibility to endonucleases as the chromosomal integration site. These data suggest that transcriptional inactivation is linked to the process of transcription, and imply that control of transgene expression via the use of inducible or tissue-specific promoters might prevent transgene silencing and conserve the active state of transgenes during sexual propagation.

  18. Meeting Postpartum Women’s Family Planning Needs Through Integrated Family Planning and Immunization Services: Results of a Cluster-Randomized Controlled Trial in Rwanda

    Science.gov (United States)

    Dulli, Lisa S; Eichleay, Marga; Rademacher, Kate; Sortijas, Steve; Nsengiyumva, Théophile

    2016-01-01

    ABSTRACT Objective The primary objective of this study was to test the effectiveness of integrating family planning service components into infant immunization services to increase modern contraceptive method use among postpartum women. Methods The study was a separate sample, parallel, cluster-randomized controlled trial. Fourteen randomly selected primary health facilities were equally allocated to intervention (integrated family planning and immunization services at the same time and location) and control groups (standard immunization services only). At baseline (May–June 2010), we interviewed postpartum women attending immunization services for their infant aged 6 to 12 months using a structured questionnaire. A separate sample of postpartum women was interviewed 16 months later after implementation of the experimental health service intervention. We used linear mixed regression models to test the study hypothesis that postpartum women attending immunization services for their infants aged 6–12 months in the intervention facilities will be more likely to use a modern contraceptive method than postpartum women attending immunization services for their infants aged 6–12 months in control group facilities. Results We interviewed and analyzed data for 825 women from the intervention group and 829 women from the control group. Results showed the intervention had a statistically significant, positive effect on modern contraceptive method use among intervention group participants compared with control group participants (regression coefficient, 0.15; 90% confidence interval [CI], 0.04 to 0.26). Although we conducted a 1-sided significance test, this effect was also significant at the 2-sided test with alpha = .05. Among those women who did not initiate a contraceptive method, awaiting the return of menses was the most common reason cited for non-use of a method. Women in both study groups overwhelmingly supported the concept of integrating family planning

  19. Arabidopsis AtPAP1 transcription factor induces anthocyanin production in transgenic Taraxacum brevicorniculatum.

    Science.gov (United States)

    Qiu, Jian; Sun, Shuquan; Luo, Shiqiao; Zhang, Jichuan; Xiao, Xianzhou; Zhang, Liqun; Wang, Feng; Liu, Shizhong

    2014-04-01

    This study developed a new purple coloured Taraxacum brevicorniculatum plant through genetic transformation using the Arabidopsis AtPAP1 gene, which overproduced anthocyanins in its vegetative tissues. Rubber-producing Taraxacum plants synthesise high-quality natural rubber (NR) in their roots and so are a promising alternative global source of this raw material. A major factor in its commercialization is the need for multipurpose exploitation of the whole plant. To add value to the aerial tissues, red/purple plants of the rubber-producing Taraxacum brevicorniculatum species were developed through heterologous expression of the production of anthocyanin pigment 1 (AtPAP1) transcription factor from Arabidopsis thaliana. The vegetative tissue of the transgenic plants showed an average of a 48-fold increase in total anthocyanin content over control levels, but with the exception of pigmentation, the transgenic plants were phenotypically comparable to controls and displayed similar growth vigor. Southern blot analysis confirmed that the AtPAP1 gene had been integrated into the genome of the high anthocyanin Taraxacum plants. The AtPAP1 expression levels were estimated by quantitative real-time PCR and were highly correlated with the levels of total anthocyanins in five independent transgenic lines. High levels of three cyanidin glycosides found in the purple plants were characterized by high performance liquid chromatography-mass spectrum analysis. The presence of NR was verified by NMR and infrared spectroscopy, and confirmed that NR biosynthesis had not been affected in the transgenic Taraxacum lines. In addition, other major phenylpropanoid products such as chlorogenic acid and quercetin glycosides were also enhanced in the transgenic Taraxacum. The red/purple transgenic Taraxacum lines described in this study would increase the future application of the species as a rubber-producing crop due to its additional health benefits.

  20. Cellular, molecular and functional characterisation of YAC transgenic mouse models of Friedreich ataxia.

    Directory of Open Access Journals (Sweden)

    Sara Anjomani Virmouni

    Full Text Available Friedreich ataxia (FRDA is an autosomal recessive neurodegenerative disorder, caused by a GAA repeat expansion mutation within intron 1 of the FXN gene. We have previously established and performed preliminary characterisation of several human FXN yeast artificial chromosome (YAC transgenic FRDA mouse models containing GAA repeat expansions, Y47R (9 GAA repeats, YG8R (90 and 190 GAA repeats and YG22R (190 GAA repeats.We now report extended cellular, molecular and functional characterisation of these FXN YAC transgenic mouse models. FXN transgene copy number analysis of the FRDA mice demonstrated that the YG22R and Y47R lines each have a single copy of the FXN transgene while the YG8R line has two copies. Single integration sites of all transgenes were confirmed by fluorescence in situ hybridisation (FISH analysis of metaphase and interphase chromosomes. We identified significant functional deficits, together with a degree of glucose intolerance and insulin hypersensitivity, in YG8R and YG22R FRDA mice compared to Y47R and wild-type control mice. We also confirmed increased somatic GAA repeat instability in the cerebellum and brain of YG22R and YG8R mice, together with significantly reduced levels of FXN mRNA and protein in the brain and liver of YG8R and YG22R compared to Y47R.Together these studies provide a detailed characterisation of our GAA repeat expansion-based YAC transgenic FRDA mouse models that will help investigations of FRDA disease mechanisms and therapy.

  1. Effect of Health Education Based on Integrative Therapy of Chinese and Western Medicine for Adult Patients with Type 2 Diabetes Mellitus: A Randomized Controlled Study.

    Science.gov (United States)

    Shi, Mai; Liu, Zhao-Lan; Zhu, Yan-Bo; Xu, Mei-Yan; Duan, Xue-Ying; Shi, Hui-Mei; Jiang, Bo; Zhang, Xiao-Mei; Yu, Xiao-Han

    2018-02-01

    To investigate the effects of health education based on integrative therapy of Chinese and Western medicine for type 2 diabetes mellitus (T2DM) from the aspects of knowledge, attitude and practice (KAP), health-related quality of life (HRQoL), body mass index (BMI) and glucose control. Patients were individually randomized into intervention group (receiving integrative education, n=120) and control group (receiving usual education, n=120). The primary outcome was the changes in glycosylated hemoglobin A1c (HbA1c) levels after 3, 6, 9 and 12 months from baseline. Hierarchical linear models (HLMs) were used to assess within-group changes in outcomes over time and between-group differences in patterns of change. Secondary outcomes were KAP scores, HRQoL scores and BMI after 6 and 12 months, paired-sample t test was used to assess within-group changes in outcomes in 6 and 12 months, independent-sample t test was used to assess between-group differences in patterns of change. HbA1c decreased statistically from baseline to 3 months, from 3 to 6 months, from 6 to 9 months and from 9 to 12 months in the intervention group (all Peducation based on integrative therapy of Chinese and Western medicine is beneficial to the control of T2DM and should be recommended for T2DM.

  2. Comparison of New Technology Integrated and Nonintegrated Arterial Filters Used in Cardiopulmonary Bypass Surgery: A Randomized, Prospective, and Single Blind Study

    Directory of Open Access Journals (Sweden)

    Özgür Gürsu

    2013-01-01

    Full Text Available Background. Innovative cardiopulmonary bypass (CPB settings have been developed in order to integrate the concepts of “surface-coating,” “blood-filtration,” and “miniaturization.” Objectives. To compare integrated and nonintegrated arterial line filters in terms of peri- and postoperative clinical variables, inflammatory response, and transfusion needs. Material and Methods. Thirty-six patients who underwent coronary bypass surgery were randomized into integrated (Group In and nonintegrated arterial line filter (Group NIn groups. Arterial blood samples for the assessments of complete hemogram, biochemical screening, interleukin-6, interleukin-2R, and C-reactive protein were analyzed before and after surgery. Need for postoperative dialysis, inotropic therapy and transfusion, in addition to extubation time, total amount of drainage (mL, length of intensive care unit, and hospital stay, and mortality rates was also recorded for each patient. Results. Prime volume was significantly higher and mean intraoperative hematocrit value was lower in Group NIn, but need for erythrocyte transfusion was significantly higher in Group NIn. C-reactive protein values did not differ significantly except for postoperative second day's results, which were found significantly lower in Group In than in Group NIn. Conclusion. Intraoperative hematocrit levels were higher and need for postoperative erythrocyte transfusion was decreased in Group In.

  3. Appropriate assessment of neighborhood effects on individual health: integrating random and fixed effects in multilevel logistic regression

    DEFF Research Database (Denmark)

    Larsen, Klaus; Merlo, Juan

    2005-01-01

    The logistic regression model is frequently used in epidemiologic studies, yielding odds ratio or relative risk interpretations. Inspired by the theory of linear normal models, the logistic regression model has been extended to allow for correlated responses by introducing random effects. However......, the model does not inherit the interpretational features of the normal model. In this paper, the authors argue that the existing measures are unsatisfactory (and some of them are even improper) when quantifying results from multilevel logistic regression analyses. The authors suggest a measure...... of heterogeneity, the median odds ratio, that quantifies cluster heterogeneity and facilitates a direct comparison between covariate effects and the magnitude of heterogeneity in terms of well-known odds ratios. Quantifying cluster-level covariates in a meaningful way is a challenge in multilevel logistic...

  4. Split-Cre complementation restores combination activity on transgene excision in hair roots of transgenic tobacco.

    Directory of Open Access Journals (Sweden)

    Mengling Wen

    Full Text Available The Cre/loxP system is increasingly exploited for genetic manipulation of DNA in vitro and in vivo. It was previously reported that inactive ''split-Cre'' fragments could restore Cre activity in transgenic mice when overlapping co-expression was controlled by two different promoters. In this study, we analyzed recombination activities of split-Cre proteins, and found that no recombinase activity was detected in the in vitro recombination reaction in which only the N-terminal domain (NCre of split-Cre protein was expressed, whereas recombination activity was obtained when the C-terminal (CCre or both NCre and CCre fragments were supplied. We have also determined the recombination efficiency of split-Cre proteins which were co-expressed in hair roots of transgenic tobacco. No Cre recombination event was observed in hair roots of transgenic tobacco when the NCre or CCre genes were expressed alone. In contrast, an efficient recombination event was found in transgenic hairy roots co-expressing both inactive split-Cre genes. Moreover, the restored recombination efficiency of split-Cre proteins fused with the nuclear localization sequence (NLS was higher than that of intact Cre in transgenic lines. Thus, DNA recombination mediated by split-Cre proteins provides an alternative method for spatial and temporal regulation of gene expression in transgenic plants.

  5. Expression of hybrid fusion protein (Cry1Ac::ASAL) in transgenic rice plants imparts resistance against multiple insect pests.

    Science.gov (United States)

    Boddupally, Dayakar; Tamirisa, Srinath; Gundra, Sivakrishna Rao; Vudem, Dashavantha Reddy; Khareedu, Venkateswara Rao

    2018-05-31

    To evolve rice varieties resistant to different groups of insect pests a fusion gene, comprising DI and DII domains of Bt Cry1Ac and carbohydrate binding domain of garlic lectin (ASAL), was constructed. Transgenic rice lines were generated and evaluated to assess the efficacy of Cry1Ac::ASAL fusion protein against three major pests, viz., yellow stem borer (YSB), leaf folder (LF) and brown planthopper (BPH). Molecular analyses of transgenic plants revealed stable integration and expression of the fusion gene. In planta insect bioassays on transgenics disclosed enhanced levels of resistance compared to the control plants. High insect mortality of YSB, LF and BPH was observed on transgenics compared to that of control plants. Furthermore, honeydew assays revealed significant decreases in the feeding ability of BPH on transgenic plants as compared to the controls. Ligand blot analysis, using BPH insects fed on cry1Ac::asal transgenic rice plants, revealed a modified receptor protein-binding pattern owing to its ability to bind to additional receptors in insects. The overall results authenticate that Cry1Ac::ASAL protein is endowed with remarkable entomotoxic effects against major lepidopteran and hemipteran insects. As such, the fusion gene appears promising and can be introduced into various other crops to control multiple insect pests.

  6. Paternal inheritance of plastid-encoded transgenes in Petunia hybrida in the greenhouse and under field conditions

    Directory of Open Access Journals (Sweden)

    Patricia Horn

    2017-12-01

    Full Text Available As already demonstrated in greenhouse trials, outcrossing of transgenic plants can be drastically reduced via transgene integration into the plastid. We verified this result in the field with Petunia, for which the highest paternal leakage has been observed. The variety white 115 (W115 served as recipient and Pink Wave (PW and the transplastomic variant PW T16, encoding the uidA reporter gene, as pollen donor. While manual pollination in the greenhouse led to over 90% hybrids for both crossings, the transgenic donor resulted only in 2% hybrids in the field. Nevertheless paternal leakage was detected in one case which proves that paternal inheritance of plastid-located transgenes is possible under artificial conditions. In the greenhouse, paternal leakage occurred in a frequency comparable to published results. As expected natural pollination reduced the hybrid formation in the field from 90 to 7.6% and the transgenic donor did not result in any hybrid. Keywords: Paternal plastid inheritance, Transgene confinement, Greenhouse, Field trial, Pollen mediated gene flow

  7. Diversity of arthropod community in transgenic poplar-cotton ecosystems.

    Science.gov (United States)

    Zhang, D J; Lu, Z Y; Liu, J X; Li, C L; Yang, M S

    2015-12-02

    Poplar-cotton agro-ecosystems are the main agricultural planting modes of plain cotton fields in China. Here, we performed a systematic survey of the diversity and population of arthropod communities in four different combination of poplar-cotton eco-systems, including I) non-transgenic poplar and non-transgenic cotton fields; II) non-transgenic poplar and transgenic cotton fields [Bacillus thuringiensis (Bt) cotton]; III) Bt transgenic poplar (high insect resistant strain Pb29) and non-transgenic cotton; and IV) transgenic poplar and transgenic cotton fields, over a period of 3 years. Based on the statistical methods used to investigate community ecology, the effects of transgenic ecosystems on the whole structure of the arthropod community, on the structure of arthropods in the nutritive layer, and on the similarity of arthropod communities were evaluated. The main results were as follows: the transgenic poplar-cotton ecosystem has a stronger inhibitory effect on insect pests and has no impact on the structure of the arthropod community, and therefore, maintains the diversity of the arthropod community. The character index of the community indicated that the structure of the arthropod community of the transgenic poplar-cotton ecosystem was better than that of the poplar-cotton ecosystem, and that system IV had the best structure. As for the abundance of nutritional classes, the transgenic poplar-cotton ecosystem was also better than that of the non-transgenic poplar-cotton ecosystem. The cluster analysis and similarity of arthropod communities between the four different transgenic poplar-cotton ecosystems illustrated that the structure of the arthropod community excelled in the small sample of the transgenic poplar-cotton ecosystems.

  8. Short course radiotherapy with simultaneous integrated boost for stage I-II breast cancer, early toxicities of a randomized clinical trial

    Science.gov (United States)

    2012-01-01

    Background TomoBreast is a unicenter, non-blinded randomized trial comparing conventional radiotherapy (CR) vs. hypofractionated Tomotherapy (TT) for post-operative treatment of breast cancer. The purpose of the trial is to compare whether TT can reduce heart and pulmonary toxicity. We evaluate early toxicities. Methods The trial started inclusion in May 2007 and reached its recruitment in August 2011. Women with stage T1-3N0M0 or T1-2N1M0 breast cancer completely resected by tumorectomy (BCS) or by mastectomy (MA) who consented to participate were randomized, according to a prescribed computer-generated randomization schedule, between control arm of CR 25x2 Gy/5 weeks by tangential fields on breast/chest wall, plus supraclavicular-axillary field if node-positive, and sequential boost 8x2 Gy/2 weeks if BCS (cumulative dose 66 Gy/7 weeks), versus experimental TT arm of 15x2.8 Gy/3 weeks, including nodal areas if node-positive and simultaneous integrated boost of 0.6 Gy if BCS (cumulative dose 51 Gy/3 weeks). Outcomes evaluated were the pulmonary and heart function. Comparison of proportions used one-sided Fisher's exact test. Results By May 2010, 70 patients were randomized and had more than 1 year of follow-up. Out of 69 evaluable cases, 32 were assigned to CR (21 BCS, 11 MA), 37 to TT (20 BCS, 17 MA). Skin toxicity of grade ≥1 at 2 years was 60% in CR, vs. 30% in TT arm. Heart function showed no significant difference for left ventricular ejection fraction at 2 years, CR 4.8% vs. TT 4.6%. Pulmonary function tests at 2 years showed grade ≥1 decline of FEV1 in 21% of CR, vs. 15% of TT and decline of DLco in 29% of CR, vs. 7% of TT (P = 0.05). Conclusions There were no unexpected severe toxicities. Short course radiotherapy of the breast with simultaneous integrated boost over 3 weeks proved feasible without excess toxicities. Pulmonary tests showed a slight trend in favor of Tomotherapy, which will need confirmation with longer

  9. Individualized chiropractic and integrative care for low back pain: the design of a randomized clinical trial using a mixed-methods approach

    Directory of Open Access Journals (Sweden)

    Evans Roni L

    2010-03-01

    Full Text Available Abstract Background Low back pain (LBP is a prevalent and costly condition in the United States. Evidence suggests there is no one treatment which is best for all patients, but instead several viable treatment options. Additionally, multidisciplinary management of LBP may be more effective than monodisciplinary care. An integrative model that includes both complementary and alternative medicine (CAM and conventional therapies, while also incorporating patient choice, has yet to be tested for chronic LBP. The primary aim of this study is to determine the relative clinical effectiveness of 1 monodisciplinary chiropractic care and 2 multidisciplinary integrative care in 200 adults with non-acute LBP, in both the short-term (after 12 weeks and long-term (after 52 weeks. The primary outcome measure is patient-rated back pain. Secondary aims compare the treatment approaches in terms of frequency of symptoms, low back disability, fear avoidance, self-efficacy, general health status, improvement, satisfaction, work loss, medication use, lumbar dynamic motion, and torso muscle endurance. Patients' and providers' perceptions of treatment will be described using qualitative methods, and cost-effectiveness and cost utility will be assessed. Methods and Design This paper describes the design of a randomized clinical trial (RCT, with cost-effectiveness and qualitative studies conducted alongside the RCT. Two hundred participants ages 18 and older are being recruited and randomized to one of two 12-week treatment interventions. Patient-rated outcome measures are collected via self-report questionnaires at baseline, and at 4, 12, 26, and 52 weeks post-randomization. Objective outcome measures are assessed at baseline and 12 weeks by examiners blinded to treatment assignment. Health care cost data is collected by self-report questionnaires and treatment records during the intervention phase and by monthly phone interviews thereafter. Qualitative interviews

  10. Integration profile and safety of an adenovirus hybrid-vector utilizing hyperactive sleeping beauty transposase for somatic integration.

    Directory of Open Access Journals (Sweden)

    Wenli Zhang

    Full Text Available We recently developed adenovirus/transposase hybrid-vectors utilizing the previously described hyperactive Sleeping Beauty (SB transposase HSB5 for somatic integration and we could show stabilized transgene expression in mice and a canine model for hemophilia B. However, the safety profile of these hybrid-vectors with respect to vector dose and genotoxicity remains to be investigated. Herein, we evaluated this hybrid-vector system in C57Bl/6 mice with escalating vector dose settings. We found that in all mice which received the hyperactive SB transposase, transgene expression levels were stabilized in a dose-dependent manner and that the highest vector dose was accompanied by fatalities in mice. To analyze potential genotoxic side-effects due to somatic integration into host chromosomes, we performed a genome-wide integration site analysis using linker-mediated PCR (LM-PCR and linear amplification-mediated PCR (LAM-PCR. Analysis of genomic DNA samples obtained from HSB5 treated female and male mice revealed a total of 1327 unique transposition events. Overall the chromosomal distribution pattern was close-to-random and we observed a random integration profile with respect to integration into gene and non-gene areas. Notably, when using the LM-PCR protocol, 27 extra-chromosomal integration events were identified, most likely caused by transposon excision and subsequent transposition into the delivered adenoviral vector genome. In total, this study provides a careful evaluation of the safety profile of adenovirus/Sleeping Beauty transposase hybrid-vectors. The obtained information will be useful when designing future preclinical studies utilizing hybrid-vectors in small and large animal models.

  11. Enhanced virus resistance in transgenic maize expressing a dsRNA-specific endoribonuclease gene from E. coli.

    Directory of Open Access Journals (Sweden)

    Xiuling Cao

    Full Text Available Maize rough dwarf disease (MRDD, caused by several Fijiviruses in the family Reoviridae, is a global disease that is responsible for substantial yield losses in maize. Although some maize germplasm have low levels of polygenic resistance to MRDD, highly resistant cultivated varieties are not available for agronomic field production in China. In this work, we have generated transgenic maize lines that constitutively express rnc70, a mutant E. coli dsRNA-specific endoribonuclease gene. Transgenic lines were propagated and screened under field conditions for 12 generations. During three years of evaluations, two transgenic lines and their progeny were challenged with Rice black-streaked dwarf virus (RBSDV, the causal agent of MRDD in China, and these plants exhibited reduced levels of disease severity. In two normal years of MRDD abundance, both lines were more resistant than non-transgenic plants. Even in the most serious MRDD year, six out of seven progeny from one line were resistant, whereas non-transgenic plants were highly susceptible. Molecular approaches in the T12 generation revealed that the rnc70 transgene was integrated and expressed stably in transgenic lines. Under artificial conditions permitting heavy virus inoculation, the T12 progeny of two highly resistant lines had a reduced incidence of MRDD and accumulation of RBSDV in infected plants. In addition, we confirmed that the RNC70 protein could bind directly to RBSDV dsRNA in vitro. Overall, our data show that RNC70-mediated resistance in transgenic maize can provide efficient protection against dsRNA virus infection.

  12. Identification of short hairpin RNA targeting foot-and-mouth disease virus with transgenic bovine fetal epithelium cells.

    Directory of Open Access Journals (Sweden)

    Hongmei Wang

    Full Text Available BACKGROUND: Although it is known that RNA interference (RNAi targeting viral genes protects experimental animals, such as mice, from the challenge of Foot-and-mouth disease virus (FMDV, it has not been previously investigated whether shRNAs targeting FMDV in transgenic dairy cattle or primary transgenic bovine epithelium cells will confer resistance against FMDV challenge. PRINCIPAL FINDING: Here we constructed three recombinant lentiviral vectors containing shRNA against VP2 (RNAi-VP2, VP3 (RNAi-VP3, or VP4 (RNAi-VP4 of FMDV, and found that all of them strongly suppressed the transient expression of a FLAG-tagged viral gene fusion protein in 293T cells. In BHK-21 cells, RNAi-VP4 was found to be more potent in inhibition of viral replication than the others with over 98% inhibition of viral replication. Therefore, recombinant lentiviral vector RNAi-VP4 was transfected into bovine fetal fibroblast cells to generate transgenic nuclear donor cells. With subsequent somatic cell cloning, we generated forty transgenic blastocysts, and then transferred them to 20 synchronized recipient cows. Three transgenic bovine fetuses were obtained after pregnant period of 4 months, and integration into chromosome in cloned fetuses was confirmed by Southern hybridization. The primary tongue epithelium cells of transgenic fetuses were isolated and inoculated with 100 TCID(50 of FMDV, and it was observed that shRNA significantly suppressed viral RNA synthesis and inhibited over 91% of viral replication after inoculation of FMDV for 48 h. CONCLUSION: RNAi-VP4 targeting viral VP4 gene appears to prevent primary epithelium cells of transgenic bovine fetus from FMDV infection, and it could be a candidate shRNA used for cultivation of transgenic cattle against FMDV.

  13. The effect of visual scanning exercises integrated into physiotherapy in patients with unilateral spatial neglect poststroke: a matched-pair randomized control trial.

    Science.gov (United States)

    van Wyk, Andoret; Eksteen, Carina A; Rheeder, Paul

    2014-01-01

    Unilateral spatial neglect (USN) is a visual-perceptual disorder that entails the inability to perceive and integrate stimuli on one side of the body, resulting in the neglect of one side of the body. Stroke patients with USN present with extensive functional disability and duration of therapy input. To determine the effect of saccadic eye movement training with visual scanning exercises (VSEs) integrated with task-specific activities on USN poststroke. A matched-pair randomized control trial was conducted. Subjects were matched according to their functional activity level and allocated to either a control (n = 12) or an experimental group (n = 12). All patients received task-specific activities for a 4-week intervention period. The experimental group received saccadic eye movement training with VSE integrated with task specific activities as an "add on" intervention. Assessments were conducted weekly over the intervention period. Statistical significant difference was noted on the King-Devick Test (P = .021), Star Cancellation Test (P = .016), and Barthel Index (P = .004). Intensive saccadic eye movement training with VSE integrated with task-specific activities has a significant effect on USN in patients poststroke. Results of this study are supported by findings from previously reviewed literature in the sense that the effect of saccadic eye movement training with VSE as an intervention approach has a significant effect on the visual perceptual processing of participants with USN poststroke. The significant improved visual perceptual processing translate to significantly better visual function and ability to perform activities of daily living following the stroke. © The Author(s) 2014.

  14. Analysis of T-DNA/Host-Plant DNA Junction Sequences in Single-Copy Transgenic Barley Lines

    Directory of Open Access Journals (Sweden)

    Joanne G. Bartlett

    2014-01-01

    Full Text Available Sequencing across the junction between an integrated transfer DNA (T-DNA and a host plant genome provides two important pieces of information. The junctions themselves provide information regarding the proportion of T-DNA which has integrated into the host plant genome, whilst the transgene flanking sequences can be used to study the local genetic environment of the integrated transgene. In addition, this information is important in the safety assessment of GM crops and essential for GM traceability. In this study, a detailed analysis was carried out on the right-border T-DNA junction sequences of single-copy independent transgenic barley lines. T-DNA truncations at the right-border were found to be relatively common and affected 33.3% of the lines. In addition, 14.3% of lines had rearranged construct sequence after the right border break-point. An in depth analysis of the host-plant flanking sequences revealed that a significant proportion of the T-DNAs integrated into or close to known repetitive elements. However, this integration into repetitive DNA did not have a negative effect on transgene expression.

  15. Isogenic transgenic homozygous fish induced by artificial parthenogenesis.

    Science.gov (United States)

    Nam, Y K; Cho, Y S; Kim, D S

    2000-12-01

    As a model system for vertebrate transgenesis, fish have many attractive advantages, especially with respect to the characteristics of eggs, allowing us to produce isogenic, transgenic, homozygous vertebrates by combining with chromosome-set manipulation. Here, we describe the large-scale production of isogenic transgenic homozygous animals using our experimental organism, the mud loach Misgurnus mizolepis, by the simple process of artificial parthenogenesis in a single generation. These isogenic fish have retained transgenic homozygous status in a stable manner during the subsequent 5 years, and exhibited increased levels of transgene expression. Furthermore, their isogenic nature was confirmed by cloned transgenic homozygous offspring produced via another step of parthenogenic reproduction of the isogenic homozygous transgenic fish. These results demonstrate that a combination of transgenesis and artificial parthenogenesis will make the rapid utilization of genetically pure homozygous transgenic system in vertebrate transgenesis possible.

  16. Transgenic Mosquitoes - Fact or Fiction?

    Science.gov (United States)

    Wilke, André B B; Beier, John C; Benelli, Giovanni

    2018-06-01

    Technologies for controlling mosquito vectors based on genetic manipulation and the release of genetically modified mosquitoes (GMMs) are gaining ground. However, concrete epidemiological evidence of their effectiveness, sustainability, and impact on the environment and nontarget species is lacking; no reliable ecological evidence on the potential interactions among GMMs, target populations, and other mosquito species populations exists; and no GMM technology has yet been approved by the WHO Vector Control Advisory Group. Our opinion is that, although GMMs may be considered a promising control tool, more studies are needed to assess their true effectiveness, risks, and benefits. Overall, several lines of evidence must be provided before GMM-based control strategies can be used under the integrated vector management framework. Copyright © 2018 Elsevier Ltd. All rights reserved.

  17. Biologically inspired flexible quasi-single-mode random laser: An integration of Pieris canidia butterfly wing and semiconductors

    Science.gov (United States)

    Wang, Cih-Su; Chang, Tsung-Yuan; Lin, Tai-Yuan; Chen, Yang-Fang

    2014-10-01

    Quasi-periodic structures of natural biomaterial membranes have great potentials to serve as resonance cavities to generate ecological friendly optoelectronic devices with low cost. To achieve the first attempt for the illustration of the underlying principle, the Pieris canidia butterfly wing was embedded with ZnO nanoparticles. Quite interestingly, it is found that the bio-inspired quasi-single-mode random laser can be achieved by the assistance of the skeleton of the membrane, in which ZnO nanoparticles act as emitting gain media. Such unique characteristics can be interpreted well by the Fabry-Perot resonance existing in the window-like quasi-periodic structure of butterfly wing. Due to the inherently promising flexibility of butterfly wing membrane, the laser action can still be maintained during the bending process. Our demonstrated approach not only indicates that the natural biological structures can provide effective scattering feedbacks but also pave a new avenue towards designing bio-controlled photonic devices.

  18. Patient training in cancer pain management using integrated print and video materials: a multisite randomized controlled trial.

    Science.gov (United States)

    Syrjala, Karen L; Abrams, Janet R; Polissar, Nayak L; Hansberry, Jennifer; Robison, Jeanne; DuPen, Stuart; Stillman, Mark; Fredrickson, Marvin; Rivkin, Saul; Feldman, Eric; Gralow, Julie; Rieke, John W; Raish, Robert J; Lee, Douglas J; Cleeland, Charles S; DuPen, Anna

    2008-03-01

    Standard guidelines for cancer pain treatment routinely recommend training patients to reduce barriers to pain relief, use medications appropriately, and communicate their pain-related needs. Methods are needed to reduce professional time required while achieving sustained intervention effectiveness. In a multisite, randomized controlled trial, this study tested a pain training method versus a nutrition control. At six oncology clinics, physicians (N=22) and nurses (N=23) enrolled patients (N=93) who were over 18 years of age, with cancer diagnoses, pain, and a life expectancy of at least 6 months. Pain training and control interventions were matched for materials and method. Patients watched a video followed by about 20 min of manual-standardized training with an oncology nurse focused on reviewing the printed material and adapted to individual concerns of patients. A follow-up phone call after 72 h addressed individualized treatment content and pain communication. Assessments at baseline, one, three, and 6 months included barriers, the Brief Pain Inventory, opioid use, and physician and nurse ratings of their patients' pain. Trained versus control patients reported reduced barriers to pain relief (P6 on a 0-10 scale) at 1-month outcomes (P=.03). Physician and nurse ratings were closer to patients' ratings of pain for trained versus nutrition groups (P=.04 and print materials, with brief individualized training, effectively improved pain management over time for cancer patients of varying diagnostic and demographic groups.

  19. Biologically inspired flexible quasi-single-mode random laser: an integration of Pieris canidia butterfly wing and semiconductors.

    Science.gov (United States)

    Wang, Cih-Su; Chang, Tsung-Yuan; Lin, Tai-Yuan; Chen, Yang-Fang

    2014-10-23

    Quasi-periodic structures of natural biomaterial membranes have great potentials to serve as resonance cavities to generate ecological friendly optoelectronic devices with low cost. To achieve the first attempt for the illustration of the underlying principle, the Pieris canidia butterfly wing was embedded with ZnO nanoparticles. Quite interestingly, it is found that the bio-inspired quasi-single-mode random laser can be achieved by the assistance of the skeleton of the membrane, in which ZnO nanoparticles act as emitting gain media. Such unique characteristics can be interpreted well by the Fabry-Perot resonance existing in the window-like quasi-periodic structure of butterfly wing. Due to the inherently promising flexibility of butterfly wing membrane, the laser action can still be maintained during the bending process. Our demonstrated approach not only indicates that the natural biological structures can provide effective scattering feedbacks but also pave a new avenue towards designing bio-controlled photonic devices.

  20. An integrated supply chain model for new products with imprecise production and supply under scenario dependent fuzzy random demand

    Science.gov (United States)

    Nagar, Lokesh; Dutta, Pankaj; Jain, Karuna

    2014-05-01

    In the present day business scenario, instant changes in market demand, different source of materials and manufacturing technologies force many companies to change their supply chain planning in order to tackle the real-world uncertainty. The purpose of this paper is to develop a multi-objective two-stage stochastic programming supply chain model that incorporates imprecise production rate and supplier capacity under scenario dependent fuzzy random demand associated with new product supply chains. The objectives are to maximise the supply chain profit, achieve desired service level and minimise financial risk. The proposed model allows simultaneous determination of optimum supply chain design, procurement and production quantities across the different plants, and trade-offs between inventory and transportation modes for both inbound and outbound logistics. Analogous to chance constraints, we have used the possibility measure to quantify the demand uncertainties and the model is solved using fuzzy linear programming approach. An illustration is presented to demonstrate the effectiveness of the proposed model. Sensitivity analysis is performed for maximisation of the supply chain profit with respect to different confidence level of service, risk and possibility measure. It is found that when one considers the service level and risk as robustness measure the variability in profit reduces.

  1. Effects of mirror therapy integrated with task-oriented exercise on the balance function of patients with poststroke hemiparesis: a randomized-controlled pilot trial.

    Science.gov (United States)

    Cha, Hyun-Gyu; Oh, Duck-Won

    2016-03-01

    This study aimed to explore the effects of mirror therapy integrated with task-oriented exercise on balance function in poststroke hemiparesis. Twenty patients with poststroke hemiparesis were assigned randomly to an experimental group (EG) and a control group (CG), with 10 individuals each. Participants of the EG and CG received a task-oriented exercise program with a focus on the strengthening of the lower limb and the practice of balance-related functional tasks. An additional option for the EG was front and side wall mirrors to provide visual feedback for their own movements while performing the exercise. The program was performed for 30 min, twice a day, five times per week for 4 weeks. Outcome measures included the Berg balance scale, the timed up-and-go test, and quantitative data (balance index and dynamic limits of stability). In the EG and CG, all variables showed significant differences between pretest and post-test (Phemiparesis.

  2. The effects of an integrated health education and exercise program in community-dwelling older adults with hypertension: a randomized controlled trial.

    Science.gov (United States)

    Park, Yeon-Hwan; Song, Misoon; Cho, Be-Long; Lim, Jae-Young; Song, Wook; Kim, Seon-Ho

    2011-01-01

    the aim of this study was to examine the effectiveness of HAHA (Healthy Aging and Happy Aging) program, which is an integrated health education and exercise program for community-dwelling older adults with hypertension. older adults with hypertension from one senior center were randomly allocated to experimental (n=18) or control group (n=22). Experimental group received health education, individual counseling and tailored exercise program for 12 weeks. the mean ages were 71 years (experimental group) and 69 (control group). After the intervention, systolic blood pressure of experimental group was significantly decreased than that of control group. Scores of exercise self-efficacy, general health, vitality, social functioning, and mental health in SF-36 were statistically higher than those of control group. the HAHA program was effective in control of systolic blood pressure and improving self-efficacy for exercise and health-related quality of life. 2010 Elsevier Ireland Ltd. All rights reserved.

  3. Chromosomal localisation of the CD4cre transgene in B6·Cg-Tg(Cd4-cre)1Cwi mice.

    Science.gov (United States)

    Westendorf, Kerstin; Durek, Pawel; Ayew, Samia; Mashreghi, Mir-Farzin; Radbruch, Andreas

    2016-09-01

    The B6·Cg-Tg(Cd4-cre)1Cwi line expresses CRE recombinase under the control of the promoter and regulatory elements of the Cd4 gene. Here we show that CRE recombinase expression reduces the number and frequencies of CD4 positive subsets in a dose-dependent manner and localize the integration site of the transgenic construct to position 60335693-60341285 (qD) of chromosome 3. The insert contains at least 15 complete sequential copies of the transgenic construct. Based on this information we describe a novel PCR assay for genetic typing of transgenic mice. Copyright © 2016 Elsevier B.V. All rights reserved.

  4. Overexpression of a modiifed AM79 aroA gene in transgenic maize confers high tolerance to glyphosate

    Institute of Scientific and Technical Information of China (English)

    REN Zhen-jing; CAO Gao-yi; ZHANG Yu-wen; LIU Yan; LIU Yun-jun

    2015-01-01

    It has previously been shown that a bacterial 5-enolpyruvylshikimate-3-phosphate synthase (EPSPS) encoding gene AM79 aroA can be a candidate gene to develop glyphosate-tolerant transgenic crops (Cao et al. 2012). In this study, AM79 aroA was redesigned using the plant biased codons and eliminating the motifs which would lead to the instability of mRNA, to create a synthetic gene that would be expressed highly in plant cel s. The redesigned and artiifcial y synthesized gene, named as mAM79, was cloned into plant expression vector pM3301UbiSpAM79, where mAM79 is fused with signal peptide sequence of pea rib-1,5-bisphospate carboxylase (rbcS) smal subunit and control ed by ubiquitin promoter. The plasmid was transformed into maize (Zea mays) immature embryos using Agrobacterium-mediated transformation method. Total 74 regenerated plants were obtained and PCR analysis showed that these transgenic plants had the integration of mAM79. Southern blot analysis was performed on the genomic DNA from four transgenic lines, and the result showed that one or two copies of mAM79 were integrated into maize genome. RT-PCR analysis result indicated that mAM79 was highly transcribed in transgenic maize plants. When sprayed with glyphosate, transgenic maize line AM85 and AM72 could tolerate 4-fold of commercial usage of glyphosate;however, al the non-transgenic maize plants were kil ed by glyphosate. The results in this study conifrmed that mAM79 could be used to develop glyphosate-tolerant maize, and the obtained transgenic maize lines could be used for the breeding of glyphosate-tolerant maize.

  5. Study protocol for a group randomized controlled trial of a classroom-based intervention aimed at preventing early risk factors for drug abuse: integrating effectiveness and implementation research.

    Science.gov (United States)

    Poduska, Jeanne; Kellam, Sheppard; Brown, C Hendricks; Ford, Carla; Windham, Amy; Keegan, Natalie; Wang, Wei

    2009-09-02

    While a number of preventive interventions delivered within schools have shown both short-term and long-term impact in epidemiologically based randomized field trials, programs are not often sustained with high-quality implementation over time. This study was designed to support two purposes. The first purpose was to test the effectiveness of a universal classroom-based intervention, the Whole Day First Grade Program (WD), aimed at two early antecedents to drug abuse and other problem behaviors, namely, aggressive, disruptive behavior and poor academic achievement. The second purpose--the focus of this paper--was to examine the utility of a multilevel structure to support high levels of implementation during the effectiveness trial, to sustain WD practices across additional years, and to train additional teachers in WD practices. The WD intervention integrated three components, each previously tested separately: classroom behavior management; instruction, specifically reading; and family-classroom partnerships around behavior and learning. Teachers and students in 12 schools were randomly assigned to receive either the WD intervention or the standard first-grade program of the school system (SC). Three consecutive cohorts of first graders were randomized within schools to WD or SC classrooms and followed through the end of third grade to test the effectiveness of the WD intervention. Teacher practices were assessed over three years to examine the utility of the multilevel structure to support sustainability and scaling-up. The design employed in this trial appears to have considerable utility to provide data on WD effectiveness and to inform the field with regard to structures required to move evidence-based programs into practice. NCT00257088.

  6. Study protocol for a group randomized controlled trial of a classroom-based intervention aimed at preventing early risk factors for drug abuse: integrating effectiveness and implementation research

    Directory of Open Access Journals (Sweden)

    Keegan Natalie

    2009-09-01

    Full Text Available Abstract Background While a number of preventive interventions delivered within schools have shown both short-term and long-term impact in epidemiologically based randomized field trials, programs are not often sustained with high-quality implementation over time. This study was designed to support two purposes. The first purpose was to test the effectiveness of a universal classroom-based intervention, the Whole Day First Grade Program (WD, aimed at two early antecedents to drug abuse and other problem behaviors, namely, aggressive, disruptive behavior and poor academic achievement. The second purpose--the focus of this paper--was to examine the utility of a multilevel structure to support high levels of implementation during the effectiveness trial, to sustain WD practices across additional years, and to train additional teachers in WD practices. Methods The WD intervention integrated three components, each previously tested separately: classroom behavior management; instruction, specifically reading; and family-classroom partnerships around behavior and learning. Teachers and students in 12 schools were randomly assigned to receive either the WD intervention or the standard first-grade program of the school system (SC. Three consecutive cohorts of first graders were randomized within schools to WD or SC classrooms and followed through the end of third grade to test the effectiveness of the WD intervention. Teacher practices were assessed over three years to examine the utility of the multilevel structure to support sustainability and scaling-up. Discussion The design employed in this trial appears to have considerable utility to provide data on WD effectiveness and to inform the field with regard to structures required to move evidence-based programs into practice. Trial Registration Clinical Trials Registration Number: NCT00257088

  7. A randomized controlled comparison of integrative cognitive-affective therapy (ICAT) and enhanced cognitive-behavioral therapy (CBT-E) for bulimia nervosa.

    Science.gov (United States)

    Wonderlich, S A; Peterson, C B; Crosby, R D; Smith, T L; Klein, M H; Mitchell, J E; Crow, S J

    2014-02-01

    The purpose of this investigation was to compare a new psychotherapy for bulimia nervosa (BN), integrative cognitive-affective therapy (ICAT), with an established treatment, 'enhanced' cognitive-behavioral therapy (CBT-E). Eighty adults with symptoms of BN were randomized to ICAT or CBT-E for 21 sessions over 19 weeks. Bulimic symptoms, measured by the Eating Disorder Examination (EDE), were assessed at baseline, at the end of treatment (EOT) and at the 4-month follow-up. Treatment outcome, measured by binge eating frequency, purging frequency, global eating disorder severity, emotion regulation, self-oriented cognition, depression, anxiety and self-esteem, was determined using generalized estimating equations (GEEs), logistic regression and a general linear model (intent-to-treat). Both treatments were associated with significant improvement in bulimic symptoms and in all measures of outcome, and no statistically significant differences were observed between the two conditions at EOT or follow-up. Intent-to-treat abstinence rates for ICAT (37.5% at EOT, 32.5% at follow-up) and CBT-E (22.5% at both EOT and follow-up) were not significantly different. ICAT was associated with significant improvements in bulimic and associated symptoms that did not differ from those obtained with CBT-E. This initial randomized controlled trial of a new individual psychotherapy for BN suggests that targeting emotion and self-oriented cognition in the context of nutritional rehabilitation may be efficacious and worthy of further study.

  8. An Integrated Approach to Control Soil-Transmitted Helminthiasis, Schistosomiasis, Intestinal Protozoa Infection, and Diarrhea: Protocol for a Cluster Randomized Trial.

    Science.gov (United States)

    Raso, Giovanna; Essé, Clémence; Dongo, Kouassi; Ouattara, Mamadou; Zouzou, Fabien; Hürlimann, Eveline; Koffi, Veronique A; Coulibaly, Gaoussou; Mahan, Virginie; Yapi, Richard B; Koné, Siaka; Coulibaly, Jean Tenena; Meïté, Aboulaye; Guéhi-Kabran, Marie-Claire; Bonfoh, Bassirou; N'Goran, Eliézer Kouakou; Utzinger, Jürg

    2018-06-12

    The global strategy to control helminthiases (schistosomiasis and soil-transmitted helminthiasis) emphasizes preventive chemotherapy. However, in the absence of access to clean water, improved sanitation, and adequate hygiene, reinfection after treatment can occur rapidly. Integrated approaches might be necessary to sustain the benefits of preventive chemotherapy and make progress toward interruption of helminthiases transmission. The aim of this study was to assess and quantify the effect of an integrated control package that consists of preventive chemotherapy, community-led total sanitation, and health education on soil-transmitted helminthiasis, schistosomiasis, intestinal protozoa infection, and diarrhea in rural Côte d'Ivoire. In a first step, a community health education program was developed that includes an animated cartoon to promote improved hygiene and health targeting school-aged children, coupled with a health education theater for the entire community. In a second step, a cluster randomized trial was implemented in 56 communities of south-central Côte d'Ivoire with 4 intervention arms: (1) preventive chemotherapy; (2) preventive chemotherapy plus community-led total sanitation; (3) preventive chemotherapy plus health education; and (4) all 3 interventions combined. Before implementation of the aforementioned interventions, a baseline parasitologic, anthropometric, and hygiene-related knowledge, attitudes, practices, and beliefs survey was conducted. These surveys were repeated 18 and 39 months after the baseline cross-sectional survey to determine the effect of different interventions on helminth and intestinal protozoa infection, nutritional indicators, and knowledge, attitudes, practices, and beliefs. Monitoring of diarrhea was done over a 24-month period at 2-week intervals, starting right after the baseline survey. Key results from this cluster randomized trial will shed light on the effect of integrated approaches consisting of preventive

  9. Integrating mobile phones into medical abortion provision: intervention development, use, and lessons learned from a randomized controlled trial.

    Science.gov (United States)

    de Tolly, Katherine Marianne; Constant, Deborah

    2014-02-14

    Medical abortion is legal in South Africa but access and acceptability are hampered by the current protocol requiring a follow-up visit to assess abortion completion. To assess the feasibility and efficacy of information and follow-up provided via mobile phone after medical abortion in a randomized controlled trial (RCT). Mobile phones were used in three ways in the study: (1) coaching women through medical abortion using short message service (SMS; text messages); (2) a questionnaire to assess abortion completion via unstructured supplementary service data (USSD, a protocol used by GSM mobile telephones that allows the user to interact with a server via text-based menus) and the South African mobile instant message and social networking application Mxit; and (3) family planning information via SMS, mobisite and Mxit. A needs and context assessment was done to learn about women's experiences undergoing medical abortion and their use of mobile phones. After development, the mobile interventions were piloted. Recruitment was done by field workers at the clinics. In the RCT, women were interviewed at baseline and exit. Computer logs were also analyzed. All study participants received standard of care at the clinics. In the RCT, 234 women were randomized to the intervention group. Eight did not receive the intervention due to invalid numbers, mis-registration, system failure, or opt-out, leaving 226 participants receiving the full intervention. Of the 226, 190 returned and were interviewed at their clinic follow-up visit. The SMSs were highly acceptable, with 97.9% (186/190) saying that the SMSs helped them through the medical abortion. In terms of mobile phone privacy, 86.3% (202/234) said that it was not likely or possible that someone would see SMSs on their phone, although at exit, 20% (38/190) indicated that they had worried about phone privacy. Having been given training at baseline and subsequently asked via SMS to complete the self-assessment questionnaire, 90

  10. Can integrating the Memory Support Intervention into cognitive therapy improve depression outcome? Study protocol for a randomized controlled trial.

    Science.gov (United States)

    Harvey, Allison G; Dong, Lu; Lee, Jason Y; Gumport, Nicole B; Hollon, Steven D; Rabe-Hesketh, Sophia; Hein, Kerrie; Haman, Kirsten; McNamara, Mary E; Weaver, Claire; Martinez, Armando; Notsu, Haruka; Zieve, Garret; Armstrong, Courtney C

    2017-11-14

    The Memory Support Intervention was developed in response to evidence showing that: (1) patient memory for treatment is poor, (2) poor memory for treatment is associated with poorer adherence and poorer outcome, (3) the impact of memory impairment can be minimized by the use of memory support strategies and (4) improved memory for treatment improves outcome. The aim of this study protocol is to conduct a confirmatory efficacy trial to test whether the Memory Support Intervention improves illness course and functional outcomes. As a "platform" for the next step in investigating this approach, we focus on major depressive disorder (MDD) and cognitive therapy (CT). Adults with MDD (n = 178, including 20% for potential attrition) will be randomly allocated to CT + Memory Support or CT-as-usual and will be assessed at baseline, post treatment and at 6 and 12 months' follow-up (6FU and 12FU). We will compare the effects of CT + Memory Support vs. CT-as-usual to determine if the new intervention improves the course of illness and reduces functional impairment (aim 1). We will determine if patient memory for treatment mediates the relationship between treatment condition and outcome (aim 2). We will evaluate if previously reported poor treatment response subgroups moderate target engagement (aim 3). The Memory Support Intervention has been developed to be "transdiagnostic" (relevant to a broad range of mental disorders) and "pantreatment" (relevant to a broad range of types of treatment). This study protocol describes a "next step" in the treatment development process by testing the Memory Support Intervention for major depressive disorder (MDD) and cognitive therapy (CT). If the results are promising, future directions will test the applicability to other kinds of interventions and disorders and in other settings. ClinicalTrials.gov, ID: NCT01790919 . Registered on 6 October 2016.

  11. Integrated Application of Random Forest and Artificial Neural Network Algorithms to Predict Viral Contamination in Coastal Waters

    Science.gov (United States)

    Shamkhali Chenar, S.; Deng, Z.

    2017-12-01

    Pathogenic viruses pose a significant public health threat and economic losses to shellfish industry in the coastal environment. Norovirus is a contagious virus and the leading cause of epidemic gastroenteritis following consumption of oysters harvested from sewage-contaminated waters. While it is challenging to detect noroviruses in coastal waters due to the lack of sensitive and routine diagnostic methods, machine learning techniques are allowing us to prevent or at least reduce the risks by developing effective predictive models. This study attempts to develop an algorithm between historical norovirus outbreak reports and environmental parameters including water temperature, solar radiation, water level, salinity, precipitation, and wind. For this purpose, the Random Forests statistical technique was utilized to select relevant environmental parameters and their various combinations with different time lags controlling the virus distribution in oyster harvesting areas along the Louisiana Coast. An Artificial Neural Networks (ANN) approach was then presented to predict the outbreaks using a final set of input variables. Finally, a sensitivity analysis was conducted to evaluate relative importance and contribution of the input variables to the model output. Findings demonstrated that the developed model was capable of reproducing historical oyster norovirus outbreaks along the Louisiana Coast with the overall accuracy of than 99.83%, demonstrating the efficacy of the model. Moreover, the increase in water temperature, solar radiation, water level, and salinity, and the decrease in wind and rainfall are associated with the reduction in the model-predicted risk of norovirus outbreak according to sensitivity analysis results. In conclusion, the presented machine learning approach provided reliable tools for predicting potential norovirus outbreaks and could be used for early detection of possible outbreaks and reduce the risk of norovirus to public health and the

  12. A Randomized Trial of Pocket-Echocardiography Integrated Mobile Health Device Assessments in Modern Structural Heart Disease Clinics.

    Science.gov (United States)

    Bhavnani, Sanjeev P; Sola, Srikanth; Adams, David; Venkateshvaran, Ashwin; Dash, P K; Sengupta, Partho P

    2018-04-01

    This study sought to determine whether mobile health (mHealth) device assessments used as clinical decision support tools at the point-of-care can reduce the time to treatment and improve long-term outcomes among patients with rheumatic and structural heart diseases (SHD). Newly developed smartphone-connected mHealth devices represent promising methods to diagnose common diseases in resource-limited areas; however, the impact of technology-based care on long-term outcomes has not been rigorously evaluated. A total of 253 patients with SHD were randomized to an initial diagnostic assessment with wireless devices in mHealth clinics (n = 139) or to standard-care (n = 114) in India. mHealth clinics were equipped with point-of-care devices including pocket-echocardiography, smartphone-connected-electrocardiogram blood pressure and oxygen measurements, activity monitoring, and portable brain natriuretic peptide laboratory testing. All individuals underwent comprehensive transthoracic echocardiography to assess the severity of SHD. The primary endpoint was the time to referral for therapy with percutaneous valvuloplasty or surgical valve replacement. Secondary endpoints included the probability of a cardiovascular hospitalization and/or death over 1 year. An initial mHealth assessment was associated with a shorter time to referral for valvuloplasty and/or valve replacement (83 ± 79 days vs. 180 ± 101 days; p Mobile Health Device Assessments in Modern Structural Heart Disease Clinics; NCT02881398). Copyright © 2018 American College of Cardiology Foundation. Published by Elsevier Inc. All rights reserved.

  13. Transgene inheritances and genetic similarities of near isogenic lines of genetically modified common beans Herança de transgenes e similaridade genética de linhagens quase isogênicas de feijoeiro-comum geneticamente modificado

    Directory of Open Access Journals (Sweden)

    Patrícia Valle Pinheiro

    2009-09-01

    Full Text Available The objective of the present work was to determine the inheritance and stability of transgenes of a transgenic bean line expressing the genes rep-trap-ren from Bean golden mosaic virus and the bar gene. Crosses were done between the transgenic line and four commercial bean cultivars, followed by four backcrosses to the commercial cultivars. Progenies from each cross were evaluated for the presence of the transgenes by brushing the leaves with glufosinate ammonium and by polymerase chain reaction using specific oligonucleotides. Advanced generations were rub-inoculated with an isolate of Bean common mosaic necrosis virus (BCMNV. The transgenes were inherited consistently in a Mendelian pattern in the four crosses studied. The analyzed lines recovered close to 80% of the characteristics of the recurrent parent, as determined by the random amplified DNA markers used, besides maintaining important traits such as resistance to BCMNV. The presence of the transgene did not cause any detectable undesirable effect in the evaluated progenies.O objetivo do presente trabalho foi determinar a herança e a estabilidade de transgenes de uma linhagem de feijoeiro-comum com expressão dos genes rep-trap-ren, do Bean golden mosaic virus, e do gene bar. Foram realizados cruzamentos entre a linhagem transgênica e quatro cultivares comerciais de feijão, seguidos de quatro retrocruzamentos. As progênies de cada cruzamento foram avaliadas quanto à presença dos transgenes, com aplicação do glifosinato de amônia nas folhas e por meio da reação da polimerase em cadeia com uso de oligonucleotídeos específicos. O vírus do mosaico comum necrótico do feijoeiro, Bean common mosaic necrosis virus (BCMNV, foi inoculado mecanicamente nas gerações avançadas. Os transgenes foram herdados em padrão mendeliano nos quatro cruzamentos estudados. As linhagens analisadas apresentaram cerca de 80% das características do parental recorrente, conforme determinado por an

  14. Transgenic rabbits as a model organism for production of human clotting factor VIII

    International Nuclear Information System (INIS)

    Vasicek, D.; Chrenek, P.; Makarevich, A.; Bauer, M.; Jurcik, R.; Suvegova, K.; Rafay, J.; Bulla, J.; Hetenyi, L.; Erickson, J.; Paleyanda, R.K.

    2005-01-01

    Human clotting factor VIII (hFVIII) is a very complex and large protein whose expression is difficult, as hFVIII requires extensive post-translational modification to be biologically active. This paper reports the generation of transgenic rabbits as a model species for testing the expression of hFVIII in the mammary gland. For micro-injection, a fusion gene construct was used, consisting of 2.5 kb murine whey acidic protein (mWAP) promoter, 7.2 kb cDNA of hFVIII, and 4.6 kb of 3' flanking sequences of the mWAP gene. from 130 micro-injected zygotes transferred into recipients, 30 offspring were delivered. The pups were screened for the transgene by PCR, using DNA isolated from the ear, and results were confirmed by Southern blot analysis. The transgene was identified in one female founder animal, and it was transmitted to the offspring in a Mendelian fashion, thus demonstrating stable integration of the gene construct into the germline of the transgenic rabbits. (author)

  15. Production of germline transgenic prairie voles (Microtus ochrogaster) using lentiviral vectors.

    Science.gov (United States)

    Donaldson, Zoe R; Yang, Shang-Hsun; Chan, Anthony W S; Young, Larry J

    2009-12-01

    The study of alternative model organisms has yielded tremendous insights into the regulation of behavioral and physiological traits not displayed by more widely used animal models, such as laboratory rats and mice. In particular, comparative approaches often exploit species ideally suited for investigating specific phenomenon. For instance, comparative studies of socially monogamous prairie voles and polygamous meadow voles have been instrumental toward gaining an understanding of the genetic and neurobiological basis of social bonding. However, laboratory studies of less commonly used organisms, such as prairie voles, have been limited by a lack of genetic tools, including the ability to manipulate the genome. Here, we show that lentiviral vector-mediated transgenesis is a rapid and efficient approach for creating germline transgenics in alternative laboratory rodents. Injection of a green fluorescent protein (GFP)-expressing lentiviral vector into the perivitelline space of 23 single-cell embryos yielded three live offspring (13 %), one of which (33%) contained germline integration of a GFP transgene driven by the human ubiquitin-C promoter. In comparison, transfer of 23 uninjected embryos yielded six live offspring (26%). Green fluorescent protein is present in all tissues examined and is expressed widely in the brain. The GFP transgene is heritable and stably expressed until at least the F(2) generation. This technology has the potential to allow investigation of specific gene candidates in prairie voles and provides a general protocol to pursue germline transgenic manipulation in many different rodent species.

  16. Findings From the EASY Minds Cluster Randomized Controlled Trial: Evaluation of a Physical Activity Integration Program for Mathematics in Primary Schools.

    Science.gov (United States)

    Riley, Nicholas; Lubans, David R; Holmes, Kathryn; Morgan, Philip J

    2016-02-01

    To evaluate the impact of a primary school-based physical activity (PA) integration program delivered by teachers on objectively measured PA and key educational outcomes. Ten classes from 8 Australian public schools were randomly allocated to treatment conditions. Teachers from the intervention group were taught to embed movement-based learning in their students' (n = 142) daily mathematics program in 3 lessons per week for 6 weeks. The control group (n = 98) continued its regular mathematics program. The primary outcome was accelerometer-determined PA across the school day. Linear mixed models were used to analyze treatment effects. Significant intervention effects were found for PA across the school day (adjusted mean difference 103 counts per minute [CPM], 95% confidence interval [CI], 36.5-169.7, P = .008). Intervention effects were also found for PA (168 CPM, 95% CI, 90.1-247.4, P = .008) and moderate-to-vigorous PA (2.6%, 95% CI, 0.9-4.4, P = .009) in mathematics lessons, sedentary time across the school day (-3.5%, 95% CI, -7.0 to -0.13, P = .044) and during mathematics (-8.2%, CI, -13.0 to -2.0, P = .010) and on-task behavior (13.8%, 95% CI, 4.0-23.6, P = .011)-but not for mathematics performance or attitude. Integrating movement across the primary mathematics syllabus is feasible and efficacious.

  17. Material insights of HfO2-based integrated 1-transistor-1-resistor resistive random access memory devices processed by batch atomic layer deposition.

    Science.gov (United States)

    Niu, Gang; Kim, Hee-Dong; Roelofs, Robin; Perez, Eduardo; Schubert, Markus Andreas; Zaumseil, Peter; Costina, Ioan; Wenger, Christian

    2016-06-17

    With the continuous scaling of resistive random access memory (RRAM) devices, in-depth understanding of the physical mechanism and the material issues, particularly by directly studying integrated cells, become more and more important to further improve the device performances. In this work, HfO2-based integrated 1-transistor-1-resistor (1T1R) RRAM devices were processed in a standard 0.25 μm complementary-metal-oxide-semiconductor (CMOS) process line, using a batch atomic layer deposition (ALD) tool, which is particularly designed for mass production. We demonstrate a systematic study on TiN/Ti/HfO2/TiN/Si RRAM devices to correlate key material factors (nano-crystallites and carbon impurities) with the filament type resistive switching (RS) behaviours. The augmentation of the nano-crystallites density in the film increases the forming voltage of devices and its variation. Carbon residues in HfO2 films turn out to be an even more significant factor strongly impacting the RS behaviour. A relatively higher deposition temperature of 300 °C dramatically reduces the residual carbon concentration, thus leading to enhanced RS performances of devices, including lower power consumption, better endurance and higher reliability. Such thorough understanding on physical mechanism of RS and the correlation between material and device performances will facilitate the realization of high density and reliable embedded RRAM devices with low power consumption.

  18. A Randomized Controlled Trial on The Beneficial Effects of Training Letter-Speech Sound Integration on Reading Fluency in Children with Dyslexia.

    Directory of Open Access Journals (Sweden)

    Gorka Fraga González

    Full Text Available A recent account of dyslexia assumes that a failure to develop automated letter-speech sound integration might be responsible for the observed lack of reading fluency. This study uses a pre-test-training-post-test design to evaluate the effects of a training program based on letter-speech sound associations with a special focus on gains in reading fluency. A sample of 44 children with dyslexia and 23 typical readers, aged 8 to 9, was recruited. Children with dyslexia were randomly allocated to either the training program group (n = 23 or a waiting-list control group (n = 21. The training intensively focused on letter-speech sound mapping and consisted of 34 individual sessions of 45 minutes over a five month period. The children with dyslexia showed substantial reading gains for the main word reading and spelling measures after training, improving at a faster rate than typical readers and waiting-list controls. The results are interpreted within the conceptual framework assuming a multisensory integration deficit as the most proximal cause of dysfluent reading in dyslexia.ISRCTN register ISRCTN12783279.

  19. Transgenic nonhuman primates for neurodegenerative diseases

    Directory of Open Access Journals (Sweden)

    Chan Anthony WS

    2004-06-01

    Full Text Available Abstract Animal models that represent human diseases constitute an important tool in understanding the pathogenesis of the diseases, and in developing effective therapies. Neurodegenerative diseases are complex disorders involving neuropathologic and psychiatric alterations. Although transgenic and knock-in mouse models of Alzheimer's disease, (AD, Parkinson's disease (PD and Huntington's disease (HD have been created, limited representation in clinical aspects has been recognized and the rodent models lack true neurodegeneration. Chemical induction of HD and PD in nonhuman primates (NHP has been reported, however, the role of intrinsic genetic factors in the development of the diseases is indeterminable. Nonhuman primates closely parallel humans with regard to genetic, neuroanatomic, and cognitive/behavioral characteristics. Accordingly, the development of NHP models for neurodegenerative diseases holds greater promise for success in the discovery of diagnoses, treatments, and cures than approaches using other animal species. Therefore, a transgenic NHP carrying a mutant gene similar to that of patients will help to clarify our understanding of disease onset and progression. Additionally, monitoring disease onset and development in the transgenic NHP by high resolution brain imaging technology such as MRI, and behavioral and cognitive testing can all be carried out simultaneously in the NHP but not in other animal models. Moreover, because of the similarity in motor repertoire between NHPs and humans, it will also be possible to compare the neurologic syndrome observed in the NHP model to that in patients. Understanding the correlation between genetic defects and physiologic changes (e.g. oxidative damage will lead to a better understanding of disease progression and the development of patient treatments, medications and preventive approaches for high risk individuals. The impact of the transgenic NHP model in understanding the role which

  20. Transgene mobilization and regulatory uncertainty for non-GE fruit products of transgenic rootstocks.

    Science.gov (United States)

    Haroldsen, Victor M; Chi-Ham, Cecilia L; Bennett, Alan B

    2012-10-31

    Genetically engineered (GE) rootstocks may offer some advantages for biotechnology applications especially in woody perennial crops such as grape or walnut. Transgrafting combines horticultural grafting practices with modern GE methods for crop improvement. Here, a non-GE conventional scion (upper stem portion) is grafted onto a transgenic GE rootstock. Thus, the scion does not contain the genetic modification present in the rootstock genome. We examined transgene presence in walnut and tomato GE rootstocks and non-GE fruit-bearing scions. Mobilization of transgene DNA, protein, and mRNA across the graft was not detected. Though transgenic siRNA mobilization was not observed in grafted tomatoes or walnut scions, transgenic siRNA signal was detected in walnut kernels. Prospective benefits from transgrafted plants include minimized risk of GE pollen flow (Lev-Yadun and Sederoff, 2001), possible use of more than one scion per approved GE rootstock which could help curb the estimated US$136 million (CropLife International, 2011) cost to bring a GE crop to international markets, as well as potential for improved consumer and market acceptance since the consumable product is not itself GE. Thus, transgrafting provides an alternative option for agricultural industries wishing to expand their biotechnology portfolio. Copyright © 2012 Elsevier B.V. All rights reserved.

  1. A randomized controlled evaluation of a spiritually integrated treatment for subclinical anxiety in the Jewish community, delivered via the Internet.

    Science.gov (United States)

    Rosmarin, David H; Pargament, Kenneth I; Pirutinsky, Steven; Mahoney, Annette

    2010-10-01

    This study evaluated the efficacy of a spiritually integrated treatment (SIT) for subclinical anxiety in the Jewish community. One hundred and twenty-five self-reported religious Jewish individuals with elevated levels of stress and worry received SIT (n=36), progressive muscle relaxation (PMR, n=42), or a waitlist control condition (WLC, n=47). SIT and PMR participants accessed Internet-based treatment on a daily basis for a period of 2 weeks. All participants completed self-report assessments at pre-treatment (T1), post-treatment (T2), and 6-8-week follow-up (T3). SIT participants reported large improvements in primary (stress and worry) and secondary (depression and intolerance of uncertainty) outcomes, and moderate improvements in spiritual outcomes (positive/negative religious coping; trust/mistrust in God). SIT participants reported greater belief in treatment credibility, greater expectancies from treatment and greater treatment satisfaction than PMR participants. SIT participants also reported better improvements in both primary outcomes (stress and worry), one of two secondary outcomes (intolerance of uncertainty), and two of four spiritual outcomes (positive religious coping and mistrust in God) compared to the WLC group, whereas PMR and WLC participants did not differ on most outcomes. Results of this investigation offer initial support for the efficacy of SIT for the treatment of subclinical anxiety symptoms among religious Jews. Results further suggest that it is important to incorporate spiritual content into treatment to help facilitate the delivery of psychotherapy to religious individuals. Copyright 2010 Elsevier Ltd. All rights reserved.

  2. Transgenic oil palm: production and projection.

    Science.gov (United States)

    Parveez, G K; Masri, M M; Zainal, A; Majid, N A; Yunus, A M; Fadilah, H H; Rasid, O; Cheah, S C

    2000-12-01

    Oil palm is an important economic crop for Malaysia. Genetic engineering could be applied to produce transgenic oil palms with high value-added fatty acids and novel products to ensure the sustainability of the palm oil industry. Establishment of a reliable transformation and regeneration system is essential for genetic engineering. Biolistic was initially chosen as the method for oil palm transformation as it has been the most successful method for monocotyledons to date. Optimization of physical and biological parameters, including testing of promoters and selective agents, was carried out as a prerequisite for stable transformation. This has resulted in the successful transfer of reporter genes into oil palm and the regeneration of transgenic oil palm, thus making it possible to improve the oil palm through genetic engineering. Besides application of the Biolistics method, studies on transformation mediated by Agrobacterium and utilization of the green fluorescent protein gene as a selectable marker gene have been initiated. Upon the development of a reliable transformation system, a number of useful targets are being projected for oil palm improvement. Among these targets are high-oleate and high-stearate oils, and the production of industrial feedstock such as biodegradable plastics. The efforts in oil palm genetic engineering are thus not targeted as commodity palm oil. Due to the long life cycle of the palm and the time taken to regenerate plants in tissue culture, it is envisaged that commercial planting of transgenic palms will not occur any earlier than the year 2020.

  3. Arsenic biotransformation and volatilization in transgenic rice

    Science.gov (United States)

    Meng, Xiang-Yan; Qin, Jie; Wang, Li-Hong; Duan, Gui-Lan; Sun, Guo-Xin; Wu, Hui-Lan; Chu, Cheng-Cai; Ling, Hong-Qing; Rosen, Barry P.; Zhu, Yong-Guan

    2011-01-01

    Summary Biotransformation of arsenic includes oxidation, reduction, methylation and conversion to more complex organic arsenicals. Members of the class of arsenite [As(III)] S-adenosylmethyltransferase enzymes catalyze As(III) methylation to a variety of mono-, di- and trimethylated species, some of which are less toxic than As(III) itself. However, no methyltransferase gene has been identified in plants. Here, an arsM gene from the soil bacterium Rhodopseudomonas palustris was expressed in Japonica rice (Oryza sativa L.) cultivar Nipponbare, and the transgenic rice produced methylated arsenic species, which were measured by inductively coupled plasma mass spectrometry (ICP-MS) and high performance liquid chromatography-inductively coupled plasma-mass spectrometry (HPLC-ICP-MS). Both monomethylarsenate [MAs(V)] and dimethylarsenate [DMAs(V)] were detected in the root and shoot of transgenic rice. After 12-d exposure to As(III), the transgenic rice gave off 10-fold more volatile arsenicals. The present study demonstrates that expression of an arsM gene in rice induces arsenic methylation and volatilization, providing a potential stratagem for phytoremediation theoretically. PMID:21517874

  4. Potential transgenic routes to increase tree biomass.

    Science.gov (United States)

    Dubouzet, Joseph G; Strabala, Timothy J; Wagner, Armin

    2013-11-01

    Biomass is a prime target for genetic engineering in forestry because increased biomass yield will benefit most downstream applications such as timber, fiber, pulp, paper, and bioenergy production. Transgenesis can increase biomass by improving resource acquisition and product utilization and by enhancing competitive ability for solar energy, water, and mineral nutrients. Transgenes that affect juvenility, winter dormancy, and flowering have been shown to influence biomass as well. Transgenic approaches have increased yield potential by mitigating the adverse effects of prevailing stress factors in the environment. Simultaneous introduction of multiple genes for resistance to various stress factors into trees may help forest trees cope with multiple or changing environments. We propose multi-trait engineering for tree crops, simultaneously deploying multiple independent genes to address a set of genetically uncorrelated traits that are important for crop improvement. This strategy increases the probability of unpredictable (synergistic or detrimental) interactions that may substantially affect the overall phenotype and its long-term performance. The very limited ability to predict the physiological processes that may be impacted by such a strategy requires vigilance and care during implementation. Hence, we recommend close monitoring of the resultant transgenic genotypes in multi-year, multi-location field trials. Copyright © 2013 The Authors. Published by Elsevier Ireland Ltd.. All rights reserved.

  5. An integrated intervention to reduce intimate partner violence and psychological distress with refugees in low-resource settings: study protocol for the Nguvu cluster randomized trial.

    Science.gov (United States)

    Tol, Wietse A; Greene, M Claire; Likindikoki, Samuel; Misinzo, Lusia; Ventevogel, Peter; Bonz, Ann G; Bass, Judith K; Mbwambo, Jessie K K

    2017-05-18

    Intimate partner violence (IPV) is a critical public health and human rights concern globally, including for refugee women in low-resource settings. Little is known about effective interventions for this population. IPV and psychological distress have a bi-directional relationship, indicating the potential benefit of a structured psychological component as part of efforts to reduce IPV for women currently in violent relationships. This protocol describes a cluster randomized controlled trial aimed at evaluating an 8-session integrated psychological and advocacy intervention (Nguvu) with female adult survivors of past-year IPV displaying moderate to severe psychological distress. Outcomes are reductions in: recurrence of IPV; symptoms of anxiety, depression and post-traumatic stress (primary); and functional impairment (secondary). Hypothesized mediators of the intervention are improvements in social support, coping skills and support seeking. We will recruit 400 participants from existing women's support groups operating within villages in Nyarugusu refugee camp, Tanzania. Women's groups will be randomized to receive the intervention (Nguvu and usual care) or usual care alone. All eligible women will complete a baseline assessment (week 0) followed by a post-treatment (week 9) and a 3-month post-treatment assessment (week 20). The efficacy of the intervention will be determined by between-group differences in the longitudinal trajectories of primary outcomes evaluated using mixed-effects models. Study procedures have been approved by Institutional Review Boards in the United States and Tanzania. This trial will provide evidence on the efficacy of a novel integrated group intervention aimed at secondary prevention of IPV that includes a structured psychological component to address psychological distress. The psychological and advocacy components of the proposed intervention have been shown to be efficacious for their respective outcomes when delivered in

  6. Max Launch Abort System (MLAS) Pad Abort Test Vehicle (PATV) II Attitude Control System (ACS) Integration and Pressurization Subsystem Dynamic Random Vibration Analysis

    Science.gov (United States)

    Ekrami, Yasamin; Cook, Joseph S.

    2011-01-01

    In order to mitigate catastrophic failures on future generation space vehicles, engineers at the National Aeronautics and Space Administration have begun to integrate a novel crew abort systems that could pull a crew module away in case of an emergency at the launch pad or during ascent. The Max Launch Abort System (MLAS) is a recent test vehicle that was designed as an alternative to the baseline Orion Launch Abort System (LAS) to demonstrate the performance of a "tower-less" LAS configuration under abort conditions. The MLAS II test vehicle will execute a propulsive coast stabilization maneuver during abort to control the vehicles trajectory and thrust. To accomplish this, the spacecraft will integrate an Attitude Control System (ACS) with eight hypergolic monomethyl hydrazine liquid propulsion engines that are capable of operating in a quick pulsing mode. Two main elements of the ACS include a propellant distribution subsystem and a pressurization subsystem to regulate the flow of pressurized gas to the propellant tanks and the engines. The CAD assembly of the Attitude Control System (ACS) was configured and integrated into the Launch Abort Vehicle (LAV) design. A dynamic random vibration analysis was conducted on the Main Propulsion System (MPS) helium pressurization panels to assess the response of the panel and its components under increased gravitational acceleration loads during flight. The results indicated that the panels fundamental and natural frequencies were farther from the maximum Acceleration Spectral Density (ASD) vibrations which were in the range of 150-300 Hz. These values will direct how the components will be packaged in the vehicle to reduce the effects high gravitational loads.

  7. Rapid transcriptional pulsing dynamics of high expressing retroviral transgenes in embryonic stem cells.

    Directory of Open Access Journals (Sweden)

    Mandy Y M Lo

    Full Text Available Single cell imaging studies suggest that transcription is not continuous and occurs as discrete pulses of gene activity. To study mechanisms by which retroviral transgenes can transcribe to high levels, we used the MS2 system to visualize transcriptional dynamics of high expressing proviral integration sites in embryonic stem (ES cells. We established two ES cell lines each bearing a single copy, self-inactivating retroviral vector with a strong ubiquitous human EF1α gene promoter directing expression of mRFP fused to an MS2-stem-loop array. Transfection of MS2-EGFP generated EGFP focal dots bound to the mRFP-MS2 stem loop mRNA. These transcription foci colocalized with the transgene integration site detected by immunoFISH. Live tracking of single cells for 20 minutes detected EGFP focal dots that displayed frequent and rapid fluctuations in transcription over periods as short as 25 seconds. Similarly rapid fluctuations were detected from focal doublet signals that colocalized with replicated proviral integration sites by immunoFISH, consistent with transcriptional pulses from sister chromatids. We concluded that retroviral transgenes experience rapid transcriptional pulses in clonal ES cell lines that exhibit high level expression. These events are directed by a constitutive housekeeping gene promoter and may provide precedence for rapid transcriptional pulsing at endogenous genes in mammalian stem cells.

  8. Expression of a cucumber class III chitinase and Nicotiana plumbaginifolia class I glucanase genes in transgenic potato plants

    NARCIS (Netherlands)

    Moravcikova, J.; Matusikova, I.; Libantova, J.; Bauer, M.; Mlynarova, L.

    2004-01-01

    The genes encoding for a cucumber class III chitinase and Nicotiana plumbaginifolia class I glucanase were co-introduced into Slovak potato (Solanum tuberosum L.) breeding line 116/86 using Agrobacterium tumefaciens. For both transgenes the number of integrated copies and level of RNA expression

  9. Oral pilocarpine for radiation-induced xerostomia: integrated efficacy and safety results from two prospective randomized clinical trials

    International Nuclear Information System (INIS)

    Rieke, John W.; Hafermann, Mark D.; Johnson, Jonas T.; LeVeque, Francis G.; Iwamoto, Ryan; Steiger, Barry W.; Muscoplat, Charles; Gallagher, Susan C.

    1995-01-01

    Purpose: Pilocarpine hydrochloride administered in either a fixed-dose or in a dose-titration protocol three times a day for 12 weeks was evaluated for its ability to relieve symptoms of postradiation xerostomia and to improve saliva production. The studies were randomized, double-blind, placebo-controlled, multicenter clinical trials. A total of 369 patients who had received at least 40 Gy of radiation to the head and neck with clinically significant xerostomia were enrolled in the two studies. In the dose-titration study, 162 patients were enrolled and they received a thrice daily regimen of 2.5 mg tablets for first 4 weeks, 5.0 mg tablets for the second 4 weeks, and 10.0 mg tablets for last 4 weeks of a 12-week study. Patients in the titration study were allowed to down titrate following at least one dose escalation to alleviate bothersome side effects, if any. In the fixed dose study, 207 patients received either placebo, 5.0 mg, or 10.0 mg tablets t.i.d. for 12 weeks. Methods and Materials: Patients were evaluated for symptomatic relief by responding to questionnaires using visual analog scales and categorical questions; and, for saliva production by sialometry. Questionnaires measured relief of intraoral dryness, improvement in overall condition (global response), oral discomfort, difficulty in speaking, chewing and swallowing, denture wearing, and usage of artificial saliva. Evaluations were conducted at baseline, and weeks 4, 8, and 12. Results: There were statistically significant improvements in salivary flow in pilocarpine treatment groups vs. placebo. There was a significant improvement in the overall 'global' condition of xerostomia associated with the use of pilocarpine in both studies. In the fixed-dose study, there were significant improvements in oral dryness, mouth comfort, ability to speak, and reduction in the use of oral comfort agents. The dose-titration study showed improvements in dryness that approached significance (p = 0.057) and a

  10. Welfare assessment in transgenic pigs expressing green fluorescent protein (GFP)

    DEFF Research Database (Denmark)

    Huber, Reinhard C.; Remuge, Liliana; Carlisle, Ailsa

    2012-01-01

    Since large animal transgenesis has been successfully attempted for the first time about 25 years ago, the technology has been applied in various lines of transgenic pigs. Nevertheless one of the concerns with the technology—animal welfare—has not been approached through systematic assessment...... and statements regarding the welfare of transgenic pigs have been based on anecdotal observations during early stages of transgenic programs. The main aim of the present study was therefore to perform an extensive welfare assessment comparing heterozygous transgenic animals expressing GFP with wildtype animals...... months. The absence of significant differences between GFP and wildtype animals in the parameters observed suggests that the transgenic animals in question are unlikely to suffer from deleterious effects of transgene expression on their welfare and thus support existing anecdotal observations of pigs...

  11. Postmortem findings in cloned and transgenic piglets dead before weaning

    DEFF Research Database (Denmark)

    Schmidt, Mette; Winther, K.D.; Secher, Jan Ole Bertelsen

    2015-01-01

    Important factors contributing to the well-known high mortality of piglets produced by SCNT are gross malformations of vital organs. The aim of the present retrospective study was to describe malformations found in cloned piglets, transgenic or not, dying or culled before weaning on Day 28. Large...... White (LW) embryos were transferred to 78 LW recipients, while 72 recipients received Göttingen embryos (67 transgenic and five not transgenic) and 56 received Yucatan embryos (43 transgenic and 13 not transgenic). Overall pregnancy rate was 76%, and there were more abortions in recipients with minipig...... in 152 piglets, but several piglets showed two (n = 58) or more (n = 23) malformations (7.4% and 2.8% of all born, respectively). A significantly higher malformation rate was found in transgenic Göttingen and Yucatan piglets (32% and 46% of all born, respectively) than in nontransgenic LW (17...

  12. ФC31 Integrase-Mediated Isolation and Characterization of Novel Safe Harbors for Transgene Expression in the Pig Genome

    Science.gov (United States)

    Bi, Yanzhen; Hua, Zaidong; Ren, Hongyan; Zhang, Liping; Xiao, Hongwei; Liu, Ximei; Hua, Wenjun; Mei, Shuqi; Molenaar, Adrian; Laible, Götz; Zheng, Xinmin

    2018-01-01

    Programmable nucleases have allowed the rapid development of gene editing and transgenics, but the technology still suffers from the lack of predefined genetic loci for reliable transgene expression and maintenance. To address this issue, we used ФC31 integrase to navigate the porcine genome and identify the pseudo attP sites suitable as safe harbors for sustained transgene expression. The combined ФC31 integrase mRNA and an enhanced green fluorescence protein (EGFP) reporter donor were microinjected into one-cell zygotes for transgene integration. Among the resulting seven EGFP-positive piglets, two had transgene integrations at pseudo attP sites, located in an intergenic region of chromosome 1 (chr1-attP) and the 6th intron of the TRABD2A gene on chromosome 3 (chr3-attP), respectively. The integration structure was determined by TAIL-PCR and Southern blotting. Primary fibroblast cells were isolated from the two piglets and examined using fluorescence-activated cell sorting (FACS) and enzyme-linked immunosorbent assay (ELISA), which demonstrated that the chr1-attP site was more potent than chr3-attP site in supporting the EGFP expression. Both piglets had green feet under the emission of UV light, and pelleted primary fibroblast cells were green-colored under natural light, corroborating that the two pseudo attP sites are beneficial to transgene expression. The discovery of these two novel safe harbors for robust and durable transgene expression will greatly facilitate the use of transgenic pigs for basic, biomedical and agricultural studies and applications. PMID:29300364

  13. Improving pneumonia case-management in Benin: a randomized trial of a multi-faceted intervention to support health worker adherence to Integrated Management of Childhood Illness guidelines

    Directory of Open Access Journals (Sweden)

    Lama Marcel

    2009-08-01

    Full Text Available Abstract Background Pneumonia is a leading cause of death among children under five years of age. The Integrated Management of Childhood Illness strategy can improve the quality of care for pneumonia and other common illnesses in developing countries, but adherence to these guidelines could be improved. We evaluated an intervention in Benin to support health worker adherence to the guidelines after training, focusing on pneumonia case management. Methods We conducted a randomized trial. After a health facility survey in 1999 to assess health care quality before Integrated Management of Childhood Illness training, health workers received training plus either study supports (job aids, non-financial incentives and supervision of workers and supervisors or "usual" supports. Follow-up surveys were conducted in 2001, 2002 and 2004. Outcomes were indicators of health care quality for Integrated Management-defined pneumonia. Further analyses included a graphical pathway analysis and multivariable logistic regression modelling to identify factors influencing case-management quality. Results We observed 301 consultations of children with non-severe pneumonia that were performed by 128 health workers in 88 public and private health facilities. Although outcomes improved in both intervention and control groups, we found no statistically significant difference between groups. However, training proceeded slowly, and low-quality care from untrained health workers diluted intervention effects. Per-protocol analyses suggested that health workers with training plus study supports performed better than those with training plus usual supports (20.4 and 19.2 percentage-point improvements for recommended treatment [p = 0.08] and "recommended or adequate" treatment [p = 0.01], respectively. Both groups tended to perform better than untrained health workers. Analyses of treatment errors revealed that incomplete assessment and difficulties processing clinical findings

  14. A powerful transgenic tool for fate mapping and functional analysis of newly generated neurons

    Directory of Open Access Journals (Sweden)

    Vogt Weisenhorn Daniela M

    2010-12-01

    Full Text Available Abstract Background Lack of appropriate tools and techniques to study fate and functional integration of newly generated neurons has so far hindered understanding of neurogenesis' relevance under physiological and pathological conditions. Current analyses are either dependent on mitotic labeling, for example BrdU-incorporation or retroviral infection, or on the detection of transient immature neuronal markers. Here, we report a transgenic mouse model (DCX-CreERT2 for time-resolved fate analysis of newly generated neurons. This model is based on the expression of a tamoxifen-inducible Cre recombinase under the control of a doublecortin (DCX promoter, which is specific for immature neuronal cells in the CNS. Results In the DCX-CreERT2 transgenic mice, expression of CreERT2 was restricted to DCX+ cells. In the CNS of transgenic embryos and adult DCX-CreERT2 mice, tamoxifen administration caused the transient translocation of CreERT2 to the nucleus, allowing for the recombination of loxP-flanked sequences. In our system, tamoxifen administration at E14.5 resulted in reporter gene activation throughout the developing CNS of transgenic embryos. In the adult CNS, neurogenic regions were the primary sites of tamoxifen-induced reporter gene activation. In addition, reporter expression could also be detected outside of neurogenic regions in cells physiologically expressing DCX (e.g. piriform cortex, corpus callosum, hypothalamus. Four weeks after recombination, the vast majority of reporter-expressing cells were found to co-express NeuN, revealing the neuronal fate of DCX+ cells upon maturation. Conclusions This first validation demonstrates that our new DCX-CreERT2 transgenic mouse model constitutes a powerful tool to investigate neurogenesis, migration and their long-term fate of neuronal precursors. Moreover, it allows for a targeted activation or deletion of specific genes in neuronal precursors and will thereby contribute to unravel the molecular

  15. Highly efficient generation of knock-in transgenic medaka by CRISPR/Cas9-mediated genome engineering.

    Science.gov (United States)

    Watakabe, Ikuko; Hashimoto, Hisashi; Kimura, Yukiko; Yokoi, Saori; Naruse, Kiyoshi; Higashijima, Shin-Ichi

    2018-01-01

    Medaka ( Oryzias latipes ) is a popular animal model used in vertebrate genetic analysis. Recently, an efficient (~ 30%) knock-in system via non-homologous end joining (NHEJ) was established in zebrafish using the CRISPR/Cas9 system. If the same technique were applicable in medaka, it would greatly expand the usefulness of this model organism. The question of the applicability of CRISPR/Cas9 in medaka, however, has yet to be addressed. We report the highly efficient generation of knock-in transgenic medaka via non-homologous end joining (NHEJ). Donor plasmid containing a heat-shock promoter and a reporter gene was co-injected with a short guide RNA (sgRNA) targeted for genome digestion, an sgRNA targeted for donor plasmid digestion, and Cas9 mRNA. Broad transgene expression in the expression domain of a target gene was observed in approximately 25% of injected embryos. By raising these animals, we established stable knock-in transgenic fish with several different constructs for five genetic loci, obtaining transgenic founders at efficiencies of > 50% for all five loci. Further, we show that the method is useful for obtaining mutant alleles. In the experiments where transgene integrations were targeted between the transcription start site and the initiation methionine, the resultant transgenic fish became mutant alleles. With its simplicity, design flexibility, and high efficiency, we propose that CRISPR/Cas9-mediated knock-in via NHEJ will become a standard method for the generation of transgenic and mutant medaka.

  16. High-efficiency Agrobacterium-mediated transformation of chickpea (Cicer arietinum L.) and regeneration of insect-resistant transgenic plants.

    Science.gov (United States)

    Mehrotra, Meenakshi; Sanyal, Indraneel; Amla, D V

    2011-09-01

    To develop an efficient genetic transformation system of chickpea (Cicer arietinum L.), callus derived from mature embryonic axes of variety P-362 was transformed with Agrobacterium tumefaciens strain LBA4404 harboring p35SGUS-INT plasmid containing the uidA gene encoding β-glucuronidase (GUS) and the nptII gene for kanamycin selection. Various factors affecting transformation efficiency were optimized; as Agrobacterium suspension at OD(600) 0.3 with 48 h of co-cultivation period at 20°C was found optimal for transforming 10-day-old MEA-derived callus. Inclusion of 200 μM acetosyringone, sonication for 4 s with vacuum infiltration for 6 min improved the number of GUS foci per responding explant from 1.0 to 38.6, as determined by histochemical GUS assay. For introducing the insect-resistant trait into chickpea, binary vector pRD400-cry1Ac was also transformed under optimized conditions and 18 T(0) transgenic plants were generated, representing 3.6% transformation frequency. T(0) transgenic plants reflected Mendelian inheritance pattern of transgene segregation in T(1) progeny. PCR, RT-PCR, and Southern hybridization analysis of T(0) and T(1) transgenic plants confirmed stable integration of transgenes into the chickpea genome. The expression level of Bt-Cry protein in T(0) and T(1) transgenic chickpea plants was achieved maximum up to 116 ng mg(-1) of soluble protein, which efficiently causes 100% mortality to second instar larvae of Helicoverpa armigera as analyzed by an insect mortality bioassay. Our results demonstrate an efficient and rapid transformation system of chickpea for producing non-chimeric transgenic plants with high frequency. These findings will certainly accelerate the development of chickpea plants with novel traits.

  17. Integrating Depression Care Management into Medicare Home Health Reduces Risk of 30 and 60 Day Hospitalization: The Depression CAREPATH Cluster-Randomized Trial

    Science.gov (United States)

    Bruce, Martha L.; Lohman, Matthew C.; Greenberg, Rebecca L.; Bao, Yuhua; Raue, Patrick J.

    2016-01-01

    OBJECTIVES To determine whether a depression care management intervention among Medicare home health recipients decreases risks of hospitalization. DESIGN Cluster-randomized trial. Nurse teams were randomized to Intervention (12 teams) or Enhanced Usual Care (EUC; 9 teams). SETTING Six home health agencies from distinct geographic regions. Patients were interviewed at home and by telephone. PARTICIPANTS Patients age>65 who screened positive for depression on nurse assessments (N=755), and a subset who consented to interviews (N=306). INTERVENTION The Depression CAREPATH (CARE for PATients at Home) guides nurses in managing depression during routine home visits. Clinical functions include weekly symptom assessment, medication management, care coordination, patient education, and goal setting. Researchers conducted biweekly telephone conferences with team supervisors. MEASUREMENTS The study examined acute-care hospitalization and days to hospitalization. H1 used data from the home health record to examine hospitalization over 30-day and 60-day periods while a home health patient. H2 used data from both home care record and research assessments to examine 30-day hospitalization from any setting. RESULTS The adjusted hazard ratio (HR) of being admitted to hospital directly from home health within 30 days of start of home health care was 0.65 (p=.013) for CAREPATH compared to EUC patients, and 0.72 (p=.027) within 60 days. In patients referred to home health directly from hospital, the relative hazard of being rehospitalized was approximately 55% lower (HR = 0.45, p=.001) among CAREPATH patients. CONCLUSION Integrating CAREPATH depression care management into routine nursing practice reduces hospitalization and rehospitalization risk among older adults receiving Medicare home health nursing services. PMID:27739067

  18. Integrating Depression Care Management into Medicare Home Health Reduces Risk of 30- and 60-Day Hospitalization: The Depression Care for Patients at Home Cluster-Randomized Trial.

    Science.gov (United States)

    Bruce, Martha L; Lohman, Matthew C; Greenberg, Rebecca L; Bao, Yuhua; Raue, Patrick J

    2016-11-01

    To determine whether a depression care management intervention in Medicare home health recipients decreases risk of hospitalization. Cluster-randomized trial. Nurse teams were randomized to intervention (12 teams) or enhanced usual care (EUC; 9 teams). Six home health agencies from distinct geographic regions. Home health recipients were interviewed at home and over the telephone. Individuals aged 65 and older who screened positive for depression on nurse assessments (N = 755) and a subset who consented to interviews (n = 306). The Depression CARE for PATients at Home (CAREPATH) guides nurses in managing depression during routine home visits. Clinical functions include weekly symptom assessment, medication management, care coordination, patient education, and goal setting. Researchers conducted telephone conferences with team supervisors every 2 weeks. Hospitalization while receiving home health services was assessed using data from the home health record. Hospitalization within 30 days of starting home health, regardless of how long recipients received home health services, was assessed using data from the home care record and research assessments. The relative hazard of being admitted to the hospital directly from home health was 35% lower within 30 days of starting home health care (hazard ratio (HR) = 0.65, P = .01) and 28% lower within 60 days (HR = 0.72, P = .03) for CAREPATH participants than for participants receiving EUC. In participants referred to home health directly from the hospital, the relative hazard of being rehospitalized was approximately 55% lower (HR = 0.45, P = .001) for CAREPATH participants. Integrating CAREPATH depression care management into routine nursing practice reduces hospitalization and rehospitalization risk in older adults receiving Medicare home health nursing services. © 2016, Copyright the Authors Journal compilation © 2016, The American Geriatrics Society.

  19. Integrated Optical Content Addressable Memories (CAM and Optical Random Access Memories (RAM for Ultra-Fast Address Look-Up Operations

    Directory of Open Access Journals (Sweden)

    Christos Vagionas

    2017-07-01

    Full Text Available Electronic Content Addressable Memories (CAM implement Address Look-Up (AL table functionalities of network routers; however, they typically operate in the MHz regime, turning AL into a critical network bottleneck. In this communication, we demonstrate the first steps towards developing optical CAM alternatives to enable a re-engineering of AL memories. Firstly, we report on the photonic integration of Semiconductor Optical Amplifier-Mach Zehnder Interferometer (SOA-MZI-based optical Flip-Flop and Random Access Memories on a monolithic InP platform, capable of storing the binary prefix-address data-bits and the outgoing port information for next hop routing, respectively. Subsequently the first optical Binary CAM cell (B-CAM is experimentally demonstrated, comprising an InP Flip-Flop and a SOA-MZI Exclusive OR (XOR gate for fast search operations through an XOR-based bit comparison, yielding an error-free 10 Gb/s operation. This is later extended via physical layer simulations in an optical Ternary-CAM (T-CAM cell and a 4-bit Matchline (ML configuration, supporting a third state of the “logical X” value towards wildcard bits of network subnet masks. The proposed functional CAM and Random Access Memories (RAM sub-circuits may facilitate light-based Address Look-Up tables supporting search operations at 10 Gb/s and beyond, paving the way towards minimizing the disparity with the frantic optical transmission linerates, and fast re-configurability through multiple simultaneous Wavelength Division Multiplexed (WDM memory access requests.

  20. How Do School-Based Prevention Programs Impact Teachers? Findings from a Randomized Trial of an Integrated Classroom Management and Social-Emotional Program.

    Science.gov (United States)

    Domitrovich, Celene E; Bradshaw, Catherine P; Berg, Juliette K; Pas, Elise T; Becker, Kimberly D; Musci, Rashelle; Embry, Dennis D; Ialongo, Nicholas

    2016-04-01

    A number of classroom-based interventions have been developed to improve social and behavioral outcomes for students, yet few studies have examined how these programs impact the teachers who are implementing them. Impacts on teachers may affect students and therefore also serve as an important proximal outcome to examine. The current study draws upon data from a school-based randomized controlled trial testing the impact of two prevention programs. In one intervention condition, teachers were trained in the classroom behavior management program, PAX Good Behavior Game (PAX GBG). In a second intervention condition, teachers were trained to use an integrated program, referred to as PATHS to PAX, of the PAX GBG and a social and emotional learning curriculum called Promoting Alternative Thinking Strategies (PATHS©). This study aimed to determine whether both interventions positively impacted teachers, with a particular interest in the teachers' own beliefs and perceptions regarding self-efficacy, burnout, and social-emotional competence. The sample included 350 K-5 teachers across 27 schools (18 schools randomized to intervention, 9 to control). Multilevel latent growth curve analyses indicated that the PATHS to PAX condition generally demonstrated the most benefits to teachers, relative to both the control and PAX GBG conditions. These findings suggest that school-based preventive interventions can have a positive impact on teachers' beliefs and perceptions, particularly when the program includes a social-emotional component. Several possible mechanisms might account for the added benefit to teachers. Additional research is needed to better understand how these programs impact teachers, as well as students.

  1. Improving diets and nutrition through an integrated poultry value chain and nutrition intervention (SELEVER) in Burkina Faso: study protocol for a randomized trial.

    Science.gov (United States)

    Gelli, Aulo; Becquey, Elodie; Ganaba, Rasmane; Headey, Derek; Hidrobo, Melissa; Huybregts, Lieven; Verhoef, Hans; Kenfack, Romain; Zongouri, Sita; Guedenet, Hannah

    2017-09-06

    The SELEVER study is designed to evaluate the impact of an integrated agriculture-nutrition package of interventions (including poultry value chain development, women's empowerment activities, and a behavior change communications strategy to promote improved diets and feeding, care, and hygiene practices) on the diets, health, and nutritional status of women and children in Burkina Faso. This paper presents the rationale and study design. The impact evaluation involves a cluster randomized controlled trial design that will be implemented in 120 rural communities/villages within 60 communes supported by SELEVER in the Boucle de Mouhoun, Centre-Ouest, and Haut-Bassins regions of Burkina Faso. Communities will be randomly assigned to one of three treatment arms, including: (1) SELEVER intervention group; (2) SELEVER with an intensive WASH component; and (3) control group without intervention. Primary outcomes include the mean probability of adequacy of diets for women and children (aged 2-4 years at baseline), infant and young child feeding practices of caregivers of children aged 0-2 years, and household poultry production and sales. Intermediate outcomes along the agriculture and nutrition pathways will also be measured, including child nutrition status and development. The evaluation will follow a mixed-methods approach, including a panel of child-, household-, community-, and market-level surveys, and data collection points during post-harvest and lean seasons, as well as one year after implementation completion to examine sustainability. To our knowledge, this study is the first to rigorously examine from a food systems perspective, the simultaneous impact of scaling-up nutrition-specific and nutrition-sensitive interventions through a livestock value-chain and community-intervention platform, across nutrition, health, and agriculture domains. The findings of this evaluation will provide evidence to support the design of market-based nutrition

  2. Localization of introduced genes on the chromosomes of transgenic barley, wheat and triticale by fluorescence in situ hybridization

    DEFF Research Database (Denmark)

    Pedersen, C.; Zimny, J.; Becker, D.

    1997-01-01

    Using fluorescence in situ hybridization (FISH) we localized introduced genes on metaphase chromosomes of barley, wheat, and triticale transformed by microprojectile bombardment of microspores and scutellar tissue with the pDB1 plasmid containing the uidA and bar genes. Thirteen integration sites...... of single-copy integrations. There was a slight tendency towards the localization of transgenes in distal chromosome regions. Using the GAA-satellite sequence for chromosome banding, the chromosomes containing the inserted genes were identified in most cases. Two barley lines derived from the same...... transformant showed a totally different integration pattern. Southern analysis confirmed that the inserted genes were segregating independently, resulting in different integration patterns among the progeny lines. The application of the FISH technique for the analysis of transgenic plants is discussed....

  3. Establishment and characterization of CAG/EGFP transgenic rabbit line.

    Science.gov (United States)

    Takahashi, Ri-ichi; Kuramochi, Takashi; Aoyagi, Kazuki; Hashimoto, Shu; Miyoshi, Ichiro; Kasai, Noriyuki; Hakamata, Yoji; Kobayashi, Eiji; Ueda, Masatsugu

    2007-02-01

    Cell marking is a very important procedure for identifying donor cells after cell and/or organ transplantation in vivo. Transgenic animals expressing marker proteins such as enhanced green fluorescent protein (EGFP) in their tissues are a powerful tool for research in fields of tissue engineering and regenerative medicine. The purpose of this study was to establish transgenic rabbit lines that ubiquitously express EGFP under the control of the cytomegalovirus immediate early enhancer/beta-actin promoter (CAG) to provide a fluorescent transgenic animal as a bioresource. We microinjected the EGFP expression vector into 945 rabbit eggs and 4 independent transgenic candidate pups were obtained. Two of them died before sexual maturation and one was infertile. One transgenic male candidate founder rabbit was obtained and could be bred by artificial insemination. The rabbit transmitted the transgene in a Mendelian manner. Using fluorescence in situ hybridization analysis, we detected the transgene at 7q11 on chromosome 7 as a large centromeric region in two F1 offspring (one female and one male). Eventually, one transgenic line was established. Ubiquitous EGFP fluorescence was confirmed in all examined organs. There were no gender-related differences in fluorescence. The established CAG/EGFP transgenic rabbit will be an important bioresource and a useful tool for various studies in tissue engineering and regenerative medicine.

  4. Hepatic steatosis in transgenic mice overexpressing human histone deacetylase 1

    International Nuclear Information System (INIS)

    Wang, Ai-Guo; Seo, Sang-Beom; Moon, Hyung-Bae; Shin, Hye-Jun; Kim, Dong Hoon; Kim, Jin-Man; Lee, Tae-Hoon; Kwon, Ho Jeong; Yu, Dae-Yeul; Lee, Dong-Seok

    2005-01-01

    It is generally thought that histone deacetylases (HDACs) play important roles in the transcriptional regulation of genes. However, little information is available concerning the specific functions of individual HDACs in disease states. In this study, two transgenic mice lines were established which harbored the human HDAC1 gene. Overexpressed HDAC1 was detected in the nuclei of transgenic liver cells, and HDAC1 enzymatic activity was significantly higher in the transgenic mice than in control littermates. The HDAC1 transgenic mice exhibited a high incidence of hepatic steatosis and nuclear pleomorphism. Molecular studies showed that HDAC1 may contribute to nuclear pleomorphism through the p53/p21 signaling pathway

  5. Using the infrastructure of a conditional cash transfer program to deliver a scalable integrated early child development program in Colombia: cluster randomized controlled trial.

    Science.gov (United States)

    Attanasio, Orazio P; Fernández, Camila; Fitzsimons, Emla O A; Grantham-McGregor, Sally M; Meghir, Costas; Rubio-Codina, Marta

    2014-09-29

    To assess the effectiveness of an integrated early child development intervention, combining stimulation and micronutrient supplementation and delivered on a large scale in Colombia, for children's development, growth, and hemoglobin levels. Cluster randomized controlled trial, using a 2 × 2 factorial design, with municipalities assigned to one of four groups: psychosocial stimulation, micronutrient supplementation, combined intervention, or control. 96 municipalities in Colombia, located across eight of its 32 departments. 1420 children aged 12-24 months and their primary carers. Psychosocial stimulation (weekly home visits with play demonstrations), micronutrient sprinkles given daily, and both combined. All delivered by female community leaders for 18 months. Cognitive, receptive and expressive language, and fine and gross motor scores on the Bayley scales of infant development-III; height, weight, and hemoglobin levels measured at the baseline and end of intervention. Stimulation improved cognitive scores (adjusted for age, sex, testers, and baseline levels of outcomes) by 0.26 of a standard deviation (P=0.002). Stimulation also increased receptive language by 0.22 of a standard deviation (P=0.032). Micronutrient supplementation had no significant effect on any outcome and there was no interaction between the interventions. No intervention affected height, weight, or hemoglobin levels. Using the infrastructure of a national welfare program we implemented the integrated early child development intervention on a large scale and showed its potential for improving children's cognitive development. We found no effect of supplementation on developmental or health outcomes. Moreover, supplementation did not interact with stimulation. The implementation model for delivering stimulation suggests that it may serve as a promising blueprint for future policy on early childhood development.Trial registration Current Controlled trials ISRCTN18991160. © Attanasio et al 2014.

  6. Generation of transgenic cattle expressing human β-defensin 3 as an approach to reducing susceptibility to Mycobacterium bovis infection.

    Science.gov (United States)

    Su, Feng; Wang, Yongsheng; Liu, Guanghui; Ru, Kun; Liu, Xin; Yu, Yuan; Liu, Jun; Wu, Yongyan; Quan, Fusheng; Guo, Zekun; Zhang, Yong

    2016-03-01

    Bovine tuberculosis results from infection with Mycobacterium bovis, a member of the Mycobacterium tuberculosis family. Worldwide, M. bovis infections result in economic losses in the livestock industry; cattle production is especially hard-hit by this disease. Generating M. bovis-resistant cattle may potentially mitigate the impact of this disease by reducing M. bovis infections. In this study, we used transgenic somatic cell nuclear transfer to generate cattle expressing the gene encoding human β-defensin 3 (HBD3), which confers resistance to mycobacteria in vitro. We first generated alveolar epithelial cells expressing HBD3 under the control of the bovine MUC1 promoter, and confirmed that these cells secreted HBD3 and possessed anti-mycobacterial capacity. We then generated and identified transgenic cattle by somatic cell nuclear transfer. The cleavage and blastocyst formation rates of genetically modified embryos provided evidence that monoclonal transgenic bovine fetal fibroblast cells have an integral reprogramming ability that is similar to that of normal cells. Five genetically modified cows were generated, and their anti-mycobacterial capacities were evaluated. Alveolar epithelial cells and macrophages from these cattle expressed higher levels of HBD3 protein compared with non-transgenic cells and possessed effective anti-mycobacterial capacity. These results suggest that the overall risk of M. bovis infection in transgenic cattle is efficiently reduced, and support the development of genetically modified animals as an effective tool to reduce M. bovis infection. © 2016 Federation of European Biochemical Societies.

  7. Transgenic rice expressing a codon-modified synthetic CP4-EPSPS confers tolerance to broad-spectrum herbicide, glyphosate.

    Science.gov (United States)

    Chhapekar, Sushil; Raghavendrarao, Sanagala; Pavan, Gadamchetty; Ramakrishna, Chopperla; Singh, Vivek Kumar; Phanindra, Mullapudi Lakshmi Venkata; Dhandapani, Gurusamy; Sreevathsa, Rohini; Ananda Kumar, Polumetla

    2015-05-01

    Highly tolerant herbicide-resistant transgenic rice was developed by expressing codon-modified synthetic CP4--EPSPS. The transformants could tolerate up to 1% commercial glyphosate and has the potential to be used for DSR (direct-seeded rice). Weed infestation is one of the major biotic stress factors that is responsible for yield loss in direct-seeded rice (DSR). Herbicide-resistant rice has potential to improve the efficiency of weed management under DSR. Hence, the popular indica rice cultivar IR64, was genetically modified using Agrobacterium-mediated transformation with a codon-optimized CP4-EPSPS (5-enolpyruvylshikimate-3-phosphate synthase) gene, with N-terminal chloroplast targeting peptide from Petunia hybrida. Integration of the transgenes in the selected rice plants was confirmed by Southern hybridization and expression by Northern and herbicide tolerance assays. Transgenic plants showed EPSPS enzyme activity even at high concentrations of glyphosate, compared to untransformed control plants. T0, T1 and T2 lines were tested by herbicide bioassay and it was confirmed that the transgenic rice could tolerate up to 1% of commercial Roundup, which is five times more in dose used to kill weeds under field condition. All together, the transgenic rice plants developed in the present study could be used efficiently to overcome weed menace.

  8. Expression of a radish defensin in transgenic wheat confers increased resistance to Fusarium graminearum and Rhizoctonia cerealis.

    Science.gov (United States)

    Li, Zhao; Zhou, Miaoping; Zhang, Zengyan; Ren, Lijuan; Du, Lipu; Zhang, Boqiao; Xu, Huijun; Xin, Zhiyong

    2011-03-01

    Fusarium head blight (scab), primarily caused by Fusarium graminearum, is a devastating disease of wheat (Triticum aestivum L.) worldwide. Wheat sharp eyespot, mainly caused by Rhizoctonia cerealis, is one of the major diseases of wheat in China. The defensin RsAFP2, a small cyteine-rich antifungal protein from radish (Raphanus sativus), was shown to inhibit growth in vitro of agronomically important fungal pathogens, such as F. graminearum and R. cerealis. The RsAFP2 gene was transformed into Chinese wheat variety Yangmai 12 via biolistic bombardment to assess the effectiveness of the defensin in protecting wheat from the fungal pathogens in multiple locations and years. The genomic PCR and Southern blot analyses indicated that RsAFP2 was integrated into the genomes of the transgenic wheat lines and heritable. RT-PCR and Western blot proved that the RsAFP2 was expressed in these transgenic wheat lines. Disease tests showed that four RsAFP2 transgenic lines (RA1-RA4) displayed enhanced resistance to F. graminearum compared to the untransformed Yangmai 12 and the null-segregated plants. Assays on Q-RT-PCR and disease severity showed that the express level of RsAFP2 was associated with the enhanced resistance degree. Two of these transgenic lines (RA1 and RA2) also exhibited enhanced resistance to R. cerealis. These results indicated that the expression of RsAFP2 conferred increased resistance to F. graminearum and R. cerealis in transgenic wheat.

  9. GmPGIP3 enhanced resistance to both take-all and common root rot diseases in transgenic wheat.

    Science.gov (United States)

    Wang, Aiyun; Wei, Xuening; Rong, Wei; Dang, Liang; Du, Li-Pu; Qi, Lin; Xu, Hui-Jun; Shao, Yanjun; Zhang, Zengyan

    2015-05-01

    Take-all (caused by the fungal pathogen Gaeumannomyces graminis var. tritici, Ggt) and common root rot (caused by Bipolaris sorokiniana) are devastating root diseases of wheat (Triticum aestivum L.). Development of resistant wheat cultivars has been a challenge since no resistant wheat accession is available. GmPGIP3, one member of polygalacturonase-inhibiting protein (PGIP) family in soybean (Glycine max), exhibited inhibition activity against fungal endopolygalacturonases (PGs) in vitro. In this study, the GmPGIP3 transgenic wheat plants were generated and used to assess the effectiveness of GmPGIP3 in protecting wheat from the infection of Ggt and B. sorokiniana. Four independent transgenic lines were identified by genomic PCR, Southern blot, and reverse transcription PCR (RT-PCR). The introduced GmPGIP3 was integrated into the genomes of these transgenic lines and could be expressed. The expressing GmPGIP3 protein in these transgenic wheat lines could inhibit the PGs produced by Ggt and B. sorokiniana. The disease response assessments postinoculation showed that the GmPGIP3-expressing transgenic wheat lines displayed significantly enhanced resistance to both take-all and common root rot diseases caused by the infection of Ggt and B. sorokiniana. These data suggested that GmPGIP3 is an attractive gene resource in improving resistance to both take-all and common root rot diseases in wheat.

  10. Transgene detection by digital droplet PCR.

    Directory of Open Access Journals (Sweden)

    Dirk A Moser

    Full Text Available Somatic gene therapy is a promising tool for the treatment of severe diseases. Because of its abuse potential for performance enhancement in sports, the World Anti-Doping Agency (WADA included the term 'gene doping' in the official list of banned substances and methods in 2004. Several nested PCR or qPCR-based strategies have been proposed that aim at detecting long-term presence of transgene in blood, but these strategies are hampered by technical limitations. We developed a digital droplet PCR (ddPCR protocol for Insulin-Like Growth Factor 1 (IGF1 detection and demonstrated its applicability monitoring 6 mice injected into skeletal muscle with AAV9-IGF1 elements and 2 controls over a 33-day period. A duplex ddPCR protocol for simultaneous detection of Insulin-Like Growth Factor 1 (IGF1 and Erythropoietin (EPO transgenic elements was created. A new DNA extraction procedure with target-orientated usage of restriction enzymes including on-column DNA-digestion was established. In vivo data revealed that IGF1 transgenic elements could be reliably detected for a 33-day period in DNA extracted from whole blood. In vitro data indicated feasibility of IGF1 and EPO detection by duplex ddPCR with high reliability and sensitivity. On-column DNA-digestion allowed for significantly improved target detection in downstream PCR-based approaches. As ddPCR provides absolute quantification, it ensures excellent day-to-day reproducibility. Therefore, we expect this technique to be used in diagnosing and monitoring of viral and bacterial infection, in detecting mutated DNA sequences as well as profiling for the presence of foreign genetic material in elite athletes in the future.

  11. Isolation of progenitor cells from GFP-transgenic pigs and transplantation to the retina of allorecipients

    DEFF Research Database (Denmark)

    Klassen, Henry; Warfvinge, Karin; Schwartz, Philip H

    2008-01-01

    to survival as allografts and integrate into the host retinal architecture, we isolated donor cells from fetal green fluorescent protein (GFP)-transgenic pigs. Cultures were propagated from the brain, retina, and corneo-scleral limbus. GFP expression rapidly increased with time in culture, although lower...... in conjunction with photoreceptor markers and glial fibrillary acid protein (GFAP), thus suggesting downregulation of GFP during differentiation. Following transplantation, GFP expression allowed histological visualization of integrated cells and extension of fine processes to adjacent plexiform layers. GFP...

  12. Chemical mutagens, transposons, and transgenes to interrogate gene function in Drosophila melanogaster.

    Science.gov (United States)

    Venken, Koen J T; Bellen, Hugo J

    2014-06-15

    The study of genetics, genes, and chromosomal inheritance was initiated by Thomas Morgan in 1910, when the first visible mutations were identified in fruit flies. The field expanded upon the work initiated by Herman Muller in 1926 when he used X-rays to develop the first balancer chromosomes. Today, balancers are still invaluable to maintain mutations and transgenes but the arsenal of tools has expanded vastly and numerous new methods have been developed, many relying on the availability of the genome sequence and transposable elements. Forward genetic screens based on chemical mutagenesis or transposable elements have resulted in the unbiased identification of many novel players involved in processes probed by specific phenotypic assays. Reverse genetic approaches have relied on the availability of a carefully selected set of transposon insertions spread throughout the genome to allow the manipulation of the region in the vicinity of each insertion. Lastly, the ability to transform Drosophila with single copy transgenes using transposons or site-specific integration using the ΦC31 integrase has allowed numerous manipulations, including the ability to create and integrate genomic rescue constructs, generate duplications, RNAi knock-out technology, binary expression systems like the GAL4/UAS system as well as other methods. Here, we will discuss the most useful methodologies to interrogate the fruit fly genome in vivo focusing on chemical mutagenesis, transposons and transgenes. Genome engineering approaches based on nucleases and RNAi technology are discussed in following chapters. Copyright © 2014 Elsevier Inc. All rights reserved.

  13. Intein-mediated Cre protein assembly for transgene excision in hybrid progeny of transgenic Arabidopsis.

    Science.gov (United States)

    Ge, Jia; Wang, Lijun; Yang, Chen; Ran, Lingyu; Wen, Mengling; Fu, Xianan; Fan, Di; Luo, Keming

    2016-10-01

    An approach for restoring recombination activity of complementation split-Cre was developed to excise the transgene in hybrid progeny of GM crops. Growing concerns about the biosafety of genetically modified (GM) crops has currently become a limited factor affecting the public acceptance. Several approaches have been developed to generate selectable-marker-gene-free GM crops. However, no strategy was reported to be broadly applicable to hybrid crops. Previous studies have demonstrated that complementation split-Cre recombinase restored recombination activity in transgenic plants. In this study, we found that split-Cre mediated by split-intein Synechocystis sp. DnaE had high recombination efficiency when Cre recombinase was split at Asp232/Asp233 (866 bp). Furthermore, we constructed two plant expression vectors, pCA-NCre-In and pCA-Ic-CCre, containing NCre866-In and Ic-CCre866 fragments, respectively. After transformation, parent lines of transgenic Arabidopsis with one single copy were generated and used for hybridization. The results of GUS staining demonstrated that the recombination activity of split-Cre could be reassembled in these hybrid progeny of transgenic plants through hybridization and the foreign genes flanked by two loxP sites were efficiently excised. Our strategy may provide an effective approach for generating the next generation of GM hybrid crops without biosafety concerns.

  14. An Empirical Assessment of Transgene Flow from a Bt Transgenic Poplar Plantation.

    Directory of Open Access Journals (Sweden)

    Jianjun Hu

    Full Text Available To assess the possible impact of transgenic poplar plantations on the ecosystem, we analyzed the frequency and distance of gene flow from a mature male transgenic Populus nigra plantation carrying the Bacillus thuringiensis toxin gene (Bt poplar and the survival of Bt poplar seeds. The resultant Bt poplar seeds occurred at a frequency of ~0.15% at 0 m to ~0.02% at 500 m from the Bt poplar plantation. The germination of Bt poplar seeds diminished within three weeks in the field (germination rate from 68% to 0% compared to 48% after three weeks of storage at 4°C. The survival rate of seedlings in the field was 0% without any treatment but increased to 1.7% under the addition of four treatments (cleaning and trimming, watering, weeding, and covering with plastic film to maintain moisture after being seeded in the field for eight weeks. The results of this study indicate that gene flow originating from the Bt poplar plantation occurred at an extremely low level through pollen or seeds under natural conditions. This study provides first-hand field data on the extent of transgene flow in poplar plantations and offers guidance for the risk assessment of transgenic poplar plantations.

  15. A sero-survey of rinderpest in nomadic pastoral systems in central and southern Somalia from 2002 to 2003, using a spatially integrated random sampling approach.

    Science.gov (United States)

    Tempia, S; Salman, M D; Keefe, T; Morley, P; Freier, J E; DeMartini, J C; Wamwayi, H M; Njeumi, F; Soumaré, B; Abdi, A M

    2010-12-01

    A cross-sectional sero-survey, using a two-stage cluster sampling design, was conducted between 2002 and 2003 in ten administrative regions of central and southern Somalia, to estimate the seroprevalence and geographic distribution of rinderpest (RP) in the study area, as well as to identify potential risk factors for the observed seroprevalence distribution. The study was also used to test the feasibility of the spatially integrated investigation technique in nomadic and semi-nomadic pastoral systems. In the absence of a systematic list of livestock holdings, the primary sampling units were selected by generating random map coordinates. A total of 9,216 serum samples were collected from cattle aged 12 to 36 months at 562 sampling sites. Two apparent clusters of RP seroprevalence were detected. Four potential risk factors associated with the observed seroprevalence were identified: the mobility of cattle herds, the cattle population density, the proximity of cattle herds to cattle trade routes and cattle herd size. Risk maps were then generated to assist in designing more targeted surveillance strategies. The observed seroprevalence in these areas declined over time. In subsequent years, similar seroprevalence studies in neighbouring areas of Kenya and Ethiopia also showed a very low seroprevalence of RP or the absence of antibodies against RP. The progressive decline in RP antibody prevalence is consistent with virus extinction. Verification of freedom from RP infection in the Somali ecosystem is currently in progress.

  16. Randomized, sham-controlled trial based on transcranial direct current stimulation and wrist robot-assisted integrated treatment on subacute stroke patients: Intermediate results.

    Science.gov (United States)

    Mazzoleni, Stefano; Tran, Vi Do; Iardella, Laura; Dario, Paolo; Posteraro, Federico

    2017-07-01

    The main goal of this study is to analyse the effects of combined transcranial direct current stimulation (tDCS) and wrist robot-assisted therapy in subacute stroke patients. Twenty-four patients were included in this study and randomly assigned to the experimental (EG) or control group (CG). All participants performed wrist robot-assisted training a) in conjunction with tDCS (real stimulation for patients in EG) or b) without tDCS (sham stimulation for patients in CG). Clinical scales and kinematic parameters recorded by the robot were used for the assessment. Clinical outcome measures show a significant decrease in motor impairment after the treatment in both groups. Kinematic data show several significant improvements after the integrated therapy in both groups. However, no significant differences in both clinical outcome measures and kinematic parameters was found between two groups. The potential advantages of combined tDCS and wrist robot-assisted therapy in subacute stroke patients are still unclear.

  17. Effect of integrated yoga therapy on pain, morning stiffness and anxiety in osteoarthritis of the knee joint: A randomized control study

    Directory of Open Access Journals (Sweden)

    John Ebnezar

    2012-01-01

    Full Text Available Aim: To study the effect of integrated yoga on pain, morning stiffness and anxiety in osteoarthritis of knees. Materials and Methods: Two hundred and fifty participants with OA knees (35-80 years were randomly assigned to yoga or control group. Both groups had transcutaneous electrical stimulation and ultrasound treatment followed by intervention (40 min for two weeks with follow up for three months. The integrated yoga consisted of yogic loosening and strengthening practices, asanas, relaxation, pranayama and meditation. The control group had physiotherapy exercises. Assessments were done on 15 th (post 1 and 90 th day (post 2. Results: Resting pain (numerical rating scale reduced better (P<0.001, Mann-Whitney U test in yoga group (post 1=33.6% and post 2=71.8% than control group (post 1=13.4% and post 2=37.5%. Morning stiffness decreased more (P<0.001 in yoga (post 1=68.6% and post 2=98.1% than control group (post 1=38.6% and post 2=71.6%. State anxiety (STAI-1 reduced (P<0.001 by 35.5% (post 1 and 58.4% (post 2 in the yoga group and 15.6% (post 1 and 38.8% (post 2 in the control group; trait anxiety (STAI 2 reduced (P<0.001 better (post 1=34.6% and post 2=57.10% in yoga than control group (post 1=14.12% and post 2=34.73%. Systolic blood pressure reduced (P<0.001 better in yoga group (post 1=−7.93% and post 2=−15.7% than the control group (post 1=−1.8% and post 2=−3.8%. Diastolic blood pressure reduced (P<0.001 better in yoga group (post 1=−7.6% and post 2=−16.4% than the control group (post 1=−2.1% and post 2=−5.0%. Pulse rate reduced (P<0.001 better in yoga group (post 1=−8.41% and post 2=−12.4% than the control group (post 1=−5.1% and post 2=−7.1%. Conclusion: Integrated approach of yoga therapy is better than physiotherapy exercises as an adjunct to transcutaneous electrical stimulation and ultrasound treatment in reducing pain, morning stiffness, state and trait anxiety, blood pressure and pulse rate in patients

  18. Rationale, design, and implementation protocol of an electronic health record integrated clinical prediction rule (iCPR randomized trial in primary care

    Directory of Open Access Journals (Sweden)

    Wisnivesky Juan

    2011-09-01

    Full Text Available Abstract Background Clinical prediction rules (CPRs represent well-validated but underutilized evidence-based medicine tools at the point-of-care. To date, an inability to integrate these rules into an electronic health record (EHR has been a major limitation and we are not aware of a study demonstrating the use of CPR's in an ambulatory EHR setting. The integrated clinical prediction rule (iCPR trial integrates two CPR's in an EHR and assesses both the usability and the effect on evidence-based practice in the primary care setting. Methods A multi-disciplinary design team was assembled to develop a prototype iCPR for validated streptococcal pharyngitis and bacterial pneumonia CPRs. The iCPR tool was built as an active Clinical Decision Support (CDS tool that can be triggered by user action during typical workflow. Using the EHR CDS toolkit, the iCPR risk score calculator was linked to tailored ordered sets, documentation, and patient instructions. The team subsequently conducted two levels of 'real world' usability testing with eight providers per group. Usability data were used to refine and create a production tool. Participating primary care providers (n = 149 were randomized and intervention providers were trained in the use of the new iCPR tool. Rates of iCPR tool triggering in the intervention and control (simulated groups are monitored and subsequent use of the various components of the iCPR tool among intervention encounters is also tracked. The primary outcome is the difference in antibiotic prescribing rates (strep and pneumonia iCPR's encounters and chest x-rays (pneumonia iCPR only between intervention and control providers. Discussion Using iterative usability testing and development paired with provider training, the iCPR CDS tool leverages user-centered design principles to overcome pervasive underutilization of EBM and support evidence-based practice at the point-of-care. The ongoing trial will determine if this collaborative

  19. Strengthening health human resources and improving clinical outcomes through an integrated guideline and educational outreach in resource-poor settings: a cluster-randomized trial

    Directory of Open Access Journals (Sweden)

    Burciul Barry

    2010-12-01

    Full Text Available Abstract Background In low-income countries, only about a third of Human Immunodeficiency Virus/Acquired Immune Deficiency Syndrome (HIV/AIDS patients eligible for anti-retroviral treatment currently receive it. Providing decentralized treatment close to where patients live is crucial to a faster scale up, however, a key obstacle is limited health system capacity due to a shortage of trained health-care workers and challenges of integrating HIV/AIDS care with other primary care services (e.g. tuberculosis, malaria, respiratory conditions. This study will test an adapted primary care health care worker training and guideline intervention, Practical Approach to Lung Health and HIV/AIDS Malawi (PALM PLUS, on staff retention and satisfaction, and quality of patient care. Methods/Design A cluster-randomized trial design is being used to compare usual care with a standardized clinical guideline and training intervention, PALM PLUS. The intervention targets middle-cadre health care workers (nurses, clinical officers, medical assistants in 30 rural primary care health centres in a single district in Malawi. PALM PLUS is an integrated, symptom-based and user-friendly guideline consistent with Malawian national treatment protocols. Training is standardized and based on an educational outreach approach. Trainers will be front-line peer healthcare workers trained to provide outreach training and support to their fellow front-line healthcare workers during focused (1-2 hours, intermittent, interactive sessions on-site in health centers. Primary outcomes are health care worker retention and satisfaction. Secondary outcomes are clinical outcomes measured at the health centre level for HIV/AIDS, tuberculosis, prevention-of-mother-to-child-transmission of HIV and other primary care conditions. Effect sizes and 95% confidence intervals for outcomes will be presented. Assessment of outcomes will occur at 1 year post- implementation. Discussion The PALM PLUS trial

  20. The impact of integrated prevention and treatment on child malnutrition and health: the PROMIS project, a randomized control trial in Burkina Faso and Mali.

    Science.gov (United States)

    Huybregts, Lieven; Becquey, Elodie; Zongrone, Amanda; Le Port, Agnes; Khassanova, Regina; Coulibaly, Lazare; Leroy, Jef L; Rawat, Rahul; Ruel, Marie T

    2017-03-09

    specific program impact pathways (PIPs). Cost-effectiveness analysis will assess the economic feasibility of the intervention. The PROMIS study assesses the effectiveness of an innovative model to integrate prevention and treatment interventions for greater and more sustainable impacts on the incidence and prevalence of AM using a rigorous, theory-based randomized control trial approach. This type of programmatic research is urgently needed to help program implementers, policy makers, and investors prioritize, select and scale-up the best program models to prevent and treat AM and achieve the World Health Assembly goal of reducing childhood wasting to less than 5% globally by the year 2025. Clinicaltrials.gov NCT02323815 (registered on December 18, 2014) and NCT02245152 (registered on September 16, 2014).

  1. The impact of integrated prevention and treatment on child malnutrition and health: the PROMIS project, a randomized control trial in Burkina Faso and Mali

    Directory of Open Access Journals (Sweden)

    Lieven Huybregts

    2017-03-01

    implementation of the intervention guided by country specific program impact pathways (PIPs. Cost-effectiveness analysis will assess the economic feasibility of the intervention. Discussion The PROMIS study assesses the effectiveness of an innovative model to integrate prevention and treatment interventions for greater and more sustainable impacts on the incidence and prevalence of AM using a rigorous, theory-based randomized control trial approach. This type of programmatic research is urgently needed to help program implementers, policy makers, and investors prioritize, select and scale-up the best program models to prevent and treat AM and achieve the World Health Assembly goal of reducing childhood wasting to less than 5% globally by the year 2025. Trial registration Clinicaltrials.gov NCT02323815 (registered on December 18, 2014 and NCT02245152 (registered on September 16, 2014

  2. BAC-Dkk3-EGFP Transgenic Mouse: An In Vivo Analytical Tool for Dkk3 Expression

    Directory of Open Access Journals (Sweden)

    Yuki Muranishi

    2012-01-01

    Full Text Available Dickkopf (DKK family proteins are secreted modulators of the Wnt signaling pathway and are capable of regulating the development of many organs and tissues. We previously identified Dkk3 to be a molecule predominantly expressed in the mouse embryonic retina. However, which cell expresses Dkk3 in the developing and mature mouse retina remains to be elucidated. To examine the precise expression of the Dkk3 protein, we generated BAC-Dkk3-EGFP transgenic mice that express EGFP integrated into the Dkk3 gene in a BAC plasmid. Expression analysis using the BAC-Dkk3-EGFP transgenic mice revealed that Dkk3 is expressed in retinal progenitor cells (RPCs at embryonic stages and in Müller glial cells in the adult retina. Since Müller glial cells may play a potential role in retinal regeneration, BAC-Dkk3-EGFP mice could be useful for retinal regeneration studies.

  3. Knock-in fibroblasts and transgenic blastocysts for expression of human FGF2 in the bovine β-casein gene locus using CRISPR/Cas9 nuclease-mediated homologous recombination.

    Science.gov (United States)

    Jeong, Young-Hee; Kim, Yeong Ji; Kim, Eun Young; Kim, Se Eun; Kim, Jiwoo; Park, Min Jee; Lee, Hong-Gu; Park, Se Pill; Kang, Man-Jong

    2016-06-01

    Many transgenic domestic animals have been developed to produce therapeutic proteins in the mammary gland, and this approach is one of the most important methods for agricultural and biomedical applications. However, expression and secretion of a protein varies because transgenes are integrated at random sites in the genome. In addition, distal enhancers are very important for transcriptional gene regulation and tissue-specific gene expression. Development of a vector system regulated accurately in the genome is needed to improve production of therapeutic proteins. The objective of this study was to develop a knock-in system for expression of human fibroblast growth factor 2 (FGF2) in the bovine β-casein gene locus. The F2A sequence was fused to the human FGF2 gene and inserted into exon 3 of the β-casein gene. We detected expression of human FGF2 mRNA in the HC11 mouse mammary epithelial cells by RT-PCR and human FGF2 protein in the culture media using western blot analysis when the knock-in vector was introduced. We transfected the knock-in vector into bovine ear fibroblasts and produced knock-in fibroblasts using the clustered regularly interspaced short palindromic repeats (CRISPR)/Cas9 system. Moreover, the CRISPR/Cas9 system was more efficient than conventional methods. In addition, we produced knock-in blastocysts by somatic cell nuclear transfer using the knock-in fibroblasts. Our knock-in fibroblasts may help to create cloned embryos for development of transgenic dairy cattle expressing human FGF2 protein in the mammary gland via the expression system of the bovine β-casein gene.

  4. [Biofuels, food security and transgenic crops].

    Science.gov (United States)

    Acosta, Orlando; Chaparro-Giraldo, Alejandro

    2009-01-01

    Soaring global food prices are threatening to push more poor people back below the poverty line; this will probably become aggravated by the serious challenge that increasing population and climate changes are posing for food security. There is growing evidence that human activities involving fossil fuel consumption and land use are contributing to greenhouse gas emissions and consequently changing the climate worldwide. The finite nature of fossil fuel reserves is causing concern about energy security and there is a growing interest in the use of renewable energy sources such as biofuels. There is growing concern regarding the fact that biofuels are currently produced from food crops, thereby leading to an undesirable competition for their use as food and feed. Nevertheless, biofuels can be produced from other feedstocks such as lingo-cellulose from perennial grasses, forestry and vegetable waste. Biofuel energy content should not be exceeded by that of the fossil fuel invested in its production to ensure that it is energetically sustainable; however, biofuels must also be economically competitive and environmentally acceptable. Climate change and biofuels are challenging FAO efforts aimed at eradicating hunger worldwide by the next decade. Given that current crops used in biofuel production have not been domesticated for this purpose, transgenic technology can offer an enormous contribution towards improving biofuel crops' environmental and economic performance. The present paper critically presents some relevant relationships between biofuels, food security and transgenic plant technology.

  5. Modifying Bananas: From Transgenics to Organics?

    Directory of Open Access Journals (Sweden)

    James Dale

    2017-02-01

    Full Text Available Bananas are one of the top ten world food crops. Unlike most other major food crops, bananas are difficult to genetically improve. The challenge is that nearly all banana cultivars and landraces are triploids, with high levels of male and female infertility. There are a number of international conventional breeding programs and many of these are developing new cultivars. However, it is virtually impossible to backcross bananas, thus excluding the possibility of introgressing new traits into a current cultivar. The alternative strategy is to “modify” the cultivar itself. We have been developing the capacity to modify Cavendish bananas and other cultivars for both disease resistance and enhanced fruit quality. Initially, we were using transgenes; genes that were derived from species outside of the Musa or banana genus. However, we have recently incorporated two banana genes (cisgenes into Cavendish; one to enhance the level of pro-vitamin A and the other to increase the resistance to Panama disease. Modified Cavendish with these cisgenes have been employed in a field trial. Almost certainly, the next advance will be to edit the Cavendish genome, to generate the desired traits. As these banana cultivars are essentially sterile, transgene flow and the outcrossing of modified genes into wild Musa species. are highly unlikely and virtually impossible in other triploid cultivars. Therefore, genetic changes in bananas may be compatible with organic farming.

  6. Bioavailability of transgenic microRNAs in genetically modified plants

    Science.gov (United States)

    Transgenic expression of small RNAs is a prevalent approach in agrobiotechnology for the global enhancement of plant foods. Meanwhile, emerging studies have, on the one hand, emphasized the potential of transgenic microRNAs (miRNAs) as novel dietary therapeutics and, on the other, suggested potentia...

  7. Transgenic Learning for STEAM Subjects and Virtual Containers for OER

    Science.gov (United States)

    Burgos, Daniel; Corbí, Alberto

    2018-01-01

    Transgenic learning is a disruptive approach in education. It encourages modification of moving parts of the educational chain. This article provides a view of transgenic learning focused on the delivery of enriched learning contents in STEAM areas. It discusses the mutagenic role that the virtual containers may play in current distance education.…

  8. Ethical perception of human gene in transgenic banana | Amin ...

    African Journals Online (AJOL)

    Transgenic banana has been developed to prevent hepatitis B through vaccination. Its production seems to be an ideal alternative for cheaper vaccines. The objective of this paper is to assess the ethical perception of transgenic banana which involved the transfer of human albumin gene, and to compare their ethical ...

  9. [Production of human proteins in the blood of transgenic animals

    NARCIS (Netherlands)

    Massoud, M.; Bischoff, Rainer; Dalemans, W.; Pointu, H.; Attal, J.; Schultz, H.; Clesse, D.; Stinnakre, M.G.; Pavirani, A.; Houdebine, L.M.

    1990-01-01

    The human alpha 1-antitrypsin gene has been microinjected into rabbit embryos. A line of transgenic rabbits has thus been established. Human alpha 1-antitrypsin was found in the blood of transgenic animals at the concentration of 1 mg/ml plasma. The human protein was active and separable from its

  10. Overview on the investigations of transgenic plums in Romania

    Science.gov (United States)

    Transgenic plums of Prunus domestica L. transformed with the Plum pox virus coat protein gene (PPV-CP) were the subjects of three experiments undertaken in Romania. In the first experiment, PPV-CP transgenic clones C2, C3, C4, C5, C6, PT3 and PT5 were evaluated for Sharka resistance under high natu...

  11. Overview of the investigation of transgenic plums in Romania

    Science.gov (United States)

    Transgenic plums of Prunus domestica L. transformed with the Plum pox virus coat protein gene (PPV-CP) were the subjects of three experiments undertaken in Romania. In the first experiment, PPV-CP transgenic clones C2, C3, C4, C5, C6 and PT3 were evaluated for Sharka resistance under high natural i...

  12. Generation of transgenic mice producing fungal xylanase in the ...

    African Journals Online (AJOL)

    DR TONUKARI NYEROVWO

    express exogenous digestive enzymes, since a single- stomached animal, such as a pig, can secret .... transgenic founder mice; 1 to15 are fifteen wild-type founder mice; M, marke; β-actin, endogenous control. (C) Identification of transgenic mice by ... 61.48±0.34%), gross energy digestibility (WT vs. TG = 68.79±0.51% vs.

  13. 2013 North Dakota Transgenic Barley Research and FHB Nursery Report

    Science.gov (United States)

    Research continues to develop and test new transgenic plants using genes provided by collaborators. As lines are developed in Golden Promise, they are crossed to Conlon for field testing. Transgenic lines developed in Conlon are being crossed to resistant lines developed by the breeding programs. ...

  14. Using quantitative real-time PCR to detect chimeras in transgenic tobacco and apricot and to monitor their dissociation

    Directory of Open Access Journals (Sweden)

    Burgos Lorenzo

    2010-07-01

    Full Text Available Abstract Background The routine generation of transgenic plants involves analysis of transgene integration into the host genome by means of Southern blotting. However, this technique cannot distinguish between uniformly transformed tissues and the presence of a mixture of transgenic and non-transgenic cells in the same tissue. On the other hand, the use of reporter genes often fails to accurately detect chimerical tissues because their expression can be affected by several factors, including gene silencing and plant development. So, new approaches based on the quantification of the amount of the transgene are needed urgently. Results We show here that chimeras are a very frequent phenomenon observed after regenerating transgenic plants. Spatial and temporal analyses of transformed tobacco and apricot plants with a quantitative, real-time PCR amplification of the neomycin phosphotransferase (nptII transgene as well as of an internal control (β-actin, used to normalise the amount of target DNA at each reaction, allowed detection of chimeras at unexpected rates. The amount of the nptII transgene differed greatly along with the sub-cultivation period of these plants and was dependent on the localisation of the analysed leaves; being higher in roots and basal leaves, while in the apical leaves it remained at lower levels. These data demonstrate that, unlike the use of the gus marker gene, real-time PCR is a powerful tool for detection of chimeras. Although some authors have proposed a consistent, positive Southern analysis as an alternative methodology for monitoring the dissociation of chimeras, our data show that it does not provide enough proof of uniform transformation. In this work, however, real-time PCR was applied successfully to monitor the dissociation of chimeras in tobacco plants and apricot callus. Conclusions We have developed a rapid and reliable method to detect and estimate the level of chimeras in transgenic tobacco and apricot

  15. Impacts of elevated CO2 on exogenous Bacillus thuringiensis toxins and transgene expression in transgenic rice under different levels of nitrogen

    OpenAIRE

    Jiang, Shoulin; Lu, Yongqing; Dai, Yang; Qian, Lei; Muhammad, Adnan Bodlah; Li, Teng; Wan, Guijun; Parajulee, Megha N.; Chen, Fajun

    2017-01-01

    Recent studies have highlighted great challenges of transgene silencing for transgenic plants facing climate change. In order to understand the impacts of elevated CO2 on exogenous Bacillus thuringiensis (Bt) toxins and transgene expression in transgenic rice under different levels of N-fertilizer supply, we investigated the biomass, exogenous Bt toxins, Bt-transgene expression and methylation status in Bt rice exposed to two levels of CO2 concentrations and nitrogen (N) supply (1/8, 1/4, 1/2...

  16. Advancing environmental risk assessment for transgenic biofeedstock crops

    Directory of Open Access Journals (Sweden)

    Wolt Jeffrey D

    2009-11-01

    Full Text Available Abstract Transgenic modification of plants is a key enabling technology for developing sustainable biofeedstocks for biofuels production. Regulatory decisions and the wider acceptance and development of transgenic biofeedstock crops are considered from the context of science-based risk assessment. The risk assessment paradigm for transgenic biofeedstock crops is fundamentally no different from that of current generation transgenic crops, except that the focus of the assessment must consider the unique attributes of a given biofeedstock crop and its environmental release. For currently envisioned biofeedstock crops, particular emphasis in risk assessment will be given to characterization of altered metabolic profiles and their implications relative to non-target environmental effects and food safety; weediness and invasiveness when plants are modified for abiotic stress tolerance or are domesticated; and aggregate risk when plants are platforms for multi-product production. Robust risk assessments for transgenic biofeedstock crops are case-specific, initiated through problem formulation, and use tiered approaches for risk characterization.

  17. RAPD and SSR Polymorphisms in Mutant Lines of Transgenic Wheat Mediated by Low Energy Ion Beam

    International Nuclear Information System (INIS)

    Wang Tiegu; Huang Qunce; Feng Weisen

    2007-01-01

    Two types of markers-random amplified polymorphic DNA (RAPD) and simple sequence repeat DNA (SSR)-have been used to characterize the genetic diversity among nine mutant lines of transgenic wheat intermediated by low energy ion beam and their four receptor cultivars. The objectives of this study were to analyze RAPD-based and SSR-based genetic variance among transgenic wheat lines and with their receptors, and to find specific genetic markers of special traits of transgenic wheat lines. 170 RAPD primers were amplified to 733 fragments in all the experimental materials. There were 121 polymorphic fragments out of the 733 fragments with a ratio of polymorphic fragments of 16.5%. 29 SSR primer pairs were amplified to 83 fragments in all the experiment materials. There were 57 polymorphic fragments out of the 83 fragments with a ratio of polymorphic fragments of 68.7%. The dendrograms were prepared based on a genetic distance matrix using the UPGMA (Unweighted Pair-group Method with Arithmetic averaging) algorithm, which corresponded well to the results of the wheat pedigree analysis and separated the 13 genotypes into four groups. Association analysis between RAPD and SSR markers with the special traits of transgenic wheat mutant lines discovered that three RAPD markers, s1, opt-16, and f14, were significantly associated with the muticate trait, while three SSR markers, Rht8 (Xgwm261), Rht-B1b, and Rht-D1b, highly associated with the dwarf trait. These markers will be useful for marker-assistant breeding and can be used as candidate markers for further gene mapping and cloning

  18. RAPD and SSR Polymorphisms in Mutant Lines of Transgenic Wheat Mediated by Low Energy Ion Beam

    Science.gov (United States)

    Wang, Tiegu; Huang, Qunce; Feng, Weisen

    2007-10-01

    Two types of markers-random amplified polymorphic DNA (RAPD) and simple sequence repeat DNA (SSR)-have been used to characterize the genetic diversity among nine mutant lines of transgenic wheat intermediated by low energy ion beam and their four receptor cultivars. The objectives of this study were to analyze RAPD-based and SSR-based genetic variance among transgenic wheat lines and with their receptors, and to find specific genetic markers of special traits of transgenic wheat lines. 170 RAPD primers were amplified to 733 fragments in all the experimental materials. There were 121 polymorphic fragments out of the 733 fragments with a ratio of polymorphic fragments of 16.5%. 29 SSR primer pairs were amplified to 83 fragments in all the experiment materials. There were 57 polymorphic fragments out of the 83 fragments with a ratio of polymorphic fragments of 68.7%. The dendrograms were prepared based on a genetic distance matrix using the UPGMA (Unweighted Pair-group Method with Arithmetic averaging) algorithm, which corresponded well to the results of the wheat pedigree analysis and separated the 13 genotypes into four groups. Association analysis between RAPD and SSR markers with the special traits of transgenic wheat mutant lines discovered that three RAPD markers, s1, opt-16, and f14, were significantly associated with the muticate trait, while three SSR markers, Rht8 (Xgwm261), Rht-B1b, and Rht-D1b, highly associated with the dwarf trait. These markers will be useful for marker-assistant breeding and can be used as candidate markers for further gene mapping and cloning.

  19. RAPD and SSR Polymorphisms in Mutant Lines of Transgenic Wheat Mediated by Low Energy Ion Beam

    Energy Technology Data Exchange (ETDEWEB)

    Tiegu, Wang [Henan Provincial Key Laboratory of Ion Beam Bio-Engineering, Zhengzhou University, Zhengzhou 450052 (China); Qunce, Huang [Henan Provincial Key Laboratory of Ion Beam Bio-Engineering, Zhengzhou University, Zhengzhou 450052 (China); Weisen, Feng [Luoyang Institute of Agricultural Science, Luoyang 471022 (China)

    2007-10-15

    Two types of markers-random amplified polymorphic DNA (RAPD) and simple sequence repeat DNA (SSR)-have been used to characterize the genetic diversity among nine mutant lines of transgenic wheat intermediated by low energy ion beam and their four receptor cultivars. The objectives of this study were to analyze RAPD-based and SSR-based genetic variance among transgenic wheat lines and with their receptors, and to find specific genetic markers of special traits of transgenic wheat lines. 170 RAPD primers were amplified to 733 fragments in all the experimental materials. There were 121 polymorphic fragments out of the 733 fragments with a ratio of polymorphic fragments of 16.5%. 29 SSR primer pairs were amplified to 83 fragments in all the experiment materials. There were 57 polymorphic fragments out of the 83 fragments with a ratio of polymorphic fragments of 68.7%. The dendrograms were prepared based on a genetic distance matrix using the UPGMA (Unweighted Pair-group Method with Arithmetic averaging) algorithm, which corresponded well to the results of the wheat pedigree analysis and separated the 13 genotypes into four groups. Association analysis between RAPD and SSR markers with the special traits of transgenic wheat mutant lines discovered that three RAPD markers, s1, opt-16, and f14, were significantly associated with the muticate trait, while three SSR markers, Rht8 (Xgwm261), Rht-B1b, and Rht-D1b, highly associated with the dwarf trait. These markers will be useful for marker-assistant breeding and can be used as candidate markers for further gene mapping and cloning.

  20. Illegal gene flow from transgenic creeping bentgrass: the saga continues.

    Science.gov (United States)

    Snow, Allison A

    2012-10-01

    Ecologists have paid close attention to environmental effects that fitness-enhancing transgenes might have following crop-to-wild gene flow (e.g. Snow et al. 2003). For some crops, gene flow also can lead to legal problems,especially when government agencies have not approved transgenic events for unrestricted environmental release.Creeping bentgrass (Agrostis stolonifera), a common turf grass used in golf courses, is the focus of both areas of concern. In 2002, prior to expected deregulation (still pending), The Scotts Company planted creeping bentgrass with transgenic resistance to the herbicide glyphosate,also known as RoundUp, on 162 ha in a designated control area in central Oregon (Fig. 1).Despite efforts to restrict gene flow, wind-dispersed pollen carried transgenes to florets of local A. stolonifera and A. gigantea as far as 14 km away, and to sentinel plants placed as far as 21 km away (Watrud et al. 2004).Then, in August 2003, a strong wind event moved transgenic seeds from wind rows of cut bentgrass into nearby areas. The company’s efforts to kill all transgenic survivors in the area failed: feral glyphosate-resistant populations of A. stolonifera were found by Reichman et al.(2006), and 62% of 585 bentgrass plants had the telltale CP4 EPSPS transgene in 2006 (Zapiola et al. 2008; Fig. 2).Now, in this issue, the story gets even more interesting as Zapiola & Mallory-Smith (2012) describe a transgenic,intergeneric hybrid produced on a feral, transgenic creeping bentgrass plant that received pollen from Polypogon monspeliensis (rabbitfoot grass). Their finding raises a host of new questions about the prevalence and fitness of intergeneric hybrids, as well as how to evaluate the full extent of gene flow from transgenic crops.

  1. Integral strategy to supportive care in breast cancer survivors through occupational therapy and a m-health system: design of a randomized clinical trial.

    Science.gov (United States)

    Lozano-Lozano, Mario; Martín-Martín, Lydia; Galiano-Castillo, Noelia; Álvarez-Salvago, Francisco; Cantarero-Villanueva, Irene; Fernández-Lao, Carolina; Sánchez-Salado, Carmen; Arroyo-Morales, Manuel

    2016-11-25

    Technological support using e-health mobile applications (m-health) is a promising strategy to improve the adherence to healthy lifestyles in breast cancer survivors (excess in energy intake or low physical activity are determinants of the risk of recurrence, second cancers and cancer mortality). Moreover, cancer rehabilitation programs supervised by health professionals are needed due to the inherent characteristics of these breast cancer patients. Our main objective is to compare the clinical efficacy of a m-health lifestyle intervention system alone versus an integral strategy to improve Quality of Life in breast cancer survivors. This therapeutic superiority study will use a two-arm, assessor blinded parallel RCT design. Women will be eligible if: they are diagnosed of stage I, II or III-A breast cancer; are between 25 and 75 years old; have a Body Mass Index > 25 kg/m 2 ; they have basic ability to use mobile apps; they had completed adjuvant therapy except for hormone therapy; and they have some functional shoulder limitations. Participants will be randomized to one of the following groups: integral group will use a mobile application (BENECA APP) and will receive a face-to-face rehabilitation (8-weeks); m-health group will use the BENECA app for 2-months and will received usual care information. Study endpoints will be assessed after 8 weeks and 6 months. The primary outcome will be Quality of Life measured by The European Organization for Research and Treatment of Cancer Quality of Life Questionnaire Core and breast module. The secondary outcomes: body composition; upper-body functionality (handgrip, Disability of the Arm, Shoulder and Hand questionnaire, goniometry); cognitive function (Wechsler Adult Intelligence Scale, Trail Making Test); anxiety and depression (Hospital Anxiety and Depression Scale); physical fitness (Short version of the Minnesota Leisure Time Physical Activity Questionnaire, Self-Efficacy Scale for Physical Activity

  2. The CAP study, evaluation of integrated universal and selective prevention strategies for youth alcohol misuse: study protocol of a cluster randomized controlled trial

    Directory of Open Access Journals (Sweden)

    Newton Nicola C

    2012-08-01

    Full Text Available Abstract Background Alcohol misuse amongst young people is a serious concern. The need for effective prevention is clear, yet there appear to be few evidenced-based programs that prevent alcohol misuse and none that target both high and low-risk youth. The CAP study addresses this gap by evaluating the efficacy of an integrated approach to alcohol misuse prevention, which combines the effective universal internet-based Climate Schools program with the effective selective personality-targeted Preventure program. This article describes the development and protocol of the CAP study which aims to prevent alcohol misuse and related harms in Australian adolescents. Methods/Design A cluster randomized controlled trial (RCT is being conducted with Year 8 students aged 13 to 14-years-old from 27 secondary schools in New South Wales and Victoria, Australia. Blocked randomisation was used to assign schools to one of four groups; Climate Schools only, Preventure only, CAP (Climate Schools and Preventure, or Control (alcohol, drug and health education as usual. The primary outcomes of the trial will be the uptake and harmful use of alcohol and alcohol related harms. Secondary outcomes will include alcohol and cannabis related knowledge, cannabis related harms, intentions to use, and mental health symptomatology. All participants will complete assessments on five occasions; baseline; immediately post intervention, and at 12, 24 and 36 months post baseline. Discussion This study protocol presents the design and current implementation of a cluster RCT to evaluate the efficacy of the CAP study; an integrated universal and selective approach to prevent alcohol use and related harms among adolescents. Compared to students who receive the stand-alone universal Climate Schools program or alcohol and drug education as usual (Controls, we expect the students who receive the CAP intervention to have significantly less uptake of alcohol use, a reduction in average

  3. Integrating data from randomized controlled trials and observational studies to predict the response to pregabalin in patients with painful diabetic peripheral neuropathy

    Directory of Open Access Journals (Sweden)

    Joe Alexander

    2017-07-01

    Full Text Available Abstract Background More patient-specific medical care is expected as more is learned about variations in patient responses to medical treatments. Analytical tools enable insights by linking treatment responses from different types of studies, such as randomized controlled trials (RCTs and observational studies. Given the importance of evidence from both types of studies, our goal was to integrate these types of data into a single predictive platform to help predict response to pregabalin in individual patients with painful diabetic peripheral neuropathy (pDPN. Methods We utilized three pivotal RCTs of pregabalin (398 North American patients and the largest observational study of pregabalin (3159 German patients. We implemented a hierarchical cluster analysis to identify patient clusters in the Observational Study to which RCT patients could be matched using the coarsened exact matching (CEM technique, thereby creating a matched dataset. We then developed autoregressive moving average models (ARMAXs to estimate weekly pain scores for pregabalin-treated patients in each cluster in the matched dataset using the maximum likelihood method. Finally, we validated ARMAX models using Observational Study patients who had not matched with RCT patients, using t tests between observed and predicted pain scores. Results Cluster analysis yielded six clusters (287–777 patients each with the following clustering variables: gender, age, pDPN duration, body mass index, depression history, pregabalin monotherapy, prior gabapentin use, baseline pain score, and baseline sleep interference. CEM yielded 1528 unique patients in the matched dataset. The reduction in global imbalance scores for the clusters after adding the RCT patients (ranging from 6 to 63% depending on the cluster demonstrated that the process reduced the bias of covariates in five of the six clusters. ARMAX models of pain score performed well (R 2 : 0.85–0.91; root mean square errors: 0.53–0

  4. Composite potato plants with transgenic roots on non-transgenic shoots: a model system for studying gene silencing in roots

    DEFF Research Database (Denmark)

    Horn, Patricia; Santala, Johanna; Nielsen, Steen Lykke

    2014-01-01

    induced phenotypically normal roots which, however, showed a reduced response to cytokinin as compared with non-transgenic roots. Nevertheless, both types of roots were infected to a similar high rate with the zoospores of Spongospora subterranea, a soilborne potato pathogen. The transgenic roots...

  5. Lifetime health effects and medical costs of integrated stroke services - a non-randomized controlled cluster-trial based life table approach

    Directory of Open Access Journals (Sweden)

    Dirks Maaike

    2010-11-01

    Full Text Available Abstract Background Economic evaluation of stroke services indicates that such services may lead to improved quality of life at affordable cost. The present study assesses lifetime health impact and cost consequences of stroke in an integrated service setting. Methods The EDISSE study is a prospective non-randomized controlled cluster trial that compared stroke services (n = 151 patients to usual care (n = 187 patients. Health status and cost trial-data were entered in multi-dimensional stroke life-tables. The tables distinguish four levels of disability which are defined by the modified Rankin scale. Quality-of-life scores (EuroQoL-5D, transition and survival probabilities are based on concurrent Dutch follow-up studies. Outcomes are quality-adjusted life years lived and lifetime medical cost by disability category. An economic analysis compares outcomes from a successful stroke service to usual care, by bootstrapping individual costs and effects data from patients in each arm. Results Lifetime costs and QALYs after stroke depend on age-of-onset of first-ever stroke. Lifetime QALYs after stroke are 2.42 (90% CI - 0.49 - 2.75 for male patients in usual care and 2.75 (-0.61; 6.26 for females. Lifetime costs for men in the usual care setting are €39,335 (15,951; 79,837 and €42,944 (14,081; 95,944 for women. A comparison with the stroke service results in an ICER of €11,685 saved per QALY gained (€14,211 and €7,745 for men and women respectively. This stroke service is with 90% certainty cost-effective. Conclusions Our analysis shows the potential of large health benefits and cost savings of stroke services, taking a lifetime perspective, also in other European settings.

  6. A Transgenic Mouse Model of Poliomyelitis.

    Science.gov (United States)

    Koike, Satoshi; Nagata, Noriyo

    2016-01-01

    Transgenic mice (tg mice) that express the human poliovirus receptor (PVR), CD155, are susceptible to poliovirus and develop a neurological disease that resembles human poliomyelitis. Assessment of the neurovirulence levels of poliovirus strains, including mutant viruses produced by reverse genetics, circulating vaccine-derived poliovirus, and vaccine candidates, is useful for basic research of poliovirus pathogenicity, the surveillance of circulating polioviruses, and the quality control of oral live poliovirus vaccines, and does not require the use of monkeys. Furthermore, PVR-tg mice are useful for studying poliovirus tissue tropism and host immune responses. PVR-tg mice can be bred with mice deficient in the genes involved in viral pathogenicity. This report describes the methods used to analyze the pathogenicity and immune responses of poliovirus using the PVR-tg mouse model.

  7. Magnetic biomineralisation in Huntington's disease transgenic mice

    International Nuclear Information System (INIS)

    Beyhum, W; Hautot, D; Dobson, J; Pankhurst, Q A

    2005-01-01

    The concentration levels of biogenic magnetite nanoparticles in transgenic R6/2 Huntington's disease (HD) mice have been investigated, using seven control and seven HD mice each from an 8 week-old litter and from a 12 week-old litter. Hysteresis and isothermal remnant magnetisation data were collected on a SQUID magnetometer, and analysed using a model comprising dia/paramagnetic, ferrimagnetic and superparamagnetic contributions, to extract the magnetite and ferritin concentrations present. It was found that magnetite was present in both superparamagnetic and blocked states. A larger spread and higher concentration of magnetite levels was found in the diseased mice for both the 8 week-old and 12 week-old batches, compared to the controls

  8. Development of transgenic cotton lines expressing Allium sativum agglutinin (ASAL) for enhanced resistance against major sap-sucking pests.

    Science.gov (United States)

    Vajhala, Chakravarthy S K; Sadumpati, Vijaya Kumar; Nunna, Hariprasad Rao; Puligundla, Sateesh Kumar; Vudem, Dashavantha Reddy; Khareedu, Venkateswara Rao

    2013-01-01

    Mannose-specific Allium sativum leaf agglutinin encoding gene (ASAL) and herbicide tolerance gene (BAR) were introduced into an elite cotton inbred line (NC-601) employing Agrobacterium-mediated genetic transformation. Cotton transformants were produced from the phosphinothricin (PPT)-resistant shoots obtained after co-cultivation of mature embryos with the Agrobacterium strain EHA105 harbouring recombinant binary vector pCAMBIA3300-ASAL-BAR. PCR and Southern blot analysis confirmed the presence and stable integration of ASAL and BAR genes in various transformants of cotton. Basta leaf-dip assay, northern blot, western blot and ELISA analyses disclosed variable expression of BAR and ASAL transgenes in different transformants. Transgenes, ASAL and BAR, were stably inherited and showed co-segregation in T1 generation in a Mendelian fashion for both PPT tolerance and insect resistance. In planta insect bioassays on T2 and T3 homozygous ASAL-transgenic lines revealed potent entomotoxic effects of ASAL on jassid and whitefly insects, as evidenced by significant decreases in the survival, development and fecundity of the insects when compared to the untransformed controls. Furthermore, the transgenic cotton lines conferred higher levels of resistance (1-2 score) with minimal plant damage against these major sucking pests when bioassays were carried out employing standard screening techniques. The developed transgenics could serve as a potential genetic resource in recombination breeding aimed at improving the pest resistance of cotton. This study represents the first report of its kind dealing with the development of transgenic cotton resistant to two major sap-sucking insects.

  9. Monitoring the efficacy of mutated Allium sativum leaf lectin in transgenic rice against Rhizoctonia solani.

    Science.gov (United States)

    Ghosh, Prithwi; Sen, Senjuti; Chakraborty, Joydeep; Das, Sampa

    2016-03-01

    Rice sheath blight, caused by Rhizoctonia solani is one of the most devastating diseases of rice. It is associated with significant reduction in rice productivity worldwide. A mutant variant of mannose binding Allium sativum leaf agglutinin (mASAL) was previously reported to exhibit strong antifungal activity against R. solani. In this study, the mASAL gene has been evaluated for its in planta antifungal activity in rice plants. mASAL was cloned into pCAMBIA1301 binary vector under the control of CaMV35S promoter. It was expressed in an elite indica rice cv. IR64 by employing Agrobacterium tumefaciens-mediated transformation. Molecular analyses of transgenic plants confirmed the presence and stable integration of mASAL gene. Immunohistofluorescence analysis of various tissue sections of plant parts clearly indicated the constitutive expression of mASAL. The segregation pattern of mASAL transgene was observed in T1 progenies in a 3:1 Mendelian ratio. The expression of mASAL was confirmed in T0 and T1 plants through western blot analysis followed by ELISA. In planta bioassay of transgenic lines against R. solani exhibited an average of 55 % reduction in sheath blight percentage disease index (PDI). The present study opens up the possibility of engineering rice plants with the antifungal gene mASAL, conferring resistance to sheath blight.

  10. New Wistar Kyoto and spontaneously hypertensive rat transgenic models with ubiquitous expression of green fluorescent protein

    Directory of Open Access Journals (Sweden)

    Ana Isabel Garcia Diaz

    2016-04-01

    Full Text Available The Wistar Kyoto (WKY rat and the spontaneously hypertensive (SHR rat inbred strains are well-established models for human crescentic glomerulonephritis (CRGN and metabolic syndrome, respectively. Novel transgenic (Tg strains add research opportunities and increase scientific value to well-established rat models. We have created two novel Tg strains using Sleeping Beauty transposon germline transgenesis, ubiquitously expressing green fluorescent protein (GFP under the rat elongation factor 1 alpha (EF1a promoter on the WKY and SHR genetic backgrounds. The Sleeping Beauty system functioned with high transgenesis efficiency; 75% of new rats born after embryo microinjections were transgene positive. By ligation-mediated PCR, we located the genome integration sites, confirming no exonic disruption and defining a single or low copy number of the transgenes in the new WKY-GFP and SHR-GFP Tg lines. We report GFP-bright expression in embryos, tissues and organs in both lines and show preliminary in vitro and in vivo imaging data that demonstrate the utility of the new GFP-expressing lines for adoptive transfer, transplantation and fate mapping studies of CRGN, metabolic syndrome and other traits for which these strains have been extensively studied over the past four decades.

  11. Generation of bi-transgenic pigs overexpressing human lactoferrin and lysozyme in milk.

    Science.gov (United States)

    Cui, Dan; Li, Jia; Zhang, Linlin; Liu, Shen; Wen, Xiao; Li, Qiuyan; Zhao, Yaofeng; Hu, Xiaoxiang; Zhang, Ran; Li, Ning

    2015-04-01

    Intensive swine production industry uses antibiotics to treat diseases and improve pig growth. This can not only cause antibiotic resistance, but can also pollute the environment or eventually affect human public health. To date, human lactoferrin (hLF) and human lysozyme (hLZ) have been known as non-adaptive but interactive antimicrobial members and could act in concert against bacteria, which contribute to host defense. Therefore, their expression in pigs might be an alternative strategy for replacing antibiotics in the pig production industry. In our study, we produced hLF and hLZ bi-transgenic pigs and assessed the milk's antibacterial ability. Integration of both transgenes was confirmed by PCR and southern blot. Both the hLF and hLZ were expressed in the mammary gland of bi-transgenic pigs, as detected by western blotting. The expression amounts were 6.5 g/L for hLF and 1.1 mg/L for hLZ using ELISA. Interestingly, pig milk containing hLF and hLZ had synergistic antimicrobial activity. Our results suggest an alternative approach for avoiding the use of antibiotics in the pig industry, which would be of great benefit to the commercial swine production.

  12. Expression of a potato antimicrobial peptide SN1 increases resistance to take-all pathogen Gaeumannomyces graminis var. tritici in transgenic wheat.

    Science.gov (United States)

    Rong, Wei; Qi, Lin; Wang, Jingfen; Du, Lipu; Xu, Huijun; Wang, Aiyun; Zhang, Zengyan

    2013-08-01

    Take-all, caused by soil-borne fungus Gaeumannomyces graminis var. tritici (Ggt), is a devastating root disease of wheat (Triticum aestivum) worldwide. Breeding resistant wheat cultivars is the most promising and reliable approach to protect wheat from take-all. Currently, no resistant wheat germplasm is available to breed cultivars using traditional methods. In this study, gene transformation was carried out using Snakin-1 (SN1) gene isolated from potato (Solanum tuberosum) because the peptide shows broad-spectrum antimicrobial activity in vitro. Purified SN1 peptide also inhibits in vitro the growth of Ggt mycelia. By bombardment-mediated method, the gene SN1 was transformed into Chinese wheat cultivar Yangmai 18 to generate SN1 transgenic wheat lines, which were used to assess the effectiveness of the SN1 peptide in protecting wheat from Ggt. Genomic PCR and Southern blot analyses indicated that the alien gene SN1 was integrated into the genomes of five transgenic wheat lines and heritable from T₀ to T₄ progeny. Reverse transcription-PCR and Western blot analyses showed that the introduced SN1 gene was transcribed and highly expressed in the five transgenic wheat lines. Following challenging with Ggt, disease test results showed that compared to segregants lacking the transgene and untransformed wheat plants, these five transgenic wheat lines expressing SN1 displayed significantly enhanced resistance to take-all. These results suggest that SN1 may be a potentially transgenic tool for improving the take-all resistance of wheat.

  13. Overexpression of wheat lipid transfer protein gene TaLTP5 increases resistances to Cochliobolus sativus and Fusarium graminearum in transgenic wheat.

    Science.gov (United States)

    Zhu, Xiuliang; Li, Zhao; Xu, Huijun; Zhou, Miaoping; Du, Lipu; Zhang, Zengyan

    2012-08-01

    The fungus Cochliobolus sativus is the main pathogen of common root rot, a serious soil-borne disease of wheat (Triticum aestivum L.). The fungus Fusarium graminearum is the primary pathogen of Fusarium head blight, a devastating disease of wheat worldwide. In this study, the wheat lipid transfer protein gene, TaLTP5, was cloned and evaluated for its ability to suppress disease development in transgenic wheat. TaLTP5 expression was induced after C. sativus infection. The TaLTP5 expression vector, pA25-TaLTP5, was constructed and bombarded into Chinese wheat variety Yangmai 18. Six TaLTP5 transgenic wheat lines were established and characterized. PCR and Southern blot analyses indicated that the introduced TaLTP5 gene was integrated into the genomes of six transgenic wheat lines by distinct patterns, and heritable. RT-PCR and real-time quantitative RT-PCR revealed that the TaLTP5 gene was over-expressed in the transgenic wheat lines compared to segregants lacking the transgene and wild-type wheat plants. Following challenge with C. sativus or F. graminearum, all six transgenic lines overexpressing TaLTP5 exhibited significantly enhanced resistance to both common root rot and Fusarium head blight compared to the untransformed wheat Yangmai 18.

  14. Transgenic Cotton Plants Expressing Double-stranded RNAs Target HMG-CoA Reductase (HMGR) Gene Inhibits the Growth, Development and Survival of Cotton Bollworms.

    Science.gov (United States)

    Tian, Geng; Cheng, Linlin; Qi, Xuewei; Ge, Zonghe; Niu, Changying; Zhang, Xianlong; Jin, Shuangxia

    2015-01-01

    RNA interference (RNAi) has been developed as a powerful technique in the research of functional genomics as well as plant pest control. In this report, double-stranded RNAs (dsRNA) targeting 3-hydroxy-3-methylglutaryl coenzyme A reductase (HMGR) gene, which catalyze a rate-limiting enzymatic reaction in the mevalonate pathway of juvenile hormone (JH) synthesis in cotton bollworm, was expressed in cotton plants via Agrobacterium tumefaciens-mediated transformation. PCR and Sothern analysis revealed the integration of HMGR gene into cotton genome. RT-PCR and qRT-PCR confirmed the high transcription level of dsHMGR in transgenic cotton lines. The HMGR expression both in transcription and translation level was significantly downregulated in cotton bollworms (helicoverpa armigera) larvae after feeding on the leaves of HMGR transgenic plants. The transcription level of HMGR gene in larvae reared on transgenic cotton leaves was as much as 80.68% lower than that of wild type. In addition, the relative expression level of vitellogenin (Vg, crucial source of nourishment for offspring embryo development) gene was also reduced by 76.86% when the insect larvae were fed with transgenic leaves. The result of insect bioassays showed that the transgenic plant harboring dsHMGR not only inhibited net weight gain but also delayed the growth of cotton bollworm larvae. Taken together, transgenic cotton plant expressing dsRNAs successfully downregulated HMGR gene and impaired the development and survival of target insect, which provided more option for plant pest control.

  15. Transgenic approach to improve wheat (Triticum aestivum L.) nutritional quality.

    Science.gov (United States)

    Tamás, Cecília; Kisgyörgy, Boglárka N; Rakszegi, Mariann; Wilkinson, Mark D; Yang, Moon-Sik; Láng, László; Tamás, László; Bedo, Zoltán

    2009-07-01

    An amaranth (Amaranthus hypochondriacus) albumin gene, encoding the 35-kDa AmA1 protein of the seed, with a high content of essential amino acids, was used in the biolistic transformation of bread wheat (Triticum aestivum L.) variety Cadenza. The transformation cassette carried the ama1 gene under the control of a powerful wheat endosperm-specific promoter (1Bx17 HMW-GS). Southern-blot analysis of T(1) lines confirmed the integration of the foreign gene, while RT-PCR and Western-blot analyses of the samples confirmed the transcription and translation of the transgene. The effects of the extra albumin protein on the properties of flour, produced from bulked T(2) seeds, were calculated using total protein and essential amino acid content analysis, polymeric/monomeric protein and HMW/LMW glutenin subunit ratio measurements. The results indicated that not only can essential amino acid content be increased, but some parameters associated with functional quality may also be improved because of the expression of the AmA1 protein.

  16. Estrogen and progesterone receptors have distinct roles in the establishment of the hyperplastic phenotype in PR-A transgenic mice

    Energy Technology Data Exchange (ETDEWEB)

    Simian, Marina; Bissell, Mina J.; Barcellos-Hoff, Mary Helen; Shyamala, Gopalan

    2009-05-11

    Expression of the A and B forms of progesterone receptor (PR) in an appropriate ratio is critical for mammary development. Mammary glands of PR-A transgenic mice, carrying an additional A form of PR as a transgene, exhibit morphological features associated with the development of mammary tumors. Our objective was to determine the roles of estrogen (E) and progesterone (P) in the genesis of mammary hyperplasias/preneoplasias in PR-A transgenics. We subjected PR-A mice to hormonal treatments and analyzed mammary glands for the presence of hyperplasias and used BrdU incorporation to measure proliferation. Quantitative image analysis was carried out to compare levels of latency-associated peptide and transforming growth factor beta 1 (TGF{beta}1) between PR-A and PR-B transgenics. Basement membrane disruption was examined by immunofluorescence and proteolytic activity by zymography. The hyperplastic phenotype of PR-A transgenics is inhibited by ovariectomy, and is reversed by treatment with E + P. Studies using the antiestrogen ICI 182,780 or antiprogestins RU486 or ZK 98,299 show that the increase in proliferation requires signaling through E/estrogen receptor alpha but is not sufficient to give rise to hyperplasias, whereas signaling through P/PR has little impact on proliferation but is essential for the manifestation of hyperplasias. Increased proliferation is correlated with decreased TGF{beta}1 activation in the PR-A transgenics. Analysis of basement membrane integrity showed loss of laminin-5, collagen III and collagen IV in mammary glands of PR-A mice, which is restored by ovariectomy. Examination of matrix metalloproteases (MMPs) showed that total levels of MMP-2 correlate with the steady-state levels of PR, and that areas of laminin-5 loss coincide with those of activation of MMP-2 in PR-A transgenics. Activation of MMP-2 is dependent on treatment with E and P in ovariectomized wild-type mice, but is achieved only by treatment with P in PR-A mice. These data

  17. The growth performance of F1 transgenic mutiara catfish

    Science.gov (United States)

    Iskandar; Buwono, I. D.; Agung, M. U. K.

    2018-04-01

    The growth of catfish (African or Sangkuriang strain) these days is tend to decreased. One of the solutions due to this problem is to improve the genetics of growth using transgenesis technology, toward more profitable. The specific objective of the research is to detect the transmission of exogenous GH (African catfish GH inserts) inside the F1 transgenic Mutiara catfish using PCR (Polymerase Chain Reaction) method and to evaluate the growth performance of transgenic Mutiara catfish made using the parameters of feed conversion (FCR = Feed Conversion Ratio). Transgenic catfish (strain mutiara) F0 and F1 carried African catfish GH (600 bp) can be produced. Superiority characters of transgenic catfish represented heritability (h2 ) and heterosis (H), indicating that the offspring of hybrid F1 transgenic mutiara catfish had phenotypes rapid growth (h2 = 17.55 % and H = 42.83 %) compared to non-transgenic catfish (h 2 = 10.07 % and H = 18.56 %). Evaluation of the efficiency of feed use parameters feed conversion ratio, shows that F1 transgenic mutiara catfish (FCR = 0.85) more efficient in converting feed into meat.

  18. Design and Management of Field Trials of Transgenic Cereals

    Science.gov (United States)

    Bedő, Zoltán; Rakszegi, Mariann; Láng, László

    The development of gene transformation systems has allowed the introgression of alien genes into plant genomes, thus providing a mechanism for broadening the genetic resources available to plant breeders. The design and the management of field trials vary according to the purpose for which transgenic cereals are developed. Breeders study the phenotypic and genotypic stability of transgenic plants, monitor the increase in homozygosity of transgenic genotypes under field conditions, and develop backcross generations to transfer the introduced genes into secondary transgenic cereal genotypes. For practical purposes, they may also multiply seed of the transgenic lines to produce sufficient amounts of grain for the detailed analysis of trait(s) of interest, to determine the field performance of transgenic lines, and to compare them with the non-transformed parental genotypes. Prior to variety registration, the Distinctness, Uniformity and Stability (DUS) tests and Value for Cultivation and Use (VCU) experiments are carried out in field trials. Field testing includes specific requirements for transgenic cereals to assess potential environmental risks. The capacity of the pollen to survive, establish and disseminate in the field test environment, the potential for gene transfer, the effects of products expressed by the introduced sequences and phenotypic and genotypic instability that might cause deleterious effects must all be specifically monitored, as required by EU Directives 2003/701/EC (1) on the release of genetically modified higher plants in the environment.

  19. Generation and characterization of human heme oxygenase-1 transgenic pigs.

    Directory of Open Access Journals (Sweden)

    Hye-Jung Yeom

    Full Text Available Xenotransplantation using transgenic pigs as an organ source is a promising strategy to overcome shortage of human organ for transplantation. Various genetic modifications have been tried to ameliorate xenograft rejection. In the present study we assessed effect of transgenic expression of human heme oxygenase-1 (hHO-1, an inducible protein capable of cytoprotection by scavenging reactive oxygen species and preventing apoptosis caused by cellular stress during inflammatory processes, in neonatal porcine islet-like cluster cells (NPCCs. Transduction of NPCCs with adenovirus containing hHO-1 gene significantly reduced apoptosis compared with the GFP-expressing adenovirus control after treatment with either hydrogen peroxide or hTNF-α and cycloheximide. These protective effects were diminished by co-treatment of hHO-1 antagonist, Zinc protoporphyrin IX. We also generated transgenic pigs expressing hHO-1 and analyzed expression and function of the transgene. Human HO-1 was expressed in most tissues, including the heart, kidney, lung, pancreas, spleen and skin, however, expression levels and patterns of the hHO-1 gene are not consistent in each organ. We isolate fibroblast from transgenic pigs to analyze protective effect of the hHO-1. As expected, fibroblasts derived from the hHO-1 transgenic pigs were significantly resistant to both hydrogen peroxide damage and hTNF-α and cycloheximide-mediated apoptosis when compared with wild-type fibroblasts. Furthermore, induction of RANTES in response to hTNF-α or LPS was significantly decreased in fibroblasts obtained from the hHO-1 transgenic pigs. These findings suggest that transgenic expression of hHO-1 can protect xenografts when exposed to oxidative stresses, especially from ischemia/reperfusion injury, and/or acute rejection mediated by cytokines. Accordingly, hHO-1 could be an important candidate molecule in a multi-transgenic pig strategy for xenotransplantation.

  20. Generation and characterization of human heme oxygenase-1 transgenic pigs.

    Science.gov (United States)

    Yeom, Hye-Jung; Koo, Ok Jae; Yang, Jaeseok; Cho, Bumrae; Hwang, Jong-Ik; Park, Sol Ji; Hurh, Sunghoon; Kim, Hwajung; Lee, Eun Mi; Ro, Han; Kang, Jung Taek; Kim, Su Jin; Won, Jae-Kyung; O'Connell, Philip J; Kim, Hyunil; Surh, Charles D; Lee, Byeong-Chun; Ahn, Curie

    2012-01-01

    Xenotransplantation using transgenic pigs as an organ source is a promising strategy to overcome shortage of human organ for transplantation. Various genetic modifications have been tried to ameliorate xenograft rejection. In the present study we assessed effect of transgenic expression of human heme oxygenase-1 (hHO-1), an inducible protein capable of cytoprotection by scavenging reactive oxygen species and preventing apoptosis caused by cellular stress during inflammatory processes, in neonatal porcine islet-like cluster cells (NPCCs). Transduction of NPCCs with adenovirus containing hHO-1 gene significantly reduced apoptosis compared with the GFP-expressing adenovirus control after treatment with either hydrogen peroxide or hTNF-α and cycloheximide. These protective effects were diminished by co-treatment of hHO-1 antagonist, Zinc protoporphyrin IX. We also generated transgenic pigs expressing hHO-1 and analyzed expression and function of the transgene. Human HO-1 was expressed in most tissues, including the heart, kidney, lung, pancreas, spleen and skin, however, expression levels and patterns of the hHO-1 gene are not consistent in each organ. We isolate fibroblast from transgenic pigs to analyze protective effect of the hHO-1. As expected, fibroblasts derived from the hHO-1 transgenic pigs were significantly resistant to both hydrogen peroxide damage and hTNF-α and cycloheximide-mediated apoptosis when compared with wild-type fibroblasts. Furthermore, induction of RANTES in response to hTNF-α or LPS was significantly decreased in fibroblasts obtained from the hHO-1 transgenic pigs. These findings suggest that transgenic expression of hHO-1 can protect xenografts when exposed to oxidative stresses, especially from ischemia/reperfusion injury, and/or acute rejection mediated by cytokines. Accordingly, hHO-1 could be an important candidate molecule in a multi-transgenic pig strategy for xenotransplantation.

  1. Aberrant phenotypes of transgenic mice expressing dimeric human erythropoietin

    Directory of Open Access Journals (Sweden)

    Yun Seong-Jo

    2012-01-01

    Full Text Available Abstract Background Dimeric human erythropoietin (dHuEPO peptides are reported to exhibit significantly higher biological activity than the monomeric form of recombinant EPO. The objective of this study was to produce transgenic (tg mice expressing dHuEPO and to investigate the characteristics of these mice. Methods A dHuEPO-expressing vector under the control of the goat beta-casein promoter, which produced a dimer of human EPO molecules linked by a 2-amino acid peptide linker (Asp-Ile, was constructed and injected into 1-cell fertilized embryos by microinjection. Mice were screened using genomic DNA samples obtained from tail biopsies. Blood samples were obtained by heart puncture using heparinized tubes, and hematologic parameters were assessed. Using the microarray analysis tool, we analyzed differences in gene expression in the spleens of tg and control mice. Results A high rate of spontaneous abortion or death of the offspring was observed in the recipients of dHuEPO embryos. We obtained 3 founder lines (#4, #11, and #47 of tg mice expressing the dHuEPO gene. However, only one founder line showed stable germline integration and transmission, subsequently establishing the only transgenic line (#11. We obtained 2 F1 mice and 3 F2 mice from line #11. The dHuEPO protein could not be obtained because of repeated spontaneous abortions in the tg mice. Tg mice exhibited symptoms such as short lifespan and abnormal blood composition. The red blood cell count, white blood cell count, and hematocrit levels in the tg mice were remarkably higher than those in the control mice. The spleens of the tg mice (F1 and F2 females were 11- and -21-fold larger than those of the control mice. Microarray analysis revealed 2,672 spleen-derived candidate genes; more genes were downregulated than upregulated (849/764. Reverse transcriptase-polymerase chain reaction (RT-PCR and quantitative real-time PCR (qRT-PCR were used for validating the results of the microarray

  2. Transition rates from schizotypal disorder to psychotic disorder for first-contact patients included in the OPUS trial. A randomized clinical trial of integrated treatment and standard treatment

    DEFF Research Database (Denmark)

    Nordentoft, Merete; Thorup, Anne; Petersen, Lone

    2006-01-01

    Only a few randomized clinical trials have tested the effect on transition rates of intervention programs for patients with sub-threshold psychosis-like symptoms.......Only a few randomized clinical trials have tested the effect on transition rates of intervention programs for patients with sub-threshold psychosis-like symptoms....

  3. Single-copy insertion of transgenes in Caenorhabditis elegans

    DEFF Research Database (Denmark)

    Frøkjaer-Jensen, Christian; Davis, M Wayne; Hopkins, Christopher E

    2008-01-01

    developed a method that inserts a single copy of a transgene into a defined site. Mobilization of a Mos1 transposon generates a double-strand break in noncoding DNA. The break is repaired by copying DNA from an extrachromosomal template into the chromosomal site. Homozygous single-copy insertions can...... be obtained in less than 2 weeks by injecting approximately 20 worms. We have successfully inserted transgenes as long as 9 kb and verified that single copies are inserted at the targeted site. Single-copy transgenes are expressed at endogenous levels and can be expressed in the female and male germlines....

  4. Randomization tests

    CERN Document Server

    Edgington, Eugene

    2007-01-01

    Statistical Tests That Do Not Require Random Sampling Randomization Tests Numerical Examples Randomization Tests and Nonrandom Samples The Prevalence of Nonrandom Samples in Experiments The Irrelevance of Random Samples for the Typical Experiment Generalizing from Nonrandom Samples Intelligibility Respect for the Validity of Randomization Tests Versatility Practicality Precursors of Randomization Tests Other Applications of Permutation Tests Questions and Exercises Notes References Randomized Experiments Unique Benefits of Experiments Experimentation without Mani

  5. A randomized phase III study between sequential versus simultaneous integrated boost intensity-modulated radiation therapy in nasopharyngeal carcinoma.

    Science.gov (United States)

    Lertbutsayanukul, Chawalit; Prayongrat, Anussara; Kannarunimit, Danita; Chakkabat, Chakkapong; Netsawang, Buntipa; Kitpanit, Sarin

    2018-05-01

    This study was performed to compare the acute and late toxicities between sequential (SEQ) and simultaneous integrated boost (SIB) intensity-modulated radiotherapy (IMRT) in nasopharyngeal carcinoma (NPC). Stage I-IVB NPC patients were randomized to receive SEQ-IMRT or SIB-IMRT. SEQ-IMRT consisted of two plans: 2 Gy × 25 fractions to low-risk planning target volume (PTV) followed by a sequential boost (2 Gy × 10 fractions) to high-risk PTV, while SIB-IMRT treated low- and high-risk PTVs with doses of 56 and 70 Gy in 33 fractions. Toxicities and survival outcomes were analyzed. Between October 2010 and September 2015, of the 209 patients who completed treatment, 102 in the SEQ and 107 in the SIB arm were analyzed. The majority had undifferentiated squamous cell carcinoma (82%). Mucositis and dysphagia were the most common grade 3-5 acute toxicities. There were no statistically significant differences in the cumulative incidence of grade 3-4 acute toxicities between the two arms (59.8% in SEQ vs. 58.9% in SIB; P = 0.892). Common grade 3-4 late toxicities for SEQ and SIB included hearing loss (2.9 vs. 8.4%), temporal lobe injury (2.9 vs. 0.9%), cranial nerve injury (0 vs. 2.8%), and xerostomia (2 vs. 0.9%). With the median follow-up of 41 months, 3‑year progression-free and overall survival rates were 72.7 vs. 73.4% (P = 0.488) and 86.3 vs. 83.6% (P = 0.938), respectively. SEQ and SIB provide excellent survival outcomes with few late toxicities. According to our study, SIB with a satisfactory dose-volume constraint to nearby critical organs is the technique of choice for NPC treatment due to its convenience.

  6. A school-randomized clinical trial of an integrated social-emotional learning and literacy intervention: impacts after 1 school year.

    Science.gov (United States)

    Jones, Stephanie M; Brown, Joshua L; Hoglund, Wendy L G; Aber, J Lawrence

    2010-12-01

    To report experimental impacts of a universal, integrated school-based intervention in social-emotional learning and literacy development on change over 1 school year in 3rd-grade children's social-emotional, behavioral, and academic outcomes. This study employed a school-randomized, experimental design and included 942 3rd-grade children (49% boys; 45.6% Hispanic/Latino, 41.1% Black/African American, 4.7% non-Hispanic White, and 8.6% other racial/ethnic groups, including Asian, Pacific Islander, Native American) in 18 New York City public elementary schools. Data on children's social-cognitive processes (e.g., hostile attribution biases), behavioral symptomatology (e.g., conduct problems), and literacy skills and academic achievement (e.g., reading achievement) were collected in the fall and spring of 1 school year. There were main effects of the 4Rs Program after 1 year on only 2 of the 13 outcomes examined. These include children's self-reports of hostile attributional biases (Cohen's d = 0.20) and depression (d = 0.24). As expected based on program and developmental theory, there were impacts of the intervention for those children identified by teachers at baseline with the highest levels of aggression (d = 0.32-0.59) on 4 other outcomes: children's self-reports of aggressive fantasies, teacher reports of academic skills, reading achievement scaled scores, and children's attendance. This report of effects of the 4Rs intervention on individual children across domains of functioning after 1 school year represents an important first step in establishing a better understanding of what is achievable by a schoolwide intervention such as the 4Rs in its earliest stages of unfolding. The first-year impacts, combined with our knowledge of sustained and expanded effects after a second year, provide evidence that this intervention may be initiating positive developmental cascades both in the general population of students and among those at highest behavioral risk. (Psyc

  7. An integrative computational framework based on a two-step random forest algorithm improves prediction of zinc-binding sites in proteins.

    Directory of Open Access Journals (Sweden)

    Cheng Zheng

    Full Text Available Zinc-binding proteins are the most abundant metalloproteins in the Protein Data Bank where the zinc ions usually have catalytic, regulatory or structural roles critical for the function of the protein. Accurate prediction of zinc-binding sites is not only useful for the inference of protein function but also important for the prediction of 3D structure. Here, we present a new integrative framework that combines multiple sequence and structural properties and graph-theoretic network features, followed by an efficient feature selection to improve prediction of zinc-binding sites. We investigate what information can be retrieved from the sequence, structure and network levels that is relevant to zinc-binding site prediction. We perform a two-step feature selection using random forest to remove redundant features and quantify the relative importance of the retrieved features. Benchmarking on a high-quality structural dataset containing 1,103 protein chains and 484 zinc-binding residues, our method achieved >80% recall at a precision of 75% for the zinc-binding residues Cys, His, Glu and Asp on 5-fold cross-validation tests, which is a 10%-28% higher recall at the 75% equal precision compared to SitePredict and zincfinder at residue level using the same dataset. The independent test also indicates that our method has achieved recall of 0.790 and 0.759 at residue and protein levels, respectively, which is a performance better than the other two methods. Moreover, AUC (the Area Under the Curve and AURPC (the Area Under the Recall-Precision Curve by our method are also respectively better than those of the other two methods. Our method can not only be applied to large-scale identification of zinc-binding sites when structural information of the target is available, but also give valuable insights into important features arising from different levels that collectively characterize the zinc-binding sites. The scripts and datasets are available at http://protein.cau.edu.cn/zincidentifier/.

  8. Selectivity and Efficiency of Late Transgene Expression by Transcriptionally Targeted Oncolytic Adenoviruses Are Dependent on the Transgene Insertion Strategy

    Science.gov (United States)

    Quirin, Christina; Rohmer, Stanimira; Fernández-Ulibarri, Inés; Behr, Michael; Hesse, Andrea; Engelhardt, Sarah; Erbs, Philippe; Enk, Alexander H.

    2011-01-01

    Abstract Key challenges facing cancer therapy are the development of tumor-specific drugs and potent multimodal regimens. Oncolytic adenoviruses possess the potential to realize both aims by restricting virus replication to tumors and inserting therapeutic genes into the virus genome, respectively. A major effort in this regard is to express transgenes in a tumor-specific manner without affecting virus replication. Using both luciferase as a sensitive reporter and genetic prodrug activation, we show that promoter control of E1A facilitates highly selective expression of transgenes inserted into the late transcription unit. This, however, required multistep optimization of late transgene expression. Transgene insertion via internal ribosome entry site (IRES), splice acceptor (SA), or viral 2A sequences resulted in replication-dependent expression. Unexpectedly, analyses in appropriate substrates and with matching control viruses revealed that IRES and SA, but not 2A, facilitated indirect transgene targeting via tyrosinase promoter control of E1A. Transgene expression via SA was more selective (up to 1,500-fold) but less effective than via IRES. Notably, we also revealed transgene-dependent interference with splicing. Hence, the prodrug convertase FCU1 (a cytosine deaminase–uracil phosphoribosyltransferase fusion protein) was expressed only after optimizing the sequence surrounding the SA site and mutating a cryptic splice site within the transgene. The resulting tyrosinase promoter-regulated and FCU1-encoding adenovirus combined effective oncolysis with targeted prodrug activation therapy of melanoma. Thus, prodrug activation showed potent bystander killing and increased cytotoxicity of the virus up to 10-fold. We conclude that armed oncolytic viruses can be improved substantially by comparing and optimizing strategies for targeted transgene expression, thereby implementing selective and multimodal cancer therapies. PMID:20939692

  9. Expression of Human CAR Splicing Variants in BAC-Transgenic Mice

    OpenAIRE

    Zhang, Yu-Kun Jennifer; Lu, Hong; Klaassen, Curtis D.

    2012-01-01

    The nuclear receptor constitutive androstane receptor (CAR) is a key regulator for drug metabolism in liver. Human CAR (hCAR) transcripts are subjected to alternative splicing. Some hCAR splicing variants (SVs) have been shown to encode functional proteins by reporter assays. However, in vivo research on the activity of these hCAR SVs has been impeded by the absence of a valid model. This study engineered an hCAR-BAC-transgenic (hCAR-TG) mouse model by integrating the 8.5-kbp hCAR gene as wel...

  10. Preliminary report on the production of transgenic Oreochromis ...

    African Journals Online (AJOL)

    Prof. Ogunji

    GFP expression using inverted fluorescence microscopy and photograph was ... cloned into pGEM®-T easy vector system and transformed using E. coli .... Fluorescent images of β-actin expression of GFP in transgenic embryo body tissues.

  11. Transgene expression in cowpea ( Vigna unguiculata (L.) Walp ...

    African Journals Online (AJOL)

    Transgene expression in cowpea ( Vigna unguiculata (L.) Walp.) ... and Bar genes for β-glucuronidase expression and bialaphos resistance respectively. ... expression also showed positive signals under PCR and Southern analysis giving ...

  12. Designer proton-channel transgenic algae for photobiological hydrogen production

    Science.gov (United States)

    Lee, James Weifu [Knoxville, TN

    2011-04-26

    A designer proton-channel transgenic alga for photobiological hydrogen production that is specifically designed for production of molecular hydrogen (H.sub.2) through photosynthetic water splitting. The designer transgenic alga includes proton-conductive channels that are expressed to produce such uncoupler proteins in an amount sufficient to increase the algal H.sub.2 productivity. In one embodiment the designer proton-channel transgene is a nucleic acid construct (300) including a PCR forward primer (302), an externally inducible promoter (304), a transit targeting sequence (306), a designer proton-channel encoding sequence (308), a transcription and translation terminator (310), and a PCR reverse primer (312). In various embodiments, the designer proton-channel transgenic algae are used with a gas-separation system (500) and a gas-products-separation and utilization system (600) for photobiological H.sub.2 production.

  13. Transgenic mouse models of hormonal mammary carcinogenesis: advantages and limitations.

    Science.gov (United States)

    Kirma, Nameer B; Tekmal, Rajeshwar R

    2012-09-01

    Mouse models of breast cancer, especially transgenic and knockout mice, have been established as valuable tools in shedding light on factors involved in preneoplastic changes, tumor development and malignant progression. The majority of mouse transgenic models develop estrogen receptor (ER) negative tumors. This is seen as a drawback because the majority of human breast cancers present an ER positive phenotype. On the other hand, several transgenic mouse models have been developed that produce ER positive mammary tumors. These include mice over-expressing aromatase, ERα, PELP-1 and AIB-1. In this review, we will discuss the value of these models as physiologically relevant in vivo systems to understand breast cancer as well as some of the pitfalls involving these models. In all, we argue that the use of transgenic models has improved our understanding of the molecular aspects and biology of breast cancer. Copyright © 2011 Elsevier Ltd. All rights reserved.

  14. Assessment of Bollgard II cotton pollen mediated transgenes flow to ...

    African Journals Online (AJOL)

    INERA05

    2013-08-14

    Aug 14, 2013 ... insects such as honey bees, bumble bees and butterflies. Genetic materials ... cotton fields separated from the transgenes source by wide open space. In Boni ..... Breeding: new strategies in plant improvement. International ...

  15. Transgene transmission in South American catfish (Rhamdia quelen ...

    Indian Academy of Sciences (India)

    Prakash

    in this study was to evaluate different sperm-mediated gene transfer (SMGT) methods to obtain transgenic silver catfish. .... by the critical point method, they were observed under a ..... protein is important for the maintenance of sperm quality in.

  16. Calcium electrotransfer for termination of transgene expression in muscle

    DEFF Research Database (Denmark)

    Hojman, Pernille; Spanggaard, Iben; Olsen, Caroline Holkman

    2011-01-01

    Gene electrotransfer is expanding in clinical use, thus we have searched for an emergency procedure to stop transgene expression in case of serious adverse events. Calcium is cytotoxic at high intracellular levels, so we tested effects of calcium electrotransfer on transgene expression in muscle....... A clinical grade calcium solution (20 μl, 168 mM) was injected into transfected mouse or rat tibialis cranialis muscle. Ca(2+) uptake was quantified using calcium 45 ((45)Ca), and voltage and time between injection and pulsation were varied. Extinction of transgene expression was investigated by using both...... voltage pulses of 1000 V/cm. Using these parameters, in vivo imaging showed that transgene expression significantly decreased 4 hr after Ca(2+) electrotransfer and was eliminated within 24 hr. Similarly, serum erythropoietin was reduced by 46% at 4 hr and to control levels at 2 days. Histological analyses...

  17. Assessment of Bollgard II cotton pollen mediated transgenes flow to ...

    African Journals Online (AJOL)

    Assessment of Bollgard II cotton pollen mediated transgenes flow to conventional cotton in the farming conditions of Burkina ... This has led to experiment on Bt cotton from 2003 to 2007. ... EMAIL FREE FULL TEXT EMAIL FREE FULL TEXT

  18. Polycythemia in transgenic mice expressing the human erythropoietin gene

    International Nuclear Information System (INIS)

    Semenza, G.L.; Traystman, M.D.; Gearhart, J.D.; Antonarakis, S.E.

    1989-01-01

    Erythropoietin is a glycoprotein hormone that regulates mammalian erythropoiesis. To study the expression of the human erythropoietin gene, EPO, 4 kilobases of DNA encompassing the gene with 0.4 kilobase of 5' flanking sequence and 0.7 kilobase of 3' flanking sequence was microinjected into fertilized mouse eggs. Transgenic mice were generated that are polycythemic, with increased erythrocytic indices in peripheral blood, increased numbers of erythroid precursors in hematopoietic tissue, and increased serum erythropoietin levels. Transgenic homozygotes show a greater degree of polycythemia than do heterozygotes as well as striking extramedullary erythropoiesis. Human erythropoietin RNA was found not only in fetal liver, adult liver, and kidney but also in all other transgenic tissues analyzed. Anemia induced increased human erythropoietin RNA levels in liver but not kidney. These transgenic mice represent a unique model of polycythemia due to increased erythropoietin levels

  19. Transgenic overexpression of BAFF regulates the expression of ...

    Indian Academy of Sciences (India)

    To investigate whether transgenic overexpression of the zebrafish BAFF leads to ... and BAFF proteins were expressed separately and confirmed in HeLa cells. ... body homogenate of zebrafish and demonstrated a significant increase in ...

  20. Efficient production of transgenic soybean (Glycine max [L] Merrill ...

    African Journals Online (AJOL)

    Efficient production of transgenic soybean (Glycine max [L] Merrill) plants mediated via whisker-supersonic (WSS) method. MM Khalafalla, HA El-Shemy, SM Rahman, M Teraishi, H Hasegawa, T Terakawa, M Ishimoto ...

  1. Transgenic approaches in potato: effects on glycoalkaloids levels

    African Journals Online (AJOL)

    Sayyar

    2013-02-20

    Feb 20, 2013 ... Tax and Vernon, 2001). The inserted transgene varies in ... regions are disfavored under selective conditions as the case in previous studies. .... human consumption at concentration >200 mg/1000 g of total tuber weight ...

  2. Genome-Wide Analysis of a TaLEA-Introduced Transgenic Populus simonii × Populus nigra Dwarf Mutant

    Directory of Open Access Journals (Sweden)

    Jing Jiang

    2012-03-01

    Full Text Available A dwarf mutant (dwf1 was obtained among 15 transgenic lines, when TaLEA (Tamarix androssowii late embryogenesis abundant gene was introduced into Populus simonii × Populus nigra by Agrobacterium tumefaciens-mediated transformation. Under the same growth conditions, dwf1 height was significantly reduced compared with the wild type and the other transgenic lines. Because only one transgenic line (dwf1 displayed the dwarf phenotype, we considered that T-DNA insertion sites may play a role in the mutant formation. The mechanisms underlying this effect were investigated using TAIL-PCR (thermal asymmetric interlaced PCR and microarrays methods. According to the TAIL-PCR results, two flanking sequences located on chromosome IV and VIII respectively, were cloned. The results indicated the integration of two independent T-DNA copies. We searched for the potential genes near to the T-DNA insertions. The nearest gene was a putative poplar AP2 transcription factor (GI: 224073210. Expression analysis showed that AP2 was up-regulated in dwf1 compared with the wild type and the other transgenic lines. According to the microarrays results, a total of 537 genes involved in hydrolase, kinase and transcription factor activities, as well as protein and nucleotide binding, showed significant alterations in gene expression. These genes were expressed in more than 60 metabolic pathways, including starch, sucrose, galactose and glycerolipid metabolism and phenylpropanoids and flavonoid biosyntheses. Our transcriptome and T-DNA insertion sites analyses might provide some useful insights into the dwarf mutant formation.

  3. Towards Transgenic Primates: What can we learn from mouse genetics?

    Institute of Scientific and Technical Information of China (English)

    KUANG Hui; WANG Phillip L.; TSIEN Joe Z.

    2009-01-01

    Considering the great physiological and behavioral similarities with humans, monkeys represent the ideal models not only for the study of complex cognitive behavior but also for the precUnical research and development of novel therapeutics for treating human diseases. Various powerful genetic tech-nologies initially developed for making mouse models are being explored for generating transgenic primate models. We review the latest genetic engineering technologies and discuss the potentials and limitations for systematic production of transgenic primates.

  4. A novel transgenic mouse model of lysosomal storage disorder

    OpenAIRE

    Ortiz-Miranda, Sonia; Ji, Rui; Jurczyk, Agata; Aryee, Ken-Edwin; Mo, Shunyan; Fletcher, Terry; Shaffer, Scott A.; Greiner, Dale L.; Bortell, Rita; Gregg, Ronald G.; Cheng, Alan; Hennings, Leah J.; Rittenhouse, Ann R.

    2016-01-01

    We provide an explanation for striking pathology found in a subset of genetically engineered mice homozygous for a rat CaVβ2a transgene (Tg+/+). Multiple transgene (Tg) copies inserted into chromosome 19; at this same site a large deletion occurred, ablating cholesterol 25-hydroxylase and partially deleting lysosomal acid lipase and CD95. Their loss of function can account for lipid build up and immune system hypertrophy, which defines this phenotype and serendipitously provides a novel model...

  5. Pain management in cancer center inpatients: a cluster randomized trial to evaluate a systematic integrated approach—The Edinburgh Pain Assessment and Management Tool

    OpenAIRE

    Fallon, M; Walker, J; Colvin, L; Rodriguez, A; Murray, G; Sharpe, M

    2018-01-01

    Purpose Pain is suboptimally managed in patients with cancer. We aimed to compare the effect of a policy of adding a clinician-delivered bedside pain assessment and management tool (Edinburgh Pain Assessment and management Tool [EPAT]) to usual care (UC) versus UC alone on pain outcomes. Patients and Methods In a two-arm, parallel group, cluster randomized (1:1) trial, we observed pain outcomes in 19 cancer centers in the United Kingdom and then randomly assigned the centers to eithe...

  6. Dehydrins Impart Protection against Oxidative Stress in Transgenic Tobacco Plants.

    Science.gov (United States)

    Halder, Tanmoy; Upadhyaya, Gouranga; Basak, Chandra; Das, Arup; Chakraborty, Chandrima; Ray, Sudipta

    2018-01-01

    Environmental stresses generate reactive oxygen species (ROS) which might be detrimental to the plants when produced in an uncontrolled way. However, the plants ameliorate such stresses by synthesizing antioxidants and enzymes responsible for the dismutation of ROS. Additionally, the dehydrins were also able to protect the inactivation of the enzyme lactate dehydrogenase against hydroxyl radicals (OH ⋅ ) generated during Fenton's reaction. SbDhn1 and SbDhn2 overexpressing transgenic tobacco plants were able to protect against oxidative damage. Transgenic tobacco lines showed better photosynthetic efficiency along with high chlorophyll content, soluble sugar and proline. However, the malonyl dialdehyde (MDA) content was significantly lower in transgenic lines. Experimental evidence demonstrates the protective effect of dehydrins on electron transport chain in isolated chloroplast upon methyl viologen (MV) treatment. The transgenic tobacco plants showed significantly lower superoxide radical generation () upon MV treatment. The accumulation of the H 2 O 2 was also lower in the transgenic plants. Furthermore, in the transgenic plants the expression of ROS scavenging enzymes was higher compared to non-transformed (NT) or vector transformed (VT) plants. Taken together these data, during oxidative stress dehydrins function by scavenging the () directly and also by rendering protection to the enzymes responsible for the dismutation of () thereby significantly reducing the amount of hydrogen peroxides formed. Increase in proline content along with other antioxidants might also play a significant role in stress amelioration. Dehydrins thus function co-operatively with other protective mechanisms under oxidative stress conditions rendering protection in stress environment.

  7. Transgenic crops coping with water scarcity.

    Science.gov (United States)

    Cominelli, Eleonora; Tonelli, Chiara

    2010-11-30

    Water scarcity is a serious problem that will be exacerbated by global climate change. Massive quantities of water are used in agriculture, and abiotic stresses, especially drought and increased salinity, are primary causes of crop loss worldwide. Various approaches may be adopted to consume less water in agriculture, one of them being the development of plants that use less water yet maintain high yields in conditions of water scarcity. In recent years several molecular networks concerned with stress perception, signal transduction and stress responses in plants have been elucidated. Consequently, engineering some of the genes involved in these mechanisms promises to enhance plant tolerance to stresses and in particular increase their water use efficiency. Here we review the various approaches used so far to produce transgenic plants having improved tolerance to abiotic stresses, and discuss criteria for choosing which genes to work on (functional and regulatory genes) and which gene expression promoters (constitutive, inducible, and cell-specific) have been used to obtain successful results. Copyright © 2010 Elsevier B.V. All rights reserved.

  8. Composite potato plants with transgenic roots on non-transgenic shoots: a model system for studying gene silencing in roots.

    Science.gov (United States)

    Horn, Patricia; Santala, Johanna; Nielsen, Steen Lykke; Hühns, Maja; Broer, Inge; Valkonen, Jari P T

    2014-12-01

    Composite potato plants offer an extremely fast, effective and reliable system for studies on gene functions in roots using antisense or inverted-repeat but not sense constructs for gene inactivation. Composite plants, with transgenic roots on a non-transgenic shoot, can be obtained by shoot explant transformation with Agrobacterium rhizogenes. The aim of this study was to generate composite potato plants (Solanum tuberosum) to be used as a model system in future studies on root-pathogen interactions and gene silencing in the roots. The proportion of transgenic roots among the roots induced was high (80-100%) in the four potato cultivars tested (Albatros, Desirée, Sabina and Saturna). No wild-type adventitious roots were formed at mock inoculation site. All strains of A. rhizogenes tested induced phenotypically normal roots which, however, showed a reduced response to cytokinin as compared with non-transgenic roots. Nevertheless, both types of roots were infected to a similar high rate with the zoospores of Spongospora subterranea, a soilborne potato pathogen. The transgenic roots of composite potato plants expressed significantly higher amounts of β-glucuronidase (GUS) than the roots of a GUS-transgenic potato line event. Silencing of the uidA transgene (GUS) was tested by inducing roots on the GUS-transgenic cv. Albatros event with strains of A. rhizogenes over-expressing either the uidA sense or antisense transcripts, or inverted-repeat or hairpin uidA RNA. The three last mentioned constructs caused 2.5-4.0 fold reduction in the uidA mRNA expression. In contrast, over-expression of uidA resulted in over 3-fold increase in the uidA mRNA and GUS expression, indicating that sense-mediated silencing (co-suppression) was not functional in roots. The results suggest that composite plants offer a useful experimental system for potato research, which has gained little previous attention.

  9. Targeted transgenic overexpression of mitochondrial thymidine kinase (TK2) alters mitochondrial DNA (mtDNA) and mitochondrial polypeptide abundance: transgenic TK2, mtDNA, and antiretrovirals.

    Science.gov (United States)

    Hosseini, Seyed H; Kohler, James J; Haase, Chad P; Tioleco, Nina; Stuart, Tami; Keebaugh, Erin; Ludaway, Tomika; Russ, Rodney; Green, Elgin; Long, Robert; Wang, Liya; Eriksson, Staffan; Lewis, William

    2007-03-01

    Mitochondrial toxicity limits nucleoside reverse transcriptase inhibitors (NRTIs) for acquired immune deficiency syndrome. NRTI triphosphates, the active moieties, inhibit human immunodeficiency virus reverse transcriptase and eukaryotic mitochondrial DNA polymerase pol-gamma. NRTI phosphorylation seems to correlate with mitochondrial toxicity, but experimental evidence is lacking. Transgenic mice (TGs) with cardiac overexpression of thymidine kinase isoforms (mitochondrial TK2 and cytoplasmic TK1) were used to study NRTI mitochondrial toxicity. Echocardiography and nuclear magnetic resonance imaging defined cardiac performance and structure. TK gene copy and enzyme activity, mitochondrial (mt) DNA and polypeptide abundance, succinate dehydrogenase and cytochrome oxidase histochemistry, and electron microscopy correlated with transgenesis, mitochondrial structure, and biogenesis. Antiretroviral combinations simulated therapy. Untreated hTK1 or TK2 TGs exhibited normal left ventricle mass. In TK2 TGs, cardiac TK2 gene copy doubled, activity increased 300-fold, and mtDNA abundance doubled. Abundance of the 17-kd subunit of complex I, succinate dehydrogenase histochemical activity, and cristae density increased. NRTIs increased left ventricle mass 20% in TK2 TGs. TK activity increased 3 logs in hTK1 TGs, but no cardiac phenotype resulted. NRTIs abrogated functional effects of transgenically increased TK2 activity but had no effect on TK2 mtDNA abundance. Thus, NRTI mitochondrial phosphorylation by TK2 is integral to clinical NRTI mitochondrial toxicity.

  10. A proteomic study to identify soya allergens--the human response to transgenic versus non-transgenic soya samples.

    Science.gov (United States)

    Batista, Rita; Martins, Isabel; Jeno, Paul; Ricardo, Cândido Pinto; Oliveira, Maria Margarida

    2007-01-01

    In spite of being among the main foods responsible for allergic reactions worldwide, soybean (Glycine max)-derived products continue to be increasingly widespread in a variety of food products due to their well-documented health benefits. Soybean also continues to be one of the elected target crops for genetic modification. The aim of this study was to characterize the soya proteome and, specifically, IgE-reactive proteins as well as to compare the IgE response in soya-allergic individuals to genetically modified Roundup Ready soya versus its non-transgenic control. We performed two-dimensional gel electrophoresis of protein extracts from a 5% genetically modified Roundup Ready flour sample and its non-transgenic control followed by Western blotting with plasma from 5 soya-sensitive individuals. We used peptide tandem mass spectrometry to identify soya proteins (55 protein matches), specifically IgE-binding ones, and to evaluate differences between transgenic and non-transgenic samples. We identified 2 new potential soybean allergens--one is maturation associated and seems to be part of the late embryogenesis abundant proteins group and the other is a cysteine proteinase inhibitor. None of the individuals tested reacted differentially to the transgenic versus non-transgenic samples under study. Soybean endogenous allergen expression does not seem to be altered after genetic modification. Proteomics should be considered a powerful tool for functional characterization of plants and for food safety assessment. Copyright (c) 2007 S. Karger AG, Basel.

  11. Survival of Skin Graft between Transgenic Cloned Dogs and Non-Transgenic Cloned Dogs

    Science.gov (United States)

    Kim, Geon A; Oh, Hyun Ju; Kim, Min Jung; Jo, Young Kwang; Choi, Jin; Park, Jung Eun; Park, Eun Jung; Lim, Sang Hyun; Yoon, Byung Il; Kang, Sung Keun; Jang, Goo; Lee, Byeong Chun

    2014-01-01

    Whereas it has been assumed that genetically modified tissues or cells derived from somatic cell nuclear transfer (SCNT) should be accepted by a host of the same species, their immune compatibility has not been extensively explored. To identify acceptance of SCNT-derived cells or tissues, skin grafts were performed between cloned dogs that were identical except for their mitochondrial DNA (mtDNA) haplotypes and foreign gene. We showed here that differences in mtDNA haplotypes and genetic modification did not elicit immune responses in these dogs: 1) skin tissues from genetically-modified cloned dogs were successfully transplanted into genetically-modified cloned dogs with different mtDNA haplotype under three successive grafts over 63 days; and 2) non-transgenic cloned tissues were accepted into transgenic cloned syngeneic recipients with different mtDNA haplotypes and vice versa under two successive grafts over 63 days. In addition, expression of the inserted gene was maintained, being functional without eliciting graft rejection. In conclusion, these results show that transplanting genetically-modified tissues into normal, syngeneic or genetically-modified recipient dogs with different mtDNA haplotypes do not elicit skin graft rejection or affect expression of the inserted gene. Therefore, therapeutically valuable tissue derived from SCNT with genetic modification might be used safely in clinical applications for patients with diseased tissues. PMID:25372489

  12. Heterologous Expression of Two Jatropha Aquaporins Imparts Drought and Salt Tolerance and Improves Seed Viability in Transgenic Arabidopsis thaliana.

    Directory of Open Access Journals (Sweden)

    Kasim Khan

    Full Text Available Drought and high salinity are environmental conditions that cause adverse effects on the growth and productivity of crops. Aquaporins are small integral membrane proteins that belong to the family of the major intrinsic proteins (MIPs, with members in animals, plants and microbes, where they facilitate the transport of water and/or small neutral solutes thereby affecting water balance. In this study we characterized two aquaporin genes namely, plasma membrane intrinsic protein (PIP2;7 and tonoplast intrinsic protein TIP1;3 from Jatropha curcas that are localised to the plasma membrane and vacuole respectively. Transgenic Arabidopsis thaliana lines over-expressing JcPIP2;7 and JcTIP1;3 under a constitutive promoter show improved germination under high salt and mannitol compared to control seeds. These transgenic plants also show increased root length under abiotic stress conditions compared to wild type Col-0 plants. Transgenic lines exposed to drought conditions by withholding water for 20 days, were able to withstand water stress and attained normal growth after re-watering unlike control plants which could not survive. Transgenic lines also had better seed yield than control under salt stress. Importantly, seed viability of transgenic plants grown under high salt concentration was 35%-45% compared to less than 5% for control seeds obtained from plants growing under salt stress. The effect of JcPIP2;7 and JcTIP1;3 on improving germination and seed viability in drought and salinity make these important candidates for genetic manipulation of plants for growth in saline soils.

  13. Competitive performance of transgenic wheat resistant to powdery mildew.

    Directory of Open Access Journals (Sweden)

    Olena Kalinina

    Full Text Available Genetically modified (GM plants offer an ideal model system to study the influence of single genes that confer constitutive resistance to pathogens on the ecological behaviour of plants. We used phytometers to study competitive interactions between GM lines of spring wheat Triticum aestivum carrying such genes and control lines. We hypothesized that competitive performance of GM lines would be reduced due to enhanced transgene expression under pathogen levels typically encountered in the field. The transgenes pm3b from wheat (resistance against powdery mildew Blumeria graminis or chitinase and glucanase genes from barley (resistance against fungi in general were introduced with the ubiquitin promoter from maize (pm3b and chitinase genes or the actin promoter from rice (glucanase gene. Phytometers of 15 transgenic and non-transgenic wheat lines were transplanted as seedlings into plots sown with the same 15 lines as competitive environments and subject to two soil nutrient levels. Pm3b lines had reduced mildew incidence compared with control lines. Chitinase and chitinase/glucanase lines showed the same high resistance to mildew as their control in low-nutrient treatment and slightly lower mildew rates than the control in high-nutrient environment. Pm3b lines were weaker competitors than control lines. This resulted in reduced yield and seed number. The Pm3b line with the highest transgene expression had 53.2% lower yield than the control whereas the Pm3b line which segregated in resistance and had higher mildew rates showed only minor costs under competition. The line expressing both chitinase and glucanase genes also showed reduced yield and seed number under competition compared with its control. Our results suggest that single transgenes conferring constitutive resistance to pathogens can have ecological costs and can weaken plant competitiveness even in the presence of the pathogen. The magnitude of these costs appears related to the degree

  14. Effect of the integrated approach of yoga therapy on platelet count and uric acid in pregnancy: A multicenter stratified randomized single-blind study

    Directory of Open Access Journals (Sweden)

    R Jayashree

    2013-01-01

    Conclusion: Antenatal integrated yoga from the twelfth week is safe and effective in promoting a healthy progression of platelets and uric acid in women with high-risk pregnancy, pointing to healthy hemodilution and better physiological adaptation.

  15. A Randomized Controlled Trial of Cognitive-Behavioral Therapy for Generalized Anxiety Disorder with Integrated Techniques from Emotion-Focused and Interpersonal Therapies

    Science.gov (United States)

    Newman, Michelle G.; Castonguay, Louis G.; Borkovec, Thomas D.; Fisher, Aaron J.; Boswell, James F.; Szkodny, Lauren E.; Nordberg, Samuel S.

    2011-01-01

    Objective: Recent models suggest that generalized anxiety disorder (GAD) symptoms may be maintained by emotional processing avoidance and interpersonal problems. Method: This is the first randomized controlled trial to test directly whether cognitive-behavioral therapy (CBT) could be augmented with the addition of a module targeting interpersonal…

  16. Random walk on random walks

    NARCIS (Netherlands)

    Hilário, M.; Hollander, den W.Th.F.; Sidoravicius, V.; Soares dos Santos, R.; Teixeira, A.

    2014-01-01

    In this paper we study a random walk in a one-dimensional dynamic random environment consisting of a collection of independent particles performing simple symmetric random walks in a Poisson equilibrium with density ¿¿(0,8). At each step the random walk performs a nearest-neighbour jump, moving to

  17. The Dmp1-SOST Transgene Interacts With and Downregulates the Dmp1-Cre Transgene and the Rosa(Notch) Allele.

    Science.gov (United States)

    Zanotti, Stefano; Canalis, Ernesto

    2016-05-01

    Activation of Notch1 in osteocytes of Rosa(Notch) mice, where a loxP-flanked STOP cassette and the Nicd coding sequence were targeted to the reverse orientation splice acceptor (Rosa)26 locus, causes osteopetrosis associated with suppressed Sost expression and enhanced Wnt signaling. To determine whether Sost downregulation mediates the effects of Notch activation in osteocytes, Rosa(Notch) mice were crossed with transgenics expressing Cre recombinase or SOST under the control of the dentin matrix protein (Dmp)1 promoter. Dmp1-SOST transgenics displayed vertebral osteopenia and a modest femoral cancellous and cortical bone phenotype, whereas hemizygous Dmp1-Cre transgenics heterozygous for the Rosa(Notch) allele (Dmp1-Cre;Rosa(Notch)) exhibited osteopetrosis. The phenotype of Notch activation in osteocytes was prevented in Dmp1-Cre;Rosa(Notch) mice hemizygous for the Dmp1-SOST transgene. The effect was associated with downregulated Notch signaling and suppressed Dmp1 and Rosa26 expression. To test whether SOST regulates Notch expression in osteocytes, cortical bone cultures from Dmp1-Cre;Rosa(Notch) mice or from Rosa(Notch) control littermates were exposed to recombinant human SOST. The addition of SOST had only modest effects on Notch target gene mRNA levels and suppressed Dmp1, but not Cre or Rosa26, expression. These findings suggest that prevention of the Dmp1-Cre;Rosa(Notch) skeletal phenotype by Dmp1-SOST is not secondary to SOST expression but to interactions among the Dmp1-SOST and Dmp1-Cre transgenes and the Rosa26 locus. In conclusion, the Dmp1-SOST transgene suppresses the expression of the Dmp1-Cre transgene and of Rosa26. © 2015 Wiley Periodicals, Inc.

  18. Transgenic loblolly pine (Pinus taeda L.) plants expressing a modified delta-endotoxin gene of Bacillus thuringiensis with enhanced resistance to Dendrolimus punctatus Walker and Crypyothelea formosicola Staud.

    Science.gov (United States)

    Tang, Wei; Tian, Yingchuan

    2003-02-01

    A synthetic version of the CRY1Ac gene of Bacillus thuringiensis has been used for the transformation of loblolly pine (Pinus taeda L.) using particle bombardment. Mature zygotic embryos were used to be bombarded and to generate organogenic callus and transgenic regenerated plants. Expression vector pB48.215 DNA contained a synthetic Bacillus thuringiensis (B.t.) CRY1Ac coding sequence flanked by the double cauliflower mosaic virus (CaMV) 35S promoter and nopaline synthase (NOS) terminator sequences, and the neomycin phosphotransferase II (NPTII) gene controlled by the promoter of the nopaline synthase gene was introduced into loblolly pine tissues by particle bombardment. The transformed tissues were proliferated and selected on media with kanamycin. Shoot regeneration was induced from the kanamycin-resistant calli, and transgenic plantlets were then produced. More than 60 transformed plants from independent transformation events were obtained for each loblolly pine genotype tested. The integration and expression of the introduced genes in the transgenic loblolly pine plants was confirmed by polymerase chain reactions (PCR) analysis, by Southern hybridization, by Northern blot analysis, and by Western blot analysis. Effective resistance of transgenic plants against Dendrolimus punctatus Walker and Crypyothelea formosicola Staud was verified in feeding bioassays with the insects. The transgenic plants recovered could represent a good opportunity to analyse the impact of genetic engineering of pine for sustainable resistance to pests using a B. thuringiensis insecticidal protein. This protocol enabled the routine transformation of loblolly pine plants that were previously difficult to transform.

  19. Overexpression of host plant urease in transgenic silkworms.

    Science.gov (United States)

    Jiang, Liang; Huang, Chunlin; Sun, Qiang; Guo, Huizhen; Peng, Zhengwen; Dang, Yinghui; Liu, Weiqiang; Xing, Dongxu; Xu, Guowen; Zhao, Ping; Xia, Qingyou

    2015-06-01

    Bombyx mori and mulberry constitute a model of insect-host plant interactions. Urease hydrolyzes urea to ammonia and is important for the nitrogen metabolism of silkworms because ammonia is assimilated into silk protein. Silkworms do not synthesize urease and acquire it from mulberry leaves. We synthesized the artificial DNA sequence ureas using the codon bias of B. mori to encode the signal peptide and mulberry urease protein. A transgenic vector that overexpresses ure-as under control of the silkworm midgut-specific P2 promoter was constructed. Transgenic silkworms were created via embryo microinjection. RT-PCR results showed that urease was expressed during the larval stage and qPCR revealed the expression only in the midgut of transgenic lines. Urea concentration in the midgut and hemolymph of transgenic silkworms was significantly lower than in a nontransgenic line when silkworms were fed an artificial diet. Analysis of the daily body weight and food conversion efficiency of the fourth and fifth instar larvae and economic characteristics indicated no differences between transgenic silkworms and the nontransgenic line. These results suggested that overexpression of host plant urease promoted nitrogen metabolism in silkworms.

  20. Identification of Secretory Odontoblasts Using DMP1-GFP Transgenic Mice

    Science.gov (United States)

    Balic, Anamaria; Mina, Mina

    2011-01-01

    Terminal differentiation of odontoblasts from dental papilla is a long process involving several intermediate steps and changes in the transcriptional profile and expression of proteins secreted by cells in the odontoblast lineage. Transgenic mouse lines in which GFP expression is under the control of tissue-and stage specific promoters have provided powerful experimental tools for identification and isolation of cells at specific stages of differentiation along a lineage. Our previous studies showed utilization of pOBCol3.6GFP and pOBCol2.3GFP animals for identification of odontoblasts at early and late stages of polarization respectively. In the present study we used the DMP1-GFP transgenic animal as an experimental model to examine its expression during the differentiation of odontoblasts from progenitor cells in vivo and in vitro. Our observations showed that DMP1-GFP transgene is first activated in secretory/functional odontoblasts engaged in secretion of predentin and then transiently expressed at high levels in newly differentiated odontoblasts. Expression of DMP1-GFP was down-regulated in highly differentiated odontoblasts. The temporal and spatial pattern of expression of DMP1-GFP transgene closely mimics the expression of endogenous DMP1. This transgenic animal will facilitate studies of gene expression and biological functions in secretory/functional odontoblasts. PMID:21172466

  1. Heart-specific expression of laminopathic mutations in transgenic zebrafish.

    Science.gov (United States)

    Verma, Ajay D; Parnaik, Veena K

    2017-07-01

    Lamins are key determinants of nuclear organization and function in the metazoan nucleus. Mutations in human lamin A cause a spectrum of genetic diseases that affect cardiac muscle and skeletal muscle as well as other tissues. A few laminopathies have been modeled using the mouse. As zebrafish is a well established model for the study of cardiac development and disease, we have investigated the effects of heart-specific lamin A mutations in transgenic zebrafish. We have developed transgenic lines of zebrafish expressing conserved lamin A mutations that cause cardiac dysfunction in humans. Expression of zlamin A mutations Q291P and M368K in the heart was driven by the zebrafish cardiac troponin T2 promoter. Homozygous mutant embryos displayed nuclear abnormalities in cardiomyocyte nuclei. Expression analysis showed the upregulation of genes involved in heart regeneration in transgenic mutant embryos and a cell proliferation marker was increased in adult heart tissue. At the physiological level, there was deviation of up to 20% from normal heart rate in transgenic embryos expressing mutant lamins. Adult homozygous zebrafish were fertile and did not show signs of early mortality. Our results suggest that transgenic zebrafish models of heart-specific laminopathies show cardiac regeneration and moderate deviations in heart rate during embryonic development. © 2017 International Federation for Cell Biology.

  2. Impacts of elevated CO2 on exogenous Bacillus thuringiensis toxins and transgene expression in transgenic rice under different levels of nitrogen.

    Science.gov (United States)

    Jiang, Shoulin; Lu, Yongqing; Dai, Yang; Qian, Lei; Muhammad, Adnan Bodlah; Li, Teng; Wan, Guijun; Parajulee, Megha N; Chen, Fajun

    2017-11-07

    Recent studies have highlighted great challenges of transgene silencing for transgenic plants facing climate change. In order to understand the impacts of elevated CO 2 on exogenous Bacillus thuringiensis (Bt) toxins and transgene expression in transgenic rice under different levels of N-fertilizer supply, we investigated the biomass, exogenous Bt toxins, Bt-transgene expression and methylation status in Bt rice exposed to two levels of CO 2 concentrations and nitrogen (N) supply (1/8, 1/4, 1/2, 1 and 2 N). It is elucidated that the increased levels of global atmospheric CO 2 concentration will trigger up-regulation of Bt toxin expression in transgenic rice, especially with appropriate increase of N fertilizer supply, while, to some extent, the exogenous Bt-transgene expression is reduced at sub-N levels (1/4 and 1/2N), even though the total protein of plant tissues is reduced and the plant growth is restricted. The unpredictable and stochastic occurrence of transgene silencing and epigenetic alternations remains unresolved for most transgenic plants. It is expected that N fertilization supply may promote the expression of transgenic Bt toxin in transgenic Bt rice, particularly under elevated CO 2 .

  3. Generation of marker-free transgenic hexaploid wheat via an Agrobacterium-mediated co-transformation strategy in commercial Chinese wheat varieties.

    Science.gov (United States)

    Wang, Ke; Liu, Huiyun; Du, Lipu; Ye, Xingguo

    2017-05-01

    Genotype specificity is a big problem lagging the development of efficient hexaploid wheat transformation system. Increasingly, the biosecurity of genetically modified organisms is garnering public attention, so the generation of marker-free transgenic plants is very important to the eventual potential commercial release of transgenic wheat. In this study, 15 commercial Chinese hexaploid wheat varieties were successfully transformed via an Agrobacterium-mediated method, with efficiency of up to 37.7%, as confirmed by the use of Quickstix strips, histochemical staining, PCR analysis and Southern blotting. Of particular interest, marker-free transgenic wheat plants from various commercial Chinese varieties and their F 1 hybrids were successfully obtained for the first time, with a frequency of 4.3%, using a plasmid harbouring two independent T-DNA regions. The average co-integration frequency of the gus and the bar genes located on the two independent T-DNA regions was 49.0% in T 0 plants. We further found that the efficiency of generating marker-free plants was related to the number of bar gene copies integrated in the genome. Marker-free transgenic wheat plants were identified in the progeny of three transgenic lines that had only one or two bar gene copies. Moreover, silencing of the bar gene was detected in 30.7% of T 1 positive plants, but the gus gene was never found to be silenced in T 1 plants. Bisulphite genomic sequencing suggested that DNA methylation in the 35S promoter of the bar gene regulatory region might be the main reason for bar gene silencing in the transgenic plants. © 2016 The Authors. Plant Biotechnology Journal published by Society for Experimental Biology and The Association of Applied Biologists and John Wiley & Sons Ltd.

  4. Transgene traceability in transgenic mice: a bioanalytical approach for potential gene-doping analysis.

    Science.gov (United States)

    Bogani, Patrizia; Spiriti, Maria Michela; Lazzarano, Stefano; Arcangeli, Annarosa; Buiatti, Marcello; Minunni, Maria

    2011-11-01

    The World Anti-Doping Agency fears the use of gene doping to enhance athletic performances. Thus, a bioanalytical approach based on end point PCR for detecting markers' of transgenesis traceability was developed. A few sequences from two different vectors using an animal model were selected and traced in different tissues and at different times. In particular, enhanced green fluorescent protein gene and a construct-specific new marker were targeted in the analysis. To make the developed detection approach open to future routine doping analysis, matrices such as urine and tears as well blood were also tested. This study will have impact in evaluating the vector transgenes traceability for the detection of a gene doping event by non-invasive sampling.

  5. Transgene Flow from Glufosinate-Resistant Rice to Improved and Weedy Rice in China

    Directory of Open Access Journals (Sweden)

    Yong-liang LU

    2014-09-01

    Full Text Available The development of transgenic rice with novel traits in China can increase rice productivity, but transgene flow to improved or weedy rice has become a major concern. We aimed to evaluate the potential maximum frequencies of transgene flow from glufosinate-resistant rice to improved rice cultivars and weedy rice. Treatments were arranged in randomized complete blocks with three replicates. Experiments were conducted between 2009 and 2010 at the Center for Environmental Safety Supervision and Inspection for Genetically Modified Plants, China National Rice Research Institute, Hangzhou, China. Glufosinate-resistant japonica rice 99-1 was the pollen donor. The pollen recipients were two inbred japonica rice (Chunjiang 016 and Xiushui 09, two inbred indica rice (Zhongzu 14 and Zhongzao 22, two indica hybrid rice (Zhongzheyou 1 and Guodao 1, and one weedy indica rice (Taizhou weedy rice. The offspring of recipients were planted in the field and sprayed with a commercial dose of glufosinate. Leaf tissues of survivors were analyzed by polymerase chain reaction to detect the presence of the transgene. The frequency of gene flow ranged from 0 to 0.488%. In 2009, the order of gene flow frequency was as follows: weedy rice > Chunjiang 016 > Xiushui 09 and Zhongzu 14 > Guodao 1, Zhongzheyou 1 and Zhongzao 22. Gene flow frequencies were generally higher in 2009 than in 2010, but did not differ significantly among rice materials. Gene flow frequency was the highest in weedy rice followed by the inbred japonica rice. The risk of gene flow differed significantly between years and year-to-year variance could mask risk differences among pollen recipients. Gene flow was generally lesser in taller pollen recipients than in shorter ones, but plant height only accounted for about 30% of variation in gene flow. When flowering synchrony was maximized, as in this study, low frequencies of gene flow occurred from herbicide-resistant japonica rice to other cultivars and

  6. Intragenesis and cisgenesis as alternatives to transgenic crop development

    DEFF Research Database (Denmark)

    Holme, Inger; Wendt, Toni; Holm, Preben Bach

    2013-01-01

    One of the major concerns of the general public about transgenic crops relates to the mixing of genetic materials between species that cannot hybridize by natural means. To meet this concern, the two transformation concepts cisgenesis and intragenesis were developed as alternatives to transgenesis...... from cisgenesis by allowing use of new gene combinations created by in vitro rearrangements of functional genetic elements. Several surveys show higher public acceptance of intragenic/cisgenic crops compared to transgenic crops. Thus, although the intragenic and cisgenic concepts were introduced...... internationally only 9 and 7 years ago, several different traits in a variety of crops have currently been modified according to these concepts. Five of these crops are now in field trials and two have pending applications for deregulation. Currently, intragenic/cisgenic plants are regulated as transgenic plants...

  7. Application of Echocardiography on Transgenic Mice with Cardiomyopathies

    Directory of Open Access Journals (Sweden)

    G. Chen

    2012-01-01

    Full Text Available Cardiomyopathies are common cardiac disorders that primarily affect cardiac muscle resulting in cardiac dysfunction and heart failure. Transgenic mouse disease models have been developed to investigate the cellular mechanisms underlying heart failure and sudden cardiac death observed in cardiomyopathy cases and to explore the therapeutic outcomes in experimental animals in vivo. Echocardiography is an essential diagnostic tool for accurate and noninvasive assessment of cardiac structure and function in experimental animals. Our laboratory has been among the first to apply high-frequency research echocardiography on transgenic mice with cardiomyopathies. In this work, we have summarized our and other studies on assessment of systolic and diastolic dysfunction using conventional echocardiography, pulsed Doppler, and tissue Doppler imaging in transgenic mice with various cardiomyopathies. Estimation of embryonic mouse hearts has been performed as well using this high-resolution echocardiography. Some technical considerations in mouse echocardiography have also been discussed.

  8. Transgenic cells with increased plastoquinone levels and methods of use

    Energy Technology Data Exchange (ETDEWEB)

    Sayre, Richard T.; Subramanian, Sowmya; Cahoon, Edgar

    2016-12-27

    Disclosed herein are transgenic cells expressing a heterologous nucleic acid encoding a prephenate dehydrogenase (PDH) protein, a heterologous nucleic acid encoding a homogentisate solanesyl transferase (HST) protein, a heterologous nucleic acid encoding a deoxyxylulose phosphate synthase (DXS) protein, or a combination of two or more thereof. In particular examples, the disclosed transgenic cells have increased plastoquinone levels. Also disclosed are methods of increasing cell growth rates or production of biomass by cultivating transgenic cells expressing a heterologous nucleic acid encoding a PDH protein, a heterologous nucleic acid encoding an HST protein, a heterologous nucleic acid encoding a DXS protein, or a combination of two or more thereof under conditions sufficient to produce cell growth or biomass.

  9. Improved protein quality in transgenic soybean expressing a de novo synthetic protein, MB-16.

    Science.gov (United States)

    Zhang, Yunfang; Schernthaner, Johann; Labbé, Natalie; Hefford, Mary A; Zhao, Jiping; Simmonds, Daina H

    2014-06-01

    To improve soybean [Glycine max (L.) Merrill] seed nutritional quality, a synthetic gene, MB-16 was introduced into the soybean genome to boost seed methionine content. MB-16, an 11 kDa de novo protein enriched in the essential amino acids (EAAs) methionine, threonine, lysine and leucine, was originally developed for expression in rumen bacteria. For efficient seed expression, constructs were designed using the soybean codon bias, with and without the KDEL ER retention sequence, and β-conglycinin or cruciferin seed specific protein storage promoters. Homozygous lines, with single locus integrations, were identified for several transgenic events. Transgene transmission and MB-16 protein expression were confirmed to the T5 and T7 generations, respectively. Quantitative RT-PCR analysis of developing seed showed that the transcript peaked in growing seed, 5-6 mm long, remained at this peak level to the full-sized green seed and then was significantly reduced in maturing yellow seed. Transformed events carrying constructs with the rumen bacteria codon preference showed the same transcription pattern as those with the soybean codon preference, but the transcript levels were lower at each developmental stage. MB-16 protein levels, as determined by immunoblots, were highest in full-sized green seed but the protein virtually disappeared in mature seed. However, amino acid analysis of mature seed, in the best transgenic line, showed a significant increase of 16.2 and 65.9 % in methionine and cysteine, respectively, as compared to the parent. This indicates that MB-16 elevated the sulfur amino acids, improved the EAA seed profile and confirms that a de novo synthetic gene can enhance the nutritional quality of soybean.

  10. Expression of β-glucosidase increases trichome density and artemisinin content in transgenic Artemisia annua plants.

    Science.gov (United States)

    Singh, Nameirakpam Dolendro; Kumar, Shashi; Daniell, Henry

    2016-03-01

    Artemisinin is highly effective against multidrug-resistant strains of Plasmodium falciparum, the aetiological agent of the most severe form of malaria. However, a low level of accumulation of artemisinin in Artemisia annua is a major limitation for its production and delivery to malaria endemic areas of the world. While several strategies to enhance artemisinin have been extensively explored, enhancing storage capacity in trichome has not yet been considered. Therefore, trichome density was increased with the expression of β-glucosidase (bgl1) gene in A. annua through Agrobacterium-mediated transformation. Transgene (bgl1) integration and transcript were confirmed by molecular analysis. Trichome density increased up to 20% in leaves and 66% in flowers of BGL1 transgenic plants than Artemisia control plants. High-performance liquid chromatography, time of flight mass spectrometer data showed that artemisinin content increased up to 1.4% in leaf and 2.56% in flowers (per g DW), similar to the highest yields achieved so far through metabolic engineering. Artemisinin was enhanced up to five-fold in BGL1 transgenic flowers. This study opens the possibility of increasing artemisinin content by manipulating trichomes' density, which is a major reservoir of artemisinin. Combining biosynthetic pathway engineering with enhancing trichome density may further increase artemisinin yield in A. annua. Because oral feeding of Artemisia plant cells reduced parasitemia more efficiently than the purified drug, reduced drug resistance and cost of prohibitively expensive purification process, enhanced expression should play a key role in making this valuable drug affordable to treat malaria in a large global population that disproportionally impacts low-socioeconomic areas and underprivileged children. © 2015 Society for Experimental Biology, Association of Applied Biologists and John Wiley & Sons Ltd.

  11. Expression of Beta-glucosidase increases trichome density and artemisinin content in transgenic Artemisia annua plants

    Science.gov (United States)

    Singh, Nameirakpam Dolendro; Kumar, Shashi; Daniell, Henry

    2015-01-01

    Artemisinin is highly effective against multidrug-resistant strains of Plasmodium falciparum, the etiological agent of the most severe form of malaria. However, a low level of accumulation of artemisinin in Artemisia annua is a major limitation for its production and delivery to malaria endemic areas of the world. While several strategies to enhance artemisinin have been extensively explored, enhancing storage capacity in trichome has not yet been considered. Therefore, trichome density was increased with the expression of β glucosidase (bgl1) gene in A. annua through Agrobacterium-mediated transformation. Transgene (bgl1) integration and transcript was confirmed by molecular analysis. Trichome density increased up to 20% in leaves and 66% in flowers of BGL1 transgenic plants than Artemisia control plants. High-performance liquid chromatography (HPLC, MS-TOF) data showed that artemisinin content increased up to 1.4% in leaf and 2.56% in flowers (g-1DW), similar to the highest yields achieved so far through metabolic engineering. Artemisinin was enhanced up to 5-fold in BGL1 transgenic flowers. The present study opens the possibility of increasing artemisinin content by manipulating trichomes density, which is a major reservoir of artemisinin. Combining biosynthetic pathway engineering with enhancing trichome density may further increase artemisinin yield in A. annua. Because oral feeding of Artemisia plant cells reduced parasitemia more efficiently than the purified drug, reduced drug resistance and cost of prohibitively expensive purification process, enhanced expression should play a key role in making this valuable drug affordable to treat malaria in a large global population that disproportionally impacts low-socioeconomic areas and underprivileged children. PMID:26360801

  12. Generation of Marker- and/or Backbone-Free Transgenic Wheat Plants via Agrobacterium-Mediated Transformation.

    Science.gov (United States)

    Wang, Gen-Ping; Yu, Xiu-Dao; Sun, Yong-Wei; Jones, Huw D; Xia, Lan-Qin

    2016-01-01

    Horizontal transfer of antibiotic resistance genes to animals and vertical transfer of herbicide resistance genes to the weedy relatives are perceived as major biosafety concerns in genetically modified (GM) crops. In this study, five novel vectors which used gusA and bar as a reporter gene and a selection marker gene, respectively, were constructed based on the pCLEAN dual binary vector system. Among these vectors, 1G7B and 5G7B carried two T-DNAs located on two respective plasmids with 5G7B possessing an additional virGwt gene. 5LBTG154 and 5TGTB154 carried two T-DNAs in the target plasmid with either one or double right borders, and 5BTG154 carried the selectable marker gene on the backbone outside of the T-DNA left border in the target plasmid. In addition, 5BTG154, 5LBTG154, and 5TGTB154 used pAL154 as a helper plasmid which contains Komari fragment to facilitate transformation. These five dual binary vector combinations were transformed into Agrobacterium strain AGL1 and used to transform durum wheat cv Stewart 63. Evaluation of the co-transformation efficiencies, the frequencies of marker-free transgenic plants, and integration of backbone sequences in the obtained transgenic lines indicated that two vectors (5G7B and 5TGTB154) were more efficient in generating marker-free transgenic wheat plants with no or minimal integration of backbone sequences in the wheat genome. The vector series developed in this study for generation of marker- and/or backbone-free transgenic wheat plants via Agrobacterium -mediated transformation will be useful to facilitate the creation of "clean" GM wheat containing only the foreign genes of agronomic importance.

  13. Generation of marker- and/or backbone-free transgenic wheat plants via Agrobacterium-mediated transformation

    Directory of Open Access Journals (Sweden)

    Wang Genping

    2016-09-01

    Full Text Available Horizontal transfer of antibiotic resistance genes to animals and vertical transfer of herbicide resistance genes to the weedy relatives are perceived as major biosafety concerns in genetically modified (GM crops. In this study, five novel vectors which used gusA and bar as a reporter gene and a selection marker gene, respectively, were constructed based on the pCLEAN dual binary vector system. Among these vectors, 1G7B and 5G7B carried two T-DNAs located on two respective plasmids with 5G7B possessing an additional virGwt gene. 5LBTG154 and 5TGTB154 carried two T-DNAs in the target plasmid with either one or double right borders, and 5BTG154 carried the selectable marker gene on the backbone outside of the T-DNA left border in the target plasmid. In addition, 5BTG154, 5LBTG154 and 5TGTB154 used pAL154 as a helper plasmid which contains Komari fragment to facilitate transformation. These five dual binary vector combinations were transformed into Agrobacterium strain AGL1 and used to transform durum wheat cv Stewart 63. Evaluation of the co-transformation efficiencies, the frequencies of marker-free transgenic plants and integration of backbone sequences in the obtained transgenic lines indicated that two vectors (5G7B and 5TGTB154 were more efficient in generating marker-free transgenic wheat plants with no or minimal integration of backbone sequences in the wheat genome. The vector series developed in this study for generation of marker- and/or backbone-free transgenic wheat plants via Agrobacterium-mediated transformation will be useful to facilitate the creation of ‘clean’ GM wheat containing only the foreign genes of agronomic importance.

  14. Effects of Integrated Traditional Chinese and Western Medicine for the Treatment of Lupus Nephritis: A Meta-Analysis of Randomized Trials

    Directory of Open Access Journals (Sweden)

    Mingli Heng

    2016-01-01

    Full Text Available After a thorough search through the database as CNKI database, VIP database, Wanfang database, PubMed, and Cochrane Library, the clinical experimental articles have been selected out on the effects of Integrated Traditional Chinese and Western Medicine on the treatment of lupus nephritis. A meta-analysis was carried out in terms of clinical efficacy criteria and safety criteria by RevMan 5.3 software. Based on the results, we cautiously conclude that Integrated Traditional Chinese and Western Medicine used for lupus nephritis could improve the clinical efficacy while at same time lower the 24-hour urine protein, serum creatinine, and adverse drug reactions.

  15. A recombinase-mediated transcriptional induction system in transgenic plants

    DEFF Research Database (Denmark)

    Hoff, T; Schnorr, K M; Mundy, J

    2001-01-01

    We constructed and tested a Cre-loxP recombination-mediated vector system termed pCrox for use in transgenic plants. In this system, treatment of Arabidopsis under inducing conditions mediates an excision event that removes an intervening piece of DNA between a promoter and the gene to be expressed......-mediated GUS activation. Induction was shown to be possible at essentially any stage of plant growth. This single vector system circumvents the need for genetic crosses required by other, dual recombinase vector systems. The pCrox system may prove particularly useful in instances where transgene over...

  16. TRANSGENIC PLANTS EXPRESSING BACILLUS THURINGIENSIS DELTA-ENDOTOXINS

    Institute of Scientific and Technical Information of China (English)

    Hua-rong,Li; BrendaOppert; KunYanZhu; RandallA.Higgins; Fang-nengHuang; LawrentL.Buschman

    2003-01-01

    Commercial varieties of transgenic Bacillus thuringiensis (Bt) plants have been developed in many countries to control target pests. Initially, the expression of native Bt genes in plants was low due to mRNA instability, improper splicing, and post-translation modifications. Subsequently, modifications of the native Bt genes greatly enhanced expression levels. This is a review of the developments that made modem high-expression transgenic Bt plants possible, with an emphasis on the reasons for the low-level expression of native Bt genes in plant systems, and the techniques that have been used to improve plant expression of Bt toxin genes.

  17. Random magnetism

    International Nuclear Information System (INIS)

    Tahir-Kheli, R.A.

    1975-01-01

    A few simple problems relating to random magnetic systems are presented. Translational symmetry, only on the macroscopic scale, is assumed for these systems. A random set of parameters, on the microscopic scale, for the various regions of these systems is also assumed. A probability distribution for randomness is obeyed. Knowledge of the form of these probability distributions, is assumed in all cases [pt

  18. Regulatory approval and a first-in-human phase I clinical trial of a monoclonal antibody produced in transgenic tobacco plants.

    Science.gov (United States)

    Ma, Julian K-C; Drossard, Jürgen; Lewis, David; Altmann, Friedrich; Boyle, Julia; Christou, Paul; Cole, Tom; Dale, Philip; van Dolleweerd, Craig J; Isitt, Valerie; Katinger, Dietmar; Lobedan, Martin; Mertens, Hubert; Paul, Mathew J; Rademacher, Thomas; Sack, Markus; Hundleby, Penelope A C; Stiegler, Gabriela; Stoger, Eva; Twyman, Richard M; Vcelar, Brigitta; Fischer, Rainer

    2015-10-01

    Although plant biotechnology has been widely investigated for the production of clinical-grade monoclonal antibodies, no antibody products derived from transgenic plants have yet been approved by pharmaceutical regulators for clinical testing. In the Pharma-Planta project, the HIV-neutralizing human monoclonal antibody 2G12 was expressed in transgenic tobacco (Nicotiana tabacum). The scientific, technical and regulatory demands of good manufacturing practice (GMP) were addressed by comprehensive molecular characterization of the transgene locus, confirmation of genetic and phenotypic stability over several generations of transgenic plants, and by establishing standard operating procedures for the creation of a master seed bank, plant cultivation, harvest, initial processing, downstream processing and purification. The project developed specifications for the plant-derived antibody (P2G12) as an active pharmaceutical ingredient (API) based on (i) the guidelines for the manufacture of monoclonal antibodies in cell culture systems; (ii) the draft European Medicines Agency Points to Consider document on quality requirements for APIs produced in transgenic plants; and (iii) de novo guidelines developed with European national regulators. From the resulting process, a GMP manufacturing authorization was issued by the competent authority in Germany for transgenic plant-derived monoclonal antibodies for use in a phase I clinical evaluation. Following preclinical evaluation and ethical approval, a clinical trial application was accepted by the UK national pharmaceutical regulator. A first-in-human, double-blind, placebo-controlled, randomized, dose-escalation phase I safety study of a single vaginal administration of P2G12 was carried out in healthy female subjects. The successful completion of the clinical trial marks a significant milestone in the commercial development of plant-derived pharmaceutical proteins. © 2015 Society for Experimental Biology, Association of

  19. The efficacy of Le Bon Départ and Sensory Integration treatment for children with developmental coordination disorder: a randomized study with six single cases.

    NARCIS (Netherlands)

    Leemrijse, C.; Meijer, O.G.; Vermeer, A.; Ader, H.J.; Diemel, S.

    2000-01-01

    Objective: evaluation of the efficacy of Le Bon Départ (LBD) treatment and Sensory Integration (SI) treatment on motor performance on children with developmental coordination disorder. Design: a single subject design with multiple baseline and alternating treatments. Order of treatment and lenght of

  20. The Effects of Arts-Integrated Instruction on Students' Memory for Science Content: Results from a Randomized Control Trial Study

    Science.gov (United States)

    Hardiman, Mariale; JohnBull, Ranjini Mahinda; Carran, Deborah

    2017-01-01

    Strong correlational evidence suggests that involvement in the arts improves students' academic outcomes and memory of learning events (e.g., Peppler et al., 2014; Robinson, 2013; Scripps & Paradis, 2014). It is unclear, however, whether the improved outcomes are the result of general exposure to the arts, arts integrated into content…

  1. Virtual Reality-Based Wii Fit Training in Improving Muscle Strength, Sensory Integration Ability, and Walking Abilities in Patients with Parkinson's Disease: A Randomized Control Trial

    Directory of Open Access Journals (Sweden)

    Ying-Yi Liao

    2015-12-01

    Conclusion: VRWii training is as beneficial as TE in improving walking abilities, sensory integration ability, and muscle strength in patients with PD, and such improvements persisted for at least for 1 month. VRWii training is thus suggested to be implemented in patients with PD.

  2. Psychological Adjustment and Levels of Self Esteem in Children with Visual-Motor Integration Difficulties Influences the Results of a Randomized Intervention Trial

    Science.gov (United States)

    Lahav, Orit; Apter, Alan; Ratzon, Navah Z.

    2013-01-01

    This study evaluates how much the effects of intervention programs are influenced by pre-existing psychological adjustment and self-esteem levels in kindergarten and first grade children with poor visual-motor integration skills, from low socioeconomic backgrounds. One hundred and sixteen mainstream kindergarten and first-grade children, from low…

  3. Effect of integrated treatment on the use of coercive measures in first-episode schizophrenia-spectrum disorder. A randomized clinical trial

    DEFF Research Database (Denmark)

    Ohlenschlæger, Johan; Nordentoft, Merete; Thorup, Anne

    2008-01-01

    of assertive community treatment, psycho-educational multi-family groups, and social skills training. Data on coercion were extracted from the register from the National Board of Health, and data on continuity from medical records. Even though the level of continuity seemed higher in integrated treatment...

  4. A randomized controlled trial on the beneficial effects of training letter-speech sound integration on reading fluency in children with dyslexia

    NARCIS (Netherlands)

    Fraga González, G.; Žarić, G.; Tijms, J.; Bonte, M.; Blomert, L.; van der Molen, M.W.

    2015-01-01

    A recent account of dyslexia assumes that a failure to develop automated letter-speech sound integration might be responsible for the observed lack of reading fluency. This study uses a pre-test-training-post-test design to evaluate the effects of a training program based on letter-speech sound

  5. Association of schizophrenia onset age and white matter integrity with treatment effect of D-cycloserine: a randomized placebo-controlled double-blind crossover study.

    Science.gov (United States)

    Takiguchi, Kazuo; Uezato, Akihito; Itasaka, Michio; Atsuta, Hidenori; Narushima, Kenji; Yamamoto, Naoki; Kurumaji, Akeo; Tomita, Makoto; Oshima, Kazunari; Shoda, Kosaku; Tamaru, Mai; Nakataki, Masahito; Okazaki, Mitsutoshi; Ishiwata, Sayuri; Ishiwata, Yasuyoshi; Yasuhara, Masato; Arima, Kunimasa; Ohmori, Tetsuro; Nishikawa, Toru

    2017-07-12

    It has been reported that drugs which promote the N-Methyl-D-aspartate-type glutamate receptor function by stimulating the glycine modulatory site in the receptor improve negative symptoms and cognitive dysfunction in schizophrenia patients being treated with antipsychotic drugs. We performed a placebo-controlled double-blind crossover study involving 41 schizophrenia patients in which D-cycloserine 50 mg/day was added-on, and the influence of the onset age and association with white matter integrity on MR diffusion tensor imaging were investigated for the first time. The patients were evaluated using the Positive and Negative Syndrome Scale (PANSS), Scale for the Assessment of Negative Symptoms (SANS), Brief Assessment of Cognition in Schizophrenia (BACS), and other scales. D-cycloserine did not improve positive or negative symptoms or cognitive dysfunction in schizophrenia. The investigation in consideration of the onset age suggests that D-cycloserine may aggravate negative symptoms of early-onset schizophrenia. The better treatment effect of D-cycloserine on BACS was observed when the white matter integrity of the sagittal stratum/ cingulum/fornix stria terminalis/genu of corpus callosum/external capsule was higher, and the better treatment effect on PANSS general psychopathology (PANSS-G) was observed when the white matter integrity of the splenium of corpus callosum was higher. In contrast, the better treatment effect of D-cycloserine on PANSS-G and SANS-IV were observed when the white matter integrity of the posterior thalamic radiation (left) was lower. It was suggested that response to D-cycloserine is influenced by the onset age and white matter integrity. UMIN Clinical Trials Registry (number UMIN000000468 ). Registered 18 August 2006.

  6. First molecular identification of the transgene red fluorescent protein (RFP in transgenic ornamental zebrafish (Danio rerio introduced in Peru

    Directory of Open Access Journals (Sweden)

    Carlos Scotto

    2013-09-01

    Full Text Available In this paper the transgenic fluorescent red, orange and pink zebra fish (Danio rerio, found in local aquariums in Peru, were identified using the PCR technique to amplify the transgene RFP sea anemone belonging to Discosoma spp. The gene expression of the red fluorescent protein (RFP transgene was found to determine different gradients-of-bioluminescence (shades in color in each GMO fish analyzed. We performed sequence analysis of the two variants of the RFP along with six variants of the existing fluorescent protein GFP from the Genbank, this could help identify quickly if they are new genes or variants thereof as these novel fluorescent proteins may be introduced in aquatic GMO in the future. Thus, developing and improving biosecurity measures through its timely detection at the molecular genetic level.

  7. Adventitious presence of transgenic events in the maize supply chain in Peru: A case study

    NARCIS (Netherlands)

    Santa-Maria, M.C.; Lajo-Morgan, G.; Guardia, L.

    2014-01-01

    Cultivation and trade of transgenic or genetically modified organisms (GMO) and commodities has become widespread worldwide. In particular, production of transgenic crops has seen an accelerated growth along with a complex regulatory process. Current Peruvian legislation prohibits import of

  8. Influence of titration schedule and maintenance dose on the tolerability of adjunctive eslicarbazepine acetate: An integrated analysis of three randomized placebo-controlled trials.

    Science.gov (United States)

    Krauss, Gregory; Biton, Victor; Harvey, Jay H; Elger, Christian; Trinka, Eugen; Soares da Silva, Patrício; Gama, Helena; Cheng, Hailong; Grinnell, Todd; Blum, David

    2018-01-01

    To examine the influence of titration schedule and maintenance dose on the incidence and type of treatment-emergent adverse events (TEAEs) associated with adjunctive eslicarbazepine acetate (ESL). Data from three randomized, double-blind, placebo-controlled trials were analyzed. Patients with refractory partial-onset seizures were randomized to maintenance doses of ESL 400, 800, or 1200mg QD (dosing was initiated at 400 or 800mg QD) or placebo. The incidence of TEAEs was analyzed during the double-blind period (2-week titration phase; 12-week maintenance phase), according to the randomized maintenance dose and the titration schedule. 1447 patients were included in the analysis. During the first week of treatment, 62% of patients taking ESL 800mg QD had ≥1 TEAE, vs 35% of those taking 400mg QD and 32% of the placebo group; dizziness, somnolence, nausea, and headache were numerically more frequent in patients taking ESL 800mg than those taking ESL 400mg QD. During the double-blind period, the incidences of common TEAEs were lower in patients who initiated ESL at 400mg vs 800mg QD. For the 800 and 1200mg QD maintenance doses, rates of TEAEs leading to discontinuation were lower in patients who began treatment with 400mg than in those who began taking ESL 800mg QD. Initiation of ESL at 800mg QD is feasible. However, initiating treatment with ESL 400mg QD for 1 or 2 weeks is recommended, being associated with a lower incidence of TEAEs, and related discontinuations. For some patients, treatment may be initiated at 800mg QD, if the need for more immediate seizure reduction outweighs concerns about increased risk of adverse reactions during initiation. Copyright © 2017 The Authors. Published by Elsevier B.V. All rights reserved.

  9. Expression of a truncated receptor protein tyrosine phosphatase kappa in the brain of an adult transgenic mouse

    DEFF Research Database (Denmark)

    Shen, P; Canoll, P D; Sap, J

    1999-01-01

    that goal, we have used this mouse model to map the distribution of the truncated RPTP-kappa/beta-geo fusion protein in the adult mouse brain using beta-galactosidase as a marker enzyme. Visualization of the beta-galactosidase activity revealed a non-random pattern of expression, and identified cells......-6596]. Nevertheless, since the transgene's expression is driven by the endogenous RPTP-kappa promoter, distribution of the truncated RPTP-kappa/beta-geo fusion protein should reflect the regional and cellular expression of wild-type RPTP-kappa, and thus may identify sites where RPTP-kappa is important. Towards...

  10. Effective generation of transgenic pigs and mice by linker based sperm-mediated gene transfer.

    OpenAIRE

    Chang, Keejong; Qian, Jin; Jiang, MeiSheng; Liu, Yi-Hsin; Wu, Ming-Che; Chen, Chi-Dar; Lai, Chao-Kuen; Lo, Hsin-Lung; Hsiao, Chin-Ton; Brown, Lucy; Bolen, James; Huang, Hsiao-I; Ho, Pei-Yu; Shih, Ping Yao; Yao, Chen-Wen

    2002-01-01

    Abstract Background Transgenic animals have become valuable tools for both research and applied purposes. The current method of gene transfer, microinjection, which is widely used in transgenic mouse production, has only had limited success in producing transgenic animals of larger or higher species. Here, we report a linker based sperm-mediated gene transfer method (LB-SMGT) that greatly improves the production efficiency of large transgenic animals. Results The linker protein, a monoclonal ...

  11. A transgenic rat expressing human APP with the Swedish Alzheimer's disease mutation

    DEFF Research Database (Denmark)

    Folkesson, Ronnie; Malkiewicz, Katarzyna; Kloskowska, Ewa

    2007-01-01

    In recent years, transgenic mice have become valuable tools for studying mechanisms of Alzheimer's disease (AD). With the aim of developing an animal model better for memory and neurobehavioural testing, we have generated a transgenic rat model of AD. These animals express human amyloid precursor...... in cerebrovascular blood vessels with very rare diffuse plaques. We believe that crossing these animals with mutant PS1 transgenic rats will result in accelerated plaque formation similar to that seen in transgenic mice....

  12. Application of a high-speed breeding technology to apple (Malus × domestica) based on transgenic early flowering plants and marker-assisted selection.

    Science.gov (United States)

    Flachowsky, Henryk; Le Roux, Pierre-Marie; Peil, Andreas; Patocchi, Andrea; Richter, Klaus; Hanke, Magda-Viola

    2011-10-01

    Breeding of apple (Malus × domestica) remains a slow process because of protracted generation cycles. Shortening the juvenile phase to achieve the introgression of traits from wild species into prebreeding material within a reasonable time frame is a great challenge. In this study, we evaluated early flowering transgenic apple lines overexpressing the BpMADS4 gene of silver birch with regard to tree morphology in glasshouse conditions. Based on the results obtained, line T1190 was selected for further analysis and application to fast breeding. The DNA sequences flanking the T-DNA were isolated and the T-DNA integration site was mapped on linkage group 4. The inheritance and correctness of the T-DNA integration were confirmed after meiosis. A crossbred breeding programme was initiated by crossing T1190 with the fire blight-resistant wild species Malus fusca. Transgenic early flowering F(1) seedlings were selected and backcrossed with 'Regia' and 98/6-10 in order to introgress the apple scab Rvi2, Rvi4 and powdery mildew Pl-1, Pl-2 resistance genes and the fire blight resistance quantitative trait locus FB-F7 present in 'Regia'. Three transgenic BC'1 seedlings pyramiding Rvi2, Rvi4 and FB-F7, as well as three other BC'1 seedlings combining Pl-1 and Pl-2, were identified. Thus, the first transgenic early flowering-based apple breeding programme combined with marker-assisted selection was established. © 2011 The Authors. New Phytologist © 2011 New Phytologist Trust.

  13. Effects of a petunia scaffold/matrix attachment region on copy number dependency and stability of transgene expression in Nicotiana tabacum.

    Science.gov (United States)

    Dietz-Pfeilstetter, Antje; Arndt, Nicola; Manske, Ulrike

    2016-04-01

    Transgenes in genetically modified plants are often not reliably expressed during development or in subsequent generations. Transcriptional gene silencing (TGS) as well as post-transcriptional gene silencing (PTGS) have been shown to occur in transgenic plants depending on integration pattern, copy number and integration site. In an effort to reduce position effects, to prevent read-through transcription and to provide a more accessible chromatin structure, a P35S-ß-glucuronidase (P35S-gus) transgene flanked by a scaffold/matrix attachment region from petunia (Petun-SAR), was introduced in Nicotiana tabacum plants by Agrobacterium tumefaciens mediated transformation. It was found that Petun-SAR mediates enhanced expression and copy number dependency up to 2 gene copies, but did not prevent gene silencing in transformants with multiple and rearranged gene copies. However, in contrast to the non-SAR transformants where silencing was irreversible and proceeded during long-term vegetative propagation and in progeny plants, gus expression in Petun-SAR plants was re-established in the course of development. Gene silencing was not necessarily accompanied by DNA methylation, while the gus transgene could still be expressed despite considerable CG methylation within the coding region.

  14. Randomized random walk on a random walk

    International Nuclear Information System (INIS)

    Lee, P.A.

    1983-06-01

    This paper discusses generalizations of the model introduced by Kehr and Kunter of the random walk of a particle on a one-dimensional chain which in turn has been constructed by a random walk procedure. The superimposed random walk is randomised in time according to the occurrences of a stochastic point process. The probability of finding the particle in a particular position at a certain instant is obtained explicitly in the transform domain. It is found that the asymptotic behaviour for large time of the mean-square displacement of the particle depends critically on the assumed structure of the basic random walk, giving a diffusion-like term for an asymmetric walk or a square root law if the walk is symmetric. Many results are obtained in closed form for the Poisson process case, and these agree with those given previously by Kehr and Kunter. (author)

  15. Long Term Follow-Up after a Randomized Integrated Educational and Psychosocial Intervention in Patient-Partner Dyads Affected by Heart Failure.

    Directory of Open Access Journals (Sweden)

    Maria Liljeroos

    Full Text Available To date, contemporary heart failure care remains patient-focused, but awareness of the partners' and families' situation is increasing. Randomized studies have mainly evaluated the short-term effects of dyadic interventions. Therefore, the aim of this study was to determine the 24-month effects of an intervention with psych-educational support in dyads of heart failure patients and their partners.This study used a randomized study design and 155 patient-partner dyads were enrolled. The intervention included a nurse-led program of three sessions addressing psychoeducational support.The intervention did not have any effect on health, depressive symptoms or perceived control among the patient-partner dyads after 24 months. Furthermore, time to first event did not differ significantly between the intervention group and the control patients.This study may be regarded as a first step in trying to understand dyads' need for supportive care. Individualized and more targeted interventions seem necessary to achieve a higher impact on dyad outcomes.ClinicalTrials.gov NCT02398799.

  16. Accurate measure of transgene copy number in crop plants using droplet digital PCR

    Science.gov (United States)

    Genetic transformation is a powerful means for the improvement of crop plants, but requires labor- and resource-intensive methods. An efficient method for identifying single-copy transgene insertion events from a population of independent transgenic lines is desirable. Currently, transgene copy numb...

  17. Production of transgenic pigs over-expressing the antiviral gene Mx1

    Directory of Open Access Journals (Sweden)

    Quanmei Yan

    2014-01-01

    Full Text Available The myxovirus resistance gene (Mx1 has a broad spectrum of antiviral activities. It is therefore an interesting candidate gene to improve disease resistance in farm animals. In this study, we report the use of somatic cell nuclear transfer (SCNT to produce transgenic pigs over-expressing the Mx1 gene. These transgenic pigs express approximately 15–25 times more Mx1 mRNA than non-transgenic pigs, and the protein level of Mx1 was also markedly enhanced. We challenged fibroblast cells isolated from the ear skin of transgenic and control pigs with influenza A virus and classical swine fever virus (CFSV. Indirect immunofluorescence assay (IFA revealed a profound decrease of influenza A proliferation in Mx1 transgenic cells. Growth kinetics showed an approximately 10-fold reduction of viral copies in the transgenic cells compared to non-transgenic controls. Additionally, we found that the Mx1 transgenic cells were more resistant to CSFV infection in comparison to non-transgenic cells. These results demonstrate that the Mx1 transgene can protect against viral infection in cells of transgenic pigs and indicate that the Mx1 transgene can be harnessed to develop disease-resistant pigs.

  18. Plant mitochondrial genome: “A sweet and safe home'' for transgene ...

    African Journals Online (AJOL)

    Transfer of transgene through pollens to related plant species is a big environmental concern. Mitochondrion is also a superb and putative aspirant for transgene containment like plastids. Having its own transcription and translation machinery, and maternal inheritance gives assurance of transgene containment with high ...

  19. Effect of 5'-flanking sequence deletions on expression of the human insulin gene in transgenic mice

    DEFF Research Database (Denmark)

    Fromont-Racine, M; Bucchini, D; Madsen, O

    1990-01-01

    Expression of the human insulin gene was examined in transgenic mouse lines carrying the gene with various lengths of DNA sequences 5' to the transcription start site (+1). Expression of the transgene was demonstrated by 1) the presence of human C-peptide in urine, 2) the presence of specific...... of the transgene was observed in cell types other than beta-islet cells....

  20. The effect of ethylene on transgenic melon ripening and fruit quality ...

    African Journals Online (AJOL)

    In cell wall expression analysis, MPG1 increased when fruits of transgenic melons were exposed to ethylene; showing they are ethylene- dependent. MPG2 decreased ... Ethylene productions in transgenic fruits were reestablished when ethylene was applied, exhibiting the same behavior as transgenic fruits. Antioxidant ...

  1. The stability of transgene expression and effect of DNA methylation ...

    African Journals Online (AJOL)

    In this paper, we selected transgenic birch (Betula platyphylla Suk) plants, which included nonsilencing plants, transcriptional silence plants including TP96, TP74, TP73 and the post-transcriptional silence ones (TP67 and TP72). The transcription of the bgt gene in different tissues and organs were significantly different.

  2. Use of transgenic mice in lipoprotein metabolism and atherosclerosis research

    NARCIS (Netherlands)

    Havekes, L.M.; Vlijmen, B.J.M. van; Jong, M.C.; Dijk, K.W. van; Hofker, M.H.

    1997-01-01

    In APOE*3-Leiden transgenic mice the atherosclerotic lesion size is correlated with plasma cholesterol. In these mice the plasma lipid levels are positively correlated with the relative amount of APOE 3-Leiden protein on the VLDL particle. The plasma cholesterol levels are influenced by diet, age

  3. Suppression of Arabidopsis genes by terminator-less transgene constructs

    Science.gov (United States)

    Transgene-mediated gene silencing is an important biotechnological and research tool. There are several RNAi-mediated techniques available for silencing genes in plants. The basis of all these techniques is to generate double stranded RNA precursors in the cell, which are recognized by the cellula...

  4. Transgenic overexpression of BAFF regulates the expression of ...

    Indian Academy of Sciences (India)

    LI ZHANG

    Hubei 430030, People's Republic of China. 3Second ... body homogenate of zebrafish and demonstrated a significant increase in BAFF-transgenic group. Therefore, our ... diet and brine shrimp according to the conditions in our sys- tem (Li et al. 2014). ... images were captured using a Leica DM3000B microscope. Embryos ...

  5. Impact of transgenic sweet corn silks to two noctuid pests

    Science.gov (United States)

    Eight Bacillus thuringiensis (Bt) transgenic sweet corn hybrids were evaluated (with two controls) for their efficacy against two ear-feeding insects; the corn earworm [Helicoverpa zea (Boddie) (Lepidoptera: Noctuidae)], and the fall armyworm (Spodoptera frugiperda (J.E. Smith) (Lepidoptera: Noctuid...

  6. Transgenic RNAi in mouse oocytes: The first decade

    Czech Academy of Sciences Publication Activity Database

    Malík, Radek; Svoboda, Petr

    2012-01-01

    Roč. 134, 1-2 (2012), s. 64-68 ISSN 0378-4320 Institutional research plan: CEZ:AV0Z50520514 Institutional support: RVO:68378050 Keywords : RNAi * oocyte * transgene * silencing Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 1.897, year: 2012

  7. The stability of transgene expression and effect of DNA methylation ...

    African Journals Online (AJOL)

    Jane

    2011-08-08

    Aug 8, 2011 ... transformation system (Zhan et al., 2003). Stable expression of foreign gene is important for commercial use of genetic transformation in long-lived tree species as well as for ecological risk-assessment studies. However, analysis of the instable/stable transgene expression in tree is more problematic than in ...

  8. Development of putative transgenic lines of cassava variety H-226 ...

    African Journals Online (AJOL)

    CMD) caused by the Indian cassava mosaic virus (ICMV) and Sri Lankan cassava mosaic virus (SLCMV). An attempt was done to develop transgenic cassava lines resistant to SLCMV through RNAi vector targeting a conserved 440 bp of 5' end ...

  9. Transgene transmission in chickens by sperm-mediated gene ...

    Indian Academy of Sciences (India)

    The aim of this work was to demonstrate transgene transmission by SMGT in chickens using ... group. EGFP mRNA was detected in 21% of newborn chicks from the DMSO group, ..... training or equipment was required and it is applicable to.

  10. Transgenic plants: from first successes to future applications.

    Science.gov (United States)

    Van Lijsebettens, Mieke; Angenon, Geert; De Block, Marc

    2013-01-01

    This dialogue was held between the Guest Editors of the Special Issue on "Plant Transgenesis" of the Int. J. Dev. Biol. and Marc De Block. He was one of the first scientists worldwide to obtain transgenic plants transformed with the chimeric selectable marker genes encoding neomycin phosphotransferase and bialaphos that confer resistance against the antibiotic kanamycin and the herbicide Basta®/glufosinate, respectively at the Department of Genetics of Ghent University and, later on, at the spin-off company, Plant Genetic Systems. Today, these two genes are still the most frequently utilized markers in transgene technology. Marc De Block chose to work on the improvement of crops in an industrial environment to help realize the production of superior seeds or products. He was part of the team that developed the male sterility/restorer system in canola (Brassica napus var. napus) that led to the first hybrid lines to be commercialized as successful products of transgene technology. In more than 30 years of research, he developed transformation procedures for numerous crops, designed histochemical, biochemical and physiological assays to monitor plant performance, and made original and innovative contributions to plant biology. Presently, he considers transgenic research part of the toolbox for plant improvement and essential for basic plant research.

  11. Recent progress on technologies and applications of transgenic ...

    African Journals Online (AJOL)

    USER

    2010-06-14

    Jun 14, 2010 ... embryo with DNA or viral vectors is possible, but this approach does not have the ... re-injecting them to cock testis is the most efficient and cost-effective strategy to .... transgenic manipulation, but also allows the selection of.

  12. Transgenic Crops to Address Third World Hunger? A Critical Analysis

    Science.gov (United States)

    Rosset, Peter M.

    2005-01-01

    Industry and mainstream research and policy institutions often suggest that transgenic crop varieties can raise the productivity of poor third world farmers, feed the hungry, and reduce poverty. These claims are critically evaluated by examining global-hunger data, the constraints that affect the productivity of small farmers in the third world,…

  13. Testicular pathology in transgenic minipig boars - in brief

    Czech Academy of Sciences Publication Activity Database

    Mačáková, Monika; Bohuslavová, Božena; Vochozková, Petra; Baxa, Monika; Ellederová, Zdeňka; Sedláčková, M.; Lišková, Irena; Valeková, Ivona; Vidinská, Daniela; Klíma, Jiří; Juhás, Štefan; Motlík, Jan

    2015-01-01

    Roč. 78, Suppl 2 (2015), s. 19-19 ISSN 1210-7859 R&D Projects: GA MŠk(CZ) 7F14308; GA MŠk ED2.1.00/03.0124 Institutional support: RVO:67985904 Keywords : transgenic minipig model of Huntington ´s disease * testes * spermatozoa Subject RIV: FH - Neurology

  14. DS read-out transcription in transgenic tomato plants

    NARCIS (Netherlands)

    Rudenko, George N.; Nijkamp, H. John J.; Hille, Jacques

    1994-01-01

    To select for Ds transposition in transgenic tomato plants a phenotypic excision assay, based on restoration of hygromycin phosphotransferase (HPT II) gene expression, was employed. Some tomato plants, however, expressed the marker gene even though the Ds had not excised. Read-out transcriptional

  15. Inheritance and segregation of exogenous genes in transgenic cotton

    Indian Academy of Sciences (India)

    Three transgenic cotton varieties (lines) were chosen for the study of inheritance and segregation of foreign Bt (Bacillus thuringiensis toxin) and tfdA genes in cotton. The transformed cotton varieties CCRI 30 and NewCott 33B expressing the Bt cryIA gene, and cotton line TFD expressing the tfdA gene were crossed with ...

  16. Transgenic resistance of eggplants to the Colorado potato beetle

    NARCIS (Netherlands)

    Arpaia, S.

    1999-01-01

    The subject of this thesis is the use of transgenic plant resistance as a method to control the Colorado potato beetle, Leptinotarsa decemlineata Say in eggplant. The gene conferring resistance is coding for a Cry3B toxin and it is a synthetic version of a wild-type

  17. Autopsy and histological analysis of the transgenic mouse

    NARCIS (Netherlands)

    Gijbels, Marion J. J.; de Winther, Menno P. J.

    2011-01-01

    Over the past decades, transgenic and knock-out mouse models have become common use in research laboratories. Detailed phenotypic characterization of such models is essential for understanding basic mechanisms of normal physiology and disease. Hereto, pathological examination is a very helpful tool.

  18. Transgenic plants as green factories for vaccine production | Vinod ...

    African Journals Online (AJOL)

    Edible vaccine technology represents an alternative to fermentation based vaccine production system. Transgenic plants are used for the production of plant derived specific vaccines with native immunogenic properties stimulating both humoral and mucosal immune responses. Keeping in view the practical need of new ...

  19. Adaptability and stability of transgenic soybean lines and cultivars in ...

    African Journals Online (AJOL)

    Subsequently, genotypic adaptability and stability were evaluated by the methods of Eberhart and Russel (1966), Lin and Binns modified by Carneiro, Annicchiarico and Centroid. All methods presented partial coherence on classifying the best genotypes and allowed the identification of the transgenic lines L1 and L4, and ...

  20. Cloning and functional analysis in transgenic tobacco of a tapetum ...

    African Journals Online (AJOL)

    The 5'-flanking region of 1174 bp upstream of the translation start point (TSP) of a reported Arabidopsis anther-specific gene, Anther7 gene (ATA7), which putatively encodes a protein related to lipid transfer protein, was cloned and functionally analyzed in transgenic tobacco after been fused with β- glucuronidase (GUS) ...

  1. Transgenic engineering of male-specific muscular hypertrophy

    DEFF Research Database (Denmark)

    Pirottin, D.; Grobet, L.; Adamantidis, A.

    2005-01-01

    Using a two-step procedure involving insertional gene targeting and recombinase-mediated cassette exchange in ES cells, we have produced two lines of transgenic mice expressing a dominant-negative latency-associated myostatin propeptide under control of the myosin light chain 1F promoter and 1/3 ...

  2. Galactose-extended glycans of antibodies produced by transgenic plants

    NARCIS (Netherlands)

    Bakker, H.; Bardor, M.; Molthoff, J.W.; Gomord, V.; Elbers, I.; Stevens, L.H.; Jordi, W.; Lommen, A.; Faye, L.; Lerouge, P.; Bosch, D.

    2001-01-01

    Plant-specific N-glycosylation can represent an important limitation for the use of recombinant glycoproteins of mammalian origin produced by transgenic plants. Comparison of plant and mammalian N-glycan biosynthesis indicates that β1,4-galactosyltransferase is the most important enzyme that is

  3. Analysis of promoter activity in transgenic plants by normalizing ...

    Indian Academy of Sciences (India)

    Analysis of promoter activity in transgenic plants by normalizing expression with a reference gene: anomalies due to the influence of the test promoter on the reference promoter. Simran Bhullar Suma Chakravarthy Deepak Pental Pradeep Kumar Burma. Articles Volume 34 Issue 6 December 2009 pp 953-962 ...

  4. Transgenic perennial biofuel feedstocks and strategies for bioconfinement

    Science.gov (United States)

    The use of transgenic tools for the improvement of plant feedstocks will be required to realize the full economic and environmental benefits of cellulosic and other biofuels, particularly from perennial plants. Traits that are targets for improvement of biofuels crops include he...

  5. Enhancer-promoter interference and its prevention in transgenic plants

    Science.gov (United States)

    Transcriptional enhancer elements have been shown to override the specificity of nearby promoters in a position- and orientation-independent manner. This is problematic when multiple enhancers/promoters co-exist within a single transgenic construct as it has the potential to cause the mis-expressio...

  6. Expression of chimeric HCV peptide in transgenic tobacco plants ...

    African Journals Online (AJOL)

    Expression of chimeric HCV peptide in transgenic tobacco plants infected with recombinant alfalfa mosaic virus for development of a plant-derived vaccine against HCV. AK El Attar, AM Shamloul, AA Shalaby, BY Riad, A Saad, HM Mazyad, JM Keith ...

  7. Radiation arteriopathy in the transgenic arteriovenous fistula model.

    Science.gov (United States)

    Lawton, Michael T; Arnold, Christine M; Kim, Yung J; Bogarin, Ernesto A; Stewart, Campbell L; Wulfstat, Amanda A; Derugin, Nikita; Deen, Dennis; Young, William L

    2008-05-01

    The transgenic arteriovenous fistula model, surgically constructed with transgenic mouse aorta interposed in common carotid artery-to-external jugular vein fistulae in nude rats, has a 4-month experimental window because patency and transgenic phenotype are lost over time. We adapted this model to investigate occlusive arteriopathy in brain arteriovenous malformations after radiosurgery by radiating grafted aorta before insertion in the fistula. We hypothesized that high-dose radiation would reproduce the arteriopathy observed clinically within the experimental time window and that deletions of endoglin (ENG) and endothelial nitric oxide synthase (eNOS) genes would modify the radiation response. Radiation arteriopathy in the common carotid arteries of 171 wild-type mice was examined with doses of 25, 80, 120, or 200 Gy (Experiment 1). Radiation arteriopathy in 68 wild-type arteriovenous fistulae was examined histologically and morphometrically with preoperative radiation doses of 0, 25, or 200 Gy (Experiment 2). Radiation arteriopathy in 51 transgenic arteriovenous fistulae (36 ENG and 15 eNOS knock-out fistulae) was examined using preoperative radiation doses of 0, 25, or 200 Gy (Experiment 3). High-dose radiation (200 Gy) of mouse common carotid arteries induced only mild arteriopathy (mean score, 0.66) without intimal hyperplasia and with high mortality (68%). Radiation arteriopathy in wild-type arteriovenous fistulae was severe (mean score, 3.5 at 200 Gy), with intimal hyperplasia and medial disruption at 3 months, decreasing luminal areas with increasing dose, and no mortality. Arteriopathy was robust in transgenic arteriovenous fistulae with ENG +/- and with eNOS +/-, with thick intimal hyperplasia in the former and distinct smooth muscle cell proliferation in the latter. The transgenic arteriovenous fistula model can be adapted to rapidly reproduce radiation arteriopathy observed in resected brain arteriovenous malformations after radiosurgery. High

  8. Integrated mental health care and vocational rehabilitation to improve return to work rates for people on sick leave because of depression and anxiety (the Danish IBBIS trial): study protocol for a randomized controlled trial.

    Science.gov (United States)

    Poulsen, Rie; Hoff, Andreas; Fisker, Jonas; Hjorthøj, Carsten; Eplov, Lene Falgaard

    2017-12-02

    Depression and anxiety are among the largest contributors to the global burden of disease and have negative effects on both the individual and society. Depression and anxiety are very likely to influence the individual's work ability, and up to 40% of the people on sick leave in Denmark have depression and/or anxiety. There is no clear evidence that treatment alone will provide sufficient support for vocational recovery in this group. Integrated vocational and health care services have shown good effects on return to work in other, similar welfare contexts. The purpose of the IBBIS (Integrated Mental Health Care and Vocational Rehabilitation to Individuals on Sick Leave Due to Anxiety and Depression) interventions is to improve and hasten the process of return to employment for people in Denmark on sick leave because of depression and anxiety. This three-arm, parallel-group, randomized superiority trial has been set up to investigate the effectiveness of the IBBIS mental health care intervention and the integrated IBBIS mental health care and IBBIS vocational rehabilitation intervention for people on sick leave because of depression and/or anxiety in Denmark. The trial has an investigator-initiated multicenter design. A total of 603 patients will be recruited from Danish job centers in 4 municipalities and randomly assigned to one of 3 groups: (1) IBBIS mental health care integrated with IBBIS vocational rehabilitation, (2) IBBIS mental health care and standard vocational rehabilitation, and (3) standard mental health care and standard vocational rehabilitation. The primary outcome is register-based return to work at 12 months. The secondary outcome measures are self-assessed level of depression (Beck Depression Inventory II), anxiety (Beck Anxiety Inventory), stress symptoms (Four-Dimensional Symptom Questionnaire), work and social functioning (Work and Social Adjustment Scale), and register-based recurrent sickness absence. This study will provide new knowledge

  9. Transgenic wheat expressing Thinopyrum intermedium MYB transcription factor TiMYB2R-1 shows enhanced resistance to the take-all disease.

    Science.gov (United States)

    Liu, Xin; Yang, Lihua; Zhou, Xianyao; Zhou, Miaoping; Lu, Yan; Ma, Lingjian; Ma, Hongxiang; Zhang, Zengyan

    2013-05-01

    The disease take-all, caused by the fungus Gaeumannomyces graminis, is one of the most destructive root diseases of wheat worldwide. Breeding resistant cultivars is an effective way to protect wheat from take-all. However, little progress has been made in improving the disease resistance level in commercial wheat cultivars. MYB transcription factors play important roles in plant responses to environmental stresses. In this study, an R2R3-MYB gene in Thinopyrum intermedium, TiMYB2R-1, was cloned and characterized. The gene sequence includes two exons and an intron. The expression of TiMYB2R-1 was significantly induced following G. graminis infection. An in vitro DNA binding assay proved that TiMYB2R-1 protein could bind to the MYB-binding site cis-element ACI. Subcellular localization assays revealed that TiMYB2R-1 was localized in the nucleus. TiMYB2R-1 transgenic wheat plants were generated, characterized molecularly, and evaluated for take-all resistance. PCR and Southern blot analyses confirmed that TiMYB2R-1 was integrated into the genomes of three independent transgenic wheat lines by distinct patterns and the transgene was heritable. Reverse transcription-PCR and western blot analyses revealed that TiMYB2R-1 was highly expressed in the transgenic wheat lines. Based on disease response assessments for three successive generations, the significantly enhanced resistance to take-all was observed in the three TiMYB2R-1-overexpressing transgenic wheat lines. Furthermore, the transcript levels of at least six wheat defence-related genes were significantly elevated in the TiMYB2R-1 transgenic wheat lines. These results suggest that engineering and overexpression of TiMYB2R-1 may be used for improving take-all resistance of wheat and other cereal crops.

  10. Novel Strategy to Control Transgene Expression Mediated by a Sendai Virus-Based Vector Using a Nonstructural C Protein and Endogenous MicroRNAs.

    Directory of Open Access Journals (Sweden)

    Masayuki Sano

    Full Text Available Tissue-specific control of gene expression is an invaluable tool for studying various biological processes and medical applications. Efficient regulatory systems have been utilized to control transgene expression in various types of DNA viral or integrating viral vectors. However, existing regulatory systems are difficult to transfer into negative-strand RNA virus vector platforms because of significant differences in their transcriptional machineries. In this study, we developed a novel strategy for regulating transgene expression mediated by a cytoplasmic RNA vector based on a replication-defective and persistent Sendai virus (SeVdp. Because of the capacity of Sendai virus (SeV nonstructural C proteins to specifically inhibit viral RNA synthesis, overexpression of C protein significantly reduced transgene expression mediated by SeVdp vectors. We found that SeV C overexpression concomitantly reduced SeVdp mRNA levels and genomic RNA synthesis. To control C expression, target sequences for an endogenous microRNA were incorporated into the 3' untranslated region of the C genes. Incorporation of target sequences for miR-21 into the SeVdp vector restored transgene expression in HeLa cells by decreasing C expression. Furthermore, the SeVdp vector containing target sequences for let-7a enabled cell-specific control of transgene expression in human fibroblasts and induced pluripotent stem cells. Our findings demonstrate that SeV C can be used as an effective regulator for controlling transgene expression. This strategy will contribute to efficient and less toxic SeVdp-mediated gene transfer in various biological applications.

  11. A Randomized Controlled Trial Assessing the Efficacy of Cognitive Behavioral Therapy for Substance-Dependent Domestic Violence Offenders: An Integrated Substance Abuse-Domestic Violence Treatment Approach (SADV).

    Science.gov (United States)

    Easton, Caroline J; Crane, Cory A; Mandel, Dolores

    2017-11-06

    The current study evaluates a therapy for substance-dependent perpetrators of partner violence. Sixty-three males arrested for partner violence within the past year were randomized to a cognitive behavioral substance abuse-domestic violence (SADV; n = 29) or a drug counseling (DC; n = 34) condition. Seventy percent of offenders completed eight core sessions with no differences between SADV and DC conditions in the amount of substance or aggression at pretreatment. SADV participants had fewer cocaine-positive toxicology screens and breathalyzer results during treatment, were less likely to engage in aggressive behavior proximal to a drinking episode, and reported fewer episodes of violence than DC participants at posttreatment follow-up. SADV shows promise in decreasing addiction and partner violence among substance-dependent male offenders. © 2017 American Association for Marriage and Family Therapy.

  12. An automated three-dimensional detection and segmentation method for touching cells by integrating concave points clustering and random walker algorithm.

    Directory of Open Access Journals (Sweden)

    Yong He

    Full Text Available Characterizing cytoarchitecture is crucial for understanding brain functions and neural diseases. In neuroanatomy, it is an important task to accurately extract cell populations' centroids and contours. Recent advances have permitted imaging at single cell resolution for an entire mouse brain using the Nissl staining method. However, it is difficult to precisely segment numerous cells, especially those cells touching each other. As presented herein, we have developed an automated three-dimensional detection and segmentation method applied to the Nissl staining data, with the following two key steps: 1 concave points clustering to determine the seed points of touching cells; and 2 random walker segmentation to obtain cell contours. Also, we have evaluated the performance of our proposed method with several mouse brain datasets, which were captured with the micro-optical sectioning tomography imaging system, and the datasets include closely touching cells. Comparing with traditional detection and segmentation methods, our approach shows promising detection accuracy and high robustness.

  13. Transgenic Expression of a Functional Fragment of Harpin Protein Hpa1 in Wheat Represses English Grain Aphid Infestation

    Institute of Scientific and Technical Information of China (English)

    XU Man-yu; ZHOU Ting; ZHAO Yan-ying; LI Jia-bao; XU Heng; DONG Han-song; ZHANG Chun-ling

    2014-01-01

    The harpin protein Hpa1 produced by the rice bacterial blight pathogen promotes plant growth and induces plant resistance to pathogens and insect pests. The region of 10-42 residues (Hpa110-42) in the Hpa1 sequence is critical as the isolated Hpa110-42 fragment is 1.3-7.5-fold more effective than the full length in inducing plant growth and resistance. Here we report that transgenic expression of Hpa110-42 in wheat induces resistance to English grain aphid, a dominant species of wheat aphids. Hpa110-42-induced resistance is effective to inhibit the aphid behavior in plant preference at the initial colonization stage and repress aphid performances in the reproduction, nymph growth, and instar development on transgenic plants. The resistance characters are correlated with enhanced expression of defense-regulatory genes (EIN2, PP2-A, and GSL10) and consistent with induced expression of defense response genes (Hel, PDF1.2, PR-1b, and PR-2b). As a result, aphid infestations are alleviated in transgenic plants. The level of Hpa110-42-induced resistance in regard to repression of aphid infestations is equivalent to the effect of chemical control provided by an insecticide. These results suggested that the defensive role of Hpa110-42 can be integrated into breeding germplasm of the agriculturally signiifcant crop with a great potential of the agricultural application.

  14. The effects of Fe2O3 nanoparticles on physiology and insecticide activity in non-transgenic and Bt-transgenic cotton

    Directory of Open Access Journals (Sweden)

    Nhan eLe Van

    2016-01-01

    Full Text Available As the demands for nanotechnology and nanoparticle (NP applications in agriculture increase, the ecological risk has drawn more attention because of the unpredictable results of interactions between NPs and transgenic crops. In this study, we investigated the effects of various concentrations of Fe2O3 NPs on Bt-transgenic cotton in comparison with conventional cotton for 10 days. Each treatment was conducted in triplicate, and each experiment was repeated three times. Results demonstrated that Fe2O3 nanoparticles (NPs inhibited the plant height and root length of Bt-transgenic cotton and promoted root hairs and biomass of non-transgenic cotton. Nutrients such as Na and K in Bt-transgenic cotton roots increased, while Zn contents decreased with Fe2O3 NPs. Most hormones in the roots of Bt-transgenic cotton increased at low Fe2O3 NP exposure (100 mg·L−1 but decreased at high concentrations of Fe2O3 NPs (1000 mg·L−1. Fe2O3 NPs increased the Bt-toxin in leaves and roots of Bt-transgenic cotton. Fe2O3 NPs were absorbed into roots, then transported to the shoots of both Bt-transgenic and non-transgenic cottons. The bioaccumulation of Fe2O3 NPs in plants might be a potential risk for agricultural crops and affect the environment and human health.

  15. A community-integrated home based depression intervention for older African Americans: descripton of the Beat the Blues randomized trial and intervention costs

    Directory of Open Access Journals (Sweden)

    Gitlin Laura N

    2012-02-01

    Full Text Available Abstract Background Primary care is the principle setting for depression treatment; yet many older African Americans in the United States fail to report depressive symptoms or receive the recommended standard of care. Older African Americans are at high risk for depression due to elevated rates of chronic illness, disability and socioeconomic distress. There is an urgent need to develop and test new depression treatments that resonate with minority populations that are hard-to-reach and underserved and to evaluate their cost and cost-effectiveness. Methods/Design Beat the Blues (BTB is a single-blind parallel randomized trial to assess efficacy of a non-pharmacological intervention to reduce depressive symptoms and improve quality of life in 208 African Americans 55+ years old. It involves a collaboration with a senior center whose care management staff screen for depressive symptoms (telephone or in-person using the Patient Health Questionnaire (PHQ-9. Individuals screened positive (PHQ-9 ≥ 5 on two separate occasions over 2 weeks are referred to local mental health resources and BTB. Interested and eligible participants who consent receive a baseline home interview and then are randomly assigned to receive BTB immediately or 4 months later (wait-list control. All participants are interviewed at 4 (main study endpoint and 8 months at home by assessors masked to study assignment. Licensed senior center social workers trained in BTB meet with participants at home for up to 10 sessions over 4 months to assess care needs, make referrals/linkages, provide depression education, instruct in stress reduction techniques, and use behavioral activation to identify goals and steps to achieve them. Key outcomes include reduced depressive symptoms (primary, reduced anxiety and functional disability, improved quality of life, and enhanced depression knowledge and behavioral activation (secondary. Fidelity is enhanced through procedure manuals and staff

  16. Obtaining of transgenic papaya plants var. Maradol roja that carry out the rice oryzacystatin gene

    Directory of Open Access Journals (Sweden)

    Milady F. Mendoza

    2004-10-01

    Full Text Available Papaya (Carica papaya L., is severely affected by Papaya Ringspot virus, which belongs to plant potyvirus group. A recent strategy for pest control produced by this virus is the transformation with genes encoding cysteine proteinase inhibitors. Rice oryzacistatin gene encoding for cystatins, was inserted in a pCAMBIA binary vector, for genetic transformation of papaya somatic embryos var. Maradol roja, mediated by gene gun. Gene integration was confirmed by means of polimerase chain reaction using the primers designed from gene bar sequence. Forty out of eighty in vitro transgenic papaya lines amplified a 402 fragment which correspond to the expecting size. Key words: Carica papaya, genetic engineering, potyvirus, proteinase inhibitor

  17. Comparing dedicated and designated models of integrating mental health into chronic disease care: study protocol for a cluster randomized controlled trial.

    Science.gov (United States)

    Myers, Bronwyn; Lund, Crick; Lombard, Carl; Joska, John; Levitt, Naomi; Butler, Christopher; Cleary, Susan; Naledi, Tracey; Milligan, Peter; Stein, Dan J; Sorsdahl, Katherine

    2018-03-16

    In low- and middle-income countries (LMIC), it is uncertain whether a "dedicated" approach to integrating mental health care (wherein a community health worker (CHW) has the sole responsibility of delivering mental health care) or a "designated" approach (wherein a CHW provides this service in addition to usual responsibilities) is most effective and cost-effective. This study aims to compare the effectiveness and cost-effectiveness of these two models of service integration relative to treatment as usual (TAU) for improving mental health and chronic disease outcomes among patients with HIV or diabetes. This is a cluster randomised trial. We will randomise 24 primary health care facilities in the Western Cape Province of South Africa to one of three study arms. Within each cluster, we will recruit 25 patients from HIV and 25 from diabetes services for a total sample of 1200 participants. Eligible patients will be aged 18 years or older, take medication for HIV or diabetes, and screen positive on the Alcohol Use Disorder Identification Test for hazardous/harmful alcohol use or depression on the Centre for Epidemiology Scale on Depression. Participants recruited in clinics assigned to the designated or dedicated approach will receive three sessions of motivational interviewing and problem-solving therapy, while those recruited at TAU-assigned clinics will be referred for further assessment. Participants will complete an interviewer-administered questionnaire at baseline, and at 6 and 12 months post-enrolment to assess change in self-reported outcomes. At these end points, we will test HIV RNA viral load for participants with HIV and HbA1c levels for participants with diabetes. Primary outcomes are reductions in self-reported hazardous/harmful alcohol use and risk of depression. Secondary outcomes are improvements in adherence to chronic disease treatment, biomarkers of chronic disease outcomes, and health-related quality of life. Mixed-effect linear regression models

  18. Comparison of Model Predictions and Laboratory Observations of Transgene Frequencies in Continuously-Breeding Mosquito Populations

    Science.gov (United States)

    Valerio, Laura; North, Ace; Collins, C. Matilda; Mumford, John D.; Facchinelli, Luca; Spaccapelo, Roberta; Benedict, Mark Q.

    2016-01-01

    The persistence of transgenes in the environment is a consideration in risk assessments of transgenic organisms. Combining mathematical models that predict the frequency of transgenes and experimental demonstrations can validate the model predictions, or can detect significant biological deviations that were neither apparent nor included as model parameters. In order to assess the correlation between predictions and observations, models were constructed to estimate the frequency of a transgene causing male sexual sterility in simulated populations of a malaria mosquito Anopheles gambiae that were seeded with transgenic females at various proportions. Concurrently, overlapping-generation laboratory populations similar to those being modeled were initialized with various starting transgene proportions, and the subsequent proportions of transgenic individuals in populations were determined weekly until the transgene disappeared. The specific transgene being tested contained a homing endonuclease gene expressed in testes, I-PpoI, that cleaves the ribosomal DNA and results in complete male sexual sterility with no effect on female fertility. The transgene was observed to disappear more rapidly than the model predicted in all cases. The period before ovipositions that contained no transgenic progeny ranged from as little as three weeks after cage initiation to as long as 11 weeks. PMID:27669312

  19. Comparison of Model Predictions and Laboratory Observations of Transgene Frequencies in Continuously-Breeding Mosquito Populations

    Directory of Open Access Journals (Sweden)

    Laura Valerio

    2016-09-01

    Full Text Available The persistence of transgenes in the environment is a consideration in risk assessments of transgenic organisms. Combining mathematical models that predict the frequency of transgenes and experimental demonstrations can validate the model predictions, or can detect significant biological deviations that were neither apparent nor included as model parameters. In order to assess the correlation between predictions and observations, models were constructed to estimate the frequency of a transgene causing male sexual sterility in simulated populations of a malaria mosquito Anopheles gambiae that were seeded with transgenic females at various proportions. Concurrently, overlapping-generation laboratory populations similar to those being modeled were initialized with various starting transgene proportions, and the subsequent proportions of transgenic individuals in populations were determined weekly until the transgene disappeared. The specific transgene being tested contained a homing endonuclease gene expressed in testes, I-PpoI, that cleaves the ribosomal DNA and results in complete male sexual sterility with no effect on female fertility. The transgene was observed to disappear more rapidly than the model predicted in all cases. The period before ovipositions that contained no transgenic progeny ranged from as little as three weeks after cage initiation to as long as 11 weeks.

  20. Keeping the genie in the bottle: transgene biocontainment by excision in pollen.

    Science.gov (United States)

    Moon, Hong S; Li, Yi; Stewart, C Neal

    2010-01-01

    Gene flow from transgenic plants is an environmental and regulatory concern. While biocontainment might be achieved using male sterility or transgenic mitigation tools, we believe that perhaps the optimal solution might be simply to remove transgenes from pollen. Male sterility might not be ideal for many pollinators, and might not be implementable using standardized genes. Transgenic mitigation might not be useful to control conspecific gene flow (e.g. crop to crop), and relies on competition and not biocontainment per se. Site-specific recombination systems could allow highly efficient excision of transgenes in pollen to eliminate, or at least minimize, unwanted transgene movement via pollen dispersal. There are other potential biotechnologies, such as zinc finger nucleases, that could be also used for transgene excision.

  1. Integrated mental health care and vocational rehabilitation to improve return to work rates for people on sick leave because of exhaustion disorder, adjustment disorder, and distress (the Danish IBBIS trial): study protocol for a randomized controlled trial.

    Science.gov (United States)

    Poulsen, Rie; Fisker, Jonas; Hoff, Andreas; Hjorthøj, Carsten; Eplov, Lene Falgaard

    2017-12-02

    Common mental disorders are important contributors to the global burden of disease and cause negative effects on both the individual and society. Stress-related disorders influence the individual's workability and cause early retirement pensions in Denmark. There is no clear evidence that mental health care alone will provide sufficient support for vocational recovery for this group. Integrated vocational and health care services have shown good effects on return to work in other similar welfare contexts. The purpose of the Danish IBBIS (Integreret Behandlings- og BeskæftigelsesIndsats til Sygemeldte) study is to examine the efficacy of (1) a stepped mental health care intervention with individual stress coaching and/or group-based MBSR and (2) an integrated stepped mental health care with individual stress coaching and/or group-based MBSR and vocational rehabilitation intervention for people on sick leave because of exhaustion disorder, adjustment disorder or distress in Denmark. This three-armed, parallel-group, randomized superiority trial is set up to investigate the effectiveness of a stepped mental health care intervention and an integrated mental health care and vocational rehabilitation intervention for people on sick leave because of exhaustion disorder, adjustment disorder or distress in Denmark. The trial has an investigator-initiated multicenter design. Six hundred and three patients will be recruited from Danish vocational rehabilitation centers in four municipalities and randomly assigned into three groups: (1) IBBIS mental health care integrated with IBBIS vocational rehabilitation, (2) IBBIS mental health care and standard vocational rehabilitation, and (3) standard mental health care and standard vocational rehabilitation. The primary outcome is register-based return to work at 12 months. The secondary outcome measures are self-assessed level of depression (BDI), anxiety (BAI), distress symptoms (4DSQ), work- and social functioning (WSAS), and

  2. Random Fields

    Science.gov (United States)

    Vanmarcke, Erik

    1983-03-01

    Random variation over space and time is one of the few attributes that might safely be predicted as characterizing almost any given complex system. Random fields or "distributed disorder systems" confront astronomers, physicists, geologists, meteorologists, biologists, and other natural scientists. They appear in the artifacts developed by electrical, mechanical, civil, and other engineers. They even underlie the processes of social and economic change. The purpose of this book is to bring together existing and new methodologies of random field theory and indicate how they can be applied to these diverse areas where a "deterministic treatment is inefficient and conventional statistics insufficient." Many new results and methods are included. After outlining the extent and characteristics of the random field approach, the book reviews the classical theory of multidimensional random processes and introduces basic probability concepts and methods in the random field context. It next gives a concise amount of the second-order analysis of homogeneous random fields, in both the space-time domain and the wave number-frequency domain. This is followed by a chapter on spectral moments and related measures of disorder and on level excursions and extremes of Gaussian and related random fields. After developing a new framework of analysis based on local averages of one-, two-, and n-dimensional processes, the book concludes with a chapter discussing ramifications in the important areas of estimation, prediction, and control. The mathematical prerequisite has been held to basic college-level calculus.

  3. Optimization of codon composition and regulatory elements for expression of human insulin like growth factor-1 in transgenic chloroplasts and evaluation of structural identity and function.

    Science.gov (United States)

    Daniell, Henry; Ruiz, Gricel; Denes, Bela; Sandberg, Laurence; Langridge, William

    2009-04-03

    Transgenic chloroplasts are potential bioreactors for recombinant protein production, especially for achievement of high levels of protein expression and proper folding. Production of therapeutic proteins in leaves provides transgene containment by elimination of reproductive structures. Therefore, in this study, human Insulin like Growth Factor-1 is expressed in transgenic chloroplasts for evaluation of structural identity and function. Expression of the synthetic Insulin like Growth Factor 1 gene (IGF-1s, 60% AT) was observed in transformed E. coli. However, no native IGF-1 gene (IGF-1n, 41% AT) product was detected in the western blots in E. coli. Site-specific integration of the transgenes into the tobacco chloroplast genome was confirmed after transformation using PCR. Southern blot analysis confirmed that the transgenic lines were homoplasmic. The transgenic plant lines had IGF-1s expression levels of 11.3% of total soluble protein (TSP). The IGF-1n plants contained 9.5% TSP as IGF-1n, suggesting that the chloroplast translation machinery is more flexible than E. coli in codon preference and usage. The expression of IGF-1 was increased up to 32% TSP under continuous illumination by the chloroplast light regulatory elements. IgG-Sepharose affinity column chromatographic separation of Z domain containing chloroplast derived IGF-1 protein, single and two dimensional electrophoresis methods and mass spectrometer analysis confirmed the identity of human IGF-1 in transgenic chloroplasts. Two spots analyzed from 2-D focusing/phoresis acrylamide gel showed the correct amino acid sequence of human IGF-1 and the S. aureus Z-tag. Cell proliferation assays in human HU-3 cells demonstrated the biological activity of chloroplast derived IGF-1 even in the presence of the S. aureus Z tag. This study demonstrates that the human Insulin like Growth Factor-1 expressed in transgenic chloroplasts is identical to the native protein and is fully functional. The ability to use plant

  4. Optimization of codon composition and regulatory elements for expression of human insulin like growth factor-1 in transgenic chloroplasts and evaluation of structural identity and function

    Directory of Open Access Journals (Sweden)

    Sandberg Laurence

    2009-04-01

    Full Text Available Abstract Background Transgenic chloroplasts are potential bioreactors for recombinant protein production, especially for achievement of high levels of protein expression and proper folding. Production of therapeutic proteins in leaves provides transgene containment by elimination of reproductive structures. Therefore, in this study, human Insulin like Growth Factor-1 is expressed in transgenic chloroplasts for evaluation of structural identity and function. Results Expression of the synthetic Insulin like Growth Factor 1 gene (IGF-1s, 60% AT was observed in transformed E. coli. However, no native IGF-1 gene (IGF-1n, 41% AT product was detected in the western blots in E. coli. Site-specific integration of the transgenes into the tobacco chloroplast genome was confirmed after transformation using PCR. Southern blot analysis confirmed that the transgenic lines were homoplasmic. The transgenic plant lines had IGF-1s expression levels of 11.3% of total soluble protein (TSP. The IGF-1n plants contained 9.5% TSP as IGF-1n, suggesting that the chloroplast translation machinery is more flexible than E. coli in codon preference and usage. The expression of IGF-1 was increased up to 32% TSP under continuous illumination by the chloroplast light regulatory elements. IgG-Sepharose affinity column chromatographic separation of Z domain containing chloroplast derived IGF-1 protein, single and two dimensional electrophoresis methods and mass spectrometer analysis confirmed the identity of human IGF-1 in transgenic chloroplasts. Two spots analyzed from 2-D focusing/phoresis acrylamide gel showed the correct amino acid sequence of human IGF-1 and the S. aureus Z-tag. Cell proliferation assays in human HU-3 cells demonstrated the biological activity of chloroplast derived IGF-1 even in the presence of the S. aureus Z tag. Conclusion This study demonstrates that the human Insulin like Growth Factor-1 expressed in transgenic chloroplasts is identical to the native

  5. A transgenic approach to study argininosuccinate synthetase gene expression

    Science.gov (United States)

    2014-01-01

    Background Argininosuccinate synthetase (ASS) participates in urea, nitric oxide and arginine production. Besides transcriptional regulation, a post-transcriptional regulation affecting nuclear precursor RNA stability has been reported. To study whether such post-transcriptional regulation underlines particular temporal and spatial ASS expression, and to investigate how human ASS gene behaves in a mouse background, a transgenic mouse system using a modified bacterial artificial chromosome carrying the human ASS gene tagged with EGFP was employed. Results Two lines of ASS-EGFP transgenic mice were generated: one with EGFP under transcriptional control similar to that of the endogenous ASS gene, another with EGFP under both transcriptional and post-transcriptional regulation as that of the endogenous ASS mRNA. EGFP expression in the liver, the organ for urea production, and in the intestine and kidney that are responsible for arginine biosynthesis, was examined. Organs taken from embryos E14.5 stage to young adult were examined under a fluorescence microscope either directly or after cryosectioning. The levels of EGFP and endogenous mouse Ass mRNAs were also quantified by S1 nuclease mapping. EGFP fluorescence and EGFP mRNA levels in both the liver and kidney were found to increase progressively from embryonic stage toward birth. In contrast, EGFP expression in the intestine was higher in neonates and started to decline at about 3 weeks after birth. Comparison between the EGFP profiles of the two transgenic lines indicated the developmental and tissue-specific regulation was mainly controlled at the transcriptional level. The ASS transgene was of human origin. EGFP expression in the liver followed essentially the mouse Ass pattern as evidenced by zonation distribution of fluorescence and the level of EGFP mRNA at birth. However, in the small intestine, Ass mRNA level declined sharply at 3 week of age, and yet substantial EGFP mRNA was still detectable at this stage

  6. Preliminarily study on the maximum handling size, prey size and species selectivity of growth hormone transgenic and non-transgenic common carp Cyprinus carpio when foraging on gastropods

    Science.gov (United States)

    Zhu, Tingbing; Zhang, Lihong; Zhang, Tanglin; Wang, Yaping; Hu, Wei; Olsen, Rolf Eric; Zhu, Zuoyan

    2017-10-01

    The present study preliminarily examined the differences in maximum handling size, prey size and species selectivity of growth hormone transgenic and non-transgenic common carp Cyprinus carpio when foraging on four gastropods species (Bellamya aeruginosa, Radix auricularia, Parafossarulus sinensis and Alocinma longicornis) under laboratory conditions. In the maximum handling size trial, five fish from each age group (1-year-old and 2-year-old) and each genotype (transgenic and non-transgenic) of common carp were individually allowed to feed on B. aeruginosa with wide shell height range. The results showed that maximum handling size increased linearly with fish length, and there was no significant difference in maximum handling size between the two genotypes. In the size selection trial, three pairs of 2-year-old transgenic and non-transgenic carp were individually allowed to feed on three size groups of B. aeruginosa. The results show that the two genotypes of C. carpio favored the small-sized group over the large-sized group. In the species selection trial, three pairs of 2-year-old transgenic and non-transgenic carp were individually allowed to feed on thin-shelled B. aeruginosa and thick-shelled R. auricularia, and five pairs of 2-year-old transgenic and non-transgenic carp were individually allowed to feed on two gastropods species (P. sinensis and A. longicornis) with similar size and shell strength. The results showed that both genotypes preferred thin-shelled Radix auricularia rather than thick-shelled B. aeruginosa, but there were no significant difference in selectivity between the two genotypes when fed on P. sinensis and A. longicornis. The present study indicates that transgenic and non-transgenic C. carpio show similar selectivity of predation on the size- and species-limited gastropods. While this information may be useful for assessing the environmental risk of transgenic carp, it does not necessarily demonstrate that transgenic common carp might

  7. Tubaramure, a Food-Assisted Integrated Health and Nutrition Program, Reduces Child Stunting in Burundi: A Cluster-Randomized Controlled Intervention Trial.

    Science.gov (United States)

    Leroy, Jef L; Olney, Deanna; Ruel, Marie

    2018-03-01

    Food-assisted maternal and child health and nutrition (FA-MCHN) programs are widely used to address undernutrition, but little is known about their effectiveness in improving child linear growth. We assessed the impact of Burundi's Tubaramure FA-MCHN program on linear growth. The program targeted women and their children during the first 1000 d and included 1) food rations, 2) strengthening of health services and promotion of their use, and 3) behavior change communication (BCC). A second objective was to assess the differential effect when varying the timing and duration of receiving food rations. We used a 4-arm, cluster-randomized controlled study to assess program impact with the use of cluster fixed-effects double-difference models with repeated cross-sectional data (baseline and follow-up 4 y later with ∼3550 children in each round). Treatment arms received food rations (corn-soy blend and micronutrient-fortified vegetable oil) for the first 1000 d (T24), from pregnancy through the child reaching 18 mo (T18), or from birth through the child reaching 24 mo ["no food during pregnancy" (TNFP)]. All treatment arms received BCC for the first 1000 d. The control arm received no food rations or BCC. Stunting (height-for-age z score effect in the T24 [7.4 percentage points (pp); P effect across arms were not significant (P > 0.01). Secondary analyses showed that the effect was limited to children whose mother and head of household had some primary education and who lived in households with above-median assets. FA-MCHN programs are an effective development tool to improve child linear growth and can protect children from political and economic shocks in vulnerable countries such as Burundi. A better understanding of how to improve the nutritional status of children in the worst-off households is needed. This trial was registered at www.clinicaltrials.gov as NCT01072279.

  8. An efficient and reproducible protocol for the production of salt tolerant transgenic wheat plants expressing the Arabidopsis AtNHX1 gene.

    Science.gov (United States)

    Moghaieb, Reda E A; Sharaf, Ahmed N; Soliman, Mohamed H; El-Arabi, Nagwa I; Momtaz, Osama A

    2014-01-01

    We present an efficient method for the production of transgenic salt tolerant hexaploid wheat plants expressing the Arabidopsis AtNHX1 gene. Wheat mature zygotic embryos were isolated from two hexaploid bread wheat (Triticum aestivum) cultivars (namely: Gemmeiza 9 and Gemmeiza 10) and were transformed with the A. tumefaciens LBA4404 harboring the pBI-121 vector containing the AtNHX1 gene. Transgenic wheat lines that express the gus intron was obtained and used as control. The results confirmed that npt-II gene could be transmitted and expressed in the T2 following 3:1 Mendelian segregation while the control plant couldn't. The data indicate that, the AtNHX1 gene was integrated in a stable manner into the wheat genome and the corresponding transcripts were expressed. The transformation efficiency was 5.7 and 7.5% for cultivars Gemmeiza 10 and Gemmeiza 9, respectively. A greenhouse experiment was conducted to investigate the effect of AtNHX1 gene in wheat salt tolerance. The transgenic wheat lines could maintain high growth rate under salt stress condition (350 mM NaCl) while the control plant couldn't. The results confirmed that Na(+)/H(+) antiporter gene AtNHX1 increased salt tolerance by increasing Na(+) accumulation and keeping K+/Na(+) balance. Thus, transgenic plants showed high tolerance to salt stress and can be considered as a new genetic resource in breeding programs.

  9. Dynamics of antigen presentation to transgene product-specific CD4+ T cells and of Treg induction upon hepatic AAV gene transfer

    Directory of Open Access Journals (Sweden)

    George Q Perrin

    2016-01-01

    Full Text Available The tolerogenic hepatic microenvironment impedes clearance of viral infections but is an advantage in viral vector gene transfer, which often results in immune tolerance induction to transgene products. Although the underlying tolerance mechanism has been extensively studied, our understanding of antigen presentation to transgene product-specific CD4+ T cells remains limited. To address this, we administered hepatotropic adeno-associated virus (AAV8 vector expressing cytoplasmic ovalbumin (OVA into wt mice followed by adoptive transfer of transgenic OVA-specific T cells. We find that that the liver-draining lymph nodes (celiac and portal are the major sites of MHC II presentation of the virally encoded antigen, as judged by in vivo proliferation of DO11.10 CD4+ T cells (requiring professional antigen-presenting cells, e.g., macrophages and CD4+CD25+FoxP3+ Treg induction. Antigen presentation in the liver itself contributes to activation of CD4+ T cells egressing from the liver. Hepatic-induced Treg rapidly disseminate through the systemic circulation. By contrast, a secreted OVA transgene product is presented in multiple organs, and OVA-specific Treg emerge in both the thymus and periphery. In summary, liver draining lymph nodes play an integral role in hepatic antigen presentation and peripheral Treg induction, which results in systemic regulation of the response to viral gene products.

  10. Generation and Characterization of a Transgenic Mouse Carrying a Functional Human β-Globin Gene with the IVSI-6 Thalassemia Mutation

    Directory of Open Access Journals (Sweden)

    Giulia Breveglieri

    2015-01-01

    Full Text Available Mouse models that carry mutations causing thalassemia represent a suitable tool to test in vivo new mutation-specific therapeutic approaches. Transgenic mice carrying the β-globin IVSI-6 mutation (the most frequent in Middle-Eastern regions and recurrent in Italy and Greece are, at present, not available. We report the production and characterization of a transgenic mouse line (TG-β-IVSI-6 carrying the IVSI-6 thalassemia point mutation within the human β-globin gene. In the TG-β-IVSI-6 mouse (a the transgenic integration region is located in mouse chromosome 7; (b the expression of the transgene is tissue specific; (c as expected, normally spliced human β-globin mRNA is produced, giving rise to β-globin production and formation of a human-mouse tetrameric chimeric hemoglobin αmu-globin2/βhu-globin2 and, more importantly, (d the aberrant β-globin-IVSI-6 RNAs are present in blood cells. The TG-β-IVSI-6 mouse reproduces the molecular features of IVSI-6 β-thalassemia and might be used as an in vivo model to characterize the effects of antisense oligodeoxynucleotides targeting the cryptic sites responsible for the generation of aberrantly spliced β-globin RNA sequences, caused by the IVSI-6 mutation. These experiments are expected to be crucial for the development of a personalized therapy for β-thalassemia.

  11. Generation and Characterization of a Transgenic Mouse Carrying a Functional Human β-Globin Gene with the IVSI-6 Thalassemia Mutation

    Science.gov (United States)

    Mancini, Irene; Lampronti, Ilaria; Salvatori, Francesca; Fabbri, Enrica; Zuccato, Cristina; Cosenza, Lucia C.; Montagner, Giulia; Borgatti, Monica; Altruda, Fiorella; Fagoonee, Sharmila; Carandina, Gianni; Aiello, Vincenzo; Breda, Laura; Rivella, Stefano; Gambari, Roberto

    2015-01-01

    Mouse models that carry mutations causing thalassemia represent a suitable tool to test in vivo new mutation-specific therapeutic approaches. Transgenic mice carrying the β-globin IVSI-6 mutation (the most frequent in Middle-Eastern regions and recurrent in Italy and Greece) are, at present, not available. We report the production and characterization of a transgenic mouse line (TG-β-IVSI-6) carrying the IVSI-6 thalassemia point mutation within the human β-globin gene. In the TG-β-IVSI-6 mouse (a) the transgenic integration region is located in mouse chromosome 7; (b) the expression of the transgene is tissue specific; (c) as expected, normally spliced human β-globin mRNA is produced, giving rise to β-globin production and formation of a human-mouse tetrameric chimeric hemoglobin mu α-globin2/hu β-globin2 and, more importantly, (d) the aberrant β-globin-IVSI-6 RNAs are present in blood cells. The TG-β-IVSI-6 mouse reproduces the molecular features of IVSI-6 β-thalassemia and might be used as an in vivo model to characterize the effects of antisense oligodeoxynucleotides targeting the cryptic sites responsible for the generation of aberrantly spliced β-globin RNA sequences, caused by the IVSI-6 mutation. These experiments are expected to be crucial for the development of a personalized therapy for β-thalassemia. PMID:26097845

  12. Identification of genomic insertion and flanking sequence of G2-EPSPS and GAT transgenes in soybean using whole genome sequencing method

    Directory of Open Access Journals (Sweden)

    Bingfu Guo

    2016-07-01

    Full Text Available Molecular characterization of sequences flanking exogenous fragment insertions is essential for safety assessment and labeling of genetically modified organisms (GMO. In this study, the T-DNA insertion sites and flanking sequences were identified in two newly developed transgenic glyphosate-tolerant soybeans GE-J16 and ZH10-6 based on whole genome sequencing (WGS method. About 21 Gb sequence data (~21× coverage for each line was generated on Illumina HiSeq 2500 platform. The junction reads mapped to boundary of T-DNA and flanking sequences in these two events were identified by comparing all sequencing reads with soybean reference genome and sequence of transgenic vector. The putative insertion loci and flanking sequences were further confirmed by PCR amplification, Sanger sequencing, and co-segregation analysis. All these analyses supported that exogenous T-DNA fragments were integrated in positions of Chr19: 50543767-50543792 and Chr17: 7980527-7980541 in these two transgenic lines. Identification of the genomic insertion site of the G2-EPSPS and GAT transgenes will facilitate the use of their glyphosate-tolerant traits in soybean breeding program. These results also demonstrated that WGS is a cost-effective and rapid method of identifying sites of T-DNA insertions and flanking sequences in soybean.

  13. Efficient generation of knock-in transgenic zebrafish carrying reporter/driver genes by CRISPR/Cas9-mediated genome engineering.

    Science.gov (United States)

    Kimura, Yukiko; Hisano, Yu; Kawahara, Atsuo; Higashijima, Shin-ichi

    2014-10-08

    The type II bacterial CRISPR/Cas9 system is rapidly becoming popular for genome-engineering due to its simplicity, flexibility, and high efficiency. Recently, targeted knock-in of a long DNA fragment via homology-independent DNA repair has been achieved in zebrafish using CRISPR/Cas9 system. This raised the possibility that knock-in transgenic zebrafish could be efficiently generated using CRISPR/Cas9. However, how widely this method can be applied for the targeting integration of foreign genes into endogenous genomic loci is unclear. Here, we report efficient generation of knock-in transgenic zebrafish that have cell-type specific Gal4 or reporter gene expression. A donor plasmid containing a heat-shock promoter was co-injected with a short guide RNA (sgRNA) targeted for genome digestion, a sgRNA targeted for donor plasmid digestion, and Cas9 mRNA. We have succeeded in establishing stable knock-in transgenic fish with several different constructs for 4 genetic loci at a frequency being exceeding 25%. Due to its simplicity, design flexibility, and high efficiency, we propose that CRISPR/Cas9-mediated knock-in will become a standard method for the generation transgenic zebrafish.

  14. Enhanced resistance to blister blight in transgenic tea (Camellia sinensis [L.] O. Kuntze) by overexpression of class I chitinase gene from potato (Solanum tuberosum).

    Science.gov (United States)

    Singh, H Ranjit; Deka, Manab; Das, Sudripta

    2015-07-01

    Tea is the second most consumed beverage in the world. A crop loss of up to 43 % has been reported due to blister blight disease of tea caused by a fungus, Exobasidium vexans. Thus, it directly affects the tea industry qualitatively and quantitatively. Solanum tuberosum class I chitinase gene (AF153195) is a plant pathogenesis-related gene. It was introduced into tea genome via Agrobacterium-mediated transformation with hygromycin phosphotransferase (hpt) gene conferring hygromycin resistance as plant selectable marker. A total of 41 hygromycin resistant plantlets were obtained, and PCR analysis established 12 plantlets confirming about the stable integration of transgene in the plant genome. Real-time PCR detected transgene expression in four transgenic plantlets (T28, C57, C9, and T31). Resistance to biotrophic fungal pathogen, E. vexans, was tested by detached leaf infection assay of greenhouse acclimated plantlets. An inhibitory activity against the fungal pathogen was evident from the detached leaves from the transformants compared with the control. Fungal lesion formed on control plantlet whereas the transgenic plantlets showed resistance to inoculated fungal pathogen by the formation of hypersensitivity reaction area. This result suggests that constitutive expression of the potato class I chitinase gene can be exploited to improve resistance to fungal pathogen, E. vexans, in economical perennial plantation crop like tea.

  15. Practical moral codes in the transgenic organism debate.

    Science.gov (United States)

    Cooley, D R; Goreham, Gary; Youngs, George A

    2004-01-01

    In one study funded by the United States Department of Agriculture, people from North Dakota were interviewed to discover which moral principles they use in evaluating the morality of transgenic organisms and their introduction into markets. It was found that although the moral codes the human subjects employed were very similar, their views on transgenics were vastly different. In this paper, the codes that were used by the respondents are developed, compared to that of the academically composed Belmont Report, and then modified to create the more practical Common Moral Code. At the end, it is shown that the Common Moral Code has inherent inconsistency flaws that might be resolvable, but would require extensive work on the definition of terms and principles. However, the effort is worthwhile, especially if it results in a common moral code that all those involved in the debate are willing to use in negotiating a resolution to their differences.

  16. Rapid method for identification of transgenic fish zygosity

    Directory of Open Access Journals (Sweden)

    . Alimuddin

    2007-07-01

    Full Text Available Identification of zygosity in transgenik fish is normally achieved by PCR analysis with genomic DNA template extracted from the tissue of progenies which are derived by mating the transgenic fish and wild-type counterpart.  This method needs relatively large amounts of fish material and is time- and labor-intensive. New approaches addressing this problem could be of great help for fish biotechnologists.  In this experiment, we applied a quantitative real-time PCR (qr-PCR method to analyze zygosity in a stable line of transgenic zebrafish (Danio rerio carrying masu salmon, Oncorhynchus masou D6-desaturase-like gene. The qr-PCR was performed using iQ SYBR Green Supermix in the iCycler iQ Real-time PCR Detection System (Bio-Rad Laboratories, USA.  Data were analyzed using the comparative cycle threshold method.  The results demonstrated a clear-cut identification of all transgenic fish (n=20 classified as a homozygous or heterozygous.  Mating of those fish with wild-type had revealed transgene transmission to the offspring following expected Mendelian laws. Thus, we found that the qTR-PCR to be effective for a rapid and precise determination of zygosity in transgenic fish. This technique could be useful in the establishment of breeding programs for mass transgenic fish production and in experiments in which zygosity effect could have a functional impact. Keywords: quantitative real-time PCR; zygosity; transgenic fish; mass production   ABSTRAK Identifikasi sigositas ikan transgenik biasanya dilakukan menggunakan analisa PCR dengan cetakan DNA genomik yang diekstraksi dari jaringan ikan hasil persilangan antara ikan transgenik dan ikan normal.   Metode ini memerlukan ikan dalam jumlah yang banyak, dan juga waktu serta tenaga.  Pendekatan baru untuk mengatasi masalah tersebut akan memberikan manfaat besar kepada peneliti bioteknologi perikanan.  Pada penelitian ini, kami menggunakan metode PCR real-time kuantitatif (krt-PCR untuk

  17. Case Study: Polycystic Livers in a Transgenic Mouse Line

    Energy Technology Data Exchange (ETDEWEB)

    Lovaglio, Jamie A.; Artwohl, James E.; Ward, Christopher J.; Diekwisch, Thomas G. H.; Ito, Yoshihiro; Fortman, Jeffrey D.

    2014-04-01

    Three mice (2 male, 1 female; age, 5 to 16 mo) from a mouse line transgenic for keratin 14 (K14)-driven LacZ expression and on an outbred Crl:CD1(ICR) background, were identified as having distended abdomens and livers that were diffusely enlarged by numerous cysts (diameter, 0.1 to 2.0 cm). Histopathology revealed hepatic cysts lined by biliary type epithelium and mild chronic inflammation, and confirmed the absence of parasites. Among 21 related mice, 5 additional affected mice were identified via laparotomy. Breeding of these 5 mice (after 5 mo of age) did not result in any offspring; the K14 mice with olycystic livers failed to reproduce. Affected male mice had degenerative testicular lesions, and their sperm was immotile. Nonpolycystic K14 control male mice bred well, had no testicular lesions, and had appropriate sperm motility. Genetic analysis did not identify an association of this phenotype with the transgene or insertion site.

  18. PP005. Vitamin D depletion aggravates hypertension in transgenic rats

    DEFF Research Database (Denmark)

    Bjørkholt Andersen, Louise; Herse, Florian; Christesen, Henrik Thybo

    2013-01-01

    INTRODUCTION: Vitamin D may ameliorate hypertension and kidney disease through genomic and extra-genomic pathways. OBJECTIVE: To investigate the impact of vitamin D in a transgenic rat model of angiotensin II-mediated hypertensive organ failure. METHODS: In 4-week-old age-matched rats overexpress......INTRODUCTION: Vitamin D may ameliorate hypertension and kidney disease through genomic and extra-genomic pathways. OBJECTIVE: To investigate the impact of vitamin D in a transgenic rat model of angiotensin II-mediated hypertensive organ failure. METHODS: In 4-week-old age-matched rats...... determined once weekly. After three weeks, animals were sacrificed. Heart tissue was examined for atrial natriuretic peptide (ANP) and brain natriuretic peptide (BNP) by RT-PCR. RESULTS: The vitamin D depleted group had higher blood pressure at week 1 (mean difference 23.4mmHg, 95% CI 9.1-37.7) and tended...

  19. Some characteristics of neoplastic cell transformation in transgenic mice.

    Science.gov (United States)

    Shvemberger, I N; Ermilov, A N

    1996-01-01

    The role of the expression of different cellular genes and viral oncogenes in malignant cell transformation is disc