Immunohistochemical study of p53 overexpression in radiation-induced colon cancers
International Nuclear Information System (INIS)
Minami, Kazunori; Hayashi, Nobuyuki; Mokarim, A.; Matsuzaki, Sumihiro; Ito, Masahiro; Sekine, Ichiro.
1998-01-01
The expressions of p53 and proliferating cell nuclear antigen (PCNA) were studied immunohistochemically from paraffin sections of 7 cases (9 lesions) of radiation-induced colon cancer and 42 cases of spontaneous colon cancer. Age distribution of radiation-induced and spontaneous colon cancer were 68.1 years (range, 56 to 77 years) and 67.4 years (range, 31 to 85 years), respectively. Among the radiation-induced colon cancers, there were 3 lesions of mucinous carcinoma (33%), a much higher than found for spontaneous mucinous cancer. Immunohistochemically, p53 protein expression was detected in 7/9 (78%) of radiation-induced cancers and in 23/42 (55%) of spontaneous colon cancers. χ 2 analysis found no significant differences between radiation-induced and spontaneous colon cancers in age distribution or p53-positive staining for frequency, histopathology, or Dukes'' classification. In radiation colitis around the cancers including aberrant crypts, spotted p53 staining and abnormal and scattered PCNA-positive staining were observed. In histologically normal cells, p53 staining was almost absent and PCNA-positive staining was regularly observed in the lower half of the crypt. In radiation colitis including aberrant glands, cellular proliferation increased and spotted p53 expression was observed. This study suggests that radiation colitis and aberrant glands might possess malignant potential and deeply associate with carcinogenesis of radiation-induced colon cancer. (author)
Thymocyte apoptosis induced by p53-dependent and independent pathways
International Nuclear Information System (INIS)
Clarke, A.R.; Purdie, C.A.; Harrison, D.J.; Morris, R.G.; Bird, C.C.; Hooper, M.L.; Wyllie, A.H.
1993-01-01
The authors studied the dependence of apoptosis on p53 expression in cells from the thymus cortex. Short-term thymocyte cultures were prepared from mice constitutively heterozygous or homozygous for a deletion in the p53 gene introduced into the germ line after gene targeting. Wild-type thymocytes readily undergo apoptosis after treatment with ionizing radiation, the glucocorticoid methylprednisolone, or etoposide (an inhibitor of topoisomerase II), or after Ca 2+ -dependent activation by phorbol ester and a calcium ionophore. In contrast, homozygous null p53 thymocytes are resistant to induction of apoptosis by radiation or etoposide, but retain normal sensitivity to glucocorticoid and calcium. The time-dependent apoptosis that occurs in untreated cultures is unaffected by p53 status. Cells heterozygous for p53 deletion are partially resistant to radiation and etoposide. Results show that p53 exerts a significant and dose-dependent effect in the initiation of apoptosis, but only when it is induced by agents that cause DNA-strand breakage. (Author)
Energy Technology Data Exchange (ETDEWEB)
Nakagawa, Yosuke [Department of Oral and Maxillofacial Surgery, School of Medicine, Nara Medical University, 840 Shijo-cho, Kashihara, Nara 634-8521 (Japan); Takahashi, Akihisa [Advanced Scientific Research Leader Development Unit, Gunma University, 3-39-22 Showa-machi, Maebashi, Gunma 371-8511 (Japan); Kajihara, Atsuhisa; Yamakawa, Nobuhiro; Imai, Yuichiro [Department of Oral and Maxillofacial Surgery, School of Medicine, Nara Medical University, 840 Shijo-cho, Kashihara, Nara 634-8521 (Japan); Ota, Ichiro; Okamoto, Noritomo [Department of Otorhinolaryngology, School of Medicine, Nara Medical University, 840 Shijo-cho, Kashihara, Nara 634-8521 (Japan); Mori, Eiichiro [Department of Radiation Oncology, School of Medicine, Nara Medical University, 840 Shijo-cho, Kashihara, Nara 634-8521 (Japan); Noda, Taichi [Department of Dermatology, School of Medicine, Nara Medical University, 840 Shijo-cho, Kashihara, Nara 634-8521 (Japan); Furusawa, Yoshiya [Heavy-ion Radiobiology Research Group, Research Center for Charged Particle Therapy, National Institute of Radiological Sciences, 4-9-1 Anagawa, Inage-ku, Chiba 263-8555 (Japan); Kirita, Tadaaki [Department of Oral and Maxillofacial Surgery, School of Medicine, Nara Medical University, 840 Shijo-cho, Kashihara, Nara 634-8521 (Japan); Ohnishi, Takeo, E-mail: tohnishi@naramed-u.ac.jp [Department of Radiation Oncology, School of Medicine, Nara Medical University, 840 Shijo-cho, Kashihara, Nara 634-8521 (Japan)
2012-07-13
Highlights: Black-Right-Pointing-Pointer High-LET radiation induces efficiently apoptosis regardless of p53 gene status. Black-Right-Pointing-Pointer We examined whether high-LET radiation depresses the Akt-survival signals. Black-Right-Pointing-Pointer High-LET radiation depresses of survival signals even in the mp53 cancer cells. Black-Right-Pointing-Pointer High-LET radiation activates Caspase-9 through depression of survival signals. Black-Right-Pointing-Pointer High-LET radiation suppresses cell growth through depression of survival signals. -- Abstract: Although mutations and deletions in the p53 tumor suppressor gene lead to resistance to low linear energy transfer (LET) radiation, high-LET radiation efficiently induces cell lethality and apoptosis regardless of the p53 gene status in cancer cells. Recently, it has been suggested that the induction of p53-independent apoptosis takes place through the activation of Caspase-9 which results in the cleavage of Caspase-3 and poly (ADP-ribose) polymerase (PARP). This study was designed to examine if high-LET radiation depresses serine/threonine protein kinase B (PKB, also known as Akt) and Akt-related proteins. Human gingival cancer cells (Ca9-22 cells) harboring a mutated p53 (mp53) gene were irradiated with 2 Gy of X-rays or Fe-ion beams. The cellular contents of Akt-related proteins participating in cell survival signaling were analyzed with Western Blotting 1, 2, 3 and 6 h after irradiation. Cell cycle distributions after irradiation were assayed with flow cytometric analysis. Akt-related protein levels decreased when cells were irradiated with high-LET radiation. High-LET radiation increased G{sub 2}/M phase arrests and suppressed the progression of the cell cycle much more efficiently when compared to low-LET radiation. These results suggest that high-LET radiation enhances apoptosis through the activation of Caspase-3 and Caspase-9, and suppresses cell growth by suppressing Akt-related signaling, even in mp
Surget, Sylvanie; Descamps, Géraldine; Brosseau, Carole; Normant, Vincent; Maïga, Sophie; Gomez-Bougie, Patricia; Gouy-Colin, Nadège; Godon, Catherine; Béné, Marie C; Moreau, Philippe; Le Gouill, Steven; Amiot, Martine; Pellat-Deceunynck, Catherine
2014-06-14
The aim of this study was to evaluate the efficacy of the p53-reactivating drugs RITA and nutlin3a in killing myeloma cells. A large cohort of myeloma cell lines (n = 32) and primary cells (n = 21) was used for this study. This cohort contained cell lines with various TP53 statuses and primary cells with various incidences of deletion of chromosome 17. Apoptosis was evaluated using flow cytometry with Apo2.7 staining of the cell lines or via the loss of the myeloma-specific marker CD138 in primary cells. Apoptosis was further confirmed by the appearance of a subG1 peak and the activation of caspases 3 and 9. Activation of the p53 pathway was monitored using immunoblotting via the expression of the p53 target genes p21, Noxa, Bax and DR5. The involvement of p53 was further studied in 4 different p53-silenced cell lines. Both drugs induced the apoptosis of myeloma cells. The apoptosis that was induced by RITA was not related to the TP53 status of the cell lines or the del17p status of the primary samples (p = 0.52 and p = 0.80, respectively), and RITA did not commonly increase the expression level of p53 or p53 targets (Noxa, p21, Bax or DR5) in sensitive cells. Moreover, silencing of p53 in two TP53(mutated) cell lines failed to inhibit apoptosis that was induced by RITA, which confirmed that RITA-induced apoptosis in myeloma cells was p53 independent. In contrast, apoptosis induced by nutlin3a was directly linked to the TP53 status of the cell lines and primary samples (p RITA, in contrast to nutlin3a, effectively induced apoptosis in a subset of MM cells independently of p53. The findings and could be of interest for patients with a 17p deletion, who are resistant to current therapies.
Chk2 regulates transcription-independent p53-mediated apoptosis in response to DNA damage
International Nuclear Information System (INIS)
Chen Chen; Shimizu, Shigeomi; Tsujimoto, Yoshihide; Motoyama, Noboru
2005-01-01
The tumor suppressor protein p53 plays a central role in the induction of apoptosis in response to genotoxic stress. The protein kinase Chk2 is an important regulator of p53 function in mammalian cells exposed to ionizing radiation (IR). Cells derived from Chk2-deficient mice are resistant to the induction of apoptosis by IR, and this resistance has been thought to be a result of the defective transcriptional activation of p53 target genes. It was recently shown, however, that p53 itself and histone H1.2 translocate to mitochondria and thereby induces apoptosis in a transcription-independent manner in response to IR. We have now examined whether Chk2 also regulates the transcription-independent induction of apoptosis by p53 and histone H1.2. The reduced ability of IR to induce p53 stabilization in Chk2-deficient thymocytes was associated with a marked impairment of p53 and histone H1 translocation to mitochondria. These results suggest that Chk2 regulates the transcription-independent mechanism of p53-mediated apoptosis by inducing stabilization of p53 in response to IR
Directory of Open Access Journals (Sweden)
Yunguang Sun
Full Text Available Understanding the mutations that confer radiation resistance is crucial to developing mechanisms to subvert this resistance. Here we describe the creation of a radiation resistant cell line and characterization of a novel p53 mutation. Treatment with 20 Gy radiation was used to induce mutations in the H460 lung cancer cell line; radiation resistance was confirmed by clonogenic assay. Limited sequencing was performed on the resistant cells created and compared to the parent cell line, leading to the identification of a novel mutation (del at the end of the DNA binding domain of p53. Levels of p53, phospho-p53, p21, total caspase 3 and cleaved caspase 3 in radiation resistant cells and the radiation susceptible (parent line were compared, all of which were found to be similar. These patterns held true after analysis of p53 overexpression in H460 cells; however, H1299 cells transfected with mutant p53 did not express p21, whereas those given WT p53 produced a significant amount, as expected. A luciferase assay demonstrated the inability of mutant p53 to bind its consensus elements. An MTS assay using H460 and H1299 cells transfected with WT or mutant p53 showed that the novel mutation did not improve cell survival. In summary, functional characterization of a radiation-induced p53 mutation in the H460 lung cancer cell line does not implicate it in the development of radiation resistance.
Infrequent alterations of the P53 gene in rat skin cancers induced by ionising-radiation
International Nuclear Information System (INIS)
Jin, Y.; Burns, F.J.; Garte, S.J.; Hosselet, S.; New York Univ., NY
1996-01-01
Radiation carcinogenesis almost certainly involves multiple genetic alterations. Identification of such genetic alterations would provide information to help understand better the molecular mechanism or radiation carcinogenesis. The energy released by ionizing radiation has the potential to produce DNA strand breaks, major gene deletions or rearrangements, and other base damages. Alterations of the p53 gene, a common tumour suppressor gene altered in human cancers, were examined in radiation-induced rat skin cancers. Genomic DNA from a total of 33rat skin cancers induced by ionizing radiation was examined by Southern blot hybridization for abnormal restriction fragment patterns in the p53 gene. A abnormal p53 restriction pattern was found in one of 16 cancers induced by electron radiation and in one of nine cancers induced by neon ions. The genomic DNA from representative cancers, including the two with an abnormal restriction pattern was further examined by polymerase chain reaction amplification and direct sequencing in exons 5-8 of the p53 gene. The results showed that one restriction fragment length polymorphism (RFLP)-positive cancer induced by electron radiation had a partial gene deletion which was defined approximately between exons 2-8, while none of the other cancers showed sequence changes. Our results indicate that the alterations in the critical binding region of the p53 gene are infrequent in rat skin cancers induced by either electron or neon ion radiation. (Author)
Weilbacher, A; Gutekunst, M; Oren, M; Aulitzky, W E; van der Kuip, H
2014-07-10
Significant advances have been made in the development of small molecules blocking the p53/MDM2 interaction. The Mdm2 inhibitor Nutlin-3 is restricted to tumors carrying wtp53. In contrast, RITA, a compound that binds p53, has recently been shown also to restore transcriptional functions of mtp53. As more than 50% of solid tumors carry p53 mutations, RITA promises to be a more effective therapeutic strategy than Nutlin-3. We investigated effects of RITA on apoptosis, cell cycle and induction of 45 p53 target genes in a panel of 14 cell lines from different tumor entities with different p53 status as well as primary lymphocytes and fibroblasts. Nine cell strains expressed wtp53, four harbored mtp53, and three were characterized by the loss of p53 protein. A significant induction of cell death upon RITA was observed in 7 of 16 cell lines. The nonmalignant cells in our panel were substantially less sensitive. We found that in contrast to Nultin-3, RITA is capable to induce cell death not only in tumor cells harboring wtp53 and mtp53 but also in p53-null cells. Importantly, whereas p53 has a central role for RITA-mediated effects in wtp53 cells, neither p53 nor p63 or p73 were essential for the RITA response in mtp53 or p53-null cells in our panel demonstrating that besides the known p53-dependent action of RITA in wtp53 cells, RITA can induce cell death also independently of p53 in cells harboring defective p53. We identified an important role of both p38 and JNK/SAPK for sensitivity to RITA in these cells leading to a typical caspase- and BAX/BAK-dependent mitochondrial apoptosis. In conclusion, our data demonstrate that RITA can induce apoptosis through p38 and JNK/SAPK not only in tumor cells harboring wtp53 and mtp53 but also in p53-null cells, making RITA an interesting tumor-selective drug.
Energy Technology Data Exchange (ETDEWEB)
Wan, Chunhua [Department of Nutrition and Food Hygiene, School of Public Health, Nantong University, Nantong 226019 Jiangsu (China); Jiangsu Province Key Laboratory for Inflammation and Molecular Drug Target, Nantong University, Nantong 226019 Jiangsu (China); Ma, Xa; Shi, Shangshi [Department of Occupational Medicine and Environmental Toxicology, School of Public Health, Nantong University, Nantong 226019 Jiangsu (China); Zhao, Jianya; Nie, Xiaoke [Department of Nutrition and Food Hygiene, School of Public Health, Nantong University, Nantong 226019 Jiangsu (China); Han, Jingling; Xiao, Jing; Wang, Xiaoke [Department of Occupational Medicine and Environmental Toxicology, School of Public Health, Nantong University, Nantong 226019 Jiangsu (China); Jiang, Shengyang [Department of Nutrition and Food Hygiene, School of Public Health, Nantong University, Nantong 226019 Jiangsu (China); Jiangsu Province Key Laboratory for Inflammation and Molecular Drug Target, Nantong University, Nantong 226019 Jiangsu (China); Jiang, Junkang, E-mail: Jiang_junkang@163.com [Department of Occupational Medicine and Environmental Toxicology, School of Public Health, Nantong University, Nantong 226019 Jiangsu (China); Jiangsu Province Key Laboratory for Inflammation and Molecular Drug Target, Nantong University, Nantong 226019 Jiangsu (China)
2014-12-15
Chronic exposure to excessive manganese (Mn) has been known to lead to neuronal loss and a clinical syndrome resembling idiopathic Parkinson's disease (IPD). p53 plays an integral role in the development of various human diseases, including neurodegenerative disorders. However, the role of p53 in Mn-induced neuronal apoptosis and neurological deficits remains obscure. In the present study, we showed that p53 was critically involved in Mn-induced neuronal apoptosis in rat striatum through both transcription-dependent and -independent mechanisms. Western blot and immunohistochemistrical analyses revealed that p53 was remarkably upregulated in the striatum of rats following Mn exposure. Coincidentally, increased level of cleaved PARP, a hallmark of apoptosis, was observed. Furthermore, using nerve growth factor (NGF)-differentiated PC12 cells as a neuronal cell model, we showed that Mn exposure decreased cell viability and induced apparent apoptosis. Importantly, p53 was progressively upregulated, and accumulated in both the nucleus and the cytoplasm. The cytoplasmic p53 had a remarkable distribution in mitochondria, suggesting an involvement of p53 mitochondrial translocation in Mn-induced neuronal apoptosis. In addition, Mn-induced impairment of mitochondrial membrane potential (ΔΨm) could be partially rescued by pretreatment with inhibitors of p53 transcriptional activity and p53 mitochondrial translocation, Pifithrin-α (PFT-α) and Pifithrin-μ (PFT-μ), respectively. Moreover, blockage of p53 activities with PFT-α and PFT-μ significantly attenuated Mn-induced reactive oxidative stress (ROS) generation and mitochondrial H{sub 2}O{sub 2} production. Finally, we observed that pretreatment with PFT-α and PFT-μ ameliorated Mn-induced apoptosis in PC12 cells. Collectively, these findings implicate that p53 transcription-dependent and -independent pathways may play crucial roles in the regulation of Mn-induced neuronal death. - Highlights: • p53 is
International Nuclear Information System (INIS)
Wan, Chunhua; Ma, Xa; Shi, Shangshi; Zhao, Jianya; Nie, Xiaoke; Han, Jingling; Xiao, Jing; Wang, Xiaoke; Jiang, Shengyang; Jiang, Junkang
2014-01-01
Chronic exposure to excessive manganese (Mn) has been known to lead to neuronal loss and a clinical syndrome resembling idiopathic Parkinson's disease (IPD). p53 plays an integral role in the development of various human diseases, including neurodegenerative disorders. However, the role of p53 in Mn-induced neuronal apoptosis and neurological deficits remains obscure. In the present study, we showed that p53 was critically involved in Mn-induced neuronal apoptosis in rat striatum through both transcription-dependent and -independent mechanisms. Western blot and immunohistochemistrical analyses revealed that p53 was remarkably upregulated in the striatum of rats following Mn exposure. Coincidentally, increased level of cleaved PARP, a hallmark of apoptosis, was observed. Furthermore, using nerve growth factor (NGF)-differentiated PC12 cells as a neuronal cell model, we showed that Mn exposure decreased cell viability and induced apparent apoptosis. Importantly, p53 was progressively upregulated, and accumulated in both the nucleus and the cytoplasm. The cytoplasmic p53 had a remarkable distribution in mitochondria, suggesting an involvement of p53 mitochondrial translocation in Mn-induced neuronal apoptosis. In addition, Mn-induced impairment of mitochondrial membrane potential (ΔΨm) could be partially rescued by pretreatment with inhibitors of p53 transcriptional activity and p53 mitochondrial translocation, Pifithrin-α (PFT-α) and Pifithrin-μ (PFT-μ), respectively. Moreover, blockage of p53 activities with PFT-α and PFT-μ significantly attenuated Mn-induced reactive oxidative stress (ROS) generation and mitochondrial H 2 O 2 production. Finally, we observed that pretreatment with PFT-α and PFT-μ ameliorated Mn-induced apoptosis in PC12 cells. Collectively, these findings implicate that p53 transcription-dependent and -independent pathways may play crucial roles in the regulation of Mn-induced neuronal death. - Highlights: • p53 is robustly
P53 Gene Mutation as Biomarker of Radiation Induced Cell Injury and Genomic Instability
International Nuclear Information System (INIS)
Mukh-Syaifudin
2006-01-01
Gene expression profiling and its mutation has become one of the most widely used approaches to identify genes and their functions in the context of identify and categorize genes to be used as radiation effect markers including cell and tissue sensitivities. Ionizing radiation produces genetic damage and changes in gene expression that may lead to cancer due to specific protein that controlling cell proliferation altered the function, its expression or both. P53 protein encoded by p53 gene plays an important role in protecting cell by inducing growth arrest and or cell suicide (apoptosis) after deoxyribonucleic acid (DNA) damage induced by mutagen such as ionizing radiation. The mutant and thereby dysfunctional of this gene was found in more than 50% of various human cancers, but it is as yet unclear how p53 mutations lead to neoplastic development. Wild-type p53 has been postulated to play a role in DNA repair, suggesting that expression of mutant forms of p53 might alter cellular resistance to the DNA damage caused by radiation. Moreover, p53 is thought to function as a cell cycle checkpoint after irradiation, also suggesting that mutant p53 might change the cellular proliferative response to radiation. P53 mutations affect the cellular response to DNA damage, either by increasing DNA repair processes or, possibly, by increasing cellular tolerance to DNA damage. The association of p53 mutations with increased radioresistance suggests that alterations in the p53 gene might lead to oncogenic transformation. Current attractive model of carcinogenesis also showed that p53 gene is the major target of radiation. The majority of p53 mutations found so far is single base pair changes ( point mutations), which result in amino acid substitutions or truncated forms of the p53 protein, and are widely distributed throughout the evolutionary conserved regions of the gene. Examination of p53 mutations in human cancer also shows an association between particular carcinogens and
Understanding the role of p53 in adaptive response to radiation-induced germline mutations
International Nuclear Information System (INIS)
Langlois, N.L.; Quinn, J.S.; Somers, C.M.; Boreham, D.R.; Mitchel, R.E.J.
2003-01-01
Full text: Radiation-induced adaptive response is now a widely studied area of radiation biology. Studies have demonstrated reduced levels of radiation-induced biological damage when an 'adaptive dose' is given before a higher 'challenge dose' compared to when the challenge dose is given alone. It has been shown in some systems to be a result of inducible cellular repair systems. The adaptive response has been clearly demonstrated in many model systems, however its impact on heritable effects in the mammalian germline has never been studied. Expanded Simple Tandem Repeat (ESTR) loci have been used as markers demonstrating that induced heritable mutations in mice follow a dose-response relationship. Recent data in our laboratory show preliminary evidence of radiation-induced adaptive response suppressing germline mutations at ESTR loci in wild type mice. The frequency of heritable mutations was significantly reduced when a priming dose of 0.1 Gy was given 24 hours prior to a 1 Gy acute challenging dose. We are now conducting a follow-up study to attempt to understand the mechanism of this adaptive response. P53 is known to play a significant role in governing apoptosis, DNA repair and cancer induction. In order to determine what function p53 has in the adaptive response for heritable mutations, we have mated radiation treated Trp53+/- male mice (C57Bl) to untreated, normal females (C57Bl). Using DNA fingerprinting, we are investigating the rate of inherited radiation-induced mutations on pre- and post-meiotic radiation-treated gametocytes by examining mutation frequencies in offspring DNA. If p53 is integral in the mechanism of adaptive response, we should not see an adaptive response in radiation-induced heritable mutations in these mice. This research is significant in that it will provide insight to understanding the mechanism behind radiation-induced adaptive response in the mammalian germline
Overexpression of p53, MDM2 proteins in some atr radiation-induced skin ulcers
International Nuclear Information System (INIS)
Gu Qingyang; Gao Yabing; Wang Dewen; Cui Yufang; Zhao Po; Yang Zhixiang; Zhou Jie
2000-01-01
An animal model of radiation-induced skin ulcer was set up with 140 rats, which were locally irradiated with 35-55 Gy γ-rays. The pathological changes were observed for 1 year. Immunohistochemical studies were performed in 72 rat radiation skin ulcer specimens using anti-p53 and anti-MDM2 proteins polyclonal antibodies. The results showed that the positive rate for overexpression of p53 protein was 9.7%, and for that of MDM2 was 19.4%. The overexpression of p53 was mainly seen in the nuclei of activated squamous epithelial cells, and in fibroblasts, endotheliocytes in deeper part of the skin ulcers. The overexpression of MDM2 had the same localizations. It is suggested that the changes of p53 and MDM2, genes and proteins, may be related to the cancer transformation and poor healing of radiation-induced skin ulcers
International Nuclear Information System (INIS)
Hayashi, Yoko; Kondo, Takashi; Zhao Qingli; Ogawa Ryohei; Cui Zhengguo; Feril, Loreto B.; Teranishi, Hidetoyo; Kasuya, Minoru
2004-01-01
It has been reported that the hexavalent chromium compound (Cr(VI)) can induce both p53-dependent and p53-independent apoptosis. While a considerable amount of information is available on the p53-dependent pathway, only little is known about the p53-independent pathway. To elucidate the p53-independent mechanism, the roles of the Ca 2+ -calpain- and mitochondria-caspase-dependent pathways in apoptosis induced by Cr(VI) were investigated. When human lymphoma U937 cells, p53 mutated cells, were treated with 20 μM Cr(VI) for 24 h, nuclear morphological changes and DNA fragmentation were observed. Production of hydroxyl radicals revealed by electron paramagnetic resonance (EPR)-spin trapping, and increase of intracellular calcium ion concentration monitored by digital imaging were also observed in Cr(VI)-treated cells. An intracellular Ca 2+ chelator, BAPTA-AM, and calpain inhibitors suppressed the Cr(VI)-induced DNA fragmentation. The number of cells showing low mitochondrial membrane potential (MMP), high level of superoxide anion radicals (O 2 - ), and high activity of caspase-3, which are indicators of mitochondria-caspase-dependent pathway, increased significantly in Cr(VI)-treated cells. An antioxidant, N-acetyl-L-cysteine (NAC), decreased DNA fragmentation and inhibited the changes in MMP, O 2 - formation, and activation of caspase-3 induced by Cr(VI). No increase of the expressions of Fas and phosphorylated JNK was observed after Cr(VI) treatment. Cell cycle analysis revealed that the fraction of G2/M phase tended to increase after 24 h of treatment, suggesting that Cr(VI)-induced apoptosis is related to the G2 block. These results indicate that Ca 2+ -calpain- and mitochondria-caspase-dependent pathways play significant roles in the Cr(VI)-induced apoptosis via the G2 block, which are independent of JNK and Fas activation. The inhibition of apoptosis and all its signal transductions by NAC suggests that intracellular reactive oxygen species (ROS) are
International Nuclear Information System (INIS)
Fischer, Barbara
2004-01-01
The general objective of this thesis was to identify the cellular mechanisms that govern the induction of apoptosis by ionizing radiations with high linear energy transfer (LET), particularly fast neutrons and carbon ions. It was also attempted to determine the role in these mechanisms of the p53 tumor suppressor protein. For this, lymphoblastoid lines differing by their p53 status have been used: TK6 (p53 + / +), WTK1 (p53 mute) and NH32 (p53 - / -). At first, the study concerned the induction of apoptosis by fast neutrons, and the effects of these radiations have been compared with those of X-rays on cell lines. Results show that for the same irradiation dose, fast neutrons are more efficient than X-rays in terms of inducing apoptosis. This induction of apoptosis also varies according to the p53 status of the cells. These data suggest that fast neutrons activate apoptosis in two distinct ways: a p53-dependent pathway that occurs in the first hours after irradiation, and an independent pathway of p53, which is slower, but also involves caspases. The author then tried to characterize the two active apoptotic signaling pathways in lymphoblastoid lines by fast neutrons, in order to identify the different mechanisms involved in triggering the apoptotic process as a function of p53. Results show that the p53 status not only affects the kinetics of induction of apoptosis but also the nature of active caspases. The p53-dependent apoptosis is associated with the activation of caspases-3, 7, 8 and 9, the cleavage of BID by caspase-8, the fall of Δψm and the release of cytochrome c from mitochondria to cytoplasm. On the other hand, caspase-7 seems to be activated by an independent p53 signaling pathway. In the following experiments, the mechanisms leading to the initiation of apoptotic pathways induced by fast neutrons were explored, and more particularly the activation of caspase-8 in p53-dependent apoptosis. The involvement of the Fas necrosis receptor in the activation
International Nuclear Information System (INIS)
Didelot, C.; Mirjolet, J.F.; Barberi-Heyob, M.; Ramacci, C.; Merlin, J.L.
2002-01-01
The effect of chemoresistance induction in radio sensitivity and cellular behavior after irradiation remains misunderstood. This study was designed to understand the relationship between radiation-induced cell cycle arrest, apoptosis, and radiosensitivity in KB cell line and KB3 subline selected after 5-fluorouracil (5FU) exposure. Exposure of KB cells to 5FU led to an increase in radiosensitivity. G 2 /M cell cycle arrest was observed in the two cell lines after irradiation. The radioresistant KB cell line reached the maximum arrest two hours before KB3. The cellular exit from this arrest was found to be related to the wild type p53 protein expression induction. After irradiation, only KB3 cell line underwent apoptosis. This apoptosis induction seemed to be independent of G 2 /M arrest exit, which was carried out later. The difference in radiosensitivity between KB and KB3 subline may result therefore from both a difference in apoptosis induction and a difference in G 2 /M arrest maximum duration. Moreover, 5FU exposure has led to an increase in constitutive p53 protein expression, which may be associated with an increase in basal apoptosis cell fraction. Given the existing correlation between radiosensitivity and the percentage of basal apoptosis. the constitutive p53 protein expression may be related to intrinsic radiosensitivity in our cellular model. (author)
International Nuclear Information System (INIS)
Wang, Bing; Ohyama, Harumi; Nose, Masako; Yukawa, Osami; Yamada, Takeshi; Hayata, Isamu
2003-01-01
In the past 5 years, a series of study was done at our institute to investigate radiation effects on the embryogenesis in mice with an emphasis on mechanisms involved in the radiation-induced adaptive response and the role of radiation-induced apoptosis played in teratogenesis in the late period of organogenesis. Using the limb bud system, we first found that radiation-induced apoptosis is involved in malformations, namely, radiation-induced apoptosis in the predigital regions of embryonic limb buds is responsible for digital defects in ICR mice. Examination of embryonic C57BL/6J mice with different p53 status led to further finding that susceptibility to the radiation-induced apoptosis and digital defects depends on both the p53 status and the radiation dose. p53 wild-type mice appeared to be the most sensitive, while p53 knockout mice were the most resistant. These results indicate that p53-dependent apoptosis mediates radiation-induced digital defects. The existence of a radioadaptive response in fetuses, i.e., the priming dose significantly decreases the apoptosis induction, prenatal death, and digital defects in the living fetuses induced by the challenging dose, was found first in ICR strain mice and later confirmed again in C57BL/6J mice. p53 heterozygous embryos did not show the radioadaptive response, indicating the involvement of p53 in the radioadaptive response. (author)
UVC-induced apoptosis in Dubca cells is independent of JNK activation and p53Ser-15 phosphorylation
International Nuclear Information System (INIS)
Chathoth, Shahanas; Thayyullathil, Faisal; Hago, Abdulkader; Shahin, Allen; Patel, Mahendra; Galadari, Sehamuddin
2009-01-01
Ultraviolet C (UVC) irradiation in mammalian cell lines activates a complex signaling network that leads to apoptosis. By using Dubca cells as a model system, we report the presence of a UVC-induced apoptotic pathway that is independent of c-Jun N-terminal kinases (JNKs) activation and p53 phosphorylation at Ser 15 . Irradiation of Dubca cells with UVC results in a rapid JNK activation and phosphorylation of its downstream target c-Jun, as well as, phosphorylation of activating transcription factor 2 (ATF2). Pre-treatment with JNK inhibitor, SP600125, inhibited UVC-induced c-Jun phosphorylation without preventing UVC-induced apoptosis. Similarly, inhibition of UVC-induced p53 phosphorylation did not prevent Dubca cell apoptosis, suggesting that p53 Ser-15 phosphorylation is not associated with UVC-induced apoptosis signaling. The pan-caspase inhibitor z-VAD-fmk inhibited UVC-induced PARP cleavage, DNA fragmentation, and ultimately apoptosis of Dubca cells. Altogether, our study clearly indicates that UVC-induced apoptosis is independent of JNK and p53 activation in Dubca cells, rather, it is mediated through a caspase dependent pathway. Our findings are not in line with the ascribed critical role for JNKs activation, and downstream phosphorylation of targets such as c-Jun and ATF2 in UVC-induced apoptosis.
International Nuclear Information System (INIS)
Widel, Maria; Lalik, Anna; Krzywon, Aleksandra; Poleszczuk, Jan; Fujarewicz, Krzysztof; Rzeszowska-Wolny, Joanna
2015-01-01
Highlights: • We tested radiation response and bystander effect on HCT116p53+/+ and p53−/− cells. • The p53+/+ cells developed premature senescence in exposed and bystander neighbors. • Directly exposed and bystander p53−/− cells died profoundly through apoptosis. • Interleukins 6 and 8 were differently generated by both cell lines. • NFκB path was activated mainly in p53+/+ hit cells, in p53 −/− in bystanders only. - Abstract: Radiation-induced bystander effect, appearing as different biological changes in cells that are not directly exposed to ionizing radiation but are under the influence of molecular signals secreted by irradiated neighbors, have recently attracted considerable interest due to their possible implication for radiotherapy. However, various cells present diverse radiosensitivity and bystander responses that depend, inter alia, on genetic status including TP53, the gene controlling the cell cycle, DNA repair and apoptosis. Here we compared the ionizing radiation and bystander responses of human colorectal carcinoma HCT116 cells with wild type or knockout TP53 using a transwell co-culture system. The viability of exposed to X-rays (0–8 Gy) and bystander cells of both lines showed a roughly comparable decline with increasing dose. The frequency of micronuclei was also comparable at lower doses but at higher increased considerably, especially in bystander TP53-/- cells. Moreover, the TP53-/- cells showed a significantly elevated frequency of apoptosis, while TP53+/+ counterparts expressed high level of senescence. The cross-matched experiments where irradiated cells of one line were co-cultured with non-irradiated cells of opposite line show that both cell lines were also able to induce bystander effects in their counterparts, however different endpoints revealed with different strength. Potential mediators of bystander effects, IL-6 and IL-8, were also generated differently in both lines. The knockout cells secreted IL-6 at
Energy Technology Data Exchange (ETDEWEB)
Widel, Maria, E-mail: maria.widel@polsl.pl [Biosystems Group, Institute of Automatic Control, Silesian University of Technology, 16 Akademicka Street, 44-100 Gliwice (Poland); Lalik, Anna; Krzywon, Aleksandra [Biosystems Group, Institute of Automatic Control, Silesian University of Technology, 16 Akademicka Street, 44-100 Gliwice (Poland); Poleszczuk, Jan [College of Inter-faculty Individual Studies in Mathematics and Natural Sciences, University of Warsaw, 93 Zwirki i Wigury Street, 02-089 Warsaw (Poland); Department of Integrated Mathematical Oncology, H. Lee Moffitt Cancer Center & Research Institute, Tampa, Florida (United States); Fujarewicz, Krzysztof; Rzeszowska-Wolny, Joanna [Biosystems Group, Institute of Automatic Control, Silesian University of Technology, 16 Akademicka Street, 44-100 Gliwice (Poland)
2015-08-15
Highlights: • We tested radiation response and bystander effect on HCT116p53+/+ and p53−/− cells. • The p53+/+ cells developed premature senescence in exposed and bystander neighbors. • Directly exposed and bystander p53−/− cells died profoundly through apoptosis. • Interleukins 6 and 8 were differently generated by both cell lines. • NFκB path was activated mainly in p53+/+ hit cells, in p53 −/− in bystanders only. - Abstract: Radiation-induced bystander effect, appearing as different biological changes in cells that are not directly exposed to ionizing radiation but are under the influence of molecular signals secreted by irradiated neighbors, have recently attracted considerable interest due to their possible implication for radiotherapy. However, various cells present diverse radiosensitivity and bystander responses that depend, inter alia, on genetic status including TP53, the gene controlling the cell cycle, DNA repair and apoptosis. Here we compared the ionizing radiation and bystander responses of human colorectal carcinoma HCT116 cells with wild type or knockout TP53 using a transwell co-culture system. The viability of exposed to X-rays (0–8 Gy) and bystander cells of both lines showed a roughly comparable decline with increasing dose. The frequency of micronuclei was also comparable at lower doses but at higher increased considerably, especially in bystander TP53-/- cells. Moreover, the TP53-/- cells showed a significantly elevated frequency of apoptosis, while TP53+/+ counterparts expressed high level of senescence. The cross-matched experiments where irradiated cells of one line were co-cultured with non-irradiated cells of opposite line show that both cell lines were also able to induce bystander effects in their counterparts, however different endpoints revealed with different strength. Potential mediators of bystander effects, IL-6 and IL-8, were also generated differently in both lines. The knockout cells secreted IL-6 at
p53-Dependent radiation-induced apoptosis in vivo: relationship to Bcl-2 and Bax expression
International Nuclear Information System (INIS)
Hasegawa, Masatoshi; Suzuki, Yoshiyuki; Furuta, Masaya; Yamakawa, Michitaka; Maebayashi, Katsuya; Hayakawa, Kayoko; Saito, Yoshihiro; Mitsuhashi, Norio; Niibe, Hideo
1997-01-01
Purpose: A close correlation between p53 protein expression and radiation-induced apoptosis has already been reported, however, Bcl-2 and Bax expression and the ratio of Bcl-2 to Bax have been also suggested to play an important role in the regulation of apoptotic cell death. In this study, we investigated the relationship between p53-dependent radiation-induced apoptosis and expression of Bcl-2 and Bax by using human tumors transplanted into nude mice. Materials and Methods: Three human tumors (an ependymoblastoma, a glioblastoma, and a small cell lung cancer) were subcutaneously transplanted into nude mice and irradiated with single doses of 1, 2, 5, or 10 Gy. The tumors were excised 1, 3, 6, 12, 24, and 48 hours after irradiation, fixed in 10% formalin for 24 hours, and embedded in paraffin. Slides were stained with hematoxylin and eosin for morphologic examination. Immunohistochemical studies were performed with mouse monoclonal antibodies to demonstrate p53, p21 (WAF-1), Bcl-2, and Bax expression. TdT-mediated dUTP-biotin nick-end labeling (TUNEL) and electron microscopic studies were performed to identify apoptosis, and PCR-SSCP analysis was used to evaluate p53 gene mutation. Results: All of the tumors showed only a few cells undergoing apoptosis before irradiation. Beginning several hours after irradiation, only the ependymoblastoma showed a large increase in the number of cells undergoing apoptosis, peaking at 6 hours after irradiation, and there was a clear dose-effect relationship. In contrast, the other tumors showed much less change following irradiation, and the dose-effect relationship was not as clear as in the ependymoblastoma. Immunohistochemically, the non-irradiated ependymoblastoma was negative for p53, p21, Bcl-2, and Bax. Following irradiation, however, many of the tumor cells became positive for p53 and p21, and a few cells became positive for bcl-2. In contrast, the glioblastoma and the small cell lung cancer were positive for p53 and Bcl-2
Molecular mechanism of X-ray-induced p53-dependent apoptosis
Energy Technology Data Exchange (ETDEWEB)
Nakano, Hisako [Tokyo Metropolitan Inst. of Medical Center (Japan)
1999-03-01
Radiation-induced cell death has been classified into the interphase- and mitotic-ones, both of which apoptosis involving. This review described the molecular mechanism of the apoptosis, focusing on its p53-dependent process. It is known that there are genes regulating cell death either negatively or positively and the latter is involved in apoptosis. As an important factor in the apoptosis, p53 has become remarkable since it was shown that X-ray-induced apoptosis required RNA and protein syntheses in thymocytes and those cells of p53 gene-depleted mouse were shown to be resistant to gamma-ray-induced apoptosis. Radiation sensitivity of MOLT-4 cells derived from human T cell leukemia, exhibiting the typical X-ray-induced p53-dependent apoptosis, depends on the levels of p53 mRNA and protein. p53 is a gene suppressing tumor and also a transcription factor. Consequently, mutation of p53 conceivably leads to the failure of cell cycle regulation, which allows damaged cells to divide without both repair and exclusion due to loss of the apoptotic mechanism, and finally results in carcinogenesis. The radiation effect occurs in the order of the cell damage, inhibition of p53-Mdm2 binding, accumulation of p53, activation of mdm2 transcription, Mdm2 accumulation, p53-protein degradation and recovery to the steady state level. Here, the cystein protease (caspases) plays an important role as a disposing mechanism for cells scheduled to die. However, many are unknown to be solved in future. (K.H.) 119 refs.
He, Mingyuan; Dong, Chen; Konishi, Teruaki; Tu, Wenzhi; Liu, Weili; Shiomi, Naoko; Kobayashi, Alisa; Uchihori, Yukio; Furusawa, Yoshiya; Hei, Tom K.; Dang, Bingrong; Shao, Chunlin
2014-04-01
High LET particle irradiation has several potential advantages over γ-rays such as p53-independent response. The purpose of this work is to disclose the effect of p53 on the bystander effect induced by different LET irradiations and underlying mechanism. Lymphocyte cells of TK6 (wild type p53) and HMy2.CIR (mutated p53) were exposed to either low or high LET irradiation, then their mitochondrial dysfunction and ROS generation were detected. The micronuclei (MN) induction in HL-7702 hepatocytes co-cultured with irradiated lymphocytes was also measured. It was found that the mitochondrial dysfunction, p66Shc activation, and intracellular ROS were enhanced in TK6 but not in HMy2.CIR cells after γ-ray irradiation, but all of them were increased in both cell lines after carbon and iron irradiation. Consistently, the bystander effect of MN formation in HL-7702 cells was only triggered by γ-irradiated TK6 cells but not by γ-irradiated HMy2.CIR cells. But this bystander effect was induced by both lymphocyte cell lines after heavy ion irradiation. PFT-μ, an inhibitor of p53, only partly inhibited ROS generation and bystander effect induced by 30 keV/μm carbon-irradiated TK6 cells but failed to suppress the bystander effect induced by the TK6 cells irradiated with either 70 keV/μm carbon or 180 keV/μm iron. The mitochondrial inhibitors of rotenone and oligomycin eliminated heavy ion induced ROS generation in TK6 and HMy2.CIR cells and hence diminished the bystander effect on HL-7702 cells. These results clearly demonstrate that the bystander effect is p53-dependent for low LET irradiation, but it is p53-independent for high LET irradiation which may be because of p53-independent ROS generation due to mitochondrial dysfunction.
Energy Technology Data Exchange (ETDEWEB)
Cappadone, C., E-mail: concettina.cappadone@unibo.it [Department of Pharmacy and Biotechnology, University of Bologna, Bologna (Italy); Stefanelli, C. [Department for Life Quality Studies, University of Bologna, Rimini Campus, Rimini (Italy); Malucelli, E. [Department of Pharmacy and Biotechnology, University of Bologna, Bologna (Italy); Zini, M. [Department of Biomedical and Neuromotor Sciences, University of Bologna, Bologna (Italy); Onofrillo, C. [Department of Experimental, Diagnostic and Specialty Medicine, University of Bologna, Bologna (Italy); Locatelli, A.; Rambaldi, M.; Sargenti, A. [Department of Pharmacy and Biotechnology, University of Bologna, Bologna (Italy); Merolle, L. [ELETTRA–Sincrotrone Trieste S.C.p.A., Trieste (Italy); Farruggia, G. [Department of Pharmacy and Biotechnology, University of Bologna, Bologna (Italy); National Institute of Biostructures and Biosystems, Roma (Italy); Graziadio, A. [Department of Pharmacy and Biotechnology, University of Bologna, Bologna (Italy); Montanaro, L. [Department of Experimental, Diagnostic and Specialty Medicine, University of Bologna, Bologna (Italy); Iotti, S. [Department of Pharmacy and Biotechnology, University of Bologna, Bologna (Italy); National Institute of Biostructures and Biosystems, Roma (Italy)
2015-11-13
Osteosarcoma (OS) is the most common primary malignant tumor of bone, occurring most frequently in children and adolescents. The mechanism of formation and development of OS have been studied for a long time. Tumor suppressor pathway governed by p53 gene are known to be involved in the pathogenesis of osteosarcoma. Moreover, loss of wild-type p53 activity is thought to be a major predictor of failure to respond to chemotherapy in various human cancers. In previous studies, we described the activity of a new indole derivative, NSC743420, belonging to the tubulin inhibitors family, capable to induce apoptosis and arrest of the cell cycle in the G2/M phase of various cancer cell lines. However, this molecule has never been tested on OS cell line. Here we address the activity of NSC743420 by examine whether differences in the p53 status could influence its effects on cell proliferation and death of OS cells. In particular, we compared the effect of the tested molecule on p53-wild type and p53-silenced U2OS cells, and on SaOS2 cell line, which is null for p53. Our results demonstrated that NSC743420 reduces OS cell proliferation by p53-dependent and p53-independent mechanisms. In particular, the molecule induces proliferative arrest that culminate to apoptosis in SaOS2 p53-null cells, while it brings a cytostatic and differentiating effect in U2OS cells, characterized by the cell cycle arrest in G0/G1 phase and increased alkaline phosphatase activity. - Highlights: • The indole derivative NSC743420 induces antitumor effects on osteosarcoma cells. • p53 status could drive the activity of antitumor agents on osteosarcoma cells. • NSC743420 induces cytostatic and differentiating effects on U2OS cells. • NSC743420 causes apoptosis on p53-null SaOS2 cells.
International Nuclear Information System (INIS)
Cappadone, C.; Stefanelli, C.; Malucelli, E.; Zini, M.; Onofrillo, C.; Locatelli, A.; Rambaldi, M.; Sargenti, A.; Merolle, L.; Farruggia, G.; Graziadio, A.; Montanaro, L.; Iotti, S.
2015-01-01
Osteosarcoma (OS) is the most common primary malignant tumor of bone, occurring most frequently in children and adolescents. The mechanism of formation and development of OS have been studied for a long time. Tumor suppressor pathway governed by p53 gene are known to be involved in the pathogenesis of osteosarcoma. Moreover, loss of wild-type p53 activity is thought to be a major predictor of failure to respond to chemotherapy in various human cancers. In previous studies, we described the activity of a new indole derivative, NSC743420, belonging to the tubulin inhibitors family, capable to induce apoptosis and arrest of the cell cycle in the G2/M phase of various cancer cell lines. However, this molecule has never been tested on OS cell line. Here we address the activity of NSC743420 by examine whether differences in the p53 status could influence its effects on cell proliferation and death of OS cells. In particular, we compared the effect of the tested molecule on p53-wild type and p53-silenced U2OS cells, and on SaOS2 cell line, which is null for p53. Our results demonstrated that NSC743420 reduces OS cell proliferation by p53-dependent and p53-independent mechanisms. In particular, the molecule induces proliferative arrest that culminate to apoptosis in SaOS2 p53-null cells, while it brings a cytostatic and differentiating effect in U2OS cells, characterized by the cell cycle arrest in G0/G1 phase and increased alkaline phosphatase activity. - Highlights: • The indole derivative NSC743420 induces antitumor effects on osteosarcoma cells. • p53 status could drive the activity of antitumor agents on osteosarcoma cells. • NSC743420 induces cytostatic and differentiating effects on U2OS cells. • NSC743420 causes apoptosis on p53-null SaOS2 cells.
International Nuclear Information System (INIS)
Kim, Harold E.; Han, Sue J.; Kasza, Thomas; Han, Richard; Choi, Hyeong-Seon; Palmer, Kenneth C.; Kim, Hyeong-Reh C.
1997-01-01
Platelet-derived growth factor (PDGF) signals a diversity of cellular responses in vitro, including cell proliferation, survival, transformation, and chemotaxis. PDGF functions as a 'competence factor' to induce a set of early response genes expressed in G 1 including p21 WAF1/CIP1 , a functional mediator of the tumor suppressor gene p53 in G 1 /S checkpoint. For PDGF-stimulated cells to progress beyond G 1 and transit the cell cycle completely, progression factors in serum such as insulin and IGF-1 are required. We have recently shown a novel role of PDGF in inducing apoptosis in growth-arrested murine fibroblasts. The PDGF-induced apoptosis is rescued by insulin, suggesting that G 1 /S checkpoint is a critical determinant for PDGF-induced apoptosis. Because recent studies suggest that radiation-induced signal transduction pathways interact with growth factor-mediated signaling pathways, we have investigated whether activation of the PDGF-signaling facilitates the radiation-induced apoptosis in the absence of functional p53. For this study we have used the 125-IL cell line, a mutant p53-containing, highly metastatic, and hormone-unresponsive human prostate carcinoma cell line. PDGF signaling is constitutively activated by transfection with a p28 v-sis expression vector, which was previously shown to activate PDGF α- and β- receptors. Although the basal level of p21 WAF1/CIP1 expression and radiation-induced apoptosis were not detectable in control 125-IL cells as would be predicted in mutant p53-containing cells, activation of PDGF-signaling induced expression of p21 WAF1/CIP1 and radiation-induced apoptosis. Our study suggests that the level of 'competence' growth factors including PDGF may be one of the critical determinants for radiation-induced apoptosis, especially in cells with loss of p53 function at the site of radiotherapy in vivo
The p53-reactivating small molecule RITA induces senescence in head and neck cancer cells.
Chuang, Hui-Ching; Yang, Liang Peng; Fitzgerald, Alison L; Osman, Abdullah; Woo, Sang Hyeok; Myers, Jeffrey N; Skinner, Heath D
2014-01-01
TP53 is the most commonly mutated gene in head and neck cancer (HNSCC), with mutations being associated with resistance to conventional therapy. Restoring normal p53 function has previously been investigated via the use of RITA (reactivation of p53 and induction of tumor cell apoptosis), a small molecule that induces a conformational change in p53, leading to activation of its downstream targets. In the current study we found that RITA indeed exerts significant effects in HNSCC cells. However, in this model, we found that a significant outcome of RITA treatment was accelerated senescence. RITA-induced senescence in a variety of p53 backgrounds, including p53 null cells. Also, inhibition of p53 expression did not appear to significantly inhibit RITA-induced senescence. Thus, this phenomenon appears to be partially p53-independent. Additionally, RITA-induced senescence appears to be partially mediated by activation of the DNA damage response and SIRT1 (Silent information regulator T1) inhibition, with a synergistic effect seen by combining either ionizing radiation or SIRT1 inhibition with RITA treatment. These data point toward a novel mechanism of RITA function as well as hint to its possible therapeutic benefit in HNSCC.
International Nuclear Information System (INIS)
Sheahan, Sharon; Bellamy, Christopher O; Harland, Stephen N; Harrison, David J; Prost, Sandrine
2008-01-01
TGFβ has pleiotropic effects that range from regulation of proliferation and apoptosis to morphological changes and epithelial-mesenchymal transition (EMT). Some evidence suggests that these effects may be interconnected. We have recently reported that P53, P21 Cip1 and pRB, three critical regulators of the G1/S transition are variably involved in TGFβ-induced cell cycle arrest in hepatocytes. As these proteins are also involved in the regulation of apoptosis in many circumstances, we investigated their contribution to other relevant TGFβ-induced effects, namely apoptosis and EMT, and examined how the various processes were interrelated. Primary mouse hepatocytes deficient in p53, p21 and/or Rb, singly or in combination were treated with TGFβ for 24 to 96 hours. Apoptosis was quantified according to morphology and by immunostaining for cleaved-capsase 3. Epithelial and mesenchymal marker expression was studied using immunocytochemistry and real time PCR. We found that TGFβ similarly induced morphological changes regardless of genotype and independently of proliferation index or sensitivity to inhibition of proliferation by TGFβ. Morphological changes were accompanied by decrease in E-cadherin and increased Snail expression but the mesenchymal markers (N-cadherin, SMAα and Vimentin) studied remained unchanged. TGFβ induced high levels of apoptosis in p53-/-, Rb-/-, p21 cip1 -/- and control hepatocytes although with slight differences in kinetics. This was unrelated to proliferation or changes in morphology and loss of cell-cell adhesion. However, hepatocytes deficient in both p53 and p21 cip1 were less sensitive to TGFβ-induced apoptosis. Although p53, p21 Cip1 and pRb are well known regulators of both proliferation and apoptosis in response to a multitude of stresses, we conclude that they are critical for TGFβ-driven inhibition of hepatocytes proliferation, but only slightly modulate TGFβ-induced apoptosis. This effect may depend on other parameters
International Nuclear Information System (INIS)
Ju Guizhi; Shen Bo; Sun Shilong; Yan Fengqin; Fu Shibo; Li Pengwu
2006-01-01
Objective: To investigate the effect of ionizing radiation on the expressions of Caspase-3 and P53 proteins in EL-4 cells and its implications in the induction of apoptosis and polyploid cells. Methods: EL- 4 cells were irradiated with 4.0 Gy X-rays (180 kV, 15 mA, 0.287 Gy/min). Fluorescent staining and flow cytometry analysis were used to measure protein expression, apoptosis and polyploid cells. Results: It was found that the expression of Caspase-3 protein was increased significantly at 8 h and 12 h after the irradiation compared with sham-irradiated control (P<0.05), and the expression of P53 protein was also increased significantly at 2,4,8,12 and 24 h after the irradiation compared with sham-irradiated control (P<0.05 or P<0.01). The results showed that apoptosis of EL-4 cells was increased significantly at 2,4,8,12,24,48, and 72 h after 4.0 Gy irradiation compared with sham-irradiated control (P<0.05 or P<0.01 or P<0.001). However, no significant change in the number of polyploidy cells was found during the period from 2 to 48 h after the irradiation with 4.0 Gy X-rays. Conclusions: It is indicated that the expressions of Caspase-3 and P53 protein in EL-4 cells can be induced by ionizing radiation, and play an important role in the induction of apoptosis; the molecular pathway for polyploid formation might be P53-independent. (authors)
Synergistic induction of profibrotic PAI-1 by TGF-β and radiation depends on p53
International Nuclear Information System (INIS)
Niemantsverdriet, Maarten; Jong, Edwin de; Langendijk, Johannes A.; Kampinga, Harm H.; Coppes, Robert P.
2010-01-01
Radiation-induced fibrosis is a severe side effect of radiotherapy. TGF-β and radiation synergistically induce expression of the profibrotic PAI-1 gene and this cooperation potentially involves p53. Here, we demonstrate that p53 is both indispensable and sufficient for the radiation effect inducing synergistic activation of PAI-1 by radiation and TGF-β.
The p53-reactivating small molecule RITA induces senescence in head and neck cancer cells.
Directory of Open Access Journals (Sweden)
Hui-Ching Chuang
Full Text Available TP53 is the most commonly mutated gene in head and neck cancer (HNSCC, with mutations being associated with resistance to conventional therapy. Restoring normal p53 function has previously been investigated via the use of RITA (reactivation of p53 and induction of tumor cell apoptosis, a small molecule that induces a conformational change in p53, leading to activation of its downstream targets. In the current study we found that RITA indeed exerts significant effects in HNSCC cells. However, in this model, we found that a significant outcome of RITA treatment was accelerated senescence. RITA-induced senescence in a variety of p53 backgrounds, including p53 null cells. Also, inhibition of p53 expression did not appear to significantly inhibit RITA-induced senescence. Thus, this phenomenon appears to be partially p53-independent. Additionally, RITA-induced senescence appears to be partially mediated by activation of the DNA damage response and SIRT1 (Silent information regulator T1 inhibition, with a synergistic effect seen by combining either ionizing radiation or SIRT1 inhibition with RITA treatment. These data point toward a novel mechanism of RITA function as well as hint to its possible therapeutic benefit in HNSCC.
Directory of Open Access Journals (Sweden)
Fuqiang Xing
Full Text Available Recent studies have reported that exposure of mammalian cells to microwave radiation may have adverse effects such as induction of cell apoptosis. However, the molecular mechanisms underlying microwave induced mammalian cell apoptosis are not fully understood. Here, we report a novel mechanism: exposure to 1800MHz microwave radiation induces p53-dependent cell apoptosis through cytochrome c-mediated caspase-3 activation pathway. We first measured intensity of microwave radiation from several electronic devices with an irradiation detector. Mouse NIH/3T3 and human U-87 MG cells were then used as receivers of 1800MHz electromagnetic radiation (EMR at a power density of 1209 mW/m2. Following EMR exposure, cells were analyzed for viability, intracellular reactive oxygen species (ROS generation, DNA damage, p53 expression, and caspase-3 activity. Our analysis revealed that EMR exposure significantly decreased viability of NIH/3T3 and U-87 MG cells, and increased caspase-3 activity. ROS burst was observed at 6 h and 48 h in NIH/3T3 cells, while at 3 h in U-87 MG cells. Hoechst 33258 staining and in situ TUNEL assay detected that EMR exposure increased DNA damage, which was significantly restrained in the presence of N-acetyl-L-cysteine (NAC, an antioxidant. Moreover, EMR exposure increased the levels of p53 protein and p53 target gene expression, promoted cytochrome c release from mitochondrion, and increased caspase-3 activity. These events were inhibited by pretreatment with NAC, pifithrin-α (a p53 inhibitor and caspase inhibitor. Collectively, our findings demonstrate, for the first time, that 1800MHz EMR induces apoptosis-related events such as ROS burst and more oxidative DNA damage, which in turn promote p53-dependent caspase-3 activation through release of cytochrome c from mitochondrion. These findings thus provide new insights into physiological mechanisms underlying microwave-induced cell apoptosis.
International Nuclear Information System (INIS)
Hollmann, Gabriela; Linden, Rafael; Giangrande, Angela; Allodi, Silvana
2016-01-01
Highlights: • The paper characterizes molecular pathways of cell responses to environmental doses of UV in brain tissue of a crab species. • The UV radiation changes levels of proteins which trigger apoptotic or cell cycle arrest pathways and also it changes neurotrophins which lead to apoptosis of neural cell in the central nervous system (CNS) of the crab Ucides cordatus. • The UVB wavelengths in the solar simulator damaged the DNA, either directly or indirectly, by increasing ROS, and induced the increase of p53 and AKT, which blocked p21 and increased the expression of activated caspase-3, triggering apoptosis. The signs of death increased the expression of neurotrophins (BDNF and GDNF), which continued to stimulate the apoptosis signaling mediated by caspase-3. • In the brain of the crab U. cordatus, p53/p21 relationship in response to UV radiation is different from that of most mammals. - Abstract: Ultraviolet (UV) radiation can produce biological damage, leading the cell to apoptosis by the p53 pathway. This study evaluated some molecular markers of the apoptosis pathway induced by UVA, UVB and UVA+ UVB (Solar Simulator, SIM) in environmental doses, during five consecutive days of exposure, in the brain of the crab Ucides cordatus. We evaluated the central nervous system (CNS) by immunoblotting the content of proteins p53, p21, phosphorylated AKT, BDNF, GDNF, activated caspase-3 (C3) and phosphohistone H3 (PH3); and by immunohistochemical tests of the cells labeled for PH3 and C3. After the fifth day of exposure, UVB radiation and SIM increased the protein content of p53, increasing the content of AKT and, somehow, blocking p21, increasing the content of activated caspase-3, which led the cells to apoptosis. The signs of death affected the increase in neurotrophins, such as BDNF and GDNF, stimulating the apoptotic cascade of events. Immunohistochemical assays and immunoblotting showed that apoptosis was present in the brains of all UV groups, while
Energy Technology Data Exchange (ETDEWEB)
Hollmann, Gabriela, E-mail: gabrielahollmann@biof.ufrj.br [Programa de Pós Graduação em Ciências Biológicas-Fisiologia, Instituto de Biofísica Carlos Chagas Filho, Universidade Federal do Rio de Janeiro-UFRJ, Rio de Janeiro, RJ 21941-590 (Brazil); Linden, Rafael, E-mail: rlinden@biof.ufrj.br [Programa de Pós Graduação em Ciências Biológicas-Fisiologia, Instituto de Biofísica Carlos Chagas Filho, Universidade Federal do Rio de Janeiro-UFRJ, Rio de Janeiro, RJ 21941-590 (Brazil); Giangrande, Angela, E-mail: angela.giangrande@igbmc.fr [Institut de Génétique et de Biologie Moléculaire et Cellulaire-IGBMC, INSERM, Strasbourg (France); Allodi, Silvana, E-mail: sallodi@biof.ufrj.br [Programa de Pós Graduação em Ciências Biológicas-Fisiologia, Instituto de Biofísica Carlos Chagas Filho, Universidade Federal do Rio de Janeiro-UFRJ, Rio de Janeiro, RJ 21941-590 (Brazil)
2016-04-15
Highlights: • The paper characterizes molecular pathways of cell responses to environmental doses of UV in brain tissue of a crab species. • The UV radiation changes levels of proteins which trigger apoptotic or cell cycle arrest pathways and also it changes neurotrophins which lead to apoptosis of neural cell in the central nervous system (CNS) of the crab Ucides cordatus. • The UVB wavelengths in the solar simulator damaged the DNA, either directly or indirectly, by increasing ROS, and induced the increase of p53 and AKT, which blocked p21 and increased the expression of activated caspase-3, triggering apoptosis. The signs of death increased the expression of neurotrophins (BDNF and GDNF), which continued to stimulate the apoptosis signaling mediated by caspase-3. • In the brain of the crab U. cordatus, p53/p21 relationship in response to UV radiation is different from that of most mammals. - Abstract: Ultraviolet (UV) radiation can produce biological damage, leading the cell to apoptosis by the p53 pathway. This study evaluated some molecular markers of the apoptosis pathway induced by UVA, UVB and UVA+ UVB (Solar Simulator, SIM) in environmental doses, during five consecutive days of exposure, in the brain of the crab Ucides cordatus. We evaluated the central nervous system (CNS) by immunoblotting the content of proteins p53, p21, phosphorylated AKT, BDNF, GDNF, activated caspase-3 (C3) and phosphohistone H3 (PH3); and by immunohistochemical tests of the cells labeled for PH3 and C3. After the fifth day of exposure, UVB radiation and SIM increased the protein content of p53, increasing the content of AKT and, somehow, blocking p21, increasing the content of activated caspase-3, which led the cells to apoptosis. The signs of death affected the increase in neurotrophins, such as BDNF and GDNF, stimulating the apoptotic cascade of events. Immunohistochemical assays and immunoblotting showed that apoptosis was present in the brains of all UV groups, while
Choi, Hyun Kyung; Ryu, Hwani; Son, A-Rang; Seo, Bitna; Hwang, Sang-Gu; Song, Jie-Young; Ahn, Jiyeon
2016-04-01
To identify novel small molecules that induce selective cancer cell death, we screened a chemical library containing 1040 compounds in HT29 colon cancer and CCD18-Co normal colon cells, using a phenotypic cell-based viability assay system with the Cell Counting Kit-8 (CCK-8). We discovered a novel anthraquinone derivative, N-(4-[{(9,10-dioxo-9,10-dihydro-1-anthracenyl)sulfonyl}amino]phenyl)-N-methylacetamide (IMP1338), which was cytotoxic against the human colon cancer cells tested. The MTT cell viability assay showed that treatment with IMP1338 selectively inhibited HCT116, HCT116 p53(-/-), HT29, and A549 cancer cell proliferation compared to that of Beas2B normal epithelial cells. To elucidate the cellular mechanism underlying the cytotoxicity of IMP1338, we examined the effect of IMP1338 on the cell cycle distribution and death of cancer cells. IMP1338 treatment significantly arrested the cell cycle at S and G2/M phases by DNA damage and led to apoptotic cell death, which was determined using FACS analysis with Annexin V/PI double staining. Furthermore, IMP1338 increased caspase-3 cleavage in wild-type p53, p53 knockout HCT116, and HT29 cells as determined using immunoblotting. In addition, IMP1338 markedly induced the phosphorylation of histone H2AX and Chk1 in both cell lines while the combination of 5-fluorouracil (5-FU) and radiation inhibited the viability of HCT116, HCT116 p53(-/-), and HT29 cells compared to 5-FU or radiation alone. Our findings indicated that IMP1338 induced p53-independent cell death through S and G2/M phase arrest as well as DNA damage. These results provide a basis for future investigations assessing the promising anticancer properties of IMP1338. Copyright © 2016. Published by Elsevier Masson SAS.
Alonso, Michelle; Tamasdan, Cristina; Miller, Douglas C; Newcomb, Elizabeth W
2003-02-01
Flavopiridol is a synthetic flavone, which inhibits growth in vitro and in vivo of several solid malignancies such as renal, prostate, and colon cancers. It is a potent cyclin-dependent kinase inhibitor presently in clinical trials. In this study, we examined the effect of flavopiridol on a panel of glioma cell lines having different genetic profiles: five of six have codeletion of p16(INK4a) and p14(ARF); three of six have p53 mutations; and one of six shows overexpression of mouse double minute-2 (MDM2) protein. Independent of retinoblastoma and p53 tumor suppressor pathway alterations, flavopiridol induced apoptosis in all cell lines but through a caspase-independent mechanism. No cleavage products for caspase 3 or its substrate poly(ADP-ribose) polymerase or caspase 8 were detected. The pan-caspase inhibitor Z-VAD-fmk did not inhibit flavopiridol-induced apoptosis. Mitochondrial damage measured by cytochrome c release and transmission electron microscopy was not observed in drug-treated glioma cells. In contrast, flavopiridol treatment induced translocation of apoptosis-inducing factor from the mitochondria to the nucleus. The proteins cyclin D(1) and MDM2 involved in the regulation of retinoblastoma and p53 activity, respectively, were down-regulated early after flavopiridol treatment. Given that MDM2 protein can confer oncogenic properties under certain circumstances, loss of MDM2 expression in tumor cells could promote increased chemosensitivity. After drug treatment, a low Bcl-2/Bax ratio was observed, a condition that may favor apoptosis. Taken together, the data indicate that flavopiridol has activity against glioma cell lines in vitro and should be considered for clinical development in the treatment of glioblastoma multiforme.
International Nuclear Information System (INIS)
Kumar, Ashish; Mukherjee, Prabuddho; Babu, Bincy; Chandna, Sudhir
2016-01-01
The protein p53 has been recognized as an important radio-responsive protein which functions mainly through transcriptional control of its target genes and microRNAs that target multiple response pathways. In this study, we investigate a putative link between p53 functionality and microRNA-31 expression that largely contributes to cellular transformation/malignancy and also establishes the role of miR-31 in radiation-induced cell death. The expression of miR-31 is found to be attenuated in cells in successive stages of cancer progression
International Nuclear Information System (INIS)
Lopez, Carlos A.; Feng, Felix Y.; Herman, Joseph M.; Nyati, Mukesh K.; Lawrence, Theodore S.; Ljungman, Mats
2007-01-01
Purpose: Histone deacetylase (HDAC) inhibitors induce growth arrest, differentiation, and apoptosis in cancer cells. Phenylbutyrate (PB) is a HDAC inhibitor used clinically for treatment of urea cycle disorders. Because of its low cytotoxicity, cerebrospinal fluid penetration, and high oral bioavailability, we investigated PB as a potential radiation sensitizer in human glioblastoma cell lines. Methods and Materials: Four glioblastoma cell lines were selected for this study. Phenylbutyrate was used at a concentration of 2 mM, which is achievable in humans. Western blots were used to assess levels of acetylated histone H3 in tumor cells after treatment with PB. Flow cytometry was used for cell cycle analysis. Clonogenic assays were performed to assess the effect of PB on radiation sensitivity. We used shRNA against p53 to study the role of p53 in radiosensitization. Results: Treatment with PB alone resulted in hyperacetylation of histones, confirmed by Western blot analysis. The PB alone resulted in cytostatic effects in three cell lines. There was no evidence of G 1 arrest, increase in sub-G 1 fraction or p21 protein induction. Clonogenic assays showed radiosensitization in two lines harboring p53 mutations, with enhancement ratios (± SE) of 1.5 (± 0.2) and 1.3 (± 0.1), respectively. There was no radiopotentiating effect in two cell lines with wild-type p53, but knockdown of wild-type p53 resulted in radiosensitization by PB. Conclusions: Phenylbutyrate can produce p21-independent cytostasis, and enhances radiation sensitivity in p53 mutant human glioblastoma cells in vitro. This suggests the potential application of combined PB and radiotherapy in glioblastoma harboring mutant p53
E2F-1-Induced p53-independent apoptosis in transgenic mice
DEFF Research Database (Denmark)
Holmberg, Christian Henrik; Helin, K.; Sehested, M.
1998-01-01
The E2F transcription factors are key targets for the retinoblastoma protein, pRB. By inactivation of E2Fs, pRB prevents progression to the S phase. To test proliferative functions of E2F, we generated transgenic mice expressing human E2F-1 and/or human DP-1. When the hydroxymethyl glutaryl...... involving increased apoptosis in the germinal epithelium. This effect was potentiated by simultaneous overexpression of DP-1. Testicular atrophy as a result of overexpression of E2F-1 and DP-1 is independent of functional p53, since p53-nullizygous transgenic mice overexpressing E2F-1 and DP-1 also suffered...
Directory of Open Access Journals (Sweden)
Jeyran eShahbazi
2013-05-01
Full Text Available Tumor protein 53-induced nuclear protein 1 (TP53INP1 is a stress-induced p53 target gene whose expression is modulated by transcription factors such as p53, p73 and E2F1. TP53INP1 gene encodes two isoforms of TP53INP1 proteins, TP53INP1α and TP53INP1β, both of which appear to be key elements in p53 function. When associated with homeodomain-interacting protein kinase-2 (HIPK2, TP53INP1 phosphorylates p53 protein at Serine 46, enhances p53 protein stability and its transcriptional activity, leading to transcriptional activation of p53 target genes such as p21, PIG-3 and MDM2, cell growth arrest and apoptosis upon DNA damage stress. The anti-proliferative and pro-apoptotic activities of TP53INP1 indicate that TP53INP1 has an important role in cellular homeostasis and DNA damage response. Deficiency in TP53INP1 expression results in increased tumorigenesis; while TP53INP1 expression is repressed during early stages of cancer by factors such as miR-155. This review aims to summarize the roles of TP53INP1 in blocking tumor progression through p53-dependant and p53-independent pathways, as well as the elements which repress TP53INP1 expression, hence highlighting its potential as a therapeutic target in cancer treatment.
International Nuclear Information System (INIS)
Yun, Hong Shik; Baek, Jeong-Hwa; Yim, Ji-Hye; Lee, Su-Jae; Lee, Chang-Woo; Song, Jie-Young; Um, Hong-Duck; Park, Jong Kuk; Park, In-Chul; Hwang, Sang-Gu
2014-01-01
Highlights: • HRP-3 is a radiation- and anticancer drug-responsive protein in H1299 cells. • Depletion of HRP-3 induces apoptosis of radio- and chemoresistant H1299 cells. • Depletion of HRP-3 promotes ROS generation via inhibition of the Nrf2/HO-1 pathway. • ROS generation enhances NF-κB activity, which acts as an upstream signal in the c-Myc/Noxa apoptotic pathway. - Abstract: We previously identified hepatoma-derived growth factor-related protein-3 (HRP-3) as a radioresistant biomarker in p53 wild-type A549 cells and found that p53-dependent induction of the PUMA pathway was a critical event in regulating the radioresistant phenotype. Here, we found that HRP-3 knockdown regulates the radioresistance of p53-null H1299 cells through a distinctly different molecular mechanism. HRP-3 depletion was sufficient to cause apoptosis of H1299 cells by generating substantial levels of reactive oxygen species (ROS) through inhibition of the Nrf2/HO-1 antioxidant pathway. Subsequent, ROS-dependent and p53-independent NF-κB activation stimulated expression of c-Myc and Noxa proteins, thereby inducing the apoptotic machinery. Our results thus extend the range of targets for the development of new drugs to treat both p53 wild-type or p53-null radioresistant lung cancer cells
The role of p53 molecule in radiation and hyperthermic therapies
International Nuclear Information System (INIS)
Yasumoto, Jun-ichi; Takahashi, Akihisa; Ohnishi, Ken; Ohnishi, Takeo
2003-01-01
In recent years, cancer-related genes have been analyzed at the molecular level as predictive indicators for cancer therapy. Among those genes, the tumor suppressor gene p53 is worthy of notice in cancer therapy, because the p53 molecule prevents the malignant degeneration of non-cancer cells by regulating cell-cycle arrest, apoptosis, and DNA repair. An abnormality of the p53 gene introduces a genetic instability and increases the incidence of carcinogenesis and teratogenesis. Therefore, p53 is called a guardian of the genome. Mutations of p53 are observed at a high frequency in human tumors, and are recognized in about half of all malignant tumors in human head and neck cancers. We previously reported that radio- and heat-sensitivities of human cultured tongue squamous cell carcinoma cells are p53-dependent, and are closely correlated with the induction of apoptosis. In a human cell culture system, the interactive hyperthermic enhancement of radiosensitivity was observed in wild-type p53 cells, but not in mutated p53 cells. In a transplanted tumor system, the combination therapies of radiation and hyperthermia induced efficient tumor growth depression and apoptosis in the wild-type p53 tumors. In this review, we discuss the p53 activation signaling pathways through the modification of p53 molecules, such as phosphorylation after radiation and hyperthermia treatments. (author)
International Nuclear Information System (INIS)
Turinetto, Valentina; Porcedda, Paola; Orlando, Luca; De Marchi, Mario; Amoroso, Antonio; Giachino, Claudia
2009-01-01
Current chemotherapy of human cancers focuses on the DNA damage pathway to induce a p53-mediated cellular response leading to either G1 arrest or apoptosis. However, genotoxic treatments may induce mutations and translocations that result in secondary malignancies or recurrent disease. In addition, about 50% of human cancers are associated with mutations in the p53 gene. Nongenotoxic activation of apoptosis by targeting specific molecular pathways thus provides an attractive therapeutic approach. Normal and leukemic cells were evaluated for their sensitivity to 5, 6-dichloro-1-beta-D-ribofuranosylbenzimidazole (DRB) through cell viability and caspase activation tests. The apoptotic pathway induced by DRB was analysed by immunfluorescence and immunoblot analysis. H2AX phosphorylation and cell cycle analysis were performed to study the dependance of apoptosis on DNA damage and DNA replication, respectively. To investigate the role of p53 in DRB-induced apoptosis, specific p53 inhibitors were used. Statistical analysis on cell survival was performed with the test of independence. Here we report that DRB, an inhibitor of the transcriptional cyclin-dependent kinases (CDKs) 7 and 9, triggers DNA replication-independent apoptosis in normal and leukemic human cells regardless of their p53 status and without inducing DNA damage. Our data indicate that (i) in p53-competent cells, apoptosis induced by DRB relies on a cytosolic accumulation of p53 and subsequent Bax activation, (ii) in the absence of p53, it may rely on p73, and (iii) it is independent of ATM and NBS1 proteins. Notably, even apoptosis-resistant leukemic cells such as Raji were sensitive to DRB. Our results indicate that DRB represents a potentially useful cancer chemotherapeutic strategy that employs both the p53-dependent and -independent apoptotic pathways without inducing genotoxic stress, thereby decreasing the risk of secondary malignancies
Zhou, Xin; Ma, Xiaofei; Wang, Zhenhua; Sun, Chao; Wang, Yupei; He, Yang; Zhang, Hong
2015-12-15
Radiation-induced hyperproliferation of intestinal crypts is well documented, but its potential tumorigenic effects remain elusive. Here we aim to determine the genomic surveillance process during crypt hyperproliferation, and its consequential outcome after ionizing radiation. Crypt regeneration in the intestine was induced by a single dose of 12Gy abdominal irradiation. γ-H2AX, 53BP1 and DNA-PKcs were used as DNA repair surrogates to investigate the inherent ability of intestinal crypt cells to recognize and repair double-strand breaks. Ki67 staining and the 5-bromo-2'-deoxyuridine incorporation assay were used to study patterns of cell proliferation in regenerating crypts. Staining for ATM, p53, Chk1 and Chk2 was performed to study checkpoint activation and release. Apoptosis was evaluated through H&E staining and terminal deoxynucleotidyl transferase (dUTP) nick-end labeling. The ATM-p53 pathway was immediately activated after irradiation. A second wave of DSBs in crypt cells was observed in regenerating crypts, accompanied with significantly increased chromosomal bridges. The p53-related genomic surveillance pathway was not active during the regeneration phase despite DSBs and chromosomal bridges in the cells of regenerating crypts. Non-homologous end joining (NHEJ) DSBs repair was involved in the DSBs repair process, as indicated by p-DNA-PKcs staining. Intestinal crypt cells retained hyperproliferation with inactive p53-related genomic surveillance system. NHEJ was involved in the resultant genomic instability during hyperproliferation. Copyright © 2015 Elsevier Inc. All rights reserved.
Lambrughi, Matteo; De Gioia, Luca; Gervasio, Francesco Luigi; Lindorff-Larsen, Kresten; Nussinov, Ruth; Urani, Chiara; Bruschi, Maurizio; Papaleo, Elena
2016-11-02
Binding-induced conformational changes of a protein at regions distant from the binding site may play crucial roles in protein function and regulation. The p53 tumour suppressor is an example of such an allosterically regulated protein. Little is known, however, about how DNA binding can affect distal sites for transcription factors. Furthermore, the molecular details of how a local perturbation is transmitted through a protein structure are generally elusive and occur on timescales hard to explore by simulations. Thus, we employed state-of-the-art enhanced sampling atomistic simulations to unveil DNA-induced effects on p53 structure and dynamics that modulate the recruitment of cofactors and the impact of phosphorylation at Ser215. We show that DNA interaction promotes a conformational change in a region 3 nm away from the DNA binding site. Specifically, binding to DNA increases the population of an occluded minor state at this distal site by more than 4-fold, whereas phosphorylation traps the protein in its major state. In the minor conformation, the interface of p53 that binds biological partners related to p53 transcription-independent functions is not accessible. Significantly, our study reveals a mechanism of DNA-mediated protection of p53 from interactions with partners involved in the p53 transcription-independent signalling. This also suggests that conformational dynamics is tightly related to p53 signalling. © The Author(s) 2016. Published by Oxford University Press on behalf of Nucleic Acids Research.
Radiation-induced p53 protein response in the A549 cell line is culture growth-phase dependent
Energy Technology Data Exchange (ETDEWEB)
Johnson, N.F.; Gurule, D.M.; Carpenter, T.R.
1995-12-01
One role of the p53 tumor suppressor protein has been recently revealed. Kastan, M.B. reported that p53 protein accumulates in cells exposed to ionizing radiation. The accumulation of p53 protein is in response to DNA damage, most importantly double-strand breaks, that results from exposure to ionizing radiation. The rise in cellular p53 levels is necessary for an arrest in the G{sub 1} phase of the cell cycle to provide additional time for DNA repair. The p53 response has also been demonstrated to enhance PCNA-dependent repair. p53 is thus an important regulator of the cellular response to DNA-damaging radiation. From this data, it can be concluded that the magnitude of the p53 response is not dependent on the phase of culture growth.
Levels of p21WAF1/CIP1 do not affect radiation-induced cell death in human breast epithelial cells
International Nuclear Information System (INIS)
Kim, Harold E.; Han, Sue J.; Waid, David; Lee, Yong J.; Kim, Hyeong-Reh Choi
1997-01-01
Purpose/Objective: Loss of the wild-type p53 activity and/or overexpression of the proto-oncogene bcl-2 are frequently detected in breast cancer and suggested to be related to resistance to chemotherapy and radiation therapy. The long-term goals of this study are to identify the downstream signaling molecules for anti-proliferative and apoptotic activities of p53 and to investigate the interaction of bcl-2 with p53 in human breast epithelial cells. We previously showed that overexpression of bcl-2 downregulates radiation-induced expression of p21 WAF1/CIP1 , a p53 downstream molecule that functions to inhibit cyclin dependent kinases, and suppresses radiation-induced apoptosis in human breast epithelial cell line (MCF10A). In this study, we investigated the role of p21 WAF1/CIP1 in radiation-induced cell death in MCF10A cells. Materials and Methods: To determine whether downregulation of p21 WAF1/CIP1 is required for anti-apoptotic activity of bcl-2, and to investigate the roles of p21 WAF1/CIP1 in cell death following irradiation, we transfected p21 WAF1/CIP1 expression vector into bcl-2 overexpressing MCF10A cells. The effects of p21 WAF1/CIP1 overexpression on cell growth, radiation-induced apoptosis and clonogenic cell survival were analyzed. Results: Overexpression of p21 WAF1/CIP1 resulted in marked growth inhibition, but no effect on dose-dependent radiation-induced cell lethality as determined by clonogenic survival assay. Radiation-induced apoptosis was not detected in bcl-2 overexpressing MCF10A cells independent of levels of p21 WAF1/CIP1 expression. Conclusion: This study suggests that bcl-2 downregulation of p21 WAF1/CIP1 is independent of anti-apoptotic activity of bcl-2 and that levels of p21 WAF1/CIP1 do not affect radiation-induced cell death in human breast epithelial cells
International Nuclear Information System (INIS)
Orre, Lukas M.; Stenerloew, Bo; Dhar, Sumeer; Larsson, Rolf; Lewensohn, Rolf; Lehtioe, Janne
2006-01-01
We have investigated p53-related differences in cellular response to DNA damaging agents, focusing on p53s effects on RAD51 protein level and sub-cellular localization post exposure to ionizing radiation. In a human colon cancer cell line, HCT116 and its isogenic p53-/- subcell line we show here p53-independent RAD51 foci formation but interestingly the resolution of RAD51 foci showed clear p53 dependence. In p53 wt cells, but not in p53-/- cells, RAD51 protein level decreased 48 h post irradiation and fluorescence immunostaining showed resolution of RAD51 foci and relocalization of RAD51 to nucleoli at time points corresponding to the decrease in RAD51 protein level. Both cell lines rejoined DNA double strand breaks efficiently with similar kinetics and p53 status did not influence sensitivity to DNA damaging agents. We suggest that p53 has a role in RAD51 clearance post DSB repair and that nucleoli might be sites of RAD51 protein degradation
International Nuclear Information System (INIS)
Alphonse, Gersende; Maalouf, Mira; Battiston-Montagne, Priscillia; Ardail, Dominique; Beuve, Michaël; Rousson, Robert; Taucher-Scholz, Gisela; Fournier, Claudia; Rodriguez-Lafrasse, Claire
2013-01-01
To determine whether ceramide is responsible for the induction of p53-independent early or late apoptosis in response to high- and low-Linear-Energy-Transfer (LET) irradiation. Four cell lines displaying different radiosensitivities and p53-protein status were irradiated with photons or 33.4 or 184 keV/μm carbon ions. The kinetics of ceramide production was quantified by fluorescent microscopy or High-Performance-Liquid-Chromatogaphy and the sequence of events leading to apoptosis by flow cytometry. Regardless of the p53-status, both low and high-LET irradiation induced an early ceramide production in radiosensitive cells and late in the radioresistant. This production strongly correlated with the level of early apoptosis in radiosensitive cells and delayed apoptosis in the radioresistant ones, regardless of radiation quality, tumor type, radiosensitivity, or p53-status. Inhibition of caspase activity or ceramide production showed that, for both types of radiation, ceramide is essential for the initiation of early apoptosis in radiosensitive cells and late apoptosis following mitotic catastrophe in radioresistant cells. Ceramide is a determining factor in the onset of early and late apoptosis after low and high-LET irradiation and is the mediator of the p53-independent-apoptotic pathway. We propose that ceramide is the molecular bridge between mitotic catastrophe and the commitment phase of delayed apoptosis in response to irradiation
Neem oil limonoids induces p53-independent apoptosis and autophagy.
Srivastava, Pragya; Yadav, Neelu; Lella, Ravi; Schneider, Andrea; Jones, Anthony; Marlowe, Timothy; Lovett, Gabrielle; O'Loughlin, Kieran; Minderman, Hans; Gogada, Raghu; Chandra, Dhyan
2012-11-01
Azadirachta indica, commonly known as neem, has a wide range of medicinal properties. Neem extracts and its purified products have been examined for induction of apoptosis in multiple cancer cell types; however, its underlying mechanisms remain undefined. We show that neem oil (i.e., neem), which contains majority of neem limonoids including azadirachtin, induced apoptotic and autophagic cell death. Gene silencing demonstrated that caspase cascade was initiated by the activation of caspase-9, whereas caspase-8 was also activated late during neem-induced apoptosis. Pretreatment of cancer cells with pan caspase inhibitor, z-VAD inhibited activities of both initiator caspases (e.g., caspase-8 and -9) and executioner caspase-3. Neem induced the release of cytochrome c and apoptosis-inducing factor (AIF) from mitochondria, suggesting the involvement of both caspase-dependent and AIF-mediated apoptosis. p21 deficiency caused an increase in caspase activities at lower doses of neem, whereas p53 deficiency did not modulate neem-induced caspase activation. Additionally, neem treatment resulted in the accumulation of LC3-II in cancer cells, suggesting the involvement of autophagy in neem-induced cancer cell death. Low doses of autophagy inhibitors (i.e., 3-methyladenine and LY294002) did not prevent accumulation of neem-induced LC3-II in cancer cells. Silencing of ATG5 or Beclin-1 further enhanced neem-induced cell death. Phosphoinositide 3-kinase (PI3K) or autophagy inhibitors increased neem-induced caspase-3 activation and inhibition of caspases enhanced neem-induced autophagy. Together, for the first time, we demonstrate that neem induces caspase-dependent and AIF-mediated apoptosis, and autophagy in cancer cells.
Neem oil limonoids induces p53-independent apoptosis and autophagy
Chandra, Dhyan
2012-01-01
Azadirachta indica, commonly known as neem, has a wide range of medicinal properties. Neem extracts and its purified products have been examined for induction of apoptosis in multiple cancer cell types; however, its underlying mechanisms remain undefined. We show that neem oil (i.e., neem), which contains majority of neem limonoids including azadirachtin, induced apoptotic and autophagic cell death. Gene silencing demonstrated that caspase cascade was initiated by the activation of caspase-9, whereas caspase-8 was also activated late during neem-induced apoptosis. Pretreatment of cancer cells with pan caspase inhibitor, z-VAD inhibited activities of both initiator caspases (e.g., caspase-8 and -9) and executioner caspase-3. Neem induced the release of cytochrome c and apoptosis-inducing factor (AIF) from mitochondria, suggesting the involvement of both caspase-dependent and AIF-mediated apoptosis. p21 deficiency caused an increase in caspase activities at lower doses of neem, whereas p53 deficiency did not modulate neem-induced caspase activation. Additionally, neem treatment resulted in the accumulation of LC3-II in cancer cells, suggesting the involvement of autophagy in neem-induced cancer cell death. Low doses of autophagy inhibitors (i.e., 3-methyladenine and LY294002) did not prevent accumulation of neem-induced LC3-II in cancer cells. Silencing of ATG5 or Beclin-1 further enhanced neem-induced cell death. Phosphoinositide 3-kinase (PI3K) or autophagy inhibitors increased neem-induced caspase-3 activation and inhibition of caspases enhanced neem-induced autophagy. Together, for the first time, we demonstrate that neem induces caspase-dependent and AIF-mediated apoptosis, and autophagy in cancer cells. PMID:22915764
International Nuclear Information System (INIS)
Liang Xin; Xu Ke; Xu Yufang; Liu Jianwen; Qian Xuhong
2011-01-01
The Bcl-2 family contains a panel of proteins which are conserved regulators of apoptosis in mammalian cells, like the anti-apoptotic protein Bcl-2. According to its significant role in altering susceptibility to apoptosis, the deciphering of the mechanism of Bcl-2 expression modulation may be crucial for identifying therapeutics strategies for cancer. Treatment with naphthalimide-based DNA intercalators, including M2-A and R16, generally leads to a decrease in Bcl-2 intracellular amounts. Whereas the interest for these chemotherapeutics is accompanied by advances in the fundamental understanding of their anticancer properties, the molecular mechanism underlying changes in Bcl-2 expression remains poorly understood. We report here that p53 contributes to Bcl-2 down-regulation induced by B1, a novel naphthalimide-based DNA intercalating agent. Indeed, the decrease in Bcl-2 protein levels observed during B1-induced apoptosis was correlated to the decrease in mRNA levels, as a result of the inhibition of Bcl-2 transcription and promoter activity. In this context, we evaluated p53 contribution in the Bcl-2 transcriptional down-regulation. We found a significant increase of p53 binding to P 2 promoter TATA box in MCF7 cells by chromatin immunoprecipitation. These data suggest that B1-induced caspase-independent apoptosis in MCF-7 cells is associated with the activation of p53 and the down-regulation of Bcl-2. Our study strengthens the links between p53 and Bcl-2 at a transcriptional level, upon naphthalimide-based DNA intercalator treatment. - Research highlights: → B1 induced apoptosis in MCF-7 cells, following a transcriptional decrease in Bcl-2. → B1 treatment triggered p53 activation and leads to a p53-dependent down-regulation of Bcl-2. → B1 induced significant increase of p53 binding to Bcl-2 P 2 promoter TATA box.
Widel, Maria; Lalik, Anna; Krzywon, Aleksandra; Poleszczuk, Jan; Fujarewicz, Krzysztof; Rzeszowska-Wolny, Joanna
2015-08-01
Radiation-induced bystander effect, appearing as different biological changes in cells that are not directly exposed to ionizing radiation but are under the influence of molecular signals secreted by irradiated neighbors, have recently attracted considerable interest due to their possible implication for radiotherapy. However, various cells present diverse radiosensitivity and bystander responses that depend, inter alia, on genetic status including TP53, the gene controlling the cell cycle, DNA repair and apoptosis. Here we compared the ionizing radiation and bystander responses of human colorectal carcinoma HCT116 cells with wild type or knockout TP53 using a transwell co-culture system. The viability of exposed to X-rays (0-8 Gy) and bystander cells of both lines showed a roughly comparable decline with increasing dose. The frequency of micronuclei was also comparable at lower doses but at higher increased considerably, especially in bystander TP53-/- cells. Moreover, the TP53-/- cells showed a significantly elevated frequency of apoptosis, while TP53+/+ counterparts expressed high level of senescence. The cross-matched experiments where irradiated cells of one line were co-cultured with non-irradiated cells of opposite line show that both cell lines were also able to induce bystander effects in their counterparts, however different endpoints revealed with different strength. Potential mediators of bystander effects, IL-6 and IL-8, were also generated differently in both lines. The knockout cells secreted IL-6 at lower doses whereas wild type cells only at higher doses. Secretion of IL-8 by TP53-/- control cells was many times lower than that by TP53+/+ but increased significantly after irradiation. Transcription of the NFκBIA was induced in irradiated TP53+/+ mainly, but in bystanders a higher level was observed in TP53-/- cells, suggesting that TP53 is required for induction of NFκB pathway after irradiation but another mechanism of activation must operate in
Transcription of five p53- and Stat-3-Inducible genes after ionizing radiation
Energy Technology Data Exchange (ETDEWEB)
Grace, M.B. [Uniformed Services University (USUHS), Armed Forces Radiobiology Research Institute, Building 42, RM 3321, 8901 Wisconsin Avenue, Bethesda, MD 20889-5603 (United States)], E-mail: grace@afrri.usuhs.mil; Blakely, W.F. [Uniformed Services University (USUHS), Armed Forces Radiobiology Research Institute, Building 42, RM 3321, 8901 Wisconsin Avenue, Bethesda, MD 20889-5603 (United States)
2007-07-15
Ionizing radiation (IR) produces temporal- and dose-dependent changes in multiple gene mRNA targets that are potential biomarkers of radiation dose. We confirmed IR-induced changes in expression of gadd45a, ddb-2, and cdkn1a downstream transcripts of p53 by quantitative reverse transcription-polymerase chain reaction (QRT-PCR) assay in total RNA samples from the whole blood of radiotherapy patients undergoing total-body irradiation [Amundson, S.A., Grace, M.B., McLeland, C.B., Epperly, M.W., Yeager, A., Zhan, Q., Greenberger, J.S., Fornace Jr., A.J., 2004. Human in vivo radiation-induced biomarkers: gene expression changes in radiotherapy patients. Cancer Res. 64, 6368-6371.]. We now confirm dose-dependent up-regulation of bax in addition to these p53-dependent transcripts, and bcl-2, a downstream transcript of Stat-3, in ex vivo irradiated blood samples from healthy unrelated volunteers. Together these biomarkers represent pathways involved in growth arrest, DNA damage, and apoptosis. The objectives of this study were to (1) investigate the relationship between baseline mRNA expression levels, and (2) define expression patterns in response to IR in a large cohort (n=20). Whole-blood samples were irradiated ex vivo to measure gene expression in samples from (i) three healthy donors over a broad dose range (0, 0.25, 0.50, 0.75, 1, 2, and 3 Gy), and (ii) 20 healthy donors at two doses, 0.25 and 2.5 Gy. Expression level variance ({sigma}{sub 2}) of baseline values (0 Gy) showed negligible inter-individual variation with all values {<=}1.0. {sigma}{sub 2}values=0.50bax, 0.25 bcl-2, 0.73 gadd45a, 0.66 cdkn1a, and 1.0 ddb-2. Meaningful IR dose-responses were observed for bax, gadd45a, and ddb-2 profiles and the ratio of bax:bcl-2 mRNA expression over a broad dose range. QRT-PCR studies were extended in the lower dose range (0, 0.1, 0.5, 0.75, and 1 Gy). Results showed that bax:bcl-2 ratio initially favors bax expression at doses of <1Gy, with IR-induced dose responses
Role for c-Abl and p73 in the radiation response of male germ cells
Hamer, G.; Gademan, I. S.; Kal, H. B.; de rooij, D. G.
2001-01-01
p53 plays a central role in the induction of apoptosis of spermatogonia in response to ionizing radiation. In p53(-/-) testes, however, spermatogonial apoptosis still can be induced by ionizing radiation, so p53 independent apoptotic pathways must exist in spermatogonia. Here we show that the p53
International Nuclear Information System (INIS)
Huober, Jens B.; Nakamura, Seiichi; Meyn, Ray; Roth, Jack A.; Mukhopadhyay, Tapas
2000-01-01
Purpose: The purpose of this study was to investigate the efficacy of 2-methoxyestradiol as an antitumor and radiosensitizing agent for the treatment of human malignancy. Methods and Materials: Two cancer cell lines with wild-type p53 status were exposed first to irradiation and then to an oral formulation of the nontoxic metabolite 2-methoxyestradiol (2ME) to stabilize p53 levels. Results: Cell growth was inhibited via G1 growth and apoptosis. Subsequent in vitro growth and Tunel assays indicated that this combination was superior to radiation alone at inducing p53 protein accumulation, stabilizing p53 protein levels, and substantially reducing long-term tumor cell growth (∼80%) and colony formation (∼95%) in vitro, and inducing apoptosis. However, harboring mutated p53, H322 cell line, was relatively insensitive to such a treatment regimen. Western blot analysis revealed that growth inhibition was associated with increased levels of p53 and p21 protein accumulation. Experiments with subcutaneous tumor in a nu/nu mouse showed the combination treatment to be superior to radiation alone at reducing tumor growth (∼50% reduction as compared to radiation alone) in vivo. Conclusion: Thus, our studies confirmed a unique strategy whereby oral administration of a nontoxic estrogen metabolite, 2ME, significantly enhanced the radiation effect on a subcutaneous tumor without any toxicity and suggesting that this strategy may be clinically useful as an adjuvant therapy
BAK overexpression mediates p53-independent apoptosis inducing effects on human gastric cancer cells
Directory of Open Access Journals (Sweden)
Liu Jun
2004-07-01
Full Text Available Abstract Background BAK (Bcl-2 homologous antagonist/killer is a novel pro-apoptotic gene of the Bcl-2 family. It has been reported that gastric tumors have reduced BAK levels when compared with the normal mucosa. Moreover, mutations of the BAK gene have been identified in human gastrointestinal cancers, suggesting that a perturbation of BAK-mediated apoptosis may contribute to the pathogenesis of gastric cancer. In this study, we explored the therapeutic effects of gene transfer mediated elevations in BAK expression on human gastric cancer cells in vitro. Methods Eukaryotic expression vector for the BAK gene was constructed and transferred into gastric cancer cell lines, MKN-45 (wild-type p53 and MKN-28 (mutant-type p53. RT-PCR and Western Blotting detected cellular BAK gene expression. Cell growth activities were detected by MTT colorimetry and flow cytometry, while apoptosis was assayed by electronic microscopy and TUNEL. Western Blotting and colorimetry investigated cellular caspase-3 activities. Results BAK gene transfer could result in significant BAK overexpression, decreased in vitro growth, cell cycle G0/G1 arrest, and induced apoptosis in gastric cancer cells. In transferred cells, inactive caspase-3 precursor was cleaved into the active subunits p20 and p17, during BAK overexpression-induced apoptosis. In addition, this process occurred equally well in p53 wild-type (MKN-45, or in p53 mutant-type (MKN-28 gastric cancer cells. Conclusions The data presented suggests that overexpression of the BAK gene can lead to apoptosis of gastric cancer cells in vitro, which does not appear to be dependent on p53 status. The action mechanism of BAK mediated apoptosis correlates with activation of caspase-3. This could be served as a potential strategy for further development of gastric cancer therapies.
BAK overexpression mediates p53-independent apoptosis inducing effects on human gastric cancer cells
International Nuclear Information System (INIS)
Tong, Qiang-Song; Zheng, Li-Duan; Wang, Liang; Liu, Jun; Qian, Wei
2004-01-01
BAK (Bcl-2 homologous antagonist/killer) is a novel pro-apoptotic gene of the Bcl-2 family. It has been reported that gastric tumors have reduced BAK levels when compared with the normal mucosa. Moreover, mutations of the BAK gene have been identified in human gastrointestinal cancers, suggesting that a perturbation of BAK-mediated apoptosis may contribute to the pathogenesis of gastric cancer. In this study, we explored the therapeutic effects of gene transfer mediated elevations in BAK expression on human gastric cancer cells in vitro. Eukaryotic expression vector for the BAK gene was constructed and transferred into gastric cancer cell lines, MKN-45 (wild-type p53) and MKN-28 (mutant-type p53). RT-PCR and Western Blotting detected cellular BAK gene expression. Cell growth activities were detected by MTT colorimetry and flow cytometry, while apoptosis was assayed by electronic microscopy and TUNEL. Western Blotting and colorimetry investigated cellular caspase-3 activities. BAK gene transfer could result in significant BAK overexpression, decreased in vitro growth, cell cycle G 0 /G 1 arrest, and induced apoptosis in gastric cancer cells. In transferred cells, inactive caspase-3 precursor was cleaved into the active subunits p20 and p17, during BAK overexpression-induced apoptosis. In addition, this process occurred equally well in p53 wild-type (MKN-45), or in p53 mutant-type (MKN-28) gastric cancer cells. The data presented suggests that overexpression of the BAK gene can lead to apoptosis of gastric cancer cells in vitro, which does not appear to be dependent on p53 status. The action mechanism of BAK mediated apoptosis correlates with activation of caspase-3. This could be served as a potential strategy for further development of gastric cancer therapies
Neitemeier, Sandra; Ganjam, Goutham K; Diemert, Sebastian; Culmsee, Carsten
2014-12-01
Impaired mitochondrial integrity and function are key features of intrinsic death pathways in neuronal cells. Therefore, key regulators of intrinsic death pathways acting upstream of mitochondria are potential targets for therapeutic approaches of neuroprotection. The tumor suppressor p53 is a well-established regulator of cellular responses towards different kinds of lethal stress, including oxidative stress. Recent reports suggested that p53 may affect mitochondrial integrity and function through both, transcriptional activation of mitochondria-targeted pro-death proteins and direct effects at the mitochondrial membrane. In the present study, we compared the effects of pharmacological inhibition of p53 by pifithrin-α with those of selective p53 gene silencing by RNA interference. Using MTT assay and real-time cell impedance measurements we confirmed the protective effect of both strategies against glutamate-induced oxidative stress in immortalized mouse hippocampal HT-22 neurons. Further, we observed full restoration of mitochondrial membrane potential and inhibition of glutamate-induced mitochondrial fragmentation by pifithrin-α which was, in contrast, not achieved by p53 gene silencing. Downregulation of p53 by siRNA decreased p53 transcriptional activity and reduced expression levels of p21 mRNA, while pifithrin-α did not affect these endpoints. These results suggest a neuroprotective effect of pifithrin-α which occurred at the level of mitochondria and independently of p53 inhibition.
Ma, Teng; Yamada, Shumpei; Ichwan, Solachuddin J A; Iseki, Sachiko; Ohtani, Kiyoshi; Otsu, Megumi; Ikeda, Masa-Aki
2012-01-20
The p53 tumor suppressor protein plays key roles in protecting cells from tumorigenesis. Phosphorylation of p53 at Ser46 (p53Ser46) is considered to be a crucial modification regulating p53-mediated apoptosis. Because the activity of p53 is impaired in most human cancers, restoration of wild-type p53 (wt-p53) function by its gene transfer or by p53-reactivating small molecules has been extensively investigated. The p53-reactivating compounds Nutlin-3 and RITA activate p53 in the absence of genotoxic stress by antagonizing the action of its negative regulator Mdm2. Although controversial, Nutlin-3 was shown to induce p53-mediated apoptosis in a manner independent of p53 phosphorylation. Recently, RITA was shown to induce apoptosis by promoting p53Ser46 phosphorylation. Here we examined whether Nutlin-3 or RITA can overcome resistance to p53-mediated apoptosis in p53-resistant tumor cell lines lacking the ability to phosphorylate p53Ser46. We show that Nutlin-3 did not rescue the apoptotic defect of a Ser46 phosphorylation-defective p53 mutant in p53-sensitive tumor cells, and that RITA neither restored p53Ser46 phosphorylation nor induced apoptosis in p53Ser46 phosphorylation-deficient cells retaining wt-p53. Furthermore, treatment with Nutlin-3 or RITA together with adenoviral p53 gene transfer also failed to induce apoptosis in p53Ser46 phosphorylation-deficient cells either expressing or lacking wt-p53. These results indicate that neither Nutlin-3 nor RITA in able to induce p53-mediated apoptosis in the absence of p53Ser46 phosphorylation. Thus, the dysregulation of this phosphorylation in tumor cells may be a critical factor that limits the efficacy of these p53-based cancer therapies. Copyright © 2011 Elsevier Inc. All rights reserved.
International Nuclear Information System (INIS)
Yamauchi, Motohiro; Suzuki, Keiji; Kodama, Seiji; Watanabe, Masami
2004-01-01
Phosphorylation of p53 at Ser15, Thr18, and Ser20 has been thought to be important for p53 stabilization in response to ionizing radiation. In the present study, we examined the X-ray-induced stabilization of Ala-substituted p53 protein at Ser15, Thr18, and Ser20, whose gene expression was controlled under an ecdyson-inducible promoter. We found that all single-, double-, or triple-Ala-substituted p53 at Ser15, Yhr18, and Ser20 were accumulated in the nucleus similarly to wild-type p53 after X-irradiation. These results indicate that the phosphorylation of p53 at Ser15, Thr18, and Ser20 is not necessarily needed for p53 stabilization in response to ionizing radiation
Expression of p53 and p21 in primary glioblastomas
International Nuclear Information System (INIS)
Gross, M.W.; Nashwan, K.; Engenhart-Cabillic, R.; Kraus, A.; Mennel, H.D.; Schlegel, J.
2005-01-01
. Conclusion: p53 protein expression in vivo does not correlate with the outcome of patients with primary GBM. Therefore, p53 protein content per se does not appear to be a helpful prognostic factor for prognosis-adapted therapy in primary GBM. By contrast, primary GBM cells in vitro show different and independent responses in their p53 and p21 pathways to ionizing radiation. The failure of G1 arrest seems to be due to a functional defect in the p53 pathway, either because p21 was not induced or because of an unidentified defect downstream from p21. (orig.)
Glycerol restores the p53 function in human lingual cancer cells bearing mutant p53
International Nuclear Information System (INIS)
Ota, Ichiro; Yane, Katsunari; Yuki, Kazue; Kanata, Hirokazu; Hosoi, Hiroshi; Miyahara, Hiroshi
2001-01-01
Mutations in p53, tumor suppressor gene, have recently been shown to have an impact on the clinical course of several human tumors, including head and neck cancers. The genetic status of the p53 gene has been focused on as the most important candidate among various cancer-related genes for prognosis-predictive assays of cancer therapy. We examined the restoration of radiation- or cisplatin (CDDP)-induced p53-dependent apoptosis in human lingual cancer cells. The results suggest that glycerol is effective in inducing a conformational change of p53 and restoring normal function of mutant p53, leading to enhanced radiosensitivity or chemosensitivity through the induction of apoptosis. We have also represented the same results in vivo as in vitro. Thus, this novel tool for enhancement of radiosensitivity or chemosensitivity in cancer cells bearing m p53 may be applicable for p53-targeted cancer therapy. (author)
The role of p53 in radiation therapy outcomes for favorable-to-intermediate-risk prostate cancer
International Nuclear Information System (INIS)
Ritter, Mark A.; Gilchrist, Kennedy W.; Voytovich, Marta; Chappell, Richard J.; Verhoven, Bret M.
2002-01-01
actuarial biochemical control was found to strongly and independently correlate with p53 status. Patients with higher p53 labeling indices demonstrated significantly higher PSA failure rates (p<0.001). In contrast, p53 status did not correlate with pretreatment PSA, grade, or tumor stage. Similarly, pretreatment PSA (log-rank 0.22), Gleason score (log-rank 0.93), and T stage (log-rank 0.15) were not prognostic for outcome in this group of patients selected for their relatively favorable clinical characteristics. Conclusions: (1) p53 status in pretreatment biopsies strongly predicted for long-term biochemical control after radiation therapy in favorable-to-intermediate-risk prostate cancer patients. (2) If validated in other independent clinical data sets, p53 status should be considered as a stratification factor in future clinical trials and could be useful in guiding treatment. Abnormal p53 status might favor surgical management, aggressive dose escalation, or p53-targeted therapy
Expression of p53, MDM2 in a mice hydradecarcinoma model induced by γ-ray irradiation
International Nuclear Information System (INIS)
Huang Yuecheng; Cai Jianming; Han Ling; Gao Fu; Sun Ding; Dong Zhitao; Zhe Wanli
2004-01-01
Objective: To investigate the role of the p53, MDM2 in carcinogenesis of mice hydradecarcinoma induced by γ-rays. Methods: A radiation-induced mice hydradecarcinoma model was established by γ-ray irradiation. Expression of MDM2 protein in hydradecarcinoma tissue, paracancerous tissue and normal control tissue was detected with Western blot. Immunoprecipitation (IP) was conducted to examine the phosphorylation level of MDM2 protein. PCR-SSCP was performed to detect p53 gene mutation. Results: Compared with the normal control tissue, the MDM2 protein expression and its phosphorylation level were significantly higher in hydradecarcinoma tissue. SSCP showed there were p53 gene mutations in hydradecarcinoma samples. Conclusion: p53/MDM2 pathway may be involved in the development and progression of hydradecarcinoma induced by γ-ray irradiation. The over-expression of MDM2 and hyperphosphorylation may be responsible for malignant transformation induced by irradiation by a possible mechanism of p53 inactivation. The gene mutation of p53 further supported the hypothesis that p53/MDM2 pathway played a central role in carcinogenesis of γray induced hydradecarcinoma. (authors)
High LET radiation enhances apoptosis in mutated p53 cancer cells through Caspase-9 activation
International Nuclear Information System (INIS)
Yamakawa, Nobuhiro; Takahashi, Akihisa; Mori, Eiichiro; Imai, Yuichiro; Ohnishi, Ken; Kirita, Tadaaki; Ohnishi, Takeo; Furusawa, Yoshiya
2008-01-01
Although mutations in the p53 gene can lead to resistance to radiotherapy, chemotherapy and thermotherapy, high linear energy transfer (LET) radiation induces apoptosis regardless of p53 gene status in cancer cells. The aim of this study was to clarify the mechanisms involved in high LET radiation-induced apoptosis. Human gingival cancer cells (Ca9-22 cells) containing a mutated p53 (mp53) gene were irradiated with X-rays, C-ion (13-100 KeV/μm), or Fe-ion beams (200 KeV/μm). Cellular sensitivities were determined using colony forming assays. Apoptosis was detected and quantified with Hoechst 33342 staining. The activity of Caspase-3 was analyzed with Western blotting and flow cytometry. Cells irradiated with high LET radiation showed a high sensitivity with a high frequency of apoptosis induction. The relative biological effectiveness (RBE) values for the surviving fraction and apoptosis induction increased in a LET-dependent manner. Both RBE curves reached a peak at 100 KeV/μm, and then decreased at values over 100 KeV/μm. When cells were irradiated with high LET radiation, Caspase-3 was cleaved and activated, leading to poly (ADP-ribose) polymerase (PARP) cleavage. In addition, Caspase-9 inhibitor suppressed Caspase-3 activation and apoptosis induction resulting from high LET radiation to a greater extent than Caspase-8 inhibitor. These results suggest that high LET radiation enhances apoptosis by activation of Caspase-3 through Caspase-9, even in the presence of mp53. (author)
Wienken, Magdalena; Dickmanns, Antje; Nemajerova, Alice; Kramer, Daniela; Najafova, Zeynab; Weiss, Miriam; Karpiuk, Oleksandra; Kassem, Moustapha; Zhang, Yanping; Lozano, Guillermina; Johnsen, Steven A; Moll, Ute M; Zhang, Xin; Dobbelstein, Matthias
2016-01-07
The MDM2 oncoprotein ubiquitinates and antagonizes p53 but may also carry out p53-independent functions. Here we report that MDM2 is required for the efficient generation of induced pluripotent stem cells (iPSCs) from murine embryonic fibroblasts, in the absence of p53. Similarly, MDM2 depletion in the context of p53 deficiency also promoted the differentiation of human mesenchymal stem cells and diminished clonogenic survival of cancer cells. Most of the MDM2-controlled genes also responded to the inactivation of the Polycomb Repressor Complex 2 (PRC2) and its catalytic component EZH2. MDM2 physically associated with EZH2 on chromatin, enhancing the trimethylation of histone 3 at lysine 27 and the ubiquitination of histone 2A at lysine 119 (H2AK119) at its target genes. Removing MDM2 simultaneously with the H2AK119 E3 ligase Ring1B/RNF2 further induced these genes and synthetically arrested cell proliferation. In conclusion, MDM2 supports the Polycomb-mediated repression of lineage-specific genes, independent of p53. Copyright © 2016 Elsevier Inc. All rights reserved.
Directory of Open Access Journals (Sweden)
Steven N Reuland
Full Text Available Metastatic melanoma has poor prognosis and is refractory to most conventional chemotherapies. The alkylating agent temozolomide (TMZ is commonly used in treating melanoma but has a disappointing response rate. Agents that can act cooperatively with TMZ and improve its efficacy are thus highly sought after. The BH3 mimetic ABT-737, which can induce apoptosis by targeting pro-survival Bcl-2 family members, has been found to enhance the efficacy of many conventional chemotherapeutic agents in multiple cancers. We found that combining TMZ and ABT-737 induced strong synergistic apoptosis in multiple human melanoma cell lines. When the drugs were used in combination in a mouse xenograft model, they drastically reduced tumor growth at concentrations where each individual drug had no significant effect. We found that TMZ treatment elevated p53 levels, and that the pro-apoptotic protein Noxa was elevated in TMZ/ABT-737 treated cells. Experiments with shRNA demonstrated that the synergistic effect of TMZ and ABT-737 was largely dependent on Noxa. Experiments with nutlin-3, a p53 inducer, demonstrated that p53 induction was sufficient for synergistic cell death with ABT-737 in a Noxa-dependent fashion. However, p53 was not necessary for TMZ/ABT-737 synergy as demonstrated by a p53-null line, indicating that TMZ and ABT-737 together induce Noxa in a p53-independent fashion. These results demonstrate that targeting anti-apoptotic Bcl-2 members is a promising method for treating metastatic melanoma, and that clinical trials with TMZ and Bcl-2 inhibitors are warranted.
DEFF Research Database (Denmark)
Øster, Bodil; Bundgaard, B; Hupp, T R
2008-01-01
Here, we demonstrate that human herpesvirus 6B (HHV-6B) infection upregulates the tumour suppressor p53 and induces phosphorylation of p53 at Ser392. Interestingly, phosphorylation at the equivalent site has previously been shown to correlate with p53 tumour suppression in murine models. Although...
p53-Dependent suppression of genome instability in germ cells
Energy Technology Data Exchange (ETDEWEB)
Otozai, Shinji [Department of Otorhinolaryngology and Head and Neck Surgery, Osaka University School of Medicine, Osaka 565-0871 (Japan); Ishikawa-Fujiwara, Tomoko [Department of Radiation Biology and Medical Genetics, Graduate School of Medicine, Osaka University, B4, 2-2 Yamadaoka, Suita, Osaka 565-0871 (Japan); Oda, Shoji [Department of Integrated Biosciences, Graduate School of Frontier Sciences, The University of Tokyo, Chiba 277-8562 (Japan); Kamei, Yasuhiro [Department of Radiation Biology and Medical Genetics, Graduate School of Medicine, Osaka University, B4, 2-2 Yamadaoka, Suita, Osaka 565-0871 (Japan); Ryo, Haruko [Nomura Project, National Institute of Biomedical Innovation, Osaka 565-0085 (Japan); Sato, Ayuko [Department of Pathology, Hyogo College of Medicine, Hyogo 663-8501 (Japan); Nomura, Taisei [Nomura Project, National Institute of Biomedical Innovation, Osaka 565-0085 (Japan); Mitani, Hiroshi [Department of Integrated Biosciences, Graduate School of Frontier Sciences, The University of Tokyo, Chiba 277-8562 (Japan); Tsujimura, Tohru [Department of Pathology, Hyogo College of Medicine, Hyogo 663-8501 (Japan); Inohara, Hidenori [Department of Otorhinolaryngology and Head and Neck Surgery, Osaka University School of Medicine, Osaka 565-0871 (Japan); Todo, Takeshi, E-mail: todo@radbio.med.osaka-u.ac.jp [Department of Radiation Biology and Medical Genetics, Graduate School of Medicine, Osaka University, B4, 2-2 Yamadaoka, Suita, Osaka 565-0871 (Japan)
2014-02-15
Highlights: • Radiation-induced microsatellite instability (MSI) was investigated in medaka fish. • msh2{sup −/−} fish had a high frequency of spontaneous MSI. • p53{sup −/−} fish had a high frequency of radiation-induced MSI. • p53 and msh2 suppress MSI by different pathways: mismatch removal and apoptosis. - Abstract: Radiation increases mutation frequencies at tandem repeat loci. Germline mutations in γ-ray-irradiated medaka fish (Oryzias latipes) were studied, focusing on the microsatellite loci. Mismatch-repair genes suppress microsatellite mutation by directly removing altered sequences at the nucleotide level, whereas the p53 gene suppresses genetic alterations by eliminating damaged cells. The contribution of these two defense mechanisms to radiation-induced microsatellite instability was addressed. The spontaneous mutation frequency was significantly higher in msh2{sup −/−} males than in wild-type fish, whereas there was no difference in the frequency of radiation-induced mutations between msh2{sup −/−} and wild-type fish. By contrast, irradiated p53{sup −/−} fish exhibited markedly increased mutation frequencies, whereas their spontaneous mutation frequency was the same as that of wild-type fish. In the spermatogonia of the testis, radiation induced a high level of apoptosis both in wild-type and msh2{sup −/−} fish, but negligible levels in p53{sup −/−} fish. The results demonstrate that the msh2 and p53 genes protect genome integrity against spontaneous and radiation-induced mutation by two different pathways: direct removal of mismatches and elimination of damaged cells.
p53-Dependent suppression of genome instability in germ cells
International Nuclear Information System (INIS)
Otozai, Shinji; Ishikawa-Fujiwara, Tomoko; Oda, Shoji; Kamei, Yasuhiro; Ryo, Haruko; Sato, Ayuko; Nomura, Taisei; Mitani, Hiroshi; Tsujimura, Tohru; Inohara, Hidenori; Todo, Takeshi
2014-01-01
Highlights: • Radiation-induced microsatellite instability (MSI) was investigated in medaka fish. • msh2 −/− fish had a high frequency of spontaneous MSI. • p53 −/− fish had a high frequency of radiation-induced MSI. • p53 and msh2 suppress MSI by different pathways: mismatch removal and apoptosis. - Abstract: Radiation increases mutation frequencies at tandem repeat loci. Germline mutations in γ-ray-irradiated medaka fish (Oryzias latipes) were studied, focusing on the microsatellite loci. Mismatch-repair genes suppress microsatellite mutation by directly removing altered sequences at the nucleotide level, whereas the p53 gene suppresses genetic alterations by eliminating damaged cells. The contribution of these two defense mechanisms to radiation-induced microsatellite instability was addressed. The spontaneous mutation frequency was significantly higher in msh2 −/− males than in wild-type fish, whereas there was no difference in the frequency of radiation-induced mutations between msh2 −/− and wild-type fish. By contrast, irradiated p53 −/− fish exhibited markedly increased mutation frequencies, whereas their spontaneous mutation frequency was the same as that of wild-type fish. In the spermatogonia of the testis, radiation induced a high level of apoptosis both in wild-type and msh2 −/− fish, but negligible levels in p53 −/− fish. The results demonstrate that the msh2 and p53 genes protect genome integrity against spontaneous and radiation-induced mutation by two different pathways: direct removal of mismatches and elimination of damaged cells
CLCA2 as a p53-Inducible Senescence Mediator
Directory of Open Access Journals (Sweden)
Chizu Tanikawa
2012-02-01
Full Text Available p53 is a tumor suppressor gene that is frequently mutated in multiple cancer tissues. Activated p53 protein regulates its downstream genes and subsequently inhibits malignant transformation by inducing cell cycle arrest, apoptosis, DNA repair, and senescence. However, genes involved in the p53-mediated senescence pathway are not yet fully elucidated. Through the screening of two genome-wide expression profile data sets, one for cells in which exogenous p53 was introduced and the other for senescent fibroblasts, we have identified chloride channel accessory 2 (CLCA2 as a p53-inducible senescence-associated gene. CLCA2 was remarkably induced by replicative senescence as well as oxidative stress in a p53-dependent manner. We also found that ectopically expressed CLCA2 induced cellular senescence, and the down-regulation of CLCA2 by small interfering RNA caused inhibition of oxidative stress-induced senescence. Interestingly, the reduced expression of CLCA2 was frequently observed in various kinds of cancers including prostate cancer, whereas its expression was not affected in precancerous prostatic intraepithelial neoplasia. Thus, our findings suggest a crucial role of p53/CLCA2-mediated senescence induction as a barrier for malignant transformation.
Stabilization and activation of p53 are regulated independently by different phosphorylation events
Chernov, Mikhail V.; Ramana, Chilakamarti V.; Adler, Victor V.; Stark, George R.
1998-01-01
Treatment of mouse or human cells with the protein kinase C (PKC) inhibitors H7 or bisindolylmaleimide I induced an increase in the lifetime of p53, leading to its accumulation. In inhibitor-treated cells, p53 translocated to the nuclei and bound to DNA but was not competent to induce transcription. However, transactivation could be induced by subsequent DNA damage. Phorbol ester, a potent activator of PKC, significantly inhibited the accumulation of p53 after DNA damage. Therefore, constitutive PKC-dependent phosphorylation of p53 itself, or of a protein that interacts with p53, is required for the rapid degradation of p53 in untreated cells. Furthermore, an increase in the lifetime of p53 is not accompanied necessarily by its activation. Treatment with the PKC inhibitors decreased the overall level of p53 phosphorylation but led to the appearance of a phosphopeptide not seen in tryptic digests of p53 from untreated cells. Therefore, the lifetime and activities of p53 are likely to be regulated by distinct alterations of the phosphorylation pattern of p53, probably caused by the actions of different kinases. PMID:9482877
International Nuclear Information System (INIS)
Ohnishi, Takeo
1997-01-01
I report the induced accumulation of wild-type p53 protein of a tumor suppressor gene within 12 h in various organs of rats exposed to X-ray irradiation at low doses (10-50 cGy). The levels of p53 in some organs of irradiated rats were increased about 2- to 3-fold in comparison with the basal p53 levels in non-irradiated rats. Differences in the levels of p53 induction after low-dose X-ray irradiation were observed among the small intestine, bone marrow, brain, liver, adrenal gland, spleen, hypophysis and skin. In contrast, there was no obvious accumulation of p53 protein in the testis and ovary. Thus, the induction of cellular p.53 accumulation by low-dose X-ray irradiation in rats seems to be organ-specific. I consider that cell type, and interactions with other signal transduction pathways of the hormone system, immune system and nervous system may contribute to the variable induction of p53 by low-dose X-ray irradiation. I discussed the induction of p53 by radiation and its biological meaning from an aspect of the defense system for radiation-induced cancer. (author)
International Nuclear Information System (INIS)
Pang Dequan; Wang Peiguo; Wang Ping; Zhang Weiming
2008-01-01
Objective: To investigate the enhancement of radiosensitivity of recombinant Ad-p53 gene on human lung adenocarcinoma cell lines(A549 and GLC-82) with different p53 status in vitro. Methods: Two human lung adenocarcinoma cell lines of A549 and GLC-82 were examined on their difference in p53 status with immunohistochemistry stain and PCR-SSCP technique. Expand Ad-wtp53 was transfected into tumor cells. Clonogenic assays were performed to evaluate the inhibition effect on cell growth and the degree of sensitization to irradiation. Apoptosis and cell cycle changes were determined using the flow cytometry assay. Results: The A549 cell line presented positive P53 expression while GLC-82 negative. GLC-82 bore mutant p53 on the exon 7. The wtp53 gene could be efficiently expressed in the two cell lines and greatly inhibit the cell growth. Its efficiency didn't depend on the intrinsic p53 genetic status. After irradiation, its function of inducing G 1 arrest and apoptosis on GLC-82 cell line was much stronger than the A549 cell line. In both the A549 and GLC-82 cell lines, the combination of Ad-p53 plus radiation resulted in more apoptosis than the others. There was no significant difference between two groups. Conclusions: Ad-p53 can depress the tumor growth and enhance the radiosensitivity of human lung adenocarcinoma cells. And this effect is independent of endogenous p53 status. (authors)
A p53-independent role for the MDM2 antagonist Nutlin-3 in DNA damage response initiation
Directory of Open Access Journals (Sweden)
Kumar Sonia
2011-02-01
Full Text Available Abstract Background The mammalian DNA-damage response (DDR has evolved to protect genome stability and maximize cell survival following DNA-damage. One of the key regulators of the DDR is p53, itself tightly regulated by MDM2. Following double-strand DNA breaks (DSBs, mediators including ATM are recruited to the site of DNA-damage. Subsequent phosphorylation of p53 by ATM and ATM-induced CHK2 results in p53 stabilization, ultimately intensifying transcription of p53-responsive genes involved in DNA repair, cell-cycle checkpoint control and apoptosis. Methods In the current study, we investigated the stabilization and activation of p53 and associated DDR proteins in response to treatment of human colorectal cancer cells (HCT116p53+/+ with the MDM2 antagonist, Nutlin-3. Results Using immunoblotting, Nutlin-3 was observed to stabilize p53, and activate p53 target proteins. Unexpectedly, Nutlin-3 also mediated phosphorylation of p53 at key DNA-damage-specific serine residues (Ser15, 20 and 37. Furthermore, Nutlin-3 induced activation of CHK2 and ATM - proteins required for DNA-damage-dependent phosphorylation and activation of p53, and the phosphorylation of BRCA1 and H2AX - proteins known to be activated specifically in response to DNA damage. Indeed, using immunofluorescent labeling, Nutlin-3 was seen to induce formation of γH2AX foci, an early hallmark of the DDR. Moreover, Nutlin-3 induced phosphorylation of key DDR proteins, initiated cell cycle arrest and led to formation of γH2AX foci in cells lacking p53, whilst γH2AX foci were also noted in MDM2-deficient cells. Conclusion To our knowledge, this is the first solid evidence showing a secondary role for Nutlin-3 as a DDR triggering agent, independent of p53 status, and unrelated to its role as an MDM2 antagonist.
International Nuclear Information System (INIS)
Wouters, An; Pauwels, Bea; Lambrechts, Hilde A.J.; Pattyn, Greet G.O.; Ides, Johan; Baay, Marc; Meijnders, Paul; Peeters, Marc; Vermorken, Jan B.; Lardon, Filip
2011-01-01
Purpose: Whereas radiosensitization by gemcitabine is well studied under normal oxygen conditions, little is known about its radiosensitizing potential under reduced oxygen conditions. Therefore, the present study evaluated the impact of anoxia on gemcitabine-mediated radiosensitization. Methods and Materials: The clonogenic assay was performed in three isogenic A549 cell lines differing in p53 status (24 h, 0-15 nM gemcitabine, 0-8 Gy irradiation, normoxia vs. anoxia). Using radiosensitizing conditions, cells were collected for cell cycle analysis and apoptosis detection. Results: Whereas wild-type p53 A549-LXSN cells were more sensitive to radiation than p53-deficient A549-E6 cells, both cell lines showed similar radiosensitization by gemcitabine under normoxia and anoxia. Independent of p53 functionality, gemcitabine was able to overcome anoxia-induced G 0/1 arrest and established an (early) S phase block in normoxic and anoxic cells. The percentage early and late apoptotic/necrotic cells increased with the gemcitabine/radiation combination, with a significant difference between A549-LXSN and A549-E6. Conclusions: This study is the first to show that gemcitabine retains its radiosensitizing potential under low oxygen conditions. Although radiosensitization was observed in both p53 wild-type and p53-deficient cells, p53 status might influence induction of apoptosis after gemcitabine/radiation treatment, whereas no effect on cell cycle progression was noticed.
Hypoxia-induced p53 modulates both apoptosis and radiosensitivity via AKT
Leszczynska, Katarzyna B.; Foskolou, Iosifina P.; Abraham, Aswin G.; Anbalagan, Selvakumar; Tellier, Céline; Haider, Syed; Span, Paul N.; O’Neill, Eric E.; Buffa, Francesca M.; Hammond, Ester M.
2015-01-01
Restoration of hypoxia-induced apoptosis in tumors harboring p53 mutations has been proposed as a potential therapeutic strategy; however, the transcriptional targets that mediate hypoxia-induced p53-dependent apoptosis remain elusive. Here, we demonstrated that hypoxia-induced p53-dependent apoptosis is reliant on the DNA-binding and transactivation domains of p53 but not on the acetylation sites K120 and K164, which, in contrast, are essential for DNA damage–induced, p53-dependent apoptosis. Evaluation of hypoxia-induced transcripts in multiple cell lines identified a group of genes that are hypoxia-inducible proapoptotic targets of p53, including inositol polyphosphate-5-phosphatase (INPP5D), pleckstrin domain–containing A3 (PHLDA3), sulfatase 2 (SULF2), B cell translocation gene 2 (BTG2), cytoplasmic FMR1-interacting protein 2 (CYFIP2), and KN motif and ankyrin repeat domains 3 (KANK3). These targets were also regulated by p53 in human cancers, including breast, brain, colorectal, kidney, bladder, and melanoma cancers. Downregulation of these hypoxia-inducible targets associated with poor prognosis, suggesting that hypoxia-induced apoptosis contributes to p53-mediated tumor suppression and treatment response. Induction of p53 targets, PHLDA3, and a specific INPP5D transcript mediated apoptosis in response to hypoxia through AKT inhibition. Moreover, pharmacological inhibition of AKT led to apoptosis in the hypoxic regions of p53-deficient tumors and consequently increased radiosensitivity. Together, these results identify mediators of hypoxia-induced p53-dependent apoptosis and suggest AKT inhibition may improve radiotherapy response in p53-deficient tumors. PMID:25961455
Energy Technology Data Exchange (ETDEWEB)
Mohan, Vijay [School of Life Sciences, Central University of Gujarat, Gandhinagar, Gujarat (India); Agarwal, Rajesh [Department of Pharmaceutical Sciences, School of Pharmacy, University of Colorado Denver, Aurora, CO (United States); Singh, Rana P., E-mail: ranaps@hotmail.com [School of Life Sciences, Central University of Gujarat, Gandhinagar, Gujarat (India); Cancer Biology Laboratory, School of Life Sciences, Jawaharlal Nehru University, New Delhi (India)
2016-09-02
Lung cancer is the most frequently diagnosed malignancy that contributes to high proportion of deaths globally among patients who die due to cancer. Chemotherapy remains the common mode of treatment for lung cancer patients though with limited success. We assessed the biological effects and associated molecular changes of evodiamine, a plant alkaloid, on human lung cancer A549 and H1299 cells along with other epithelial cancer and normal lung SAEC cells. Our data showed that 20–40 μM evodiamine treatment for 24–48 h strongly (up to 73%, P < 0.001) reduced the growth and survival of these cancer cells. However, it also moderately inhibited growth and survival of SAEC cells. A strong inhibition (P < 0.001) was observed on clonogenicity of A549 cells. Further, evodiamine increased (4-fold) mitochondrial membrane depolarization with 6-fold increase in apoptosis and a slight increase in Bax/Bcl-2 ratio. It increased the cytochrome-c release from mitochondria into the cytosol as well as nucleus. Cytosolic cytochrome-c activated cascade of caspase-9 and caspase-3 intrinsic pathway, however, DR5 and caspase-8 extrinsic pathway was also activated which could be due to nuclear cytochrome-c. Pan-caspase inhibitor (z-VAD.fmk) partially reversed evodiamine induced apoptosis. An increase in p53 as well as its serine 15 phosphorylation was also observed. Pifithrin-α, a p53 inhibitor, slightly inhibited growth of A549 cells and under p53 inhibitory condition evodiamine-induced apoptosis could not be reversed. Together these findings suggest that evodiamine is a strong inducer of apoptosis in lung epithelial cancer cells independent of their p53 status and that could involve both intrinsic as well as extrinsic pathway of apoptosis. Thus evodiamine could be a potential anticancer agent against lung cancer. - Highlights: • Evodiamine, a novel plant alkaloid, relatively selectively inhibited growth and survival of human lung cancer cells. • Increased cancer cell
The p53-dependent radioadaptive response
Ohnishi, Takeo
We already reported that conditioning exposures at low doses, or at low dose-rates, lowered radiation-induced p53-dependent apoptosis in cultured cells in vitro and in the spleens of mice in vivo. In this study, the aim was to characterize the p53-dependent radioadaptive response at the molecular level. We used wild-type (wt) p53 and mutated (m) p53 containing cells derived from the human lung cancer H1299 cell line, which is p53-null. Cellular radiation sensitivities were determined with a colony-forming assay. The accumulation of p53, Hdm2, and iNOS was analyzed with Western blotting. The quantification of chromosomal aberrations was estimated by scoring dicentrics per cell. In wtp53 cells, it was demonstrated that the lack of p53 accumulation was coupled with the activation of Hdm2 after low dose irradiation (0.02 Gy). Although NO radicals were only minimally induced in wtp53 cells irradiated with a challenging irradiation (6 Gy) alone, NO radicals were seen to increase about 2-4 fold after challenging irradiation following a priming irradiation (0.02 Gy). Under similar irradiation conditions with a priming and challenging irradiation in wtp53 cells, induction of radioresistance and a depression of chromosomal aberrations were observed only in the absence of Pifithrin-α (a p53 inhibitor), RITA or Nutlin-3 (p53-Hdm2 interaction inhibitors), aminoguanidine (an iNOS inhibitor) and c-PTIO (an NO radical scavenger). On the other hand, in p53 dysfunctional cells, a radioadaptive response was not observed in the presence or absence of those inhibitors. Moreover, radioresistance developed when wtp53 cells were treated with ISDN (an NO generating agent) alone. These findings suggest that NO radicals are an initiator of the radioadaptive response acting through the activation of Hdm2 and the depression of p53 accumulations.
International Nuclear Information System (INIS)
Blackstock, A. Wm.; Gill, Misha; Hess, Suzanne M.; Fisher, Robert W.; Leadon, Steven A.; Tepper, Joel E.
1996-01-01
Purpose/Objective: The role of programmed cell death (apoptosis) as a cellular response to cancer therapy such as radiation or chemotherapy is the subject of much study, and manipulation of the apoptotic response in tumor cells may be valuable in the treatment of a variety of cancers. Both p53 dependent and independent apoptotic pathways have been identified; p53 is mutated in at least 50 % of human cancers and a majority of radiation resistant tumors contain p53 mutations. This study is designed to examine the induction of programmed cell death in a human colon carcinoma cell line that possesses two mutated p53 alleles. Ionizing radiation alone, or in combination with the chemotherapeutic drug 5-fluorouracil (5-FU), were used to elicit the apoptotic response. This study will focus on whether these treatments can induce a significant apoptotic response in cells that have mutated p53 alleles. Materials and Methods: HT-29 cells were assessed for clonogenic survival after being plated at a variety of densities, and treated with single graded doses of radiation (0, 1, 2, 4, 6, 8, 10 Gy) either alone or immediately prior to a 24 hour exposure to 5-FU (2 ug/ml). The extent of radiation and 5-FU-induced apoptosis was determined in the HT-29 cell line after single doses of 0, 2, 5, and 10 Gy either alone or immediately prior to a 24 hour incubation in 5-FU (2 ug/ml). Three separate assays were used to evaluate the apoptotic response. Cells undergoing apoptosis undergo gross morphological changes including a condensation of chromatin, membrane blebbing, and an eventual release of membrane bound cytoplasmic fragments. Hematoxylin and eosin staining were used to visualize some of these morphological changes. Another characteristic of the apoptotic response is the activation of an endonuclease that cleaves DNA into specific fragments. Accordingly, an ELISA cell death assay (Boehringer Mannheim, Indianapolis IN) was used to quantitate cytoplasmic histone-associated DNA
Expression of Egr1 and p53 in human carotid plaques and apoptosis induced by 7-oxysterol or p53.
Miah, Sayem; Zadeh, Shahram Nour Mohammad; Yuan, Xi-Ming; Li, Wei
2013-07-01
Egr-1 and p53 are involved in pathology of both atherosclerosis and cancer. However, it is unknown whether p53 and Egr1 are interactively involved in apoptosis in atherosclerosis. We found that in human carotid plaques, the expression of p53 was inversely correlated with Egr1. In U937 cells, 7β-hydroxycholesterol and 7-ketocholesterol induced production of reactive oxygen species (ROS), transient up-regulation of Egr1 followed by late induction of p53 and apoptosis. Cells with nuclear fragmentation induced by 7-oxysterol or p53 showed increased levels of p53, but decreased levels of Egr1. In conclusion, ROS induced by 7-oxysterols may function as an early initiator of Egr1 expression. The late induced p53 by 7-oxysterols contributes to apoptotic cell death and is linked to the reduction of Egr1 levels, which resembles the differential expression of p53 and Egr1 in human atheroma progression. Copyright © 2012 Elsevier GmbH. All rights reserved.
International Nuclear Information System (INIS)
Shu, H.-K.G.; Furman, Felix; Dee, Suzanne; Israel, Mark A.
1997-01-01
Purpose/Objective: Medulloblastoma cell lines readily undergo a p53-mediated apoptosis following exposure to ionizing radiation, while glioma cell lines do not undergo significant levels of apoptosis following irradiation. This study attempts to define some of the molecular events that characterize the differential ability medulloblastomas and gliomas to undergo radiation-induced apoptosis. Materials and Methods: The medulloblastoma cell lines D283 and D341 and the glioma cell lines U87, U343 and U563 were used in this study. All five cell lines were confirmed to have a wild type p53 by their ability to induce p21 protein levels and to undergo a cell-cycle arrest in G1 following treatment with ionizing radiation. Also, 3 clonal derivatives of D283 were used. Two of the clones were derived following transfection with an expression plasmid containing a dominant negative mutant p53 (Arg175 --> His) expressed from the CMV promoter (D283/53.6 and D283/53.7), while the remaining clone was derived following transfection with that same expression plasmid without mutant p53 (D283/vec). All irradiation experiments were performed on Phillips RT-250 X-ray unit using 250 Kvp X-rays. In each case, 5 Gy of ionizing radiation was given at a dose rate of 250 cGy/minute. Apoptosis was quantitated by staining fixed cells with propidium iodide and determining the percentage of cells with subdiploid DNA content by flow cytometry. Northern blot analysis was performed using standard methods. Results: The D283 and D341 cell lines exhibited a significant induction of apoptosis when assayed 2 days following treatment with radiation while the U87, U343 and U563 cell lines displayed only minimal induction of apoptosis when assayed following treatment at that time. RNA was prepared from the different cell lines that were unirradiated, 6 hours or 24 hours post-irradiation. Northern blots were made of the total RNAs and probed for bax, bcl-2 and bcl-x mRNA. This analysis detected no significant
G2-block after irradiation of cells with different p53 status
International Nuclear Information System (INIS)
Zoelzer, Friedo; Jagetia, Ganesh; Streffer, Christian
2014-01-01
Although it is clear that functional p53 is not required for radiation-induced G 2 block, certain experimental findings suggest a role for p53 in this context. For instance, as we also confirm here, the maximum accumulation in the G 2 compartment after X-ray exposure occurs much later in p53 mutants than in wild types. It remains to be seen, however, whether this difference is due to a longer block in the G 2 phase itself. We observed the movement of BrdU-labeled cells through G 2 and M into G 1 . From an analysis of the fraction of labeled cells that entered the second posttreatment cell cycle, we were able to determine the absolute duration of the G 2 and M phases in unirradiated and irradiated cells. Our experiments with four cell lines, two melanomas and two squamous carcinomas, showed that the radiation-induced delay of transition through the G 2 and M phases did not correlate with p53 status. We conclude that looking at the accumulation of cells in the G 2 compartment alone is misleading when differences in the G 2 block are investigated and that the G 2 block itself is indeed independent of functional p53. (orig.) [de
Contribution of caspase-3 differs by p53 status in apoptosis induced by X-irradiation
International Nuclear Information System (INIS)
Kobayashi, Daisuke; Tokino, Takashi; Watanabe, Naoki
2001-01-01
We investigated the effect of p53 status on involvement of caspase-3 activation in cell death induced by X-irradiation, using rat embryonic fibroblasts (REFs) transduced with a temperature-sensitive mutant (mt) p53 gene. Cells with wild-type (wt) p53 showed greater resistance to X-irradiation than cells with mt p53. In cells with wt p53, X-irradiation-induced apoptosis was not inhibited by the caspase-3 inhibitor acetyl-L-aspartyl-L-methionyl-L-glutaminyl-L-aspartyl-aldehyde (Ac-DMQD-CHO) and caspase-3 activity was not elevated following X-irradiation, although induction of p53 and p21/WAF-1 protein was observed. In contrast, irradiated cells with mt p53 showed 89% inhibition of cell death with Ac-DMQD-CHO and 98% inhibition with the antioxidant N-acetyl-L-cysteine (NAC). In cells with mt p53, caspase-3 activity was increased approximately 5 times beyond baseline activity at 24 h after irradiation. This increase was almost completely inhibited by NAC. However, inhibition of caspase-3 by Ac-DMQD-CHO failed to decrease production of reactive oxygen species by cells with mt p53. Differential involvement of caspase-3 is a reason for differences in sensitivity to X-irradiation in cells with different p53 status. Caspase-3 activation appears to occur downstream from generation of reactive oxygen species occurring independently of wt p53 during X-irradiation-induced cell death. (author)
RITA enhances chemosensivity of pre-B ALL cells to doxorubicin by inducing p53-dependent apoptosis.
Kazemi, Ahmad; Safa, Majid; Shahbazi, Atefeh
2011-07-01
The use of low-molecular-weight, non-peptidic molecules that disrupt the interaction between the p53 tumor suppressor and its negative regulator MDM2 has provided a promising alternative for the treatment of different types of cancer. Here, we used small-molecule reactivation of p53 and induction of tumor cell apoptosis (RITA) to sensitize leukemic NALM-6 cells to doxorubicin by upregulating p53 protein. RITA alone effectively inhibited NALM-6 cells viability in dose-dependent manner as measured by 3-(4,5-dimethylthiazolyl-2)-2,5-diphenyltetrazolium bromide assay and induced apoptosis as evaluated by flow cytometry, whereas RITA in combination with doxorubicin enhanced NALM-6 cells to doxorubicin-sensitivity and promoted doxorubicin induced apoptosis. Levels of p53 protein and its proapoptotic target genes, quantified by western blot and real-time PCR respectively, showed that expression of p53 was significantly increased after RITA treatment. Using p53 inhibitors PFT-alpha and PFT-mu it was shown that p53-mediated apoptosis induced by RITA can be regulated by both p53-transcription-dependent and -independent pathways. Moreover, RITA-induced apoptosis was accompanied by the activation of caspase-3 and PARP cleavage. Therefore, exploiting synergistic effects between RITA and chemotherapeutics might be an effective clinical strategy for leukemia chemotherapy.
p53-Independent thermosensitization by mitomycin C in human non-small cell lung carcinoma cells
International Nuclear Information System (INIS)
Jin, Z.-H.; Matsumoto, H.; Hayashi, S.; Shioura, H.; Kitai, R.; Kano, E.; Hatashita, M.
2003-01-01
The combined treatment with hyperthermia and chemotherapeutic drugs such as cisplatin (CDDP), doxorubicin (DOX) and mitomycin C (MMC) has been widely adopted as a strategy of interdisciplinary cancer therapy to obtain greater therapeutic benefits. However, the involved mechanisms of the interactive cytotoxic effects of hyperthermia and MMC remain unclear. To elucidate the relationship between p53 functions and the interactive effects of the combined treatment with mild-hyperthermia and MMC, we examined the potentiation of cytotoxic effects, the induction of apoptosis, the changes in cell cycles and the accumulation of Hsp72 after the combined treatment with hyperthermia at 42 degree C and MMC using human non-small cell lung carcinoma H1299 transfectants with either null, wild-type (wt) or mutant (m) p53 gene. H1299/null, H1299/wtp53 and H1299/mp53 cells showed similar sensitivities to either hyperthermia at 42 degree C alone or MMC alone. The combined treatment resulted in a synergistically enhanced cytotoxicity in H1299 transfectants in a p53-independent manner. The mechanisms involved an enhancement of heat-induced apoptosis and a modulation of the cell cycle distribution by the combined treatment. The accumulation of Hsp72 was not suppressed by the combined treatment, as is not the case of the combined treatment with hyperthermia and either CDDP (1) or bleomycin (2). Our findings demonstrate a p53-independent mechanism for a synergistically cytotoxic enhancement by the combined treatment with mild-hyperthermia and MMC
p53 Aggregates penetrate cells and induce the co-aggregation of intracellular p53.
Directory of Open Access Journals (Sweden)
Karolyn J Forget
Full Text Available Prion diseases are unique pathologies in which the infectious particles are prions, a protein aggregate. The prion protein has many particular features, such as spontaneous aggregation, conformation transmission to other native PrP proteins and transmission from an individual to another. Protein aggregation is now frequently associated to many human diseases, for example Alzheimer's disease, Parkinson's disease or type 2 diabetes. A few proteins associated to these conformational diseases are part of a new category of proteins, called prionoids: proteins that share some, but not all, of the characteristics associated with prions. The p53 protein, a transcription factor that plays a major role in cancer, has recently been suggested to be a possible prionoid. The protein has been shown to accumulate in multiple cancer cell types, and its aggregation has also been reproduced in vitro by many independent groups. These observations suggest a role for p53 aggregates in cancer development. This study aims to test the «prion-like» features of p53. Our results show in vitro aggregation of the full length and N-terminally truncated protein (p53C, and penetration of these aggregates into cells. According to our findings, the aggregates enter cells using macropinocytosis, a non-specific pathway of entry. Lastly, we also show that once internalized by the cell, p53C aggregates can co-aggregate with endogenous p53 protein. Together, these findings suggest prion-like characteristics for p53 protein, based on the fact that p53 can spontaneously aggregate, these aggregates can penetrate cells and co-aggregate with cellular p53.
Directory of Open Access Journals (Sweden)
Luciano de Souza Santos
2017-01-01
Full Text Available Xylopine is an aporphine alkaloid that has cytotoxic activity to cancer cells. In this study, the underlying mechanism of xylopine cytotoxicity was assessed in human colon carcinoma HCT116 cells. Xylopine displayed potent cytotoxicity in different cancer cell lines in monolayer cultures and in a 3D model of cancer multicellular spheroids formed from HCT116 cells. Typical morphology of apoptosis, cell cycle arrest in the G2/M phase, increased internucleosomal DNA fragmentation, loss of the mitochondrial transmembrane potential, and increased phosphatidylserine externalization and caspase-3 activation were observed in xylopine-treated HCT116 cells. Moreover, pretreatment with a caspase-3 inhibitor (Z-DEVD-FMK, but not with a p53 inhibitor (cyclic pifithrin-α, reduced xylopine-induced apoptosis, indicating induction of caspase-mediated apoptosis by the p53-independent pathway. Treatment with xylopine also caused an increase in the production of reactive oxygen/nitrogen species (ROS/RNS, including hydrogen peroxide and nitric oxide, but not superoxide anion, and reduced glutathione levels were decreased in xylopine-treated HCT116 cells. Application of the antioxidant N-acetylcysteine reduced the ROS levels and xylopine-induced apoptosis, indicating activation of ROS-mediated apoptosis pathway. In conclusion, xylopine has potent cytotoxicity to different cancer cell lines and is able to induce oxidative stress and G2/M phase arrest, triggering caspase-mediated apoptosis by the p53-independent pathway in HCT116 cells.
p53 binding protein 1 foci as a biomarker of DNA double strand breaks induced by ionizing radiation
International Nuclear Information System (INIS)
Ng, C.K.M.; Wong, M.Y.P.; Lam, R.K.K.; Ho, J.P.Y.; Chiu, S.K.; Yu, K.N.
2011-01-01
Foci of p53 binding protein 1 (53 BP1) have been used as a biomarker of DNA double-strand breaks (DSBs) in cells induced by ionizing radiations. 53 BP1 was shown to relocalize into foci shortly after irradiation, with the number of foci closely paralleling the number of DNA DSBs. However, consensus on criteria in terms of the numbers of 53 BP1 foci to define cells damaged by direct irradiation or by bystander signals has not been reached, which is partly due to the presence of 53 BP1 also in normal cells. The objective of the present work was to study the changes in the distribution of cells with different numbers of 53 BP1 foci in a cell population after low-dose ionizing irradiation (<0.1 Gy) provided by alpha particles, with a view to propose feasible criteria for defining cells damaged by direct irradiation or by bystander signals. It was proposed that the change in the percentage of cells with 1-3 foci should be used for such purposes. The underlying reasons were discussed.
Stabilization and activation of p53 are regulated independently by different phosphorylation events
Chernov, Mikhail V.; Ramana, Chilakamarti V.; Adler, Victor V.; Stark, George R.
1998-01-01
Treatment of mouse or human cells with the protein kinase C (PKC) inhibitors H7 or bisindolylmaleimide I induced an increase in the lifetime of p53, leading to its accumulation. In inhibitor-treated cells, p53 translocated to the nuclei and bound to DNA but was not competent to induce transcription. However, transactivation could be induced by subsequent DNA damage. Phorbol ester, a potent activator of PKC, significantly inhibited the accumulation of p53 after DNA damage. Therefore, constitut...
Energy Technology Data Exchange (ETDEWEB)
Drane, P.; Alvarez, S.; Meiller, A.; May, E. [CEA Fontenay-aux-Roses, Dept. de Radiobiologie et de Radiopathologie, Lab. de Cancerogenese Moleculaire, CNRS, UMR 217, 92 (France)
2002-03-01
The tumor suppressor gene p53 encodes a protein whose major function is to protect organisms from proliferation of potentially tumorigenic cells. In normal conditions (unstressed cells), the p53 protein is inert and maintained at low level through its association with the Mdm2 oncogene, causing its translocation from the nucleus into the cytoplasm and its degradation through ubiquitin/proteasome pathway. In response to damaged DNA or to a variety of stresses, p53 accumulates in the nucleus and is activated as a transcriptional trans-activator. Posttranslational modifications of p53 including multi-site phosphorylation and acetylation are the major mechanism of p53 regulation. After exposure to ionising radiation, p53 activation implicates ATM, ATR, Chk2 and Chk1 kinases that phosphorylate the N-terminal domain on Ser15 (ATM and/or ATR), and Ser20 (Chk2 and/or Chk1), causing the dissociation of the p53/Mdm2 complex and thereby the stabilisation of p53. The process initiated by {gamma}-irradiation exposure involves also increased interaction of the p53 N-terminal domain with CBP/p300 and P/CAF leading to acetylation of the distant C-terminal domain at Lys 320, 373 and 382. In addition, the ATM-mediated dephosphorylation of Ser376 creates a fixation site for 14-3-3 protein. Taken together, phosphorylation, acetylation and association with co factors induce the stimulation of p53 transcriptional activity resulting in the expression of a set of genes involved, notably, in cell cycle arrest and apoptosis. This stress-induced p53 pathways lead to one of two outcomes: growth arrest or apoptosis and consequently protects the organism from the genotoxic effects of ionising radiation. (author)
P53 overexpression and outcome of radiation therapy in head and neck cancers
International Nuclear Information System (INIS)
Kim, In Ah; Choi, Ihl Bhong; Kang, Ki Mun; Jang, Ji Young; Kim, Kyung Mi; Park, Kyung Shin; Kim, Young Shin; Kang, Chang Suk; Cho, Seung Ho; Kim, Hyung Tae
1999-01-01
Experimental studies have implicated the wild type p53 in cellular response to radiation. Whether altered p53 function can lead to changes in clinical radiocurability remains an area of ongoing study. This study was performed to investigate whether any correlation between change of p53 and outcome of curative radiation therapy in patients with head and neck cancers. Immunohistochemical analysis with a mouse monoclonal antibody (D0-7) specific for human p53 was used to detect to overexpression of protein in formalin fixed, paraffin-embedded tumor sample from 55 head and neck cancer patients treated with curative radiation therapy (median dose of 7020 cGy) from February 1988 to March 1996 at St. Mary's Hospital. Overexpression of p53 was correlated with locoregional control and survival using Kaplan-Meier method. A Cox regression multivariate analysis was performed that included all clinical variables and status of p53 expression. Thirty-seven (67.2%) patients showed overexpression of p53 by immunohistochemical staining in their tumor. One hundred percent of oral cavity, 76% of laryngeal, 66.7% of oropharyngeal, 66.7% of hypopharyngeal cancer showed p53 overexpression (p=0.05). The status of p53 had significant relationship with stage of disease (p=0.03) and history of smoking (p=0.001). The overexpression of p53 was not predictive of response rate to radiation therapy. The locoregional control was not significantly affected by p53 status. Overexpression of p53 didn't have any prognostic implication for disease free survival and overall survival. Primary site and stage of disease were significant prognostic factors for survival. The p53 overexpression as detected by immunohistochemical staining had significant correlation with stage, primary site of disease and smoking habit of patients. The p53 overexpression didn't have any predictive value for outcome of curative radiation therapy in a group of head and neck cancers
P53 overexpression and outcome of radiation therapy in head and neck cancers
Energy Technology Data Exchange (ETDEWEB)
Kim, In Ah; Choi, Ihl Bhong; Kang, Ki Mun; Jang, Ji Young; Kim, Kyung Mi; Park, Kyung Shin; Kim, Young Shin; Kang, Chang Suk; Cho, Seung Ho; Kim, Hyung Tae [College of Medicine, The Catholic Univ., Seoul (Korea, Republic of)
1999-03-01
Experimental studies have implicated the wild type p53 in cellular response to radiation. Whether altered p53 function can lead to changes in clinical radiocurability remains an area of ongoing study. This study was performed to investigate whether any correlation between change of p53 and outcome of curative radiation therapy in patients with head and neck cancers. Immunohistochemical analysis with a mouse monoclonal antibody (D0-7) specific for human p53 was used to detect to overexpression of protein in formalin fixed, paraffin-embedded tumor sample from 55 head and neck cancer patients treated with curative radiation therapy (median dose of 7020 cGy) from February 1988 to March 1996 at St. Mary's Hospital. Overexpression of p53 was correlated with locoregional control and survival using Kaplan-Meier method. A Cox regression multivariate analysis was performed that included all clinical variables and status of p53 expression. Thirty-seven (67.2%) patients showed overexpression of p53 by immunohistochemical staining in their tumor. One hundred percent of oral cavity, 76% of laryngeal, 66.7% of oropharyngeal, 66.7% of hypopharyngeal cancer showed p53 overexpression (p=0.05). The status of p53 had significant relationship with stage of disease (p=0.03) and history of smoking (p=0.001). The overexpression of p53 was not predictive of response rate to radiation therapy. The locoregional control was not significantly affected by p53 status. Overexpression of p53 didn't have any prognostic implication for disease free survival and overall survival. Primary site and stage of disease were significant prognostic factors for survival. The p53 overexpression as detected by immunohistochemical staining had significant correlation with stage, primary site of disease and smoking habit of patients. The p53 overexpression didn't have any predictive value for outcome of curative radiation therapy in a group of head and neck cancers.
International Nuclear Information System (INIS)
Kuo, Kung-Kai; Chen, Yi-Ling; Chen, Lih-Ren; Li, Chien-Feng; Lan, Yu-Hsuan; Chang, Fang-Rong; Wu, Yang-Chang; Shiue, Yow-Ling
2011-01-01
The objective was to investigate the upstream apoptotic mechanisms that were triggered by a styrylpyrone derivative, goniothalamin (GTN), in tumor protein p53 (TP53)-positive and -negative hepatocellular carcinoma (HCC)-derived cells. Effects of GTN were evaluated by the flow cytometry, alkaline comet assay, immunocytochemistry, small-hairpin RNA interference, mitochondria/cytosol fractionation, quantitative reverse transcription-polymerase chain reaction, immunoblotting analysis and caspase 3 activity assays in two HCC-derived cell lines. Results indicated that GTN triggered phorbol-12-myristate-13-acetate-induced protein 1 (PMAIP1, also known as NOXA)-mediated apoptosis via TP53-dependent and -independent pathways. In TP53-positive SK-Hep1 cells, GTN furthermore induced TP53 transcription-dependent and -independent apoptosis. After GTN treatment, accumulation of reactive oxygen species, formation of DNA double-strand breaks, transactivation of TP53 and/or PMAIP1 gene, translocation of TP53 and/or PMAIP1 proteins to mitochondria, release of cytochrome c from mitochondria, cleavage of caspases and induction of apoptosis in both cell lines were sustained. GTN might represent a novel class of anticancer drug that induces apoptosis in HCC-derived cells through PMAIP1 transactivation regardless of the status of TP53 gene. - Highlights: → Goniothalamin (GTN) induced apoptosis in hepatocellular carcinomas-derived cells. → The apoptosis induced by GTN is PMAIP1-dependent, regardless of TP53 status. → The apoptosis induced by GTN might be TP53 transcription-dependent or -independent. → GTN-induced apoptosis is mitochondria- and caspases-mediated.
Hypoxia-induced p53 modulates both apoptosis and radiosensitivity via AKT
Leszczynska, K.B.; Foskolou, I.P.; Abraham, A.G.; Anbalagan, S.; Tellier, C.; Haider, S.; Span, P.N.; O'Neill, E.E.; Buffa, F.M.; Hammond, E.M.
2015-01-01
Restoration of hypoxia-induced apoptosis in tumors harboring p53 mutations has been proposed as a potential therapeutic strategy; however, the transcriptional targets that mediate hypoxia-induced p53-dependent apoptosis remain elusive. Here, we demonstrated that hypoxia-induced p53-dependent
Radiosensitivity of cancer cells against carbon-ion beams in an aspect of the p53 gene status
International Nuclear Information System (INIS)
Takahashi, Akihisa; Ohnishi, Takeo; Matsumoto, Hideki
2004-01-01
We can easily understand that radiation sensitivities of cancer cells are dependent on the status of cancer-related genes. It is important to clarify which genes affect radiation sensitivity and reflect the effectiveness of radiation therapy for cancer cells. We have studied about the function of a tumor suppressor gene of p53, because p53 controls apoptosis, cell cycle and DNA repair from an aspect of important roles in cell fate. By analysis of function of p53 gene, therefore, we aim to predict the therapeutic effectiveness and to select the modalities of cancer therapies such as radiotherapy, chemotherapy and hyperthermia. As a final goal, we want to accept the most effective therapy, namely tailor-made cancer therapy, for each patient. Here, we introduce that carbon-beam therapy induced the expression of p53-independent apoptosis-related genes and NO radicals in mutated p53 cancer cells. (author)
Drosten, Matthias; Sum, Eleanor Y. M.; Lechuga, Carmen G.; Simón-Carrasco, Lucía; Jacob, Harrys K. C.; García-Medina, Raquel; Huang, Sidong; Beijersbergen, Roderick L.; Bernards, Rene; Barbacid, Mariano
2014-01-01
The Ras family of small GTPases constitutes a central node in the transmission of mitogenic stimuli to the cell cycle machinery. The ultimate receptor of these mitogenic signals is the retinoblastoma (Rb) family of pocket proteins, whose inactivation is a required step to license cell proliferation. However, little is known regarding the molecular events that connect Ras signaling with the cell cycle. Here, we provide genetic evidence to illustrate that the p53/p21 Cdk-interacting protein 1 (Cip1)/Rb axis is an essential component of the Ras signaling pathway. Indeed, knockdown of p53, p21Cip1, or Rb restores proliferative properties in cells arrested by ablation of the three Ras loci, H-, N- and K-Ras. Ras signaling selectively inactivates p53-mediated induction of p21Cip1 expression by inhibiting acetylation of specific lysine residues in the p53 DNA binding domain. Proliferation of cells lacking both Ras proteins and p53 can be prevented by reexpression of the human p53 ortholog, provided that it retains an active DNA binding domain and an intact lysine residue at position 164. These results unveil a previously unidentified role for p53 in preventing cell proliferation under unfavorable mitogenic conditions. Moreover, we provide evidence that cells lacking Ras and p53 proteins owe their proliferative properties to the unexpected retroactivation of the Raf/Mek/Erk cascade by a Ras-independent mechanism. PMID:25288756
DEFF Research Database (Denmark)
Wienken, Magdalena; Dickmanns, Antje; Nemajerova, Alice
2016-01-01
The MDM2 oncoprotein ubiquitinates and antagonizes p53 but may also carry out p53-independent functions. Here we report that MDM2 is required for the efficient generation of induced pluripotent stem cells (iPSCs) from murine embryonic fibroblasts, in the absence of p53. Similarly, MDM2 depletion...... in the context of p53 deficiency also promoted the differentiation of human mesenchymal stem cells and diminished clonogenic survival of cancer cells. Most of the MDM2-controlled genes also responded to the inactivation of the Polycomb Repressor Complex 2 (PRC2) and its catalytic component EZH2. MDM2 physically...... associated with EZH2 on chromatin, enhancing the trimethylation of histone 3 at lysine 27 and the ubiquitination of histone 2A at lysine 119 (H2AK119) at its target genes. Removing MDM2 simultaneously with the H2AK119 E3 ligase Ring1B/RNF2 further induced these genes and synthetically arrested cell...
Phosphorylation and nuclear accumulation are distinct events contributing to the activation of p53
International Nuclear Information System (INIS)
O'Hagan, Heather M.; Ljungman, Mats
2004-01-01
It has been recently shown that ionizing radiation (IR) and the mRNA synthesis inhibitor 5,6-dichloro-1-b-D-ribofuranosylbenzimidazole (DRB) act in synergy to induce p53-mediated transactivation of reporter plasmids in human cells [Oncogene 19 (2000) 3829]. We have extended these studies and show that ionizing radiation and DRB also act in synergy to induce ATM-mediated phosphorylation of the ser15 site of p53 and enhance the expression of endogenous p21 protein. Examination of the localization of p53 revealed that while DRB did not induce phosphorylation of the ser15 site of p53 but efficiently accumulated p53 in the nucleus, ionizing radiation induced phosphorylation of the ser15 site of p53 without prolonged nuclear accumulation. Importantly, the combination of DRB and IR resulted in a strong accumulation of phosphorylated p53 in the nucleus that was more persistent then p53 accumulation after IR alone. Furthermore, the nuclear export inhibitor leptomycin B showed a similar synergy with IR as did DRB regarding ser15 phosphorylation of p53 and p21 induction. These results suggest that the synergistic activation of the p53 response by the combination treatment is due to the activation of two distinct pathways where DRB causes the prolonged nuclear accumulation of p53 while ionizing radiation activates p53 by ATM-mediated phosphorylation
Restriction of human herpesvirus 6B replication by p53
DEFF Research Database (Denmark)
Øster, Bodil; Kofod-Olsen, Emil; Bundgaard, Bettina
2008-01-01
Human herpesvirus 6B (HHV-6B) induces significant accumulation of p53 in both the nucleus and cytoplasm during infection. Activation of p53 by DNA damage is known to induce either growth arrest or apoptosis; nevertheless, HHV-6B-infected cells are arrested in their cell cycle independently of p53...
Cisplatinum and Taxol Induce Different Patterns of p53 Phosphorylation
Directory of Open Access Journals (Sweden)
Giovanna Damia
2001-01-01
Full Text Available Posttranslational modifications of p53 induced by two widely used anticancer agents, cisplatinum (DDP and taxol were investigated in two human cancer cell lines. Although both drugs were able to induce phosphorylation at serine 20 (Ser20, only DDP treatment induced p53 phosphorylation at serine 15 (Ser15. Moreover, both drug treatments were able to increase p53 levels and consequently the transcription of waf1 and mdm-2 genes, although DDP treatment resulted in a stronger inducer of both genes. Using two ataxia telangiectasia mutated (ATM cell lines, the role of ATM in druginduced p53 phosphorylations was investigated. No differences in drug-induced p53 phosphorylation could be observed, indicating that ATM is not the kinase involved in these phosphorylation events. In addition, inhibition of DNA-dependent protein kinase activity by wortmannin did not abolish p53 phosphorylation at Ser15 and Ser20, again indicating that DNA-PK is unlikely to be the kinase involved. After both taxol and DDP treatments, an activation of hCHK2 was found and this is likely to be responsible for phosphorylation at Ser20. In contrast, only DDP was able to activate ATR, which is the candidate kinase for phosphorylation of Ser15 by this drug. This data clearly suggests that differential mechanisms are involved in phosphorylation and activation of p53 depending on the drug type.
CK1α ablation in keratinocytes induces p53-dependent, sunburn-protective skin hyperpigmentation.
Chang, Chung-Hsing; Kuo, Che-Jung; Ito, Takamichi; Su, Yu-Ya; Jiang, Si-Tse; Chiu, Min-Hsi; Lin, Yi-Hsiung; Nist, Andrea; Mernberger, Marco; Stiewe, Thorsten; Ito, Shosuke; Wakamatsu, Kazumasa; Hsueh, Yi-An; Shieh, Sheau-Yann; Snir-Alkalay, Irit; Ben-Neriah, Yinon
2017-09-19
Casein kinase 1α (CK1α), a component of the β-catenin destruction complex, is a critical regulator of Wnt signaling; its ablation induces both Wnt and p53 activation. To characterize the role of CK1α (encoded by Csnk1a1 ) in skin physiology, we crossed mice harboring floxed Csnk1a1 with mice expressing K14-Cre-ER T2 to generate mice in which tamoxifen induces the deletion of Csnk1a1 exclusively in keratinocytes [single-knockout (SKO) mice]. As expected, CK1α loss was accompanied by β-catenin and p53 stabilization, with the preferential induction of p53 target genes, but phenotypically most striking was hyperpigmentation of the skin, importantly without tumorigenesis, for at least 9 mo after Csnk1a1 ablation. The number of epidermal melanocytes and eumelanin levels were dramatically increased in SKO mice. To clarify the putative role of p53 in epidermal hyperpigmentation, we established K14-Cre-ER T2 CK1α/p53 double-knockout (DKO) mice and found that coablation failed to induce epidermal hyperpigmentation, demonstrating that it was p53-dependent. Transcriptome analysis of the epidermis revealed p53-dependent up-regulation of Kit ligand (KitL). SKO mice treated with ACK2 (a Kit-neutralizing antibody) or imatinib (a Kit inhibitor) abrogated the CK1α ablation-induced hyperpigmentation, demonstrating that it requires the KitL/Kit pathway. Pro-opiomelanocortin (POMC), a precursor of α-melanocyte-stimulating hormone (α-MSH), was not activated in the CK1α ablation-induced hyperpigmentation, which is in contrast to the mechanism of p53-dependent UV tanning. Nevertheless, acute sunburn effects were successfully prevented in the hyperpigmented skin of SKO mice. CK1α inhibition induces skin-protective eumelanin but no carcinogenic pheomelanin and may therefore constitute an effective strategy for safely increasing eumelanin via UV-independent pathways, protecting against acute sunburn.
Inactivation and inducible oncogenic mutation of p53 in gene targeted pigs.
Directory of Open Access Journals (Sweden)
Simon Leuchs
Full Text Available Mutation of the tumor suppressor p53 plays a major role in human carcinogenesis. Here we describe gene-targeted porcine mesenchymal stem cells (MSCs and live pigs carrying a latent TP53(R167H mutant allele, orthologous to oncogenic human mutant TP53(R175H and mouse Trp53(R172H, that can be activated by Cre recombination. MSCs carrying the latent TP53(R167H mutant allele were analyzed in vitro. Homozygous cells were p53 deficient, and on continued culture exhibited more rapid proliferation, anchorage independent growth, and resistance to the apoptosis-inducing chemotherapeutic drug doxorubicin, all characteristic of cellular transformation. Cre mediated recombination activated the latent TP53(R167H allele as predicted, and in homozygous cells expressed mutant p53-R167H protein at a level ten-fold greater than wild-type MSCs, consistent with the elevated levels found in human cancer cells. Gene targeted MSCs were used for nuclear transfer and fifteen viable piglets were produced carrying the latent TP53(R167H mutant allele in heterozygous form. These animals will allow study of p53 deficiency and expression of mutant p53-R167H to model human germline, or spontaneous somatic p53 mutation. This work represents the first inactivation and mutation of the gatekeeper tumor suppressor gene TP53 in a non-rodent mammal.
Matsumoto, H.; Ohnishi, T.
There has been a recent upsurge of interest in radiation-induced adaptive response and bystander effect which are specific modes in stress response to low-dose low-dose rate radiation Recently we found that the accumulation of inducible nitric oxide NO synthase iNOS in wt p53 cells was induced by chronic irradiation with gamma rays followed by acute irradiation with X-rays but not by each one resulting in an increase in nitrite concentrations of medium It is suggested that the accumulation of iNOS may be due to the depression of acute irradiation-induced p53 functions by pre-chronic irradiation In addition we found that the radiosensitivity of wt p53 cells against acute irradiation with X-rays was reduced after chronic irradiation with gamma rays This reduction of radiosensitivity of wt p53 cells was nearly completely suppressed by the addition of NO scavenger carboxy-PTIO to the medium This reduction of radiosensitivity of wt p53 cells is just radiation-induced adaptive response suggesting that NO-mediated bystander effect may considerably contribute to adaptive response induced by radiation
Fast neutrons-induced apoptosis is Fas-independent in lymphoblastoid cells
International Nuclear Information System (INIS)
Fischer, Barbara; Benzina, Sami; Jeannequin, Pierre; Dufour, Patrick; Bergerat, Jean-Pierre; Denis, Jean-Marc; Gueulette, John; Bischoff, Pierre L.
2005-01-01
We have previously shown that ionizing radiation-induced apoptosis in human lymphoblastoid cells differs according to their p53 status, and that caspase 8-mediated cleavage of BID is involved in the p53-dependent pathway. In the present study, we investigated the role of Fas signaling in caspase 8 activation induced by fast neutrons irradiation in these cells. Fas and FasL expression was assessed by flow cytometry and by immunoblot. We also measured Fas aggregation after irradiation by fluorescence microscopy. We found a decrease of Fas expression after irradiation, but no change in Fas ligand expression. We also showed that, in contrast to the stimulation of Fas by an agonistic antibody, Fas aggregation did not occur after irradiation. Altogether, our data strongly suggest that fast neutrons induced-apoptosis is Fas-independent, even in p53-dependent apoptosis
Pax3 stimulates p53 ubiquitination and degradation independent of transcription.
Directory of Open Access Journals (Sweden)
Xiao Dan Wang
Full Text Available Pax3 is a developmental transcription factor that is required for neural tube and neural crest development. We previously showed that inactivating the p53 tumor suppressor protein prevents neural tube and cardiac neural crest defects in Pax3-mutant mouse embryos. This demonstrates that Pax3 regulates these processes by blocking p53 function. Here we investigated the mechanism by which Pax3 blocks p53 function.We employed murine embryonic stem cell (ESC-derived neuronal precursors as a cell culture model of embryonic neuroepithelium or neural crest. Pax3 reduced p53 protein stability, but had no effect on p53 mRNA levels or the rate of p53 synthesis. Full length Pax3 as well as fragments that contained either the DNA-binding paired box or the homeodomain, expressed as GST or FLAG fusion proteins, physically associated with p53 and Mdm2 both in vitro and in vivo. In contrast, Splotch Pax3, which causes neural tube and neural crest defects in homozygous embryos, bound weakly, or not at all, to p53 or Mdm2. The paired domain and homeodomain each stimulated Mdm2-mediated ubiquitination of p53 and p53 degradation in the absence of the Pax3 transcription regulatory domains, whereas Splotch Pax3 did not stimulate p53 ubiquitination or degradation.Pax3 inactivates p53 function by stimulating its ubiquitination and degradation. This process utilizes the Pax3 paired domain and homeodomain but is independent of DNA-binding and transcription regulation. Because inactivating p53 is the only required Pax3 function during neural tube closure and cardiac neural crest development, and inactivating p53 does not require Pax3-dependent transcription regulation, this indicates that Pax3 is not required to function as a transcription factor during neural tube closure and cardiac neural crest development. These findings further suggest novel explanations for PAX3 functions in human diseases, such as in neural crest-derived cancers and Waardenburg syndrome types 1 and 3.
Chronic ultraviolet exposure-induced p53 gene alterations in sencar mouse skin carcinogenesis model
International Nuclear Information System (INIS)
Tong, Ying; Smith, M.A.; Tucker, S.B.
1997-01-01
Alterations of the tumor suppressor gene p53 have been found in ultraviolet radiation (UVR) related human skin cancers and in UVR-induced murine skin tumors. However, links between p53 gene alterations and the stages of carcinogenesis induced by UVR have not been clearly defined. We established a chronic UVR exposure-induced Sencar mouse skin carcinogenesis model to determine the frequency of p53 gene alterations in different stages of carcinogenesis, including UV-exposed skin, papillomas, squamous-cell carcinomas (SCCs), and malignant spindle-cell tumors (SCTs). A high incidence of SCCs and SCTs were found in this model. Positive p53 nuclear staining was found in 10137 (27%) of SCCs and 12124 (50%) of SCTs, but was not detected in normal skin or papillomas. DNA was isolated from 40 paraffin-embedded normal skin, UV-exposed skin, and tumor sections. The p53 gene (exons 5 and 6) was amplified from the sections by using nested polymerase chain reaction (PCR). Subsequent single-strand conformation polymorphism (SSCP) assay and sequencing analysis revealed one point mutation in exon 6 (coden 193, C → A transition) from a UV-exposed skin sample, and seven point mutations in exon 5 (codens 146, 158, 150, 165, and 161, three C → T, two C → A, one C → G, and one A → T transition, respectively) from four SCTs, two SCCs and one UV-exposed skin sample. These experimental results demonstrate that alterations in the p53 gene are frequent events in chronic UV exposure-induced SCCs and later stage SCTs in Sencar mouse skin. 40 refs., 5 figs., 1 tab
Pre-irradiation at a low dose-rate blunted p53 response
International Nuclear Information System (INIS)
Takahashi, A.; Ohnishi, K.; Asakawa, I.; Tamamoto, T.; Yasumoto, J.; Yuki, K.; Ohnishi, T.; Tachibana, A.
2003-01-01
Full text: We have studied whether the p53-centered signal transduction pathway induced by acute radiation is interfered with chronic pre-irradiation at a low dose-rate in human cultured cells and whole body of mice. In squamous cell carcinoma cells, we found that a challenge irradiation with X-ray immediately after chronic irradiation resulted in lower levels of p53 than those observed after the challenge irradiation alone. In addition, the induction of p53-centered apoptosis and the accumulation of its related proteins after the challenge irradiation were strongly correlated with the above-mentioned phenomena. In mouse spleen, the induction of apoptosis and the accumulation of p53 and Bax were observed dose-dependently at 12 h after a challenge irradiation. In contrast, we found significant suppression of them induced by challenge irradiation at a high dose-rate when mice were pre-irradiated with chronic irradiation at a low dose-rate. These findings suggest that chronic pre-irradiation suppressed the p53 function through radiation-induced p53-dependent signal transduction processes. There are numerous papers about p53 functions in apoptosis, radiosensitivity, genomic instability and cancer incidence in cultured cells or animals. According to our data and other findings, since p53 can prevent carcinogenesis, pre-irradiation at a low dose-rate might enhance the predisposition to cancer. Therefore, it is possible that different maximal permissible dose equivalents for the public populations are appropriate. Furthermore, concerning health of human beings, studies of the adaptive responses to radiation are quite important, because the radiation response strongly depends on experience of prior exposure to radiation
Recent progress of the study of p53 control mechanism by ionizing radiation
International Nuclear Information System (INIS)
Kawai, Hidehiko
2004-01-01
Reviewed are the recent findings on the control mechanism of function and activity of p53 as a response factor to stress of ionizing radiation. The p53 protein is controlled to be essentially inactive in cells under normal conditions and is activated by various stresses. The role of p53 as a stress-responding and tumor-suppressing factor in cells with damaged DNA is discussed in relation with its participation in G1/S and G2/M checkpoints, DNA repair, and apoptosis. The stress like radiation affects the control mechanisms of stability and function of p53 through modification of its N-terminal region (the activation domain of transcription), DNA binding region (core domain) and C-terminal region (domains of the nuclear export signaling, tetramer formation and its own regulation). MDM2 (mouse double minute 2) family, the most important regulatory factor of p53, forms a negative feedback cycle since the family is the target factor of p53 transcription and also suppressor of p53. MDM2 is regulated by phosphorylation and by interaction with itself or other factors like p300/CBP. Further studies on p53 are thus important in various fields as well as in radiation biology. (N.I.)
International Nuclear Information System (INIS)
Tommaso, Anne di; Hagen, Jussara; Tompkins, Van; Muniz, Viviane; Dudakovic, Amel; Kitzis, Alain; Ladeveze, Veronique; Quelle, Dawn E.
2009-01-01
The Alternative Reading Frame (ARF) protein suppresses tumorigenesis through p53-dependent and p53-independent pathways. Most of ARF's anti-proliferative activity is conferred by sequences in its first exon. Previous work showed specific amino acid changes occurred in that region during primate evolution, so we programmed those changes into human p14ARF to assay their functional impact. Two human p14ARF residues (Ala 14 and Thr 31 ) were found to destabilize the protein while two others (Val 24 and Ala 41 ) promoted more efficient p53 stabilization and activation. Despite those effects, all modified p14ARF forms displayed robust p53-dependent anti-proliferative activity demonstrating there are no significant biological differences in p53-mediated growth suppression associated with simian versus human p14ARF residues. In contrast, p53-independent p14ARF function was considerably altered by several residue changes. Val 24 was required for p53-independent growth suppression whereas multiple residues (Val 24 , Thr 31 , Ala 41 and His 60 ) enabled p14ARF to block or reverse the inherent chromosomal instability of p53-null MEFs. Together, these data pinpoint specific residues outside of established p14ARF functional domains that influence its expression and signaling activities. Most intriguingly, this work reveals a novel and direct role for p14ARF in the p53-independent maintenance of genomic stability.
p18(Hamlet) mediates different p53-dependent responses to DNA-damage inducing agents.
Lafarga, Vanesa; Cuadrado, Ana; Nebreda, Angel R
2007-10-01
Cells organize appropriate responses to environmental cues by activating specific signaling networks. Two proteins that play key roles in coordinating stress responses are the kinase p38alpha (MAPK14) and the transcription factor p53 (TP53). Depending on the nature and the extent of the stress-induced damage, cells may respond by arresting the cell cycle or by undergoing cell death, and these responses are usually associated with the phosphorylation of particular substrates by p38alpha as well as the activation of specific target genes by p53. We recently characterized a new p38alpha substrate, named p18(Hamlet) (ZNHIT1), which mediates p53-dependent responses to different genotoxic stresses. Thus, cisplatin or UV light induce stabilization of the p18(Hamlet) protein, which then enhances the ability of p53 to bind to and activate the promoters of pro-apoptotic genes such as NOXA and PUMA leading to apoptosis induction. In a similar way, we report here that p18(Hamlet) can also mediate the cell cycle arrest induced in response to gamma-irradiation, by participating in the p53-dependent upregulation of the cell cycle inhibitor p21(Cip1) (CDKN1A).
DEFF Research Database (Denmark)
Savelyeva, I.; Dobbelstein, M.
2011-01-01
to the suppression of p21 transcription. Depending on the E1A conserved region 3, E1B-defective adenovirus impaired the ability of the transcription factor Sp1 to bind the p21 promoter. Moreover, the amino terminal region of E1A, binding the acetyl transferases p300 and CREB-binding protein, blocked p53 K382...... accumulation of p53, without obvious defects in p53 localization, phosphorylation, conformation and oligomerization. Nonetheless, p53 completely failed to induce its target genes in this scenario, for example, p21/CDKN1A, Mdm2 and PUMA. Two regions of the E1A gene products independently contributed...... acetylation in infected cells. Mutating either of these E1A regions, in addition to E1B, partially restored p21 mRNA levels. Our findings argue that adenovirus attenuates p53-mediated p21 induction, through at least two E1B-independent mechanisms. Other virus species and cancer cells may employ analogous...
International Nuclear Information System (INIS)
Yu Dehua; Fan, Wufang; Liu, Guohong; Nguy, Vivian; Chatterton, Jon E.; Long Shilong; Ke, Ning; Meyhack, Bernd; Bruengger, Adrian; Brachat, Arndt; Wong-Staal, Flossie; Li, Qi-Xiang
2006-01-01
HeLaHF is a non-transformed revertant of HeLa cells, likely resulting from the activation of a putative tumor suppressor(s). p53 protein was stabilized in this revertant and reactivated for certain transactivation functions. Although p53 stabilization has not conclusively been linked to the reversion, it is clear that the genes in p53 pathway are involved. The present study confirms the direct role of p53 in HeLaHF reversion by demonstrating that RNAi-mediated p53 silencing partially restores anchorage-independent growth potential of the revertant through the suppression of anoikis. In addition, we identified a novel gene, named PHTS, with putative tumor suppressor properties, and showed that this gene is also involved in HeLaHF reversion independently of the p53 pathway. Expression profiling revealed that PHTS is one of the genes that is up-regulated in HeLaHF but not in HeLa. It encodes a putative protein with CD59-like domains. RNAi-mediated PHTS silencing resulted in the partial restoration of transformation (anchorage-independent growth) in HeLaHF cells, similar to that of p53 gene silencing, implying its tumor suppressor effect. However, the observed increased transformation potential by PHTS silencing appears to be due to an increased anchorage-independent proliferation rate rather than suppression of anoikis, unlike the effect of p53 silencing. p53 silencing did not affect PHTS gene expression, and vice versa, suggesting PHTS may function in a new and p53-independent tumor suppressor pathway. Furthermore, over-expression of PHTS in different cancer cell lines, in addition to HeLa, reduces cell growth likely via induced apoptosis, confirming the broad PHTS tumor suppressor properties
Relationship between P53 and bystander effect induced by radiated hepatoma cells
International Nuclear Information System (INIS)
Zhao Meijia; Shen Bo; Yuan Dexiao; Cheng Honghong; Shao Chunlin
2009-01-01
The role of p53 in bystander responses on normal liver cells were investigated by co-culturing irradiated hepatoma cells with non-irradiated bystander Chang liver cells. It was found that radiosensitivity of the hepatoma cells was relative to p53. HepG2 cells with wtp53 had the highest radiosensitivity followed by PLC/PRF/5 cells with mtp53 and Hep3B cells with null-p53. The induction of bystander micronucleus(MN) was observed only in the Chang liver cells that had been co-cultured with HepG2 cells but not co-cultured with PLC/PRF/5 or Hep3B. Also, this bystander MN was relative to the irradiation dose and the cell co-culture rime. When the hepatoma cells were treated with pifithrin-α, a p53 inhibitor, their radiosensitivities were reduced, and the bystander effect was diminished. The results indicate that p53 could regulate not only the radiosensitivity but also the bystander response. (authors)
Directory of Open Access Journals (Sweden)
Napapat Amornwichet
Full Text Available BACKGROUND AND PURPOSE: To understand the mechanisms involved in the strong killing effect of carbon-ion beam irradiation on cancer cells with TP53 tumor suppressor gene deficiencies. MATERIALS AND METHODS: DNA damage responses after carbon-ion beam or X-ray irradiation in isogenic HCT116 colorectal cancer cell lines with and without TP53 (p53+/+ and p53-/-, respectively were analyzed as follows: cell survival by clonogenic assay, cell death modes by morphologic observation of DAPI-stained nuclei, DNA double-strand breaks (DSBs by immunostaining of phosphorylated H2AX (γH2AX, and cell cycle by flow cytometry and immunostaining of Ser10-phosphorylated histone H3. RESULTS: The p53-/- cells were more resistant than the p53+/+ cells to X-ray irradiation, while the sensitivities of the p53+/+ and p53-/- cells to carbon-ion beam irradiation were comparable. X-ray and carbon-ion beam irradiations predominantly induced apoptosis of the p53+/+ cells but not the p53-/- cells. In the p53-/- cells, carbon-ion beam irradiation, but not X-ray irradiation, markedly induced mitotic catastrophe that was associated with premature mitotic entry with harboring long-retained DSBs at 24 h post-irradiation. CONCLUSIONS: Efficient induction of mitotic catastrophe in apoptosis-resistant p53-deficient cells implies a strong cancer cell-killing effect of carbon-ion beam irradiation that is independent of the p53 status, suggesting its biological advantage over X-ray treatment.
TP53inp1 Gene Is Implicated in Early Radiation Response in Human Fibroblast Cells
Directory of Open Access Journals (Sweden)
Nikolett Sándor
2015-10-01
Full Text Available Tumor protein 53-induced nuclear protein-1 (TP53inp1 is expressed by activation via p53 and p73. The purpose of our study was to investigate the role of TP53inp1 in response of fibroblasts to ionizing radiation. γ-Ray radiation dose-dependently induces the expression of TP53inp1 in human immortalized fibroblast (F11hT cells. Stable silencing of TP53inp1 was done via lentiviral transfection of shRNA in F11hT cells. After irradiation the clonogenic survival of TP53inp1 knockdown (F11hT-shTP cells was compared to cells transfected with non-targeting (NT shRNA. Radiation-induced senescence was measured by SA-β-Gal staining and autophagy was detected by Acridine Orange dye and microtubule-associated protein-1 light chain 3 (LC3B immunostaining. The expression of TP53inp1, GDF-15, and CDKN1A and alterations in radiation induced mitochondrial DNA deletions were evaluated by qPCR. TP53inp1 was required for radiation (IR induced maximal elevation of CDKN1A and GDF-15 expressions. Mitochondrial DNA deletions were increased and autophagy was deregulated following irradiation in the absence of TP53inp1. Finally, we showed that silencing of TP53inp1 enhances the radiation sensitivity of fibroblast cells. These data suggest functional roles for TP53inp1 in radiation-induced autophagy and survival. Taken together, we suppose that silencing of TP53inp1 leads radiation induced autophagy impairment and induces accumulation of damaged mitochondria in primary human fibroblasts.
Cdk2 is required for p53-independent G2/M checkpoint control.
Directory of Open Access Journals (Sweden)
Jon H Chung
2010-02-01
Full Text Available The activation of phase-specific cyclin-dependent kinases (Cdks is associated with ordered cell cycle transitions. Among the mammalian Cdks, only Cdk1 is essential for somatic cell proliferation. Cdk1 can apparently substitute for Cdk2, Cdk4, and Cdk6, which are individually dispensable in mice. It is unclear if all functions of non-essential Cdks are fully redundant with Cdk1. Using a genetic approach, we show that Cdk2, the S-phase Cdk, uniquely controls the G(2/M checkpoint that prevents cells with damaged DNA from initiating mitosis. CDK2-nullizygous human cells exposed to ionizing radiation failed to exclude Cdk1 from the nucleus and exhibited a marked defect in G(2/M arrest that was unmasked by the disruption of P53. The DNA replication licensing protein Cdc6, which is normally stabilized by Cdk2, was physically associated with the checkpoint regulator ATR and was required for efficient ATR-Chk1-Cdc25A signaling. These findings demonstrate that Cdk2 maintains a balance of S-phase regulatory proteins and thereby coordinates subsequent p53-independent G(2/M checkpoint activation.
DEFF Research Database (Denmark)
Galanos, Panagiotis; Vougas, Konstantinos; Walter, David
2016-01-01
The cyclin-dependent kinase inhibitor p21(WAF1/CIP1) (p21) is a cell-cycle checkpoint effector and inducer of senescence, regulated by p53. Yet, evidence suggests that p21 could also be oncogenic, through a mechanism that has so far remained obscure. We report that a subset of atypical cancerous ...
Effect of radiation combined with p53 gene therapy and endostatin on mouse prostate cancer
International Nuclear Information System (INIS)
Zhang Min; Ren Jun; Xu Bo; Gao Xianshu; He Zhisong; He Xiaoming; Zhang Ming; Liu Chaoxing; He Xinyong; Cao Guangming; Zhang Shaolong
2009-01-01
Objective: To test the hypothesis that p53 gene therapy combined with endostatin can enhance tumor response to radiation therapy of RM-1 mouse xenograft prostate cancer and to investigate its mechanism. Methods: A mouse prostate cancer model was established. Then mice with xenograft tumor were randomly divided into group A (control), B (radiation), C (radiation and rAdp53), D (radiation and rh-endostatin) and E (radiation and rAdp53 and rhendostatin). On day 1, rAdp53 was injected intra-tumorously with 1 x 10 10 vp per animal to group C and E. From day 1 to 14, rh-endostatin was given 15 mg/kg intraperitoneally daily to group D and E. On day 4 single fraction of 15 Gy was given to tumors in groups B, C, D and E. Normal saline was injected intra-tumorously or intraperitoneaUy accordingly as control. No treatment was done to group A. Tumor volume was measured daily. Samples were collected on Days 5, 10 and 15. Ki67, CD31, p53 and VEGF were detected by means of immunohistochemistry. Results: (1) Radiation alone, radiation combined with intra-tumorous injection of Adp53 and/or intraperitoneal injection of rhendostatin resulted in tumor growth arrest of RM-1 cells in vivo (P = 0.000). Radiation combined with both rAdp53 and rhendostatin was the most effective treatment (P < 0.05). (2) All the four treatment groups had a decreased expression of mutant type P53 (P = 0.000). The expression of Ki67 in groups B and C were equal (P 0.05) and increasing (P = 0.000), respectively. Group D had a up-down-up curve (P < 0.05), but group E had a up-down one. On day 5 the expresion of VEGF in group E was the lowest (P < 0.05). An increased expression of MVD compared with the control was shown, and MVD in groups C, D and E were always higher than that in the control (P < 0.05). Conclusions: The limitation of radiotherapy could be overcome by combination with beth p53 gene therapy and endostatin on the growth of mouse prostate cancer cell. Radiation, rAdp53 and endostatin have their
Dose rate effectiveness in radiation-induced teratogenesis in mice
International Nuclear Information System (INIS)
Kato, F.; Ootsuyama, A.; Norimura, T.
2000-01-01
To investigate the role of p53 gene in tissue repair of teratogenic injury, we compared incidence of radiation-induced malformations in homozygous p53(-/-) mice, heterozygous p53(+/-) mice and wild-type p53(+/+) mice. After X-irradiation with 2 Gy at high dose rate on 9.5 days of gestation, p53(-/-) mice showed higher incidences of anomalies and higher resistance to prenatal deaths than p53(+/+) mice. This reciprocal relationship of radiosensitivity to anomalies and deaths supports the notion that embryos or fetuses have a p53-dependent 'guardian' that aborts cells bearing radiation-induced teratogenic DNA damage. In fact, after X-irradiation, the number of apoptotic cells was greatly increased in p53(+/+) fetuses but not in p53(-/-) fetuses. The same dose of γ-ray exposure at low dose rate on 9.5-10.5 day of gestation produced significant reduction of radiation-induced malformation in p53(+/+) and p53(+/-) mice, remained teratogenic for p53(-/-) mice. These results suggest that complete elimination of teratogenic damage from irradiated tissues requires the concerted cooperation of two mechanisms; proficient DNA repair and the p53-dependent apoptotic tissue repair. When concerted DNA repair and apoptosis functions efficiently, there is a threshold dose-rate for radiation-induced malformations. (author)
Directory of Open Access Journals (Sweden)
Karine Z Oben
Full Text Available An understanding of how each individual 5q chromosome critical deleted region (CDR gene contributes to malignant transformation would foster the development of much needed targeted therapies for the treatment of therapy related myeloid neoplasms (t-MNs. Early Growth Response 1 (EGR1 is a key transcriptional regulator of myeloid differentiation located within the 5q chromosome CDR that has been shown to regulate HSC (hematopoietic stem cell quiescence as well as the master regulator of apoptosis-p53. Since resistance to apoptosis is a hallmark of malignant transformation, we investigated the role of EGR1 in apoptosis of bone marrow cells; a cell population from which myeloid malignancies arise. We evaluated radiation induced apoptosis of Egr1+/+ and Egr1-/- bone marrow cells in vitro and in vivo. EGR1 is not required for radiation induced apoptosis of murine bone marrow cells. Neither p53 mRNA (messenger RNA nor protein expression is regulated by EGR1 in these cells. Radiation induced apoptosis of bone marrow cells by double strand DNA breaks induced p53 activation. These results suggest EGR1 dependent signaling mechanisms do not contribute to aberrant apoptosis of malignant cells in myeloid malignancies.
p53 modulates the AMPK inhibitor compound C induced apoptosis in human skin cancer cells
Energy Technology Data Exchange (ETDEWEB)
Huang, Shi-Wei [Institute of Biomedical Sciences, National Chung Hsing University, Taichung, Taiwan (China); Wu, Chun-Ying [Division of Gastroenterology and Hepatology, Taichung Veterans General Hospital, Taichung, Taiwan (China); Wang, Yen-Ting [Department of Medical Research and Education, Cheng Hsin General Hospital, Taipei, Taiwan (China); Kao, Jun-Kai [Institute of Biomedical Sciences, National Chung Hsing University, Taichung, Taiwan (China); Department of Pediatrics, Children' s Hospital, Changhua Christian Hospital, Changhua, Taiwan (China); Lin, Chi-Chen; Chang, Chia-Che; Mu, Szu-Wei; Chen, Yu-Yu [Institute of Biomedical Sciences, National Chung Hsing University, Taichung, Taiwan (China); Chiu, Husan-Wen [Institute of Biotechnology, National Cheng-Kung University, Tainan, Taiwan (China); Agricultural Biotechnology Research Center, Academia Sinica, Taipei, Taiwan (China); Chang, Chuan-Hsun [Department of Surgical Oncology, Cheng Hsin General Hospital, Taipei, Taiwan (China); Department of Nutrition Therapy, Cheng Hsin General Hospital, Taipei, Taiwan (China); School of Nutrition and Health Sciences, Taipei Medical University, Taipei, Taiwan (China); Liang, Shu-Mei [Institute of Biotechnology, National Cheng-Kung University, Tainan, Taiwan (China); Agricultural Biotechnology Research Center, Academia Sinica, Taipei, Taiwan (China); Chen, Yi-Ju [Department of Dermatology, Taichung Veterans General Hospital, Taichung, Taiwan (China); Huang, Jau-Ling [Department of Bioscience Technology, Chang Jung Christian University, Tainan, Taiwan (China); Shieh, Jeng-Jer, E-mail: shiehjj@vghtc.gov.tw [Institute of Biomedical Sciences, National Chung Hsing University, Taichung, Taiwan (China); Department of Education and Research, Taichung Veterans General Hospital, Taichung, Taiwan (China)
2013-02-15
Compound C, a well-known inhibitor of the intracellular energy sensor AMP-activated protein kinase (AMPK), has been reported to cause apoptotic cell death in myeloma, breast cancer cells and glioma cells. In this study, we have demonstrated that compound C not only induced autophagy in all tested skin cancer cell lines but also caused more apoptosis in p53 wildtype skin cancer cells than in p53-mutant skin cancer cells. Compound C can induce upregulation, phosphorylation and nuclear translocalization of the p53 protein and upregulate expression of p53 target genes in wildtype p53-expressing skin basal cell carcinoma (BCC) cells. The changes of p53 status were dependent on DNA damage which was caused by compound C induced reactive oxygen species (ROS) generation and associated with activated ataxia-telangiectasia mutated (ATM) protein. Using the wildtype p53-expressing BCC cells versus stable p53-knockdown BCC sublines, we present evidence that p53-knockdown cancer cells were much less sensitive to compound C treatment with significant G2/M cell cycle arrest and attenuated the compound C-induced apoptosis but not autophagy. The compound C induced G2/M arrest in p53-knockdown BCC cells was associated with the sustained inactive Tyr15 phosphor-Cdc2 expression. Overall, our results established that compound C-induced apoptosis in skin cancer cells was dependent on the cell's p53 status. - Highlights: ► Compound C caused more apoptosis in p53 wildtype than p53-mutant skin cancer cells. ► Compound C can upregulate p53 expression and induce p53 activation. ► Compound C induced p53 effects were dependent on ROS induced DNA damage pathway. ► p53-knockdown attenuated compound C-induced apoptosis but not autophagy. ► Compound C-induced apoptosis in skin cancer cells was dependent on p53 status.
p53 modulates the AMPK inhibitor compound C induced apoptosis in human skin cancer cells
International Nuclear Information System (INIS)
Huang, Shi-Wei; Wu, Chun-Ying; Wang, Yen-Ting; Kao, Jun-Kai; Lin, Chi-Chen; Chang, Chia-Che; Mu, Szu-Wei; Chen, Yu-Yu; Chiu, Husan-Wen; Chang, Chuan-Hsun; Liang, Shu-Mei; Chen, Yi-Ju; Huang, Jau-Ling; Shieh, Jeng-Jer
2013-01-01
Compound C, a well-known inhibitor of the intracellular energy sensor AMP-activated protein kinase (AMPK), has been reported to cause apoptotic cell death in myeloma, breast cancer cells and glioma cells. In this study, we have demonstrated that compound C not only induced autophagy in all tested skin cancer cell lines but also caused more apoptosis in p53 wildtype skin cancer cells than in p53-mutant skin cancer cells. Compound C can induce upregulation, phosphorylation and nuclear translocalization of the p53 protein and upregulate expression of p53 target genes in wildtype p53-expressing skin basal cell carcinoma (BCC) cells. The changes of p53 status were dependent on DNA damage which was caused by compound C induced reactive oxygen species (ROS) generation and associated with activated ataxia-telangiectasia mutated (ATM) protein. Using the wildtype p53-expressing BCC cells versus stable p53-knockdown BCC sublines, we present evidence that p53-knockdown cancer cells were much less sensitive to compound C treatment with significant G2/M cell cycle arrest and attenuated the compound C-induced apoptosis but not autophagy. The compound C induced G2/M arrest in p53-knockdown BCC cells was associated with the sustained inactive Tyr15 phosphor-Cdc2 expression. Overall, our results established that compound C-induced apoptosis in skin cancer cells was dependent on the cell's p53 status. - Highlights: ► Compound C caused more apoptosis in p53 wildtype than p53-mutant skin cancer cells. ► Compound C can upregulate p53 expression and induce p53 activation. ► Compound C induced p53 effects were dependent on ROS induced DNA damage pathway. ► p53-knockdown attenuated compound C-induced apoptosis but not autophagy. ► Compound C-induced apoptosis in skin cancer cells was dependent on p53 status
The effects of combining ionizing radiation and adenoviral p53 therapy in nasopharyngeal carcinoma
International Nuclear Information System (INIS)
Li Jianhua; Lax, Stuart A.; Kim, John; Klamut, Henry; Liu Feifei
1999-01-01
Purpose: Nasopharyngeal carcinoma (NPC) is a malignant disease of the head/neck region, with a 5-year survival level of approximately 65%. To explore gene therapy as a novel approach which might improve outcome, we have shown previously that introduction of human recombinant wild-type p53 mediated by the adenoviral vector (Ad5CMV-p53) was cytotoxic in two human nasopharyngeal carcinoma (NPC) cell lines (CNE-1 and CNE-2Z). The current work was designed to determine whether this strategy, combined with ionizing radiation (XRT), was more effective than either treatment alone. Methods and Materials: CNE-1, CNE-2Z, and a normal human nasopharyngeal fibroblast strain, KS1, were infected with 2- and 6-plaque-forming units (pfu)/cell of Ad5CMV-p53, respectively. These doses were iso-effective for β-galactosidase activity in the CNE-1 and CNE-2Z cells. XRT was administered 24 h post-infection, and Western blot analyses were conducted for p53, p21 WAF1/CIP1 , bax, and bcl-2 2 days after XRT. Cell survival was assessed using a clonogenic assay. Presence of DNA ladders reflecting apoptosis was detected using DNA agarose gel electrophoresis, and cell cycle was analyzed using flow cytometry. Results: The combination of Ad5CMV-p53 plus XRT (2, 4, and 6 Gy) resulted in an approximately 1-log greater level of cytotoxicity compared to that observed with XRT alone for both NPC cell lines. The two modalities appear to be interacting in a synergistic manner in cancer cells, but not in KS1 fibroblasts. XRT alone stimulated minimal p53 expression in control cells; Ad5CMV-p53 alone induced significant recombinant p53 expression, which was not further enhanced by the addition of XRT. Similar observations were made for p21 WAF1/CIP1 expression. No changes were observed for bax or bcl-2 expression with any of these treatments. Apoptosis was induced following 4 Gy of XRT alone, but was observed after only 2 Gy when combined with Ad5CMV-p53. Cell cycle analysis indicated that Ad5CMV-p53
International Nuclear Information System (INIS)
Powell, S.N.; DeFrank, J.S.; Connell, P.; Eogan, M.; Preffer, F.; Dombkowski, D.; Tang, W.; Friend, S.H.
1995-01-01
Purpose: Most drug discovery efforts have focused on finding new DNA damaging agents to kill tumor cells preferentially. An alternative approach is to find ways to increase tumor specific killing by modifying tumor specific responses to that damage. We asked whether cells lacking the G1/S arrest in response to X-rays are more sensitive to X-ray damage when treated with agents that override G2/M arrest. Materials and Methods: Mouse embryonic fibroblasts genetically matched to be (+/+) or (-/-) p53 and rat embryonic fibroblasts (REF) made (+) or (-) for wild-type p53 function by transfection were irradiated with and without caffeine, a known checkpoint inhibitor. Caffeine treatment was maintained for 24 hours from 1 hour prior to irradiation. Cell survival following ionizing radiation was measured by clonogenic assay. For cell-cycle analysis, cells were in exponential asynchronous growth at the time of irradiation. The proportion of cells in G1, S and G2/M phases of the cell cycle were recorded immediately before and following irradiation and subsequently at 3,6,9,12,24 and 48 hours following irradiation. Results: Caffeine was found to cause radiosensitzation at low dose (0.5mM) in (-/-) cells but not in (+/+) cells. The sensitization enhancement ratio (SER) was 1.45 at 0.1 survival and 1.56 at 0.01 survival. At this dose of caffeine, this SER reflected therapeutic gain as there was no detectable effect on (+/+) cells. At 1mM caffeine, sensitization of (-/-) cells was 1.77, but (+/+) cells now also showed sensitization (SER=1.25). In (-/-) cells at 0.1mM caffeine the SER was 1.5 at 0.01 survival. The transfected REF cells (functionally null for p53) also exhibited caffeine-induced radiosensitization at both 0.5 and 2mM caffeine with a SER 1.45 for 2mM at 0.1 survival. No significant sensitization could be demonstrated for REF cells at the same doses of caffeine. The REF cells, with wild-type p53, transfected with pCMVneo alone showed no change in radiosensitivity or
p53-Induced Apoptosis Occurs in the Absence of p14ARF in Malignant Pleural Mesothelioma
Directory of Open Access Journals (Sweden)
Sally Hopkins-Donaldson
2006-07-01
Full Text Available Malignant pleural mesotheliomas (MPMs are usually wild type for the p53 gene but contain homozygous deletions in the INK4A locus that encodes p14ARF, an inhibitor of p53-MDM2 interaction. Previous findings suggest that lack of p14ARF expression and the presence of SV40 large T antigen (L-Tag result in p53 inactivation in MPM. We did not detect SV40 L-Tag mRNA in either MPM cell lines or primary cultures, treatment of p14ARF-deficient cells with cisplatin (CDDP increased both total and phosphorylated p53 and enhanced p53 DNA-binding activity. On incubation with CDDP, levels of positively regulated p53 transcriptional targets p21WAF, PIG3, MDM2, Bax, PUMA increased in p14ARF-deficient cells, whereas negatively regulated survivin decreased. Significantly, p53-induced apoptosis was activated by CDDP in p14ARF-deficient cells, treatment with p53-specific siRNA rendered them more CDDP-resistant. p53 was also activated by: 1 inhibition of MDM2 (using nutlin-3; 2 transient overexpression of p14ARF; and 3 targeting of survivin using antisense oligonucleotides. However, it is noteworthy that only survivin downregulation sensitized cells to CDDP-induced apoptosis. These results suggest that p53 is functional in the absence of p14ARF in MPM and that targeting of the downstream apoptosis inhibitor survivin can sensitize to CDDP-induced apoptosis.
Substrate Stiffness Influences Doxorubicin-Induced p53 Activation via ROCK2 Expression
Directory of Open Access Journals (Sweden)
Takahiro Ebata
2017-01-01
Full Text Available The physical properties of the extracellular matrix (ECM, such as stiffness, are involved in the determination of the characteristics of cancer cells, including chemotherapy sensitivity. Resistance to chemotherapy is often linked to dysfunction of tumor suppressor p53; however, it remains elusive whether the ECM microenvironment interferes with p53 activation in cancer cells. Here, we show that, in MCF-7 breast cancer cells, extracellular stiffness influences p53 activation induced by the antitumor drug doxorubicin. Cell growth inhibition by doxorubicin was increased in response to ECM rigidity in a p53-dependent manner. The expression of Rho-associated coiled coil-containing protein kinase (ROCK 2, which induces the activation of myosin II, was significantly higher when cells were cultured on stiffer ECM substrates. Knockdown of ROCK2 expression or pharmacological inhibition of ROCK decreased doxorubicin-induced p53 activation. Our results suggest that a soft ECM causes downregulation of ROCK2 expression, which drives resistance to chemotherapy by repressing p53 activation.
Pre-irradiation at a low dose-rate blunted p53 response
International Nuclear Information System (INIS)
Takahashi, Akihisa
2002-01-01
We investigated whether chronic irradiation at a low dose-rate interferes with the p53-centered signal transduction pathyway induced by radiation in human cultured cells and C57BL/6N mice. In in vitro experiments, we found that a challenge with X-ray irradiation immediately after chronic irradiation resulted in lower levels of p53 than those observed after the challenge alone in glioblastoma cells (A-172). In addition, the levels of p53-centered apoptosis and its related proteins after the challenge were strongly correlated with the above-mentioned phenomena in squamous cell carcinoma cells (SAS/neo). In in vivo experiments, the accumulation of p53 and Bax, and the induction of apoptosis were observed dose-dependently in mouse spleen at 12 h after a challenge with X-rays (3.0 Gy). However, we found significant suppression of p53 and Bax accumulation and the induction of apoptosis 12 h after challenge irradiation at 3.0 Gy with a high doses-rate following chronic pre-irradiation (1.5 Gy, 0.001 Gy/min). These findings suggest that chronic pre-irradiation suppressed the p53 function through radiation-induced signaling and/or p53 stability. (author)
Doxycyclin induces p53 expression in SaOs (osteosarcoma) cell line ...
African Journals Online (AJOL)
The p53 tumour suppressor gene plays an important role in preventing cancer development. This study determined if p53 can be induced in osteosarcoma cell line upon treatment ... represent an important component of the p53 tumor suppressor pathway. Keywords: Tumor suppressor, oncogene, mdm2, cyclinE, apoptosis ...
Viral single-strand DNA induces p53-dependent apoptosis in human embryonic stem cells.
Hirsch, Matthew L; Fagan, B Matthew; Dumitru, Raluca; Bower, Jacquelyn J; Yadav, Swati; Porteus, Matthew H; Pevny, Larysa H; Samulski, R Jude
2011-01-01
Human embryonic stem cells (hESCs) are primed for rapid apoptosis following mild forms of genotoxic stress. A natural form of such cellular stress occurs in response to recombinant adeno-associated virus (rAAV) single-strand DNA genomes, which exploit the host DNA damage response for replication and genome persistence. Herein, we discovered a unique DNA damage response induced by rAAV transduction specific to pluripotent hESCs. Within hours following rAAV transduction, host DNA damage signaling was elicited as measured by increased gamma-H2AX, ser15-p53 phosphorylation, and subsequent p53-dependent transcriptional activation. Nucleotide incorporation assays demonstrated that rAAV transduced cells accumulated in early S-phase followed by the induction of apoptosis. This lethal signaling sequalae required p53 in a manner independent of transcriptional induction of Puma, Bax and Bcl-2 and was not evident in cells differentiated towards a neural lineage. Consistent with a lethal DNA damage response induced upon rAAV transduction of hESCs, empty AAV protein capsids demonstrated no toxicity. In contrast, DNA microinjections demonstrated that the minimal AAV origin of replication and, in particular, a 40 nucleotide G-rich tetrad repeat sequence, was sufficient for hESC apoptosis. Our data support a model in which rAAV transduction of hESCs induces a p53-dependent lethal response that is elicited by a telomeric sequence within the AAV origin of replication.
Viral single-strand DNA induces p53-dependent apoptosis in human embryonic stem cells.
Directory of Open Access Journals (Sweden)
Matthew L Hirsch
Full Text Available Human embryonic stem cells (hESCs are primed for rapid apoptosis following mild forms of genotoxic stress. A natural form of such cellular stress occurs in response to recombinant adeno-associated virus (rAAV single-strand DNA genomes, which exploit the host DNA damage response for replication and genome persistence. Herein, we discovered a unique DNA damage response induced by rAAV transduction specific to pluripotent hESCs. Within hours following rAAV transduction, host DNA damage signaling was elicited as measured by increased gamma-H2AX, ser15-p53 phosphorylation, and subsequent p53-dependent transcriptional activation. Nucleotide incorporation assays demonstrated that rAAV transduced cells accumulated in early S-phase followed by the induction of apoptosis. This lethal signaling sequalae required p53 in a manner independent of transcriptional induction of Puma, Bax and Bcl-2 and was not evident in cells differentiated towards a neural lineage. Consistent with a lethal DNA damage response induced upon rAAV transduction of hESCs, empty AAV protein capsids demonstrated no toxicity. In contrast, DNA microinjections demonstrated that the minimal AAV origin of replication and, in particular, a 40 nucleotide G-rich tetrad repeat sequence, was sufficient for hESC apoptosis. Our data support a model in which rAAV transduction of hESCs induces a p53-dependent lethal response that is elicited by a telomeric sequence within the AAV origin of replication.
Andrographolide induces degradation of mutant p53 via activation of Hsp70.
Sato, Hirofumi; Hiraki, Masatsugu; Namba, Takushi; Egawa, Noriyuki; Baba, Koichi; Tanaka, Tomokazu; Noshiro, Hirokazu
2018-05-22
The tumor suppressor gene p53 encodes a transcription factor that regulates various cellular functions, including DNA repair, apoptosis and cell cycle progression. Approximately half of all human cancers carry mutations in p53 that lead to loss of tumor suppressor function or gain of functions that promote the cancer phenotype. Thus, targeting mutant p53 as an anticancer therapy has attracted considerable attention. In the current study, a small-molecule screen identified andrographlide (ANDRO) as a mutant p53 suppressor. The effects of ANDRO, a small molecule isolated from the Chinese herb Andrographis paniculata, on tumor cells carrying wild-type or mutant p53 were examined. ANDRO suppressed expression of mutant p53, induced expression of the cyclin-dependent kinase inhibitor p21 and pro-apoptotic proteins genes, and inhibited the growth of cancer cells harboring mutant p53. ANDRO also induced expression of the heat-shock protein (Hsp70) and increased binding between Hsp70 and mutant p53 protein, thus promoting proteasomal degradation of p53. These results provide novel insights into the mechanisms regulating the function of mutant p53 and suggest that activation of Hsp70 may be a new strategy for the treatment of cancers harboring mutant p53.
Zhukova, Nataliya; Ramaswamy, Vijay; Remke, Marc; Martin, Dianna C; Castelo-Branco, Pedro; Zhang, Cindy H; Fraser, Michael; Tse, Ken; Poon, Raymond; Shih, David J H; Baskin, Berivan; Ray, Peter N; Bouffet, Eric; Dirks, Peter; von Bueren, Andre O; Pfaff, Elke; Korshunov, Andrey; Jones, David T W; Northcott, Paul A; Kool, Marcel; Pugh, Trevor J; Pomeroy, Scott L; Cho, Yoon-Jae; Pietsch, Torsten; Gessi, Marco; Rutkowski, Stefan; Bognár, Laszlo; Cho, Byung-Kyu; Eberhart, Charles G; Conter, Cecile Faure; Fouladi, Maryam; French, Pim J; Grajkowska, Wieslawa A; Gupta, Nalin; Hauser, Peter; Jabado, Nada; Vasiljevic, Alexandre; Jung, Shin; Kim, Seung-Ki; Klekner, Almos; Kumabe, Toshihiro; Lach, Boleslaw; Leonard, Jeffrey R; Liau, Linda M; Massimi, Luca; Pollack, Ian F; Ra, Young Shin; Rubin, Joshua B; Van Meir, Erwin G; Wang, Kyu-Chang; Weiss, William A; Zitterbart, Karel; Bristow, Robert G; Alman, Benjamin; Hawkins, Cynthia E; Malkin, David; Clifford, Steven C; Pfister, Stefan M; Taylor, Michael D; Tabori, Uri
2014-12-24
TP53 mutations confer subgroup specific poor survival for children with medulloblastoma. We hypothesized that WNT activation which is associated with improved survival for such children abrogates TP53 related radioresistance and can be used to sensitize TP53 mutant tumors for radiation. We examined the subgroup-specific role of TP53 mutations in a cohort of 314 patients treated with radiation. TP53 wild-type or mutant human medulloblastoma cell-lines and normal neural stem cells were used to test radioresistance of TP53 mutations and the radiosensitizing effect of WNT activation on tumors and the developing brain. Children with WNT/TP53 mutant medulloblastoma had higher 5-year survival than those with SHH/TP53 mutant tumours (100% and 36.6%±8.7%, respectively (p<0.001)). Introduction of TP53 mutation into medulloblastoma cells induced radioresistance (survival fractions at 2Gy (SF2) of 89%±2% vs. 57.4%±1.8% (p<0.01)). In contrast, β-catenin mutation sensitized TP53 mutant cells to radiation (p<0.05). Lithium, an activator of the WNT pathway, sensitized TP53 mutant medulloblastoma to radiation (SF2 of 43.5%±1.5% in lithium treated cells vs. 56.6±3% (p<0.01)) accompanied by increased number of γH2AX foci. Normal neural stem cells were protected from lithium induced radiation damage (SF2 of 33%±8% for lithium treated cells vs. 27%±3% for untreated controls (p=0.05). Poor survival of patients with TP53 mutant medulloblastoma may be related to radiation resistance. Since constitutive activation of the WNT pathway by lithium sensitizes TP53 mutant medulloblastoma cells and protect normal neural stem cells from radiation, this oral drug may represent an attractive novel therapy for high-risk medulloblastomas.
Directory of Open Access Journals (Sweden)
Ruth Villalonga-Planells
2011-04-01
Full Text Available Glioblastoma multiforme (GBM is the most common and aggressive primary brain tumor in adults. Despite concerted efforts to improve current therapies and develop novel clinical approaches, patient survival remains poor. As such, increasing attention has focused on developing new therapeutic strategies that specifically target the apoptotic pathway in order to improve treatment responses. Recently, nutlins, small-molecule antagonists of MDM2, have been developed to inhibit p53-MDM2 interaction and activate p53 signaling in cancer cells. Glioma cell lines and primary cultured glioblastoma cells were treated with nutlin-3a. Nutlin-3a induced p53-dependent G1- and G2-M cell cycle arrest and apoptosis in glioma cell lines with normal TP53 status. In addition, nutlin-arrested glioma cells show morphological features of senescence and persistent induction of p21 protein. Furthermore, senescence induced by nutlin-3a might be depending on mTOR pathway activity. In wild-type TP53 primary cultured cells, exposure to nutlin-3a resulted in variable degrees of apoptosis as well as cellular features of senescence. Nutlin-3a-induced apoptosis and senescence were firmly dependent on the presence of functional p53, as revealed by the fact that glioblastoma cells with knockdown p53 with specific siRNA, or cells with mutated or functionally impaired p53 pathway, were completely insensitive to the drug. Finally, we also found that nutlin-3a increased response of glioma cells to radiation therapy. The results provide a basis for the rational use of MDM2 antagonists as a novel treatment option for glioblastoma patients.
Analysis of the K-ras and p53 pathways in x-ray-induced lung tumors in the rat
Energy Technology Data Exchange (ETDEWEB)
Belinsky, S.A.; Middleton, S.K.; Hahn, F.F.; Nikula, K.J. [Inhalation Toxicology Research Inst., Albuquerque, NM (United States); Picksley, S.M. [Medical Sciences Inst., Dundee (United Kingdom)
1996-04-01
The risk from exposure to low-dose radiation in conjunction with cigarette smoking has not been estimated due in part to lmited knowledge surrounding the molecular mechanisms underlying radiation-induced cancers. The purpose of this investigation was to determine the frequency for alterations in genes within the K-ras and p53 signal and cell cycle regulatory pathways, respectively, in X-ray-induced lung tumors in the F344/N rat. These tumors were examined for genetic alterations in the K-ras, c-raf-1, p53, mdm2 and cip1 genes. No K-ras mutations were detected by sequencing in 18 squamous cell carcinomas (SCCs) or 17 adenocarcinomas. However, using a K-ras codon 12 mutation selection assay, a codon 12 GGT {r_arrow} GAT mutation was detected in one SCC, suggesting that activation of the K-ras proto-oncogene is both a rare and late event. Single-strand conformation polymorphism (SSCP) analysis of the kinase-binding domain of the c-raf-1 gene did not detect any polymorphisms. Three of 18 SCCs but none of the adenocarcinomas showed p53 nuclear immunoreactivity. Single-strand conformation polymorphism analysis of exons 4-9 of the p53 gene detected only an exon 9 mutation in one SCC. Mutations were not detected in the three SCCs with immunoreactive p53 protein. No amplification of the mdm2 gene was detected; however, nuclear mdm2 immunoreactivity was present in one of the three SCCs that stained positive for the p53 protein. The complete cDNA of the rat cip1 gene comprising 810 bases was cloned and sequenced. The frequency of somatic mutations in exon 2 of the cip1 gene was determined by SSCP analysis. No alterations in electrophoretic mobility were detected. The results of this investigation indicate that alterations in the K-ras and p53 pathways do not play a major role in the genesis of X-ray-induced lung tumors in the rat. 49 refs., 5 figs.
International Nuclear Information System (INIS)
Saintigny, Yannick
1999-01-01
The control of cell cycle, associated with the mechanisms of replication, DNA repair/recombination allows the cells to maintain their genetic integrity. The p53 protein ensures the control of G1/S transition. Its inactivation would allow to initial replication on damaged matrix and lead to the block of replication forks followed by DNA strand breaks, good substrates for recombination. This work shows that the expression of mutant p53 protein stimulates both spontaneous and radio-induced homologous recombination, independently of the control of cell cycle. Moreover, the use of a set of replication inhibitors show that inhibition of the replication elongation stimulates recombination more strongly than the initiation inhibition. Replication arrest by these inhibitors also significantly increases the number of DNA strand breaks. These results highlighted a point of action of p53 protein on the ultimate stages of the homologous recombination mechanism. Lastly, the expression of Bcl-2 protein inhibits apoptosis and increases survival, but specifically inhibits conservative recombination, after radiation as well as in absence of apoptotic stress. The extinction of this mechanism of DNA repair is associated with an increase of mutagenesis. Taken together, these results allow ta consider the maintenance of the genetic stability as a cellular network involving different pathways. A multiple stages model for tumoral progression can be deduced. (author) [fr
Role of p53 status in radiation sensitivity and cell cycle progression
International Nuclear Information System (INIS)
Zellars, Richard C.; Loney, Tania; Schott, Ann F.; Davis, Mary A.; Maybaum, Jonathan; Clarke, Michael F.; Lawrence, Theodore S.
1995-01-01
Purpose: Although p53 function plays a major role in G1 arrest after radiation, the influence of p53 status on progress through other phases of the cell cycle and on radiation sensitivity of human tumors is less clear. We investigated these issues using cells with a conditional expression system for wild type p53. Methods: A temperature sensitive murine wild type p53 plasmid was used (Ginsberg D, et al: Mol. Cell.Biol . 11:582, 1991). At the permissive temperature (32 deg. C), this plasmid produces a protein which assumes a conformation that exhibits wild type p53 function. However, when cells are cultured at 38 deg. C, this protein assumes an inactive conformation. HT29 human colon cancer cells (which are p53 mutant) were transduced with this plasmid (designated PEP A and PEP G cells) or a control vector (designated CCH1 cells) using electroporation and Geneticin selection. The presence of murine p53 transcript in the PEP cells was confirmed by Northern analysis. Results: Cells were cultured under 3 conditions: 1) 38 deg. C at all times; 2) 32 deg. C for 24 hours prior to irradiation and 3) 32 deg. C for 24 hours after irradiation. We found that culturing under permissive temperatures produced a small decrease in surviving fraction in the PEP clones (0.61 ± 0.10 and 0.64 ± 0.07, for PEP A and G, respectively) but not the CCH1 controls (1.14 ± 0.15). PEP cells tended to be more radiosensitive than CCH1 cells (even under non-permissive conditions) and demonstrated a trend towards increased radiosensitivity under both Conditions 2 and 3. In addition, flow cytometry revealed that a 24 hour exposure to permissive conditions increased the fraction of cells in G1 slightly and in G2/M substantially. S phase was almost absent. Conclusion: Restoration of p53 function in HT29 human colon cancer cells using this temperature sensitive system produced increased cytotoxicity and radiation sensitivity as well as cell cycle redistribution. It will be important to assess the
Ishizawa, Jo; Kojima, Kensuke; Chachad, Dhruv; Ruvolo, Peter; Ruvolo, Vivian; Jacamo, Rodrigo O; Borthakur, Gautam; Mu, Hong; Zeng, Zhihong; Tabe, Yoko; Allen, Joshua E; Wang, Zhiqiang; Ma, Wencai; Lee, Hans C; Orlowski, Robert; Sarbassov, Dos D; Lorenzi, Philip L; Huang, Xuelin; Neelapu, Sattva S; McDonnell, Timothy; Miranda, Roberto N; Wang, Michael; Kantarjian, Hagop; Konopleva, Marina; Davis, R Eric; Andreeff, Michael
2016-02-16
The clinical challenge posed by p53 abnormalities in hematological malignancies requires therapeutic strategies other than standard genotoxic chemotherapies. ONC201 is a first-in-class small molecule that activates p53-independent apoptosis, has a benign safety profile, and is in early clinical trials. We found that ONC201 caused p53-independent apoptosis and cell cycle arrest in cell lines and in mantle cell lymphoma (MCL) and acute myeloid leukemia (AML) samples from patients; these included samples from patients with genetic abnormalities associated with poor prognosis or cells that had developed resistance to the nongenotoxic agents ibrutinib and bortezomib. Moreover, ONC201 caused apoptosis in stem and progenitor AML cells and abrogated the engraftment of leukemic stem cells in mice while sparing normal bone marrow cells. ONC201 caused changes in gene expression similar to those caused by the unfolded protein response (UPR) and integrated stress responses (ISRs), which increase the translation of the transcription factor ATF4 through an increase in the phosphorylation of the translation initiation factor eIF2α. However, unlike the UPR and ISR, the increase in ATF4 abundance in ONC201-treated hematopoietic cells promoted apoptosis and did not depend on increased phosphorylation of eIF2α. ONC201 also inhibited mammalian target of rapamycin complex 1 (mTORC1) signaling, likely through ATF4-mediated induction of the mTORC1 inhibitor DDIT4. Overexpression of BCL-2 protected against ONC201-induced apoptosis, and the combination of ONC201 and the BCL-2 antagonist ABT-199 synergistically increased apoptosis. Thus, our results suggest that by inducing an atypical ISR and p53-independent apoptosis, ONC201 has clinical potential in hematological malignancies. Copyright © 2016, American Association for the Advancement of Science.
Ewing, SJ; Zhu, S; Zhu, F; House, JS; Smart, RC
2013-01-01
CCAAT/enhancer-binding protein-β (C/EBPβ) is a mediator of cell survival and tumorigenesis. When C/EBPβ−/− mice are treated with carcinogens that produce oncogenic Ras mutations in keratinocytes, they respond with abnormally elevated keratinocyte apoptosis and a block in skin tumorigenesis. Although this aberrant carcinogen-induced apoptosis results from abnormal upregulation of p53, it is not known whether upregulated p53 results from oncogenic Ras and its ability to induce p19Arf and/or activate DNA-damage response pathways or from direct carcinogen-induced DNA damage. We report that p19Arf is dramatically elevated in C/EBPβ−/− epidermis and that C/EBPβ represses a p19Arf promoter reporter. To determine whether p19Arf is responsible for the proapoptotic phenotype in C/EBPβ−/− mice, C/EBPβ−/−;p19Arf−/− mice were generated. C/EBPβ−/−;p19Arf−/− mice responded to carcinogen treatment with increased p53 and apoptosis, indicating p19Arf is not essential. To ascertain whether oncogenic Ras activation induces aberrant p53 and apoptosis in C/EBPβ−/− epidermis, we generated K14-ER:Ras; C/EBPβ−/− mice. Oncogenic Ras activation induced by 4-hydroxytamoxifen did not produce increased p53 or apoptosis. Finally, when C/EBPβ−/− mice were treated with differing types of DNA-damaging agents, including alkylating chemotherapeutic agents, they displayed aberrant levels of p53 and apoptosis. These results indicate that C/EBPβ represses p53 to promote cell survival downstream of DNA damage and suggest that inhibition of C/EBPβ may be a target for cancer cotherapy to increase the efficacy of alkylating chemotherapeutic agents. PMID:18636078
Marx, Christian; Marx-Blümel, Lisa; Lindig, Nora; Thierbach, René; Hoelzer, Doerte; Becker, Sabine; Wittig, Susan; Lehmann, Roland; Slevogt, Hortense; Heinzel, Thorsten; Wang, Zhao-Qi; Beck, James F; Sonnemann, Jürgen
2018-06-01
The sirtuin 1/2 inhibitor tenovin-1 activates p53 and may have potential in the management of cancer. Here, we investigated the responsiveness of Ewing's sarcoma cells to tenovin-1. We examined its effects in two Ewing's sarcoma cell lines with different p53 status, i.e. in p53 wild-type and p53 null cells. Effects were assessed by flow cytometric analyses of cell death, mitochondrial membrane depolarization and reactive oxygen species (ROS) generation, by caspase 3/7 activity measurement, by mRNA expression profiling and by immunoblotting. Tenovin-1 elicited caspase-mediated cell death in p53 wild-type cells, but caspase-independent cell death in p53 null cells. Remarkably, it induced a nonlinear concentration response in the latter: low concentrations of tenovin-1 were much more effective than were higher concentrations. Tenovin-1's effects in p53 null cells involved gene expression changes of Bcl-2 family members, mitochondrial membrane depolarization, nuclear translocation of apoptosis-inducing factor, ROS formation and DNA damage; all these effects followed a bell-shaped pattern. In conclusion, our results provide new insights into tenovin-1's mode of action by demonstrating that it can induce different pathways of cell death.
Polato, Federica; Rusconi, Paolo; Zangrossi, Stefano; Morelli, Federica; Boeri, Mattia; Musi, Alberto; Marchini, Sergio; Castiglioni, Vittoria; Scanziani, Eugenio; Torri, Valter; Broggini, Massimo
2014-04-01
p53 influences genomic stability, apoptosis, autophagy, response to stress, and DNA damage. New p53-target genes could elucidate mechanisms through which p53 controls cell integrity and response to damage. DRAGO (drug-activated gene overexpressed, KIAA0247) was characterized by bioinformatics methods as well as by real-time polymerase chain reaction, chromatin immunoprecipitation and luciferase assays, time-lapse microscopy, and cell viability assays. Transgenic mice (94 p53(-/-) and 107 p53(+/-) mice on a C57BL/6J background) were used to assess DRAGO activity in vivo. Survival analyses were performed using Kaplan-Meier curves and the Mantel-Haenszel test. All statistical tests were two-sided. We identified DRAGO as a new p53-responsive gene induced upon treatment with DNA-damaging agents. DRAGO is highly conserved, and its ectopic overexpression resulted in growth suppression and cell death. DRAGO(-/-) mice are viable without macroscopic alterations. However, in p53(-/-) or p53(+/-) mice, the deletion of both DRAGO alleles statistically significantly accelerated tumor development and shortened lifespan compared with p53(-/-) or p53(+/-) mice bearing wild-type DRAGO alleles (p53(-/-), DRAGO(-/-) mice: hazard ratio [HR] = 3.25, 95% confidence interval [CI] = 1.7 to 6.1, P < .001; p53(+/-), DRAGO(-/-) mice: HR = 2.35, 95% CI = 1.3 to 4.0, P < .001; both groups compared with DRAGO(+/+) counterparts). DRAGO mRNA levels were statistically significantly reduced in advanced-stage, compared with early-stage, ovarian tumors, but no mutations were found in several human tumors. We show that DRAGO expression is regulated both at transcriptional-through p53 (and p73) and methylation-dependent control-and post-transcriptional levels by miRNAs. DRAGO represents a new p53-dependent gene highly regulated in human cells and whose expression cooperates with p53 in tumor suppressor functions.
Inhibition of p53 acetylation by INHAT subunit SET/TAF-Iβ represses p53 activity.
Kim, Ji-Young; Lee, Kyu-Sun; Seol, Jin-Ee; Yu, Kweon; Chakravarti, Debabrata; Seo, Sang-Beom
2012-01-01
The tumor suppressor p53 responds to a wide variety of cellular stress signals. Among potential regulatory pathways, post-translational modifications such as acetylation by CBP/p300 and PCAF have been suggested for modulation of p53 activity. However, exactly how p53 acetylation is modulated remains poorly understood. Here, we found that SET/TAF-Iβ inhibited p300- and PCAF-mediated p53 acetylation in an INHAT (inhibitor of histone acetyltransferase) domain-dependent manner. SET/TAF-Iβ interacted with p53 and repressed transcription of p53 target genes. Consequently, SET/TAF-Iβ blocked both p53-mediated cell cycle arrest and apoptosis in response to cellular stress. Using different apoptosis analyses, including FACS, TUNEL and BrdU incorporation assays, we also found that SET/TAF-Iβ induced cellular proliferation via inhibition of p53 acetylation. Furthermore, we observed that apoptotic Drosophila eye phenotype induced by either dp53 overexpression or UV irradiation was rescued by expression of dSet. Inhibition of dp53 acetylation by dSet was observed in both cases. Our findings provide new insights into the regulation of stress-induced p53 activation by HAT-inhibiting histone chaperone SET/TAF-Iβ.
Energy Technology Data Exchange (ETDEWEB)
Langland, Gregory T.; Yannone, Steven M.; Langland, Rachel A.; Nakao, Aki; Guan, Yinghui; Long, Sydney B.T.; Vonguyen, Lien; Chen, David J.; Gray, Joe W; Chen, Fanqing
2009-09-07
The variability of radiation responses in ovarian tumors and tumor-derived cell lines is poorly understood. Since both DNA repair capacity and p53 status can significantly alter radiation sensitivity, we evaluated these factors along with radiation sensitivity in a panel of sporadic human ovarian carcinoma cell lines. We observed a gradation of radiation sensitivity among these sixteen lines, with a five-fold difference in the LD50 between the most radiosensitive and the most radioresistant cells. The DNA-dependent protein kinase (DNA-PK) is essential for the repair of radiation induced DNA double-strand breaks in human somatic cells. Therefore, we measured gene copy number, expression levels, protein abundance, genomic copy and kinase activity for DNA-PK in all of our cell lines. While there were detectable differences in DNA-PK between the cell lines, there was no clear correlation with any of these differences and radiation sensitivity. In contrast, p53 function as determined by two independent methods, correlated well with radiation sensitivity, indicating p53 mutant ovarian cancer cells are typically radioresistant relative to p53 wild-type lines. These data suggest that the activity of regulatory molecules such as p53 may be better indicators of radiation sensitivity than DNA repair enzymes such as DNAPK in ovarian cancer.
Suberoyl bis-hydroxamic acid induces p53-dependent apoptosis of MCF-7 breast cancer cells
Institute of Scientific and Technical Information of China (English)
Zhi-gang ZHUANG; Fei FEI; Ying CHEN; Wei JIN
2008-01-01
Aim: To study the effects of suberoyl bis-hydroxamic acid (SBHA), an inhibitor of histone deacetylases, on the apoptosis of MCF-7 breast cancer cells. Meth-ods: Apoptosis in MCF-7 cells induced by SBHA was demonstrated by flow cytometric analysis, morphological observation, and DNA ladder. Mitochondrial membrane potential (△ψm) was measured using the fluorescent probe JC-1. The expressions of p53, p21, Bax, and PUMA were determined using RT-PCR or Western blotting analysis after the MCF-7 cells were treated with SBHA or p53 siRNA. Results: SBHA induced apoptosis in MCF-7 cells. The expressions of p53, p21, Bax, and PUMA were induced, and △ψm collapsed after treatment with SBHA. p53 siRNA abrogated the SBHA-induced apoptosis and the expressions of p53, p21, Bax, and PUMA. Conclusion: The activation of the p53 pathway is involved in SBHA-induced apoptosis in MCF-7 cells.
International Nuclear Information System (INIS)
Liu Bing; Chinese Academy of Sciences, Beijing; Zhang Hong
2005-01-01
Radiotherapy has some disadvantages due to the severe side-effect on the normal tissues at a curative dose of ionizing radiation (IR). Similarly, as a new developing approach, gene therapy also has some disadvantages, such as lack of specificity for tumors, limited expression of therapeutic gene, potential biological risk. To certain extent, above problems would be solved by the suicide genes or p53 gene and its target genes therapies targeted by ionizing radiation. This strategy not only makes up the disadvantage from radiotherapy or gene therapy alone, but also promotes success rate on the base of lower dose. By present, there have been several vectors measuring up to be reaching clinical trials. This review focused on the development of the cancer gene therapy through suicide genes or p53 and its target genes mediated by IR. (authors)
Non-Canonical Cell Death Induced by p53
Directory of Open Access Journals (Sweden)
Atul Ranjan
2016-12-01
Full Text Available Programmed cell death is a vital biological process for multicellular organisms to maintain cellular homeostasis, which is regulated in a complex manner. Over the past several years, apart from apoptosis, which is the principal mechanism of caspase-dependent cell death, research on non-apoptotic forms of programmed cell death has gained momentum. p53 is a well characterized tumor suppressor that controls cell proliferation and apoptosis and has also been linked to non-apoptotic, non-canonical cell death mechanisms. p53 impacts these non-canonical forms of cell death through transcriptional regulation of its downstream targets, as well as direct interactions with key players involved in these mechanisms, in a cell type- or tissue context-dependent manner. In this review article, we summarize and discuss the involvement of p53 in several non-canonical modes of cell death, including caspase-independent apoptosis (CIA, ferroptosis, necroptosis, autophagic cell death, mitotic catastrophe, paraptosis, and pyroptosis, as well as its role in efferocytosis which is the process of clearing dead or dying cells.
Novel small molecule induces p53-dependent apoptosis in human colon cancer cells
International Nuclear Information System (INIS)
Park, Sang Eun; Min, Yong Ki; Ha, Jae Du; Kim, Bum Tae; Lee, Woo Ghil
2007-01-01
Using high-throughput screening with small-molecule libraries, we identified a compound, KCG165 [(2-(3-(2-(pyrrolidin-1-yl)ethoxy)-1,10b-dihydro-[1,2,4]triazolo[1,5-c] quinazolin-5(6H)-one)], which strongly activated p53-mediated transcriptional activity. KCG165-induced phosphorylations of p53 at Ser 6 , Ser 15 , and Ser 20 , which are all key residues involved in the activation and stabilization of p53. Consistent with these findings, KCG165 increased level of p53 protein and led to the accumulation of transcriptionally active p53 in the nucleus with the increased occupancy of p53 in the endogenous promoter region of its downstream target gene, p21 WAF1/CIP . Notably, KCG165-induced p53-dependent apoptosis in cancer cells. Furthermore, we suggested topoisomerase II as the molecular target of KCG165. Together, these results indicate that KCG165 may have potential applications as an antitumor agent
Cellular inactivation of nitric oxide induces p53-dependent ...
African Journals Online (AJOL)
Tropical Journal of Pharmaceutical Research August 2016; 15 (8): 1595-1603 ... Cellular inactivation of nitric oxide induces p53-dependent apoptosis in ... apoptosis induced by a selective iNOS inhibitor, N-[(3-aminomethyl) benzyl] acetamidine (1400W), .... and nitrate. ... Nitrite production was measured in culture media.
International Nuclear Information System (INIS)
Kumar, Ashish; Chandna, Sudhir
2016-01-01
In this study, we demonstrate the role of microRNA-31 (miR-31) in the regulation of radiation-induced apoptosis in model radioresistant insect cell line Sf9 (derived from the ovaries of insect Spodoptera frugiperda) which carries well-conserved apoptotic response. We also investigated the miR-31 expression regulation by p53 homologue in these cells. Our initial in silico analysis confirmed perfect conservation of mature miR-31 across various insect orders, hence we designed biotinylated probes from Bombyx mori sequence for successful detection of miR-31 in Sf9 cells
Directory of Open Access Journals (Sweden)
Ying Shen
2014-01-01
Full Text Available Genome integrity is essential for normal cellular functions and cell survival. Its instability can cause genetic aberrations and is considered as a hallmark of most cancers. To investigate the carcinogenesis process induced by tobacco-specific carcinogen NNK, we studied the dynamic changes of two important protectors of genome integrity, p53 and MMR system, in malignant transformation of human bronchial epithelial cells after NNK exposure. Our results showed that the expression of MLH1, one of the important MMR proteins, was decreased early and maintained the downregulation during the transformation in a histone modification involved and DNA methylation-independent manner. Another MMR protein PMS2 also displayed a declined expression while being in a later stage of transformation. Moreover, we conducted p53 mutation analysis and revealed a mutation at codon 273 which led to the replacement of arginine by histidine. With the mutation, DNA damage-induced activation of p53 was significantly impaired. We further reintroduced the wild-type p53 into the transformed cells, and the malignant proliferation can be abrogated by inducing cell cycle arrest and apoptosis. These findings indicate that p53 and MMR system play an important role in the initiation and progression of NNK-induced transformation, and p53 could be a potential therapeutic target for tobacco-related cancers.
Apoptosis signaling and radiation protection
International Nuclear Information System (INIS)
Morita, Akinori; Suzuki, Norio; Hosoi, Yoshio
2005-01-01
Radiation protection by apoptosis control is the suppression of cell death in highly radiosensitive tissues. This paper describes the outline of radiation-induced apoptosis framework, apoptosis-concerned target molecules possibly related to apoptosis by radiation and their inhibitors. Although there are intrinsic (via mitochondria) and extrinsic (via death receptor) pathways in apoptosis, this review mainly mentions the former which is more important in radiation-induced apoptosis. Those molecules known at present in the apoptosis are caspase, Bcl-2 family and p53. Caspase, a group of cystein proteases, initiates apoptosis but its inhibition is known not always to result in apoptosis suppression, suggesting the existence of caspase-independent pathways. Bcl-2 family involves apoptosis-suppressing (possessing BH domains) and -promoting (lacking BH domains or possessing BH3 domain alone/BH3-only protein) groups. Two p53-transcription-dependent and one -independent pathways in p53-induced apoptosis are known and p53 can be a most possible target molecule since it positions at the start of apoptosis. Authors have found a vanadate inactivates p53. Inhibitors affecting upstream molecules of apoptosis will be the most useful candidate for apoptosis suppression/radiation protection. (S.I.) 106 refs
Directory of Open Access Journals (Sweden)
Gillian D McFeat
Full Text Available Exposure to ultraviolet (UV light can cause significant damage to mammalian cells and, although the spectrum of damage produced varies with the wavelength of UV, all parts of the UV spectrum are recognised as being detrimental to human health. Characterising the cellular response to different wavelengths of UV therefore remains an important aim so that risks and their moderation can be evaluated, in particular in relation to the initiation of skin cancer. The p53 tumour suppressor protein is central to the cellular response that protects the genome from damage by external agents such as UV, thus reducing the risk of tumorigenesis. In response to a variety of DNA damaging agents including UV light, wild-type p53 plays a role in mediating cell-cycle arrest, facilitating apoptosis and stimulating repair processes, all of which prevent the propagation of potentially mutagenic defects. In this study we examined the induction of p53 protein and its influence on the survival of primary mouse fibroblasts exposed to different wavelengths of UV light. UVC was found to elevate p53 protein and its sequence specific DNA binding capacity. Unexpectedly, UVA treatment failed to induce p53 protein accumulation or sequence specific DNA binding. Despite this, UVA exposure of wild-type cells induced a p53 dependent G1 cell cycle arrest followed by a wave of p53 dependent apoptosis, peaking 12 hours post-insult. Thus, it is demonstrated that the elements of the p53 cellular response evoked by exposure to UV radiation are wavelength dependent. Furthermore, the interrelationship between various endpoints is complex and not easily predictable. This has important implications not only for understanding the mode of action of p53 but also for the use of molecular endpoints in quantifying exposure to different wavelengths of UV in the context of human health protection.
Chemotherapy-Induced Apoptosis in a Transgenic Model of Neuroblastoma Proceeds Through p53 Induction
Directory of Open Access Journals (Sweden)
Louis Chesler
2008-11-01
Full Text Available Chemoresistance in neuroblastoma is a significant issue complicating treatment of this common pediatric solid tumor. MYCN-amplified neuroblastomas are infrequently mutated at p53 and are chemosensitive at diagnosis but acquire p53 mutations and chemoresistance with relapse. Paradoxically, Myc-driven transformation is thought to require apoptotic blockade. We used the TH-MYCN transgenic murine model to examine the role of p53-driven apoptosis on neuroblastoma tumorigenesis and the response to chemotherapy. Tumors formed with high penetrance and low latency in p53-haploinsufficient TH-MYCN mice. Cyclophosphamide (CPM induced a complete remission in p53 wild type TH-MYCN tumors, mirroring the sensitivity of childhood neuroblastoma to this agent. Treated tumors showed a prominent proliferation block, induction of p53 protein, and massive apoptosis proceeding through induction of the Bcl-2 homology domain-3-only proteins PUMA and Bim, leading to the activation of Bax and cleavage of caspase-3 and -9. Apoptosis induced by CPM was reduced in p53-haploinsufficient tumors. Treatment of MYCN-expressing human neuroblastoma cell lines with CPM induced apoptosis that was suppressible by siRNA to p53. Taken together, the results indicate that the p53 pathway plays a significant role in opposing MYCN-driven oncogenesis in a mouse model of neuroblastoma and that basal inactivation of the pathway is achieved in progressing tumors. This, in part, explains the striking sensitivity of such tumors to chemotoxic agents that induce p53-dependent apoptosis and is consistent with clinical observations that therapy-associated mutations in p53 are a likely contributor to the biology of tumors at relapse and secondarily mediate resistance to therapy.
International Nuclear Information System (INIS)
Min Fengling; Zhang Hong; Li Wenjian; Liu Bing; Zhou Qingming; Duan Xin; Gao Qingxiang
2007-01-01
Objective: To investigate the effect of low dose irradiation on gene transfer efficiency and the effect of adenoviral-mediated exogenous P53 overexpression on apoptosis and radiosensitivity of radioresistant human melanoma cell lines A375(wild type p53)and WM983a(mutant type p53). Methods: Control vector, a replication deficient recombinant adenoviral vector containing a CMV promoter and green fluorescent protein (AdCMV-GFP), was used to transfect A375 cells and WM983a cells preirradiated with or without 1 Gy X-ray. The transduction efficiency of GFP gene was determined with fluorescence microscope directly. These two types of cells irradiated by 1 Gy X-ray were transfected with a replication deficient recombinant adenoviral vector carrying human wild p53 (AdCMV-p53), and mRNA level was detected by RT-PCR. The cell cycle delay and the expression of exogenous P53 were detected using flow cytometry (FCM) at different times after transfection. Tunel technique was used to detect cell apoptosis. The radiosensivity of A375 and WM983a cells after p53 transduction was analyzed by colony formation. Results: It is found that 1 Gy irradiation increased the gene transfection efficiency of A375 and WM983a cells. The expression of exogenous P53 was found to range from 60% to 80% among transfected cells during the first three days after transduction and then declined continuously down to the control level on day 10. G 1 cell cycle arrest was also observed after p53 gene transduction. WM983a cells transfected with p53 showed higher sensitivity to X-ray-induced cell killing than A375 cells. Conclusions: It is indicated that low dose of ionizing radiation can improve gene transfection efficiency of A375 and WM983a cells mediated by adenovirus vector. Althrough the overexpresion of exogenous p53 may not inhibit cell growth and induce apoptosis of melanoma cell line A375 and WM983a irt vitro, the two cell lines are much more sensitive to cell death induced by irradiation. It is
Energy Technology Data Exchange (ETDEWEB)
Seong, Jinsil; Oh, Hae Jin; Kim, Jiyoung; An, Jeung Hee; Kim, Wonwoo [Dept. of Radiation Oncology, Yonsei Univ. Medical College, Seoul (Korea, Republic of)
2007-09-15
In this study, we investigated the molecular factors determining the induction of apoptosis by radiation. Two murine tumors syngeneic to C3H/HeJ mice were used: an ovarian carcinoma OCa-I, and a hepatocarcinoma HCa-I. Both have wild type p53, but display distinctly different radiosensitivity in terms of specific growth delay (12.7 d in OCa-I and 0.3 d in HCa-I) and tumor cure dose 50% (52.6 Gy in OCa-I and >80 Gy in HCa-I). Eight-mm tumors on the thighs of mice were irradiated with 25 Gy and tumor samples were collected at regular time intervals after irradiation. The peak levels of apoptosis were 16.1{+-}0.6% in OCa-I and 0.2{+-}0.0% in HCa-I at 4 h after radiation, and this time point was used for subsequent proteomics analysis. Protein spots were identified by peptide mass fingerprinting with a focus on those related to apoptosis. In OCa-I tumors, radiation increased the expression of cytochrome c oxidase and Bcl2/adenovirus E1B-interacting 2 (Nip 2) protein higher than 3-fold. However in HCa-I, these two proteins showed no significant change. The results suggest that radiosensitivity in tumors with wild type p53 is regulated by a complex mechanism. Furthermore, these proteins could be molecular targets for a novel therapeutic strategy involving the regulation of radiosensitivity. (author)
International Nuclear Information System (INIS)
Seong, Jinsil; Oh, Hae Jin; Kim, Jiyoung; An, Jeung Hee; Kim, Wonwoo
2007-01-01
In this study, we investigated the molecular factors determining the induction of apoptosis by radiation. Two murine tumors syngeneic to C3H/HeJ mice were used: an ovarian carcinoma OCa-I, and a hepatocarcinoma HCa-I. Both have wild type p53, but display distinctly different radiosensitivity in terms of specific growth delay (12.7 d in OCa-I and 0.3 d in HCa-I) and tumor cure dose 50% (52.6 Gy in OCa-I and >80 Gy in HCa-I). Eight-mm tumors on the thighs of mice were irradiated with 25 Gy and tumor samples were collected at regular time intervals after irradiation. The peak levels of apoptosis were 16.1±0.6% in OCa-I and 0.2±0.0% in HCa-I at 4 h after radiation, and this time point was used for subsequent proteomics analysis. Protein spots were identified by peptide mass fingerprinting with a focus on those related to apoptosis. In OCa-I tumors, radiation increased the expression of cytochrome c oxidase and Bcl2/adenovirus E1B-interacting 2 (Nip 2) protein higher than 3-fold. However in HCa-I, these two proteins showed no significant change. The results suggest that radiosensitivity in tumors with wild type p53 is regulated by a complex mechanism. Furthermore, these proteins could be molecular targets for a novel therapeutic strategy involving the regulation of radiosensitivity. (author)
Rescue of the apoptotic-inducing function of mutant p53 by small molecule RITA.
Zhao, Carolyn Y; Grinkevich, Vera V; Nikulenkov, Fedor; Bao, Wenjie; Selivanova, Galina
2010-05-01
Expression of mutant p53 correlates with poor prognosis in many tumors, therefore strategies aimed at reactivation of mutant p53 are likely to provide important benefits for treatment of tumors that are resistant to chemotherapy and radiotherapy. We have previously identified and characterized a small molecule RITA which binds p53 and induces a conformational change which prevents the binding of p53 to several inhibitors, including its own destructor MDM2. In this way, RITA rescues the tumor suppression function of wild type p53. Here, we demonstrate that RITA suppressed the growth and induced apoptosis in human tumor cell lines of a diverse origin carrying mutant p53 proteins. RITA restored transcriptional transactivation and transrepression function of several hot spot p53 mutants. The ability of RITA to rescue the activity of different p53 mutants suggests its generic mechanism of action. Thus, RITA is a promising lead for the development of anti-cancer drugs that reactivate the tumor suppressor function of p53 in cancer cells irrespective whether they express mutant or wild type p53.
G2-block after irradiation of cells with different p53 status
Energy Technology Data Exchange (ETDEWEB)
Zoelzer, Friedo [University of South Bohemia in Ceske Budejovice, Department of Radiology, Toxicology and Civil Protection, Faculty of Health and Social Studies, Ceske Budejovice (Czech Republic); University Duisburg-Essen, Institute of Medical Radiobiology, Medical Faculty, Essen (Germany); Jagetia, Ganesh [University Duisburg-Essen, Institute of Medical Radiobiology, Medical Faculty, Essen (Germany); Mizoram University, Department of Zoology, School of Life Sciences, Aizawl (India); Streffer, Christian [University Duisburg-Essen, Institute of Medical Radiobiology, Medical Faculty, Essen (Germany)
2014-11-15
Although it is clear that functional p53 is not required for radiation-induced G{sub 2} block, certain experimental findings suggest a role for p53 in this context. For instance, as we also confirm here, the maximum accumulation in the G{sub 2} compartment after X-ray exposure occurs much later in p53 mutants than in wild types. It remains to be seen, however, whether this difference is due to a longer block in the G{sub 2} phase itself. We observed the movement of BrdU-labeled cells through G{sub 2} and M into G{sub 1}. From an analysis of the fraction of labeled cells that entered the second posttreatment cell cycle, we were able to determine the absolute duration of the G{sub 2} and M phases in unirradiated and irradiated cells. Our experiments with four cell lines, two melanomas and two squamous carcinomas, showed that the radiation-induced delay of transition through the G{sub 2} and M phases did not correlate with p53 status. We conclude that looking at the accumulation of cells in the G{sub 2} compartment alone is misleading when differences in the G{sub 2} block are investigated and that the G{sub 2} block itself is indeed independent of functional p53. (orig.) [German] Obwohl klar ist, dass ein funktionelles p53-Protein fuer die Ausbildung des strahleninduzierten G{sub 2}-Blocks nicht zwingend erforderlich ist, gibt es experimentelle Befunde, die nahe legen, dass p53 in diesem Zusammenhang doch eine gewisse Rolle spielt. Zum Beispiel bestaetigen wir hier fruehere Berichte, dass die Akkumulation von Zellen im G{sub 2}-Kompartiment bei p53-Mutanten deutlich spaeter nach Bestrahlung ihr Maximum erreicht als bei p53-Wildtypen. Es bleibt jedoch zu klaeren, ob dieser Unterschied seinen Grund in einem laengeren Block der G{sub 2}-Phase selbst hat. Beobachtet wurde die Bewegung von BrdU-markierten Zellen durch G{sub 2} und M nach G{sub 1}. Aus der zeitlichen Veraenderung des Anteils markierter Zellen im G{sub 1}-Kompartiment des naechsten Zellzyklus konnte die
Cereseto, A; Diella, F; Mulloy, J C; Cara, A; Michieli, P; Grassmann, R; Franchini, G; Klotman, M E
1996-09-01
Human T-cell lymphotropic/leukemia virus type I (HTLV-I) is associated with T-cell transformation both in vivo and in vitro. Although some of the mechanisms responsible for transformation remain unknown, increasing evidence supports a direct role of viral as well as dysregulated cellular proteins in transformation. We investigated the potential role of the tumor suppressor gene p53 and of the p53-regulated gene, p21waf1/cip1 (wild-type p53 activated fragment 1/cycling dependent kinases [cdks] interacting protein 1), in HTLV-I-infected T cells. We have found that the majority of HTLV-I-infected T cells have the wild-type p53 gene. However, its function in HTLV-I-transformed cells appears to be impaired, as shown by the lack of appropriate p53-mediated responses to ionizing radiation (IR). Interestingly, the expression of the p53 inducible gene, p21waf1/cip1, is elevated at the messenger ribonucleic acid and protein levels in all HTLV-I-infected T-cell lines examined as well as in Taxl-1, a human T-cell line stably expressing Tax. Additionally, Tax induces upregulation of a p21waf1/cip1 promoter-driven luciferase gene in p53 null cells, and increases p21waf1/cip1 expression in Jurkat T cells. These findings suggest that the Tax protein is at least partially responsible for the p53-independent expression of p21waf1/cip1 in HTLV-I-infected cells. Dysregulation of p53 and p21waf1/cip1 proteins regulating cell-cycle progression, may represent an important step in HTLV-I-induced T-cell transformation.
Mitochondrial localization of the low level p53 protein in proliferative cells
Energy Technology Data Exchange (ETDEWEB)
Ferecatu, Ioana; Bergeaud, Marie; Rodriguez-Enfedaque, Aida; Le Floch, Nathalie [Laboratoire de Genetique et Biologie Cellulaire - CNRS UMR 8159, Universite de Versailles Saint-Quentin-en-Yvelines, Versailles, France and Laboratoire de Genetique Moleculaire et Physiologique, Ecole Pratique des Hautes Etudes, Versailles (France); Oliver, Lisa [INSERM U601, Universite de Nantes, Faculte de Medecine, Nantes Cedex (France); Rincheval, Vincent; Renaud, Flore [Laboratoire de Genetique et Biologie Cellulaire - CNRS UMR 8159, Universite de Versailles Saint-Quentin-en-Yvelines, Versailles, France and Laboratoire de Genetique Moleculaire et Physiologique, Ecole Pratique des Hautes Etudes, Versailles (France); Vallette, Francois M. [INSERM U601, Universite de Nantes, Faculte de Medecine, Nantes Cedex (France); Mignotte, Bernard [Laboratoire de Genetique et Biologie Cellulaire - CNRS UMR 8159, Universite de Versailles Saint-Quentin-en-Yvelines, Versailles, France and Laboratoire de Genetique Moleculaire et Physiologique, Ecole Pratique des Hautes Etudes, Versailles (France); Vayssiere, Jean-Luc, E-mail: jean-luc.vayssiere@uvsq.fr [Laboratoire de Genetique et Biologie Cellulaire - CNRS UMR 8159, Universite de Versailles Saint-Quentin-en-Yvelines, Versailles, France and Laboratoire de Genetique Moleculaire et Physiologique, Ecole Pratique des Hautes Etudes, Versailles (France)
2009-10-02
p53 protein plays a central role in suppressing tumorigenesis by inducing cell cycle arrest or apoptosis through transcription-dependent and -independent mechanisms. Emerging publications suggest that following stress, a fraction of p53 translocates to mitochondria to induce cytochrome c release and apoptosis. However, the localization of p53 under unstressed conditions remains largely unexplored. Here we show that p53 is localized at mitochondria in absence of apoptotic stimuli, when cells are proliferating, localization observed in various cell types (rodent and human). This is also supported by acellular assays in which p53 bind strongly to mitochondria isolated from rat liver. Furthermore, the mitochondria subfractionation study and the alkaline treatment of the mitochondrial p53 revealed that the majority of mitochondrial p53 is present in the membranous compartments. Finally, we identified VDAC, a protein of the mitochondrial outer-membrane, as a putative partner of p53 in unstressed/proliferative cells.
Mitochondrial localization of the low level p53 protein in proliferative cells
International Nuclear Information System (INIS)
Ferecatu, Ioana; Bergeaud, Marie; Rodriguez-Enfedaque, Aida; Le Floch, Nathalie; Oliver, Lisa; Rincheval, Vincent; Renaud, Flore; Vallette, Francois M.; Mignotte, Bernard; Vayssiere, Jean-Luc
2009-01-01
p53 protein plays a central role in suppressing tumorigenesis by inducing cell cycle arrest or apoptosis through transcription-dependent and -independent mechanisms. Emerging publications suggest that following stress, a fraction of p53 translocates to mitochondria to induce cytochrome c release and apoptosis. However, the localization of p53 under unstressed conditions remains largely unexplored. Here we show that p53 is localized at mitochondria in absence of apoptotic stimuli, when cells are proliferating, localization observed in various cell types (rodent and human). This is also supported by acellular assays in which p53 bind strongly to mitochondria isolated from rat liver. Furthermore, the mitochondria subfractionation study and the alkaline treatment of the mitochondrial p53 revealed that the majority of mitochondrial p53 is present in the membranous compartments. Finally, we identified VDAC, a protein of the mitochondrial outer-membrane, as a putative partner of p53 in unstressed/proliferative cells.
Arecoline-induced growth arrest and p21WAF1 expression are dependent on p53 in rat hepatocytes
International Nuclear Information System (INIS)
Chou, W.-W.; Guh, J.-Y.; Tsai, J.-F.; Hwang, C.-C.; Chen, H.-C.; Huang, J.-S.; Yang, Y.-L.; Hung, W.-C.; Chuang, L.-Y.
2008-01-01
Betel-quid use is associated with the risk of liver cirrhosis and hepatocellular carcinoma and arecoline, the major alkaloid of betel-quid, is hepatotoxic in mice. Therefore, we studied the cytotoxic and genotoxic effects of arecoline in normal rat hepatocytes (Clone-9 cells). Arecoline dose-dependently (0.1-1 mM) decreased cell cycle-dependent proliferation while inducing DNA damage at 24 h. Moreover, arecoline (1 mM)-induced apoptosis and necrosis at 24 h. Arecoline dose-dependently (0.1-0.5 mM) increased transforming growth factor-β (TGF-β) mRNA, gene transcription and bioactivity and neutralizing TGF-β antibody attenuated arecoline (0.5 mM)-inhibited cell proliferation at 24 h. Arecoline (0.5 mM) also increased p21 WAF1 protein expression and p21 WAF1 gene transcription. Moreover, arecoline (0.5 mM) time-dependently (8-24 h) increased p53 serine 15 phosphorylation. Pifithrin-α (p53 inhibitor) and the loss of the two p53-binding elements in the p21 WAF1 gene promoter attenuated arecoline-induced p21 WAF1 gene transcription at 24 h. Pifithrin-α also attenuated arecoline (0.5 mM)-inhibited cell proliferation at 24 h. We concluded that arecoline induces cytotoxicity, DNA damage, G 0 /G 1 cell cycle arrest, TGF-β1, p21 WAF1 and activates p53 in Clone-9 cells. Moreover, arecoline-induced p21 WAF1 is dependent on p53 while arecoline-inhibited growth is dependent on both TGF-β and p53
International Nuclear Information System (INIS)
Ito, Atsushi; Nakano, Hisako; Shinohara, Kunio
2010-01-01
The sensitizing effects of wild-type p53 on X-ray-induced cell death and on heat-induced apoptosis in M10, a radiosensitive and Trp53 (mouse p53 gene)-mutated lymphoma cell line which dies through necrosis by X-irradiation, were investigated using three M10 derived transfectants with wild-type TP53 (human p53 gene). Cell death was determined by colony formation and/or dye exclusion test, and apoptosis was detected as the changes in nuclear morphology by Giemsa staining. Expression of wild-type p53 protein increased radiosensitivity of cell death as determined by both clonogenic and dye exclusion assays. This increase in radiosensitivity was attributable largely to apoptosis induction in addition to a small enhancement of necrosis. Interestingly neither pathway to cell death was accompanied by caspase-3 activation. On the other hand, heat-induced caspase-3 dependent apoptotic cell death without transfection was further increased by the transfection of wild-type p53. In conclusion, the introduction of wild-type p53 enhanced apoptotic cell death by X-rays or heat via different mechanisms that do or do not activate caspase-3, respectively. In addition, p53 also enhanced the X-ray-induced necrosis in M10 cells. (author)
Gene expression patterns associated with p53 status in breast cancer
International Nuclear Information System (INIS)
Troester, Melissa A; Herschkowitz, Jason I; Oh, Daniel S; He, Xiaping; Hoadley, Katherine A; Barbier, Claire S; Perou, Charles M
2006-01-01
Breast cancer subtypes identified in genomic studies have different underlying genetic defects. Mutations in the tumor suppressor p53 occur more frequently in estrogen receptor (ER) negative, basal-like and HER2-amplified tumors than in luminal, ER positive tumors. Thus, because p53 mutation status is tightly linked to other characteristics of prognostic importance, it is difficult to identify p53's independent prognostic effects. The relation between p53 status and subtype can be better studied by combining data from primary tumors with data from isogenic cell line pairs (with and without p53 function). The p53-dependent gene expression signatures of four cell lines (MCF-7, ZR-75-1, and two immortalized human mammary epithelial cell lines) were identified by comparing p53-RNAi transduced cell lines to their parent cell lines. Cell lines were treated with vehicle only or doxorubicin to identify p53 responses in both non-induced and induced states. The cell line signatures were compared with p53-mutation associated genes in breast tumors. Each cell line displayed distinct patterns of p53-dependent gene expression, but cell type specific (basal vs. luminal) commonalities were evident. Further, a common gene expression signature associated with p53 loss across all four cell lines was identified. This signature showed overlap with the signature of p53 loss/mutation status in primary breast tumors. Moreover, the common cell-line tumor signature excluded genes that were breast cancer subtype-associated, but not downstream of p53. To validate the biological relevance of the common signature, we demonstrated that this gene set predicted relapse-free, disease-specific, and overall survival in independent test data. In the presence of breast cancer heterogeneity, experimental and biologically-based methods for assessing gene expression in relation to p53 status provide prognostic and biologically-relevant gene lists. Our biologically-based refinements excluded genes
p53 Loss Synergizes with Estrogen and Papillomaviral Oncogenes to Induce Cervical and Breast Cancers
Shai, Anny; Pitot, Henry C.; Lambert, Paul F.
2010-01-01
Whereas the tumor suppressor p53 gene is frequently mutated in most human cancers, this is not the case in human papillomavirus (HPV)-associated cancers, presumably because the viral E6 oncoprotein inactivates the p53 protein. The ability of E6 to transform cells in tissue culture and induce cancers in mice correlates in part with its ability to inactivate p53. In this study, we compared the expression of the HPV16 E6 oncogene to the conditional genetic disruption of p53 in the context of a mouse model for cervical cancer in which estrogen is a critical cofactor. Nearly all of the K14Crep53f/f mice treated with estrogen developed cervical cancer, a stark contrast to its complete absence in like-treated K14E6WTp53f/f mice, indicating that HPV16 E6 must only partially inactivate p53. p53-independent activities of E6 also contributed to carcinogenesis, but in the female reproductive tract, these activities were manifested only in the presence of the HPV16 E7 oncogene. Interestingly, treatment of K14Crep53f/f mice with estrogen also resulted in mammary tumors after only a short latency, many of which were positive for estrogen receptor α. The majority of these mammary tumors were of mixed cell types, suggestive of their originating from a multipotent progenitor. Furthermore, a subset of mammary tumors arising in the estrogen-treated, p53-deficient mammary glands exhibited evidence of an epithelial to mesenchymal transition. These data show the importance of the synergy between estrogen and p53 insufficiency in determining basic properties of carcinogenesis in hormone-responsive tissues, such as the breast and the reproductive tract. PMID:18413729
p53-Dependent and -Independent Epithelial Integrity: Beyond miRNAs and Metabolic Fluctuations
Directory of Open Access Journals (Sweden)
Tsukasa Oikawa
2018-05-01
Full Text Available In addition to its classical roles as a tumor suppressor, p53 has also been shown to act as a guardian of epithelial integrity by inducing the microRNAs that target transcriptional factors driving epithelial–mesenchymal transition. On the other hand, the ENCODE project demonstrated an enrichment of putative motifs for the binding of p53 in epithelial-specific enhancers, such as CDH1 (encoding E-cadherin enhancers although its biological significance remained unknown. Recently, we identified two novel modes of epithelial integrity (i.e., maintenance of CDH1 expression: one involves the binding of p53 to a CDH1 enhancer region and the other does not. In the former, the binding of p53 is necessary to maintain permissive histone modifications around the CDH1 transcription start site, whereas in the latter, p53 does not bind to this region nor affect histone modifications. Furthermore, these mechanisms likely coexisted within the same tissue. Thus, the mechanisms involved in epithelial integrity appear to be much more complex than previously thought. In this review, we describe our findings, which may instigate further experimental scrutiny towards understanding the whole picture of epithelial integrity as well as the related complex asymmetrical functions of p53. Such understanding will be important not only for cancer biology but also for the safety of regenerative medicine.
Low grade inflammation inhibits VEGF induced HUVECs migration in p53 dependent manner
International Nuclear Information System (INIS)
Panta, Sushil; Yamakuchi, Munekazu; Shimizu, Toshiaki; Takenouchi, Kazunori; Oyama, Yoko; Koriyama, Toyoyasu; Kojo, Tsuyoshi; Hashiguchi, Teruto
2017-01-01
In the course of studying crosstalk between inflammation and angiogenesis, high doses of pro-inflammatory factors have been reported to induce apoptosis in cells. Under normal circumstances also the pro-inflammatory cytokines are being released in low doses and are actively involved in cell signaling pathways. We studied the effects of low grade inflammation in growth factor induced angiogenesis using tumor necrosis factor alfa (TNFα) and vascular endothelial growth factor A (VEGF) respectively. We found that low dose of TNFα can inhibit VEGF induced angiogenesis in human umbilical vein endothelial cells (HUVECs). Low dose of TNFα induces mild upregulation and moreover nuclear localization of tumor suppressor protein 53 (P53) which causes decrease in inhibitor of DNA binding-1 (Id1) expression and shuttling to the cytoplasm. In absence of Id1, HUVECs fail to upregulate β 3 -integrin and cell migration is decreased. Connecting low dose of TNFα induced p53 to β 3 -integrin through Id1, we present additional link in cross talk between inflammation and angiogenesis. - Highlights: • Low grade inflammation (low dose of TNF alfa) inhibits VEGF induced endothelial cells migration. • The low grade inflammation with VEGF treatment upregulates P53 to a nonlethal level. • P53 activation inhibits Id1 shuttling to the cytoplasm in endothelial cells. • Inhibition of Id1 resulted in downregulation of β 3 -integrin which cause decrease in cell migration. • Inflammation and angiogenesis might cross-talk by P53 – Id1 – β 3 -integrin pathway in endothelial cells.
Fukushi, Saori; Yoshino, Hironori; Yoshizawa, Atsushi; Kashiwakura, Ikuo
2016-07-25
We recently demonstrated the cytotoxicity of liquid crystal precursors (hereafter referred to as "mesogenic compounds") in the human non-small cell lung cancer (NSCLC) cell line A549 which carry wild-type p53. p53 mutations are observed in 50 % of NSCLC and contribute to their resistance to chemotherapy. To develop more effective and cancer-specific agents, in this study, we investigated the structure-activity relationships of mesogenic compounds with cytotoxic effects against multiple NSCLC cells. The pharmacological effects of mesogenic compounds were examined in human NSCLC cells (A549, LU99, EBC-1, and H1299) and normal WI-38 human fibroblast. Analyses of the cell cycle, cell-death induction, and capsases expression were performed. The 3-ring compounds possessing terminal alkyl and hydroxyl groups (compounds C1-C5) showed cytotoxicity in NSCLC cells regardless of the p53 status. The compounds C1 and C3, which possess a pyrimidine at the center of the core, induced G2/M arrest, while the compounds without a pyrimidine (C2, C4, and C5) caused G1 arrest; all compounds produced caspase-mediated cell death. These events occurred in a p53-independent manner. Furthermore, it was suggested that compounds induced cell death through p53-independent DNA damage-signaling pathway. Compounds C2, C4, and C5 did not show strong cytotoxicity in WI-38 cells, whereas C1 and C3 did. However, the cytotoxicity of compound C1 against WI-38 cells was improved by modulating the terminal alkyl chain lengths of the compound. We showed the p53-indepdent structure-activity relationships of mesogenic compounds related to the cytotoxic effects. These structure-activity relationships will be helpful in the development of more effective and cancer-specific agents.
The p53 gene as a modifier of intrinsic radiosensitivity: implications for radiotherapy
International Nuclear Information System (INIS)
Bristow, Robert G.; Benchimol, Samuel; Hill, Richard P.
1996-01-01
Background and purpose: Experimental studies have implicated the normal or 'wild type' p53 protein (i.e. WTp53) in the cellular response to ionizing radiation and other DNA damaging agents. Whether altered WTp53 protein function can lead to changes in cellular radiosensitivity and/or clinical radiocurability remains an area of ongoing study. In this review, we describe the potential implications of altered WTp53 protein function in normal and tumour cells as it relates to clinical radiotherapy, and describe novel treatment strategies designed to re-institute WTp53 protein function as a means of sensitizing cells to ionizing radiation. Methods and Materials: A number of experimental and clinical studies are critically reviewed with respect to the role of the p53 protein as a determinant of cellular oncogenesis, genomic stability, apoptosis, DNA repair and radioresponse in normal and transformed mammalian cells. Results: In normal fibroblasts, exposure to ionizing radiation leads to a G1 cell cycle delay (i.e. a 'G1 checkpoint') as a result of WTp53-mediated inhibition of G1-cyclin-kinase and retinoblastoma (pRb) protein function. The G1 checkpoint response is absent in tumour cells which express a mutant form of the p53 protein (i.e. MTp53), leading to acquired radioresistance in vitro. Depending on the cell type studied, this increase in cellular radiation survival can be mediated through decreased radiation-induced apoptosis, or altered kinetics of the radiation-induced G1 checkpoint. Recent biochemical studies support an indirect role for the p53 protein in both nucleotide excision and recombinational DNA repair pathways. However, based on clinicopathologic data, it remains unclear as to whether WTp53 protein function can predict for human tumour radiocurability and normal tissue radioresponse. Conclusions: Alterations in cell cycle control secondary to aberrant WTp53 protein function may be clinically significant if they lead to the acquisition of mutant
Zhang, Erli; Guo, Qianyun; Gao, Haiyang; Xu, Ruixia; Teng, Siyong; Wu, Yongjian
2015-01-01
Endothelial senescence plays crucial roles in diabetic vascular complication. Recent evidence indicated that transient hyperglycaemia could potentiate persistent diabetic vascular complications, a phenomenon known as "metabolic memory." Although SIRT1 has been demonstrated to mediate high glucose-induced endothelial senescence, whether and how "metabolic memory" would affect endothelial senescence through SIRT1 signaling remains largely unknown. In this study, we investigated the involvement of SIRT1 axis as well as the protective effects of resveratrol (RSV) and metformin (MET), two potent SIRT1 activators, during the occurrence of "metabolic memory" of cellular senescence (senescent "memory"). Human umbilical vascular endothelial cells (HUVECs) were cultured in either normal glucose (NG)/high glucose (HG) media for 6 days, or 3 days of HG followed by 3 days of NG (HN), with or without RSV or MET treatment. It was shown that HN incubation triggered persistent downregulation of deacetylase SIRT1 and upregulation of acetyltransferase p300, leading to sustained hyperacetylation (at K382) and activation of p53, and subsequent p53/p21-mediated senescent "memory." In contrast, senescent "memory" was abrogated by overexpression of SIRT1 or knockdown of p300. Interestingly, we found that SIRT1 and p300 could regulate each other in response to HN stimulation, suggesting that a delicate balance between acetyltransferases and deacetylases may be particularly important for sustained acetylation and activation of non-histone proteins (such as p53), and eventually the occurrence of "metabolic memory." Furthermore, we found that RSV or MET treatment prevented senescent "memory" by modulating SIRT1/p300/p53/p21 pathway. Notably, early and continuous treatment of MET, but not RSV, was particularly important for preventing senescent "memory." In conclusion, short-term high glucose stimulation could induce sustained endothelial senescence via SIRT1/p300/p53/p21 pathway. RVS or MET
International Nuclear Information System (INIS)
Deocaris, Custer C.
2004-01-01
Ionizing radiation remains one of the most effective tools for the treatment of breast cancer. It combines properties of a potent DNA-damaging agent and high degree of spatial specificity to the target tissue. Nonetheless, there remain considerable differences in the outcome for treatment of tumors of differing histological type treated by radiotherapy. The identification of predictive indicators of radiosensitivity is crucial for selecting patients suited for preoperative radiotherapy as well as those unwarranted for postoperative treatments. To improve prognostication, numerous genes involved in the breast carcinogenesis have been studied and thus far over the last decade several multi-center researches converge on the role of tumor suppressor p53 in tumor biology. The p53 gene is located on the short arm of chromosome 17 and encodes a 53-kd nuclear protein, p-53, also referred to as 'the guardian of the genome', it orchestrates multiple cellular processes such as cell growth control, DNA repair and programmed cell death. During radiotherapy, genotoxic damage induces p53 overexpression in order to control the rate of proliferating damaged cells, repair damage or induce the apoptotic pathway. Its molecular inactivation in a tumor cell, typically by a point mutation, leads to chemo/radio resistance due to the inability of the molecule to trigger p53-dependent programmed cell death
Guthrie, O'neil W
2017-10-01
In response to DNA damage from ultraviolet (UV) radiation, bacteria deploy the SOS response in order to limit cell death. This bacterial SOS response is characterized by an increase in the recA gene that transactivates expression of multiple DNA repair genes. The current series of experiments demonstrate that a mammalian organ system (the cochlea) that is not evolutionarily conditioned to UV radiation can elicit SOS responses that are reminiscent of that of bacteria. This mammalian SOS response is characterized by an increase in the p53 gene with activation of multiple DNA repair genes that harbor p53 response elements in their promoters. Furthermore, the experimental results provide support for the notion of a convergent trigger paradox, where independent SOS triggers facilitate disparate physiologic sequelae (loss vs. recovery of function). Therefore, it is proposed that the mammalian SOS response is multifunctional and manipulation of this endogenous response could be exploited in future biomedical interventions. Copyright © 2017 Elsevier Inc. All rights reserved.
P53-dependent upregulation of neutral sphingomyelinase-2: role in doxorubicin-induced growth arrest.
Shamseddine, A A; Clarke, C J; Carroll, B; Airola, M V; Mohammed, S; Rella, A; Obeid, L M; Hannun, Y A
2015-10-29
Neutral sphingomyelinase-2 (nSMase2) is a ceramide-generating enzyme that has been implicated in growth arrest, apoptosis and exosome secretion. Although previous studies have reported transcriptional upregulation of nSMase2 in response to daunorubicin, through Sp1 and Sp3 transcription factors, the role of the DNA damage pathway in regulating nSMase2 remains unclear. In this study, we show that doxorubicin induces a dose-dependent induction of nSMase2 mRNA and protein with concomitant increases in nSMase activity and ceramide levels. Upregulation of nSMase2 was dependent on ATR, Chk1 and p53, thus placing it downstream of the DNA damage pathway. Moreover, overexpression of p53 was sufficient to transcriptionally induce nSMase2, without the need for DNA damage. DNA-binding mutants as well as acetylation mutants of p53 were unable to induce nSMase2, suggesting a role of nSMase2 in growth arrest. Moreover, knockdown of nSMase2 prevented doxorubicin-induced growth arrest. Finally, p53-induced nSMase2 upregulation appears to occur via a novel transcription start site upstream of exon 3. These results identify nSMase2 as a novel p53 target gene, regulated by the DNA damage pathway to induce cell growth arrest.
International Nuclear Information System (INIS)
Kanady, Kirk E.; Mei Su; Proulx, Gary; Malkin, David M.; Pardo, Francisco S.
1995-01-01
Introduction: Alterations in the p53 tumor suppressor gene are one of the most frequent genetic alterations in malignant gliomas. An understanding of the molecular genetic events leading to glial tumor progression would aid in designing therapeutic vectors for controlling these challenging tumor types. We investigated whether mutations in coding exons of the p53 gene result in functional changes altering cell cycle 'checkpoint' control and the intrinsic radiation sensitivity of glial cells. Methods: An astrocytic cell line was derived from a low grade astrocytoma and characterized to be of human karyotype and GFAP positivity. Additionally, the cellular population has never formed tumors in immune-deficient mice. At early passage ( 2 as parameters. Cell kinetic analyses after 2, 5, and 10 Gy of ionizing radiation were conducted using propidium iodide FACS analyses. Results: Overall levels of p53 expression were increased 5-10 fold in the transfected cellular populations. Astrocytic cellular populations transfected with mutant p53 revealed a statistically significant increase in levels of resistance to ionizing radiation in vitro (2-tailed test, SF2, MID). Astrocytic cellular populations transfected with mutant p53, unlike the parental cells, were tumorigenic in SCID mice. Cell kinetic analyses indicated that the untransfected cell line demonstrated dose dependent G1 and G2 arrests. Following transfection, however, the resultant cellular population demonstrated a predominant G2 arrest. Conclusions: Astrocytic cellular populations derived from low grade astrocytomas, are relatively radiation sensitive, non-tumorigenic, and have intact cell cycle ''checkpoints.'' Cellular populations resulting upon transfection of parental cells with a dominant negative p53 mutation, are relatively radiation resistant, when compared to both parental and mock-transfected cells. Transfected cells demonstrate abnormalities of cell cycle control at the G1/S checkpoint, increases in levels
Lee, Sook-Jeong; Hwang, Sung-Ook; Noh, Eun Joo; Kim, Dong-Uk; Nam, Miyoung; Kim, Jong Hyeok; Nam, Joo Hyun; Hoe, Kwang-Lae
2014-02-14
Vorinostat (VOR) has been reported to enhance the cytotoxic effects of doxorubicin (DOX) with fewer side effects because of the lower DOX dosage in breast cancer cells. In this study, we investigated the novel mechanism underlying the synergistic cytotoxic effects of VOR and DOX co-treatment in cervical cancer cells HeLa, CaSki and SiHa cells. Co-treatment with VOR and DOX at marginal doses led to the induction of apoptosis through caspase-3 activation, poly (ADP-ribose) polymerase cleavage and DNA micronuclei. Notably, the synergistic growth inhibition induced by the co-treatment was attributed to the upregulation of the pro-apoptotic protein Bad, as the silencing of Bad expression using small interfering RNA (siRNA) abolished the phenomenon. As siRNA against p53 did not result in an increase in acetylated p53 and the consequent upregulation of Bad, the observed Bad upregulation was mediated by acetylated p53. Moreover, a chromatin immunoprecipitation analysis showed that the co-treatment of HeLa cells with VOR and DOX increased the recruitment of acetylated p53 to the bad promoter, with consequent bad transactivation. Conversely, C33A cervical cancer cells containing mutant p53 co-treated with VOR and DOX did not exhibit Bad upregulation, acetylated p53 induction or consequent synergistic growth inhibition. Together, the synergistic growth inhibition of cervical cancer cell lines induced by co-treatment with VOR and DOX can be attributed to the upregulation of Bad, which is induced by acetylated p53. These results show for the first time that the acetylation of p53, rather than histones, is a mechanism for the synergistic growth inhibition induced by VOR and DOX co-treatments.
Chromatin-Bound MDM2 Regulates Serine Metabolism and Redox Homeostasis Independently of p53.
Riscal, Romain; Schrepfer, Emilie; Arena, Giuseppe; Cissé, Madi Y; Bellvert, Floriant; Heuillet, Maud; Rambow, Florian; Bonneil, Eric; Sabourdy, Frédérique; Vincent, Charles; Ait-Arsa, Imade; Levade, Thierry; Thibaut, Pierre; Marine, Jean-Christophe; Portais, Jean-Charles; Sarry, Jean-Emmanuel; Le Cam, Laurent; Linares, Laetitia K
2016-06-16
The mouse double minute 2 (MDM2) oncoprotein is recognized as a major negative regulator of the p53 tumor suppressor, but growing evidence indicates that its oncogenic activities extend beyond p53. Here, we show that MDM2 is recruited to chromatin independently of p53 to regulate a transcriptional program implicated in amino acid metabolism and redox homeostasis. Identification of MDM2 target genes at the whole-genome level highlights an important role for ATF3/4 transcription factors in tethering MDM2 to chromatin. MDM2 recruitment to chromatin is a tightly regulated process that occurs during oxidative stress and serine/glycine deprivation and is modulated by the pyruvate kinase M2 (PKM2) metabolic enzyme. Depletion of endogenous MDM2 in p53-deficient cells impairs serine/glycine metabolism, the NAD(+)/NADH ratio, and glutathione (GSH) recycling, impacting their redox state and tumorigenic potential. Collectively, our data illustrate a previously unsuspected function of chromatin-bound MDM2 in cancer cell metabolism. Copyright © 2016 Elsevier Inc. All rights reserved.
International Nuclear Information System (INIS)
Yu Zeyang; Fan Wo; Li Dongqing; Zhu Ran; Wan Jianmei; Wang Yongqing; Wu Jinchang
2008-01-01
This paper analyzes the inhibitory effect and radiation sensitization of recombinant adenovirus encoding human p53 tumor suppressor gene (rAd-p53) on human lymphoma cell lines. Human lymphoma cell lines were treated with rAd-p53, radiation therapy and combined treatment, respectively. The cell growth inhibition was assessed by MTF. The cell cycle and apoptosis were detected by flow cytometry, and the p53 protein expression was detected by Western blotting. The results showed that extrinsic p53 gene have expressed to some degree, but not at high level. The role of inhibition and radiation sensitivity of rAd-p53 was not significant to human lymphoma cell lines. (authors)
International Nuclear Information System (INIS)
Lawton, Colleen A.; Grignon, David; Caplan, Richard; Sarkar, Fazlul; Forman, Jeffrey; Mesic, John; Fu, Karen K.; Abrams, Ross
1995-01-01
Purpose/Objective: The purpose of this study is to establish the effect of the abnormal expression of the P-53 suppressor gene on the results of locally advanced adenocarcinoma of the prostate treated with radiation therapy with or without pre-radiation therapy androgen ablation. Materials and Methods: Patients evaluated were part of a RTOG phase III multi-institutional trial. This trial assessed the value of pre-radiation therapy androgen ablation on patients with locally advanced disease (bulky stage B and stage C). Of the 471 patients registered, pre-treatment pathological material was available for 129 patients. P-53 status was determined immunohistochemically utilizing a commercially available antibody (D07). Clinical endpoints evaluated were overall survival and development of metastases. Results: Twenty-three of the 129 patients had abnormal expression of the P-53 suppressor gene. Presence of this abnormal expression significantly correlated with lower overall survival (p=0.03) and the development of distant metastases (p=0.03). Abnormal expression of the P-53 gene was an independent prognostic indicator when evaluated against clinical stage and Gleason score. Conclusion: This data from patients entered on a phase III multi-institutional, randomized clinical trial shows that abnormal P-53 suppressor gene expression as determined immunohistochemically is an independent predictor of poorer survival and the development of distant metastases in patients with locally advanced adenocarcinoma of the prostate treated with radiation therapy with or without pre-radiation therapy androgen ablation
Fluoxetine protects against IL-1β-induced neuronal apoptosis via downregulation of p53.
Shan, Han; Bian, Yaqi; Shu, Zhaoma; Zhang, Linxia; Zhu, Jialei; Ding, Jianhua; Lu, Ming; Xiao, Ming; Hu, Gang
2016-08-01
Fluoxetine, a selective serotonin reuptake inhibitor, exerts neuroprotective effects in a variety of neurological diseases including stroke, but the underlying mechanism remains obscure. In the present study, we addressed the molecular events in fluoxetine against ischemia/reperfusion-induced acute neuronal injury and inflammation-induced neuronal apoptosis. We showed that treatment of fluoxetine (40 mg/kg, i.p.) with twice injections at 1 h and 12 h after transient middle cerebral artery occlusion (tMCAO) respectively alleviated neurological deficits and neuronal apoptosis in a mouse ischemic stroke model, accompanied by inhibiting interleukin-1β (IL-1β), Bax and p53 expression and upregulating anti-apoptotic protein Bcl-2 level. We next mimicked neuroinflammation in ischemic stroke with IL-1β in primary cultured cortical neurons and found that pretreatment with fluoxetine (1 μM) prevented IL-1β-induced neuronal apoptosis and upregulation of p53 expression. Furthermore, we demonstrated that p53 overexpression in N2a cell line abolished the anti-apoptotic effect of fluoxetine, indicating that p53 downregulation is required for the protective role of fluoxetine in IL-1β-induced neuronal apoptosis. Fluoxetine downregulating p53 expression could be mimicked by SB203580, a specific inhibitor of p38, but blocked by anisomycin, a p38 activator. Collectively, our findings have revealed that fluoxetine protects against IL-1β-induced neuronal apoptosis via p38-p53 dependent pathway, which give us an insight into the potential of fluoxetine in terms of opening up novel therapeutic avenues for neurological diseases including stroke. Copyright © 2016 Elsevier Ltd. All rights reserved.
Radiation-induced apoptosis and cell cycle checkpoints in human colorectal tumour cell lines
International Nuclear Information System (INIS)
Playle, L.C.
2001-03-01
The p53 tumour suppressor gene is mutated in 75% of colorectal carcinomas and is critical for DNA damage-induced G1 cell cycle arrest. Data presented in this thesis demonstrate that after treatment with Ionizing Radiation (IR), colorectal tumour cell lines with mutant p53 are unable to arrest at G1 and undergo cell cycle arrest at G2. The staurosporine derivative, UCN-01, was shown to abrogate the IR-induced G2 checkpoint in colorectal tumour cell lines. Furthermore, in some cell lines, abrogation of the G2 checkpoint was associated with radiosensitisation. Data presented in this study demonstrate that 2 out of 5 cell lines with mutant p53 were sensitised to IR by UCN-01. In order to determine whether radiosensitisation correlated with lack of functional p53, transfected derivatives of an adenoma-derived cell line were studied, in which endogenous wild type p53 was disrupted by expression of a dominant negative p53 mutant protein (and with a vector control). In both these cell lines UCN-01 abrogated the G2 arrest however this was not associated with radiosensitisation, indicating that radiosensitisation is a cell type-specific phenomenon. Although 2 colorectal carcinoma cell lines, with mutant p53, were sensitised to IR by UCN-01, the mechanisms of p53-independent IR-induced apoptosis in the colon are essentially unknown. The mitogen-activated protein kinase (MAPK) pathways (that is the JNK, p38 and ERK pathways) have been implicated in apoptosis in a range of cell systems and in IR-induced apoptosis in some cell types. Data presented in this study show that, although the MAPKs can be activated by the known activator anisomycin, there is no evidence of a role for MAPKs in IR-induced apoptosis in colorectal tumour cell lines, regardless of p53 status. In summary, some colorectal tumour cell lines with mutant p53 can be sensitised to IR-induced cell death by G2 checkpoint abrogation and this may be an important treatment strategy, however mechanisms of IR-induced p53
International Nuclear Information System (INIS)
Shiraishi, K.; Yonezawa, M.; Niwa, O.
2003-01-01
Full text: We previously reported that radiation has an ability to induce genomic instability which causes delayed and untargeted mutation. These mutations aren't accounted for by the usual relationship between DNA damages and repair. However, the mechanisms of a long-term memory of DNA damage and the persistence of up-regulated recombination activity have yet to be elucidated. The mouse pink-eyed unstable (pun) mutation is due to an intragenic duplication of the pink-eyed dilution locus and frequently reverts black to the wild type in germ cells as well as somatic cells. The frequency of reversion was estimated by counting cluster of pigment cells in retinal pigment epithelium. Twice increase of the reversion was observed in F1 mice born to 6Gy irradiated male at spermatozoa stage, but not at other spermatogenesis stages( -tid, -cyte, -gonia ). Trans-genarational effect in F2 mice also didn't observe. Therefore, this phenomenon only occurs under the restricted germ cell stage. Additionally, the reversion frequency of p53 deficient F1 mouse born to irradiated sperm was less than irradiated wild mouse. 5aza-dc chemical agent, which is DNA methylation emzyme inhibitor, also suppressed pun allele recombination in mouse embryo. These data indicate that p53 contributes delayed and untargeted mutation, perhaps, by regulation of DNA metylation status
Wiegering, Armin; Matthes, Niels; Mühling, Bettina; Koospal, Monika; Quenzer, Anne; Peter, Stephanie; Germer, Christoph-Thomas; Linnebacher, Michael; Otto, Christoph
2017-04-01
Colorectal carcinoma (CRC) is the most common cancer of the gastrointestinal tract with frequently dysregulated intracellular signaling pathways, including p53 signaling. The mainstay of chemotherapy treatment of CRC is 5-fluorouracil (5FU) and oxaliplatin. The two anticancer drugs mediate their therapeutic effect via DNA damage-triggered signaling. The small molecule reactivating p53 and inducing tumor apoptosis (RITA) is described as an activator of wild-type and reactivator of mutant p53 function, resulting in elevated levels of p53 protein, cell growth arrest, and cell death. Additionally, it has been shown that RITA can induce DNA damage signaling. It is expected that the therapeutic benefits of 5FU and oxaliplatin can be increased by enhancing DNA damage signaling pathways. Therefore, we highlighted the antiproliferative response of RITA alone and in combination with 5FU or oxaliplatin in human CRC cells. A panel of long-term established CRC cell lines (n=9) including p53 wild-type, p53 mutant, and p53 null and primary patient-derived, low-passage cell lines (n=5) with different p53 protein status were used for this study. A substantial number of CRC cells with pronounced sensitivity to RITA (IC 50 RITA appeared independent of p53 status and was associated with an increase in antiproliferative response to 5FU and oxaliplatin, a transcriptional increase of p53 targets p21 and NOXA, and a decrease in MYC mRNA. The effect of RITA as an inducer of DNA damage was shown by a strong elevation of phosphorylated histone variant H2A.X, which was restricted to RITA-sensitive cells. Our data underline the primary effect of RITA, inducing DNA damage, and demonstrate the differential antiproliferative effect of RITA to CRC cells independent of p53 protein status. We found a substantial number of RITA-sensitive CRC cells within both panels of established CRC cell lines and primary patient-derived CRC cell lines (6/14) that provide a rationale for combining RITA with 5FU or
Meng, X; Carlson, NR; Dong, J; Zhang, Y
2015-01-01
The multifaceted oncogene c-Myc plays important roles in the development and progression of human cancer. Recent in vitro and in vivo studies have shown that the p19Arf–Mdm2–p53 and the ribosomal protein (RP)–Mdm2–p53 pathways are both essential in preventing oncogenic c-Myc-induced tumorigenesis. Disruption of each pathway individually by p19Arf deletion or by Mdm2C305F mutation, which disrupts RP-Mdm2 binding, accelerates Eμ-myc transgene-induced pre-B/B-cell lymphoma in mice at seemingly s...
p53 Over-expression and p53 mutations in colon carcinomas: Relation to dietary risk factors
Voskuil, D.W.; Kampman, E.; Kraats, A.A. van; Balder, H.F.; Muijen, G.N.P. van; Goldbohm, R.A.; Veer, P. van 't
1999-01-01
Epidemiological studies have suggested that dietary factors may differently affect p53-dependent and p53-independent pathways to colon cancer. Results of such studies may depend on the method used to assess p53 status. This case-control study of 185 colon-cancer cases and 259 controls examines this
Energy Technology Data Exchange (ETDEWEB)
Shao Chunlin, E-mail: clshao@shmu.edu.c [Institute of Radiation Medicine, Fudan University, No. 2094 Xie-Tu Road, Shanghai 200032 (China); Zhang Jianghong [Institute of Radiation Medicine, Fudan University, No. 2094 Xie-Tu Road, Shanghai 200032 (China); Prise, Kevin M. [Centre for Cancer Research and Cell Biology, Queen' s University Belfast, Lisburn Road, Belfast BT9 7AB (United Kingdom)
2010-03-15
The implication of radiation-induced bystander effect (RIBE) for both radiation protection and radiotherapy has attracted significant attention, but a key question is how to modulate the RIBE. The present study found that, when a fraction of glioblastoma cells in T98G population were individually targeted with precise helium particles through their nucleus, micronucleus (MN) were induced and its yield increased non-linearly with radiation dose. After co-culturing with irradiated cells, additional MN could be induced in the non-irradiated bystander cells and its yield was independent of irradiation dose, giving direct evidence of a RIBE. Further results showed that the RIBE could be eliminated by pifithrin-alpha (p53 inhibitor) but enhanced by wortmannin (PI3K inhibitor). Moreover, it was found that nitric oxide (NO) contributed to this RIBE, and the levels of NO of both irradiated cells and bystander cells could be extensively diminished by pifithrin-alpha but insignificantly reduced by wortmannin. Our results indicate that RIBE can be modulated by p53 and PI3K through a NO-dependent and NO-independent pathway, respectively.
International Nuclear Information System (INIS)
Santra, Manas Kumar
2017-01-01
In response to radiation-induced DNA damage, eukaryotic cells initiate a complex signalling pathway, termed the DNA damage response (DDR), which coordinates cell cycle arrest with DNA repair. Previous study showed that induction of G1 arrest in response to radiation induced DNA damage is minimally a two-step process: a fast p53-independent initiation of G1 arrest mediated by cyclin D1 proteolysis and a slower maintenance of arrest resulting from increased p53 stability. We elucidated the molecular mechanism of slow and fast response of radiation induced DDR. We showed that FBXO31, a member of F-box family proteins, plays important role in DDR induced by ionizing radiation. We show that FBXO31 is responsible for promoting MDM2 degradation following radiation. FBXO31 interacts with and directs the degradation of MDM2 in ATM dependent phosphorylation of MDM2. FBXO31-mediated loss of MDM2 leads to elevated levels of p53, resulting in growth arrest. In cells depleted of FBXO31, MDM2 is not degraded and p53 levels do not increase following genotoxic stress. Thus, FBXO31 is essential for the classic robust increase in p53 levels following DNA damage
The effects of radiation on p53-mutated glioma cells using cDNA microarray technique
International Nuclear Information System (INIS)
Ngo, F.Q.H.; Hsiao, Y.-Y.H.
2003-01-01
Full text: In this study, we investigated the effects of 10-Gy irradiation on cell-cycle arrest, apoptosis and clonogenic death in the p53-mutated human U138MG (malignant glioblastoma) cell line. In order to evaluate time-dependent events in cellular responses to radiation, we did a time course study by incubating cells ranging from 0.5 to 48 hours after irradiation. Cell-cycle distribution and apoptosis were evaluated by flow cytometry using propidium iodide (PI) and annexin-V plus PI staining. Cell viability and proliferative capacity were studied by colony formation assay. Dual fluorescence cDNA microarray technique was used to examine the differential expression patterns of the irradiated cells. The cDNA microarray chips used contained DNA sequences corresponding to 12,814 human genes. From the flow cytometry data, it can be observed that radiation induced G2/M phase arrest and that late apoptosis was more evident following G2/M arrest. After 36 hours, some cells underwent senescence and the remains continued on with the cell cycle. Microarray analyses revealed changes in the expression of a small number of cell-cycle-related genes (p21, cyclin B1, etc.) and cell-death genes (tumor necrosis factors, DDB2, etc.) suggesting their involvement in radiation-induced cell-cycle arrest and apoptosis. In silico interpretations of the molecular mechanisms responsible for these radiation effects are in progress
International Nuclear Information System (INIS)
Liu Feifei; Li Jianhua; Lax, Stuart; Klamut, Henry
1997-01-01
Purpose/Objective: We have previously demonstrated that the introduction of human recombinant wild-type p53 carried by the adenoviral vector (Ad5CMV-p53) into two human nasopharyngeal carcinoma (NPC) cell lines (CNE-1 and CNE-2Z) resulted in significant cytotoxicity. In the current work, we wanted to evaluate the results of this strategy when combined with ionizing radiation (XRT). Materials and Methods: CNE-1, CNE-2Z, and a normal human nasopharyngeal fibroblast strain KS1, were infected with iso-effective doses of 2, 6 and 6 pfu/cell of Ad5CMV-p53 respectively. XRT was administered 24 hours post-infection, to coincide with the time of maximal recombinant p53 expression. Western blot analyses were conducted for p53, p21 WAF1/CIP1 , bax and bcl-2. Cell viability was evaluated using both the MTT and clonogenic assays. Presence of apoptosis was determined by using DNA agarose gel electrophoresis. Results: We observed that the combination of Ad5CMV-p53 + XRT (2, 4, and 6 Gy) resulted in an approximately 1-log greater level of cytotoxicity compared to that observed with XRT alone for both NPC cell lines. The MTT assay indicated sparing of the KS1 cells when subjected to the identical treatments. XRT alone stimulated minimal p53 expression; Ad5CMV-p53 alone induced significant recombinant p53 expression, which was not further enhanced by the addition of XRT. Similar observations were made for p21 WAF1/CIP1 expression. No changes were observed for bax and bcl-2 expression with any of these treatments. Apoptosis was induced following 4 Gy of XRT alone, but was observed earlier, at 2 Gy when combined with Ad5CMV-p53. Conclusion: Additional cytotoxicity was observed for the NPC cell lines when XRT was combined with Ad5CMV-p53 infection, with concurrent sparing of normal cells (KS1). This cytotoxicity also appeared to be mediated through the induction of the apoptotic pathway. These results support our previous observation of the potential application of this strategy in the
Enhancement of P53-Mutant Human Colorectal Cancer Cells Radiosensitivity by Flavonoid Fisetin
International Nuclear Information System (INIS)
Chen Wenshu; Lee Yijang; Yu Yichu; Hsaio Chinghui
2010-01-01
Purpose: The aim of this study was to investigate whether fisetin is a potential radiosensitizer for human colorectal cancer cells, which are relatively resistant to radiotherapy. Methods and Materials: Cell survival was examined by clonogenic survival assay, and DNA fragmentation was assessed by terminal deoxynucleotidyl transferase-mediated dUTP nick end labeling assay. The effects of treatments on cell cycle distribution and apoptosis were examined by flow cytometry. Western blot analysis was performed to ascertain the protein levels of γ-H2AX, phospho-Chk2, active caspase-3, PARP cleavage, phospho-p38, phospho-AKT, and phospho-ERK1/2. Results: Fisetin pretreatment enhanced the radiosensitivity of p53-mutant HT-29 human colorectal cancer cells but not human keratocyte HaCaT cells; it also prolonged radiation-induced G 2 /M arrest, enhanced radiation-induced cell growth arrest in HT-29 cells, and suppressed radiation-induced phospho-H2AX (Ser-139) and phospho-Chk2 (Thr-68) in p53-mutant HT-29 cells. Pretreatment with fisetin enhanced radiation-induced caspase-dependent apoptosis in HT-29 cells. Fisetin pretreatment augmented radiation-induced phosphorylation of p38 mitogen-activated protein kinase, which is involved in caspase-mediated apoptosis, and SB202190 significantly reduced apoptosis and radiosensitivity in fisetin-pretreated HT-29 cells. By contrast, both phospho-AKT and phospho-ERK1/2, which are involved in cell proliferation and antiapoptotic pathways, were suppressed after irradiation combined with fisetin pretreatment. Conclusions: To our knowledge, this study is the first to provide evidence that fisetin exerts a radiosensitizing effect in p53-mutant HT-29 cells. Fisetin could potentially be developed as a novel radiosensitizer against radioresistant human cancer cells.
p21-LacZ reporter mice reflect p53-dependent toxic insult
International Nuclear Information System (INIS)
Vasey, Douglas B.; Wolf, C. Roland; MacArtney, Thomas; Brown, Ken; Whitelaw, C. Bruce A.
2008-01-01
There is an urgent need to discover less toxic and more selective drugs to treat disease. The use of transgenic mice that report on toxic insult-induced transcription can provide a valuable tool in this regard. To exemplify this strategy, we have generated transgenic mice carrying a p21-LacZ transgene. Transgene activity reflected endogenous p21 gene activation in various tissues, displayed compound-specific spatial expression signatures in the brain and immune tissues and enabled p53-dependent and p53-independent responses to be identified. We discuss the application of these mice in delineating the molecular events in normal cellular growth and disease and for the evaluation of drug toxicity
Directory of Open Access Journals (Sweden)
Armin Wiegering
2017-04-01
Full Text Available Colorectal carcinoma (CRC is the most common cancer of the gastrointestinal tract with frequently dysregulated intracellular signaling pathways, including p53 signaling. The mainstay of chemotherapy treatment of CRC is 5-fluorouracil (5FU and oxaliplatin. The two anticancer drugs mediate their therapeutic effect via DNA damage-triggered signaling. The small molecule reactivating p53 and inducing tumor apoptosis (RITA is described as an activator of wild-type and reactivator of mutant p53 function, resulting in elevated levels of p53 protein, cell growth arrest, and cell death. Additionally, it has been shown that RITA can induce DNA damage signaling. It is expected that the therapeutic benefits of 5FU and oxaliplatin can be increased by enhancing DNA damage signaling pathways. Therefore, we highlighted the antiproliferative response of RITA alone and in combination with 5FU or oxaliplatin in human CRC cells. A panel of long-term established CRC cell lines (n = 9 including p53 wild-type, p53 mutant, and p53 null and primary patient-derived, low-passage cell lines (n = 5 with different p53 protein status were used for this study. A substantial number of CRC cells with pronounced sensitivity to RITA (IC50< 3.0 μmol/l were identified within established (4/9 and primary patient-derived (2/5 CRC cell lines harboring wild-type or mutant p53 protein. Sensitivity to RITA appeared independent of p53 status and was associated with an increase in antiproliferative response to 5FU and oxaliplatin, a transcriptional increase of p53 targets p21 and NOXA, and a decrease in MYC mRNA. The effect of RITA as an inducer of DNA damage was shown by a strong elevation of phosphorylated histone variant H2A.X, which was restricted to RITA-sensitive cells. Our data underline the primary effect of RITA, inducing DNA damage, and demonstrate the differential antiproliferative effect of RITA to CRC cells independent of p53 protein status. We found a substantial number
INGN 201: Ad-p53, Ad5CMV-p53, Adenoviral p53, INGN 101, p53 gene therapy--Introgen, RPR/INGN 201.
2003-01-01
products. Aventis Gencell will increase its equity stake in Introgen by investing $US 20 million in non-voting preferred shares of Introgen that will be convertible to Introgen common shares at a premium to the market price. Introgen will also receive a 5% equity stake in Aventis Gencell. Introgen intends to use the proceeds of Aventis Gencell's investment to fund the commercialisation of the p53 gene therapy product and to begin building its internal sales and marketing division to support the products anticipated market introduction. In April 2001, Aventis Pharma announced that it intended to spin off its gene therapy division, Aventis Gencell, as a separate operating company. In mid-2002, Aventis Pharma was still attempting to spin off Aventis Gencell but negotiations with venture capital partners had failed. Gene Logic (formerly OncorMed) of the US was contracted by Introgen to perform the p53 status testing for RPR/INGN 201 phase I clinical trials. In February 2003, Introgen announced it will streamline its phase III clinical trials for head and neck cancer to reduce spending, and that INGN 201 received Orphan Drug Status for head and neck cancer in the US. According to results (published in January 2003) of Introgen's phase II study of non-metastatic patients with non-small cell lung cancer (ineligible to receive surgery or combination therapy with radiation and cancer chemotherapy) treated with INGN 201 combined with radiation therapy, approximately 60% of patients' primary tumours regressed or disappeared after the combination therapy, as assessed by both biopsies and by CT scans 3 months after treatment. Investigators commented that further randomised trials are needed to follow-up on these observations. In February 2003, Introgen announced that it will move ahead with the development of registration plans for a non-small cell lung cancer indication for INGN 201, and is now including support for lung cancer registration in partnering discussions. RPR/INGN 201 is
Imiquimod activates p53-dependent apoptosis in a human basal cell carcinoma cell line.
Huang, Shi-Wei; Chang, Shu-Hao; Mu, Szu-Wei; Jiang, Hsin-Yi; Wang, Sin-Ting; Kao, Jun-Kai; Huang, Jau-Ling; Wu, Chun-Ying; Chen, Yi-Ju; Shieh, Jeng-Jer
2016-03-01
The tumor suppressor p53 controls DNA repair, cell cycle, apoptosis, autophagy and numerous other cellular processes. Imiquimod (IMQ), a synthetic toll-like receptor (TLR) 7 ligand for the treatment of superficial basal cell carcinoma (BCC), eliminates cancer cells by activating cell-mediated immunity and directly inducing apoptosis and autophagy in cancer cells. To evaluate the role of p53 in IMQ-induced cell death in skin cancer cells. The expression, phosphorylation and subcellular localization of p53 were detected by real-time PCR, luciferase reporter assay, cycloheximide chase analysis, immunoblotting and immunocytochemistry. Using BCC/KMC1 cell line as a model, the upstream signaling of p53 activation was dissected by over-expression of TLR7/8, the addition of ROS scavenger, ATM/ATR inhibitors and pan-caspase inhibitor. The role of p53 in IMQ-induced apoptosis and autophagy was assessed by genetically silencing p53 and evaluated by a DNA content assay, immunoblotting, LC3 puncta detection and acridine orange staining. IMQ induced p53 mRNA expression and protein accumulation, increased Ser15 phosphorylation, promoted nuclear translocation and up-regulated its target genes in skin cancer cells in a TLR7/8-independent manner. In BCC/KMC1 cells, the induction of p53 by IMQ was achieved through increased ROS production to stimulate the ATM/ATR-Chk1/Chk2 axis but was not mediated by inducing DNA damage. The pharmacological inhibition of ATM/ATR significantly suppressed IMQ-induced p53 activation and apoptosis. Silencing of p53 significantly decreased the IMQ-induced caspase cascade activation and apoptosis but enhanced autophagy. Mutant p53 skin cancer cell lines were more resistant to IMQ-induced apoptosis than wildtype p53 skin cancer cell lines. IMQ induced ROS production to stimulate ATM/ATR pathways and contributed to p53-dependent apoptosis in a skin basal cell carcinoma cell line BCC/KMC1. Copyright © 2015 Japanese Society for Investigative Dermatology
Chou, Wen-Wen; Guh, Jinn-Yuh; Tsai, Jung-Fa; Hwang, Chi-Ching; Chiou, Shean-Jaw; Chuang, Lea-Yea
2009-06-01
Betel-quid use is associated with liver cancer whereas its constituent arecoline is cytotoxic, genotoxic, and induces p53-dependent p21(WAF1) protein expression in Clone-9 cells (rat hepatocytes). The ataxia telangiectasia mutated (ATM)/rad3-related (ATR)-p53-p21(WAF1) and the phosphatidylinositol-3-kinase (PI3K)-mammalian target of rapamycin (mTOR) pathways are involved in the DNA damage response and the pathogenesis of cancers. Thus, we studied the role of ATM/ATR and PI3K in arecoline-induced p53 and p21(WAF1) protein expression in Clone-9 cells. We found that arecoline (0.5 mM) activated the ATM/ATR kinase at 30 min. The arecoline-activated ATM/ATR substrate contained p-p53Ser15. Moreover, arecoline only increased the levels of the p-p53Ser6, p-p53Ser15, and p-p53Ser392 phosphorylated p53 isoforms among the known isoforms. ATM shRNA attenuated arecoline-induced p-p53Ser15 and p21(WAF1) at 24 h. Arecoline (0.5 mM) increased phosphorylation levels of p-AktSer473 and p-mTORSer2448 at 30-60 min. Dominant-negative PI3K plasmids attenuated arecoline-induced p21(WAF1), but not p-p53Ser15, at 24 h. Rapamycin attenuated arecoline-induced phosphrylated p-p53Ser15, but not p21(WAF1), at 24 h. ATM shRNA, but not dominant-negative PI3K plasmids, attenuated arecoline-induced p21(WAF1) gene transcription. We conclude that arecoline activates the ATM/ATR-p53-p21(WAF1) and the PI3K/Akt-mTOR-p53 pathways in Clone-9 cells. Arecoline-induced phosphorylated p-p53Ser15 expression is dependent on ATM whereas arecoline-induced p21(WAF1) protein expression is dependent on ATM and PI3K. Moreover, p21(WAF1) gene is transcriptionally induced by arecoline-activated ATM. (c) 2009 Wiley-Liss, Inc.
International Nuclear Information System (INIS)
Bom, Hee Seung; Min, Jung Jun; Kim, Kyung Keun; Choi, Keun Hee
2000-01-01
The purpose of this study was to evaluate the relationship between radiation-induced acivation of DNA repair genes and radiation induced apoptosis in A431 cell line. Five and 25 Gys of gamma radiation were given to A431 cells by a Cs-137 cell irradiator. Apoptosis was evaluated by flow cytometry using annexin V-fluorescein isothiocyanate and propidium iodide staining. The expression of DNA repair genes was evaluated by both Northern and Western blot analyses. The number of apoptotic cells increased with the increased radiation dose. It increased most significantly at 12 hours after irradiation. Expression of p53, p21, and ℎRAD50 reached the highest level at 12 hours after 5 Gy irradiation. In response to 25 Gy irradiation, ℎRAD50 and p21 were expressed maximally at 12 hours, but p53 and GADD45 genes showed the highest expression level after 12 hours. Induction of apoptosis and DNA repair by ionizing radiation were closely correlated. The peak time of inducing apoptosis and DNA repair was 12 hours in this study model. ℎRAD50, a recently discovered DNA repair gene, was also associated with radiation-induced apoptosis.=20
International Nuclear Information System (INIS)
El Maghraby, T.
2003-01-01
One of the most important environmental and occupational metallic toxicants is cadmium. It causes generic irregularity of proto-oncogenes that leads to carcinogenicity and cytotoxicity in male reproductive tissues. Both ionizing radiation and cadmium generate reactive oxygen species (ROS). When the balance between ROS and antioxidant system is lost, oxidative stress is produced, so, the present investigation was carried out to study the effect of cadmium and ionizing radiation on the expression of tumor suppressor gene P53 and antioxidant enzymes in testis, prostate and liver in vivo rats related to histopathological changes. The results revealed that the ionizing radiation caused increase in the level of P53 expression, activities of superoxide dismutases (SOD) and catalase (CAT) especially at 24 hours, while there is negative dose dependent relationship between cadmium and P53 expression in testis reverse to prostate. However, in liver, further induction of P53 gene expression by cadmium was not observed. These results revealed the dangerous effects of cadmium and ionizing radiation on human body, especially in male reproductive tissues
Roh, Jong-Lyel; Ko, Jung Ho; Moon, Soo Jin; Ryu, Chang Hwan; Choi, Jun Young; Koch, Wayne M
2012-12-01
We evaluated whether the restoration of p53 function by the p53-reactivating small molecule RITA (reactivation of p53 and induction of tumor cell apoptosis enhances cisplatin-induced cytotoxicity and apoptosis in head-and-neck cancer (HNC). RITA induced prominent accumulation and reactivation of p53 in a wild-type TP53-bearing HNC cell line. RITA showed maximal growth suppression in tumor cells showing MDM2-dependent p53 degradation. RITA promoted apoptosis in association with upregulation of p21, BAX, and cleaved caspase-3; notably, the apoptotic response was blocked by pifithrin-α, demonstrating its p53 dependence. With increasing concentrations, RITA strongly induced apoptosis rather than G2-phase arrest. In combination therapy, RITA enhanced cisplatin-induced growth inhibition and apoptosis of HNC cells invitro and in vivo. Our data suggest that the restoration of p53 tumor-suppressive function by RITA enhances the cytotoxicity and apoptosis of cisplatin, an action that may offer an attractive strategy for treating HNC. Copyright © 2012 Elsevier Ireland Ltd. All rights reserved.
Lee, Soonduck; Kim, Jinsun; Jung, Samil; Li, Chengping; Yang, Young; Kim, Keun Il; Lim, Jong-Seok; Kim, Yonghwan; Cheon, Choong-Il; Lee, Myeong-Sok
2015-03-01
Vitamin C is considered as an important anticancer therapeutic agent although this view is debatable. In this study, we introduce a physiological mechanism demonstrating how vitamin C exerts anticancer activity that induces cell cycle arrest and apoptosis. Our previous and current data reveal that p53 tumor suppressor is the prerequisite factor for stronger anticancer effects of vitamin C. In addition, vitamin C-mediated cancer cell cytotoxicity appears to be achieved at least partly through the downregulation of the p34SEI-1 oncoprotein. Our previous study showed that p34SEI-1 increases the survival of various types of cancer cells by inhibiting their apoptosis. Present data suggest that vitamin C treatment decreases the p34SEI-1 expression at the protein level and therefore alleviates its anti-apoptotic activity. Of note, SIAH1, E3 ubiquitin ligase, appears to be responsible for the p34SEI-1 polyubiquitination and its subsequent degradation, which is dependent on p53. In summary, vitamin C increases cancer cell death by inducing SIAH1-mediated polyubiquitination/degradation of the p34SEI-1 oncoprotein in a p53-dependent manner.
Fox, Daniel K.; Ebert, Scott M.; Bongers, Kale S.; Dyle, Michael C.; Bullard, Steven A.; Dierdorff, Jason M.; Kunkel, Steven D.
2014-01-01
Immobilization causes skeletal muscle atrophy via complex signaling pathways that are not well understood. To better understand these pathways, we investigated the roles of p53 and ATF4, two transcription factors that mediate adaptations to a variety of cellular stresses. Using mouse models, we demonstrate that 3 days of muscle immobilization induces muscle atrophy and increases expression of p53 and ATF4. Furthermore, muscle fibers lacking p53 or ATF4 are partially resistant to immobilization-induced muscle atrophy, and forced expression of p53 or ATF4 induces muscle fiber atrophy in the absence of immobilization. Importantly, however, p53 and ATF4 do not require each other to promote atrophy, and coexpression of p53 and ATF4 induces more atrophy than either transcription factor alone. Moreover, muscle fibers lacking both p53 and ATF4 are more resistant to immobilization-induced atrophy than fibers lacking only p53 or ATF4. Interestingly, the independent and additive nature of the p53 and ATF4 pathways allows for combinatorial control of at least one downstream effector, p21. Using genome-wide mRNA expression arrays, we identified p21 mRNA as a skeletal muscle transcript that is highly induced in immobilized muscle via the combined actions of p53 and ATF4. Additionally, in mouse muscle, p21 induces atrophy in a manner that does not require immobilization, p53 or ATF4, and p21 is required for atrophy induced by immobilization, p53, and ATF4. Collectively, these results identify p53 and ATF4 as essential and complementary mediators of immobilization-induced muscle atrophy and discover p21 as a critical downstream effector of the p53 and ATF4 pathways. PMID:24895282
Oh, Eun-Taex; Park, Moon-Taek; Choi, Bo-Hwa; Ro, Seonggu; Choi, Eun-Kyung; Jeong, Seong-Yun; Park, Heon Joo
2012-04-01
Histone deacetylase (HDAC) plays an important role in cancer onset and progression. Therefore, inhibition of HDAC offers potential as an effective cancer treatment regimen. CG200745, (E)-N(1)-(3-(dimethylamino)propyl)-N(8)-hydroxy-2-((naphthalene-1-loxy)methyl)oct-2-enediamide, is a novel HDAC inhibitor presently undergoing a phase I clinical trial. Enhancement of p53 acetylation by HDAC inhibitors induces cell cycle arrest, differentiation, and apoptosis in cancer cells. The purpose of the present study was to investigate the role of p53 acetylation in the cancer cell death caused by CG200745. CG200745-induced clonogenic cell death was 2-fold greater in RKO cells expressing wild-type p53 than in p53-deficient RC10.1 cells. CG200745 treatment was also cytotoxic to PC-3 human prostate cancer cells, which express wild-type p53. CG200745 increased acetylation of p53 lysine residues K320, K373, and K382. CG200745 induced the accumulation of p53, promoted p53-dependent transactivation, and enhanced the expression of MDM2 and p21(Waf1/Cip1) proteins, which are encoded by p53 target genes. An examination of CG200745 effects on p53 acetylation using cells transfected with various p53 mutants showed that cells expressing p53 K382R mutants were significantly resistant to CG200745-induced clonogenic cell death compared with wild-type p53 cells. Moreover, p53 transactivation in response to CG200745 was suppressed in all cells carrying mutant forms of p53, especially K382R. Taken together, these results suggest that acetylation of p53 at K382 plays an important role in CG200745-induced p53 transactivation and clonogenic cell death.
Effect of hydroxyurea on the promoter occupancy profiles of tumor suppressor p53 and p73
Directory of Open Access Journals (Sweden)
Lu Xin
2009-06-01
Full Text Available Abstract Background The p53 tumor suppressor and its related protein, p73, share a homologous DNA binding domain, and mouse genetics studies have suggested that they have overlapping as well as distinct biological functions. Both p53 and p73 are activated by genotoxic stress to regulate an array of cellular responses. Previous studies have suggested that p53 and p73 independently activate the cellular apoptotic program in response to cytotoxic drugs. The goal of this study was to compare the promoter-binding activity of p53 and p73 at steady state and after genotoxic stress induced by hydroxyurea. Results We employed chromatin immunoprecipitation, the NimbleGen promoter arrays and a model-based algorithm for promoter arrays to identify promoter sequences enriched in anti-p53 or anti-p73 immunoprecipitates, either before or after treatment with hydroxyurea, which increased the expression of both p53 and p73 in the human colon cancer cell line HCT116-3(6. We calculated a model-based algorithm for promoter array score for each promoter and found a significant correlation between the promoter occupancy profiles of p53 and p73. We also found that after hydroxyurea treatment, the p53-bound promoters were still bound by p73, but p73 became associated with additional promoters that that did not bind p53. In particular, we showed that hydroxyurea induces the binding of p73 but not p53 to the promoter of MLH3, which encodes a mismatch repair protein, and causes an up-regulation of the MLH3 mRNA. Conclusion These results suggest that hydroxyurea exerts differential effects on the promoter-binding functions of p53 and p73 and illustrate the power of model-based algorithm for promoter array in the analyses of promoter occupancy profiles of highly homologous transcription factors.
Defense mechanisms against radiation induced teratogenic damage in mice
International Nuclear Information System (INIS)
Kato, F.; Ootsuyama, A.; Nomoto, S.; Norimura, T.
2002-01-01
Experimental studies with mice have established that fetuses at midgestational stage are highly susceptible to malformation at high, but not low, doses of radiation. When DNA damage is produced by a small amount of radiation, it is efficiently eliminated by DNA repair. However, DNA repair is not perfect. There must be defense mechanisms other than DNA repair. In order to elucidate the essential role of p53 gene in apoptotic tissue repair, we compared the incidence of radiation-induced malformations and deaths (deaths after day 10) in wild-type p53 (+/+) mice and null p53 (-/-) mice. For p53 (+/+) mice, an X-ray dose of 2 Gy given at a high dose-rate (450 mGy/min) to fetuses at 9.5 days of gestation was highly lethal and considerably teratogenic whereas it was only slightly lethal but highly teratogenic for p53 (-/-) fetuses. This reciprocal relationship of radiosensitivity to malformations and deaths supports the notion that fetal tissues have a p53 -dependent idguardianln of the tissue that aborts cells bearing radiation-induced teratogenic DNA damage. When an equal dose of 2 Gy given at a 400-fold lower dose-rate (1.2 mGy/min), this dose became not teratogenic for p53 (+/+) fetuses exhibiting p53 -dependent apoptosis, whereas this dose remained teratogenic for p53 (-/-) fetuses unable to carry out apoptosis. Furthermore, when the dose was divided into two equal dose fractions (1+1 Gy) at high dose rate, separated by 24 hours, the incidences of malformations were equal with control level for p53 (+/+), but higher for p53 (-/-) mice. Hence, complete elimination of teratogenic damage from irradiated tissues requires a concerted cooperation of two mechanisms; proficient DNA repair and p53-dependent apoptotic tissue repair
De Smet, Frederik; Saiz Rubio, Mirian; Hompes, Daphne; Naus, Evelyne; De Baets, Greet; Langenberg, Tobias; Hipp, Mark S; Houben, Bert; Claes, Filip; Charbonneau, Sarah; Delgado Blanco, Javier; Plaisance, Stephane; Ramkissoon, Shakti; Ramkissoon, Lori; Simons, Colinda; van den Brandt, Piet; Weijenberg, Matty; Van England, Manon; Lambrechts, Sandrina; Amant, Frederic; D'Hoore, André; Ligon, Keith L; Sagaert, Xavier; Schymkowitz, Joost; Rousseau, Frederic
2017-05-01
Although p53 protein aggregates have been observed in cancer cell lines and tumour tissue, their impact in cancer remains largely unknown. Here, we extensively screened for p53 aggregation phenotypes in tumour biopsies, and identified nuclear inclusion bodies (nIBs) of transcriptionally inactive mutant or wild-type p53 as the most frequent aggregation-like phenotype across six different cancer types. p53-positive nIBs co-stained with nuclear aggregation markers, and shared molecular hallmarks of nIBs commonly found in neurodegenerative disorders. In cell culture, tumour-associated stress was a strong inducer of p53 aggregation and nIB formation. This was most prominent for mutant p53, but could also be observed in wild-type p53 cell lines, for which nIB formation correlated with the loss of p53's transcriptional activity. Importantly, protein aggregation also fuelled the dysregulation of the proteostasis network in the tumour cell by inducing a hyperactivated, oncogenic heat-shock response, to which tumours are commonly addicted, and by overloading the proteasomal degradation system, an observation that was most pronounced for structurally destabilized mutant p53. Patients showing tumours with p53-positive nIBs suffered from a poor clinical outcome, similar to those with loss of p53 expression, and tumour biopsies showed a differential proteostatic expression profile associated with p53-positive nIBs. p53-positive nIBs therefore highlight a malignant state of the tumour that results from the interplay between (1) the functional inactivation of p53 through mutation and/or aggregation, and (2) microenvironmental stress, a combination that catalyses proteostatic dysregulation. This study highlights several unexpected clinical, biological and therapeutically unexplored parallels between cancer and neurodegeneration. Copyright © 2017 Pathological Society of Great Britain and Ireland. Published by John Wiley & Sons, Ltd. Copyright © 2016 Pathological Society of Great
Directory of Open Access Journals (Sweden)
Xiang Ling
Full Text Available Drug/radiation resistance to treatment and tumor relapse are major obstacles in identifying a cure for cancer. Development of novel agents that address these challenges would therefore be of the upmost importance in the fight against cancer. In this regard, studies show that the antiapoptotic protein survivin is a central molecule involved in both hurdles. Using cancer cell-based survivin-reporter systems (US 7,569,221 B2 via high throughput screening (HTS of compound libraries, followed by in vitro and in vivo analyses of HTS-derived hit-lead compounds, we identified a novel anticancer compound (designated FL118. FL118 shows structural similarity to irinotecan. However, while the inhibition of DNA topoisomerase 1 activity by FL118 was no better than the active form of irinotecan, SN-38 at 1 µM, FL118 effectively inhibited cancer cell growth at less than nM levels in a p53 status-independent manner. Moreover, FL118 selectively inhibited survivin promoter activity and gene expression also in a p53 status-independent manner. Although the survivin promoter-reporter system was used for the identification of FL118, our studies revealed that FL118 not only inhibits survivin expression but also selectively and independently inhibits three additional cancer-associated survival genes (Mcl-1, XIAP and cIAP2 in a p53 status-independent manner, while showing no inhibitory effects on control genes. Genetic silencing or overexpression of FL118 targets demonstrated a role for these targets in FL118's effects. Follow-up in vivo studies revealed that FL118 exhibits superior antitumor efficacy in human tumor xenograft models in comparison with irinotecan, topotecan, doxorubicin, 5-FU, gemcitabine, docetaxel, oxaliplatin, cytoxan and cisplatin, and a majority of mice treated with FL118 showed tumor regression with a weekly × 4 schedule. FL118 induced favorable body-weight-loss profiles (temporary and reversible and was able to eliminate large tumors. Together
International Nuclear Information System (INIS)
Oya, N.; Zoelzer, F.; Werner, F.; Streffer, C.
2003-01-01
Purpose: The effects of serum starvation on radiation sensitivity, cell proliferation and apoptosis were investigated with particular consideration of the p53 status. Material and Methods: Four human tumor cell lines, Be11 (melanoma, p53 wild-type), MeWo (melanoma, p53 mutant), 4197 (squamous cell carcinoma, p53 wild-type) and 4451 (squamous cell carcinoma, p53 mutant), were used. After the cells had been incubated in starvation medium (0.5% FCS) for 1-6 days, changes in cell cycle distribution, induction of apoptosis and necrosis, and changes in radiation sensitivity were assessed by two-parameter flow cytometric measurements of DNA content/BrdU labeling, two-parameter flow cytometric measurements of DNA-dye-exclusion/Annexin V binding, and a conventional colony assay, respectively. Results: p53 wild-type cell lines showed a decrease in the BrdU labeling index and an increase in the apoptotic cell frequency in starvation medium. p53 mutant cell lines showed a decrease in the BrdU labeling index but no evidence of apoptosis. These cells went into necrosis instead. The radiation sensitivity was increased in 4451 and slightly decreased in Be11 and 4197 in starvation medium. Conclusion: These data suggest a functional involvement of p53 in starvation-induced G1-block and apoptosis in tumor cells. Altered radiosensitivity after culture in starvation medium seemed to be explained at least in part by the starvation-induced G1-block. The frequency of starvation-induced apoptosis or necrosis was not correlated with radiation sensitivity. (orig.)
Loss of p53 induces M-phase retardation following G2 DNA damage checkpoint abrogation.
Minemoto, Yuzuru; Uchida, Sanae; Ohtsubo, Motoaki; Shimura, Mari; Sasagawa, Toshiyuki; Hirata, Masato; Nakagama, Hitoshi; Ishizaka, Yukihito; Yamashita, Katsumi
2003-04-01
Most cell lines that lack functional p53 protein are arrested in the G2 phase of the cell cycle due to DNA damage. When the G2 checkpoint is abrogated, these cells are forced into mitotic catastrophe. A549 lung adenocarcinoma cells, in which p53 was eliminated with the HPV16 E6 gene, exhibited efficient arrest in the G2 phase when treated with adriamycin. Administration of caffeine to G2-arrested cells induced a drastic change in cell phenotype, the nature of which depended on the status of p53. Flow cytometric and microscopic observations revealed that cells that either contained or lacked p53 resumed their cell cycles and entered mitosis upon caffeine treatment. However, transit to the M phase was slower in p53-negative cells than in p53-positive cells. Consistent with these observations, CDK1 activity was maintained at high levels, along with stable cyclin B1, in p53-negative cells. The addition of butyrolactone I, which is an inhibitor of CDK1 and CDK2, to the p53-negative cells reduced the floating round cell population and induced the disappearance of cyclin B1. These results suggest a relationship between the p53 pathway and the ubiquitin-mediated degradation of mitotic cyclins and possible cross-talk between the G2-DNA damage checkpoint and the mitotic checkpoint.
SCGB3A2 Inhibits Acrolein-Induced Apoptosis through Decreased p53 Phosphorylation.
Kurotani, Reiko; Shima, Reika; Miyano, Yuki; Sakahara, Satoshi; Matsumoto, Yoshie; Shibata, Yoko; Abe, Hiroyuki; Kimura, Shioko
2015-04-28
Chronic obstructive pulmonary disease (COPD), a major global health problem with increasing morbidity and mortality rates, is anticipated to become the third leading cause of death worldwide by 2020. COPD arises from exposure to cigarette smoke. Acrolein, which is contained in cigarette smoke, is the most important risk factor for COPD. It causes lung injury through altering apoptosis and causes inflammation by augmenting p53 phosphorylation and producing reactive oxygen species (ROS). Secretoglobin (SCGB) 3A2, a secretory protein predominantly present in the epithelial cells of the lungs and trachea, is a cytokine-like small molecule having anti-inflammatory, antifibrotic, and growth factor activities. In this study, the effect of SCGB3A2 on acrolein-related apoptosis was investigated using the mouse fibroblast cell line MLg as the first step in determining the possible therapeutic value of SCGB3A2 in COPD. Acrolein increased the production of ROS and phosphorylation of p53 and induced apoptosis in MLg cells. While the extent of ROS production induced by acrolein was not affected by SCGB3A2, p53 phosphorylation was significantly decreased by SCGB3A2. These results demonstrate that SCGB3A2 inhibited acrolein-induced apoptosis through decreased p53 phosphorylation, not altered ROS levels.
SCGB3A2 Inhibits Acrolein-Induced Apoptosis through Decreased p53 Phosphorylation
International Nuclear Information System (INIS)
Kurotani, Reiko; Shima, Reika; Miyano, Yuki; Sakahara, Satoshi; Matsumoto, Yoshie; Shibata, Yoko; Abe, Hiroyuki; Kimura, Shioko
2015-01-01
Chronic obstructive pulmonary disease (COPD), a major global health problem with increasing morbidity and mortality rates, is anticipated to become the third leading cause of death worldwide by 2020. COPD arises from exposure to cigarette smoke. Acrolein, which is contained in cigarette smoke, is the most important risk factor for COPD. It causes lung injury through altering apoptosis and causes inflammation by augmenting p53 phosphorylation and producing reactive oxygen species (ROS). Secretoglobin (SCGB) 3A2, a secretory protein predominantly present in the epithelial cells of the lungs and trachea, is a cytokine-like small molecule having anti-inflammatory, antifibrotic, and growth factor activities. In this study, the effect of SCGB3A2 on acrolein-related apoptosis was investigated using the mouse fibroblast cell line MLg as the first step in determining the possible therapeutic value of SCGB3A2 in COPD. Acrolein increased the production of ROS and phosphorylation of p53 and induced apoptosis in MLg cells. While the extent of ROS production induced by acrolein was not affected by SCGB3A2, p53 phosphorylation was significantly decreased by SCGB3A2. These results demonstrate that SCGB3A2 inhibited acrolein-induced apoptosis through decreased p53 phosphorylation, not altered ROS levels
AAVPG: A vigilant vector where transgene expression is induced by p53
Energy Technology Data Exchange (ETDEWEB)
Bajgelman, Marcio C.; Medrano, Ruan F.V.; Carvalho, Anna Carolina P.V.; Strauss, Bryan E., E-mail: bstrauss@usp.br
2013-12-15
Using p53 to drive transgene expression from viral vectors may provide on demand expression in response to physiologic stress, such as hypoxia or DNA damage. Here we introduce AAVPG, an adeno-associated viral (AAV) vector where a p53-responsive promoter, termed PG, is used to control transgene expression. In vitro assays show that expression from the AAVPG-luc vector was induced specifically in the presence of functional p53 (1038±202 fold increase, p<0.001). The AAVPG-luc vector was an effective biosensor of p53 activation in response to hypoxia (4.48±0.6 fold increase in the presence of 250 µM CoCl{sub 2}, p<0.001) and biomechanical stress (2.53±0.4 fold increase with stretching, p<0.05). In vivo, the vigilant nature of the AAVPG-luc vector was revealed after treatment of tumor-bearing mice with doxorubicin (pre-treatment, 3.4×10{sup 5}±0.43×10{sup 5} photons/s; post-treatment, 6.6×10{sup 5}±2.1×10{sup 5} photons/s, p<0.05). These results indicate that the AAVPG vector is an interesting option for detecting p53 activity both in vitro and in vivo. - Highlights: • AAV vector where transgene expression is controlled by the tumor suppressor p53. • The new vector, AAVPG, shown to function as a biosensor of p53 activity, in vitro and in vivo. • The p53 activity monitored by the AAVPG vector is relevant to cancer and other diseases. • AAVPG reporter gene expression was activated upon DNA damage, hypoxia and mechanical stress.
Iron deprivation induces apoptosis independently of p53 in human and murine tumour cells
Czech Academy of Sciences Publication Activity Database
Truksa, Jaroslav; Kovář, Jan; Valenta, Tomáš; Ehrlichová, Marie; Polák, J.; Naumann, P. W.
2003-01-01
Roč. 36, č. 4 (2003), s. 199-213 ISSN 0960-7722 R&D Projects: GA ČR GA301/01/0041 Keywords : iron deprivation * p53 * apoptosis induction Subject RIV: EB - Gene tics ; Molecular Biology Impact factor: 1.529, year: 2003
Regulation of autophagy by cytoplasmic p53.
Tasdemir, Ezgi; Maiuri, M Chiara; Galluzzi, Lorenzo; Vitale, Ilio; Djavaheri-Mergny, Mojgan; D'Amelio, Marcello; Criollo, Alfredo; Morselli, Eugenia; Zhu, Changlian; Harper, Francis; Nannmark, Ulf; Samara, Chrysanthi; Pinton, Paolo; Vicencio, José Miguel; Carnuccio, Rosa; Moll, Ute M; Madeo, Frank; Paterlini-Brechot, Patrizia; Rizzuto, Rosario; Szabadkai, Gyorgy; Pierron, Gérard; Blomgren, Klas; Tavernarakis, Nektarios; Codogno, Patrice; Cecconi, Francesco; Kroemer, Guido
2008-06-01
Multiple cellular stressors, including activation of the tumour suppressor p53, can stimulate autophagy. Here we show that deletion, depletion or inhibition of p53 can induce autophagy in human, mouse and nematode cells subjected to knockout, knockdown or pharmacological inhibition of p53. Enhanced autophagy improved the survival of p53-deficient cancer cells under conditions of hypoxia and nutrient depletion, allowing them to maintain high ATP levels. Inhibition of p53 led to autophagy in enucleated cells, and cytoplasmic, not nuclear, p53 was able to repress the enhanced autophagy of p53(-/-) cells. Many different inducers of autophagy (for example, starvation, rapamycin and toxins affecting the endoplasmic reticulum) stimulated proteasome-mediated degradation of p53 through a pathway relying on the E3 ubiquitin ligase HDM2. Inhibition of p53 degradation prevented the activation of autophagy in several cell lines, in response to several distinct stimuli. These results provide evidence of a key signalling pathway that links autophagy to the cancer-associated dysregulation of p53.
Energy Technology Data Exchange (ETDEWEB)
Sun, Hengwen [Department of Radiation, Cancer Center of Guangdong General Hospital (Guangdong Academy of Medical Science), Guangzhou, 510080, Guangdong (China); Yang, Shana; Li, Jianhua [Department of Physiology, Guangzhou Medical University, Guangzhou, 510182, Guangdong (China); Zhang, Yajie [Department of Pathology, Guangzhou Medical University, Guangzhou, 510182, Guangdong (China); Gao, Dongsheng [Department of Oncology, Guangdong Medical College Affiliated Pengpai Memorial Hospital, Hai Feng, 516400, Gungdong (China); Zhao, Shenting, E-mail: zhaoshenting@126.com [Department of Physiology, Guangzhou Medical University, Guangzhou, 510182, Guangdong (China)
2016-03-25
Hepatocellular carcinoma (HCC) is the fifth most common cancer in the world. The aim of radiotherapy is to eradicate cancer cells with ionizing radiation. Except for the caspase-dependent mechanism, several lines of evidence demonstrated that caspase-independent mechanism is directly involved in the cell death responding to irradiation. For this reason, defining the contribution of caspase-independent molecular mechanisms represents the main goal in radiotherapy. In this study, we focused on the role of apoptosis-inducing factor (AIF), the caspase-independent molecular, in ionizing radiation induced hepatocellular carcinoma cell line (HepG2) cell death. We found that ionizing radiation has no function on AIF expression in HepG2 cells, but could induce AIF release from the mitochondria and translocate into nuclei. Inhibition of AIF could reduce ionizing radiation induced HepG2 cell death. These studies strongly support a direct relationship between AIF nuclear translocation and radiation induced cell death. What's more, AIF nuclear translocation is caspase-independent manner, but not caspase-dependent manner, in this process. These new findings add a further attractive point of investigation to better define the complex interplay between caspase-independent cell death and radiation therapy. - Highlights: • AIF nuclear translocation is involved in ionizing radiation induced hepatocellular carcinoma cell line HepG2 cell death. • AIF mediated cell death induced by ionizing radiation is caspase-independent. • Caspase-independent pathway is involved in ionzing radiation induced HepG2 cell death.
International Nuclear Information System (INIS)
Sun, Hengwen; Yang, Shana; Li, Jianhua; Zhang, Yajie; Gao, Dongsheng; Zhao, Shenting
2016-01-01
Hepatocellular carcinoma (HCC) is the fifth most common cancer in the world. The aim of radiotherapy is to eradicate cancer cells with ionizing radiation. Except for the caspase-dependent mechanism, several lines of evidence demonstrated that caspase-independent mechanism is directly involved in the cell death responding to irradiation. For this reason, defining the contribution of caspase-independent molecular mechanisms represents the main goal in radiotherapy. In this study, we focused on the role of apoptosis-inducing factor (AIF), the caspase-independent molecular, in ionizing radiation induced hepatocellular carcinoma cell line (HepG2) cell death. We found that ionizing radiation has no function on AIF expression in HepG2 cells, but could induce AIF release from the mitochondria and translocate into nuclei. Inhibition of AIF could reduce ionizing radiation induced HepG2 cell death. These studies strongly support a direct relationship between AIF nuclear translocation and radiation induced cell death. What's more, AIF nuclear translocation is caspase-independent manner, but not caspase-dependent manner, in this process. These new findings add a further attractive point of investigation to better define the complex interplay between caspase-independent cell death and radiation therapy. - Highlights: • AIF nuclear translocation is involved in ionizing radiation induced hepatocellular carcinoma cell line HepG2 cell death. • AIF mediated cell death induced by ionizing radiation is caspase-independent. • Caspase-independent pathway is involved in ionzing radiation induced HepG2 cell death.
Stimulation of autophagy by the p53 target gene Sestrin2.
Maiuri, Maria Chiara; Malik, Shoaib Ahmad; Morselli, Eugenia; Kepp, Oliver; Criollo, Alfredo; Mouchel, Pierre-Luc; Carnuccio, Rosa; Kroemer, Guido
2009-05-15
The oncosuppressor protein p53 regulates autophagy in a dual fashion. The pool of cytoplasmic p53 protein represses autophagy in a transcription-independent fashion, while the pool of nuclear p53 stimulates autophagy through the transactivation of specific genes. Here we report the discovery that Sestrin2, a novel p53 target gene, is involved in the induction of autophagy. Depletion of Sestrin2 by RNA interference reduced the level of autophagy in a panel of p53-sufficient human cancer cell lines responding to distinct autophagy inducers. In quantitative terms, Sestrin2 depletion was as efficient in preventing autophagy induction as was the depletion of Dram, another p53 target gene. Knockout of either Sestrin2 or Dram reduced autophagy elicited by nutrient depletion, rapamycin, lithium or thapsigargin. Moreover, autophagy induction by nutrient depletion or pharmacological stimuli led to an increase in Sestrin2 expression levels in p53-proficient cells. In strict contrast, the depletion of Sestrin2 or Dram failed to affect autophagy in p53-deficient cells and did not modulate the inhibition of baseline autophagy by a cytoplasmic p53 mutant that was reintroduced into p53-deficient cells. We conclude that Sestrin2 acts as a positive regulator of autophagy in p53-proficient cells.
Human T-Cell Leukemia Virus I Tax Protein Sensitizes p53-Mutant Cells to DNA Damage
Mihaylova, Valia T.; Green, Allison M.; Khurgel, Moshe; Semmes, Oliver J.; Kupfer, Gary M.
2018-01-01
Mutations in p53 are a common cause of resistance of cancers to standard chemotherapy and, thus, treatment failure. Reports have shown that Tax, a human T-cell leukemia virus type I encoded protein that has been associated with genomic instability and perturbation of transcription and cell cycle, sensitizes HeLa cells to UV treatment. The extent to which Tax can sensitize cells and the mechanism by which it exerts its effect are unknown. In this study, we show that Tax sensitizes p53-mutant cells to a broad range of DNA-damaging agents, including mitomycin C, a bifunctional alkylator, etoposide, a topoisomerase II drug, and UV light, but not ionizing radiation, a double-strand break agent, or vinblastine, a tubulin poison. Tax caused hypersensitivity in all p53-deleted cell lines and several, but not all, mutant-expressed p53–containing cell lines, while unexpectedly being protective in p53 wild-type (wt) cells. The effect observed in p53-deleted lines could be reversed for this by transfection of wt p53. We also show that Tax activates a p53-independent proapoptotic program through decreased expression of the retinoblastoma protein and subsequent increased E2F1 expression. The expression of several proapoptotic proteins was also induced by Tax, including Puma and Noxa, culminating in a substantial increase in Bax dimerization. Our results show that Tax can sensitize p53-mutant cells to DNA damage while protecting p53 wt cells, a side benefit that might result in reduced toxicity in normal cells. Such studies hold the promise of a novel adjunctive therapy that could make cancer chemotherapy more effective. PMID:18559532
International Nuclear Information System (INIS)
Ding, Li; Huang, Yong; Du, Qian; Dong, Feng; Zhao, Xiaomin; Zhang, Wenlong; Xu, Xingang; Tong, Dewen
2014-01-01
Highlights: • TGEV N protein reduces cell viability by inducing cell cycle arrest and apoptosis. • TGEV N protein induces cell cycle arrest and apoptosis by regulating p53 signaling. • TGEV N protein plays important roles in TGEV-induced cell cycle arrest and apoptosis. - Abstract: Our previous studies showed that TGEV infection could induce cell cycle arrest and apoptosis via activation of p53 signaling in cultured host cells. However, it is unclear which viral gene causes these effects. In this study, we investigated the effects of TGEV nucleocapsid (N) protein on PK-15 cells. We found that TGEV N protein suppressed cell proliferation by causing cell cycle arrest at the S and G2/M phases and apoptosis. Characterization of various cellular proteins that are involved in regulating cell cycle progression demonstrated that the expression of N gene resulted in an accumulation of p53 and p21, which suppressed cyclin B1, cdc2 and cdk2 expression. Moreover, the expression of TGEV N gene promoted translocation of Bax to mitochondria, which in turn caused the release of cytochrome c, followed by activation of caspase-3, resulting in cell apoptosis in the transfected PK-15 cells following cell cycle arrest. Further studies showed that p53 inhibitor attenuated TGEV N protein induced cell cycle arrest at S and G2/M phases and apoptosis through reversing the expression changes of cdc2, cdk2 and cyclin B1 and the translocation changes of Bax and cytochrome c induced by TGEV N protein. Taken together, these results demonstrated that TGEV N protein might play an important role in TGEV infection-induced p53 activation and cell cycle arrest at the S and G2/M phases and apoptosis occurrence
p53 protein expression versus micronucleus induction as an indicator of DNA damage
International Nuclear Information System (INIS)
Hickman, A.W.; Carpenter, T.R.; Johnson, N.F.
1994-01-01
In vitro assays for detecting DNA damage play an important role in evaluating the possible adverse health effects of chemical compounds. Exposure to many DNA-damaging agents in vitro has been shown to cause elevated levels of the tumor-suppressor protein p53. Work in our laboratory has shown that induction of the p53 protein is useful as a biodosimeter for determining the radiation dose to cells. The purpose of this investigation was to compare the sensitivity of this assay to that of micronucleus induction, which is commonly used as a marker of radiation-induced damage
Crescenzi, Elvira; Raia, Zelinda; Pacifico, Francesco; Mellone, Stefano; Moscato, Fortunato; Palumbo, Giuseppe; Leonardi, Antonio
2013-01-01
Premature or drug-induced senescence is a major cellular response to chemotherapy in solid tumors. The senescent phenotype develops slowly and is associated with chronic DNA damage response. We found that expression of wild-type p53-induced phosphatase 1 (Wip1) is markedly down-regulated during persistent DNA damage and after drug release during the acquisition of the senescent phenotype in carcinoma cells. We demonstrate that down-regulation of Wip1 is required for maintenance of permanent G2 arrest. In fact, we show that forced expression of Wip1 in premature senescent tumor cells induces inappropriate re-initiation of mitosis, uncontrolled polyploid progression, and cell death by mitotic failure. Most of the effects of Wip1 may be attributed to its ability to dephosphorylate p53 at Ser15 and to inhibit DNA damage response. However, we also uncover a regulatory pathway whereby suppression of p53 Ser15 phosphorylation is associated with enhanced phosphorylation at Ser46, increased p53 protein levels, and induction of Noxa expression. On the whole, our data indicate that down-regulation of Wip1 expression during premature senescence plays a pivotal role in regulating several p53-dependent aspects of the senescent phenotype. PMID:23612976
Energy Technology Data Exchange (ETDEWEB)
Carpenter, T.R.; Johnson, N.F.; Gilliland, F.D. [Univ. of New Mexico, Albuquerque, NM (United States)] [and others
1995-12-01
Exposure to {alpha}-particles emitted by radon progeny appears to be the second-leading cause of lung cancer mortality. However, individual susceptibility to the carcinogenic effects of {alpha}-particles remains poorly characterized. Variation in susceptibility to cancer produced by certian classes of DNA-damaging chemicals is suspected to involve differences in metabolic activation and detoxication. Susceptibility to {alpha}-particle-induced cancer may involve variations in capacity or opportunity to repair DNA damage. Subtle variations in DNA repair capacity would more likely explain radon-related lung cancer susceptibility. The p53 tumor suppressor protein accumulates as a cellular response to DNA damage from ionizing radiation and regulates arrest in the G{sub 1} portion of the cell cycle. Arrest in G{sub 1} portion of the cell cycle. While upstream regulation of p53 protein stability is poorly understood, variations in the ability to accumulate p53 following DNA damage represent potential variations in lung cancer susceptibility related to radon progeny. Further, transcription of the cell-cycle regulatory gene Cip1 is regulated by p53 and increases following ionizing radiation. Therefore, variations in the expression of Cip1 following {alpha}-particle exposure may also be a susceptibility factor in radon-related lung cancers. The purpose of the present investigation was to measure p53 and Cip1 protein induction following {alpha}-particle exposure of fibroblast lines from nine individuals to determine if there were significant variations. The expression of Cip1 protein indicates the differences in response are biologically relevant.
International Nuclear Information System (INIS)
Carpenter, T.R.; Johnson, N.F.; Gilliland, F.D.
1995-01-01
Exposure to α-particles emitted by radon progeny appears to be the second-leading cause of lung cancer mortality. However, individual susceptibility to the carcinogenic effects of α-particles remains poorly characterized. Variation in susceptibility to cancer produced by certian classes of DNA-damaging chemicals is suspected to involve differences in metabolic activation and detoxication. Susceptibility to α-particle-induced cancer may involve variations in capacity or opportunity to repair DNA damage. Subtle variations in DNA repair capacity would more likely explain radon-related lung cancer susceptibility. The p53 tumor suppressor protein accumulates as a cellular response to DNA damage from ionizing radiation and regulates arrest in the G 1 portion of the cell cycle. Arrest in G 1 portion of the cell cycle. While upstream regulation of p53 protein stability is poorly understood, variations in the ability to accumulate p53 following DNA damage represent potential variations in lung cancer susceptibility related to radon progeny. Further, transcription of the cell-cycle regulatory gene Cip1 is regulated by p53 and increases following ionizing radiation. Therefore, variations in the expression of Cip1 following α-particle exposure may also be a susceptibility factor in radon-related lung cancers. The purpose of the present investigation was to measure p53 and Cip1 protein induction following α-particle exposure of fibroblast lines from nine individuals to determine if there were significant variations. The expression of Cip1 protein indicates the differences in response are biologically relevant
Chen, Yu-Ying; Hsieh, Cheng-Ying; Jayakumar, Thanasekaran; Lin, Kuan-Hung; Chou, Duen-Suey; Lu, Wan-Jung; Hsu, Ming-Jen; Sheu, Joen-Rong
2014-07-10
The abnormal growth of vascular smooth muscle cells (VSMCs) is considered a critical pathogenic process in inflammatory vascular diseases. We have previously demonstrated that protein phosphatase 2 A (PP2A)-mediated NF-κB dephosphorylation contributes to the anti-inflammatory properties of andrographolide, a novel NF-κB inhibitor. In this study, we investigated whether andrographolide causes apoptosis, and characterized its apoptotic mechanisms in rat VSMCs. Andrographolide activated the p38 mitogen-activated protein kinase (p38MAPK), leading to p53 phosphorylation. Phosphorylated p53 subsequently transactivated the expression of Bax, a pro-apoptotic protein. Transfection with pp2a small interfering RNA (siRNA) suppressed andrographolide-induced p38MAPK activation, p53 phosphorylation, and caspase 3 activation. Andrographolide also activated the Src homology 1 domain-containing protein tyrosine phosphatase (SHP-1), and induced PP2A dephosphorylation, both of which were inhibited by the SHP-1 inhibitor sodium stibogluconate (SSG) or shp-1 siRNA. SSG or shp-1 siRNA prevented andrographolide-induced apoptosis. These results suggest that andrographolide activates the PP2A-p38MAPK-p53-Bax cascade, causing mitochondrial dysfunction and VSMC death through an SHP-1-dependent mechanism.
International Nuclear Information System (INIS)
Colucci, S.; Mothersill, C.; Seymour, C.; Harney, J.; Gamble, S.; Arrand, J.
1997-01-01
We have previously shown that primary explant cultures of human urothelium exposed to low doses of gamma radiation subsequently exhibit a high level of stable P53 but it was not clear from those studies whether this protein stabilisation occurred through epigenetic events or as a result of mutation. In these experiments, primary urothelium cultures from five different patients were exposed to 0.5 and 5 Gy γ- radiation from a 60 Cobalt source and allowed to grow for 7- 10 division cycles to allow development of any radiation-induced, non lethal changes in the urothelial cells. C-myc, Bcl-2, and stable P53 protein expression was found to be elevated in cultures following both radiation doses. Following 0.5 Gy exposure, the cultures also developed multiple distinct 'foci' of rapidly-dividing cells which strongly over-expressed P53. These grew on a background of morphologically normal cells. When such foci were selectively analysed for their p53 mutation status by PCR-SSCPE, there was evidence that they contained cells which had developed changes to thr p53 gene post-irradiation. These changes appeared to occur more frequently in focal cells than in cells of normal morphological appearance in the same culture. DNA sequence analysis of the p53 gene in 0.5 Gy-induced foci displayed frame shift mutations in some cases. These results may have mechanistic importance given the controversy regarding low-dose radiation effects and p53-related genomic instability. (authors)
Directory of Open Access Journals (Sweden)
Yanyi Sun
2017-10-01
Full Text Available Hyperglycemia is an independent risk factor for diabetic cardiomyopathy in humans; however, the underlying mechanisms have not been thoroughly elucidated. Zebrafish (Danio rerio was used in this study as a novel vertebrate model to explore the signaling pathways of human adult cardiomyopathy. Hyperglycemia was induced by alternately immersing adult zebrafish in a glucose solution or water. The hyperglycemic fish gradually exhibited some hallmarks of cardiomyopathy such as myocardial hypertrophy and apoptosis, myofibril loss, fetal gene reactivation, and severe arrhythmia. Echocardiography of the glucose-treated fish demonstrated diastolic dysfunction at an early stage and systolic dysfunction at a later stage, consistent with what is observed in diabetic patients. Enlarged hearts with decreased myocardial density, accompanied by decompensated cardiac function, indicated that apoptosis was critical in the pathological process. Significant upregulation of the expression of Nkx2.5 and its downstream targets calreticulin (Calr and p53 was noted in the glucose-treated fish. High-glucose stimulation in vitro evoked marked apoptosis of primary cardiomyocytes, which was rescued by the p53 inhibitor pifithrin-μ. In vitro experiments were performed using compound treatment and genetically via cell infection. Genetically, knockout of Nkx2.5 induced decreased expression of Nkx2.5, Calr and p53. Upregulation of Calr resulted in increased p53 expression, whereas the level of Nkx2.5 remained unchanged. An adult zebrafish model of hyperglycemia-induced cardiomyopathy was successfully established. Hyperglycemia-induced myocardial apoptosis was mediated, at least in part, by activation of the Nkx2.5–Calr–p53 pathway in vivo, resulting in cardiac dysfunction and hyperglycemia-induced cardiomyopathy.
Characterisation in vivo of ways of induced deaths by p53, in the male germinal cells
International Nuclear Information System (INIS)
Coureuil, M.
2006-10-01
The male germinal cells constitute a heterogeneous cell population including pre-meiotic proliferating cells (spermatogonia) and meiotic cells and post meiotic cells in differentiation (spermatocytes and spermatids). We study the involvement in vivo of the p53 protein in the death of these cells with the help of two models, (1) a transgenic model of infertility, MTp53, in which the p53 is over expressed in the differentiated cells and induced their death, (2) the response of these cells to gamma irradiation, where only the spermatogonia die by apoptosis dependent of p53. We showed that the caspases (cysteine-aspartic proteases) are involved in the terminal differentiation of normal germinal cells. But in the MTp53 model, the p53 induces the death of differentiated cells via the activation of calpains and not of caspases. We studied the response of spermatogonia, to gamma irradiation by a transcriptomic approach, by DNA chips and semi-quantitative RT-PCR. we showed that the puma and dr5 genes are induced by the p53 after irradiation. more, the study of mice invalidated for trail ( the dr5 ligand) or for puma, allowed to demonstrate that the two effectors are essential to the activation of intrinsic and extrinsic ways of apoptosis. (N.C.)
HAMLET triggers apoptosis but tumor cell death is independent of caspases, Bcl-2 and p53.
Hallgren, O; Gustafsson, L; Irjala, H; Selivanova, G; Orrenius, S; Svanborg, C
2006-02-01
HAMLET (Human alpha-lactalbumin Made Lethal to Tumor cells) triggers selective tumor cell death in vitro and limits tumor progression in vivo. Dying cells show features of apoptosis but it is not clear if the apoptotic response explains tumor cell death. This study examined the contribution of apoptosis to cell death in response to HAMLET. Apoptotic changes like caspase activation, phosphatidyl serine externalization, chromatin condensation were detected in HAMLET-treated tumor cells, but caspase inhibition or Bcl-2 over-expression did not prolong cell survival and the caspase response was Bcl-2 independent. HAMLET translocates to the nuclei and binds directly to chromatin, but the death response was unrelated to the p53 status of the tumor cells. p53 deletions or gain of function mutations did not influence the HAMLET sensitivity of tumor cells. Chromatin condensation was partly caspase dependent, but apoptosis-like marginalization of chromatin was also observed. The results show that tumor cell death in response to HAMLET is independent of caspases, p53 and Bcl-2 even though HAMLET activates an apoptotic response. The use of other cell death pathways allows HAMLET to successfully circumvent fundamental anti-apoptotic strategies that are present in many tumor cells.
Ribosomal stress induces L11- and p53-dependent apoptosis in mouse pluripotent stem cells.
Morgado-Palacin, Lucia; Llanos, Susana; Serrano, Manuel
2012-02-01
Ribosome biogenesis is the most demanding energetic process in proliferating cells and it is emerging as a critical sensor of cellular homeostasis. Upon disturbance of ribosome biogenesis, specific free ribosomal proteins, most notably L11, bind and inhibit Mdm2, resulting in activation of the tumor suppressor p53. This pathway has been characterized in somatic and cancer cells, but its function in embryonic pluripotent cells has remained unexplored. Here, we show that treatment with low doses of Actinomycin D or depletion of ribosomal protein L37, two well-established inducers of ribosomal stress, activate p53 in an L11-dependent manner in mouse embryonic stem cells (ESCs) and in induced pluripotent stem cells (iPSCs). Activation of p53 results in transcriptional induction of p53 targets, including p21, Mdm2, Pidd, Puma, Noxa and Bax. Finally, ribosomal stress elicits L11- and p53-dependent apoptosis in ESCs/iPSCs. These results extend to pluripotent cells the functionality of the ribosomal stress pathway and we speculate that this could be a relevant cellular checkpoint during early embryogenesis.
Directory of Open Access Journals (Sweden)
Danielle B Ulanet
2010-08-01
Full Text Available The Arf tumor suppressor acts as a sensor of oncogenic signals, countering aberrant proliferation in large part via activation of the p53 transcriptional program, though a number of p53-independent functions have been described. Mounting evidence suggests that, in addition to promoting tumorigenesis via disruptions in the homeostatic balance between cell proliferation and apoptosis of overt cancer cells, genetic alterations leading to tumor suppressor loss of function or oncogene gain of function can also incite tumor development via effects on the tumor microenvironment. In a transgenic mouse model of multi-stage pancreatic neuroendocrine carcinogenesis (PNET driven by inhibition of the canonical p53 and Rb tumor suppressors with SV40 large T-antigen (Tag, stochastic progression to tumors is limited in part by a requirement for initiation of an angiogenic switch. Despite inhibition of p53 by Tag in this mouse PNET model, concomitant disruption of Arf via genetic knockout resulted in a significantly accelerated pathway to tumor formation that was surprisingly not driven by alterations in tumor cell proliferation or apoptosis, but rather via earlier activation of the angiogenic switch. In the setting of a constitutional p53 gene knockout, loss of Arf also accelerated tumor development, albeit to a lesser degree. These findings demonstrate that Arf loss of function can promote tumorigenesis via facilitating angiogenesis, at least in part, through p53-independent mechanisms.
International Nuclear Information System (INIS)
Kim, W.-J.; Beardsley, Dillon I.; Adamson, Aaron W.; Brown, Kevin D.
2005-01-01
One of the cellular responses to DNA damaging events is the activation of programmed cell death, also known as apoptosis. Apoptosis is an important process in limiting tumorigenesis by eliminating cells with damaged DNA. This view is reinforced by the finding that many genes with pro-apoptotic function are absent or altered in cancer cells. The tumor suppressor p53 performs a significant role in apoptotic signaling by controlling expression of a host of genes that have pro-apoptotic or pro-survival function. The S N 1 DNA alkylating agent N-methyl-N'-nitro-N-nitrosoguanidine (MNNG) triggers apoptosis and the upregulation/phosphorylation of p53; however, the mechanism(s) governing MNNG-induced cell death remain unresolved. We observed that the human lymphoblastoid cell line WTK-1, which expresses mutant p53, shows far less sensitivity to the cytotoxic effects of MNNG than the closely related, p53-normal line TK-6. Exposure to 15 μM MNNG (LD50 at 24 h in TK-6) leads to a kinetically slower rate of apoptotic onset in WTK-1 cells compared to TK-6 as judged by viability assays and approaches that directly examine apoptotic onset. Similar results were obtained using an unrelated human lymphoblastoid line B310 expressing reduced levels of p53 due to E6 oncoprotein expression, indicating that MNNG activates both p53-dependent and -independent apoptotic mechanisms and that these two mechanisms are discernable by the rates which they trigger apoptotic onset. We document, during time points corresponding to peak apoptotic response in TK6, WTK-1, B310, and B310-E6, that these cell lines show marked decreases in mitochondrial transmembrane potential and increases in cytochrome c within the cytosolic fraction of MNNG-treated cells. Consistent with these events, we observed that both caspase-9 and -3 are activated in our panel of lymphoblastoid cells after MNNG exposure. We also found, using both broad spectrum and specific inhibitors, that blocking caspase activity in TK-6 and
Michaelis, Martin; Rothweiler, Florian; Löschmann, Nadine; Sharifi, Mohsen; Ghafourian, Taravat; Cinatl, Jindrich
2015-07-10
The PKCβ inhibitor enzastaurin was tested in parental neuroblastoma and rhabdomyosarcoma cell lines, their vincristine-resistant sub-lines, primary neuroblastoma cells, ABCB1-transduced, ABCG2-transduced, and p53-depleted cells. Enzastaurin IC50s ranged from 3.3 to 9.5 μM in cell lines and primary cells independently of the ABCB1, ABCG2, or p53 status. Enzastaurin 0.3125 μM interfered with ABCB1-mediated drug transport. PKCα and PKCβ may phosphorylate and activate ABCB1 under the control of p53. However, enzastaurin exerted similar effects on ABCB1 in the presence or absence of functional p53. Also, enzastaurin inhibited PKC signalling only in concentrations ≥ 1.25 μM. The investigated cell lines did not express PKCβ. PKCα depletion reduced PKC signalling but did not affect ABCB1 activity. Intracellular levels of the fluorescent ABCB1 substrate rhodamine 123 rapidly decreased after wash-out of extracellular enzastaurin, and enzastaurin induced ABCB1 ATPase activity resembling the ABCB1 substrate verapamil. Computational docking experiments detected a direct interaction of enzastaurin and ABCB1. These data suggest that enzastaurin directly interferes with ABCB1 function. Enzastaurin further inhibited ABCG2-mediated drug transport but by a different mechanism since it reduced ABCG2 ATPase activity. These findings are important for the further development of therapies combining enzastaurin with ABC transporter substrates.
3-MCPD 1-Palmitate Induced Tubular Cell Apoptosis In Vivo via JNK/p53 Pathways
Liu, Man; Huang, Guoren; Wang, Thomas T.Y.; Sun, Xiangjun; Yu, Liangli (Lucy)
2016-01-01
Fatty acid esters of 3-chloro-1, 2-propanediol (3-MCPD esters) are a group of processing induced food contaminants with nephrotoxicity but the molecular mechanism(s) remains unclear. This study investigated whether and how the JNK/p53 pathway may play a role in the nephrotoxic effect of 3-MCPD esters using 3-MCPD 1-palmitate (MPE) as a probe compound in Sprague Dawley rats. Microarray analysis of the kidney from the Sprague Dawley rats treated with MPE, using Gene Ontology categories and KEGG pathways, revealed that MPE altered mRNA expressions of the genes involved in the mitogen-activated protein kinase (JNK and ERK), p53, and apoptotic signal transduction pathways. The changes in the mRNA expressions were confirmed by qRT-PCR and Western blot analyses and were consistent with the induction of tubular cell apoptosis as determined by histopathological, TUNEL, and immunohistochemistry analyses in the kidneys of the Sprague Dawley rats. Additionally, p53 knockout attenuated the apoptosis, and the apoptosis-related protein bax expression and cleaved caspase-3 activation induced by MPE in the p53 knockout C57BL/6 mice, whereas JNK inhibitor SP600125 but not ERK inhibitor U0126 inhibited MPE-induced apoptosis, supporting the conclusion that JNK/p53 might play a critical role in the tubular cell apoptosis induced by MPE and other 3-MCPD fatty acid esters. PMID:27008853
Directory of Open Access Journals (Sweden)
Harrison David J
2007-11-01
Full Text Available Abstract Background TGFβ is critical to control hepatocyte proliferation by inducing G1-growth arrest through multiple pathways leading to inhibition of E2F transcription activity. The retinoblastoma protein pRb is a key controller of E2F activity and G1/S transition which can be inhibited in viral hepatitis. It is not known whether the impairment of pRb would alter the growth inhibitory potential of TGFβ in disease. We asked how Rb-deficiency would affect responses to TGFβ-induced cell cycle arrest. Results Primary hepatocytes isolated from Rb-floxed mice were infected with an adenovirus expressing CRE-recombinase to delete the Rb gene. In control cells treatment with TGFβ prevented cells to enter S phase via decreased cMYC activity, activation of P16INK4A and P21Cip and reduction of E2F activity. In Rb-null hepatocytes, cMYC activity decreased slightly but P16INK4A was not activated and the great majority of cells continued cycling. Rb is therefore central to TGFβ-induced cell cycle arrest in hepatocytes. However some Rb-null hepatocytes remained sensitive to TGFβ-induced cell cycle arrest. As these hepatocytes expressed very high levels of P21Cip1 and P53 we investigated whether these proteins regulate pRb-independent signaling to cell cycle arrest by evaluating the consequences of disruption of p53 and p21Cip1. Hepatocytes deficient in p53 or p21Cip1 showed diminished growth inhibition by TGFβ. Double deficiency had a similar impact showing that in cells containing functional pRb; P21Cip and P53 work through the same pathway to regulate G1/S in response to TGFβ. In Rb-deficient cells however, p53 but not p21Cip deficiency had an additive effect highlighting a pRb-independent-P53-dependent effector pathway of inhibition of E2F activity. Conclusion The present results show that otherwise genetically normal hepatocytes with disabled p53, p21Cip1 or Rb genes respond less well to the antiproliferative effects of TGFβ. As the function of
Gene alterations in radiation-induced F344 rat lung tumors
International Nuclear Information System (INIS)
Kelly, G.; Hahn, F.F.
1994-01-01
The p53 tumor suppressor gene is frequently altered in all major histopathologic types of human lung tumors. Reported p53 mutations include base substitutions, allelic loss, rearrangements, and deletions. Point mutations resulting in base substitutions are clustered within a highly conserved region of the gene encoding exons 508, and mutations in this region substantially extend the half-life of the p53 protein. In addition to its prominent importance in lung carcinogenesis, the p53 gene plays a critical role in the cellular response to genetic damage caused by radiation. Specifically, the protein product of p53 induces a pause or block at the G 1 to S boundary of the cell cycle following radiation-caused DNA damage. This G 1 block may allow the cell time to repair the damaged DNA prior to replication. Cells lacking a functional p53 protein fail to pause for repair and consequently accumulate mutations in the genome at an accelerated rate. p53 has also been implicated as a controlling factor in apoptosis or in programmed cell death induced by DNA-damaging agents, such as ionizing radiation. The p53 gene is mutated in approximately 50% of squamous cell carcinomas from uranium miners who inhaled high doses of radon daughters. The purpose of the present study was to determine if a similar percentage of squamous cell carcinomas with p53 mutations developed in the lungs of rats exposed to aerosols of 239 PuO 2
Palmitate induces VSMC apoptosis via toll like receptor (TLR)4/ROS/p53 pathway.
Zhang, Yuanjun; Xia, Guanghao; Zhang, Yaqiong; Liu, Juxiang; Liu, Xiaowei; Li, Weihua; Lv, Yaya; Wei, Suhong; Liu, Jing; Quan, Jinxing
2017-08-01
Toll-like receptor 4 (TLR4) has been implicated in vascular inflammation, as well as in the pathogenesis of atherosclerosis and diabetes. Vascular smooth muscle cell (VSMC) apoptosis has been shown to induce plaque vulnerability in atherosclerosis. Previous studies reported that palmitate induced apoptosis in VSMCs; however, the role of TLR4 in palmitate-induced apoptosis in VSMCs has not yet been defined. In this study, we investigated whether or not palmitate-induced apoptosis depended on the activation of the TLR4 pathway. VSMCs were treated with or without palmitate, CRISPR/Cas9z-mediated genome editing methods were used to deplete TLR4 expression, while NADPH oxidase inhibitors were used to inhibit reactive oxygen species (ROS) generation. Cell apoptosis was detected by terminal deoxynucleotidyl transferase dUTP nick end labeling (TUNEL) assay, ROS was measured using the 2',7'-dichlorodihydrofluorescein diacetate (DCFH-DA) method, the mRNA and protein expression levels of caspase 3, caspase 9, BCL-2 and p53 were studied by real-time polymerase chain reaction (RT-PCR) and ELISA. Palmitate significantly promotes VSMC apoptosis, ROS generation, and expression of caspase 3, caspase 9 and p53; while NADPH oxidase inhibitor pretreatment markedly attenuated these effects. Moreover, knockdown of TLR4 significantly blocked palmitate-induced ROS generation and VSMC apoptosis accompanied by inhibition of caspase 3, caspase 9, p53 expression and restoration of BCL-2 expression. Our results suggest that palmitate-induced apoptosis depends on the activation of the TLR4/ROS/p53 signaling pathway, and that TLR4 may be a potential therapeutic target for the prevention and treatment of atherosclerosis. Copyright © 2017 Elsevier B.V. All rights reserved.
Cell cycle arrest induced by radiation
International Nuclear Information System (INIS)
Okaichi, Yasuo; Matsumoto, Hideki; Ohnishi, Takeo
1994-01-01
It is known that various chemical reactions, such as cell cycle arrest, DNA repair and cell killing, can occur within the cells when exposed to ionizing radiation and ultraviolet radiation. Thus protein dynamics involved in such chemical reactions has received considerable attention. In this article, cell cycle regulation is first discussed in terms of the G2/M-phase and the G1/S-phase. Then, radiation-induced cell cycle arrest is reviewed. Cell cycle regulation mechanism involved in the G2 arrest, which is well known to occur when exposed to radiation, has recently been investigated using yeasts. In addition, recent study has yielded a noticeable finding that the G1 arrest can occur with intracellular accumulation of p53 product following ionization radiation. p53 is also shown to play an extremely important role in both DNA repair and cell killing due to DNA damage. Studies on the role of genes in protein groups induced by radiation will hold promise for the elucidation of cell cycle mechanism. (N.K.) 57 refs
Directory of Open Access Journals (Sweden)
Jennifer M. Smith
2007-12-01
Full Text Available Two adjacent regions within the transactivation domain of p53 are sufficient to support sequence-specific transactivation when fused to a heterologous DNA binding domain. It has been hypothesized that these two subdomains of p53 may contribute to the expression of distinct p53-responsive genes. Here we have used oligonucleotide microarrays to identify transcripts induced by variants of p53 with point mutations within subdomains 1, 2, or 1 and 2 (QS1, QS2, QS1/QS2, respectively. The expression of 254 transcripts was increased in response to wild-type p53 expression but most of these transcripts were poorly induced by these variants of p53. Strikingly, a number of known p53regulated transcripts including TNFRSF10B, BAX, BTG2, POLH were increased to wild-type levels by p53QS1 and p53QS2 but not p53QS1/QS2, indicating that either sub domain 1 or 2 is sufficient for p53-dependent expression of a small subset of p53-responsive genes. Unexpectedly, there was no evidence for p53QS1- or p53QS2-specific gene expression. Taken together, we found heterogeneity in the requirement for transactivation subdomains 1 and 2 of p53 without any subdomain-specific contribution to p53-induced gene expression.
Naphthoquinone Derivative PPE8 Induces Endoplasmic Reticulum Stress in p53 Null H1299 Cells
Directory of Open Access Journals (Sweden)
Jin-Cherng Lien
2015-01-01
Full Text Available Endoplasmic reticulum (ER plays a key role in synthesizing secretory proteins and sensing signal function in eukaryotic cells. Responding to calcium disturbance, oxidation state change, or pharmacological agents, ER transmembrane protein, inositol-regulating enzyme 1 (IRE1, senses the stress and triggers downstream signals. Glucose-regulated protein 78 (GRP78 dissociates from IRE1 to assist protein folding and guard against cell death. In prolonged ER stress, IRE1 recruits and activates apoptosis signal-regulating kinase 1 (ASK1 as well as downstream JNK for cell death. Naphthoquinones are widespread natural phenolic compounds. Vitamin K3, a derivative of naphthoquinone, inhibits variant tumor cell growth via oxygen uptake and oxygen stress. We synthesized a novel naphthoquinone derivative PPE8 and evaluated capacity to induce ER stress in p53 null H1299 and p53 wild-type A549 cells. In H1299 cells, PPE8 induced ER enlargement, GRP78 expression, and transient IER1 activation. Activated IRE1 recruited ASK1 for downstream JNK phosphorylation. IRE1 knockdown by siRNA attenuated PPE8-induced JNK phosphorylation and cytotoxicity. Prolonged JNK phosphorylation may be involved in PPE8-induced cytotoxicity. Such results did not arise in A549 cells, but p53 knockdown by siRNA restored PPE8-induced GRP78 expression and JNK phosphorylation. We offer a novel compound to induce ER stress and cytotoxicity in p53-deficient cancer cells, presenting an opportunity for treatment.
A Dual Role of P53 in Regulating Colistin-Induced Autophagy in PC-12 Cells
Directory of Open Access Journals (Sweden)
Ziyin Lu
2017-10-01
Full Text Available This study aimed to investigate the mechanism of p53 in regulating colistin-induced autophagy in PC-12 cells. Importantly, cells were treated with 125 μg/ml colistin for 12 and 24 h after transfection with p53 siRNA or recombinant plasmid. The hallmarks of autophagy and apoptosis were examined by real-time PCR and western blot, fluorescence/immunofluorescence microscopy, and electron microscopy. The results showed that silencing of p53 leads to down-regulation of Atg5 and beclin1 for 12 h while up-regulation at 24 h and up-regulation of p62 noted. The ratio of LC3-II/I and autophagic vacuoles were significantly increased at 24 h, but autophagy flux was blocked. The cleavage of caspase3 and PARP (poly ADP-ribose polymerase were enhanced, while PC-12-sip53 cells exposed to 3-MA showed down-regulation of apoptosis. By contrast, the expression of autophagy-related genes and protein reduced in p53 overexpressing cells following a time dependent manner. Meanwhile, there was an increase in the expression of activated caspase3 and PARP, condensed and fragmented nuclei were evident. Conclusively, the data supported that silencing of p53 promotes impaired autophagy, which acts as a pro-apoptotic induction factor in PC-12 cells treated with colistin for 24 h, and overexpression of p53 inhibits autophagy and accelerates apoptosis. Hence, it has been suggested that p53 could not act as a neuro-protective target in colistin-induced neurotoxicity.
P53 status influences regulation of HSPs and ribosomal proteins by PDTC and radiation
International Nuclear Information System (INIS)
Thompson, John S.; Asmis, Reto; Glass, Judith; Liu Hua; Wilson, Colin; Nelson, Brandy; Brown, Stephen A.; Stromberg, Arnold J.
2006-01-01
Pyrrolidine dithiocarbamate (PDTC) is a thiol-containing compound that can act under varying conditions as an anti-oxidant or pro-oxidant. Utilizing microarrays, we determined the effect of PDTC +/- ionizing radiation (IR) on the expression of heat shock protein (HSP) genes in isolated B6/129 wild-type (WT) and p53-/- spleen cells. Extremely significant microarrays demonstrated that PDTC, but not IR, markedly up-regulated the expression of the majority of detectable HSP genes in WT and many to a significantly greater degree in p53-/- deficient cells. Determination of the glutathione/glutathione disulfide ratio indicated that PDTC was acting as a pro-oxidant under these conditions. From these data we conclude that the clinical use of 'antioxidants' with radiotherapy or chemotherapy must be very carefully based on knowledge of the p53 status of their intended normal and tumor target cells
Suzuki, Maiko; Ikeda, Atsushi; Bartlett, John D
2018-03-01
Low-dose fluoride is an effective caries prophylactic, but high-dose fluoride is an environmental health hazard that causes skeletal and dental fluorosis. Treatments to prevent fluorosis and the molecular pathways responsive to fluoride exposure remain to be elucidated. Previously we showed that fluoride activates SIRT1 as an adaptive response to protect cells. Here, we demonstrate that fluoride induced p53 acetylation (Ac-p53) [Lys379], which is a SIRT1 deacetylation target, in ameloblast-derived LS8 cells in vitro and in enamel organ in vivo. Here we assessed SIRT1 function on fluoride-induced Ac-p53 formation using CRISPR/Cas9-mediated Sirt1 knockout (LS8 Sirt/KO ) cells or CRISPR/dCas9/SAM-mediated Sirt1 overexpressing (LS8 Sirt1/over ) cells. NaF (5 mM) induced Ac-p53 formation and increased cell cycle arrest via Cdkn1a/p21 expression in Wild-type (WT) cells. However, fluoride-induced Ac-p53 was suppressed by the SIRT1 activator resveratrol (50 µM). Without fluoride, Ac-p53 persisted in LS8 Sirt/KO cells, whereas it decreased in LS8 Sirt1/over . Fluoride-induced Ac-p53 formation was also suppressed in LS8 Sirt1/over cells. Compared to WT cells, fluoride-induced Cdkn1a/p21 expression was elevated in LS8 Sirt/KO and these cells were more susceptible to fluoride-induced growth inhibition. In contrast, LS8 Sirt1/over cells were significantly more resistant. In addition, fluoride-induced cytochrome-c release and caspase-3 activation were suppressed in LS8 Sirt1/over cells. Fluoride induced expression of the DNA double strand break marker γH2AX in WT cells and this was augmented in LS8 Sirt1/KO cells, but was attenuated in LS8 Sirt1/over cells. Our results suggest that SIRT1 deacetylates Ac-p53 to mitigate fluoride-induced cell growth inhibition, mitochondrial damage, DNA damage and apoptosis. This is the first report implicating Ac-p53 in fluoride toxicity.
Directory of Open Access Journals (Sweden)
Yang Liu
Full Text Available Novel strategies are necessary to improve chemotherapy response in advanced and recurrent endometrial cancer. Here, we demonstrate that terpenoids present in the Steam Distilled Extract of Ginger (SDGE are potent inhibitors of proliferation of endometrial cancer cells. SDGE, isolated from six different batches of ginger rhizomes, consistently inhibited proliferation of the endometrial cancer cell lines Ishikawa and ECC-1 at IC(50 of 1.25 µg/ml. SDGE also enhanced the anti-proliferative effect of radiation and cisplatin. Decreased proliferation of Ishikawa and ECC-1 cells was a direct result of SDGE-induced apoptosis as demonstrated by FITC-Annexin V staining and expression of cleaved caspase 3. GC/MS analysis identified a total of 22 different terpenoid compounds in SDGE, with the isomers neral and geranial constituting 30-40%. Citral, a mixture of neral and geranial inhibited the proliferation of Ishikawa and ECC-1 cells at an IC(50 10 µM (2.3 µg/ml. Phenolic compounds such as gingerol and shogaol were not detected in SDGE and 6-gingerol was a weaker inhibitor of the proliferation of the endometrial cancer cells. SDGE was more effective in inducing cancer cell death than citral, suggesting that other terpenes present in SDGE were also contributing to endometrial cancer cell death. SDGE treatment resulted in a rapid and strong increase in intracellular calcium and a 20-40% decrease in the mitochondrial membrane potential. Ser-15 of p53 was phosphorylated after 15 min treatment of the cancer cells with SDGE. This increase in p53 was associated with 90% decrease in Bcl2 whereas no effect was observed on Bax. Inhibitor of p53, pifithrin-α, attenuated the anti-cancer effects of SDGE and apoptosis was also not observed in the p53(neg SKOV-3 cells. Our studies demonstrate that terpenoids from SDGE mediate apoptosis by activating p53 and should be therefore be investigated as agents for the treatment of endometrial cancer.
P53 function influences the effect of fractionated radiotherapy on glioblastoma tumors
International Nuclear Information System (INIS)
Haas-Kogan, Daphne A.; Kogan, Scott S.; Yount, Garret; Hsu, Jennie; Haas, Martin; Deen, Dennis F.; Israel, Mark A.
1999-01-01
Purpose: Glioblastoma multiforme brain tumors (GM) are treated with a spectrum of fractionation regimens based on the clinical and anatomical characteristics of the tumor but rarely based on the molecular characteristics of the individual neoplasm. This study tests the hypothesis that the response of cell lines derived from GM to fractionated radiotherapy depends on the function of wild-type p53 (wt p53), a tumor suppressor gene frequently mutated in GM tumors. Methods and Materials: Isogenic derivatives of glioblastoma cells differing only in p53 function were prepared using a retroviral vector expressing a dominant negative mutant of p53 (mt p53). Radiation survival in vitro was quantitated using linear quadratic and repair-saturation mathematical models. Apoptosis was assayed by a terminal deoxynucleotide transferase-labeling technique and chromatin morphology. Results: We have previously reported the generation of isogenic GM cell lines differing only in p53 function. U87-175.4, lacking wt p53 function, had a significantly lower α/β value than U87-LUX.8, expressing functional wt p53, leading us to hypothesize that fractionated irradiation would preferentially spare GM cells harboring mt p53 compared with those expressing functional, wt p53. Survival curves following either 2.0 Gy or 3.5 Gy/fraction demonstrated that lack of functional wt p53 was associated with resistance to fractionated irradiation. Radiation-induced apoptosis could not account for the observed differences in clonogenic survival. Rather, our data suggested that a deficit in the G1-checkpoint contributed to increased resistance to fractionated irradiation of cells expressing mutant p53. Conclusions: The effect of fractionated radiotherapy in GM may depend on the function of the tumor suppressor gene p53. A potential clinical consequence of these findings is that hyperfractionation regimens may provide a therapeutic advantage specifically for tumors expressing wt p53 whereas a radiotherapy
Hirose, H; Sakuma, N; Kaji, N; Suhara, T; Sekijima, M; Nojima, T; Miyakoshi, J
2006-09-01
A large-scale in vitro study focusing on low-level radiofrequency (RF) fields from mobile radio base stations employing the International Mobile Telecommunication 2000 (IMT-2000) cellular system was conducted to test the hypothesis that modulated RF fields induce apoptosis or other cellular stress response that activate p53 or the p53-signaling pathway. First, we evaluated the response of human cells to microwave exposure at a specific absorption rate (SAR) of 80 mW/kg, which corresponds to the limit of the average whole-body SAR for general public exposure defined as a basic restriction by the International Commission on Non-Ionizing Radiation Protection (ICNIRP) guidelines. Second, we investigated whether continuous wave (CW) and wideband code division multiple access (W-CDMA) modulated signal RF fields at 2.1425 GHz induced apoptosis or any signs of stress. Human glioblastoma A172 cells were exposed to W-CDMA radiation at SARs of 80, 250, and 800 mW/kg, and CW radiation at 80 mW/kg for 24 or 48 h. Human IMR-90 fibroblasts from fetal lungs were exposed to both W-CDMA and CW radiation at a SAR of 80 mW/kg for 28 h. Under the RF field exposure conditions described above, no significant differences in the percentage of apoptotic cells were observed between the test groups exposed to RF signals and the sham-exposed negative controls, as evaluated by the Annexin V affinity assay. No significant differences in expression levels of phosphorylated p53 at serine 15 or total p53 were observed between the test groups and the negative controls by the bead-based multiplex assay. Moreover, microarray hybridization and real-time RT-PCR analysis showed no noticeable differences in gene expression of the subsequent downstream targets of p53 signaling involved in apoptosis between the test groups and the negative controls. Our results confirm that exposure to low-level RF signals up to 800 mW/kg does not induce p53-dependent apoptosis, DNA damage, or other stress response in human
Directory of Open Access Journals (Sweden)
Paramita Banerjee Sawant
Full Text Available Hypoxia is a global phenomenon affecting recruitment as well as the embryonic development of aquatic fauna. The present study depicts hypoxia induced disruption of the intrinsic pathway of programmed cell death (PCD, leading to embryonic malformation in the goldfish, Carrasius auratus. Constant hypoxia induced the early expression of pro-apoptotic/tumor suppressor p53 and concomitant expression of the cell death molecule, caspase-3, leading to high level of DNA damage and cell death in hypoxic embryos, as compared to normoxic ones. As a result, the former showed delayed 4 and 64 celled stages and a delay in appearance of epiboly stage. Expression of p53 efficiently switched off expression of the anti-apoptotic Bcl-2 during the initial 12 hours post fertilization (hpf and caused embryonic cell death. However, after 12 hours, simultaneous downregulation of p53 and Caspase-3 and exponential increase of Bcl-2, caused uncontrolled cell proliferation and prevented essential programmed cell death (PCD, ultimately resulting in significant (p<0.05 embryonic malformation up to 144 hpf. Evidences suggest that uncontrolled cell proliferation after 12 hpf may have been due to downregulation of p53 abundance, which in turn has an influence on upregulation of anti-apoptotic Bcl-2. Therefore, we have been able to show for the first time and propose that hypoxia induced downregulation of p53 beyond 12 hpf, disrupts PCD and leads to failure in normal differentiation, causing malformation in gold fish embryos.
Loss of Geminin induces rereplication in the presence of functional p53
DEFF Research Database (Denmark)
Melixetian, Marina; Ballabeni, Andrea; Masiero, Laura
2004-01-01
nuclear foci. Abrogation of the checkpoint leads to abortive mitosis and death of rereplicated cells. In addition, we demonstrate that the induction of rereplication is dependent on the replication initiation factors CDT1 and CDC6, and independent of the functional status of p53. These data show...
Agarwal, Ayushi; Kasinathan, Akiladdevi; Ganesan, Ramamoorthi; Balasubramanian, Akhila; Bhaskaran, Jahnavi; Suresh, Samyuktha; Srinivasan, Revanth; Aravind, K B; Sivalingam, Nageswaran
2018-03-01
Curcumin is a natural dietary polyphenol compound that has various pharmacological activities such as antiproliferative and cancer-preventive activities on tumor cells. Indeed, the role reactive oxygen species (ROS) generated by curcumin on cell death and cell proliferation inhibition in colon cancer is poorly understood. In the present study, we hypothesized that curcumin-induced ROS may promote apoptosis and cell cycle arrest in colon cancer. To test this hypothesis, the apoptosis-inducing potential and cell cycle inhibition effect of ROS induced by curcumin was investigated in Smd4 and p53 mutated HT-29 colon adenocarcinoma cells. We found that curcumin treatment significantly increased the level of ROS in HT-29 cells in a dose- and time-dependent manner. Furthermore, curcumin treatment markedly decreased the cell viability and proliferation potential of HT-29 cells in a dose- and time-dependent manner. Conversely, generation of ROS and inhibitory effect of curcumin on HT-29 cells were abrogated by N-acetylcysteine treatment. In addition, curcumin treatment did not show any cytotoxic effects on HT-29 cells. Furthermore, curcumin-induced ROS generation caused the DNA fragmentation, chromatin condensation, and cell nuclear shrinkage and significantly increased apoptotic cells in a dose- and time-dependent manner in HT-29 cells. However, pretreatment of N-acetylcysteine inhibited the apoptosis-triggering effect of curcumin-induced ROS in HT-29 cells. In addition, curcumin-induced ROS effectively mediated cell cycle inhibition in HT-29 cells. In conclusion, our data provide the first evidence that curcumin induces ROS independent apoptosis and cell cycle arrest in colon cancer cells that carry mutation on Smad4 and p53. Copyright © 2018. Published by Elsevier Inc.
Sequential mutations in Notch1, Fbxw7, and Tp53 in radiation-induced mouse thymic lymphomas.
Jen, Kuang-Yu; Song, Ihn Young; Banta, Karl Luke; Wu, Di; Mao, Jian-Hua; Balmain, Allan
2012-01-19
T-cell acute lymphoblastic lymphomas commonly demonstrate activating Notch1 mutations as well as mutations or deletions in Fbxw7. However, because Fbxw7 targets Notch1 for degradation, genetic alterations in these genes are expected to be mutually exclusive events in lymphomagenesis. Previously, by using a radiation-induced Tp53-deficient mouse model for T-cell acute lymphoblastic lymphoma, we reported that loss of heterozygosity at the Fbxw7 locus occurs frequently in a Tp53-dependent manner. In the current study, we show that these thymic lymphomas also commonly exhibit activating Notch1 mutations in the proline-glutamic acid-serine-threonine (PEST) domain. Moreover, concurrent activating Notch1 PEST domain mutations and single-copy deletions at the Fbxw7 locus occur with high frequency in the same individual tumors, indicating that these changes are not mutually exclusive events. We further demonstrate that although Notch1 PEST domain mutations are independent of Tp53 status, they are completely abolished in mice with germline Fbxw7 haploinsufficiency. Therefore, Notch1 PEST domain mutations only occur when Fbxw7 expression levels are intact. These data suggest a temporal sequence of mutational events involving these important cancer-related genes, with Notch1 PEST domain mutations occurring first, followed by Fbxw7 deletion, and eventually by complete loss of Tp53.
Loss of p53 promotes anaplasia and local invasion in ret/PTC1-induced thyroid carcinomas.
La Perle, K M; Jhiang, S M; Capen, C C
2000-08-01
Papillary thyroid carcinomas in humans are associated with the ret/PTC oncogene and, following loss of p53 function, may progress to anaplastic carcinomas. Mice with thyroid-targeted expression of ret/PTC1 developed papillary thyroid carcinomas that were minimally invasive and did not metastasize. These mice were crossed with p53-/- mice to investigate whether loss of p53 would promote anaplasia and metastasis of ret/PTC1-induced thyroid tumors. The majority of p53-/- mice died or were euthanized by 17 weeks of age due to the development of thymic lymphomas, soft tissue sarcomas, and testicular teratomas. All ret/PTC1 mice developed thyroid carcinomas, but tumors in p53-/- mice were more anaplastic, larger in diameter, more invasive, and had a higher mitotic index than tumors in p53+/+ and p53+/- mice. Thyroid tumors did not metastasize in any of the experimental p53+/+ and p53+/- mice anaplasia and invasiveness of thyroid carcinomas.
Gao, Li; Ji, Yue; Lu, Yan; Qiu, Ming; Shen, Yejiao; Wang, Yaqing; Kong, Xiangqing; Shao, Yongfeng; Sheng, Yanhui; Sun, Wei
2018-03-09
The most frequently used oral anti-coagulant warfarin has been implicated in inducing calcification of aortic valve interstitial cells (AVICs), whereas the mechanism is not fully understood. The low-level activation of p53 is found to be involved in osteogenic transdifferentiation and calcification of AVICs. Whether p53 participates in warfarin-induced AVIC calcification remains unknown. In this study, we investigated the role of low-level p53 overexpression in warfarin-induced porcine AVIC (pAVIC) calcification. Immunostaining, quantitative PCR, and Western blotting revealed that p53 was expressed in human and pAVICs and that p53 expression was slightly increased in calcific human aortic valves compared with non-calcific valves. Terminal deoxynucleotidyltransferase-mediated dUTP nick end labeling staining indicated that apoptosis slightly increased in calcific aortic valves than in non-calcific valves. Warfarin treatment led to a low-level increase of p53 mRNA and protein in both pAVICs and mouse aortic valves. Low-level overexpression of p53 in pAVICs via an adenovirus vector did not affect pAVIC apoptosis but promoted warfarin-induced calcium deposition and expression of osteogenic markers. shRNA-mediated p53 knockdown attenuated the pAVIC calcium deposition and osteogenic marker expression. Moreover, ChIP and luciferase assays showed that p53 was recruited to the slug promoter and activated slug expression in calcific pAVICs. Of note, overexpression of Slug increased osteogenic marker Runx2 expression, but not pAVIC calcium deposition, and Slug knockdown attenuated pAVIC calcification and p53-mediated pAVIC calcium deposition and expression of osteogenic markers. In conclusion, we found that p53 plays an important role in warfarin induced pAVIC calcification, and increased slug transcription by p53 is required for p53-mediated pAVIC calcification. © 2018 by The American Society for Biochemistry and Molecular Biology, Inc.
Directory of Open Access Journals (Sweden)
Rabia Johnson
2017-09-01
Full Text Available Doxorubicin (Dox is an effective chemotherapeutic agent used in the treatment of various cancers. Its clinical use is often limited due to its potentially fatal cardiotoxic side effect. Increasing evidence indicates that tumour protein p53 (p53, adenosine monophosphate-activated protein kinase (AMPK, nucleoporin p62 (p62, and the mammalian target of rapamycin (mTOR are critical mediators of Dox-induced apoptosis, and subsequent dysregulation of autophagy. Aspalathin, a polyphenolic dihydrochalcone C-glucoside has been shown to activate AMPK while decreasing the expression of p53. However, the role that aspalathin could play in the inhibition of Dox-induced cardiotoxicity through increased autophagy flux remained unexplored. H9c2 cardiomyocytes and Caov-3 ovarian cancer cells were cultured in Dulbecco’s Modified Eagle’s medium and treated with or without Dox for five days. Thereafter, cells exposed to 0.2 µM Dox were co-treated with either 20 µM Dexrazozane (Dexra or 0.2 µM aspalathin (ASP daily for 5 days. Results obtained showed that ASP mediates its cytoprotective effect in a p53-dependent manner, by increasing the Bcl-2/Bax ratio and decreasing apoptosis. The latter effect was diminished through ASP-induced activation of autophagy-related genes (Atgs with an associated decrease in p62 through induction of AMPK and Fox01. Furthermore, we showed that ASP was able to potentiate this effect without decreasing the anti-cancer efficacy of Dox, as could be observed in Caov-3 ovarian cancer cells. Taken together, the data presented in this study provides a credible mechanism by which ASP co-treatment could protect the myocardium from Dox-induced cardiotoxicity.
Directory of Open Access Journals (Sweden)
Marie Lue Antony
Full Text Available Benzyl isothiocyanate (BITC, a constituent of edible cruciferous vegetables, decreases viability of cancer cells by causing apoptosis but the mechanism of cell death is not fully understood. The present study was undertaken to determine the role of Bcl-2 family proteins in BITC-induced apoptosis using MDA-MB-231 (breast, MCF-7 (breast, and HCT-116 (colon human cancer cells. The B-cell lymphoma 2 interacting mediator of cell death (Bim protein was dispensable for proapoptotic response to BITC in MCF-7 and MDA-MB-231 cells as judged by RNA interference studies. Instead, the BITC-treated MCF-7 and MDA-MB-231 cells exhibited upregulation of p53 upregulated modulator of apoptosis (PUMA protein. The BITC-mediated induction of PUMA was relatively more pronounced in MCF-7 cells due to the presence of wild-type p53 compared with MDA-MB-231 with mutant p53. The BITC-induced apoptosis was partially but significantly attenuated by RNA interference of PUMA in MCF-7 cells. The PUMA knockout variant of HCT-116 cells exhibited significant resistance towards BITC-induced apoptosis compared with wild-type HCT-116 cells. Attenuation of BITC-induced apoptosis in PUMA knockout HCT-116 cells was accompanied by enhanced G2/M phase cell cycle arrest due to induction of p21 and down regulation of cyclin-dependent kinase 1 protein. The BITC treatment caused a decrease in protein levels of Bcl-xL (MCF-7 and MDA-MB-231 cells and Bcl-2 (MCF-7 cells. Ectopic expression of Bcl-xL in MCF-7 and MDA-MB-231 cells and that of Bcl-2 in MCF-7 cells conferred protection against proapoptotic response to BITC. Interestingly, the BITC-treated MDA-MB-231 cells exhibited induction of Bcl-2 protein expression, and RNA interference of Bcl-2 in this cell line resulted in augmentation of BITC-induced apoptosis. The BITC-mediated inhibition of MDA-MB-231 xenograft growth in vivo was associated with the induction of PUMA protein in the tumor. In conclusion, the results of the present study
Radiation-induced apoptosis in different pH environments in vitro
International Nuclear Information System (INIS)
Lee, Hyung-Sik; Park, Heon J.; Lyons, John C.; Griffin, Robert J.; Auger, Elizabeth A.; Song, Chang W.
1997-01-01
Purpose: The effect of environmental pH on the radiation-induced apoptosis in tumor cells in vitro was investigated. Methods and Materials: Mammary adenocarcinoma cells of A/J mice (SCK cells) were irradiated with γ-rays using a 137 Cs irradiator and incubated in media of different pHs. After incubation at 37 deg. C for 24-120 h the extent of apoptosis was determined using agarose gel electrophoresis, TdT-mediated dUTP-biotin nick end labeling (TUNEL) staining, flow cytometry, and release of 3 H from 3 H-thymidine labeled cells. The clonogenicity of the cells irradiated in different pH medium was determined, and the progression of cells through the cell cycle after irradiation in different pHs was also determined with flow cytometry. Results: Irradiation with 2-12 Gy of γ-rays induced apoptosis in SCK cells in pH 7.5 medium within 48 h as judged from the results of four different assays mentioned. Radiation-induced apoptosis declined as the medium pH was lowered from 7.5 to 6.4. Specifically, the radiation-induced degradation of DNA including the early DNA breaks, as determined with the TUNEL method, progressively declined as the medium pH was lowered so that little DNA fragmentation occurred 48 h after irradiation with 12 Gy in pH 6.6 medium. When the cells were irradiated and incubated for 48 h in pH 6.6 medium and the medium was replaced with pH 7.5 medium, DNA fragmentation promptly occurred. DNA fragmentation also occurred even in pH 6.6 medium when the cells were irradiated and maintained in pH 7.5 medium for 8 h or longer post-irradiation before incubation in pH 6.6 medium. The radiation-induced G 2 arrest in pH 6.6 medium lasted markedly longer than that in pH 7.5 medium. Conclusion: Radiation-induced apoptosis in SCK cells in vitro is reversibly suppressed in an acidic environment. Taking the results of four different assays together, it was concluded that early step(s) in the apoptotic pathway, probably the DNA break or upstream of DNA break, is
Carr, Michael I; Roderick, Justine E; Zhang, Hong; Woda, Bruce A; Kelliher, Michelle A; Jones, Stephen N
2016-12-27
The p53 tumor suppressor acts as a guardian of the genome by preventing the propagation of DNA damage-induced breaks and mutations to subsequent generations of cells. We have previously shown that phosphorylation of the Mdm2 oncoprotein at Ser394 by the ATM kinase is required for robust p53 stabilization and activation in cells treated with ionizing radiation, and that loss of Mdm2 Ser394 phosphorylation leads to spontaneous tumorigenesis and radioresistance in Mdm2 S394A mice. Previous in vitro data indicate that the c-Abl kinase phosphorylates Mdm2 at the neighboring residue (Tyr393) in response to DNA damage to regulate p53-dependent apoptosis. In this present study, we have generated an Mdm2 mutant mouse (Mdm2 Y393F ) to determine whether c-Abl phosphorylation of Mdm2 regulates the p53-mediated DNA damage response or p53 tumor suppression in vivo. The Mdm2 Y393F mice develop accelerated spontaneous and oncogene-induced tumors, yet display no defects in p53 stabilization and activity following acute genotoxic stress. Although apoptosis is unaltered in these mice, they recover more rapidly from radiation-induced bone marrow ablation and are more resistant to whole-body radiation-induced lethality. These data reveal an in vivo role for c-Abl phosphorylation of Mdm2 in regulation of p53 tumor suppression and bone marrow failure. However, c-Abl phosphorylation of Mdm2 Tyr393 appears to play a lesser role in governing Mdm2-p53 signaling than ATM phosphorylation of Mdm2 Ser394. Furthermore, the effects of these phosphorylation events on p53 regulation are not additive, as Mdm2 Y393F/S394A mice and Mdm2 S394A mice display similar phenotypes.
International Nuclear Information System (INIS)
Kachnic, L.A.; Wunsch, H.; Mekeel, K.L.; De Frank, J.S.; Powell, S.N.
1996-01-01
Purpose: P53 is known to be involved in the cellular response to DNA damage. It mediates many of its effects by acting as a transcription factor via sequence-specific DNA binding. The half-life of p53 is prolonged following DNA damage, and this results in elevated levels of p53 for a period of 2-8 hours. The increase in p53 is often relatively small, but this produces significant stimulation of a downstream gene such as p21(WAF1/cip1). We investigated post-translational modification of p53 following ionizing radiation damage. Materials and Methods: The response of normal Balb-C mouse fibroblasts (FC) to ionizing radiation (IR, 8 Gy) was measured at 0,3,6,9 and 24 hours, by the levels of p53, p21, flow cytometry and the electrophoretic mobility shift assay (EMSA). EMSA utilized a 26 bp consensus sequence end-labeled oligonucleotide to measure sequence-specific p53 binding. P53 specificity was confirmed by an enhanced mobility shift (retardation) when using p53 antibody. Comparison was made with scid fibroblasts (FS) and FC cells transfected with a plasmid (CX3) containing mutant p53 (alanine-143) or infected with a retrovirus containing the E6 protein of human papilloma virus type 16. Results: The response of p53 to DNA damage shows a 3-fold increase at 3-6 hours, and was not significantly different between FC and FS. FC-CX3 showed detectable basal levels of p53, and a 2-fold further induction of p53 after IR. FC-E6 showed no detectable levels of p53 before or after IR. No induction of p21 or G1/S arrest was seen in FC-CX3 or FC-E6, as has been observed previously. The induction of p21 in FS cells was attenuated and delayed: a 2-3-fold increase seen maximally at 9 hours, compared with a 5-fold increase seen maximally at 3-6 hours in FC cells. The accumulation of cells at the G1/S junction after IR showed the same kinetics as p21 induction: the peak of cells in G1 occurs at 3-6 hours in FC, but not until 9-24 hours in FS. The response is reminiscent of that seen in
Gene expression and apoptosis induction in p53-heterozygous irradiated mice
International Nuclear Information System (INIS)
Di Masi, Alessandra; Antoccia, Antonio; Dimauro, Ivan; Argentino-Storino, Alberta; Mosiello, Alberto; Mango, Ruggiero; Novelli, Giuseppe; Tanzarella, Caterina
2006-01-01
The role of the p53-genetic background in the expression of genes involved in either cell cycle checkpoint activation or apoptosis was evaluated in p53+/+ and p53+/- mouse strains at both basal levels and after DNA-induced damage. The spleen, colon, kidneys, lungs and liver of both strains were harvested from untreated animals and from mice exposed to 7.5 Gy of X-rays and sacrificed after 5 h. No significant differences were observed in the basal levels of p53 protein, CDKN1A and bax mRNA and spontaneous apoptosis, neither among the different organs within the same strain, nor between the same organ in the p53+/+ and p53+/- strains. After X-ray exposure, p53-dependent regulation was strikingly tissue-specific. In wild-type irradiated mice, p53 protein level increased after radiation treatment in all the organs analysed, whereas both CDKN1A and bax genes transcription increased in the spleen, colon and lungs, as assessed by means of quantitative RT-PCR. In p53+/- irradiated mice, on the contrary, a significant p53 induction was detected only in the spleen, while CDKN1A and bax genes levels increased in the spleen, colon and lungs, revealing the existence of different mechanisms of gene regulation in different organs. Apoptosis induction was observed in the spleen and colon of both strains, even if to lower extent in p53+/- mice compared to p53+/+ animals. In conclusion, in the spleen and colon, target gene transcription and apoptosis may be related to p53 genotype after DNA damage-induction. Moreover, our findings highlight the selectivity of p53 in transactivation following DNA damage in vivo, resulting in tissue-specific responses
Gene expression and apoptosis induction in p53-heterozygous irradiated mice
Energy Technology Data Exchange (ETDEWEB)
Di Masi, Alessandra [Department of Biology, University of Rome ' Roma Tre' , Viale G. Marconi, 446, 00146 Rome (Italy); Antoccia, Antonio [Department of Biology, University of Rome ' Roma Tre' , Viale G. Marconi, 446, 00146 Rome (Italy); Dimauro, Ivan [Department of Biology, University of Rome ' Roma Tre' , Viale G. Marconi, 446, 00146 Rome (Italy); Argentino-Storino, Alberta [Research Toxicology Centre S.p.A., Via Tito Speri, 18, 00040 Pomezia (RM) (Italy); Mosiello, Alberto [Research Toxicology Centre S.p.A., Via Tito Speri, 18, 00040 Pomezia (RM) (Italy); Mango, Ruggiero [Centre of Excellence for Genomic Risk Assessment in Multifactorial and Complex Diseases, School of Medicine, University of Rome ' Tor Vergata' , Rome (Italy); Novelli, Giuseppe [Centre of Excellence for Genomic Risk Assessment in Multifactorial and Complex Diseases, School of Medicine, University of Rome ' Tor Vergata' , Rome (Italy); Tanzarella, Caterina [Department of Biology, University of Rome ' Roma Tre' , Viale G. Marconi, 446, 00146 Rome (Italy)]. E-mail: tanzarel@uniroma3.it
2006-02-22
The role of the p53-genetic background in the expression of genes involved in either cell cycle checkpoint activation or apoptosis was evaluated in p53+/+ and p53+/- mouse strains at both basal levels and after DNA-induced damage. The spleen, colon, kidneys, lungs and liver of both strains were harvested from untreated animals and from mice exposed to 7.5 Gy of X-rays and sacrificed after 5 h. No significant differences were observed in the basal levels of p53 protein, CDKN1A and bax mRNA and spontaneous apoptosis, neither among the different organs within the same strain, nor between the same organ in the p53+/+ and p53+/- strains. After X-ray exposure, p53-dependent regulation was strikingly tissue-specific. In wild-type irradiated mice, p53 protein level increased after radiation treatment in all the organs analysed, whereas both CDKN1A and bax genes transcription increased in the spleen, colon and lungs, as assessed by means of quantitative RT-PCR. In p53+/- irradiated mice, on the contrary, a significant p53 induction was detected only in the spleen, while CDKN1A and bax genes levels increased in the spleen, colon and lungs, revealing the existence of different mechanisms of gene regulation in different organs. Apoptosis induction was observed in the spleen and colon of both strains, even if to lower extent in p53+/- mice compared to p53+/+ animals. In conclusion, in the spleen and colon, target gene transcription and apoptosis may be related to p53 genotype after DNA damage-induction. Moreover, our findings highlight the selectivity of p53 in transactivation following DNA damage in vivo, resulting in tissue-specific responses.
International Nuclear Information System (INIS)
Wang Changsheng; Xiao Shaowen; Zhang Shanwen
2007-01-01
Objective: To explore the relation between p53 genetic polymorphisms and radiotherapy-induced acute injury of mucosa of oral cavity mucosa. Methods: The total of 56 patients with NPC treated by radiotherapy alone or with chemoradiotherapy synchronically were genotyped for the p53 codon 72 pro-Arg SNP using PCR-RFLP assays, and were ranked according to the acute injury of oral cavity mucosa. Results: There was no difference in acute injury of oral cavity mucosa between the p53 Pro allele carriers and the other carriers (P>0.05); the high single dose (P<0.01) and concomitant chemoradiotherapy (P<0.05) resulted in increase in acute injury of oral cavity mucosa. Conclusion: Those results suggest that p53 SNP may not associate with radiotherapeutic acute injury of oral cavity mucosa. (authors)
Energy Technology Data Exchange (ETDEWEB)
Coureuil, M
2006-10-15
The male germinal cells constitute a heterogeneous cell population including pre-meiotic proliferating cells (spermatogonia) and meiotic cells and post meiotic cells in differentiation (spermatocytes and spermatids). We study the involvement in vivo of the p53 protein in the death of these cells with the help of two models, (1) a transgenic model of infertility, MTp53, in which the p53 is over expressed in the differentiated cells and induced their death, (2) the response of these cells to gamma irradiation, where only the spermatogonia die by apoptosis dependent of p53. We showed that the caspases (cysteine-aspartic proteases) are involved in the terminal differentiation of normal germinal cells. But in the MTp53 model, the p53 induces the death of differentiated cells via the activation of calpains and not of caspases. We studied the response of spermatogonia, to gamma irradiation by a transcriptomic approach, by DNA chips and semi-quantitative RT-PCR. we showed that the puma and dr5 genes are induced by the p53 after irradiation. more, the study of mice invalidated for trail ( the dr5 ligand) or for puma, allowed to demonstrate that the two effectors are essential to the activation of intrinsic and extrinsic ways of apoptosis. (N.C.)
Regulation of p53 tetramerization and nuclear export by ARC.
Foo, Roger S-Y; Nam, Young-Jae; Ostreicher, Marc Jason; Metzl, Mark D; Whelan, Russell S; Peng, Chang-Fu; Ashton, Anthony W; Fu, Weimin; Mani, Kartik; Chin, Suet-Feung; Provenzano, Elena; Ellis, Ian; Figg, Nichola; Pinder, Sarah; Bennett, Martin R; Caldas, Carlos; Kitsis, Richard N
2007-12-26
Inactivation of the transcription factor p53 is central to carcinogenesis. Yet only approximately one-half of cancers have p53 loss-of-function mutations. Here, we demonstrate a mechanism for p53 inactivation by apoptosis repressor with caspase recruitment domain (ARC), a protein induced in multiple cancer cells. The direct binding in the nucleus of ARC to the p53 tetramerization domain inhibits p53 tetramerization. This exposes a nuclear export signal in p53, triggering Crm1-dependent relocation of p53 to the cytoplasm. Knockdown of endogenous ARC in breast cancer cells results in spontaneous tetramerization of endogenous p53, accumulation of p53 in the nucleus, and activation of endogenous p53 target genes. In primary human breast cancers with nuclear ARC, p53 is almost always WT. Conversely, nearly all breast cancers with mutant p53 lack nuclear ARC. We conclude that nuclear ARC is induced in cancer cells and negatively regulates p53.
Limited role of murine ATM in oncogene-induced senescence and p53-dependent tumor suppression.
Directory of Open Access Journals (Sweden)
Alejo Efeyan
Full Text Available Recent studies in human fibroblasts have provided a new general paradigm of tumor suppression according to which oncogenic signaling produces DNA damage and this, in turn, results in ATM/p53-dependent cellular senescence. Here, we have tested this model in a variety of murine experimental systems. Overexpression of oncogenic Ras in murine fibroblasts efficiently induced senescence but this occurred in the absence of detectable DNA damage signaling, thus suggesting a fundamental difference between human and murine cells. Moreover, lung adenomas initiated by endogenous levels of oncogenic K-Ras presented abundant senescent cells, but undetectable DNA damage signaling. Accordingly, K-Ras-driven adenomas were also senescent in Atm-null mice, and the tumorigenic progression of these lesions was only modestly accelerated by Atm-deficiency. Finally, we have examined chemically-induced fibrosarcomas, which possess a persistently activated DNA damage response and are highly sensitive to the activity of p53. We found that the absence of Atm favored genomic instability in the resulting tumors, but did not affect the persistent DNA damage response and did not impair p53-dependent tumor suppression. All together, we conclude that oncogene-induced senescence in mice may occur in the absence of a detectable DNA damage response. Regarding murine Atm, our data suggest that it plays a minor role in oncogene-induced senescence or in p53-dependent tumor suppression, being its tumor suppressive activity probably limited to the maintenance of genomic stability.
Gridley, D. S.; Andres, M. L.; Li, J.; Timiryasova, T.; Chen, B.; Fodor, I.; Nelson, G. A. (Principal Investigator)
1998-01-01
The primary objective of this study was to evaluate the antitumor effects of recombinant vaccinia virus-p53 (rVV-p53) in combination with radiation therapy against the C6 rat glioma, a p53 deficient tumor that is relatively radioresistant. VV-LIVP, the parental virus (Lister strain), was used as a control. Localized treatment of subcutaneous C6 tumors in athymic mice with either rVV-p53 or VV-LIVP together with tumor irradiation resulted in low tumor incidence and significantly slower tumor progression compared to the agents given as single modalities. Assays of blood and spleen indicated that immune system activation may account, at least partly, for the enhance tumor inhibition seen with combined treatment. No overt signs of treatment-related toxicity were noted.
International Nuclear Information System (INIS)
Schwartz, Jeffrey L.; Tamura, Yasuko; Jordan, Robert; Grierson, John R.; Krohn, Kenneth A.
2004-01-01
The use of thymidine (TdR) and thymidine analogs such as 3'-deoxy-3'-fluorothymidine (FLT) as positron emission tomography (PET)-based tracers of tumor proliferation rate is based on the hypothesis that measurement of uptake of these nucleosides, a function primarily of thymidine kinase-1 (TK 1 ) activity, provides an accurate measure of cell proliferation in tumors. Tumor growth is influenced by many factors including the oxygen concentration within tumors and whether tumor cells have been exposed to cytotoxic therapies. The p53 gene plays an important role in regulating growth under both of these conditions. The goal of this study was to investigate the influence of p53 activation on cell growth, TK 1 activity, and FLT uptake. To accomplish this, TK 1 activity, S phase fraction, and the uptake of FLT were determined in plateau-phase and exponentially growing cultures of an isogenic pair of human tumor cell lines in which p53 expression was normal or inactivated by human papilloma virus type 16 E6 expression. Ionizing radiation exposure was used to stimulate p53 activity and to induce alterations in cell cycle progression. We found that exposure of cells to ionizing radiation induced dose-dependent changes in cell cycle progression in both cell lines. The relationship between S phase percentage, TK 1 activity, and FLT uptake were essentially unchanged in the p53-normal cell line. In contrast, TK 1 activity and FLT uptake remained high in the p53-deficient variant even when S phase percentage was low due to a p53-dependent G2 arrest. We conclude that a functional p53 response is required to maintain the normal relationship between TK1 activity and S phase percentage following radiation exposure
International Nuclear Information System (INIS)
Tierney, L.A.; Hahn, F.F.; Lechner, J.F.
1996-01-01
Inhalation of high-linear energy transfer radiation in the form of radon progeny is a suspected cause of human lung cancer. To gain insight into the types of genetic derangements caused by this type of radiation, lung tumors from beagle dogs exposed to 239 PuO 2 and those arising in animals with no known carcinogen exposure were examined for evidence of aberrations in genes known to be altered in lung tumors. Altered expression of the p53 tumor suppressor gene and proto-oncogene erbB-2 proteins (p185 erbB2 ) was evaluated by immunohistochemical analysis of 117 tumors representing different histological types in exposed (n = 80) and unexposed (n = 37) animals. Twenty-eight tumors were analyzed for K-ras proto-oncogene mutations by polymerase chain reaction amplification and direct sequencing. Fourteen percent (16/116) of all lung neoplasms showed elevated nuclear accumulation of p53 protein. Regardless of exposure history, adenosquamous and squamous cell cancers comprised 94% of all tumors with p53 abnormalities. Eighteen percent (21/117) of all tumors had evidence of erbB-2 protein overexpression. K-ras mutations were not detected in codons 12, 13 or 61 of tumors from unexposed (n = 9) or plutonium-exposed dogs (n = 19). These data indicate that p53 and K-ras gene abnormalities as a result of missense mutation are infrequent events in spontaneous and 239 PuO 2 -induced lung neoplasia in this colony of beagle dogs. Alternative mechanisms of gene alteration may be involved in canine pulmonary carcinogenesis. 45 refs., 3 figs., 2 tabs
Apoptosis induced by high- and low-LET radiations
International Nuclear Information System (INIS)
Hendry, J.H.; Potten, C.S.; Merritt, A.
1995-01-01
Cell death after irradiation occurs by apoptosis in certain cell populations in tissues. The phenomenon also occurs after high linear energy transfer (LET) irradiation, and the relative biological effectiveness (RBE) is 3 to 4 (with respect to low-LET radiation and apoptosis in intestinal crypts) for neutrons with energies of 14 MeV and up to 600 MeV. It is thought that p53 plays a role in the phenomenon, as radiation-induced apoptosis is not observed in p53-null animals. (orig.)
Acin, Sergio; Li, Zhongyou; Mejia, Olga; Roop, Dennis R; El-Naggar, Adel K; Caulin, Carlos
2015-01-01
Mutations in p53 occur in over 50% of the human head and neck squamous cell carcinomas (SCCHN). The majority of these mutations result in the expression of mutant forms of p53, rather than deletions in the p53 gene. Some p53 mutants are associated with poor prognosis in SCCHN patients. However, the molecular mechanisms that determine the poor outcome of cancers carrying p53 mutations are unknown. Here, we generated a mouse model for SCCHN and found that activation of the endogenous p53 gain-of-function mutation p53R172H, but not deletion of p53, cooperates with oncogenic K-ras during SCCHN initiation, accelerates oral tumour growth, and promotes progression to carcinoma. Mechanistically, expression profiling of the tumours that developed in these mice and studies using cell lines derived from these tumours determined that mutant p53 induces the expression of genes involved in mitosis, including cyclin B1 and cyclin A, and accelerates entry in mitosis. Additionally, we discovered that this oncogenic function of mutant p53 was dependent on K-ras because the expression of cyclin B1 and cyclin A decreased, and entry in mitosis was delayed, after suppressing K-ras expression in oral tumour cells that express p53R172H. The presence of double-strand breaks in the tumours suggests that oncogene-dependent DNA damage resulting from K-ras activation promotes the oncogenic function of mutant p53. Accordingly, DNA damage induced by doxorubicin also induced increased expression of cyclin B1 and cyclin A in cells that express p53R172H. These findings represent strong in vivo evidence for an oncogenic function of endogenous p53 gain-of-function mutations in SCCHN and provide a mechanistic explanation for the genetic interaction between oncogenic K-ras and mutant p53. PMID:21952947
S100A4 interacts with p53 in the nucleus and promotes p53 degradation.
Orre, L M; Panizza, E; Kaminskyy, V O; Vernet, E; Gräslund, T; Zhivotovsky, B; Lehtiö, J
2013-12-05
S100A4 is a small calcium-binding protein that is commonly overexpressed in a range of different tumor types, and it is widely accepted that S100A4 has an important role in the process of cancer metastasis. In vitro binding assays has shown that S100A4 interacts with the tumor suppressor protein p53, indicating that S100A4 may have additional roles in tumor development. In the present study, we show that endogenous S100A4 and p53 interact in complex samples, and that the interaction increases after inhibition of MDM2-dependent p53 degradation using Nutlin-3A. Further, using proximity ligation assay, we show that the interaction takes place in the cell nucleus. S100A4 knockdown experiments in two p53 wild-type cell lines, A549 and HeLa, resulted in stabilization of p53 protein, indicating that S100A4 is promoting p53 degradation. Finally, we demonstrate that S100A4 knockdown leads to p53-dependent cell cycle arrest and increased cisplatin-induced apoptosis. Thus, our data add a new layer to the oncogenic properties of S100A4 through its inhibition of p53-dependent processes.
International Nuclear Information System (INIS)
Yu Zeyang; Fan Wo; Li Dongqing; Zhu Ran; Wang Yongqing; Wu Jinchang
2008-01-01
Objective: To explore the inhibitory effect and radiation sensitization of recombinant adenovirus encoding human p53 tumor suppressor gene (rAd-p53) on human lymphoma cell lines. Methods: Human lymphoma cell lines Raji and Daudi were treated with rAd-p53, radiation therapy and combined treatment, respectively. The cell growth inhibition was assessed by MTT. The p53 protein expression was detected by Western blotting, and p53 mRNA was detected by BT-PCB. Results: The MTT results showed that the inhibitory effect and radiosensitivity enhancement of rAd-p53 on human lymphoma cell lines were not obvious [Raji: (27.5±4.1)%; Daudi: (28.1±1.6)%]. The results of Western blotting and BT-PCB showed that extrinsic p53 protein and p53 mRNA were expressed to some degree, but not at high-level. In addition, the results didn't demonstrate obvious radiosensitivity enhancement. Conclusions: The role of inhibition and radiosensitivity enhancement of rAd-p53 was not significant on human lymphoma cell lines. (authors)
Song, Shanshan; Xing, Guichun; Yuan, Lin; Wang, Jian; Wang, Shan; Yin, Yuxin; Tian, Chunyan; He, Fuchu; Zhang, Lingqiang
2012-08-01
Alkylating agents induce genome-wide base damage, which is repaired mainly by N-methylpurine DNA glycosylase (MPG). An elevated expression of MPG in certain types of tumor cells confers higher sensitivity to alkylation agents because MPG-induced apurinic/apyrimidic (AP) sites trigger more strand breaks. However, the determinant of drug sensitivity or insensitivity still remains unclear. Here, we report that the p53 status coordinates with MPG to play a pivotal role in such process. MPG expression is positive in breast, lung and colon cancers (38.7%, 43.4% and 25.3%, respectively) but negative in all adjacent normal tissues. MPG directly binds to the tumor suppressor p53 and represses p53 activity in unstressed cells. The overexpression of MPG reduced, whereas depletion of MPG increased, the expression levels of pro-arrest gene downstream of p53 including p21, 14-3-3σ and Gadd45 but not proapoptotic ones. The N-terminal region of MPG was specifically required for the interaction with the DNA binding domain of p53. Upon DNA alkylation stress, in p53 wild-type tumor cells, p53 dissociated from MPG and induced cell growth arrest. Then, AP sites were repaired efficiently, which led to insensitivity to alkylating agents. By contrast, in p53-mutated cells, the AP sites were repaired with low efficacy. To our knowledge, this is the first direct evidence to show that a DNA repair enzyme functions as a selective regulator of p53, and these findings provide new insights into the functional linkage between MPG and p53 in cancer therapy.
Paracrine Apoptotic Effect of p53 Mediated by Tumor Suppressor Par-4
Directory of Open Access Journals (Sweden)
Ravshan Burikhanov
2014-01-01
Full Text Available The guardian of the genome, p53, is often mutated in cancer and may contribute to therapeutic resistance. Given that p53 is intact and functional in normal tissues, we harnessed its potential to inhibit the growth of p53-deficient cancer cells. Specific activation of p53 in normal fibroblasts selectively induced apoptosis in p53-deficient cancer cells. This paracrine effect was mediated by p53-dependent secretion of the tumor suppressor Par-4. Accordingly, the activation of p53 in normal mice, but not p53−/− or Par-4−/− mice, caused systemic elevation of Par-4, which induced apoptosis of p53-deficient tumor cells. Mechanistically, p53 induced Par-4 secretion by suppressing the expression of its binding partner, UACA, which sequesters Par-4. Thus, normal cells can be empowered by p53 activation to induce Par-4 secretion for the inhibition of therapy-resistant tumors.
International Nuclear Information System (INIS)
Sasano, Nakashi; Shiraishi, Kenshiro; Igaki, Hiroshi; Nakagawa, Keiichi; Enomoto, Atsushi; Hosoi, Yoshio; Matsumoto, Yoshihisa; Miyagawa, Kiyoshi; Katsumura, Yosuke
2007-01-01
Edaravone, a clinical drug used widely for the treatment of acute cerebral infarction, is reported to scavenge free radicals. In the present study, we investigated the radioprotective effect of edaravone on X-ray-induced apoptosis in MOLT-4 cells. Apoptosis was determined by the dye exclusion test, Annexin V binding assay, cleavage of caspase, and DNA fragmentation. We found that edaravone significantly suppressed the X-ray-induced apoptosis. The amount of intracellular reactive oxygen species (ROS) production was determined by the chloromethyl-2', 7'-dichlorodihydro-fluorescein diacetate system. We found that the intracellular ROS production by X-irradiation was completely suppressed by the addition of edaravone. The accumulation and phosphorylation of p53 and the expression of p21 WAF1 , a target protein of p53, which were induced by X-irradiation, were also suppressed by adding edaravone. We conclude that the free radical scavenger edaravone suppresses X-ray-induced apoptosis in MOLT-4 cells by inhibiting p53. (author)
Energy Technology Data Exchange (ETDEWEB)
Sasano, Nakashi; Shiraishi, Kenshiro; Igaki, Hiroshi; Nakagawa, Keiichi [Tokyo Univ., Graduate School of Medicine, Tokyo (Japan); Enomoto, Atsushi; Hosoi, Yoshio; Matsumoto, Yoshihisa; Miyagawa, Kiyoshi [Tokyo Univ., Faculty of Medicine, Tokyo (Japan); Katsumura, Yosuke [Tokyo Univ., Graduate School of Engineering, Tokyo (Japan)
2007-11-15
Edaravone, a clinical drug used widely for the treatment of acute cerebral infarction, is reported to scavenge free radicals. In the present study, we investigated the radioprotective effect of edaravone on X-ray-induced apoptosis in MOLT-4 cells. Apoptosis was determined by the dye exclusion test, Annexin V binding assay, cleavage of caspase, and DNA fragmentation. We found that edaravone significantly suppressed the X-ray-induced apoptosis. The amount of intracellular reactive oxygen species (ROS) production was determined by the chloromethyl-2', 7'-dichlorodihydro-fluorescein diacetate system. We found that the intracellular ROS production by X-irradiation was completely suppressed by the addition of edaravone. The accumulation and phosphorylation of p53 and the expression of p21{sup WAF1}, a target protein of p53, which were induced by X-irradiation, were also suppressed by adding edaravone. We conclude that the free radical scavenger edaravone suppresses X-ray-induced apoptosis in MOLT-4 cells by inhibiting p53. (author)
McNaughton, Melissa; Pitman, Melissa; Pitson, Stuart M; Pyne, Nigel J; Pyne, Susan
2016-03-29
Sphingosine kinases (two isoforms termed SK1 and SK2) catalyse the formation of the bioactive lipid sphingosine 1-phosphate. We demonstrate here that the SK2 inhibitor, ABC294640 (3-(4-chlorophenyl)-adamantane-1-carboxylic acid (pyridin-4-ylmethyl)amide) or the SK1/SK2 inhibitor, SKi (2-(p-hydroxyanilino)-4-(p-chlorophenyl)thiazole)) induce the proteasomal degradation of SK1a (Mr = 42 kDa) and inhibit DNA synthesis in androgen-independent LNCaP-AI prostate cancer cells. These effects are recapitulated by the dihydroceramide desaturase (Des1) inhibitor, fenretinide. Moreover, SKi or ABC294640 reduce Des1 activity in Jurkat cells and ABC294640 induces the proteasomal degradation of Des1 (Mr = 38 kDa) in LNCaP-AI prostate cancer cells. Furthermore, SKi or ABC294640 or fenretinide increase the expression of the senescence markers, p53 and p21 in LNCaP-AI prostate cancer cells. The siRNA knockdown of SK1 or SK2 failed to increase p53 and p21 expression, but the former did reduce DNA synthesis in LNCaP-AI prostate cancer cells. Moreover, N-acetylcysteine (reactive oxygen species scavenger) blocked the SK inhibitor-induced increase in p21 and p53 expression but had no effect on the proteasomal degradation of SK1a. In addition, siRNA knockdown of Des1 increased p53 expression while a combination of Des1/SK1 siRNA increased the expression of p21. Therefore, Des1 and SK1 participate in regulating LNCaP-AI prostate cancer cell growth and this involves p53/p21-dependent and -independent pathways. Therefore, we propose targeting androgen-independent prostate cancer cells with compounds that affect Des1/SK1 to modulate both de novo and sphingolipid rheostat pathways in order to induce growth arrest.
Survivin inhibits anti-growth effect of p53 activated by aurora B
International Nuclear Information System (INIS)
Jung, Ji-Eun; Kim, Tae-Kyung; Lee, Joong-Seob; Oh, Se-Yeong; Kwak, Sungwook; Jin, Xun; Sohn, Jin-Young; Song, Min-Keun; Sohn, Young-Woo; Lee, Soo-Yeon; Pian, Xumin; Lee, Jang-Bo; Chung, Yong Gu; Choi, Young Ki; You, Seungkwon; Kim, Hyunggee
2005-01-01
Genomic instability and apoptosis evasion are hallmarks of cancer, but the molecular mechanisms governing these processes remain elusive. Here, we found that survivin, a member of the apoptosis-inhibiting gene family, and aurora B kinase, a chromosomal passenger protein, were co-overexpressed in the various glioblastoma cell lines and tumors. Notably, exogenous introduction of the aurora B in human BJ cells was shown to decrease cell growth and increase the senescence-associated β-galactosidase activity by activation of p53 tumor suppressor. However, aurora B overexpression failed to inhibit cell proliferation in BJ and U87MG cells transduced with dominant-negative p53 as well as in p53 -/- mouse astrocytes. Aurora B was shown to increase centrosome amplification in the p53 -/- astrocytes. Survivin was shown to induce anchorage-independent growth and inhibit anti-proliferation and drug-sensitive apoptosis caused by aurora B. Overexpression of both survivin and aurora B further accelerated the proliferation of BJ cells. Taken together, the present study indicates that survivin should accelerate tumorigenesis by inhibiting the anti-proliferative effect of p53 tumor suppressor that is activated by aurora B in normal and glioblastoma cells containing intact p53
Apoptosis in spermatogonia irradiated P53 null mice
International Nuclear Information System (INIS)
Streit-Bianchi, M.; Hendry, J.H.; Roberts, S.A.; Morris, J.D.; Durgaryan, A.A.
2007-01-01
irradiation and may contribute to a greater mutational burden with respect to transgenerational effects. Split-dose data when compared to single dose also shows for p53 null mice a very high rate of spermatogonia survival. The strain +/+ indicates a large mortality rate when the second dose is given at the time mitotic radiation induced delay is highest whereas the strain +/- shows intermediate values. In the +/+ mice efficient apoptosis activity is shown by a first and second wave appearance whereas in p53 null mice only a second wave is clearly visible. These data seems to indicate that in +/+ mice repair mechanisms in spermatogonial cell are extremely low and that poor cellular damage proofreading exists in p53 null mice. The deficiencies in apoptosis related to the p53 status contribute to the high cancer-proneness of individual with p53 deficiency in the Li-Fraumeni syndrome.
Energy Technology Data Exchange (ETDEWEB)
Denamur, Sophie; Boland, Lidvine [Université catholique de Louvain, Louvain Drug Research Institute, Cellular and Molecular Pharmacology, UCL B1.73.05, avenue E. Mounier, 73 – B1200 Brussels (Belgium); Beyaert, Maxime [Université catholique de Louvain, de Duve Institute, Laboratory of Physiological Chemistry, UCL B1.75.08, avenue Hippocrate, 75 B -1200 Brussels (Belgium); Verstraeten, Sandrine L. [Université catholique de Louvain, Louvain Drug Research Institute, Cellular and Molecular Pharmacology, UCL B1.73.05, avenue E. Mounier, 73 – B1200 Brussels (Belgium); Fillet, Marianne [University of Liege, CIRM, Department of Pharmacy, Laboratory for the Analysis of Medicines, Quartier Hopital, Avenue Hippocrate, 15, B36, Tower 4, 4000 Liège 1 (Belgium); Tulkens, Paul M. [Université catholique de Louvain, Louvain Drug Research Institute, Cellular and Molecular Pharmacology, UCL B1.73.05, avenue E. Mounier, 73 – B1200 Brussels (Belgium); Bontemps, Françoise [Université catholique de Louvain, de Duve Institute, Laboratory of Physiological Chemistry, UCL B1.75.08, avenue Hippocrate, 75 B -1200 Brussels (Belgium); Mingeot-Leclercq, Marie-Paule [Université catholique de Louvain, Louvain Drug Research Institute, Cellular and Molecular Pharmacology, UCL B1.73.05, avenue E. Mounier, 73 – B1200 Brussels (Belgium)
2016-10-15
Gentamicin, an aminoglycoside used to treat severe bacterial infections, may cause acute renal failure. In the renal cell line LLC-PK1, gentamicin accumulates in lysosomes, induces alterations of their permeability, and triggers the mitochondrial pathway of apoptosis via activation of caspase-9 and -3 and changes in Bcl-2 family proteins. Early ROS production in lysosomes has been associated with gentamicin induced lysosomal membrane permeabilization. In order to better understand the multiple interconnected pathways of gentamicin-induced apoptosis and ensuing renal cell toxicity, we investigated the effect of gentamicin on p53 and p21 levels. We also studied the potential effect of gentamicin on proteasome by measuring the chymotrypsin-, trypsin- and caspase-like activities, and on endoplasmic reticulum by determining phopho-eIF2α, caspase-12 activation and GRP78 and 94. We observed an increase in p53 levels, which was dependent on ROS production. Accumulation of p53 resulted in accumulation of p21 and of phospho-eIF2α. These effects could be related to an impairment of proteasome as we demonstrated an inhibition of trypsin-and caspase-like activities. Moderate endoplasmic reticulum stress could also participate to cellular toxicity induced by gentamicin, with activation of caspase-12 without change in GRP74 and GRP98. All together, these data provide new mechanistic insights into the apoptosis induced by aminoglycoside antibiotics on renal cell lines. - Highlights: • Gentamicin induces apoptosis through p53 pathway. • Gentamicin inhibits proteosomal activity. • Gentamicin activates caspase-12.
International Nuclear Information System (INIS)
Denamur, Sophie; Boland, Lidvine; Beyaert, Maxime; Verstraeten, Sandrine L.; Fillet, Marianne; Tulkens, Paul M.; Bontemps, Françoise; Mingeot-Leclercq, Marie-Paule
2016-01-01
Gentamicin, an aminoglycoside used to treat severe bacterial infections, may cause acute renal failure. In the renal cell line LLC-PK1, gentamicin accumulates in lysosomes, induces alterations of their permeability, and triggers the mitochondrial pathway of apoptosis via activation of caspase-9 and -3 and changes in Bcl-2 family proteins. Early ROS production in lysosomes has been associated with gentamicin induced lysosomal membrane permeabilization. In order to better understand the multiple interconnected pathways of gentamicin-induced apoptosis and ensuing renal cell toxicity, we investigated the effect of gentamicin on p53 and p21 levels. We also studied the potential effect of gentamicin on proteasome by measuring the chymotrypsin-, trypsin- and caspase-like activities, and on endoplasmic reticulum by determining phopho-eIF2α, caspase-12 activation and GRP78 and 94. We observed an increase in p53 levels, which was dependent on ROS production. Accumulation of p53 resulted in accumulation of p21 and of phospho-eIF2α. These effects could be related to an impairment of proteasome as we demonstrated an inhibition of trypsin-and caspase-like activities. Moderate endoplasmic reticulum stress could also participate to cellular toxicity induced by gentamicin, with activation of caspase-12 without change in GRP74 and GRP98. All together, these data provide new mechanistic insights into the apoptosis induced by aminoglycoside antibiotics on renal cell lines. - Highlights: • Gentamicin induces apoptosis through p53 pathway. • Gentamicin inhibits proteosomal activity. • Gentamicin activates caspase-12.
Combination of Heavy-ion radiotherapy and p53-gene therapy by radio-sensitizing promoter for glioma
International Nuclear Information System (INIS)
Oga, Masaru; Koshikawa, Nobuko; Takenaga, Keizo; Iwadate, Yasuo; Nojima, Kumie
2005-01-01
In this study we have investigated the anti-tumor effect of the combination of heavy-ion radiotherapy, inducing p53-independent apoptosis, and p53-gene therapy, inducing p53-dependent apoptosis for glioma. To enhance the p53-dependent apoptosis, we chose the strategy to utilize the heavy-ion irradiation itself as a ''trigger'' by using radio-sensitizing promoter-E9ns-2/CMV chimeric promoter (Scott et al:2003) in p53-gene therapy. First, EGFP reporter gene with E9ns-2/CMV chimeric promoter was transfected in C6 rat glioma cell-line and the transfected-cell bulk was irradiated at dose of 3, 5, 10 Gy respectively with charged carbon particle (290 MeV/nucleon). The light upregulation of EGFP was observed in 24 hours after 5 Gy irradiation. On the basis of this result, p53 gene with E9ns-2/CMV chimeric promoter was transfected in p53-mutant U373MG human glioma cell-line and the transfected-cell bulk was irradiated at dose of 5 Gy. There was, however, no obvious p53-upregulation at any time-point, so far. Further investigation is needed to clarify the appropriate experimental system. (author)
A dual role of p53 in the control of autophagy.
Tasdemir, Ezgi; Chiara Maiuri, M; Morselli, Eugenia; Criollo, Alfredo; D'Amelio, Marcello; Djavaheri-Mergny, Mojgan; Cecconi, Francesco; Tavernarakis, Nektarios; Kroemer, Guido
2008-08-01
Genotoxic stress can induce autophagy in a p53-dependent fashion and p53 can transactivate autophagy-inducing genes. We have observed recently that inactivation of p53 by deletion, depletion or inhibition can trigger autophagy. Thus, human and mouse cells subjected to knockout, knockdown or pharmacological inhibition of p53 manifest signs of autophagy such as depletion of p62/SQSTM1, LC3 lipidation, redistribution of GFP-LC3 in cytoplasmic puncta, and accumulation of autophagosomes and autolysosomes, both in vitro and in vivo. Inhibition of p53 causes autophagy in enucleated cells, indicating that the cytoplasmic, non-nuclear pool of p53 can regulate autophagy. Accordingly, retransfection of p53(-/-) cells with wild-type p53 as well as a p53 mutant that is excluded from the nucleus (due to the deletion of the nuclear localization sequence) can inhibit autophagy, whereas retransfection with a nucleus-restricted p53 mutant (in which the nuclear localization sequence has been deleted) does not inhibit autophagy. Several distinct autophagy inducers (e.g., starvation, rapamycin, lithium, tunicamycin and thapsigargin) stimulate the rapid degradation of p53. In these conditions, inhibition of the p53-specific E3 ubiquitin ligase HDM2 can avoid p53 depletion and simultaneously prevent the activation of autophagy. Moreover, a p53 mutant that lacks the HDM2 ubiquitinylation site and hence is more stable than wild-type p53 is particularly efficient in suppressing autophagy. In conclusion, p53 plays a dual role in the control of autophagy. On the one hand, nuclear p53 can induce autophagy through transcriptional effects. On the other hand, cytoplasmic p53 may act as a master repressor of autophagy.
Kim, Bo-Mi; Rhee, Jae-Sung; Lee, Kyun-Woo; Kim, Min-Jung; Shin, Kyung-Hoon; Lee, Su-Jae; Lee, Young-Mi; Lee, Jae-Seong
2015-01-01
Ultraviolet B (UV-B) radiation presents an environmental hazard to aquatic organisms. To understand the molecular responses of the intertidal copepod Tigriopus japonicus to UV-B radiation, we measured the acute toxicity response to 96 h of UV-B radiation, and we also assessed the intracellular reactive oxygen species (ROS) levels, glutathione (GSH) content, and antioxidant enzyme (GST, GR, GPx, and SOD) activities after 24 h of exposure to UV-B with LD50 and half LD50 values. Also, expression patterns of p53 and hsp gene families with phosphorylation of p38 MAPK were investigated in UV-B-exposed copepods. We found that the ROS level, GSH content, and antioxidant enzyme activity levels were increased with the transcriptional upregulation of antioxidant-related genes, indicating that UV-B induces oxidative stress by generating ROS and stimulating antioxidant enzymatic activity as a defense mechanism. Additionally, we found that p53 expression was significantly increased after UV-B irradiation due to increases in the phosphorylation of the stress-responsive p38 MAPK, indicating that UV-B may be responsible for inducing DNA damage in T. japonicus. Of the hsp family genes, transcriptional levels of hsp20, hsp20.7, hsp70, and hsp90 were elevated in response to a low dose of UV-B radiation (9 kJ m(-2)), suggesting that these hsp genes may be involved in cellular protection against UV-B radiation. In this paper, we performed a pathway-oriented mechanistic analysis in response to UV-B radiation, and this analysis provides a better understanding of the effects of UV-B in the intertidal benthic copepod T. japonicus. Copyright © 2014 Elsevier Inc. All rights reserved.
Targeting p53 by small molecules in hematological malignancies
Saha, Manujendra N; Qiu, Lugui; Chang, Hong
2013-01-01
p53 is a powerful tumor suppressor and is an attractive cancer therapeutic target. A breakthrough in cancer research came from the discovery of the drugs which are capable of reactivating p53 function. Most anti-cancer agents, from traditional chemo- and radiation therapies to more recently developed non-peptide small molecules exert their effects by enhancing the anti-proliferative activities of p53. Small molecules such as nutlin, RITA, and PRIMA-1 that can activate p53 have shown their ant...
The novel fusion proteins, GnRH-p53 and GnRHIII-p53, expression and their anti-tumor effect.
Directory of Open Access Journals (Sweden)
Peiyuan Jia
Full Text Available p53, one of the most well studied tumor suppressor factor, is responsible to a variety of damage owing to the induction of apoptosis and cell cycle arrest in the tumor cells. More than 50% of human tumors contain mutation or deletion of p53. Gonadotrophin-releasing hormone (GnRH, as the ligand of Gonadotrophin-releasing hormone receptor (GnRH-R, was used to deliver p53 into tumor cells. The p53 fusion proteins GnRH-p53 and GnRH iii-p53 were expressed and their targeted anti-tumor effects were determined. GnRH mediates its fusion proteins transformation into cancer cells. The intracellular delivery of p53 fusion proteins exerted the inhibition of the growth of H1299 cells in vitro and the reduction of tumor volume in vivo. Their anti-tumor effect was functioned by the apoptosis and cell cycle arrest induced by p53. Hence, the fusion protein could be a novel protein drug for anti-tumor therapy.
Sucralfate protects intestinal epithelial cells from radiation-induced apoptosis in rats
International Nuclear Information System (INIS)
Matsuu-Matsuyama, Mutsumi; Shichijo, Kazuko; Okaichi, Kumio
2006-01-01
Radiotherapy for malignant pelvic disease is often followed by acute radiation colitis (ARC). It has been reported that sucralfate treatment has a protective effect against ARC, though the mechanisms of action are unknown. The effects of sucralfate on X-ray radiation-induced apoptosis was studied at 4 Gy in the colonic crypt cells of rats. Sucralfate enemas given prior to radiation resulted in the following: reduction in number of apoptotic colonic crypt cells; reduction in number of caspase-3 positive cells; decreases in p53 accumulation and p21 expression; decreases of Bax/Bcl-2 ratio. The protective effects of sucralfate against ARC may be partially due to the suppression of radiation-induced apoptosis by way of p53 in the colon and the protection of the colonic epithelial stem cell region. (author)
Role of p53–fibrinolytic system cross-talk in the regulation of quartz-induced lung injury
International Nuclear Information System (INIS)
Bhandary, Yashodhar P.; Shetty, Shwetha K.; Marudamuthu, Amarnath S.; Fu, Jian; Pinson, Barbara M.; Levin, Jeffrey; Shetty, Sreerama
2015-01-01
Silica is the major component of airborne dust generated by wind, manufacturing and/or demolition. Chronic occupational inhalation of silica dust containing crystalline quartz is by far the predominant form of silicosis in humans. Silicosis is a progressive lung disease that typically arises after a very long latency and is a major occupational concern with no known effective treatment. The mechanism of silicosis is not clearly understood. However, silicosis is associated with increased cell death, expression of redox enzymes and pro-fibrotic cytokines and chemokines. Since alveolar epithelial cell (AEC) death and disruption of alveolar fibrinolysis is often associated with both acute and chronic lung injuries, we explored whether p53-mediated changes in the urokinase-type plasminogen activator (uPA) system contributes to silica-induced lung injury. We further sought to determine whether caveolin-1 scaffolding domain peptide (CSP), which inhibits p53 expression, mitigates lung injury associated with exposure to silica. Lung tissues and AECs isolated from wild-type (WT) mice exposed to silica exhibit increased apoptosis, p53 and PAI-1, and suppression of uPA expression. Treatment of WT mice with CSP inhibits PAI-1, restores uPA expression and prevents AEC apoptosis by suppressing p53, which is otherwise induced in mice exposed to silica. The process involves CSP-mediated inhibition of serine-15 phosphorylation of p53 by inhibition of protein phosphatase 2A-C (PP2A-C) interaction with silica-induced caveolin-1 in AECs. These observations suggest that changes in the p53–uPA fibrinolytic system cross-talk contribute to lung injury caused by inhalation of silica dust containing crystalline quartz and is protected by CSP by targeting this pathway. - Highlights: • Chronic exposure to quartz dusts is a major cause of lung injury and silicosis. • The survival of patients with silicosis is bleak due to lack of effective treatments. • This study defines a new role of
DEFF Research Database (Denmark)
Zandi, Roza; Selivanova, Galina; Christensen, Camilla Laulund
2011-01-01
Small cell lung cancer (SCLC) is a highly malignant disease with poor prognosis, necessitating the need to develop new and efficient treatment modalities. PRIMA-1(Met) (p53-dependent reactivation of massive apoptosis), also known as APR-246, is a small molecule, which restores tumor suppressor...... function to mutant p53 and induces cancer cell death in various cancer types. Since p53 is mutated in more than 90% of SCLC, we investigated the ability of PRIMA-1(Met) to induce apoptosis and inhibit tumor growth in SCLC with different p53 mutations....
Lagunas-Martínez, Alfredo; García-Villa, Enrique; Arellano-Gaytán, Magaly; Contreras-Ochoa, Carla O; Dimas-González, Jisela; López-Arellano, María E; Madrid-Marina, Vicente; Gariglio, Patricio
2017-01-01
The E6 oncoprotein can interfere with the ability of infected cells to undergo programmed cell death through the proteolytic degradation of proapoptotic proteins such as p53, employing the proteasome pathway. Therefore, inactivation of the proteasome through MG132 should restore the activity of several proapoptotic proteins. We investigated whether in HPV16 E6-expressing keratinocytes (KE6 cells), the restoration of p53 levels mediated by MG132 and/or activation of the CD95 pathway through apoptosis antigen-1 (APO-1) antibody are responsible for the induction of apoptosis. We found that KE6 cells underwent apoptosis mainly after incubation for 24 h with MG132 alone or APO-1 plus MG132. Both treatments activated the extrinsic and intrinsic apoptosis pathways. Autophagy was also activated, principally by APO-1 plus MG132. Inhibition of E6-mediated p53 proteasomal degradation by MG132 resulted in the elevation of p53 protein levels and its phosphorylation in Ser46 and Ser20; the p53 protein was localized mainly at nucleus after treatment with MG132 or APO-1 plus MG132. In addition, induction of its transcriptional target genes such as p21, Bax and TP53INP was observed 3 and 6 h after treatment. Also, LC3 mRNA was induced after 3 and 6 h, which correlates with lipidation of LC3B protein and induction of autophagy. Finally, using pifithrin alpha we observed a decrease in apoptosis induced by MG132, and by APO-1 plus MG132, suggesting that restoration of APO-1 sensitivity occurs in part through an increase in both the levels and the activity of p53. The use of small molecules to inhibit the proteasome pathway might permit the activation of cell death, providing new opportunities for CC treatment.
OTUD5 regulates p53 stability by deubiquitinating p53.
Directory of Open Access Journals (Sweden)
Judong Luo
Full Text Available The p53 tumour suppressor protein is a transcription factor that prevents oncogenic progression by activating the expression of apoptosis and cell-cycle arrest genes in stressed cells. The stability of p53 is tightly regulated by ubiquitin-dependent degradation, driven mainly by its negative regulators ubiquitin ligase MDM2.In this study, we have identified OTUD5 as a DUB that interacts with and deubiquitinates p53. OTUD5 forms a direct complex with p53 and controls level of ubiquitination. The function of OTUD5 is required to allow the rapid activation of p53-dependent transcription and a p53-dependent apoptosis in response to DNA damage stress.As a novel deubiquitinating enzyme for p53, OTUD5 is required for the stabilization and the activation of a p53 response.
Energy Technology Data Exchange (ETDEWEB)
Khan, Rehan; Khan, Abdul Quaiyoom; Qamar, Wajhul; Lateef, Abdul; Tahir, Mir; Rehman, Muneeb U; Ali, Farrah; Sultana, Sarwat, E-mail: sarwat786@rediffmail.com
2012-02-01
Cisplatin, an antineoplastic drug, is widely used as a foremost therapy against numerous forms of cancer but it has pronounced adverse effects viz., nephrotoxicity, ototoxicity etc. CDDP-induced emesis and diarrhea are also marked toxicities that may be due to intestinal injury. Chrysin (5,7-dihydroxyflavone), a natural flavone commonly found in many plants possesses multiple biological activities, such as antioxidant, anti-inflammatory and anti-cancer effects. In the present study, we investigated the protective effect of chrysin against CDDP-induced colon toxicity. The plausible mechanism of CDDP-induced colon toxicity and damage includes oxidative stress, activation of p38MAPK and p53, and colonic epithelial cell apoptosis via upregulating the expression of Bak and cleaved caspase-3. Chrysin was administered to Wistar rats once daily for 14 consecutive days at the doses of 25 and 50 mg/kg body weight orally in corn oil. On day 14, a single intraperitoneal injection of cisplatin was given at the dose of 7.5 mg/kg body weight and animals were euthanized after 24 h of cisplatin injection. Chrysin ameliorated CDDP-induced lipid peroxidation, xanthine oxidase activity, glutathione depletion, decrease in antioxidant (catalase, glutathione reductase, glutathione peroxidase and glucose-6 phosphate dehydrogenase) and phase-II detoxifying (glutathione-S-transferase and quinone reductase) enzyme activities. Chrysin also attenuated goblet cell disintegration, expression of phospho-p38MAPK and p53, and apoptotic tissue damage which were induced by CDDP. Histological findings further supported the protective effects of chrysin against CDDP-induced colonic damage. The results of the present study suggest that the protective effect of chrysin against CDDP-induced colon toxicity was related with attenuation of oxidative stress, activation of p38MAPK and p53, and apoptotic tissue damage. Highlights: ► Cisplatin-induced colon toxicity is associated with oxidative stress and
International Nuclear Information System (INIS)
Khan, Rehan; Khan, Abdul Quaiyoom; Qamar, Wajhul; Lateef, Abdul; Tahir, Mir; Rehman, Muneeb U; Ali, Farrah; Sultana, Sarwat
2012-01-01
Cisplatin, an antineoplastic drug, is widely used as a foremost therapy against numerous forms of cancer but it has pronounced adverse effects viz., nephrotoxicity, ototoxicity etc. CDDP-induced emesis and diarrhea are also marked toxicities that may be due to intestinal injury. Chrysin (5,7-dihydroxyflavone), a natural flavone commonly found in many plants possesses multiple biological activities, such as antioxidant, anti-inflammatory and anti-cancer effects. In the present study, we investigated the protective effect of chrysin against CDDP-induced colon toxicity. The plausible mechanism of CDDP-induced colon toxicity and damage includes oxidative stress, activation of p38MAPK and p53, and colonic epithelial cell apoptosis via upregulating the expression of Bak and cleaved caspase-3. Chrysin was administered to Wistar rats once daily for 14 consecutive days at the doses of 25 and 50 mg/kg body weight orally in corn oil. On day 14, a single intraperitoneal injection of cisplatin was given at the dose of 7.5 mg/kg body weight and animals were euthanized after 24 h of cisplatin injection. Chrysin ameliorated CDDP-induced lipid peroxidation, xanthine oxidase activity, glutathione depletion, decrease in antioxidant (catalase, glutathione reductase, glutathione peroxidase and glucose-6 phosphate dehydrogenase) and phase-II detoxifying (glutathione-S-transferase and quinone reductase) enzyme activities. Chrysin also attenuated goblet cell disintegration, expression of phospho-p38MAPK and p53, and apoptotic tissue damage which were induced by CDDP. Histological findings further supported the protective effects of chrysin against CDDP-induced colonic damage. The results of the present study suggest that the protective effect of chrysin against CDDP-induced colon toxicity was related with attenuation of oxidative stress, activation of p38MAPK and p53, and apoptotic tissue damage. Highlights: ► Cisplatin-induced colon toxicity is associated with oxidative stress and
Grison, Alice; Mantovani, Fiamma; Comel, Anna; Agostoni, Elena; Gustincich, Stefano; Persichetti, Francesca; Del Sal, Giannino
2011-11-01
Huntington disease (HD) is a neurodegenerative disorder caused by a CAG repeat expansion in the gene coding for huntingtin protein. Several mechanisms have been proposed by which mutant huntingtin (mHtt) may trigger striatal neurodegeneration, including mitochondrial dysfunction, oxidative stress, and apoptosis. Furthermore, mHtt induces DNA damage and activates a stress response. In this context, p53 plays a crucial role in mediating mHtt toxic effects. Here we have dissected the pathway of p53 activation by mHtt in human neuronal cells and in HD mice, with the aim of highlighting critical nodes that may be pharmacologically manipulated for therapeutic intervention. We demonstrate that expression of mHtt causes increased phosphorylation of p53 on Ser46, leading to its interaction with phosphorylation-dependent prolyl isomerase Pin1 and consequent dissociation from the apoptosis inhibitor iASPP, thereby inducing the expression of apoptotic target genes. Inhibition of Ser46 phosphorylation by targeting homeodomain-interacting protein kinase 2 (HIPK2), PKCδ, or ataxia telangiectasia mutated kinase, as well as inhibition of the prolyl isomerase Pin1, prevents mHtt-dependent apoptosis of neuronal cells. These results provide a rationale for the use of small-molecule inhibitors of stress-responsive protein kinases and Pin1 as a potential therapeutic strategy for HD treatment.
A surrogate p53 reporter in Drosophila reveals the interaction of eIF4E and p53
International Nuclear Information System (INIS)
Corujo, G.; Campagno, R.; Rivera Pomar, R.; Ferrero, P.; Lu, W.J.
2011-01-01
eIF4E promotes translation upon binding the mRNA 5'cap and it is required for cell proliferation. p53 is a proapoptotic protein which is activated in response to DNA damage. There is evidence that suggests that eIF4E and p53 are connected in a mechanism that regulates their function. We propose a model for that such a mechanism to explain the equilibrium between apoptosis and cell proliferation. Our data shows a correlation between the overexpression of eIF4E and the suppression of apoptosis triggered by the overexpression of p53 in Drosophila imaginal discs. We also studied a reporter transgene which expresses GFP in response to p53 activation by gamma radiation. We could confirm that this p53 surrogate works in imaginal discs as well as in embryos. This provided us a tool to quantify the effect on the GFP signal by overexpression of eIF4E to confirm how these two proteins could interact in vivo. Our results suggest that p53 and eIF4E are indeed in an equilibrium that decides if a cell shall proliferate or die. (authors)
P53 suppresses expression of the 14-3-3gamma oncogene
Directory of Open Access Journals (Sweden)
Qi Wenqing
2011-08-01
Full Text Available Abstract Background 14-3-3 proteins are a family of highly conserved proteins that are involved in a wide range of cellular processes. Recent evidence indicates that some of these proteins have oncogenic activity and that they may promote tumorigenesis. We previously showed that one of the 14-3-3 family members, 14-3-3gamma, is over expressed in human lung cancers and that it can induce transformation of rodent cells in vitro. Methods qRTPCR and Western blot analysis were performed to examine 14-3-3gamma expression in non-small cell lung cancers (NSCLC. Gene copy number was analyzed by qPCR. P53 mutations were detected by direct sequencing and also by western blot. CHIP and yeast one hybrid assays were used to detect p53 binding to 14-3-3gamma promoter. Results Quantitative rtPCR results showed that the expression level of 14-3-3gamma was elevated in the majority of NSCLC that we examined which was also consistent with protein expression. Further analysis of the expression pattern of 14-3-3gamma in lung tumors showed a correlation with p53 mutations suggesting that p53 might suppress 14-3-3 gamma expression. Analysis of the gamma promoter sequence revealed the presence of a p53 consensus binding motif and in vitro assays demonstrated that wild-type p53 bound to this motif when activated by ionizing radiation. Deletion of the p53 binding motif eliminated p53's ability to suppress 14-3-3gamma expression. Conclusion Increased expression of 14-3-3gamma in lung cancer coincides with loss of functional p53. Hence, we propose that 14-3-3gamma's oncogenic activities cooperate with loss of p53 to promote lung tumorigenesis.
Zhao, Yi; Yao, Yun-hong; Li, Li; An, Wei-fang; Chen, Hong-zen; Sun, Li-ping; Kang, Hai-xian; Wang, Sen; Hu, Xin-rong
2014-12-01
Pokemon has been showed to directly suppress p14(ARF) expression and also to overexpress in multiple cancers. However, p14(ARF)-MDM2-p53 pathway is usually aberrant in colorectal cancer (CRC). The aim is to confirm whether Pokemon plays a role in CRC and explore whether Pokemon works through p14(ARF)-MDM2-p53 pathway in CRC. Immunohistochemistry for Pokemon, p14(ARF) and Mtp53 protein was applied to 45 colorectal epitheliums (CREs), 42 colorectal adenomas (CRAs) and 66 CRCs. Pokemon was knocked down with RNAi technique in CRC cell line Lovo to detect mRNA expression of p14(ARF) with qRT-PCR, cell proliferation with CCK8 assay, and cell cycle and apoptosis with flowcytometry analysis. The protein expression rates were significantly higher in CRC (75.8%) than in CRE (22.2 %) or CRA (38.1%) for Pokemon and higher in CRC (53.0%) than in CRE (0) or CRA (4.8%) for Mtp53, but not significantly different in CRC (86.4 %) versus CRE (93.3%) or CRA (90.5 %) for p14(ARF). Higher expression rate of Pokemon was associated with lymph node metastasis and higher Duke's stage. After knockdown of Pokemon in Lovo cells, the mRNA level of p14(ARF) was not significantly changed, the cell proliferation ability was decreased by 20.6%, cell cycle was arrested by 55.7% in G0/G1 phase, and apoptosis rate was increased by 19.0%. Pokemon enhanced the oncogenesis of CRC by promoting proliferation, cell cycle progression and anti-apoptosis activity of CRC cells independently of p14(ARF)-MDM2-p53 pathway. This finding provided a novel idea for understanding and further studying the molecular mechanism of Pokemon on carcinogenesis of CRC.
Choi, Tae Gyu; Nguyen, Minh Nam; Kim, Jieun; Jo, Yong Hwa; Jang, Miran; Nguyen, Ngoc Ngo Yen; Yun, Hyeong Rok; Choe, Wonchae; Kang, Insug; Ha, Joohun; Tang, Dean G; Kim, Sung Soo
2018-06-06
Colorectal cancer (CRC) is one of the leading causes of cancer-related deaths worldwide. Chemoresistance is a major problem for effective therapy in CRC. Here, we investigated the mechanism by which peptidylprolyl isomerase B (PPIB; cyclophilin B, CypB) regulates chemoresistance in CRC. We found that CypB is a novel wild type p53 (p53WT)-inducible gene but a negative regulator of p53WT in response to oxaliplatin treatment. Overexpression of CypB shortens the half-life of p53WT and inhibits oxaliplatin-induced apoptosis in CRC cells, whereas knockdown of CypB lengthens the half-life of p53WT and stimulates p53WT dependent apoptosis. CypB interacts directly with MDM2, and enhances MDM2-dependent p53WT ubiquitination and degradation. Furthermore, we firmly validated using bioinformatics analyses that overexpression of CypB is associated with poor prognosis in CRC progression and chemoresistance. Hence, we suggest a novel mechanism of chemoresistance caused by overexpressed CypB, which may help to develop new anti-cancer drugs. We also propose that CypB may be utilized as a predictive biomarker in CRC patients. This article is protected by copyright. All rights reserved. This article is protected by copyright. All rights reserved.
International Nuclear Information System (INIS)
Liao, W.-T.; Yu, H.-S.; Lin Pinpin; Chang, Louis W.
2010-01-01
Epidemiological evidence indicated that residents, especially cigarette smokers, in arseniasis areas had significantly higher lung cancer risk than those living in non-arseniasis areas. Thus an interaction between arsenite and cigarette smoking in lung carcinogenesis was suspected. In the present study, we investigated the interactions of a tobacco-specific carcinogen 4- (methylnitrosamino)-1-(3-pyridyl)-1-butanone (nicotine-derived nitrosamine ketone, NNK) and arsenite on lung cell transformation. BEAS-2B, an immortalized human lung epithelial cell line, was selected to test the centrosomal abnormalities and colony formation by NNK and arsenite. We found that NNK, alone, could enhance BEAS-2B cell growth at 1-5 μM. Under NNK exposure, arsenite was able to increase centrosomal abnormality as compared with NNK or arsenite treatment alone. NNK treatment could also reduce arsenite-induced G2/M cell cycle arrest and apoptosis, these cellular effects were found to be correlated with p53 dysfunction. Increased anchorage-independent growth (colony formation) of BEAS-2B cells cotreated with NNK and arsenite was also observed in soft agar. Our present investigation demonstrated that NNK could provide a p53 compromised status. Arsenite would act specifically on this p53 compromised status to induce centrosomal abnormality and colony formation. These findings provided strong evidence on the carcinogenic promotional role of arsenite under tobacco-specific carcinogen co-exposure.
Nuclear accumulation and activation of p53 in embryonic stem cells after DNA damage.
Solozobova, Valeriya; Rolletschek, Alexandra; Blattner, Christine
2009-06-17
P53 is a key tumor suppressor protein. In response to DNA damage, p53 accumulates to high levels in differentiated cells and activates target genes that initiate cell cycle arrest and apoptosis. Since stem cells provide the proliferative cell pool within organisms, an efficient DNA damage response is crucial. In proliferating embryonic stem cells, p53 is localized predominantly in the cytoplasm. DNA damage-induced nuclear accumulation of p53 in embryonic stem cells activates transcription of the target genes mdm2, p21, puma and noxa. We observed bi-phasic kinetics for nuclear accumulation of p53 after ionizing radiation. During the first wave of nuclear accumulation, p53 levels were increased and the p53 target genes mdm2, p21 and puma were transcribed. Transcription of noxa correlated with the second wave of nuclear accumulation. Transcriptional activation of p53 target genes resulted in an increased amount of proteins with the exception of p21. While p21 transcripts were efficiently translated in 3T3 cells, we failed to see an increase in p21 protein levels after IR in embryonal stem cells. In embryonic stem cells where (anti-proliferative) p53 activity is not necessary, or even unfavorable, p53 is retained in the cytoplasm and prevented from activating its target genes. However, if its activity is beneficial or required, p53 is allowed to accumulate in the nucleus and activates its target genes, even in embryonic stem cells.
International Nuclear Information System (INIS)
Ohyama, Harumi
1995-01-01
Apoptosis is an active process of gene-directed cellular self-destruction that can be induced in many cell types via numerous physiological and pathological stimuli. We found that interphasedeath of thymocytes is a typical apoptosis showing the characteristic features of apoptosis including cell shrinkage, chromatin condensation and DNA degradation. Moderate dose of radiation induces extensive apoptosis in rapidly proliferating cell population such as the epithelium of intestinal crypt. Recent reports indicate that the ultimate form of radiation-induced mitotic death in several cells is also apoptosis. One of the hallmarks of apoptosis is the enzymatic internucleosomal degradation of chromatin DNA. We identified an endonuclease responsible for the radiation-induced DNA degradation in rat thymocytes. The death-sparing effects of interrupting RNA and protein synthesis suggested a cell genetic program for apoptosis. Apoptosis of thymocytes initiated by DNA damage, such as radiation and radio mimetic substance, absolutely requires the protein of p53 cancer suppresser gene. The cell death induced by glucocorticoid, or aging, has no such requirement. Expression of oncogene bcl-2 rescues cells from the apoptosis. Massive apoptosis in radiosensitive cells induced by higher dose radiation may be fatal. It is suggested that selective apoptotic elimination of cells would play an important role for protection against carcinogenesis and malformation through removal of cells with unrepaired radiation-induced DNA damages. Data to evaluate the significance of apoptosis in the radiation risk are still poor. Further research should be done in order to clarify the roles of the cell death on the acute and late effects of irradiation. (author)
Goodson, Michael S; Crookes-Goodson, Wendy J; Kimbell, Jennifer R; McFall-Ngai, Margaret J
2006-08-01
Within hours of hatching, the squid Euprymna scolopes forms a specific light organ symbiosis with the marine luminous bacterium Vibrio fischeri. Interactions with the symbiont result in the loss of a complex ciliated epithelium dedicated to promoting colonization of host tissue, and some or all of this loss is due to widespread, symbiont-induced apoptosis. Members of the p53 family, including p53, p63, and p73, are conserved across broad phyletic lines and p63 is thought to be the ancestral gene. These proteins have been shown to induce apoptosis and developmental morphogenesis. In this study, we characterized p63-like transcripts from mRNA isolated from the symbiotic tissues of E. scolopes and described their role in symbiont-induced morphogenesis. Using degenerate RT-PCR and RACE PCR, we identified two p63-like transcripts encoding proteins of 431 and 567 amino acids. These transcripts shared identical nucleotides where they overlapped, suggesting that they are splice variants of the same gene. Immunocytochemistry and Western blots using an antibody specific for E. scolopes suggested that the p53 family members are activated in cells of the symbiont-harvesting structures of the symbiotic light organ. We propose that once the symbiosis is initiated, a symbiont-induced signal activates p53 family members, inducing apoptosis and developmental morphogenesis of the light organ.
Romeo, Megan; Hutchison, Tetiana; Malu, Aditi; White, Averi; Kim, Janice; Gardner, Rachel; Smith, Katie; Nelson, Katherine; Bergeson, Rachel; McKee, Ryan; Harrod, Carolyn; Ratner, Lee; Lüscher, Bernhard; Martinez, Ernest; Harrod, Robert
2018-05-01
In normal cells, aberrant oncogene expression leads to the accumulation of cytotoxic metabolites, including reactive oxygen species (ROS), which can cause oxidative DNA-damage and apoptosis as an intrinsic barrier against neoplastic disease. The c-Myc oncoprotein is overexpressed in many lymphoid cancers due to c-myc gene amplification and/or 8q24 chromosomal translocations. Intriguingly, p53 is a downstream target of c-Myc and hematological malignancies, such as adult T-cell leukemia/lymphoma (ATL), frequently contain wildtype p53 and c-Myc overexpression. We therefore hypothesized that p53-regulated pro-survival signals may thwart the cell's metabolic anticancer defenses to support oncogene-activation in lymphoid cancers. Here we show that the Tp53-induced glycolysis and apoptosis regulator (TIGAR) promotes c-myc oncogene-activation by the human T-cell leukemia virus type-1 (HTLV-1) latency-maintenance factor p30 II , associated with c-Myc deregulation in ATL clinical isolates. TIGAR prevents the intracellular accumulation of c-Myc-induced ROS and inhibits oncogene-induced cellular senescence in ATL, acute lymphoblastic leukemia, and multiple myeloma cells with elevated c-Myc expression. Our results allude to a pivotal role for p53-regulated antioxidant signals as mediators of c-Myc oncogenic functions in viral and non-viral lymphoid tumors. Copyright © 2018 Elsevier Inc. All rights reserved.
POSTRANSLATIONAL MODIFICATIONS OF P53: UPSTREAM SIGNALING PATHWAYS.
Energy Technology Data Exchange (ETDEWEB)
ANDERSON,C.W.APPELLA,E.
2003-10-23
The p53 tumor suppressor is a tetrameric transcription factor that is posttranslational modified at >20 different sites by phosphorylation, acetylation, or sumoylation in response to various cellular stress conditions. Specific posttranslational modifications, or groups of modifications, that result from the activation of different stress-induced signaling pathways are thought to modulate p53 activity to regulate cell fate by inducing cell cycle arrest, apoptosis, or cellular senescence. Here we review recent progress in characterizing the upstream signaling pathways whose activation in response to various genotoxic and non-genotoxic stresses result in p53 posttranslational modifications.
Effect of pH on radiation-induced apoptosis
International Nuclear Information System (INIS)
Chang, W. Song; Park, Heon J.; Lyons, John C.; Auger, Elizabeth A.; Lee, Hyung-Sik
1996-01-01
Purpose/Objective: The effect of environmental pH on the radiation-induced apoptosis in tumor cells in vitro was investigated. Materials and Methods: SCK mammary adenocarcinoma cells of A/J mice were irradiated with γ-rays using a 137 Cs irradiator and incubated in media of different pHs. After incubation at 37 degree sign C for 24-120 hrs., the extent of apoptosis was determined using agarose gel electrophoresis of DNA, in situ TUNEL staining, flow cytometry, and release of 3 H from 3 H-thymidine labeled cells. The membrane integrity, using the trypan blue exclusion method, and the clonogenicity of the cells were also determined. Results: Irradiation with 2-12 Gy of γ-rays induced apoptosis in pH 7.5 medium within 48 hrs. The radiation-induced apoptosis progressively declined as the medium pH was lowered so that little apoptosis occurred in 48 hrs. after irradiation with 12 Gy in pH 6.6 medium. However, when the cells were irradiated and incubated for 48 hrs. in pH 6.6 medium and then medium was replaced with pH 7.5 medium, apoptosis promptly occurred. Apoptosis also occurred even in pH 6.6 medium when the cells were irradiated and maintained in pH 7.5 medium for 8 hrs. or longer post-irradiation before incubation in pH 6.6 medium. Conclusion: An acidic environment markedly suppresses radiation-induced apoptosis probably by suppressing the expression of initial signals responsible for irradiation-induced apoptosis. Indications are that the signals persist in an acidic environment and trigger apoptosis when the environmental acidity is eased. Our results suggest that the acidic environment in human tumors may inhibit the apoptosis after irradiation. However, apoptosis may be triggered when reoxygenation occurs after irradiation, and thus, the intratumor environment becomes less acidic after irradiation. Not only the change in pO 2 but the change in pH during the course of fractionated radiotherapy may greatly influence the outcome of the treatment
International Nuclear Information System (INIS)
Wei Tang; Powell, Simon N.
1996-01-01
Purpose: The tumor suppressor gene p53 can mediate cell cycle arrest or apoptosis in response to DNA damage. Accumulating evidence suggests that it may also directly or indirectly influence the DNA repair machinery. In the present study, we investigated whether p53, induced by DNA damage, could enhance the rejoining of double-strand DNA breaks. Materials and Methods: DNA double-strand breaks (dsb) were made by restriction enzyme digestion of a plasmid, between a promoter and a 'reporter' gene: luciferase (LUC) or chloramphenicol acetyl-transferase (CAT). Linear or circular plasmid DNA (LUC or CAT) was co-transfected with circular β-Gal plasmid (to normalize for uptake) into mouse embryonic fibroblasts genetically matched to be (+/+) or (-/-) for p53. Their ability to rejoin linearized plasmid was measured by the luciferase or CAT activity detected in rescued plasmids. The activity detected in cells transfected with linear plasmid was scored relative to the activity detected in cells transfected with circular plasmid. Results: Ionizing radiation (IR, 2 Gy) enhanced the dsb repair activity in wild type p53 cells; however, p53 null cells lose this effect, indicating that the enhancement of dsb repair was p53-dependent. REF cells with dominant-negative mutant p53 showed a similar induction compared with the parental REF cells with wild-type p53. This ala-143 mutant p53 prevents cell cycle arrest and transactivation of p21 WAF1/cip1) following IR, indicating that the p53-dependent enhancement of DNA repair is distinct from transactivation. Immortalized murine embryonic fibroblasts, 10(1)VasK1 cells, which express p53 cDNA encoding a temperature-sensitive mutant in the DNA sequence specific binding domain (ala135 to val135) with an alternatively spliced C-terminal domain (ASp53: amino-acids 360-381) and, 10(1)Val5 cells, which express the normal spliced p53 (NSp53) with the same temperature-sensitive mutant were compared. It was found that 10(1)VasK1 cells showed no DNA
International Nuclear Information System (INIS)
Yu, Zhendong; Wang, Hao; Zhang, Libin; Tang, Aifa; Zhai, Qinna; Wen, Jianxiang; Yao, Li; Li, Pengfei
2009-01-01
CDglyTK fusion suicide gene has been well characterized to effectively kill tumor cells. However, the exact mechanism and downstream target genes are not fully understood. In our study, we found that CDglyTK/prodrug treatment works more efficiently in p53 wild-type (HONE1) cells than in p53 mutant (CNE1) cells. We then used adenovirus-mediated gene delivery system to either knockdown or overexpress p53 and its target genes in these cells. Consistent results showed that both p53-PUMA/NOXA/Bcl2-Bax and p53-p21 pathways contribute to the CDglyTK induced tumor cell suppression. Our work for the first time addressed the role of p53 related genes in the CDglyTK/prodrug system.
Energy Technology Data Exchange (ETDEWEB)
Yu, Zhendong, E-mail: zdyu@hotmail.com [Department of Clinical laboratory, Peking University Shenzhen Hospital, Guangdong (China); Wang, Hao [Department of pathology, The Chinese University of Hong Kong, Hong Kong (China); Zhang, Libin; Tang, Aifa; Zhai, Qinna; Wen, Jianxiang; Yao, Li [Department of Clinical laboratory, Peking University Shenzhen Hospital, Guangdong (China); Li, Pengfei, E-mail: lipengfei@cuhk.edu.hk [Department of pathology, The Chinese University of Hong Kong, Hong Kong (China)
2009-09-04
CDglyTK fusion suicide gene has been well characterized to effectively kill tumor cells. However, the exact mechanism and downstream target genes are not fully understood. In our study, we found that CDglyTK/prodrug treatment works more efficiently in p53 wild-type (HONE1) cells than in p53 mutant (CNE1) cells. We then used adenovirus-mediated gene delivery system to either knockdown or overexpress p53 and its target genes in these cells. Consistent results showed that both p53-PUMA/NOXA/Bcl2-Bax and p53-p21 pathways contribute to the CDglyTK induced tumor cell suppression. Our work for the first time addressed the role of p53 related genes in the CDglyTK/prodrug system.
Starvation-induced activation of ATM/Chk2/p53 signaling sensitizes cancer cells to cisplatin
Directory of Open Access Journals (Sweden)
Shi Yandong
2012-12-01
Full Text Available Abstract Background Optimizing the safety and efficacy of standard chemotherapeutic agents such as cisplatin (CDDP is of clinical relevance. Serum starvation in vitro and short-term food starvation in vivo both stress cells by the sudden depletion of paracrine growth stimulation. Methods The effects of serum starvation on CDDP toxicity were investigated in normal and cancer cells by assessing proliferation, cell cycle distribution and activation of DNA-damage response and of AMPK, and were compared to effects observed in cells grown in serum-containing medium. The effects of short-term food starvation on CDDP chemotherapy were assessed in xenografts-bearing mice and were compared to effects on tumor growth and/or regression determined in mice with no diet alteration. Results We observed that serum starvation in vitro sensitizes cancer cells to CDDP while protecting normal cells. In detail, in normal cells, serum starvation resulted in a complete arrest of cellular proliferation, i.e. depletion of BrdU-incorporation during S-phase and accumulation of the cells in the G0/G1-phase of the cell cycle. Further analysis revealed that proliferation arrest in normal cells is due to p53/p21 activation, which is AMPK-dependent and ATM-independent. In cancer cells, serum starvation also decreased the fraction of S-phase cells but to a minor extent. In contrast to normal cells, serum starvation-induced p53 activation in cancer cells is both AMPK- and ATM-dependent. Combination of CDDP with serum starvation in vitro increased the activation of ATM/Chk2/p53 signaling pathway compared to either treatment alone resulting in an enhanced sensitization of cancer cells to CDDP. Finally, short-term food starvation dramatically increased the sensitivity of human tumor xenografts to cisplatin as indicated not only by a significant growth delay, but also by the induction of complete remission in 60% of the animals bearing mesothelioma xenografts, and in 40% of the
Energy Technology Data Exchange (ETDEWEB)
Schwartz, Jeffrey L. E-mail: jschwart@u.washington.edu; Tamura, Yasuko; Jordan, Robert; Grierson, John R.; Krohn, Kenneth A
2004-05-01
The use of thymidine (TdR) and thymidine analogs such as 3'-deoxy-3'-fluorothymidine (FLT) as positron emission tomography (PET)-based tracers of tumor proliferation rate is based on the hypothesis that measurement of uptake of these nucleosides, a function primarily of thymidine kinase-1 (TK{sub 1}) activity, provides an accurate measure of cell proliferation in tumors. Tumor growth is influenced by many factors including the oxygen concentration within tumors and whether tumor cells have been exposed to cytotoxic therapies. The p53 gene plays an important role in regulating growth under both of these conditions. The goal of this study was to investigate the influence of p53 activation on cell growth, TK{sub 1} activity, and FLT uptake. To accomplish this, TK{sub 1} activity, S phase fraction, and the uptake of FLT were determined in plateau-phase and exponentially growing cultures of an isogenic pair of human tumor cell lines in which p53 expression was normal or inactivated by human papilloma virus type 16 E6 expression. Ionizing radiation exposure was used to stimulate p53 activity and to induce alterations in cell cycle progression. We found that exposure of cells to ionizing radiation induced dose-dependent changes in cell cycle progression in both cell lines. The relationship between S phase percentage, TK{sub 1} activity, and FLT uptake were essentially unchanged in the p53-normal cell line. In contrast, TK{sub 1} activity and FLT uptake remained high in the p53-deficient variant even when S phase percentage was low due to a p53-dependent G2 arrest. We conclude that a functional p53 response is required to maintain the normal relationship between TK1 activity and S phase percentage following radiation exposure.
Sex-specific differences in fetal germ cell apoptosis induced by ionizing radiation
International Nuclear Information System (INIS)
Guerquin, M.J.; Duquenne, C.; Coffigny, H.; Rouiller-Fabre, V.; Lambrot, R.; Habert, R.; Livera, G.; Guerquin, M.J.; Duquenne, C.; Coffigny, H.; Rouiller-Fabre, V.; Lambrot, R.; Habert, R.; Livera, G.; Guerquin, M.J.; Duquenne, C.; Coffigny, H.; Rouiller-Fabre, V.; Lambrot, R.; Habert, R.; Livera, G.; Bakalska, M.; Frydman, R.; Frydman, R.; Frydman, R.
2009-01-01
Background: We have previously shown that male human fetal germ cells are highly radiosensitive and that their death depends on p53 activation. Male germ cell apoptosis was initiated with doses as low as 0.1 Gy and was prevented by pifithrin α, a p53 inhibitor. In this study, we investigated the radiosensitivity of early female and male fetal proliferating germ cells. Methods and results: Both male and female fetal germ cells displayed a similar number of γH2AX foci in response to ionizing radiation (IR). In organ culture of human fetal ovaries, the germ cells underwent apoptosis only when exposed to high doses of IR (1.5 Gy and above). Accumulation of p53 was detected in irradiated male human fetal germ cells but not in female ones. Inhibition of p53 with pifithrin α did not affect oogonia apoptosis following irradiation. IR induced apoptosis similarly in mouse fetal ovaries in organ culture and in vivo during oogonial proliferation. Germ cell survival in testes from p53 knockout or p63 knockout mice exposed to IR was better than wild-type, whereas female germ cell survival was unaffected by p53 or p63 knockout. Conclusions: These findings show that pre-meiotic male and female fetal germ cells behave differently in response to a genotoxic stress-irradiation with oogonia being less sensitive and undergoing p53-independent apoptosis. (authors)
Sex-specific differences in fetal germ cell apoptosis induced by ionizing radiation
Energy Technology Data Exchange (ETDEWEB)
Guerquin, M.J.; Duquenne, C.; Coffigny, H.; Rouiller-Fabre, V.; Lambrot, R.; Habert, R.; Livera, G. [CEA, DSV/DRR/SEGG/LDRG, Laboratory of Differentiation and Radiobiology of the Gonads, Unit of Gametogenesis and Genotoxicity, F-92265 Fontenay aux Roses (France); Guerquin, M.J.; Duquenne, C.; Coffigny, H.; Rouiller-Fabre, V.; Lambrot, R.; Habert, R.; Livera, G. [Univ. Paris 7-Denis Diderot, UFR of Biology, UMR-S 566, F-92265 Fontenay aux Roses (France); Guerquin, M.J.; Duquenne, C.; Coffigny, H.; Rouiller-Fabre, V.; Lambrot, R.; Habert, R.; Livera, G. [INSERM, U566, F-92265 Fontenay aux Roses (France); Bakalska, M. [Institute of Experimental Morphology and Anthropology, Bulgarian Academy of Sciences, Sofia (Bulgaria); Frydman, R. [Univ Paris-Sud, Clamart F-92140 (France); Frydman, R. [AP-HP, Service de Gynecologie-Obstetrique et Medecine de la Reproduction, Hopital Antoine Beclere, Clamart F-92141 (France); Frydman, R. [INSERM, U782, Clamart F-92140 (France)
2009-07-01
Background: We have previously shown that male human fetal germ cells are highly radiosensitive and that their death depends on p53 activation. Male germ cell apoptosis was initiated with doses as low as 0.1 Gy and was prevented by pifithrin {alpha}, a p53 inhibitor. In this study, we investigated the radiosensitivity of early female and male fetal proliferating germ cells. Methods and results: Both male and female fetal germ cells displayed a similar number of {gamma}H2AX foci in response to ionizing radiation (IR). In organ culture of human fetal ovaries, the germ cells underwent apoptosis only when exposed to high doses of IR (1.5 Gy and above). Accumulation of p53 was detected in irradiated male human fetal germ cells but not in female ones. Inhibition of p53 with pifithrin {alpha} did not affect oogonia apoptosis following irradiation. IR induced apoptosis similarly in mouse fetal ovaries in organ culture and in vivo during oogonial proliferation. Germ cell survival in testes from p53 knockout or p63 knockout mice exposed to IR was better than wild-type, whereas female germ cell survival was unaffected by p53 or p63 knockout. Conclusions: These findings show that pre-meiotic male and female fetal germ cells behave differently in response to a genotoxic stress-irradiation with oogonia being less sensitive and undergoing p53-independent apoptosis. (authors)
International Nuclear Information System (INIS)
Oga, Masaru; Koshikawa, Nobuko; Takenaga, Keizo; Iwadate, Yasuo; Nojima, Kumie
2006-01-01
In this study we have started to investigate the anti-tumor effect of the combination of heavy-ion radiotherapy, inducing p53-independent apoptosis, and p53-gene therapy, inducing p53-dependent apoptosis for glioma. To enhance the p53-dependent apoptosis, we chose the strategy to utilize the heavy-ion irradiation itself as a ''trigger'' by using radio-sensitizing E 9ns-2 /cytomegalovirus (CMV) chimeric promoter (Scott et al: 2003) in p53-gene therapy. Our study in the first year, however, suggested the uselessness of E 9ns-2 /CMV chimeric promoter. Then we applied E 9ns-2 /Epo5/CMV-radio and hypoxia-sensitizing chimeric promoter to amplify p53 gene exopression. P53 gene with E 9ns2 /Epo5/CMV chimeric promoter was transfected in p53-mutant U373MG human glioma cell-line and the transfected-cell bulk was irradiated at dose of 1 Gy of high linear energy transfer (LET)-carbon ion beam or low-LET X-ray under various hypoxic conditions. The result suggested the possible role of 1 Gy of high LET-carbon ion beam as a ''useful trigger'' to enhance a selective anti-tumor effect toward glioma under hypoxic condition through amplification of p53 gene expression. (author)
Min, Kyoung-Jin; Nam, Ju-Ock; Kwon, Taeg Kyu
2017-08-02
Fisetin is a natural compound found in fruits and vegetables such as strawberries, apples, cucumbers, and onions. Since fisetin can elicit anti-cancer effects, including anti-proliferation and anti-migration, we investigated whether fisetin induced apoptosis in human renal carcinoma (Caki) cells. Fisetin markedly induced sub-G1 population and cleavage of poly (ADP-ribose) polymerase (PARP), which is a marker of apoptosis, and increased caspase activation. We found that pan-caspase inhibitor (z-VAD-fmk) inhibited fisetin-induced apoptosis. In addition, fisetin induced death receptor 5 (DR5) expression at the transcriptional level, and down-regulation of DR5 by siRNA blocked fisetin-induced apoptosis. Furthermore, fisetin induced p53 protein expression through up-regulation of protein stability, whereas down-regulation of p53 by siRNA markedly inhibited fisetin-induced DR5 expression. In contrast, fisetin induced up-regulation of CHOP expression and reactive oxygen species production, which had no effect on fisetin-induced apoptosis. Taken together, our study demonstrates that fisetin induced apoptosis through p53 mediated up-regulation of DR5 expression at the transcriptional level.
Michaelis, M; Rothweiler, F; Agha, B; Barth, S; Voges, Y; Löschmann, N; von Deimling, A; Breitling, R; Doerr, H Wilhelm; Rödel, F; Speidel, D; Cinatl, J
2012-04-05
Adaptation of wild-type p53 expressing UKF-NB-3 cancer cells to the murine double minute 2 inhibitor nutlin-3 causes de novo p53 mutations at high frequency (13/20) and multi-drug resistance. Here, we show that the same cells respond very differently when adapted to RITA, a drug that, like nutlin-3, also disrupts the p53/Mdm2 interaction. All of the 11 UKF-NB-3 sub-lines adapted to RITA that we established retained functional wild-type p53 although RITA induced a substantial p53 response. Moreover, all RITA-adapted cell lines remained sensitive to nutlin-3, whereas only five out of 10 nutlin-3-adapted cell lines retained their sensitivity to RITA. In addition, repeated adaptation of the RITA-adapted sub-line UKF-NB-3(r)RITA(10 μM) to nutlin-3 resulted in p53 mutations. The RITA-adapted UKF-NB-3 sub-lines displayed no or less pronounced resistance to vincristine, cisplatin, and irradiation than nutlin-3-adapted UKF-NB-3 sub-lines. Furthermore, adaptation to RITA was associated with fewer changes at the expression level of antiapoptotic factors than observed with adaptation to nutlin-3. Transcriptomic analyses indicated the RITA-adapted sub-lines to be more similar at the gene expression level to the parental UKF-NB-3 cells than nutlin-3-adapted UKF-NB-3 sub-lines, which correlates with the observed chemotherapy and irradiation sensitivity phenotypes. In conclusion, RITA-adapted cells retain functional p53, remain sensitive to nutlin-3, and display a less pronounced resistance phenotype than nutlin-3-adapted cells.
International Nuclear Information System (INIS)
Ohnishi, T.; Asakawa, I.; Tamamoto, T.; Takahashi, A.; Ohnishi, K.
2003-01-01
The mutations of many kinds of cancer related genes have been investigated for the predictive assay against cancer therapy by the application of molecular biology. A tumor suppressor gene product of wtp53 plays important roles in cancer suppression through the induction of cell growth arrest, DNA repair or apoptosis. The p53 exerts its function by induction of downstream genes and/or interaction to various proteins. Mutations in the p53 gene (mp53) cause conformational alterations in the p53 protein, the majority of which can no longer induce expression of the downstream genes. The genetic status of p53 gene has been focused as the most important candidate among them for cancer therapy. The gene therapy of p53 has been already applied. We reported that the transfection of mp53 gene increased the radio-, thermo- and chemo-resistance, and depressed apoptosis introduced with them through bax-induction and proteolysis of PARP and caspase-3. From these results, we propose that the gene therapy of wtp53 to p53-deleted cancer cells may be very useful for cancer therapy by the combination with radiotherapy. Even in the case of mp53 cancer cells, we succeeded the restoration of mp53 to wtp53 by glycerol or C-terminal peptide of p53 as chemical chaperones. These experimental progresses might support effective cancer therapy against individual patients bearing with different p53 gene status by the use of the most suitable treatment to them in the near future
Conditional inactivation of PDCD2 induces p53 activation and cell cycle arrest
Directory of Open Access Journals (Sweden)
Celine J. Granier
2014-08-01
Full Text Available PDCD2 (programmed cell death domain 2 is a highly conserved, zinc finger MYND domain-containing protein essential for normal development in the fly, zebrafish and mouse. The molecular functions and cellular activities of PDCD2 remain unclear. In order to better understand the functions of PDCD2 in mammalian development, we have examined PDCD2 activity in mouse blastocyst embryos, as well as in mouse embryonic stem cells (ESCs and embryonic fibroblasts (MEFs. We have studied mice bearing a targeted PDCD2 locus functioning as a null allele through a splicing gene trap, or as a conditional knockout, by deletion of exon2 containing the MYND domain. Tamoxifen-induced knockout of PDCD2 in MEFs, as well as in ESCs, leads to defects in progression from the G1 to the S phase of cell cycle, associated with increased levels of p53 protein and p53 target genes. G1 prolongation in ESCs was not associated with induction of differentiation. Loss of entry into S phase of the cell cycle and marked induction of nuclear p53 were also observed in PDCD2 knockout blastocysts. These results demonstrate a unique role for PDCD2 in regulating the cell cycle and p53 activation during early embryonic development of the mouse.
Induction of B-cell lymphoma by UVB Radiation in p53 Haploinsufficient Mice
International Nuclear Information System (INIS)
Puebla-Osorio, Nahum; Miyahara, Yasuko; Coimbatore, Sreevidya; Limón-Flores, Alberto Y; Kazimi, Nasser; Ullrich, Stephen E; Zhu, Chengming
2011-01-01
The incidence of non-Hodgkin's lymphoma has increased over recent years. The exact etiology of lymphoma remains unknown. Ultraviolet light exposure has been associated with the development of internal lymphoid malignancies and some reports suggest that it may play a role in the development of lymphoma in humans. Here we describe the characterization and progression of lymphoma in p53 heterozygous mice exposed to UVB irradiation. UVB-irradiated p53 +/- mice developed enlargement of the spleen. Isolated spleen cells were transplanted into Rag deficient hosts. The UV-induced tumor cells were analyzed by flow cytometry. The tumor cells were tagged with GFP to study their metastatic potential. SKY and karyotypic analysis were carried out for the detection of chromosomal abnormalities. Functional assays included in vitro class switch recombination assay, immunoglobulin rearrangement assay, as well as cytokine profiling. UVB-exposed mice showed enlargement of the spleen and lymph nodes. Cells transplanted into Rag deficient mice developed aggressive tumors that infiltrated the lymph nodes, the spleen and the bone marrow. The tumor cells did not grow in immune competent syngeneic C57Bl/6 mice yet showed a modest growth in UV-irradiated B6 mice. Phenotypic analysis of these tumor cells revealed these cells are positive for B cell markers CD19 + , CD5 + , B220 + , IgM + and negative for T cell, NK or dendritic cell markers. The UV-induced tumor cells underwent robust in vitro immunoglobulin class switch recombination in response to lipopolysaccharide. Cytogenetic analysis revealed a t(14;19) translocation and trisomy of chromosome 6. These tumor cells secret IL-10, which can promote tumor growth and cause systemic immunosuppression. UV-irradiated p53 +/- mice developed lymphoid tumors that corresponded to a mature B cell lymphoma. Our results suggest that an indirect mechanism is involved in the development of internal tumors after chronic exposure to UV light. The
Induction of B-cell lymphoma by UVB Radiation in p53 Haploinsufficient Mice
Directory of Open Access Journals (Sweden)
Ullrich Stephen E
2011-01-01
Full Text Available Abstract Background The incidence of non-Hodgkin's lymphoma has increased over recent years. The exact etiology of lymphoma remains unknown. Ultraviolet light exposure has been associated with the development of internal lymphoid malignancies and some reports suggest that it may play a role in the development of lymphoma in humans. Here we describe the characterization and progression of lymphoma in p53 heterozygous mice exposed to UVB irradiation. Methods UVB-irradiated p53+/- mice developed enlargement of the spleen. Isolated spleen cells were transplanted into Rag deficient hosts. The UV-induced tumor cells were analyzed by flow cytometry. The tumor cells were tagged with GFP to study their metastatic potential. SKY and karyotypic analysis were carried out for the detection of chromosomal abnormalities. Functional assays included in vitro class switch recombination assay, immunoglobulin rearrangement assay, as well as cytokine profiling. Results UVB-exposed mice showed enlargement of the spleen and lymph nodes. Cells transplanted into Rag deficient mice developed aggressive tumors that infiltrated the lymph nodes, the spleen and the bone marrow. The tumor cells did not grow in immune competent syngeneic C57Bl/6 mice yet showed a modest growth in UV-irradiated B6 mice. Phenotypic analysis of these tumor cells revealed these cells are positive for B cell markers CD19+, CD5+, B220+, IgM+ and negative for T cell, NK or dendritic cell markers. The UV-induced tumor cells underwent robust in vitro immunoglobulin class switch recombination in response to lipopolysaccharide. Cytogenetic analysis revealed a t(14;19 translocation and trisomy of chromosome 6. These tumor cells secret IL-10, which can promote tumor growth and cause systemic immunosuppression. Conclusion UV-irradiated p53+/- mice developed lymphoid tumors that corresponded to a mature B cell lymphoma. Our results suggest that an indirect mechanism is involved in the development of internal
Zhu, Hong; Abulimiti, Muyasha; Liu, Huan; Su, Xiang-Jiang; Liu, Cai-Hong; Pei, Hai-Ping
2015-09-01
Radiation therapy is the most widely used treatment for patients with cervical cancer. Recent studies have shown that endoplasmic reticulum (ER) stress induces apoptosis and sensitizes tumor cells to radiotherapy, which reportedly induces ER stress in cells. Classical key tumor suppressor p53 is involved in the response to a variety of cellular stresses, including those incurred by ionizing irradiation. A recent study demonstrated that small-molecule RITA (reactivation of p53 and induction of tumor cell apoptosis) increased the radiosensitivity of tumor cells expressing mutant p53 (mtp53). In the present study, we explored the effects and the underlying mechanisms of RITA in regards to the radiosensitivity and ER stress in mtp53-expressing human cervix cancer cells. Treatment with 1 µM of RITA for 24 h before irradiation markedly decreased survival and increased apoptosis in C-33A and HT-3 cells; the effects were not significantly altered by knockdown of p53. In the irradiated C-33A and HT-3 cells, RITA significantly increased the expression of IRE1α, the spliced XBP1 mRNA level, as well as apoptosis; the effects were abolished by knockdown of IRE1α. Transcriptional pulse-chase assays revealed that RITA significantly increased the stability of IRE1α mRNA in the irradiated C-33A and HT-3 cells. In contrast, the same RITA treatment did not show any significant effect on sham-irradiated cells. In conclusion, the present study provides initial evidence that RITA upregulates the expression level of IRE1α by increasing the stability of IRE1α mRNA in irradiated mtp53-expressing cervical cancer cells; the effect leads to enhanced IRE1α/XBP1 ER stress signaling and increased apoptosis in the cells. The present study offers novel insight into the pharmacological potential of RITA in the radiotherapy for cervical cancer.
High and Low LET Radiation Differentially Induce Normal Tissue Damage Signals
International Nuclear Information System (INIS)
Niemantsverdriet, Maarten; Goethem, Marc-Jan van; Bron, Reinier; Hogewerf, Wytse; Brandenburg, Sytze; Langendijk, Johannes A.; Luijk, Peter van; Coppes, Robert P.
2012-01-01
Purpose: Radiotherapy using high linear energy transfer (LET) radiation is aimed at efficiently killing tumor cells while minimizing dose (biological effective) to normal tissues to prevent toxicity. It is well established that high LET radiation results in lower cell survival per absorbed dose than low LET radiation. However, whether various mechanisms involved in the development of normal tissue damage may be regulated differentially is not known. Therefore the aim of this study was to investigate whether two actions related to normal tissue toxicity, p53-induced apoptosis and expression of the profibrotic gene PAI-1 (plasminogen activator inhibitor 1), are differentially induced by high and low LET radiation. Methods and Materials: Cells were irradiated with high LET carbon ions or low LET photons. Cell survival assays were performed, profibrotic PAI-1 expression was monitored by quantitative polymerase chain reaction, and apoptosis was assayed by annexin V staining. Activation of p53 by phosphorylation at serine 315 and serine 37 was monitored by Western blotting. Transfections of plasmids expressing p53 mutated at serines 315 and 37 were used to test the requirement of these residues for apoptosis and expression of PAI-1. Results: As expected, cell survival was lower and induction of apoptosis was higher in high -LET irradiated cells. Interestingly, induction of the profibrotic PAI-1 gene was similar with high and low LET radiation. In agreement with this finding, phosphorylation of p53 at serine 315 involved in PAI-1 expression was similar with high and low LET radiation, whereas phosphorylation of p53 at serine 37, involved in apoptosis induction, was much higher after high LET irradiation. Conclusions: Our results indicate that diverse mechanisms involved in the development of normal tissue damage may be differentially affected by high and low LET radiation. This may have consequences for the development and manifestation of normal tissue damage.
Nuclear accumulation and activation of p53 in embryonic stem cells after DNA damage
Directory of Open Access Journals (Sweden)
Rolletschek Alexandra
2009-06-01
Full Text Available Abstract Background P53 is a key tumor suppressor protein. In response to DNA damage, p53 accumulates to high levels in differentiated cells and activates target genes that initiate cell cycle arrest and apoptosis. Since stem cells provide the proliferative cell pool within organisms, an efficient DNA damage response is crucial. Results In proliferating embryonic stem cells, p53 is localized predominantly in the cytoplasm. DNA damage-induced nuclear accumulation of p53 in embryonic stem cells activates transcription of the target genes mdm2, p21, puma and noxa. We observed bi-phasic kinetics for nuclear accumulation of p53 after ionizing radiation. During the first wave of nuclear accumulation, p53 levels were increased and the p53 target genes mdm2, p21 and puma were transcribed. Transcription of noxa correlated with the second wave of nuclear accumulation. Transcriptional activation of p53 target genes resulted in an increased amount of proteins with the exception of p21. While p21 transcripts were efficiently translated in 3T3 cells, we failed to see an increase in p21 protein levels after IR in embryonal stem cells. Conclusion In embryonic stem cells where (anti-proliferative p53 activity is not necessary, or even unfavorable, p53 is retained in the cytoplasm and prevented from activating its target genes. However, if its activity is beneficial or required, p53 is allowed to accumulate in the nucleus and activates its target genes, even in embryonic stem cells.
Radioresistance of human glioma spheroids and expression of HSP70, p53 and EGFr
International Nuclear Information System (INIS)
Fedrigo, Carlos A; Rocha, Adriana B da; Grivicich, Ivana; Schunemann, Daniel P; Chemale, Ivan M; Santos, Daiane dos; Jacovas, Thais; Boschetti, Patryck S; Jotz, Geraldo P; Filho, Aroldo Braga
2011-01-01
Radiation therapy is routinely prescribed for high-grade malignant gliomas. However, the efficacy of this therapeutic modality is often limited by the occurrence of radioresistance, reflected as a diminished susceptibility of the irradiated cells to undergo cell death. Thus, cells have evolved an elegant system in response to ionizing radiation induced DNA damage, where p53, Hsp70 and/or EGFr may play an important role in the process. In the present study, we investigated whether the content of p53, Hsp70 and EGFr are associated to glioblastoma (GBM) cell radioresistance. Spheroids from U-87MG and MO59J cell lines as well as spheroids derived from primary culture of tumor tissue of one GBM patient (UGBM1) were irradiated (5, 10 and 20 Gy), their relative radioresistance were established and the p53, Hsp70 and EGFr contents were immunohistochemically determined. Moreover, we investigated whether EGFr-phospho-Akt and EGFr-MEK-ERK pathways can induce GBM radioresistance using inhibitors of activation of ERK (PD098059) and Akt (wortmannin). At 5 Gy irradiation UGBM1 and U-87MG spheroids showed growth inhibition whereas the MO59J spheroid was relatively radioresistant. Overall, no significant changes in p53 and Hsp70 expression were found following 5 Gy irradiation treatment in all spheroids studied. The only difference observed in Hsp70 content was the periphery distribution in MO59J spheroids. However, 5 Gy treatment induced a significant increase on the EGFr levels in MO59J spheroids. Furthermore, treatment with inhibitors of activation of ERK (PD098059) and Akt (wortmannin) leads to radiosensitization of MO59J spheroids. These results indicate that the PI3K-Akt and MEK-ERK pathways triggered by EGFr confer GBM radioresistance
Buglioni, S; D'Agnano, I; Cosimelli, M; Vasselli, S; D'Angelo, C; Tedesco, M; Zupi, G; Mottolese, M
1999-12-22
About 40% of patients with colorectal carcinoma will develop local or distant tumour recurrences. Integrated analyses of bio-pathological markers, predictive of tumour aggressiveness, may offer a more rational approach to planning adjuvant therapy. To this end, we analysed the correlation between p53 accumulation, Bcl-2 expression, DNA ploidy, cell proliferation and conventional clinico-pathological parameters by testing the prognostic significance of these variables in a series of 171 colorectal carcinoma patients with long-term follow-up. The relationships among the various bio-pathological parameters, analysed by multiple correspondence analysis, showed 2 different clinico-biological profiles. The first, characterised by p53 negativity, Bcl-2 positivity, diploidy, low percentage of cells in S-phase (%S-phase), a low Ki-67 score, is associated with Dukes' A-B stage, well differentiated tumours and lack of relapse. The second, defined by p53 positivity, Bcl-2 negativity, aneuploidy, high %S-phase and elevated Ki-67 score, correlates with Dukes' C-D stage, poorly differentiated tumours and presence of relapse. When these parameters were examined according to Kaplan-Meier's method, significantly shorter disease-free (DFS) and overall survival (OS) were also observed in patients bearing p53 positive and Bcl-2 negative tumours, in Dukes' B stage. In multivariate analysis, p53 accumulation and Bcl-2 expression emerged as independent predictors of a worse and better clinical outcome, respectively. Our results indicate that, in colorectal adenocarcinomas, a biological profile, based on the combined evaluation of p53 and Bcl-2, may be useful for identifying high risk patients to be enrolled in an adjuvant setting, mainly in an early stage of the disease. Int. J. Cancer (Pred. Oncol.) 84:545-552, 1999. Copyright 1999 Wiley-Liss, Inc.
Basic molecular biology in radiation-induced carcinogenesis
International Nuclear Information System (INIS)
Rytoemaa, T.
1992-01-01
The tumour suppressor gene p53 is 'guardian of the genome'. If a DNA molecule (each chromosome has one DNA molecule) is damaged by an external factor, such as ionizing radiation, the protein product of the p53 gene stops the cell's proliferative activity until the damage is repaired. If the repair fails, the p53 gene product normally triggers programmed death of the cell. P53 gene itself is commonly damaged by radiation (or by another DNA-damaging factor). The altered gene product fails to control the integrity of the genome, and it also prevents the guardian action of the protein which is produced by the intact allele (each cell has two p53 genes). Under these circumstances any subsequent damage to DNA, induced e.g. by a chemical, is easily 'fixed'. Potentially critical sites for an additional DNA damage are the proto-oncogens (when damaged these genes are called oncogens), which commonly act as components of the regulatory network in a cell. Permanent malfunction of the signal network may then lead to uncontrolled cell growth, resulting in a malignant clone (=cancer). This simplified molecular model seems to be the common mechanism in many (or most) human cancers. (orig.)
DEFF Research Database (Denmark)
Xu-Monette, Zijun Y; Zhang, Shanxiang; Li, Xin
2016-01-01
with a pan-p63-monoclonal antibody and correlated it with other clinicopathologic factors and clinical outcomes. p63 expression was observed in 42.5% of DLBCL, did not correlate with p53 levels, but correlated with p21, MDM2, p16INK4A, Ki-67, Bcl-6, IRF4/MUM-1 and CD30 expression, REL gains, and BCL6...... was likely due to the association of p63 expression with high-risk IPI, and potential presence of ∆Np63 isoform in TP63 rearranged patients (a mere speculation). Gene expression profiling suggested that p63 has both overlapping and distinct functions compared with p53, and that p63 and mutated p53 antagonize...
Bioluminescence Detection of Cells Having Stabilized p53 in Response to a Genotoxic Event
Directory of Open Access Journals (Sweden)
Alnawaz Rehemtulla
2004-01-01
Full Text Available Inactivation of p53 is one of the most frequent molecular events in neoplastic transformation. Approximately 60% of all human tumors have mutations in both p53 alleles. Wild-type p53 activity is regulated in large part by the proteosome-dependent degradation of p53, resulting in a short p53 half-life in unstressed and untransformed cells. Activation of p53 by a variety of stimuli, including DNA damage induced by genotoxic drugs or radiation, is accomplished by stabilization of wild-type p53. The stabilized and active p53 can result in either cell-cycle arrest or apoptosis. Surprisingly, the majority of tumor-associated, inactivating p53 mutations also result in p53 accumulation. Thus, constitutive elevation of p53 levels in cells is a reliable measure of p53 inactivation, whereas transiently increased p53 levels reflect a recent genotoxic stress. In order to facilitate noninvasive imaging of p53 accumulation, we here describe the construction of a p53-luciferase fusion protein. Induction of DNA damage in cells expressing the fusion protein resulted in a time-dependent accumulation of the fusion that was noninvasively detected using bioluminescence imaging and validated by Western blot analysis. The p53-Luc protein retains p53 function because its expression in HCT116 cells lacking functional p53 resulted in activation of p21 expression as well as induction of apoptosis in response to a DNA damaging event. Employed in a transgenic animal model, the proposed p53-reporter fusion protein will be useful for studying p53 activation in response to exposure to DNA-damaging carcinogenic agents. It could also be used to study p53 stabilization as a result of inactivating p53 mutations. Such studies will further our understanding of p53's role as the “guardian of the genome” and its function in tumorigenesis.
p53 represses autophagy in a cell cycle-dependent fashion.
Tasdemir, Ezgi; Maiuri, Maria Chiara; Orhon, Idil; Kepp, Oliver; Morselli, Eugenia; Criollo, Alfredo; Kroemer, Guido
2008-10-01
Autophagy is one of the principal mechanisms of cellular defense against nutrient depletion and damage to cytoplasmic organelles. When p53 is inhibited by a pharmacological antagonist (cyclic pifithrin-alpha), depleted by a specific small interfering RNA (siRNA) or deleted by homologous recombination, multiple signs of autophagy are induced. Here, we show by epistatic analysis that p53 inhibition results in a maximum level of autophagy that cannot be further enhanced by a variety of different autophagy inducers including lithium, tunicamycin-induced stress of the endoplasmic reticulum (ER) or inhibition of Bcl-2 and Bcl-X(L) with the BH3 mimetic ABT737. Chemical inducers of autophagy (including rapamycin, lithium, tunicamycin and ABT737) induced rapid depletion of the p53 protein. The absence or the inhibition of p53 caused autophagy mostly in the G(1) phase, less so in the S phase and spares the G(2)/M phase of the cell cycle. The possible pathophysiological implications of these findings are discussed.
International Nuclear Information System (INIS)
Guo Jianping; Wang Yongli; Wei Jinping; Yang Zhongtian; Liu Chunhui
2012-01-01
Study of compatibility of oligo-chitosan and ginkgo bilobal polyprenol (GP) influences on micronuclear rate and p53, gadd45 protein expression of radiated mice. Survival rate and survival time of 30-day-time of radiated mice was studied with the mixture of compatibility of oligo-chitosan and different density of GP. High survival rate of mixture density was screening. Another study on this mixture density was about micronuclear rates of marrow and p53, gadd45 protein of spleen after mice were radiated 12 h. The mixture of 300 mg/kg oligo-chitosan and 5 mg/kg GP could increase remarkably the survival rate and survival time of 30-day-time of radiated mice and degrade micronuclear rates and p53, gadd45 protein expression. Compatibility of oligo-chitosan and GP effectively raise the survival rate of radiated mice. It could proved initially that the mixture has the function of radiation protection. (authors)
Buglioni, S; D'Agnano, I; Vasselli, S; Perrone Donnorso, R; D'Angelo, C; Brenna, A; Benevolo, M; Cosimelli, M; Zupi, G; Mottolese, M
2001-09-01
To identify the prognostically highest risk patients, DNA content and p53 nuclear or cytoplasmic accumulation, evaluated by monoclonal antibody DO7 and polyclonal antibody CM1, were determined in 94 surgically resected stage II (Dukes B2) colorectal cancers, treated or not with adjuvant 5-fluorouracil-based chemotherapy. Sixty-one (65%) of the tumors were aneuploid, 16 (17%) of which had a multiploid DNA content; 50 (53%) displayed DO7 nuclear p53 accumulation, and 44 (47%) showed cytoplasmic CM1 positivity. In multivariate analysis, only multiploidy and p53 nuclear positivity emerged as independent prognostic indicators of a poorer outcome. Positivity for p53 was associated with shorter survival in 5-fluorouracil-treated and untreated patients. Therefore, in patients with Dukes B2 colorectal cancer, a biologic profile based on the combined evaluation of DNA multiploidy and p53 status can provide valuable prognostic information, identifying patients to be enrolled in alternative, more aggressive therapeutic trials.
Directory of Open Access Journals (Sweden)
Kyoung-jin Min
2017-08-01
Full Text Available Fisetin is a natural compound found in fruits and vegetables such as strawberries, apples, cucumbers, and onions. Since fisetin can elicit anti-cancer effects, including anti-proliferation and anti-migration, we investigated whether fisetin induced apoptosis in human renal carcinoma (Caki cells. Fisetin markedly induced sub-G1 population and cleavage of poly (ADP-ribose polymerase (PARP, which is a marker of apoptosis, and increased caspase activation. We found that pan-caspase inhibitor (z-VAD-fmk inhibited fisetin-induced apoptosis. In addition, fisetin induced death receptor 5 (DR5 expression at the transcriptional level, and down-regulation of DR5 by siRNA blocked fisetin-induced apoptosis. Furthermore, fisetin induced p53 protein expression through up-regulation of protein stability, whereas down-regulation of p53 by siRNA markedly inhibited fisetin-induced DR5 expression. In contrast, fisetin induced up-regulation of CHOP expression and reactive oxygen species production, which had no effect on fisetin-induced apoptosis. Taken together, our study demonstrates that fisetin induced apoptosis through p53 mediated up-regulation of DR5 expression at the transcriptional level.
The ionizing radiation inducible gene PARX/ARAP2 participates in Rho and ARF signaling
International Nuclear Information System (INIS)
Wong, J.A.; Chen, Z.; Zhao, Y.; Vallis, K.A.; Marignani, P.A.; Randazzo, P.A.
2003-01-01
Full text: PARX/ARAP2 is a novel protein that we identified in a gene trap screen for ionizing radiation (IR)-regulated genes. It belongs to a recently described family of proteins that link Rho, ADP-ribosilation factor (ARF) and phosphoinositide 3-kinase (PI3-K) signaling. We have cloned the full length human PARX. Domain analysis of the predicted protein revealed a sterile-alpha motif, five pleckstrin homology domains, a RhoGTPase activating domain (RhoGAP) and an ARF activating domain (ARFGAP). PARX is early inducible by IR in a dose-dependent manner in murine ES cells and in several human B-cell lymphoma lines with up to six-fold induction at the mRNA level at 2 hours (10 Gy). Thus, the kinetics of PARX induction follows the pattern of the rapid response typical of many stress-induced immediate-early genes. PARX expression is also induced in response to other cellular stressors including sorbitol and bleomycin. PARX induction is dependent on PI3-K activity and can be suppressed by the PI3-K inhibitor LY294002. Induction of PARX in response to IR has been observed in cell lines that are p53 mutant indicating up-regulation independent of normal p53 function. The role of p53 in PARX induction is currently being studied using cell lines expressing temperature sensitive p53. Biochemical studies reveal that human PARX has in vivo RhoGAP activity for Rac1 and phosphatidylinositol 3,4,5-trisphosphate dependent ARFGAP activity for ARF1, ARF5 and ARF6. Also, temporal changes in PARX cellular localization following IR are currently being investigated using confocal microscopy. PARX is a gene with a potential role in the cellular response to genotoxic stress, and may illuminate the currently unclear role the small GTPases Rho and ARF play in the radiation response
Dose selenomethionine have radio-protective effect on cell lines with wild type p53?
International Nuclear Information System (INIS)
Tsuji, K.; Hagihira, T.; Ohnishi, K.; Ohnishi, T.; Matsumoto, H.
2003-01-01
Full text: Selenium compounds are known to have cancer preventive effects. It is reported recently that selenium in the form of selenomethionine (SeMet) can protect cells with wild type p53 from UV-induced cell killing by activating the DNA repair mechanism of p53 tumor suppressor protein via redox factor Ref1 by reducing p53 cysteine residue 275 and 277. In contrast, SeMet has no protective effect on UV-induced cell killing in p53-null cells. If SeMet also has protective effect in cells with wild type p53 on cell killing by photon irradiation, SeMet can be used as normal tissue radio-protector. We examined the effect of SeMet on cell killing by X-ray irradiation in several cell lines with different p53 status at exponentially growing phase. Cell lines used in this experiment were as follows: H1299/neo; human lung cancer cell line of p53 null type tranfected with control vector with no p53, H1299/wp53; wild type p53 transfected counterpart. A172/neo; human glioblastoma cell line with wild type p53, A172/mp53-248; mp53-248 (248-mutant, ARG >TRP) transfected counterpart. SAS/neo; human tongue cancer cell line with wild type p53, and SAS/mp53-248; mp53-248 transfected counterpart. Cells were subcultured at monolayer in D-MEM containing 10% FBS. Survivals of the cells were determined by colony forming ability. Ten-MV linac X-ray was used to irradiate the cells. Exponentially growing cells were incubated with 20μM of SeMet for 15 hours before irradiation. After 24 hours exposure of SeMet, cells were incubated up to two weeks in growth medium for colony formation. Twenty-four hours exposure of 20μM of SeMet had no cytotoxicity on these cell lines. SeMet had no modification effect on cell killing by photon irradiation in H1299/neo, H1299/wp53, SAS/neo, SAS/mp53-248, and A172/mp53-248. On the other hand, SeMet sensitized A172/neo in radiation cell killing. The effects of p53 on interaction of SeMet and photon irradiation differ according to cell lines
Human herpesvirus 6B inhibits cell proliferation by a p53-independent pathway
DEFF Research Database (Denmark)
Øster, Bodil; Kaspersen, M.D.; Kofod-Olsen, Emil
2006-01-01
BACKGROUND: Various forms of cellular stress can activate the tumour suppressor protein p53, an important regulator of cell cycle arrest, apoptosis, and cellular senescence. Cells infected by human herpesvirus 6B (HHV-6B) accumulate aberrant amounts of p53. OBJECTIVES: The aim of this study...
Knockdown of p53 suppresses Nanog expression in embryonic stem cells
Energy Technology Data Exchange (ETDEWEB)
Abdelalim, Essam Mohamed, E-mail: emohamed@qf.org.qa [Qatar Biomedical Research Institute, Qatar Foundation, Doha 5825 (Qatar); Molecular Neuroscience Research Center, Shiga University of Medical Science, Setatsukinowa-cho, Otsu, Shiga 520-2192 (Japan); Department of Cytology and Histology, Faculty of Veterinary Medicine, Suez Canal University, Ismailia (Egypt); Tooyama, Ikuo [Molecular Neuroscience Research Center, Shiga University of Medical Science, Setatsukinowa-cho, Otsu, Shiga 520-2192 (Japan)
2014-01-10
Highlights: •We investigate the role of p53 in ESCs in the absence of DNA damage. •p53 knockdown suppresses ESC proliferation. •p53 knockdown downregulates Nanog expression. •p53 is essential for mouse ESC self-renewal. -- Abstract: Mouse embryonic stem cells (ESCs) express high levels of cytoplasmic p53. Exposure of mouse ESCs to DNA damage leads to activation of p53, inducing Nanog suppression. In contrast to earlier studies, we recently reported that chemical inhibition of p53 suppresses ESC proliferation. Here, we confirm that p53 signaling is involved in the maintenance of mouse ESC self-renewal. RNA interference-mediated knockdown of p53 induced downregulation of p21 and defects in ESC proliferation. Furthermore, p53 knockdown resulted in a significant downregulation in Nanog expression at 24 and 48 h post-transfection. p53 knockdown also caused a reduction in Oct4 expression at 48 h post-transfection. Conversely, exposure of ESCs to DNA damage caused a higher reduction of Nanog expression in control siRNA-treated cells than in p53 siRNA-treated cells. These data show that in the absence of DNA damage, p53 is required for the maintenance of mouse ESC self-renewal by regulating Nanog expression.
29 CFR 1926.53 - Ionizing radiation.
2010-07-01
... 29 Labor 8 2010-07-01 2010-07-01 false Ionizing radiation. 1926.53 Section 1926.53 Labor... § 1926.53 Ionizing radiation. (a) In construction and related activities involving the use of sources of ionizing radiation, the pertinent provisions of the Nuclear Regulatory Commission's Standards for...
Directory of Open Access Journals (Sweden)
HENY EKOWATI
2012-09-01
Full Text Available In previous studies, Zingiber officinale, Piper retrofractum, and the combination showed cytotoxic activity, induced apoptosis, and p53 expression of HeLa, T47D, and MCF-7 cell lines. This study was conducted to investigate the cytotoxic and apoptotic activity of Zingiber officinale (ZO, Piper retrofractum (PR, and the combination as well as their effect to p53 expression on Myeloma and WiDr cells. The powder of ZO, PR, and ZO + PR combination (1:1 were macerated with 96% ethanol for 3 x 24 hours. MTT cytotoxic assay was performed on Myeloma and WiDr cell lines. Apoptotic cells were stained with ethidium bromide and acridine orange. Imunohistochemical expression of p53 was examined on Myeloma and WiDr cell lines. Doxorubicin was used as positive control in all assays. Results showed that ZO, PR, and ZO + PR combination had cytotoxic activity on Myeloma cells with IC50 of 28, 36, and 55 mg/ml respectively and WiDr cell lines with IC50 of 74, 158, and 64 mg/ml respectively, induced apoptotic activity, and increased p53 expression on Myeloma and WiDr cells. These results suggest that ZO, PR, and their combination induced Myeloma and WiDr cells in apoptosis through p53 expression.
International Nuclear Information System (INIS)
Liu Bing; Min Fengling; Xie Yi; Zhou Qingming; Duan Xin; Chinese Academy of Sciences, Beijing; Zhang Hong; Li Wenjian; Hao Jifang; Zhou Guangming; Gao Qingxiang
2006-01-01
The effect of AdCMV-p53 gene transfection induced by γ-ray irradiation on human colorectal adenocarcinoma cells was investigated. The HT-29 cells were irradiated by 0.5, 1.0, 2.0 Gy 60 Co γ-rays, then were transfected with AdCMV-GFP (a replication of deficient recombinant adenoviral vector containing a CMV promoter and green fluorescent protein) or AdCMV-p53 (a replication of deficient recombinant adenoviral vector containing a CMV promoter and carrying human wild p53 gene). Cytotoxity was measured by clonogenic survival assay; apoptosis and the p53 expression were determined by flow cytometry. The results show that the pre-exposure of 0.5 Gy 60 Co γ-rays significantly enhanced the inhibition of HT-29 cells with AdCMV-53 transfection and promoted cell apoptosis. The inhibition rates for the groups of pre-exposure with 0.5 Gy and transfection with 40 and 80 MOI AdCMV-p53 were 50% and 20% higher than those for the groups of the mere transfection, and 40% more than the mere irradiation group. In the case of higher than 0.5 Gy pre-exposure, no significant difference was found between the pre-exposure with transfection group and the mere irradiation group. So 0.5 Gy pre-irradiation and AdCMV-p53 transfection obviously increases the inhibition of HT-29 cells with AdCMV-p53 transfection. The optimum condition is the lower than 1.0 Gy pre-exposure combined with the lower than 80 MOI AdCMV-p53 transfection. (authors)
Directory of Open Access Journals (Sweden)
Ivan Raimondi
Full Text Available The tumor suppressor p53 was previously shown to markedly up-regulate the expression of the PRODH gene, encoding the proline dehydrogenase (PRODH enzyme, which catalyzes the first step in proline degradation. Also PRODH2, which degrades 4-hydroxy-L-proline, a product of protein (e.g. collagen catabolism, was recently described as a p53 target. Here, we confirmed p53-dependent induction of endogenous PRODH in response to genotoxic damage in cell lines of different histological origin. We established that over-expression of TAp73β or TAp63β is sufficient to induce PRODH expression in p53-null cells and that PRODH expression parallels the modulation of endogenous p73 by genotoxic drugs in several cell lines. The p53, p63, and p73-dependent transcriptional activation was linked to specific intronic response elements (REs, among those predicted by bioinformatics tools and experimentally validated by a yeast-based transactivation assay. p53 occupancy measurements were validated in HCT116 and MCF7 human cell lines. Conversely, PRODH2 was not responsive to p63 nor p73 and, at best, could be considered a weak p53 target. In fact, minimal levels of PRODH2 transcript induction by genotoxic stress was observed exclusively in one of four p53 wild-type cell lines tested. Consistently, all predicted p53 REs in PRODH2 were poor matches to the p53 RE consensus and showed very weak responsiveness, only to p53, in the functional assay. Taken together, our results highlight that PRODH, but not PRODH2, expression is under the control of p53 family members, specifically p53 and p73. This supports a deeper link between proteins of the p53-family and metabolic pathways, as PRODH modulates the balance of proline and glutamate levels and those of their derivative alpha-keto-glutarate (α-KG under normal and pathological (tumor conditions.
Microbial Regulation of p53 Tumor Suppressor.
Directory of Open Access Journals (Sweden)
Alexander I Zaika
2015-09-01
Full Text Available p53 tumor suppressor has been identified as a protein interacting with the large T antigen produced by simian vacuolating virus 40 (SV40. Subsequent research on p53 inhibition by SV40 and other tumor viruses has not only helped to gain a better understanding of viral biology, but also shaped our knowledge of human tumorigenesis. Recent studies have found, however, that inhibition of p53 is not strictly in the realm of viruses. Some bacterial pathogens also actively inhibit p53 protein and induce its degradation, resulting in alteration of cellular stress responses. This phenomenon was initially characterized in gastric epithelial cells infected with Helicobacter pylori, a bacterial pathogen that commonly infects the human stomach and is strongly linked to gastric cancer. Besides H. pylori, a number of other bacterial species were recently discovered to inhibit p53. These findings provide novel insights into host-bacteria interactions and tumorigenesis associated with bacterial infections.
Battle Against Cancer: An Everlasting Saga of p53
Directory of Open Access Journals (Sweden)
Qian Hao
2014-12-01
Full Text Available Cancer is one of the most life-threatening diseases characterized by uncontrolled growth and spread of malignant cells. The tumor suppressor p53 is the master regulator of tumor cell growth and proliferation. In response to various stress signals, p53 can be activated and transcriptionally induces a myriad of target genes, including both protein-encoding and non-coding genes, controlling cell cycle progression, DNA repair, senescence, apoptosis, autophagy and metabolism of tumor cells. However, around 50% of human cancers harbor mutant p53 and, in the majority of the remaining cancers, p53 is inactivated through multiple mechanisms. Herein, we review the recent progress in understanding the molecular basis of p53 signaling, particularly the newly identified ribosomal stress—p53 pathway, and the development of chemotherapeutics via activating wild-type p53 or restoring mutant p53 functions in cancer. A full understanding of p53 regulation will aid the development of effective cancer treatments.
Pardossi-Piquard, Raphaëlle; Dunys, Julie; Giaime, Emilie; Guillot-Sestier, Marie-Victoire; St George-Hyslop, Peter; Checler, Frédéric; Alves da Costa, Cristine
2009-04-01
Nicastrin (NCT) is a component of the presenilin (PS)-dependent gamma-secretase complexes that liberate amyloid beta-peptides from the beta-Amyloid Precursor Protein. Several lines of evidence indicate that the members of these complexes could also contribute to the control of cell death. Here we show that over-expression of NCT increases the viability of human embryonic kidney (HEK293) cells and decreases staurosporine (STS)- and thapsigargin (TPS)-induced caspase-3 activation in various cell lines from human and neuronal origins by Akt-dependent pathway. NCT lowers p53 expression, transcriptional activity and promoter transactivation and reduces p53 phosphorylation. NCT-associated protection against STS-stimulated cell death was completely abolished by p53 deficiency. Conversely, the depletion of NCT drastically enhances STS-induced caspase-3 activation and p53 pathway and favored p53 nuclear translocation. We examined whether NCT protective function depends on PS-dependent gamma-secretase activity. First, a 29-amino acid deletion known to reduce NCT-dependent amyloid beta-peptide production did not affect NCT-associated protective phenotype. Second, NCT still reduces STS-induced caspase-3 activation in fibroblasts lacking PS1 and PS2. Third, the gamma-secretase inhibitor DFK167 did not affect NCT-mediated reduction of p53 activity. Altogether, our study indicates that NCT controls cell death via phosphoinositide 3-kinase/Akt and p53-dependent pathways and that this function remains independent of the activity and molecular integrity of the gamma-secretase complexes.
The role of hypoxia, p53, and apoptosis in human cervical carcinoma pathogenesis
International Nuclear Information System (INIS)
Kim, Charlotte Y.; Tsai, Mitchell H.; Osmanian, Cynthia; Calkins, Dennise P.; Graeber, Thomas G.; Greenspan, David L.; Kennedy, Andrew S.; Rinker, Lillian H.; Varia, Mahesh A.; DiPaolo, Joseph A.; Peehl, Donna M.; Raleigh, James A.; Giaccia, Amato J.
1997-01-01
, ionizing radiation did not stimulate p53 accumulation or apoptosis in these cells. Cervical epithelial cells containing the intact HPV 16 genome also exhibited hypoxia induced apoptosis. Hypoxia stimulated p53 induction but not apoptosis in cell lines derived from human cervical squamous cell carcinomas, indicating that these cell lines have acquired further genetic alterations independent of p53 which reduced their apoptotic sensitivity to hypoxia. Furthermore, E6 and E7 infected cervical epithelial cells subjected to multiple rounds of hypoxia followed by aerobic recovery achieved resistance to hypoxia induced apoptosis, indicating that hypoxia could directly select for cells with diminished apoptotic sensitivity. In situ, hypoxia and apoptosis were found to co-localize in tumors of patients with advanced clinical stage. Conclusion: Expression of viral oncoproteins in human cervical epithelial cells can increase their sensitivity to hypoxia-induced apoptosis. Hypoxia can select for variants that have lost their apoptotic potential and hypoxia correlates spatially with apoptosis in human cervical carcinoma biopsies. Therefore, these results implicate a role for hypoxia-mediated selection in human tumor progression and can in part explain the aggressiveness of cervical carcinomas with low p0 2 values
The pro-survival function of p53 in HeLa cells
Energy Technology Data Exchange (ETDEWEB)
Kim, Jin Kyu; Kang, Mi Young; Jang, Eun Yeong; Kim, Jin Hong [Korea Atomic Energy Research Institute, Advanced Radiation Technology Institute, Jeongeup (Korea, Republic of)
2014-11-15
The rate of apoptosis and autophagy was variable with different p53 status after IR treatment of cells. The influence of p53 status on cell fate suggests a role of p53 in two fundamentally important cell biological pathways: autophagy and apoptosis. p53 coordinates cell cycle arrest and apoptosis to govern cell fate. This study was done to identify p53-mediated regulation of cell's fate. Autophagy induced by IR may prevent cells from undergoing apoptosis, implying an interlink modulation between autophagy and apoptosis. The rate of apoptosis and autophagy was determined with different p53 status after IR treatment of HeLa cells in this study. Our research on IR-induced cellular responses may provide new information about fate decision between the processes of apoptosis and autophagy.
International Nuclear Information System (INIS)
Liao Weiting; Lin Pinpin; Cheng, T.-S.; Yu, H.-S.; Chang, Louis W.
2007-01-01
Epidemiological evidence indicated that residents, especially cigarette smokers, in arseniasis areas had significantly higher lung cancer risk than those living in non-arseniasis areas. Thus, an interaction between arsenic and cigarette smoking in lung carcinogenesis was suspected. p53 dysfunction or mutation in lung epithelial cells was frequently observed in cigarette smokers. Our present study was to explore the differential effects by arsenic on H1355 cells (human lung adenocarcinoma cell line with mutation in p53), BEAS-2B (immortalized lung epithelial cell with functional p53) and pifithrin-α-treated BEAS-2B cells (p53-inhibited cells). These cells were treated with different doses of sodium arsenite (0, 0.1, 1, 5 and 10 μM) for 48 h. A greater reduction in cell viability was observed in the BEAS-2B cells vs. p53 compromised cells (H1355 or p53-inhibited BEAS-2B). Similar observation was also made on 7-day cell survival (growth) study. TUNEL analysis confirmed that there was indeed a significantly reduced arsenite-induced apoptosis found in p53-compromised cells. Centrosomal abnormality has been attributed to eventual chromosomal missegregation, aneuploidy and tumorigenesis. In our present study, reduced p21 and Gadd45a expressions and increased centrosomal abnormality (atopic and multiple centrosomes) were observed in both arsenite-treated H1355 and p53-inhibited BEAS-2B cells as compared with similarly treated BEAS-2B cells. Increased anchorage-independent growth (colony formation) of BEAS-2B cells co-treated with pifithrin-α and 5 μM sodium arsenite was also observed in soft agar. Our present investigation demonstrated that arsenic would act specifically on p53 compromised cells (either with p53 dysfunction or inhibited) to induce centrosomal abnormality and colony formation. These findings provided strong evidence on the carcinogenic promotional role of arsenic, especially under the condition of p53 dysfunction
Kim, H.; Bernard, M.; Epperly, M.W.; Shen, H.; Dixon, T.M.; Amoscato, A.A.; Doemling, A.S.; Li, S.; Gao, X.; Wipf, P.
2011-01-01
Purpose/Objective(s): To evaluate the esophageal radiation dose modification properties of the GS-nitroxide (JP4-039) and the p53/MDM2/MDM4 inhibitor (BEB55). Materials/Methods: Esophagitis is a significant toxicity of radiation therapy of thoracic cancers. We evaluated radiation dose modification
Fong, Chii Shyang; Mazo, Gregory; Das, Tuhin; Goodman, Joshua; Kim, Minhee; O'Rourke, Brian P; Izquierdo, Denisse; Tsou, Meng-Fu Bryan
2016-07-02
Mitosis occurs efficiently, but when it is disturbed or delayed, p53-dependent cell death or senescence is often triggered after mitotic exit. To characterize this process, we conducted CRISPR-mediated loss-of-function screens using a cell-based assay in which mitosis is consistently disturbed by centrosome loss. We identified 53BP1 and USP28 as essential components acting upstream of p53, evoking p21-dependent cell cycle arrest in response not only to centrosome loss, but also to other distinct defects causing prolonged mitosis. Intriguingly, 53BP1 mediates p53 activation independently of its DNA repair activity, but requiring its interacting protein USP28 that can directly deubiquitinate p53 in vitro and ectopically stabilize p53 in vivo. Moreover, 53BP1 can transduce prolonged mitosis to cell cycle arrest independently of the spindle assembly checkpoint (SAC), suggesting that while SAC protects mitotic accuracy by slowing down mitosis, 53BP1 and USP28 function in parallel to select against disturbed or delayed mitosis, promoting mitotic efficiency.
Directory of Open Access Journals (Sweden)
Qiong Jia
Full Text Available Diamond-Blackfan anemia (DBA is a rare inherited bone marrow failure syndrome that is characterized by pure red-cell aplasia and associated physical deformities. It has been proven that defects of ribosomal proteins can lead to this disease and that RPS19 is the most frequently mutated gene in DBA patients. Previous studies suggest that p53-dependent genes and pathways play important roles in RPS19-deficient embryos. However, whether there are other vital factors linked to DBA has not been fully clarified. In this study, we compared the whole genome RNA-Seq data of zebrafish embryos injected with RPS19 morpholino (RPS19 MO, RPS19 and p53 morpholino simultaneously (RPS19+p53 MO and control morpholino (control. We found that genes enriched in the functions of hematological systems, nervous system development and skeletal and muscular disorders had significant differential expression in RPS19 MO embryos compared with controls. Co-inhibition of p53 partially alleviates the abnormalities for RPS19-deficient embryos. However, the hematopoietic genes, which were down-regulated significantly in RPS19 MO embryos, were not completely recovered by the co-inhibition of p53. Furthermore, we identified the genome-wide p53-dependent and -independent genes and pathways. These results indicate that not only p53 family members but also other factors have important impacts on RPS19-deficient embryos. The detection of potential pathogenic genes and pathways provides us a new paradigm for future research on DBA, which is a systematic and complex hereditary disease.
MDM2 inhibitor nutlin-3a induces apoptosis and senescence in cutaneous T-cell lymphoma: Role of p53
DEFF Research Database (Denmark)
Manfé, Valentina; Biskup, Edyta Urszula; Johansen, Peter
2012-01-01
cell lines, P53 mutation analysis identified a homozygous nonsense mutation (R196Stop in Hut-78) and a homozygous missense mutation (G245S in SeAx). In MyLa2000, Mac1, and Mac2a carrying wild-type P53, nutlin-3a induced apoptosis and senescence demonstrated by permanent G0/G1 cell-cycle block...... with intact p53 but also in Hut-78, SeAx, and Sézary cells. Thus, targeting p53 by nutlin-3a may constitute a therapeutic approach in CTCL because of increased apoptosis and senescence of tumor cells....
Choudhury, Sreetama; Ghosh, Sayan; Mukherjee, Sudeshna; Gupta, Payal; Bhattacharya, Saurav; Adhikary, Arghya; Chattopadhyay, Sreya
2016-12-01
Molecular mechanisms involved in arsenic-induced toxicity are complex and elusive. Liver is one of the most favored organs for arsenic toxicity as methylation of arsenic occurs mostly in the liver. In this study, we have selected a range of environmentally relevant doses of arsenic to examine the basis of arsenic toxicity and the role of pomegranate fruit extract (PFE) in combating it. Male Swiss albino mice exposed to different doses of arsenic presented marked hepatic injury as evident from histological and electron microscopic studies. Increased activities of enzymes alanine aminotransferase, aspartate aminotransferase, lactate dehydrogenase and alkaline phosphatase corroborated extensive liver damage. It was further noted that arsenic exposure initiated reactive oxygen species (ROS)-dependent apoptosis in the hepatocytes involving loss of mitochondrial membrane potential. Arsenic significantly increased nuclear translocation of nuclear factor erythroid 2-related factor 2 (Nrf2) and nuclear factor-κB (NF-κB), coupled with increase in phosphorylated Iκ-B, possibly as adaptive cellular survival strategies. Arsenic-induced oxidative DNA damage to liver cells culminated in p53 activation and increased expression of p53 targets like miR-34a and Bax. Pomegranate polyphenols are known to possess remarkable antioxidant properties and are capable of protecting normal cells from various stimuli-induced oxidative stress and toxicities. We explored the protective role of PFE in ameliorating arsenic-induced hepatic damage. PFE was shown to reduce ROS generation in hepatocytes, thereby reducing arsenic-induced Nrf2 activation. PFE also inhibited arsenic-induced NF-κB-inflammatory pathway. Data revealed that PFE reversed arsenic-induced hepatotoxicity and apoptosis by modulating the ROS/Nrf2/p53-miR-34a axis. For the first time, we have mapped the possible signaling pathways associated with arsenic-induced hepatotoxicity and its rescue by pomegranate polyphenols. Copyright
Hsu, Tzu-Sheng; Chen, Chinpiao; Lee, Pei-Ting; Chiu, Shu-Jun; Liu, Huei-Fang; Tsai, Chih-Chien; Chao, Jui-I
2008-10-01
The derivatives of 5,8-quinolinedione have been shown to exert anticancer activities. A new synthetic compound 7-chloro-6-piperidin-1-yl-quinoline-5,8-dione (designed as PT-262) derived from 6,7-dichloroquinoline-5,8-dione on its anticancer activity was investigated in this study. PT-262 was synthesized as the following: triethylamine (0.56 ml, 5.1 mmol) was added dropwise to a solution of 6,7-dichloroquinoline-5,8-dione (1.00 g, 4.4 mmol) and piperidine (0.50 ml, 5.1 mmol) in 150 ml of benzene with stirring at room temperature for 5 min, and the solvent was removed using rotary evaporator to give a dark brown solid. PT-262 was purified by flash chromatography using 50% ethyl acetate/hexanes to elute that displayed as brown solids. To examine the induction of apoptosis following PT-262 treatment, the lung cancer cells were subjected to apoptotic cell observation, caspase activation, and mitochondrial functional assays. The protein levels of phosphorylated ERK and CDC2 after treatment with PT-262 were analyzed by Western blot. Treatment with 1-20 microM PT-262 for 24 h induced cytotoxicity via a concentration-dependent manner in human lung cancer cells. PT-262 induced the loss of mitochondrial membrane potential and elevated the caspase-3 activation and apoptosis. Interestingly, the phosphorylation of ERK was inhibited by PT-262. The IC50 value of ERK phosphorylation inhibition was approximate around 5 microM. Treatment with a specific MEK1/2 (the upstream of ERK) inhibitor, PD98059, increased the PT-262-induced cytotoxicity in lung cancer cells. Moreover, PT-262 did not alter the protein expression of tumor suppressor p53. PT-262 elicited the cytotoxicity and accumulated the G2/M fractions in both the p53-wild type and p53-null lung cancer cells. The mitosis-regulated protein levels of cyclin B1 and phospho-CDC2 at Thr14, Tyr15, and Thr161 were repressed by PT-262 in these cells. PT-262 suppresses the phosphorylation of ERK and CDC2 associated with proliferation
Interaction of p53 with prolyl isomerases: Healthy and unhealthy relationships.
Mantovani, Fiamma; Zannini, Alessandro; Rustighi, Alessandra; Del Sal, Giannino
2015-10-01
The p53 protein family, comprising p53, p63 and p73, is primarily involved in preserving genome integrity and preventing tumor onset, and also affects a range of physiological processes. Signal-dependent modifications of its members and of other pathway components provide cells with a sophisticated code to transduce a variety of stress signaling into appropriate responses. TP53 mutations are highly frequent in cancer and lead to the expression of mutant p53 proteins that are endowed with oncogenic activities and sensitive to stress signaling. p53 family proteins have unique structural and functional plasticity, and here we discuss the relevance of prolyl-isomerization to actively shape these features. The anti-proliferative functions of the p53 family are carefully activated upon severe stress and this involves the interaction with prolyl-isomerases. In particular, stress-induced stabilization of p53, activation of its transcriptional control over arrest- and cell death-related target genes and of its mitochondrial apoptotic function, as well as certain p63 and p73 functions, all require phosphorylation of specific S/T-P motifs and their subsequent isomerization by the prolyl-isomerase Pin1. While these functions of p53 counteract tumorigenesis, under some circumstances their activation by prolyl-isomerases may have negative repercussions (e.g. tissue damage induced by anticancer therapies and ischemia-reperfusion, neurodegeneration). Moreover, elevated Pin1 levels in tumor cells may transduce deregulated phosphorylation signaling into activation of mutant p53 oncogenic functions. The complex repertoire of biological outcomes induced by p53 finds mechanistic explanations, at least in part, in the association between prolyl-isomerases and the p53 pathway. This article is part of a Special Issue entitled Proline-directed foldases: Cell signaling catalysts and drug targets. Copyright © 2015 Elsevier B.V. All rights reserved.
The p53 gene with emphasis on its paralogues in mosquitoes
Directory of Open Access Journals (Sweden)
Tien-Huang Chen
2017-12-01
Full Text Available The p53 gene is highly important in human cancers, as it serves as a tumor-suppressor gene. Subsequently, two p53 homologues, i.e., p73 and p63, with high identity of amino acids were identified, leading to construction of the p53 family. The p53 gene is highly important in human cancer because it usually transcribes genes that function by causing apoptosis in mammalian cells. In contrast, p63 and p73 tend to be more important in modulating development than inducing cell death, even though they share similar protein structures. Relatively recently, p53 was also identified in mosquitoes and many other insect species. Uniquely, its structure lacks the sterile alpha motif domain which is a putative protein-protein interaction domain and exclusively exists at the C-terminal region in p73 and p63 in mammals. A phylogenetic analysis revealed that the p53 gene derived from mosquitoes is composed of two paralogues, p53-1 and p53-2. Of these, only p53-2 is responsively upregulated by dengue 2 virus (DENV2 in C6/36 cells which usually survive the infection. This indicates that the p53 gene is closely related to DENV infection in mosquito cells. The specific significance of p53-2's involvement in cell survival from virus-induced stress is described and briefly discussed in this report. Keywords: p53 homologue, Paralogue, Mosquitoes, Phylogeny, Cell survival
Regulation of Mdmx and its role in the p53 pathway
Meulmeester, Erik
2006-01-01
The p53 protein is an important tumor suppressor that acts as a key regulator of the integrity of the genome. Two essential regulators of the p53 protein are Mdm2 and its homologue Mdmx. Like Mdm2, Mdmx represses p53-induced transcription. However, Mdmx cannot ubiquitinate or degrade p53 opposed to
Directory of Open Access Journals (Sweden)
Bruce C. McKay
1999-08-01
Full Text Available We have previously suggested that the inhibition of RNA polymerase II-mediated transcription after exposure to UV light promotes the accumulation of p53 and the induction of apoptosis (Oncogene 13, 823–831. However, it was not clear whether p53 induction was contributing to apoptosis. Here we report that apoptosis is triggered at lower UV doses in p53-deficient Li-Fraumeni syndrome (LFS and human papillomavirus (HPV E6 expressing fibroblasts than in normal cells, suggesting that p53 can be protective against UVinduced apoptosis. There is no significant difference in the effect of UV-irradiation on the cell cycle distribution of normal and primary LFS fibroblasts. Importantly, the recovery of nascent mRNA synthesis in all p53-deficient fibroblasts is significantly impaired compared with control cells after exposure to relevant doses of UV light. Taken together, our results suggest that wild-type p53 can protect cells against UV-induced apoptosis by facilitating the recovery of transcription. Furthermore, we suggest that the capacity of cells to recover transcription after genotoxic damage is an important determinant of sensitivity to apoptosis.
International Nuclear Information System (INIS)
Takahashi, Akihisa; Suzuki, Hiromi; Shimazu, Toru; Omori, Katsunori; Ishioka, Noriaki; Ohnishi, Takeo; Seki, Masaya; Hashizume, Toko
2012-01-01
The aim of this study was to determine the biological effects of space radiations, microgravity, and the interaction of them on the expression of p53-regulated proteins. Space experiments were performed with two human cultured lymphoblastoid cell lines: one line (TSCE5) bears a wild-type p53 gene status, and another line (WTK1) bears a mutated p53 gene status. Under 1 gravity or microgravity conditions, the cells were grown in the cell biology experimental facility (CBEF) of the International Space Station for 8 days without experiencing the stress during launching and landing because the cells were frozen during these periods. Ground control samples were simultaneously cultured for 8 days in the CBEF on the ground for 8 days. After spaceflight, protein expression was analyzed using a Panorama TM Ab MicroArray protein chips. It was found that p53-dependent up-regulated proteins in response to space radiations and space environment were MeCP2 (methyl CpG binding protein 2), and Notch1 (Notch homolog 1), respectively. On the other hand, p53-dependent down-regulated proteins were TGF-β, TWEAKR (tumor necrosis factor-like weak inducer of apoptosis receptor), phosho-Pyk2 (Proline-rich tyrosine kinase 2), and 14-3-3θ/τ which were affected by microgravity, and DR4 (death receptor 4), PRMT1 (protein arginine methyltransferase 1) and ROCK-2 (Rho-associated, coiled-coil containing protein kinase 2) in response to space radiations. ROCK-2 was also suppressed in response to the space environment. The data provides the p53-dependent regulated proteins by exposure to space radiations and/or microgravity during spaceflight. Our expression data revealed proteins that might help to advance the basic space radiation biology. (author)
Directory of Open Access Journals (Sweden)
Deepak Poudyal
2012-01-01
Full Text Available Ulcerative colitis (UC is debilitating and carries a high colon cancer risk. Apoptosis of inflammatory cells is a key mechanism regulating UC. We have recently shown that American ginseng (AG, and to a greater extent, a Hexane fraction of AG (HAG can cause apoptosis and suppress mouse colitis through a p53-mediated mechanism. Here, we tested the hypothesis that HAG suppresses colitis through a p53 mechanism. We found only a limited impact of p53 in the ability of HAG to induce inflammatory cell apoptosis and suppress mouse colitis in vitro and in vivo. Finally, we asked whether HAG could cause cell cycle arrest of HCT116 colon cancer cells in vitro. Interestingly, HAG caused a G1 arrest of such cells independent of p53 status. Findings are significant because HAG suppresses colitis and associated colon cancer, and mutation in p53 is observed in most colitis-driven colon cancers. Therefore, HAG might be very effective in targeting the inflammatory cells and cancer cells since it induces apoptosis of inflammatory cells and cell cycle arrest in both p53−/− and WT p53 colon cancer cells.
Ghatei, Najmeh; Nabavi, Ariane Sadr; Toosi, Mohammad Hossein Bahreyni; Azimian, Hosein; Homayoun, Mansour; Targhi, Reza Ghasemnezhad; Haghir, Hossein
2017-09-01
The increasing rate of over using cell phones has been considerable in youths and pregnant women. We examined the effect of mobile phones radiation on genes expression variation on cerebellum of BALB/c mice before and after of the birth. In this study, a mobile phone jammer, which is an instrument to prevent receiving signals between cellular phones and base transceiver stations (two frequencies 900 and 1800 MHz) for exposure was used and twelve pregnant mice (BALB/c) divided into two groups (n=6), first group irradiated in pregnancy period (19th day), the second group did not irradiate in pregnancy period. After childbirth, offspring were classified into four groups (n=4): Group1: control, Group 2: B1 (Irradiated after birth), Group 3: B2 (Irradiated in pregnancy period and after birth), Group 4: B3 (Irradiated in pregnancy period). When maturity was completed (8-10 weeks old), mice were dissected and cerebellum was isolated. The expression level of bax , bcl-2, p21 and p53 genes examined by real-time reverse transcription polymerase chain reaction (Real-Time RT- PCR). The data showed that mobile phone radio waves were ineffective on the expression level of bcl-2 and p53 genes) P >0.05(. Also gene expression level of bax decreased and gene expression level of p21 increased comparing to the control group ( P mobile phone radiations did not induce apoptosis in cells of the cerebellum and the injured cells can be repaired by cell cycle arrest.
The nucleolus directly regulates p53 export and degradation.
Boyd, Mark T; Vlatkovic, Nikolina; Rubbi, Carlos P
2011-09-05
The correlation between stress-induced nucleolar disruption and abrogation of p53 degradation is evident after a wide variety of cellular stresses. This link may be caused by steps in p53 regulation occurring in nucleoli, as suggested by some biochemical evidence. Alternatively, nucleolar disruption also causes redistribution of nucleolar proteins, potentially altering their interactions with p53 and/or MDM2. This raises the fundamental question of whether the nucleolus controls p53 directly, i.e., as a site where p53 regulatory processes occur, or indirectly, i.e., by determining the cellular localization of p53/MDM2-interacting factors. In this work, transport experiments based on heterokaryons, photobleaching, and micronucleation demonstrate that p53 regulatory events are directly regulated by nucleoli and are dependent on intact nucleolar structure and function. Subcellular fractionation and nucleolar isolation revealed a distribution of ubiquitylated p53 that supports these findings. In addition, our results indicate that p53 is exported by two pathways: one stress sensitive and one stress insensitive, the latter being regulated by activities present in the nucleolus.
International Nuclear Information System (INIS)
Hirabayashi, Yoko; Yoon, Byung-Il; Kawasaki, Yasushi; Li, Guang-Xun; Kanno, Jun; Inoue, Tohru
2003-01-01
Leukemia induction by benzene inhalation was first reported by Le Noire in 1887, described multiple cases of leukemia among Parisian cobblers. However, experimental induction of leukemia by benzene exposure was not succeeded for a hundred years, until Snyder et al. and our group reported it nearly 20 years ago. Nevertheless, the mechanistic background of benzene-induced leukemia was still an enigma until recently a benzene-induced peculiar cell kinetics of the stem/progenitor cells has been elucidated by our study, demonstrated a marked repeated oscillatory decrease in peripheral blood and bone marrow (BM) cellularity during and after benzene exposure, which epigenetically preceded and developed the leukemia more than a year later. We utilized the BUUV (bromodeoxyuridine + UV exposure) method to study stem/progenitor cell kinetics during and/or after benzene exposure. Using these methods, we were able to measure the labeling rate, cycling fraction of clonogenic progenitor cells, and other cell cycle parameters. The cycling fraction of stem/progenitor cells was found not to turn into an active hematopoiesis but to remain low during benzene inhalation and further we found evidence that the cycling fraction depression may be mediated in part by a slowing of stem/progenitor cell cycling perse by up-regulation of p21. The benzene induced leukemogenicity between mice carrying wild-type p53 and mice lacking p53 seem to differ from one another. In the case of p53 knockout mouse, DNA damage such as weak mutagenicity and or chromosomal damages are retained, and those damages participated in the induction of a consequent activation of proto-oncogenes and the like, which led cells to further neoplastic changes. In contrast, in the case of wild type mice, a dramatic oscillational change in the cell cycle of the stem cell compartment seems to be an important factor for mice carrying the p53 gene. (author)
Ets-2 and p53 mediate cAMP-induced MMP-2 expression, activity and trophoblast invasion
Directory of Open Access Journals (Sweden)
Goldman Shlomit
2009-11-01
Full Text Available Abstract Background We have previously shown that Matrix metalloproteinase (MMP -2 is a key-enzyme in early trophoblast invasion and that Protein Kinase A (PKA increases MMP-2 expression and trophoblast invasion. The aim of this study was to examine MMP -2 regulation by PKA in invasive trophoblasts: JAR choriocarcinoma cell-line and 6-8 w first trimester trophoblasts. Methods The effect of Forskolin (PKA on MMP-2 expression was assessed by Northern Blot and RT-PCR. Possible transcription factors binding to consensus MMP-2 promoter sequences in response to Forskolin, were detected by EMSA binding assay and their expression assessed by western blot analysis. Antisense transfection of relevant transcription factors was performed and the inhibitory effect assessed on MMP-2 expression (RT-PCR, secretion (zymography and trophoblast invasiveness (transwell migration assay. Results We found that Forskolin increased MMP-2 mRNA in JAR cells within 24 hours, and induced binding to p53, Ets, C/EBP and AP-2. Transcription factors Ets-2, phospho- p53, C/EBP epsilon, C/EBP lambda and AP-2 alpha bound to their respective binding sequences in response to Forskolin and the expressions of these transcription factors were all elevated in Forskolin- treated cells. Inhibition of Ets-2 and p53 reduced MMP-2 expression, secretion and invasiveness of Forskolin treated cells. Conclusion MMP-2 is regulated by PKA through several binding sites and transcription factors including Ets-2, p53, C/EBP, C/EBP lambda and AP-2 alpha. Ets-2 and p53 mediate cAMP- induced trophoblast invasiveness, through regulation of MMP-2.
Radiotherapy modulates expression of EGFR, ERCC1 and p53 in cervical cancer
Energy Technology Data Exchange (ETDEWEB)
Almeida, V.H. de; Melo, A.C. de; Nogueira-Rodrigues, A.; Pimenta-Inada, H.K.; Alves, F.G.; Moralez, G.; Thiago, L.S.; Ferreira, C.G.; Sternberg, C., E-mail: diretoriaexecutiva@sboc.org.br [Instituto Nacional de Câncer (INCA), Rio de Janeiro, RJ (Brazil); Meira, D.D. [Universidade Federal do Espírito Santo (UFES), Vitória, ES (Brazil); Pires, A.C. [Fonte Medicina Diagnóstica, Niterói, RJ (Brazil)
2018-02-01
Cervical cancer is a public health problem and the molecular mechanisms underlying radioresistance are still poorly understood. Here, we evaluated the modulation of key molecules involved in cell proliferation, cell cycle and DNA repair in cervical cancer cell lines (CASKI and C33A) and in malignant tissues biopsied from 10 patients before and after radiotherapy. The expression patterns of epidermal growth factor receptor (EGFR), excision repair cross-complementation group 1 (ERCC1) and p53 were evaluated in cancer cell lines by quantitative PCR and western blotting, and in human malignant tissues by immunohistochemistry. The mutation status of TP53 gene was evaluated by direct sequencing. Among cell lines, absent or weak modulations of EGFR, ERCC1 and p53 were observed after exposure to 1.8 Gy. Conversely, increased expressions of p53 (5/10 patients; P=0.0239), ERCC1 (5/10 patients; P=0.0294) and EGFR (4/10 patients; P=0.1773) were observed in malignant tissues after radiotherapy with the same radiation dose. TP53 mutations were found only in one patient. Here we show that a single dose of radiotherapy induced EGFR, ERCC1 and p53 expression in malignant tissues from cervical cancer patients but not in cancer cell lines, highlighting the gap between in vitro and in vivo experimental models. Studies on larger patient cohorts are needed to allow an interpretation that an up regulation of p53, EGFR and ERCC1 may be part of a radioresistance mechanism. (author)
Molecular analysis of p53 and K-ras in lung carcinomas of coal miners
Energy Technology Data Exchange (ETDEWEB)
Sarkar, F.H.; Li, Y.W.; Vallyathan, V. [Wayne State University, Detroit, MI (United States). School of Medicine, Dept. of Pathology
2001-10-01
Thirty-three cases of non-small cell lung cancers (NSCLC) from the archives of National Coal Workers' Autopsy Study were studied for mutational alterations in p53 and K-ras using PCR-SSCP, DNA sequencing and PCR-oligonucleotide probe hybridization techniques. Mutations of the p53 were observed in 4 smokers (19%) and one in a never smoker (8%). Two polymorphisms in smokers were detected at codon 213, a common site for sequence variation. Among the smokers the p53 mutations were in the heavy smokers. In never smokers there was only a single p53 mutation and two K-ras mutations. In never smokers the frequency of K-ras mutations was similar (17%) in smokers, but one never smoker had two K-ras mutations. Mutations of p53 were more frequent in adenocarcinomas (27%) and they were AT-GC transitions. There were two large cell undifferentiated carcinomas with p53 mutation and one with a K-ras mutation. Two of the 16 squamous cell carcinomas were positive for p53 mutation, while no K-ras mutations were found in this group. The results of these preliminary studies indicate a moderately different mutational spectrum of p53 and K-ras in coal miners independent of cigarette smoking. The mutational spectrum observed in this study of coal miners with heavy cigarette smoking history suggest a protective effect of coal mine dust in preventing abnormal mutations induced by chemical carcinogens in cigarette smoke or reactive oxygen species.
Dopaminergic Neuron-Specific Deletion of p53 Gene Attenuates Methamphetamine Neurotoxicity.
Lu, Tao; Kim, Paul P; Greig, Nigel H; Luo, Yu
2017-08-01
p53 plays an essential role in the regulation of cell death in dopaminergic (DA) neurons and its activation has been implicated in the neurotoxic effects of methamphetamine (MA). However, how p53 mediates MA neurotoxicity remains largely unknown. In this study, we examined the effect of DA-specific p53 gene deletion in DAT-p53KO mice. Whereas in vivo MA binge exposure reduced locomotor activity in wild-type (WT) mice, this was significantly attenuated in DAT-p53KO mice and associated with significant differences in the levels of the p53 target genes BAX and p21 between WT and DAT-p53KO. Notably, DA-specific deletion of p53 provided protection of substantia nigra pars reticulata (SNpr) tyrosine hydroxylase (TH) positive fibers following binge MA, with DAT-p53KO mice having less decline of TH protein levels in striatum versus WT mice. Whereas DAT-p53KO mice demonstrated a consistently higher density of TH fibers in striatum compared to WT mice at 10 days after MA exposure, DA neuron counts within the substantia nigra pars compacta (SNpc) were similar. Finally, supportive of these results, administration of a p53-specific inhibitor (PFT-α) provided a similarly protective effect on MA binge-induced behavioral deficits. Neither DA specific p53 deletion nor p53 pharmacological inhibition affected hyperthermia induced by MA binge. These findings demonstrate a specific contribution of p53 activation in behavioral deficits and DA neuronal terminal loss by MA binge exposure.
p53-dependent inhibition of TrxR1 contributes to the tumor-specific induction of apoptosis by RITA.
Hedström, Elisabeth; Eriksson, Sofi; Zawacka-Pankau, Joanna; Arnér, Elias S J; Selivanova, Galina
2009-11-01
Thioredoxin reductase 1 (TrxR1) is a key regulator in many redox-dependent cellular pathways, and is often overexpressed in cancer. Several studies have identified TrxR1 as a potentially important target for anticancer therapy. The low molecular weight compound RITA (NSC 652287) binds p53 and induces p53-dependent apoptosis. Here we found that RITA also targets TrxR1 by non-covalent binding, followed by inhibition of its activity in vitro and by inhibition of TrxR activity in cancer cells. Interestingly, a novel approximately 130 kDa form of TrxR1, presumably representing a stable covalently linked dimer, and an increased generation of reactive oxygen species (ROS) were induced by RITA in cancer cells in a p53-dependent manner. Similarly, the gold-based TrxR inhibitor auranofin induced apoptosis related to oxidative stress, but independently of p53 and without apparent induction of the approximately 130 kDa form of TrxR1. In contrast to the effects observed in cancer cells, RITA did not inhibit TrxR or ROS formation in normal fibroblasts (NHDF). The inhibition of TrxR1 can sensitize tumor cells to agents that induce oxidative stress and may directly trigger cell death. Thus, our results suggest that a unique p53-dependent effect of RITA on TrxR1 in cancer cells might synergize with p53-dependent induction of pro-apoptotic genes and oxidative stress, thereby leading to a robust induction of cancer cell death, without affecting non-transformed cells.
2-Sulfonylpyrimidines: Mild alkylating agents with anticancer activity toward p53-compromised cells.
Bauer, Matthias R; Joerger, Andreas C; Fersht, Alan R
2016-09-06
The tumor suppressor p53 has the most frequently mutated gene in human cancers. Many of p53's oncogenic mutants are just destabilized and rapidly aggregate, and are targets for stabilization by drugs. We found certain 2-sulfonylpyrimidines, including one named PK11007, to be mild thiol alkylators with anticancer activity in several cell lines, especially those with mutationally compromised p53. PK11007 acted by two routes: p53 dependent and p53 independent. PK11007 stabilized p53 in vitro via selective alkylation of two surface-exposed cysteines without compromising its DNA binding activity. Unstable p53 was reactivated by PK11007 in some cancer cell lines, leading to up-regulation of p53 target genes such as p21 and PUMA. More generally, there was cell death that was independent of p53 but dependent on glutathione depletion and associated with highly elevated levels of reactive oxygen species and induction of endoplasmic reticulum (ER) stress, as also found for the anticancer agent PRIMA-1(MET)(APR-246). PK11007 may be a lead for anticancer drugs that target cells with nonfunctional p53 or impaired reactive oxygen species (ROS) detoxification in a wide variety of mutant p53 cells.
Borax-induced apoptosis in HepG2 cells involves p53, Bcl-2, and Bax.
Wei, Y; Yuan, F J; Zhou, W B; Wu, L; Chen, L; Wang, J J; Zhang, Y S
2016-06-21
Borax, a boron compound and a salt of boric acid, is known to inhibit the growth of tumor cells. HepG2 cells have been shown to be clearly susceptible to the anti-proliferative effects of borax. However, the specific mechanisms regulating this effect are poorly understood. This study aimed to investigate the pathways underlying the growth inhibition induced by borax in HepG2 cells. The effects of borax on HepG2 cell viability were characterized using MTT. Apoptosis was also verified by annexin V/propidium iodide staining. JC-1 dye and western blotting techniques were used to measure mitochondrial membrane potential and p53, Bax, and Bcl-2 protein expression, respectively. Relevant mRNA levels were measured by qRT-PCR. Borax inhibited the proliferation of HepG2 cells in a time- and dose-dependent manner in vitro. The apoptotic process triggered by borax involved the upregulation of p53 and Bax and the downregulation of Bcl-2, which was confirmed by a change in the mitochondrial membrane potential. These results elucidate a borax-induced apoptotic pathway in HepG2 cells that involves the upregulation of p53 and Bax and the downregulation of Bcl-2.
International Nuclear Information System (INIS)
Pei, Jian; Park, In-Ho; Ryu, Hyang-Hwa; Li, Song-Yuan; Li, Chun-Hao; Lim, Sa-Hoe; Wen, Min; Jang, Woo-Youl; Jung, Shin
2015-01-01
Glioblastoma is a highly lethal neoplasm that frequently recurs locally after radiotherapy, and most of these recurrences originate from near the irradiated target field. In the present study, we identified the effects of radiation on glioma invasion and p53, TIMP-2, and MMP-2 expression through in vitro and in vivo experiments. The U87MG (wt p53) and U251 (mt p53) human malignant glioma cell lines were prepared, and the U2OS (wt 53) and Saos2 (del p53) osteosarcoma cell lines were used as p53 positive and negative controls. The four cell lines and p53 knock-downed U87MG cells received radiation (2–6 Gy) and were analyzed for expression of p53 and TIMP-2 by Western blot, and MMP-2 activity was detected by zymography. In addition, the effects of irradiation on directional invasion of malignant glioma were evaluated by implanting nude mice with bioluminescent u87-Fluc in vivo followed by MMP-2, p53, and TIMP-2 immunohisto-chemistry and in situ zymography. MMP-2 activity and p53 expression increased in proportional to the radiation dose in cell lines with wt p53, but not in the cell lines with del or mt p53. TIMP-2 expression did not increase in U87MG cells. MMP-2 activity decreased in p53 knock-downed U87MG cells but increased in the control group. Furthermore, radiation enhanced MMP-2 activity and increased tumor margin invasiveness in vivo. Tumor cells invaded by radiation overexpressed MMP-2 and p53 and revealed high gelatinolytic activity compared with those of non-radiated tumor cells. Radiation-induced upregulation of p53 modulated MMP-2 activity, and the imbalance between MMP-2 and TIMP-2 may have an important role in glioblastoma invasion by degrading the extracellular matrix. Bioluminescent “U87-Fluc”was useful for observing tumor formation without sacrifice after implanting tumor cells in the mouse brain. These findings suggest that the radiotherapy involved field for malignant glioma needs to be reconsidered, and that future trials should investigate
Wang, Yiping; Wong, Matthew Man-Kin; Zhang, Xiaojian; Chiu, Sung-Kay
2015-11-15
When cells are grown to confluence, cell-cell contact inhibition occurs and drives the cells to enter reversible quiescence rather than senescence. Confluent retinal pigment epithelial (RPE) cells exhibiting contact inhibition was used as a model in this study to examine the role of overexpression of transcription factor AP4, a highly expressed transcription factor in many types of cancer, in these cells during long-term culture. We generated stable inducible RPE cell clones expressing AP4 or AP4 without the DNA binding domain (DN-AP4) and observed that, when cultured for 24 days, RPE cells with a high level of AP4 exhibit a large, flattened morphology and even cease proliferating; these changes were not observed in DN-AP4-expressing cells or non-induced cells. In addition, AP4-expressing cells exhibited senescence-associated β-galactosidase activity and the senescence-associated secretory phenotype. We demonstrated that the induced cellular senescence was mediated by enhanced p53 expression and that AP4 regulates the p53 gene by binding directly to two of the three E-boxes present on the promoter of the p53 gene. Moreover, we showed that serum is essential for AP4 in inducing p53-associated cellular senescence. Collectively, we showed that overexpression of AP4 mediates cellular senescence involving in activation of p53 in long-term post-confluent RPE cells. Copyright © 2015 Elsevier Inc. All rights reserved.
Ccdc94 protects cells from ionizing radiation by inhibiting the expression of p53.
Directory of Open Access Journals (Sweden)
Shelly Sorrells
Full Text Available DNA double-strand breaks (DSBs represent one of the most deleterious forms of DNA damage to a cell. In cancer therapy, induction of cell death by DNA DSBs by ionizing radiation (IR and certain chemotherapies is thought to mediate the successful elimination of cancer cells. However, cancer cells often evolve to evade the cytotoxicity induced by DNA DSBs, thereby forming the basis for treatment resistance. As such, a better understanding of the DSB DNA damage response (DSB-DDR pathway will facilitate the design of more effective strategies to overcome chemo- and radioresistance. To identify novel mechanisms that protect cells from the cytotoxic effects of DNA DSBs, we performed a forward genetic screen in zebrafish for recessive mutations that enhance the IR-induced apoptotic response. Here, we describe radiosensitizing mutation 7 (rs7, which causes a severe sensitivity of zebrafish embryonic neurons to IR-induced apoptosis and is required for the proper development of the central nervous system. The rs7 mutation disrupts the coding sequence of ccdc94, a highly conserved gene that has no previous links to the DSB-DDR pathway. We demonstrate that Ccdc94 is a functional member of the Prp19 complex and that genetic knockdown of core members of this complex causes increased sensitivity to IR-induced apoptosis. We further show that Ccdc94 and the Prp19 complex protect cells from IR-induced apoptosis by repressing the expression of p53 mRNA. In summary, we have identified a new gene regulating a dosage-sensitive response to DNA DSBs during embryonic development. Future studies in human cancer cells will determine whether pharmacological inactivation of CCDC94 reduces the threshold of the cancer cell apoptotic response.
International Nuclear Information System (INIS)
Vilasova, Z.; Vavrova, J.; Sinkorova, Z.; Tichy, A.; Oesterreicher, J.; Rezacova, M.; Zoelzer, F.
2008-01-01
The aim of this study was to compare reaction of quiescent and proliferating PHA (mitogenic lectin phytohemagglutinin)-stimulated human peripheral blood mononuclear cells (PBMCs) to γ-irradiation and analyze changes of proteins related to repair if DNA damage and apoptosis, such as γH2A.X, p53 and its phosphorylations on serine 15 and 392, and p21. Protein changes induced by radiation are different in quiescent and stimulated PBMCs. W e analyzed changes in proteins related to DNA damage repair and apoptosis using the western blot method in quiescent and stimulated PBMCs. Western blot technique can detect γH2A.X increase only at later times, when the phosphorylation of H2A.X is related to the onset of apoptosis (24-72 h after irradiation by the dose of 4 Gy). The level of H2A.X phosphorylation increased after stimulation of PBMC by PHA (72 h, 10 μg/ml) and as shown here it was detectable by western blot analysis. The increase in γH2A.X that we detected by western blot 4 h after irradiation of stimulated lymphocytes was dose dependent. It can be concluded that measurement of γH2A.X during the first hours after the irradiation is a good marker of the received dose of radiation. We compared the dynamics of p53 induction after irradiation by IR in both quiescent and stimulated lymphocytes. p53 increase was observed only in stimulated lymphocytes, as was p53 phosphorylation at serines-392 and -15. The increase in the amount of p53 was not dose-dependent 4 h after the irradiation. On the other hand, phosphorylation of p53 at serine-15 analyzed 4 h after the irradiation is dose-dependent over the studied dose range. Despite the fact that p53 was not detected in quiescent lymphocytes and a reaction to irradiation was not observed either, p21 levels increased after irradiation in both quiescent and stimulated lymphocytes in a dose-dependent manner. IR induces phosphorylation of p53 at both serines-15 and -392 in PHA stimulated human lymphocytes. However
Expression of Androgen Receptor Is Negatively Regulated By p53
Directory of Open Access Journals (Sweden)
Fatouma Alimirah
2007-12-01
Full Text Available Increased expression of androgen receptor (AR in prostate cancer (PC is associated with transition to androgen independence. Because the progression of PC to advanced stages is often associated with the loss of p53 function, we tested whether the p53 could regulate the expression of AR gene. Here we report that p53 negatively regulates the expression of AR in prostate epithelial cells (PrECs. We found that in LNCaP human prostate cancer cells that express the wild-type p53 and AR and in human normal PrECs, the activation of p53 by genotoxic stress or by inhibition of p53 nuclear export downregulated the expression of AR. Furthermore, forced expression of p53 in LNCaP cells decreased the expression of AR. Conversely, knockdown of p53 expression in LNCaP cells increased the AR expression. Consistent with the negative regulation of AR expression by p53, the p53-null HCT116 cells expressed higher levels of AR compared with the isogenic HCT116 cells that express the wildtype p53. Moreover, we noted that in etoposide treated LNCaP cells p53 bound to the promoter region of the AR gene, which contains a potential p53 DNA-binding consensus sequence, in chromatin immunoprecipitation assays. Together, our observations provide support for the idea that the loss of p53 function in prostate cancer cells contributes to increased expression of AR.
Down-Regulation of p53 by Double-Stranded RNA Modulates the Antiviral Response
Marques, Joao T.; Rebouillat, Dominique; Ramana, Chilakamarti V.; Murakami, Junko; Hill, Jason E.; Gudkov, Andrei; Silverman, Robert H.; Stark, George R.; Williams, Bryan R. G.
2005-01-01
p53 has been well characterized as a tumor suppressor gene, but its role in antiviral defense remains unclear. A recent report has demonstrated that p53 can be induced by interferons and is activated after vesicular stomatitis virus (VSV) infection. We observed that different nononcogenic viruses, including encephalomyocarditis virus (EMCV) and human parainfluenza virus type 3 (HPIV3), induced down-regulation of p53 in infected cells. Double-stranded RNA (dsRNA) and a mutant vaccinia virus lacking the dsRNA binding protein E3L can also induce this effect, indicating that dsRNA formed during viral infection is likely the trigger for down-regulation of p53. The mechanism of down-regulation of p53 by dsRNA relies on translation inhibition mediated by the PKR and RNase L pathways. In the absence of p53, the replication of both EMCV and HPIV3 was retarded, whereas, conversely, VSV replication was enhanced. Cell cycle analysis indicated that wild-type (WT) but not p53 knockout (KO) fibroblasts undergo an early-G1 arrest following dsRNA treatment. Moreover, in WT cells the onset of dsRNA-induced apoptosis begins after p53 levels are down-regulated, whereas p53 KO cells, which lack the early-G1 arrest, rapidly undergo apoptosis. Hence, our data suggest that the down-regulation of p53 facilitates apoptosis, thereby limiting viral replication. PMID:16103161
Effect of UV C irradiation on P53 in FADD+/+ and FADD-/- cells
International Nuclear Information System (INIS)
Matic, Igor; Radnic, Maja; Marijanovic, Inga; Furcic, Ivana; Nagy, Biserka
2008-01-01
The dominant paradigm of tumor biology is that evasion from apoptosis is one of the crucial features of malignant diseases and that the efficiency of cancer therapy depends on P53-dependent apoptosis. Because of the importance of apoptotic pathways in protecting cells against malignant transformation, disruption of apoptosis is extremely common in cancer cells, and is frequently due to mutations in the P53 tumor suppressor gene. Fas-associated death domain (FADD) is an adapter protein that is required for apoptosis induced by all known death receptors. FADD is implicated in death receptor-independent apoptotic response, such as DNA damage. We used embryonic fibroblasts derived from FADD knockout mice and their genetic counterparts. We predicted that UV exposure induces a loss of FADD function and leads to mutations in P53. Loss of FADD expression causes deregulation of apoptosis and expansion of mutated cells and initiation of cancer. We predicted that FADD dysfunction may be potentially advantageous for tumor growth and that FADD can act as a tumor suppressor. Cells were irradiated with UV C light (254 nm) using a germicidal lamp (Upland, CA). The culture media was drained before the irradiation and fresh media was added after. In the first experiment we irradiated cells with a dose of 25 J/m 2 and after 5 days we isolated genomic DNA but part of the cells were irradiated again with the same dose. After 5 days DNA were isolated so the cumulative irradiation dose was 50 J/m 2 . In the second experiment cells were irradiated ones with the dose of 40 J/m 2 and DNA was isolated after 18 days. Lethal dosage for each cell line is 50 J/m 2 . Genomic DNA was analyzed by allele-specific polymerase chain reaction (AS-PCR) for CC to TT mutation at codons 154-155 and 175-176 in exon 5 and for C to T mutations at codons 270 and 275 in exon 8 of the P53 gene. The mutant-specific forward primer was used for each mutation. The reverse primers for amplification of mutations were
Pharmacological manipulation of radiation induced apoptosis in a cervical carcinoma cell line
International Nuclear Information System (INIS)
Kamradt, M.; Mohideen, N.; Krueger, E.; Sokolova, I.A.; Khodarev, N.N; Vaughan, A.T.M.
1997-01-01
Purpose: Radiotherapy is a curative option in the treatment of early stage cervical carcinoma and radioresistant tumors limit local control and survival. Therefore, it is important to understand mechanisms by which cells evade death after irradiation. Of these, the process of apoptosis offers a useful model system to study. Tumors of the cervix offer a unique opportunity in that most contain an HPV genome expressing the E6 and E7 gene products under the control of a glucocorticoid responsive promoter. The HPV E6 and E7 proteins target p53 and/or Rb, both of which are involved in cell cycle control and in the apoptotic process. It was previously determined that treatment with the corticosteroid dexamethasone increased transcription of E6 and E7 and decreased p53 protein levels which corresponded with increased radioresistance and decreased apoptosis in C4-1 cervical carcinoma cells. The goal of this study is to demonstrate pharmacological manipulation of apoptosis within an HPV +ve cervical cell line. Methods: The HPV 18 +ve and p53 wildtype human cervical cell line C4-1 was used in this study. Apoptosis was induced by exposure to 6 Gy of gamma radiation and the ability of cells to undergo apoptosis was determined by morphology and the ability to form internucleosomal fragments using a DNA laddering technique. Cells were exposed to 0.01 to 1 μM dexamethasone in the presence or absence of 1 μM Mifepristone (RU486), a steroid antagonist and analyzed using the DNA laddering assay. In addition, cells that were irradiated in the presence of dexamethasone and/or Mifepristone were collected and p53 protein levels determined by FACS analysis. Results: Apoptosis was observed at a low level in control cells and was increased by irradiation with 6 Gy as determined by DNA laddering and morphology. The presence of 0.01 to 1 μM dexamethasone reduced both the radiation induced DNA laddering and also that seen in control cells. Addition of 1 μM Mifepristone to dexamethasone
International Nuclear Information System (INIS)
Bodis, Stephan; Pruschy, Martin; Wirbelauer, Christiane; Glanzmann, Christoph; Krek, Wilhelm
1997-01-01
Purpose: Correct advance of cells through the S-phase of the mammalian cell cycle depends on the timely controlled activity of the E2F-1 transcription factor by cyclin A-cdk2. We are studying the reproductive integrity and radiosensitation of isogenic mouse fibrosarcoma cells, differing only in their p53 status, after expression of E2F-1 wildtype (wt) and specific E2F-1 mutants (mt) lacking the cyclin-A-binding domain. In this tumor model system only p53 wild-type expressing tumor cells are sensitive to ionizing radiation in vitro and in vivo. Material and Methods: Either wild-type p53 or genetically engineered p53 'null' mouse embryo fibroblasts were transfected with the oncogenes E1A and ras. These otherwise isogenic fibrosarcoma cells, with a malignant phenotype and tumorigenic in nude mice, were transfected with retroviruses containing either E2F-1 wild-type or specific E2F-1 mutants lacking the cyclin-A binding domain. Reproductive integrity after E2F-1 transfection with or without ionizing radiation (RT) was tested using the clonogenic assay. Tumor cell morphology of treated cells is analyzed for cell death mechanism. Results: E2F-1 wild-type expression in fibrosarcoma cells induced a clear p53 dependent cell death. While clonogenic survival of p53 'null' tumor cells was only slightly reduced with the expression of E2F-1 wild type (survival fraction of 0.5), the clonogenic survival of p53 wild-type fibrosarcoma tumor cells was reduced by at least one logarithm (survival fraction of 0.05). However, expression of the specific E2F-1 mutant lacking the cyclin-A binding domain reduced clonogenic survival in both the p53 'null' and the p53 wild-type fibrosarcoma cells by at least 2 logarithms (survival fraction 0.01 for p53 'null' and 0.002 for p53 wild-type). The mean values of the survival fractions after 2 and 5 Gy radiation alone in p53 'null' fibrosarcoma cells (SF 2 and SF 5) were SF 2 0.7, SF 5 = 0.15, respectively. The combination of ionizing RT in the p53
GRIM-19 disrupts E6/E6AP complex to rescue p53 and induce apoptosis in cervical cancers.
Directory of Open Access Journals (Sweden)
Ying Zhou
Full Text Available BACKGROUND: Our previous studies showed a down-regulation of GRIM-19 in primary human cervical cancers, and restoration of GRIM-19 induced tumor regression. The induction of tumor suppressor protein p53 ubiquitination and degradation by E6 oncoportein of high risk-HPV through forming a stable complex with E6AP is considered as a critical mechanism for cervical tumor development. The aims of this study were to determine the potential role of GRIM-19 in rescuing p53 protein and inducing cervical cancer cell apoptosis. METHODOLOGY/PRINCIPAL FINDINGS: The protein levels of GRIM-19 and p53 were detected in normal cervical tissues from 45 patients who underwent hysterectomy for reasons other than neoplasias of either the cervix or endometrium, and cervical cancer tissues from 60 patients with non-metastatic squamous epithelial carcinomas. Coimmunoprecipitation and GST pull-down assay were performed to examine the interaction of GRIM-19 with 18E6 and E6AP in vivo and in vitro respectively. The competition of 18E6 with E6AP in binding GRIM-19 by performing competition pull-down assays was designed to examine the disruption of E6/E6AP complex by GRIM-19. The augment of E6AP ubiquitination by GRIM-19 was detected in vivo and in vitro ubiquitination assay. The effects of GRIM-19-dependent p53 accumulation on cell proliferation, cell cycle, apoptosis were explored by MTT, flow cytometry and transmission electron microscopy respectively. The tumor suppression was detected by xenograft mouse model. CONCLUSION/SIGNIFICANCE: The levels of GRIM-19 and p53 were concurrently down regulated in cervical cancers. The restoration of GRIM-19 can induce ubiquitination and degradation of E6AP, and disrupt the E6/E6AP complex through the interaction of N-terminus of GRIM-19 with both E6 and E6AP, which protected p53 from degradation and promoted cell apoptosis. Tumor xenograft studies also revealed the suppression of p53 degradation in presence of GRIM-19. These data
Mutant p53 protein localized in the cytoplasm inhibits autophagy.
Morselli, Eugenia; Tasdemir, Ezgi; Maiuri, Maria Chiara; Galluzzi, Lorenzo; Kepp, Oliver; Criollo, Alfredo; Vicencio, José Miguel; Soussi, Thierry; Kroemer, Guido
2008-10-01
The knockout, knockdown or chemical inhibition of p53 stimulates autophagy. Moreover, autophagy-inducing stimuli such as nutrient depletion, rapamycin or lithium cause the depletion of cytoplasmic p53, which in turn is required for the induction of autophagy. Here, we show that retransfection of p53(-/-) HCT 116 colon carcinoma cells with wild type p53 decreases autophagy down to baseline levels. Surprisingly, one third among a panel of 22 cancer-associated p53 single amino acid mutants also inhibited autophagy when transfected into p53(-/-) cells. Those variants of p53 that preferentially localize to the cytoplasm effectively repressed autophagy, whereas p53 mutants that display a prominently nuclear distribution failed to inhibit autophagy. The investigation of a series of deletion mutants revealed that removal of the DNA-binding domain from p53 fails to interfere with its role in the regulation of autophagy. Altogether, these results identify the cytoplasmic localization of p53 as the most important feature for p53-mediated autophagy inhibition. Moreover, the structural requirements for the two biological activities of extranuclear p53, namely induction of apoptosis and inhibition of autophagy, are manifestly different.
The critical role of catalase in prooxidant and antioxidant function of p53
Kang, M Y; Kim, H-B; Piao, C; Lee, K H; Hyun, J W; Chang, I-Y; You, H J
2013-01-01
The tumor suppressor p53 is an important regulator of intracellular reactive oxygen species (ROS) levels, although downstream mediators of p53 remain to be elucidated. Here, we show that p53 and its downstream targets, p53-inducible ribonucleotide reductase (p53R2) and p53-inducible gene 3 (PIG3), physically and functionally interact with catalase for efficient regulation of intracellular ROS, depending on stress intensity. Under physiological conditions, the antioxidant functions of p53 are mediated by p53R2, which maintains increased catalase activity and thereby protects against endogenous ROS. After genotoxic stress, high levels of p53 and PIG3 cooperate to inhibit catalase activity, leading to a shift in the oxidant/antioxidant balance toward an oxidative status, which could augment apoptotic cell death. These results highlight the essential role of catalase in p53-mediated ROS regulation and suggest that the p53/p53R2–catalase and p53/PIG3–catalase pathways are critically involved in intracellular ROS regulation under physiological conditions and during the response to DNA damage, respectively. PMID:22918438
Energy Technology Data Exchange (ETDEWEB)
Lin, Chien-Ju [Graduate Institute of Medical Sciences, Taipei Medical University, Taipei, Taiwan (China); Comprehensive Cancer Center, Taipei Medical University, Taipei, Taiwan (China); Chen, Ta-Liang [Anesthetics and Toxicology Research Center, Taipei Medical University Hospital, Taipei, Taiwan (China); Department of Anesthesiology, Taipei Medical University Hospital, Taipei, Taiwan (China); Tseng, Yuan-Yun [Department of Neurosurgery, Shuang-Ho Hospital, Taipei Medical University, Taipei, Taiwan (China); Wu, Gong-Jhe [Department of Anesthesiology, Shin Kong Wu Ho-Su Memorial Hospital, Taipei, Taiwan (China); Hsieh, Ming-Hui [Anesthetics and Toxicology Research Center, Taipei Medical University Hospital, Taipei, Taiwan (China); Department of Anesthesiology, Taipei Medical University Hospital, Taipei, Taiwan (China); Lin, Yung-Wei [Brain Disease Research Center, Taipei Medical University Wan-Fang Hospital, Taipei, Taiwan (China); Chen, Ruei-Ming, E-mail: rmchen@tmu.edu.tw [Graduate Institute of Medical Sciences, Taipei Medical University, Taipei, Taiwan (China); Anesthetics and Toxicology Research Center, Taipei Medical University Hospital, Taipei, Taiwan (China); Brain Disease Research Center, Taipei Medical University Wan-Fang Hospital, Taipei, Taiwan (China); Comprehensive Cancer Center, Taipei Medical University, Taipei, Taiwan (China)
2016-08-01
Honokiol, an active constituent extracted from the bark of Magnolia officinalis, possesses anticancer effects. Apoptosis is classified as type I programmed cell death, while autophagy is type II programmed cell death. We previously proved that honokiol induces cell cycle arrest and apoptosis of U87 MG glioma cells. Subsequently in this study, we evaluated the effect of honokiol on autophagy of glioma cells and examined the molecular mechanisms. Administration of honokiol to mice with an intracranial glioma increased expressions of cleaved caspase 3 and light chain 3 (LC3)-II. Exposure of U87 MG cells to honokiol also induced autophagy in concentration- and time-dependent manners. Results from the addition of 3-methyladenine, an autophagy inhibitor, and rapamycin, an autophagy inducer confirmed that honokiol-induced autophagy contributed to cell death. Honokiol decreased protein levels of PI3K, phosphorylated (p)-Akt, and p-mammalian target of rapamycin (mTOR) in vitro and in vivo. Pretreatment with a p53 inhibitor or transfection with p53 small interfering (si)RNA suppressed honokiol-induced autophagy by reversing downregulation of p-Akt and p-mTOR expressions. In addition, honokiol caused generation of reactive oxygen species (ROS), which was suppressed by the antioxidant, vitamin C. Vitamin C also inhibited honokiol-induced autophagic and apoptotic cell death. Concurrently, honokiol-induced alterations in levels of p-p53, p53, p-Akt, and p-mTOR were attenuated following vitamin C administration. Taken together, our data indicated that honokiol induced ROS-mediated autophagic cell death through regulating the p53/PI3K/Akt/mTOR signaling pathway. - Highlights: • Exposure of mice with intracranial gliomas to honokiol induces cell apoptosis and autophagy. • Honokiol triggers autophagy of human glioma cells via the PISK/AKT/mTOR signaling pathway. • P53 induces autophagy via regulating the AKT/mTOR pathway in honokiol-treated glioma cells. • ROS participates
International Nuclear Information System (INIS)
Zhang, Hongling; Huang, Yong; Du, Qian; Luo, Xiaomao; Zhang, Liang; Zhao, Xiaomin; Tong, Dewen
2015-01-01
Highlights: • PPV reduces PK-15 cells viability by inducing apoptosis. • PPV infection induces apoptosis through mitochondria-mediated pathway. • PPV infection activates p53 to regulate the mitochondria apoptotic signaling. - Abstract: Porcine parvovirus (PPV) infection has been reported to induce the cytopathic effects (CPE) in some special host cells and contribute the occurrence of porcine parvovirus disease, but the molecular mechanisms underlying PPV-induced CPE are not clear. In this study, we investigated the morphological and molecular changes of porcine kidney cell line (PK-15 cells) infected with PPV. The results showed that PPV infection inhibited the viability of PK-15 cells in a time and concentration dependent manner. PPV infection induced typical apoptotic features including chromatin condensation, apoptotic body formation, nuclear fragmentation, and Annexin V-binding activity. Further studies showed that Bax was increased and translocated to mitochondria, whereas Bcl-2 was decreased in PPV-infected cells, which caused mitochondrial outer-membrane permeabilization, resulting in the release of mitochondrial cytochrome c, followed by caspase-9 and caspase-3 activation. However, the expression of Fas and Fas ligand (FasL) did not appear significant changes in the process of PPV-induced apoptosis. Moreover, PPV infection activated p53 signaling, which was involved in the activation of apoptotic signaling induced by PPV infection via regulation of Bax and Bcl-2. Taken together, our results demonstrated that PPV infection induced apoptosis in PK-15 cells through activation of p53 and mitochondria-mediated apoptosis pathway. This study may contribute to shed light on the molecular pathogenesis of PPV infection
Energy Technology Data Exchange (ETDEWEB)
Zhang, Hongling; Huang, Yong; Du, Qian; Luo, Xiaomao; Zhang, Liang; Zhao, Xiaomin; Tong, Dewen, E-mail: dwtong@nwsuaf.edu.cn
2015-01-09
Highlights: • PPV reduces PK-15 cells viability by inducing apoptosis. • PPV infection induces apoptosis through mitochondria-mediated pathway. • PPV infection activates p53 to regulate the mitochondria apoptotic signaling. - Abstract: Porcine parvovirus (PPV) infection has been reported to induce the cytopathic effects (CPE) in some special host cells and contribute the occurrence of porcine parvovirus disease, but the molecular mechanisms underlying PPV-induced CPE are not clear. In this study, we investigated the morphological and molecular changes of porcine kidney cell line (PK-15 cells) infected with PPV. The results showed that PPV infection inhibited the viability of PK-15 cells in a time and concentration dependent manner. PPV infection induced typical apoptotic features including chromatin condensation, apoptotic body formation, nuclear fragmentation, and Annexin V-binding activity. Further studies showed that Bax was increased and translocated to mitochondria, whereas Bcl-2 was decreased in PPV-infected cells, which caused mitochondrial outer-membrane permeabilization, resulting in the release of mitochondrial cytochrome c, followed by caspase-9 and caspase-3 activation. However, the expression of Fas and Fas ligand (FasL) did not appear significant changes in the process of PPV-induced apoptosis. Moreover, PPV infection activated p53 signaling, which was involved in the activation of apoptotic signaling induced by PPV infection via regulation of Bax and Bcl-2. Taken together, our results demonstrated that PPV infection induced apoptosis in PK-15 cells through activation of p53 and mitochondria-mediated apoptosis pathway. This study may contribute to shed light on the molecular pathogenesis of PPV infection.
Saha, Manujendra N; Jiang, Hua; Mukai, Asuka; Chang, Hong
2010-11-01
Mutations or deletions of p53 are relatively rare in multiple myeloma (MM), at least in newly diagnosed patients. Thus, restoration of p53 tumor suppressor function in MM by blocking the inhibitory role of murine double minute 2 (MDM2) is a promising and applicable therapeutic strategy. RITA and nutlin are two new classes of small molecule MDM2 inhibitors that prevent the p53-MDM2 interaction. Earlier reports showed p53-dependent activity of RITA in solid tumors as well as in leukemias. We and others recently described nutlin-induced apoptosis in MM cells, but it remains unclear whether RITA exerts antimyeloma activity. Here, we found that RITA activates the p53 pathway and induces apoptosis in MM cell lines and primary MM samples, preferentially killing myeloma cells. The activation of p53 induced by RITA was mediated through modulation of multiple apoptotic regulatory proteins, including upregulation of a proapoptotic protein (NOXA), downregulation of an antiapoptotic protein, Mcl-1, and activation of caspases through extrinsic pathways. Moreover, a number of key p53-mediated apoptotic target genes were identified by gene expression profiling and further validated by quantitative real-time PCR. Importantly, the combination of RITA with nutlin displayed a strong synergism on growth inhibition with the combination index ranging from 0.56 to 0.82 in MM cells. Our data support further clinical evaluation of RITA as a potential novel therapeutic intervention in MM. ©2010 AACR.
Influence of radiation-induced apoptosis on development brain in molecular regulation
International Nuclear Information System (INIS)
Gu Guixiong
2000-01-01
An outline of current status on the influence of radiation on the development brain was given. Some genes as immediate early gene, Bcl-2 family, p53, heat shock protein and AT gene play an important regulation role in ionizing radiation-induced development brain cells apoptosis. And such biological factor as nerve growth factor, interleukin-1, tumor necrosis factor, basic fibroblast growth factor, transforming growth factor and so on have a vital protection function against ionizing radiation-induced cells apoptosis
Chk1 inhibition activates p53 through p38 MAPK in tetraploid cancer cells.
Vitale, Ilio; Senovilla, Laura; Galluzzi, Lorenzo; Criollo, Alfredo; Vivet, Sonia; Castedo, Maria; Kroemer, Guido
2008-07-01
We have previously shown that tetraploid cancer cells succumb through a p53-dependent apoptotic pathway when checkpoint kinase 1 (Chk1) is depleted by small interfering RNAs (siRNAs) or inhibited with 7-hydroxystaurosporine (UCN-01). Here, we demonstrate that Chk1 inhibition results in the activating phosphorylation of p38 mitogen-activated protein kinase (p38 MAPK). Depletion of p38 MAPK by transfection with a siRNA targeting the alpha isoform of p38 MAPK (p38alpha MAPK) abolishes the phosphorylation of p53 on serines 15 and 46 that is induced by Chk1 knockdown. The siRNA-mediated downregulation and pharmacological inhibition of p38alpha MAPK (with SB 203580) also reduces cell death induced by Chk1 knockdown or UCN-01. These results underscore the role of p38 MAPK as a pro-apoptotic kinase in the p53-dependant pathway for the therapeutic elimination of polyploidy cells.
Quiescence does not affect p53 and stress response by irradiation in human lung fibroblasts
Energy Technology Data Exchange (ETDEWEB)
Dai, Jiawen [Molecular Radiobiology Laboratory, Division of Cellular and Molecular Research (Singapore); Itahana, Koji, E-mail: koji.itahana@duke-nus.edu.sg [Cancer and Stem Cell Biology Program, Duke-NUS Graduate Medical School (Singapore); Baskar, Rajamanickam, E-mail: r.baskar@nccs.com.sg [Molecular Radiobiology Laboratory, Division of Cellular and Molecular Research (Singapore); Department of Radiation Oncology, National Cancer Centre (Singapore)
2015-02-27
Cells in many organs exist in both proliferating and quiescent states. Proliferating cells are more radio-sensitive, DNA damage pathways including p53 pathway are activated to undergo either G{sub 1}/S or G{sub 2}/M arrest to avoid entering S and M phase with DNA damage. On the other hand, quiescent cells are already arrested in G{sub 0}, therefore there may be fundamental difference of irradiation response between proliferating and quiescent cells, and this difference may affect their radiosensitivity. To understand these differences, proliferating and quiescent human normal lung fibroblasts were exposed to 0.10–1 Gy of γ-radiation. The response of key proteins involved in the cell cycle, cell death, and metabolism as well as histone H2AX phosphorylation were examined. Interestingly, p53 and p53 phosphorylation (Ser-15), as well as the cyclin-dependent kinase inhibitors p21 and p27, were induced similarly in both proliferating and quiescent cells after irradiation. Furthermore, the p53 protein half-life, and expression of cyclin A, cyclin E, proliferating cell nuclear antigen (PCNA), Bax, or cytochrome c expression as well as histone H2AX phosphorylation were comparable after irradiation in both phases of cells. The effect of radioprotection by a glycogen synthase kinase 3β inhibitor on p53 pathway was also similar between proliferating and quiescent cells. Our results showed that quiescence does not affect irradiation response of key proteins involved in stress and DNA damage at least in normal fibroblasts, providing a better understanding of the radiation response in quiescent cells, which is crucial for tissue repair and regeneration. - Highlights: • p53 response by irradiation was similar between proliferating and quiescent cells. • Quiescent cells showed similar profiles of cell cycle proteins after irradiation. • Radioprotection of GSK-3β inhibitor caused similar effects between these cells. • Quiescence did not affect p53 response despite its
Quiescence does not affect p53 and stress response by irradiation in human lung fibroblasts
International Nuclear Information System (INIS)
Dai, Jiawen; Itahana, Koji; Baskar, Rajamanickam
2015-01-01
Cells in many organs exist in both proliferating and quiescent states. Proliferating cells are more radio-sensitive, DNA damage pathways including p53 pathway are activated to undergo either G 1 /S or G 2 /M arrest to avoid entering S and M phase with DNA damage. On the other hand, quiescent cells are already arrested in G 0 , therefore there may be fundamental difference of irradiation response between proliferating and quiescent cells, and this difference may affect their radiosensitivity. To understand these differences, proliferating and quiescent human normal lung fibroblasts were exposed to 0.10–1 Gy of γ-radiation. The response of key proteins involved in the cell cycle, cell death, and metabolism as well as histone H2AX phosphorylation were examined. Interestingly, p53 and p53 phosphorylation (Ser-15), as well as the cyclin-dependent kinase inhibitors p21 and p27, were induced similarly in both proliferating and quiescent cells after irradiation. Furthermore, the p53 protein half-life, and expression of cyclin A, cyclin E, proliferating cell nuclear antigen (PCNA), Bax, or cytochrome c expression as well as histone H2AX phosphorylation were comparable after irradiation in both phases of cells. The effect of radioprotection by a glycogen synthase kinase 3β inhibitor on p53 pathway was also similar between proliferating and quiescent cells. Our results showed that quiescence does not affect irradiation response of key proteins involved in stress and DNA damage at least in normal fibroblasts, providing a better understanding of the radiation response in quiescent cells, which is crucial for tissue repair and regeneration. - Highlights: • p53 response by irradiation was similar between proliferating and quiescent cells. • Quiescent cells showed similar profiles of cell cycle proteins after irradiation. • Radioprotection of GSK-3β inhibitor caused similar effects between these cells. • Quiescence did not affect p53 response despite its known role in
Lin, Ke; Sherrington, Paul D; Dennis, Michael; Matrai, Zoltan; Cawley, John C; Pettitt, Andrew R
2002-08-15
Established adverse prognostic factors in chronic lymphocytic leukemia (CLL) include CD38 expression, relative lack of IgV(H) mutation, and defects of the TP53 gene. However, disruption of the p53 pathway can occur through mechanisms other than TP53 mutation, and we have recently developed a simple screening test that detects p53 dysfunction due to mutation of the genes encoding either p53 or ATM, a kinase that regulates p53. The present study was conducted to examine the predictive value of this test and to establish the relationship between p53 dysfunction, CD38 expression, and IgV(H) mutation. CLL cells from 71 patients were examined for IgV(H) mutation, CD38 expression, and p53 dysfunction (detected as an impaired p53/p21 response to ionizing radiation). Survival data obtained from 69 patients were analyzed according to each of these parameters. Relative lack of IgV(H) mutation (less than 5%; n = 45), CD38 positivity (antigen expressed on more than 20% of malignant cells; n = 19), and p53 dysfunction (n = 19) were independently confirmed as adverse prognostic factors. Intriguingly, all p53-dysfunctional patients and all but one of the CD38(+) patients had less [corrected] than 5% IgV(H) mutation. Moreover, patients with p53 dysfunction and/or CD38 positivity (n = 31) accounted for the short survival of the less mutated group. These findings indicate that the poor outcome associated with having less than 5% IgV(H) mutation may be due to the overrepresentation of high-risk patients with p53 dysfunction and/or CD38 positivity within this group, and that CD38(-) patients with functionally intact p53 may have a prolonged survival regardless of the extent of IgV(H) mutation.
Cellular response to DNA damage. Link between p53 and DNA-PK
International Nuclear Information System (INIS)
Salles-Passador, I.; Fotedar, R.; Fotedar, A.
1999-01-01
Cells which lack DNA-activated protein kinase (DNA-PK) are very susceptible to ionizing radiation and display an inability to repair double-strand DNA breaks. DNA-PK is a member of a protein kinase family that includes ATR and ATM which have strong homology in their carboxy-terminal kinase domain with Pl-3 kinase. ATM has been proposed to act upstream of p53 in cellular response to ionizing radiation. DNA-PK may similarly interact with p53 in cellular growth control and in mediation of the response to ionizing radiation. (author)
ZNF307, a novel zinc finger gene suppresses p53 and p21 pathway
International Nuclear Information System (INIS)
Li Jing; Wang Yuequn; Fan Xiongwei; Mo Xiaoyang; Wang Zequn; Li Yongqing; Yin Zhaochu; Deng Yun; Luo Na; Zhu Chuanbing; Liu Mingyao; Ma Qian; Ocorr, Karen; Yuan Wuzhou; Wu Xiushan
2007-01-01
We have cloned a novel KRAB-related zinc finger gene, ZNF307, encoding a protein of 545 aa. ZNF307 is conserved across species in evolution and is differentially expressed in human adult and fetal tissues. The fusion protein of EGFP-ZNF307 localizes in the nucleus. Transcriptional activity assays show ZNF307 suppresses transcriptional activity of L8G5-luciferase. Overexpressing ZNF307 in different cell lines also inhibits the transcriptional activities of p53 and p21. Moreover, ZNF307 works by reducing the p53 protein level and p53 protein reduction is achieved by increasing transcription of MDM2 and EP300. ZNF307 might suppress p53-p21 pathway through activating MDM2 and EP300 expression and inducing p53 degradation
International Nuclear Information System (INIS)
Li Xia; Wu, William K.K.; Sun Bin; Cui Min; Liu Shanshan; Gao Jian; Lou Hongxiang
2011-01-01
Dihydroptychantol A (DHA), a novel macrocyclic bisbibenzyl compound extracted from liverwort Asterella angusta, has antifungal and multi-drug resistance reversal properties. Here, the chemically synthesized DHA was employed to test its anti-cancer activities in human osteosarcoma U2OS cells. Our results demonstrated that DHA induced autophagy followed by apoptotic cell death accompanied with G 2 /M-phase cell cycle arrest in U2OS cells. DHA-induced autophagy was morphologically characterized by the formation of double membrane-bound autophagic vacuoles recognizable at the ultrastructural level. DHA also increased the levels of LC3-II, a marker of autophagy. Surprisingly, DHA-mediated apoptotic cell death was potentiated by the autophagy inhibitor 3-methyladenine, suggesting that autophagy may play a protective role that impedes the eventual cell death. Furthermore, p53 was shown to be involved in DHA-meditated autophagy and apoptosis. In this connection, DHA increased nuclear expression of p53, induced p53 phosphorylation, and upregulated p53 target gene p21 Waf1/Cip1 . In contrast, cytoplasmic p53 was reduced by DHA, which contributed to the stimulation of autophagy. In relation to the cell cycle, DHA decreased the expression of cyclin B 1 , a cyclin required for progression through the G 2 /M phase. Taken together, DHA induces G 2 /M-phase cell cycle arrest and apoptosis in U2OS cells. DHA-induced apoptosis was preceded by the induction of protective autophagy. DHA-mediated autophagy and apoptosis are associated with the cytoplasmic and nuclear functions of p53.
Directory of Open Access Journals (Sweden)
Othman A. Al-Shabanah
2012-01-01
Full Text Available Interaction of doxorubicin DOX with iron and the consequent generation of reactive oxygen species (ROS is a major player in DOX-induced cardiomyopathy. Accordingly, this study has been initiated to investigate the preventive effect of the iron chelator, desferrioxamine (DFX, against DOX-induced acute cardiotoxicity in rats. Male Wistar albino rats were divided into four groups and were injected intraperitoneally (I.P. with normal saline, a single dose of DOX (15 mg/kg, a single dose of DFX (250 mg/kg and a combined treatment with DFX (250 mg/kg 30 min prior to a single dose of DOX, (15 mg/kg. A single dose of DOX significantly increased mRNA expression of TGF-β, Smad2, Smad4, CDKN2A and p53 and significantly decreased Samd7 and Mdm2 mRNA expression levels. Administration of DFX prior to DOX resulted in a complete reversal of DOX-induced alteration in cardiac enzymes and gene expression to normal levels. Data from this study suggest that (1 DOX induces its acute cardiotoxicity secondary to increasing genes expression of TGF-β/Smad pathway. (2 DOX increases apoptosis through upregulation of CDKN2A and p53 and downregulation of Mdm2 gene expression. (3 The preventive effect of DFX against DOX-induced cardiotoxicity is mediated via the TGF-β1/Smad pathway.
[Punish or cherish: p53, metabolism and tumor suppression].
Albagli, Olivier
2015-10-01
The p53 gene is essential for tumor suppression, but how it does so remains unclear. Upon genotoxic or oncogenic stresses, increased p53 activity induces transient cell cycle arrest, senescence or apoptosis, the three cornerstones of the so-called triumvirate. Accordingly, it has long been thought that p53 suppresses tumorigenesis by somehow counteracting cell proliferation or survival. However, several recently described genetically modified mice indicate that p53 can suppress tumorigenesis without triggering these three responses. Rather, as an important mechanism for tumor suppression, these mutant mice point to the ability of p53 to prevent the Warburg effect, that is to dampen glycolysis and foster mitochondrial respiration. Interestingly, these metabolic functions of p53 rely, in part, on its "unstressed" (basal) expression, a feature shared by its mechanistically linked anti-oxydant function. Together, these "conservative" activities of p53 may prevent tumor initiation by promoting and maintaining a normal oxidative metabolism and hence underly the "daily" tumor suppression by p53 in most cells. Conversely, destructive activities elicited by high p53 levels and leading to senescence or apoptosis provide a shield against partially or overtly transformed cells. This last situation, although relatively infrequent throughout life, is usual in experimental settings, which could explain the disproportionally high number of data implicating the triumvirate in tumor suppression by p53. © 2015 médecine/sciences – Inserm.
Ching, L Y; Yeung, Bonnie H Y; Wong, Chris K C
2012-06-01
Human stanniocalcin 1 (STC1) has recently been identified as a putative protein factor involved in cellular apoptosis. The use of histone deacetylase inhibitor (i.e. trichostatin A (TSA)) and doxorubicin (Dox) is one of the common treatment methods to induce apoptosis in human cancer cells. A study on TSA and Dox-mediated apoptosis may shed light on the regulation and function of STC1 in cancer treatment. In this study, TSA and Dox cotreatment in human nasopharyngeal carcinoma cells (CNE2) elicited synergistic effects on STC1 gene expression and cellular apoptosis. An activation of p53 (TP53) transcriptional activity in Dox- or Dox+TSA-treated cells was revealed by the increased expression levels of p53 mRNA/protein as well as p53-driven luciferase activities. To elucidate the possible involvement of p53 in STC1 gene transcription, a vector expressing wild-type or dominant negative (DN) p53 was transiently transfected into the cells. Both STC1 promoter luciferase constructs and chromatin immunoprecipitation assays did not support the direct role of p53 in STC1 gene transactivation. However, the synergistic effects of p53 on the induction of NF-κB phosphorylation and the recruitment of acetylated histone H3 in STC1 promoter were observed in TSA-cotreated cells. The overexpression of exogenous STC1 sensitized apoptosis in Dox-treated cells. Taken together, this study provides data to show the cross talk of NF-κB, p53, and histone protein in the regulation of STC1 expression and function.
International Nuclear Information System (INIS)
Liu Zhaojian; Liu Qiao; Xu Bing; Wu Jingjing; Guo Chun; Zhu Faliang; Yang Qiaozi; Gao Guimin; Gong Yaoqin; Shao Changshun
2009-01-01
Alkaloid berberine is widely used for the treatment of diarrhea and other diseases. Many laboratory studies showed that it exhibits anti-proliferative activity against a wide spectrum of cancer cells in culture. In this report we studied the mechanisms underlying the inhibitory effects of berberine on human osteosarcoma cells and on normal osteoblasts. The inhibition was largely attributed to cell cycle arrest at G1 and G2/M, and to a less extent, to apoptosis. The G1 arrest was dependent on p53, as G1 arrest was abolished in p53-deficient osteosarcoma cells. The induction of G1 arrest and apoptosis was accompanied by a p53-dependent up-regulation of p21 and pro-apoptotic genes. However, the G2/M arrest could be induced by berberine regardless of the status of p53. Interestingly, DNA double-strand breaks, as measured by the phosphorylation of H2AX, were remarkably accumulated in berberine-treated cells in a dose-dependent manner. Thus, one major mechanism by which berberine exerts its growth-inhibitory effect is to inflict genomic lesions on cells, which in turn trigger the activation of p53 and the p53-dependent cellular responses including cell cycle arrest and apoptosis
Energy Technology Data Exchange (ETDEWEB)
Liu Zhaojian; Liu Qiao; Xu Bing; Wu Jingjing [Key Laboratory of Experimental Teratology of Ministry of Education and Institute of Molecular Medicine and Genetics, Shandong University School of Medicine, Jinan, Shandong 250012 (China); Guo Chun; Zhu Faliang [Institute of Immunology, Shandong University School of Medicine, Jinan, Shandong 250012 (China); Yang Qiaozi [Department of Genetics, Rutgers University, Piscataway, NJ 08854 (United States); Gao Guimin [Key Laboratory of Experimental Teratology of Ministry of Education and Institute of Molecular Medicine and Genetics, Shandong University School of Medicine, Jinan, Shandong 250012 (China); Gong Yaoqin [Key Laboratory of Experimental Teratology of Ministry of Education and Institute of Molecular Medicine and Genetics, Shandong University School of Medicine, Jinan, Shandong 250012 (China)], E-mail: yxg8@sdu.edu.cn; Shao Changshun [Key Laboratory of Experimental Teratology of Ministry of Education and Institute of Molecular Medicine and Genetics, Shandong University School of Medicine, Jinan, Shandong 250012 (China); Department of Genetics, Rutgers University, Piscataway, NJ 08854 (United States)], E-mail: shao@biology.rutgers.edu
2009-03-09
Alkaloid berberine is widely used for the treatment of diarrhea and other diseases. Many laboratory studies showed that it exhibits anti-proliferative activity against a wide spectrum of cancer cells in culture. In this report we studied the mechanisms underlying the inhibitory effects of berberine on human osteosarcoma cells and on normal osteoblasts. The inhibition was largely attributed to cell cycle arrest at G1 and G2/M, and to a less extent, to apoptosis. The G1 arrest was dependent on p53, as G1 arrest was abolished in p53-deficient osteosarcoma cells. The induction of G1 arrest and apoptosis was accompanied by a p53-dependent up-regulation of p21 and pro-apoptotic genes. However, the G2/M arrest could be induced by berberine regardless of the status of p53. Interestingly, DNA double-strand breaks, as measured by the phosphorylation of H2AX, were remarkably accumulated in berberine-treated cells in a dose-dependent manner. Thus, one major mechanism by which berberine exerts its growth-inhibitory effect is to inflict genomic lesions on cells, which in turn trigger the activation of p53 and the p53-dependent cellular responses including cell cycle arrest and apoptosis.
Taylor, Lisa M; James, Alexander; Schuller, Christine E; Brce, Jesena; Lock, Richard B; Mackenzie, Karen L
2004-10-15
Recent investigations, including our own, have shown that specific strains of fibroblasts expressing telomerase reverse transcriptase (hTERT) have an extended lifespan, but are not immortal. We previously demonstrated that hTERT-transduced MRC5 fetal lung fibroblasts (MRC5hTERTs) bypassed senescence but eventually succumbed to a second mortality barrier (crisis). In the present study, 67 MRC5hTERT clones were established by limiting dilution of a mass culture. Whereas 39/67 clones had an extended lifespan, all 39 extended lifespan clones underwent crisis. 11 of 39 clones escaped crisis and were immortalized. There was no apparent relationship between the fate of clones at crisis and the level of telomerase activity. Telomeres were hyperextended in the majority of the clones analyzed. There was no difference in telomere length of pre-crisis compared with post-crisis and immortal clones, indicating that hyperextended telomeres were conducive for immortalization and confirming that crisis was independent of telomere length. Immortalization of MRC5hTERT cells was associated with repression of the cyclin-dependent kinase inhibitor p16INK4a and up-regulation of pRB. However, the regulation of pRB phosphorylation and the response of the p53/p21cip1/waf1 pathway were normal in immortal cells subject to genotoxic stress. Overexpression of oncogenic ras failed to de-repress p16INK4a in immortal cells. Furthermore, expression of ras enforced senescent-like growth arrest in p16INK4a-positive, but not p16INK4a-negative MRC5hTERT cells. Immortal cells expressing ras formed small, infrequent colonies in soft agarose, but were non-tumorigenic. Overall, these results implicate the inactivation of p16INK4a as a critical event for overcoming telomere-independent crisis, immortalizing MRC5 fibroblasts and overcoming ras-induced premature senescence.
DEFF Research Database (Denmark)
Møller, Michael Boe; Ino, Y; Gerdes, A M
1999-01-01
The two gene products of the CDKN2A gene, p16 and p19ARF, have recently been linked to each of two major tumour suppressor pathways in human carcinogenesis, the RB1 pathway and the p53 pathway. p16 inhibits the phosphorylation of the retinoblastoma gene product by cyclin D-dependent kinases...
TAF6delta controls apoptosis and gene expression in the absence of p53.
Directory of Open Access Journals (Sweden)
Emmanuelle Wilhelm
Full Text Available BACKGROUND: Life and death decisions of metazoan cells hinge on the balance between the expression of pro- versus anti-apoptotic gene products. The general RNA polymerase II transcription factor, TFIID, plays a central role in the regulation of gene expression through its core promoter recognition and co-activator functions. The core TFIID subunit TAF6 acts in vitro as an essential co-activator of transcription for the p53 tumor suppressor protein. We previously identified a splice variant of TAF6, termed TAF6delta that can be induced during apoptosis. METHODOLOGY/PRINCIPAL FINDINGS: To elucidate the impact of TAF6delta on cell death and gene expression, we have employed modified antisense oligonucleotides to enforce expression of endogenous TAF6delta. The induction of endogenous TAF6delta triggered apoptosis in tumor cell lines, including cells devoid of p53. Microarray experiments revealed that TAF6delta activates gene expression independently of cellular p53 status. CONCLUSIONS: Our data define TAF6delta as a pivotal node in a signaling pathway that controls gene expression programs and apoptosis in the absence of p53.
High LET Radiation Can Enhance TGF(Beta) Induced EMT and Cross-Talk with ATM Pathways
Wang, Minli; Hada, Megumi; Huff, Janice; Pluth, Janice M.; Anderson, Janniffer; ONeill, Peter; Cucinotta, Francis A.
2010-01-01
The TGF(Beta) pathway has been shown to regulate or directly interact with the ATM pathway in the response to radiation in mammary epithelial cells. We investigated possible interactions between the TGF(Beta) and ATM pathways following simulated space radiation using hTERT immortalized human esophageal epithelial cells (EPC-hTERT), mink lung epithelial cells (Mv1lu), and several human fibroblast cell lines. TGF(Beta) is a key modulator of the Epithelial-Mesenchymal Transition (EMT), important in cancer progression and metastasis. The implication of EMT by radiation also has several lines of developing evidence, however is poorly understood. The identification of TGF(Beta) induced EMT can be shown in changes to morphology, related gene over expression or down regulation, which can be detected by RT-PCR, and immunostaining and western blotting. In this study, we have observed morphologic and molecular alternations consistent with EMT after Mv1lu cells were treated with TGF(Beta) High LET radiation enhanced TGF(Beta) mediated EMT with a dose as low as 0.1Gy. In order to consider the TGF(Beta) interaction with ATM we used a potent ATM inhibitor Ku55933 and investigated gene expression changes and Smad signaling kinetics. Ku559933 was observed to reverse TGF(Beta) induced EMT, while this was not observed in dual treated cells (radiation+TGF(Beta)). In EPC-hTERT cells, TGF(Beta) alone was not able to induce EMT after 3 days of application. A combined treatment with high LET, however, significantly caused the alteration of EMT markers. To study the function of p53 in the process of EMT, we knocked down P53 through RNA interference. Morphology changes associated with EMT were observed in epithelial cells with silenced p53. Our study indicates: high LET radiation can enhance TGF(Beta) induced EMT; while ATM is triggering the process of TGF(Beta)-induced EMT, p53 might be an essential repressor for EMT phenotypes.
Directory of Open Access Journals (Sweden)
Shiwang Li
Full Text Available Neuroblastoma is the most common extracranial solid tumor of childhood. It accounts for 15% of pediatric cancer deaths. Chemotherapy is the mainstay of treatment in children with advanced neuroblastoma. Noscapine, a nontoxic natural compound, can trigger apoptosis in many cancer types. We now show that p53 is dispensable for Noscapine-induced cell death in neuroblastoma cell lines, proapoptotic response to this promising chemopreventive agent is mediated by suppression of survivin protein expression. The Noscapine treatment increased levels of total and Ser(15-phosphorylated p53 protein in SK-SY5Y cells, but the proapoptotic response to this agent was maintained even after knockdown of the p53 protein level. Exposure of SK-SY5Y and LA1-5S cells to Noscapine resulted in a marked decrease in protein and mRNA level of survivin as early as 12 hours after treatment. Ectopic expression of survivin conferred statistically significant protection against Noscapine-mediated cytoplasmic histone-associated apoptotic DNA fragmentation. Also, the Noscapine-induced apoptosis was modestly but statistically significantly augmented by RNA interference of survivin in both cell lines. Furthermore, Noscapine-induced apoptotic cell death was associated with activation of caspase-3 and cleavage of PARP. In conclusion, the present study provides novel insight into the molecular circuitry of Noscapine-induced apoptosis to indicate suppression of survivin expression as a critical mediator of this process.
Directory of Open Access Journals (Sweden)
Kumari Ratna
2010-07-01
Full Text Available Abstract Background p53 is the most studied tumor suppressor and its overexpression may or may not cause cell death depending upon the genetic background of the cells. p53 is degraded by human papillomavirus (HPV E6 protein in cervical carcinoma. Several stress activated kinases are known to phosphorylate p53 and, among them cyclin dependent kinase 5 (Cdk5 is one of the kinase studied in neuronal cell system. Recently, the involvement of Cdk5 in phosphorylating p53 has been shown in certain cancer types. Phosphorylation at specific serine residues in p53 is essential for it to cause cell growth inhibition. Activation of p53 under non stress conditions is poorly understood. Therefore, the activation of p53 and detection of upstream kinases that phosphorylate non-genotoxically overexpressed p53 will be of therapeutic importance for cancer treatment. Results To determine the non-genotoxic effect of p53; Tet-On system was utilized and p53 inducible HPV-positive HeLa cells were developed. p53 overexpression in HPV-positive cells did not induce cell cycle arrest or apoptosis. However, we demonstrate that overexpressed p53 can be activated to upregulate p21 and Bax which causes G2 arrest and apoptosis, by inhibiting protein phosphatase 2A. Additionally, we report that the upstream kinase cyclin dependent kinase 5 interacts with p53 to phosphorylate it at Serine20 and Serine46 residues thereby promoting its recruitment on p21 and bax promoters. Upregulation and translocation of Bax causes apoptosis through intrinsic mitochondrial pathway. Interestingly, overexpressed activated p53 specifically inhibits cell-growth and causes regression in vivo tumor growth as well. Conclusion Present study details the mechanism of activation of p53 and puts forth the possibility of p53 gene therapy to work in HPV positive cervical carcinoma.
G2 phase arrest of cell cycle induced by ionizing radiation
International Nuclear Information System (INIS)
Liu Guangwei; Gong Shouliang
2002-01-01
The exposure of mammalian cells to X rays results in the prolongation of the cell cycle, including the delay or the arrest in G 1 , S and G 2 phase. The major function of G 1 arrest may be to eliminate the cells containing DNA damage and only occurs in the cells with wild type p53 function whereas G 2 arrest following ionizing radiation has been shown to be important in protecting the cells from death and occurs in all cells regardless of p53 status. So the study on G 2 phase arrest of the cell cycle induced by ionizing radiation has currently become a focus at radiobiological fields
Tumor suppressor WWOX and p53 alterations and drug resistance in glioblastomas
Directory of Open Access Journals (Sweden)
Ming-Fu eChiang
2013-03-01
Full Text Available Tumor suppressor p53 are frequently mutated in glioblastomas (GBMs and appears to contribute, in part, to resistance to temozolomide and therapeutic drugs. WW domain-containing oxidoreductase WWOX (FOR or WOX1 is a proapoptotic protein and is considered as a tumor suppressor. Loss of WWOX gene expression is frequently seen in malignant cancer cells due to promoter hypermethylation, genetic alterations, and translational blockade. Intriguingly, ectopic expression of wild type WWOX preferentially induces apoptosis in human glioblastoma cells harboring mutant p53. WWOX is known to physically bind and stabilize wild type p53. Here, we provide an overview for the updated knowledge in p53 and WWOX, and postulate a potential scenarios that wild type and mutant p53, or isoforms, modulate the apoptotic function of WWOX. We propose that triggering WWOX activation by therapeutic drugs under p53 functional deficiency is needed to overcome TMZ resistance and induce GBM cell death.
Directory of Open Access Journals (Sweden)
Maria V Chiantore
Full Text Available Interferon (IFN-β inhibits cell proliferation and affects cell cycle in keratinocytes transformed by both mucosal high risk Human Papilloma Virus (HPV and cutaneous HPV E6 and E7 proteins. In particular, upon longer IFN-β treatments, cutaneous HPV38 expressing cells undergo senescence. IFN-β appears to induce senescence by upregulating the expression of the tumor suppressor PML, a well known IFN-induced gene. Indeed, experiments in gene silencing via specific siRNAs have shown that PML is essential in the execution of the senescence programme and that both p53 and p21 pathways are involved. IFN-β treatment leads to a modulation of p53 phosphorylation and acetylation status and a reduction in the expression of the p53 dominant negative ΔNp73. These effects allow the recovery of p53 transactivating activity of target genes involved in the control of cell proliferation. Taken together, these studies suggest that signaling through the IFN pathway might play an important role in cellular senescence. This additional understanding of IFN antitumor action and mechanisms influencing tumor responsiveness or resistance appears useful in aiding further promising development of biomolecular strategies in the IFN therapy of cancer.
Kim, Jong-Sik; Baek, Seung Joon; Bottone, Frank G; Sali, Tina; Eling, Thomas E
2005-09-01
To investigate the function of 15-lipoxygenase-1 (15-LOX-1) in human colorectal cancer, we overexpressed 15-LOX-1 in HCT-116 human colorectal cancer cells. Clones expressing the highest levels of 15-LOX-1 displayed reduced viability compared with the HCT-116-Vector control cells. Further, by cell cycle gene array analyses, the cyclin-dependent kinase inhibitor p21WAF1/CIP1 and MDM2 genes were up-regulated in 15-LOX-1-overexpressing cells. The induction of p21(WAF1/CIP1) and MDM2 were linked to activation of p53 by 15-LOX-1, as there was a dramatic induction of phosphorylated p53 (Ser15) in 15-LOX-1-overesxpressing cells. However, the 15-LOX-1 metabolites 13(S)-hydroxyoctadecadienoic acid and 15(S)-hydroxyeicosatetraenoic acid failed to induce phosphorylation of p53 at Ser15, and the 15-LOX-1 inhibitor PD146176 did not inhibit the phosphorylation of p53 at Ser15 in 15-LOX-1-overexpressing cells. Nonetheless, the growth-inhibitory effects of 15-LOX-1 were p53 dependent, as 15-LOX-1 overexpression had no effect on cell growth in p53 (-/-) HCT-116 cells. Finally, treatment of HCT-116-15-LOX-1 cells with different kinase inhibitors suggested that the effects of 15-LOX-1 on p53 phosphorylation and activation were due to effects on DNA-dependent protein kinase. Collectively, these findings suggest a new mechanism to explain the biological activity of 15-LOX-1, where 15-LOX plays a stoichiometric role in activating a DNA-dependent protein kinase-dependent pathway that leads to p53-dependent growth arrest.
International Nuclear Information System (INIS)
Paris, Francois
1998-01-01
In this research thesis, the author presents ionizing radiations and their effects on living matter (damages to DNA, cell response to irradiation, proteins activated by radio-induced DNA breaks), the p53 protein (p53 mutation in cancers, structure), and the effect of ionizing radiation on this protein (expression and activation). Then this thesis addresses the study of a set of sister line of epithelial cells obtained from an embryonic rat lung treated with benzo(a)pyrene, a mutagenic agent notably present in cigarette smoke, in hydrocarbon combustion and in atmospheric pollution, and therefore responsible of cancers. This thesis thus reports the development of an experimental model allowing transformed cells to be studied [fr
International Nuclear Information System (INIS)
Okaichi, Kumio; Wang Lihong; Sasaki, Ji-ichiro; Saya, Hideyuki; Tada, Mitsuhiro; Okumura, Yutaka
1999-01-01
Purpose: The 123A point mutation of p53 showed increased radiosensitivity, whereas other mutations (143A, 175H, and 273H) were not affected. To determine the reason for increased radiosensitivity of the 123A mutation, the response of the transformant of 123A mutation to ionizing radiation (IR) was examined and compared to those of transformants with the wild type p53 or other point mutations (143A, 175H, and 273H). Methods and Materials: Stable transformants with a mutant or wild type p53 made by introducing cDNA into the human osteosarcoma cell line, Saos-2, which lacks an endogenous p53 were used. The transcriptional activity of mutant p53 was examined using a yeast functional assay. The transformants were examined for the accumulation of p53, the induction of p21 Waf1/Cip1/Sdi1 (hereafter referred to as p21), and the other response of p53-responsive genes (MDM2, Bax, and Bcl-2) by Western blotting. Apoptosis was analyzed by detection of DNA fragmentation. Results: The 123A point mutation of p53 was detected as a wild type in the yeast functional assay. The 123A mutant accumulated p53 in response to IR. The 123A mutant did not induce p21, but normally responded to MDM2, Bax, and Bcl-2. The 123A mutant entered apoptosis earlier than the wild type p53 transformant, and induced Fas at earlier in response to IR. Conclusion: The 123A mutant led to apoptosis, but not p21 expression in response to IR. The occurrence of apoptosis, but not induction of p21, corresponded to the radiosensitivity in the transformant. The early occurrence of apoptosis in 123A transformants may depend on the early induction of Fas
International Nuclear Information System (INIS)
Menaa, F.
2003-12-01
Cells submitted to genotoxic factors -like IR- activate several and important mechanisms such as repair, cell cycle arrest or 'apoptosis' to maintain genetic integrity. So, the damaged cells will induce many and different genes. The human transcriptome analysis by 'SSH' method in a human breast carcinoma cell line MCF7 γ-irradiated versus not irradiated, allowed to identify about one hundred genes. Among of these genes, we have focused our study on a radio-induced gene encoding the p68 helicase. In the conditions of irradiation used, our results show that the kinetic and the regulation of this gene expression differs between the nature of radiations used. Indeed, in γ-irradiated mammalian cells, ATM, a protein kinase activated by DSB and IR, is required to induce quickly P68 gene via the important transcription factor p53 stabilized by IR. In the case of UVC-irradiated cells, the P68 gene induction is late and the intracellular signalling pathway that lead to this induction is independent from the p53 protein. Finally, we show that the p68 protein under-expression is responsible for an increased radiosensitivity of MCF7 cells. Consequently, we can postulate that the p68 protein is involved in cellular responses to radiations to reduce the increased radiosensitivity of cells exposed to γ-rays. (author)
Association of p53 protein expression with clinical outcome in advanced supraglottic cancer
International Nuclear Information System (INIS)
Kang, Jin Oh; Hong, Seong Eon
1998-01-01
To determine the incidence and prognostic effect of p53 expression in patients with advanced supraglottic cancer. Twenty-one cases of total 48 advanced supraglottic cancer patients who received postoperative adjuvant radiation therapy were evaluated by immunohistochemical staining employing p53 monoclonal antibody. Three out of six stage III patients and four out of fifteen stage IV patients showed p53 expression without statistically significant difference (p=0.608). Five year survival rates are 93% in p53 negative, 86% in p53 positive patients and there was no significant difference(p=0.776). p53 expression does not show statistically significant correlation with primary tumor status(p=0.877), lymph node status(p=0.874) and age(p=0.64). There was no statistically significant correlation between traditionally known risk factors and p53 expression
Directory of Open Access Journals (Sweden)
Na-Yiyuan Wu
2017-03-01
Full Text Available High-grade serous ovarian carcinoma (HGSOC originates mainly from the fallopian tube (FT epithelium and always carries early TP53 mutations. We previously reported that tumors initiate in the FT fimbria epithelium because of apoptotic failure and the expansion of cells with DNA double-strand breaks (DSB caused by bathing of the FT epithelial cells in reactive oxygen species (ROSs and hemoglobin-rich follicular fluid (FF after ovulation. Because ovulation is frequent and HGSOC is rare, we hypothesized that luteal-phase progesterone (P4 could eliminate p53-defective FT cells. Here we show that P4, via P4 receptors (PRs, induces necroptosis in Trp53−/− mouse oviduct epithelium and in immortalized human p53-defective fimbrial epithelium through the TNF-α/RIPK1/RIPK3/MLKL pathway. Necroptosis occurs specifically at diestrus, recovers at the proestrus phase of the estrus cycle, and can be augmented with P4 supplementation. These results reveal the mechanism of the well-known ability of progesterone to prevent ovarian cancer.
International Nuclear Information System (INIS)
Stubbert, Lawton J; Smith, Jennifer M; McKay, Bruce C
2010-01-01
One of the most commonly used classes of anti-cancer drugs presently in clinical practice is the platinum-based drugs, including cisplatin. The efficacy of cisplatin therapy is often limited by the emergence of resistant tumours following treatment. Cisplatin resistance is multi-factorial but can be associated with increased DNA repair capacity, mutations in p53 or loss of DNA mismatch repair capacity. RNA interference (RNAi) was used to reduce the transcription-coupled nucleotide excision repair (TC-NER) capacity of several prostate and colorectal carcinoma cell lines with specific defects in p53 and/or DNA mismatch repair. The effect of small inhibitory RNAs designed to target the CSB (Cockayne syndrome group B) transcript on TC-NER and the sensitivity of cells to cisplatin-induced apoptosis was determined. These prostate and colon cancer cell lines were initially TC-NER proficient and RNAi against CSB significantly reduced their DNA repair capacity. Decreased TC-NER capacity was associated with an increase in the sensitivity of tumour cells to cisplatin-induced apoptosis, even in p53 null and DNA mismatch repair-deficient cell lines. The present work indicates that CSB and TC-NER play a prominent role in determining the sensitivity of tumour cells to cisplatin even in the absence of p53 and DNA mismatch repair. These results further suggest that CSB represents a potential target for cancer therapy that may be important to overcome resistance to cisplatin in the clinic
Directory of Open Access Journals (Sweden)
Smith Jennifer M
2010-05-01
Full Text Available Abstract Background One of the most commonly used classes of anti-cancer drugs presently in clinical practice is the platinum-based drugs, including cisplatin. The efficacy of cisplatin therapy is often limited by the emergence of resistant tumours following treatment. Cisplatin resistance is multi-factorial but can be associated with increased DNA repair capacity, mutations in p53 or loss of DNA mismatch repair capacity. Methods RNA interference (RNAi was used to reduce the transcription-coupled nucleotide excision repair (TC-NER capacity of several prostate and colorectal carcinoma cell lines with specific defects in p53 and/or DNA mismatch repair. The effect of small inhibitory RNAs designed to target the CSB (Cockayne syndrome group B transcript on TC-NER and the sensitivity of cells to cisplatin-induced apoptosis was determined. Results These prostate and colon cancer cell lines were initially TC-NER proficient and RNAi against CSB significantly reduced their DNA repair capacity. Decreased TC-NER capacity was associated with an increase in the sensitivity of tumour cells to cisplatin-induced apoptosis, even in p53 null and DNA mismatch repair-deficient cell lines. Conclusion The present work indicates that CSB and TC-NER play a prominent role in determining the sensitivity of tumour cells to cisplatin even in the absence of p53 and DNA mismatch repair. These results further suggest that CSB represents a potential target for cancer therapy that may be important to overcome resistance to cisplatin in the clinic.
p53 inactivation in chewing tobacco-induced oral cancers and leukoplakias from India.
Saranath, D; Tandle, A T; Teni, T R; Dedhia, P M; Borges, A M; Parikh, D; Sanghavi, V; Mehta, A R
1999-05-01
The inactivation of p53 tumour suppressor gene vis-á-vis point mutation, overexpression and degradation due to Human Papilloma virus (HPV) 16/18 infection, was examined in chewing tobacco-associated oral cancers and oral leukoplakias from India. The analysis of mutations was assessed by polymerase chain reaction (PCR) with single strand conformation polymorphism (PCR-SSCP) of exons 5-9 on DNA from 83 oral cancer cases, and the mutations confirmed by direct nucleotide sequencing of the PCR products. p53 protein expression was evaluated by immunohistochemical analysis on paraffin-embedded sections of 62 representative oral cancer biopsies and 22 leukoplakias, using p53-specific monoclonal antibody DO-7. The presence of HPV16/18 was detected in the 83 oral cancer cases by PCR analysis using HPV L1 consensus sequences, followed by Southern hybridization with type-specific oligonucleotide probes. Forty-six per cent (38/83) of oral cancer tumours showed p53 alterations, with 17% (14/83) showing point mutations, 37% (23/62) with overexpression and 25% (21/83) with presence of HPV16 wherein the E6 HPV16 protein degrades p53. HPV18 was not detected in any of the samples. Ninety-two per cent concordance was observed between missense point mutations and overexpression of p53 protein. A significant correlation was not observed between p53 alterations in oral cancer and clinico-pathological profile of the patients. Twenty-seven per cent (6/22) of oral leukoplakias showed p53 overexpression. The overall p53 alterations in oral cancer tissues and oral lesions are comparable to data from the oral cancers reported in the Western countries with smoking and alcohol-associated oral cancers, and suggest a critical role for p53 gene in a significant proportion of oral cancers from India. The overexpression of p53 protein in leukoplakias may serve as a valuable biomarker for identifying individuals at high risk of transformation to malignant phenotype.
Isolation and characterization of DUSP11, a novel p53 target gene
DEFF Research Database (Denmark)
Caprara, Greta; Zamponi, Raffaella; Melixetian, Marina
2009-01-01
target gene. Consistent with this, the expression of DUSP11 is induced in a p53-dependent manner after treatment with DNA damaging agents. Chromatin immunoprecipitation analysis showed that p53 binds to 2 putative p53 DNA binding sites in the promoter region of DUSP11. Colony formation and proliferation...
Energy Technology Data Exchange (ETDEWEB)
Zhenwei, Zhang [Department of Nuclear Medicine, Tongji Hospital, Tongji Medical College, Huazhong University of Science and Technology, Wuhan (China); Shanghai Institute of Biochemistry and Cell Biology, Shanghai Institute for Biological Sciences, Chinese Academy of Sciences, Shanghai (China); Hua, Wu; Xuemei, Zhang [Department of Nuclear Medicine, Tongji Hospital, Tongji Medical College, Huazhong University of Science and Technology, Wuhan (China); Xinyuan, Liu [Shanghai Institute of Biochemistry and Cell Biology, Shanghai Institute for Biological Sciences, Chinese Academy of Sciences, Shanghai (China)
2004-07-01
Purpose: Chemotherapy or external radiation therapy can potentiate the therapeutic effect of E1 B-attenuated oncolytic adenovirus. In this study, the antitumor efficacy of oncolytic adenovirus combined with internal radionuclide therapy was evaluated. Methods: Firstly, viral replication was examined by plaque assay and Southern blotting, after oncolytic adenovirus, ZD55, was exposed to iodine-131. Cell viability was evaluated qualitatively by crystal violet staining and quantitatively by MTT assay. FACS analysis was performed to determine the synergic proapoptotic effect of iodine-131 combined with ZD55. Results: Irradiation of iodine-131 does not influence ZD55 viral DNA replication. In combination with ZD55, iodine-131 can efficiently kill tumor cells in a p53-independent model. ZD55 augments the proapoptotic effect of iodine-131. Conclusion: Radionuclide-viral therapy might be a novel tool for treatment of hepatocarcinoma. (authors)
Directory of Open Access Journals (Sweden)
Gong C
2017-12-01
Full Text Available Cheng Gong,1 Zongyuan Yang,1 Lingyun Zhang,2 Yuehua Wang,2 Wei Gong,2 Yi Liu3 1Department of Obstetrics and Gynecology, Tongji Hospital, Tongji Medical College, Huazhong University of Science and Technology, Wuhan, 2Department of Oncology, XiangYang Central Hospital, Hubei University of Arts and Science, XiangYang, 3Department of Medicinal Chemistry, School of Pharmacy, Hubei University of Chinese Medicine, Wuhan, China Abstract: Quercetin is proven to have anticancer effects for many cancers. However, the role of tumor suppressor p53 on quercetin’s radiosensitization and regulation of endoplasmic reticulum (ER stress response in this process remains obscure. Here, quercetin exposure resulted in ER stress, prolonged DNA repair, and the expression of p53 protein; phosphorylation on serine 15 and 20 increased in combination with X-irradiation. Quercetin pretreatment could potentiate radiation-induced cell death. The combination of irradiation and quercetin treatment aggravated DNA damages and caused typical apoptotic cell death; as well the expression of Bax and p21 elevated and the expression of Bcl-2 decreased. Knocking down of p53 could reverse all the above effects under quercetin in combination with radiation. In addition, quercetin-induced radiosensitization was through stimulation of ATM phosphorylation. In human ovarian cancer xenograft model, combined treatment of quercetin and radiation significantly restrained the growth of tumors, accompanied with the activation of p53, CCAAT/enhancer-binding protein homologous protein, and γ-H2AX. Overall, these results indicated that quercetin acted as a promising radiosensitizer through p53-dependent ER stress signals. Keywords: quercetin, p53, endoplasmic reticulum stress, DNA double-strand breaks, eIF-2α (eukaryotic initiation factor 2α, ATM kinase
G9a stimulates CRC growth by inducing p53 Lys373 dimethylation-dependent activation of Plk1.
Zhang, Jie; Wang, Yafang; Shen, Yanyan; He, Pengxing; Ding, Jian; Chen, Yi
2018-01-01
Rationale: G9a is genetically deregulated in various tumor types and is important for cell proliferation; however, the mechanism underlying G9a-induced carcinogenesis, especially in colorectal cancer (CRC), is unclear. Here, we investigated if G9a exerts oncogenic effects in CRC by increasing polo-like kinase 1 (Plk1) expression. Thus, we further characterized the detailed molecular mechanisms. Methods: The role of Plk1 in G9a aberrant CRC was determined by performing different in vitro and in vivo assays, including assessment of cell growth by performing cell viability assay and assessment of signaling transduction profiles by performing immunoblotting, in the cases of pharmacological inhibition or short RNA interference-mediated suppression of G9a. Detailed molecular mechanisms underlying the effect of G9a on Plk1 expression were determined by performing point mutation analysis, chromatin immunoprecipitation analysis, and luciferase reporter assay. Correlation between G9a and Plk1 expression was determined by analyzing clinical samples of patients with CRC by performing immunohistochemistry. Results: Our study is the first to report a significant positive correlation between G9a and Plk1 levels in 89 clinical samples of patients with CRC. Moreover, G9a depletion decreased Plk1 expression and suppressed CRC cell growth both in vitro and in vivo , thus confirming the significant correlation between G9a and Plk1 levels. Further, we observed that G9a-induced Plk1 regulation depended on p53 inhibition. G9a dimethylated p53 at lysine 373, which in turn increased Plk1 expression and promoted CRC cell growth. Conclusions: These results indicate that G9a-induced and p53-dependent epigenetic programing stimulates the growth of colon cancer, which also suggests that G9a inhibitors that restore p53 activity are promising therapeutic agents for treating colon cancer, especially for CRC expressing wild-type p53.
p53 Maintains Genomic Stability by Preventing Interference between Transcription and Replication
Directory of Open Access Journals (Sweden)
Constance Qiao Xin Yeo
2016-04-01
Full Text Available p53 tumor suppressor maintains genomic stability, typically acting through cell-cycle arrest, senescence, and apoptosis. We discovered a function of p53 in preventing conflicts between transcription and replication, independent of its canonical roles. p53 deficiency sensitizes cells to Topoisomerase (Topo II inhibitors, resulting in DNA damage arising spontaneously during replication. Topoisomerase IIα (TOP2A-DNA complexes preferentially accumulate in isogenic p53 mutant or knockout cells, reflecting an increased recruitment of TOP2A to regulate DNA topology. We propose that p53 acts to prevent DNA topological stress originating from transcription during the S phase and, therefore, promotes normal replication fork progression. Consequently, replication fork progression is impaired in the absence of p53, which is reversed by transcription inhibition. Pharmacologic inhibition of transcription also attenuates DNA damage and decreases Topo-II-DNA complexes, restoring cell viability in p53-deficient cells. Together, our results demonstrate a function of p53 that may underlie its role in tumor suppression.
The role of p53 in the response to mitotic spindle damage
International Nuclear Information System (INIS)
Meek, D.W.
2000-01-01
The p53 tumour suppressor protein has defined roles in G1/S and G2/M cell cycle checkpoint in response to a range of cellular stresses including DNA damage, dominant oncogene expression, hypoxia, metabolic changes and viral infection. In addition to these responses, p53 can also be activated when damage occurs to the mitotic spindle. Initially, spindle damage activates a p53-independent checkpoint which functions at the metaphase-anaphase transition and prevents cells from progressing through mitosis until the completion of spindle formation. Cells eventually escape from this block (a process termed 'mitotic slippage'), and an aberrant mitosis ensues in which sister chromatids fail to segregate properly. After a delay period, p53 responds to this mitotic failure by instituting a G1-like growth arrest, with an intact nucleus containing 4N DNA, but without the cells undergoing division. Cells lacking wild-type p53 are still able to arrest transiently at mitosis, and also fail to undergo division, underscoring that the delay in mitosis is p53-independent. However, these cells are not prevented from re-entering the cell cycle and can reduplicate their DNA unchecked, leading to polyploidy. Additionally, p53-null cells which experience spindle failure often show the appearance of micronuclei arising from poorly segregated chromosomes which have de-condensed and been enclosed in a nuclear envelope. The ability of p53 to prevent their formation suggests an additional G2 involvement which prevents nuclear breakdown prior to mitosis. The molecular mechanism by which p53 is able to sense mitotic failure is still unknown, but may be linked to the ability of p53 to regulate duplication of the centrosome, the organelle which nucleates spindle formation. (authors)
Armitage, Mark
Ionizing radiation can have several different effects on cells, some are almost instantaneous such as the generation of DNA damage, other cellular responses take a matter of minutes or hours - DNA repair protein induction/activation, and others may take months or even years to be manifested - carcinogenesis. Human epithelial cell lines derived from both normal, non-neoplastic tissues and from a malignant source were cultured in order to examine several effects of ionizing radiation on such cell types. Cells not from a malignant source were previously immortalized by viral infection or by transfection with viral sequences. Simian virus 40 immortalised uroepithelial cells (SV-HUC) were found to be approximately a factor of two fold more radioresistant than cells of malignant origin (T24) in terms of unrepaired clastogenic damage i.e. assessment of micronuclei levels following irradiation. SV-HUC lines unlike T24 cells are non-tumourigenic when inoculated into nude athymic mice. SV-HUC lines proved very resistant to full oncogenic transformation using radiation and chemical carcinogens. However, morphological alterations and decreased anchorage dependant growth was observed in post carcinogen treated cells after appropriate cell culture conditions were utilized. The progression from this phenotype to a fully tumourigenic one was not recorded in this study. The ability of ionizing radiation to induce increased levels of the nuclear phosphoprotein p53 was also assessed using several different cell lines. SV- HUC and T24 cell lines failed to exhibit any increased p53 stabilization following irradiation. One cell line, a human papilloma virus transformed line (HPV) did show an approximate two fold increase of the wild type p53 protein after treatment with radiation. Only the cell line HPV showed any cell cycle delay, resulting in accumulation of cells in the G2/M compartment in post irradiation cell cycle analysis. The status of p53 was also assessed i.e. wild type or
International Nuclear Information System (INIS)
Verheyde, J.
2007-01-01
radiation exposure. The Trp53 null mutants at this stage exhibited a decreased expression profile for various Cyclins and Cyclin-dependent kinases, suggesting the induction of a Trp53 independent cell cycle arrest. The observed absence of high levels of apoptosis is in concordance with the described phenotype of Trp53 null mutant mice that show an increased risk for tumour formation. Next, we questioned if the developing brain is characterized by a regional dependent differences on radiation sensitivity. Therefore, additional transcriptional analyses of the different regions (hippocampus, pallidal neuroepithelium and cortex of control and irradiated brain embryos) of the ventral wild type brain at E15 were performed. In these three regions of the developing brain, the differential expression of Trp53inp1 and Ccng1 by in situ hybridization suggested that the ventral brain shows a specific regional dependent expression pattern. This was further evidenced by real time qPCR, by which it also became clear that the strongest radiation induced effect can be observed in the cerebral cortex. However, this experiment didn't allow making a distinction between neural cells in this experiment, and different cell types contribute to correct neural network formation. Detailed analysis of cultured and irradiated neural cell types indicated that the expression of the Trp53inp1/Hipk2 and Ccng1/Mdm2/P19Arf signalling pathways are activated in a cell-type dependent matter. From this data it appears that, depending on the cell type and the stage of differentiation, two possible mechanisms for the induction of apoptosis are activated. In one hand cell cycle arrest occurs via P21 (Cdkn1a) induction and to certain extends via P19ARF in the mitotic astrocytes, while in short-term neurons this mechanism seems to be preferentially induced by Cyclin G1. This arrest is then followed by the induction of the mitochondrial proapoptotic pathway. Interestingly, long term cultured neurons show also an
Absence of p53 gene mutations in mice colon pre-cancerous stage induced by o-nitrotoluene
Directory of Open Access Journals (Sweden)
Nahed A Hussien
2014-01-01
Conclusion: The results from the present study indicate that point mutations in the p53 gene, in the coding region (exons 5-8 and outside it (exons 10, 11, are not involved in the development of the colon precancerous stage induced by o-nt in mice.
Endogenous c-Myc is essential for p53-induced apoptosis in response to DNA damage in vivo.
Phesse, T J; Myant, K B; Cole, A M; Ridgway, R A; Pearson, H; Muncan, V; van den Brink, G R; Vousden, K H; Sears, R; Vassilev, L T; Clarke, A R; Sansom, O J
2014-06-01
Recent studies have suggested that C-MYC may be an excellent therapeutic cancer target and a number of new agents targeting C-MYC are in preclinical development. Given most therapeutic regimes would combine C-MYC inhibition with genotoxic damage, it is important to assess the importance of C-MYC function for DNA damage signalling in vivo. In this study, we have conditionally deleted the c-Myc gene in the adult murine intestine and investigated the apoptotic response of intestinal enterocytes to DNA damage. Remarkably, c-Myc deletion completely abrogated the immediate wave of apoptosis following both ionizing irradiation and cisplatin treatment, recapitulating the phenotype of p53 deficiency in the intestine. Consistent with this, c-Myc-deficient intestinal enterocytes did not upregulate p53. Mechanistically, this was linked to an upregulation of the E3 Ubiquitin ligase Mdm2, which targets p53 for degradation in c-Myc-deficient intestinal enterocytes. Further, low level overexpression of c-Myc, which does not impact on basal levels of apoptosis, elicited sustained apoptosis in response to DNA damage, suggesting c-Myc activity acts as a crucial cell survival rheostat following DNA damage. We also identify the importance of MYC during DNA damage-induced apoptosis in several other tissues, including the thymus and spleen, using systemic deletion of c-Myc throughout the adult mouse. Together, we have elucidated for the first time in vivo an essential role for endogenous c-Myc in signalling DNA damage-induced apoptosis through the control of the p53 tumour suppressor protein.
Tumour suppressor protein p53 regulates the stress activated bilirubin oxidase cytochrome P450 2A6
Energy Technology Data Exchange (ETDEWEB)
Hu, Hao, E-mail: hao.hu1@uqconnect.edu.au [The University of Queensland, National Research Centre for Environmental Toxicology (Entox), 4072 Brisbane, Queensland (Australia); Yu, Ting, E-mail: t.yu2@uq.edu.au [The University of Queensland, National Research Centre for Environmental Toxicology (Entox), 4072 Brisbane, Queensland (Australia); Arpiainen, Satu, E-mail: Satu.Juhila@orion.fi [Institute of Biomedicine, Department of Pharmacology and Toxicology and Medical Research Center Oulu, Oulu University Hospital and University of Oulu, Oulu (Finland); Lang, Matti A., E-mail: m.lang@uq.edu.au [The University of Queensland, National Research Centre for Environmental Toxicology (Entox), 4072 Brisbane, Queensland (Australia); Hakkola, Jukka, E-mail: Jukka.hakkola@oulu.fi [Institute of Biomedicine, Department of Pharmacology and Toxicology and Medical Research Center Oulu, Oulu University Hospital and University of Oulu, Oulu (Finland); Abu-Bakar, A' edah, E-mail: a.abubakar@uq.edu.au [The University of Queensland, National Research Centre for Environmental Toxicology (Entox), 4072 Brisbane, Queensland (Australia)
2015-11-15
Human cytochrome P450 (CYP) 2A6 enzyme has been proposed to play a role in cellular defence against chemical-induced oxidative stress. The encoding gene is regulated by various stress activated transcription factors. This paper demonstrates that p53 is a novel transcriptional regulator of the gene. Sequence analysis of the CYP2A6 promoter revealed six putative p53 binding sites in a 3 kb proximate promoter region. The site closest to transcription start site (TSS) is highly homologous with the p53 consensus sequence. Transfection with various stepwise deletions of CYP2A6-5′-Luc constructs – down to − 160 bp from the TSS – showed p53 responsiveness in p53 overexpressed C3A cells. However, a further deletion from − 160 to − 74 bp, including the putative p53 binding site, totally abolished the p53 responsiveness. Electrophoretic mobility shift assay with a probe containing the putative binding site showed specific binding of p53. A point mutation at the binding site abolished both the binding and responsiveness of the recombinant gene to p53. Up-regulation of the endogenous p53 with benzo[α]pyrene – a well-known p53 activator – increased the expression of the p53 responsive positive control and the CYP2A6-5′-Luc construct containing the intact p53 binding site but not the mutated CYP2A6-5′-Luc construct. Finally, inducibility of the native CYP2A6 gene by benzo[α]pyrene was demonstrated by dose-dependent increases in CYP2A6 mRNA and protein levels along with increased p53 levels in the nucleus. Collectively, the results indicate that p53 protein is a regulator of the CYP2A6 gene in C3A cells and further support the putative cytoprotective role of CYP2A6. - Highlights: • CYP2A6 is an immediate target gene of p53. • Six putative p53REs located on 3 kb proximate CYP2A6 promoter region. • The region − 160 bp from TSS is highly homologous with the p53 consensus sequence. • P53 specifically bind to the p53RE on the − 160 bp region. • HNF4
Liu, Yi; Wang, Wei-Mao; Zou, Li-Yi; Li, Li; Feng, Lu; Pan, Ming-Zhu; Lv, Min-Yi; Cao, Ying; Wang, Hua; Kung, Hsiang-Fu; Pang, Jian-Xin; Fu, Wei-Ming; Zhang, Jin-Fang
2017-06-01
Hpn is a small histidine-rich cytoplasmic protein from Helicobacter pylori and has been recognized as a high-risk factor for several cancers including gastric cancer, colorectal cancer, and MALT lymphoma. However, the relationship between Hpn and cancers remains elusive. In this study, we discovered that Hpn protein effectively suppressed cell growth and induced apoptosis in hepatocellular carcinoma (HCC). A two-dimensional gel electrophoresis and mass spectrometry-based comparative proteomics was performed to find the molecular targets of Hpn in HCC cells. It was identified that twelve proteins were differentially expressed, with USP5 being one of the most significantly downregulated protein. The P14 ARF -P53 signaling was activated by USP5 knockdown in HCC cells. Furthermore, USP5 overexpression significantly rescued the suppressive effect of Hpn on the viability of HCC cells. In conclusion, our study suggests that Hpn plays apoptosis-inducing roles through suppressing USP5 expression and activating the P14 ARF -P53 signaling. Therefore, Hpn may be a potential candidate for developing novel anti-HCC drugs. © 2017 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Mohamed, Anis Syamimi; Hanafi, Noorul Izzati; Sheikh Abdul Kadir, Siti Hamimah; Md Noor, Julina; Abdul Hamid Hasani, Narimah; Ab Rahim, Sharaniza; Siran, Rosfaiizah
2017-10-01
In hepatocytes, ursodeoxycholic acid (UDCA) activates cell signalling pathways such as p53, intracellular calcium ([Ca 2+ ] i ), and sphingosine-1-phosphate (S1P)-receptor via Gα i -coupled-receptor. Recently, UDCA has been shown to protect the heart against hypoxia-reoxygenation injury. However, it is not clear whether UDCA cardioprotection against hypoxia acts through a transcriptional mediator of cells stress, HIF-1α and p53. Therefore, in here, we aimed to investigate whether UDCA could protect cardiomyocytes (CMs) against hypoxia by regulating expression of HIF-1α, p53, [Ca 2+ ] i , and S1P-Gα i -coupled-receptor. Cardiomyocytes were isolated from newborn rats (0-2 days), and hypoxia was induced by using cobalt chloride (CoCl 2 ). Cardiomyocytes were treated with UDCA and cotreated with either FTY720 (S1P-receptor agonist) or pertussis toxin (PTX; Gα i inhibitor). Cells were subjected for proliferation assay, beating frequency, QuantiGene Plex assay, western blot, immunofluorescence, and calcium imaging. Our findings showed that UDCA counteracted the effects of CoCl 2 on cell viability, beating frequency, HIF-1α, and p53 protein expression. We found that these cardioprotection effects of UDCA were similar to FTY720, S1P agonist. Furthermore, we observed that UDCA protects CMs against CoCl 2 -induced [Ca 2+ ] i dynamic alteration. Pharmacological inhibition of the Gα i -sensitive receptor did not abolish the cardioprotection of UDCA against CoCl 2 detrimental effects, except for cell viability and [Ca 2+ ] i . Pertussis toxin is partially effective in inhibiting UDCA protection against CoCl 2 effects on CM cell viability. Interestingly, PTX fully inhibits UDCA cardioprotection on CoCl 2 -induced [Ca 2+ ] i dynamic changes. We conclude that UDCA cardioprotection against CoCl 2 -induced hypoxia is similar to FTY720, and its actions are not fully mediated by the Gα i -coupled protein sensitive pathways. Ursodeoxycholic acid is the most hydrophilic bile
Role of DNA mismatch repair and p53 in signaling induction of apoptosis by alkylating agents.
Hickman, M J; Samson, L D
1999-09-14
All cells are unavoidably exposed to chemicals that can alkylate DNA to form genotoxic damage. Among the various DNA lesions formed, O(6)-alkylguanine lesions can be highly cytotoxic, and we recently demonstrated that O(6)-methylguanine (O(6)MeG) and O(6)-chloroethylguanine (O(6)CEG) specifically initiate apoptosis in hamster cells. Here we show, in both hamster and human cells, that the MutSalpha branch of the DNA mismatch repair pathway (but not the MutSbeta branch) is absolutely required for signaling the initiation of apoptosis in response to O(6)MeGs and is partially required for signaling apoptosis in response to O(6)CEGs. Further, O(6)MeG lesions signal the stabilization of the p53 tumor suppressor, and such signaling is also MutSalpha-dependent. Despite this, MutSalpha-dependent apoptosis can be executed in a p53-independent manner. DNA mismatch repair status did not influence the response of cells to other inducers of p53 and apoptosis. Thus, it appears that mismatch repair status, rather than p53 status, is a strong indicator of the susceptibility of cells to alkylation-induced apoptosis. This experimental system will allow dissection of the signal transduction events that couple a specific type of DNA base lesion with the final outcome of apoptotic cell death.
The antagonism between MCT-1 and p53 affects the tumorigenic outcomes
Directory of Open Access Journals (Sweden)
Lin Tai-Du
2010-12-01
Full Text Available Abstract Background MCT-1 oncoprotein accelerates p53 protein degradation via a proteosome pathway. Synergistic promotion of the xenograft tumorigenicity has been demonstrated in circumstance of p53 loss alongside MCT-1 overexpression. However, the molecular regulation between MCT-1 and p53 in tumor development remains ambiguous. We speculate that MCT-1 may counteract p53 through the diverse mechanisms that determine the tumorigenic outcomes. Results MCT-1 has now identified as a novel target gene of p53 transcriptional regulation. MCT-1 promoter region contains the response elements reactive with wild-type p53 but not mutant p53. Functional p53 suppresses MCT-1 promoter activity and MCT-1 mRNA stability. In a negative feedback regulation, constitutively expressed MCT-1 decreases p53 promoter function and p53 mRNA stability. The apoptotic events are also significantly prevented by oncogenic MCT-1 in a p53-dependent or a p53-independent fashion, according to the genotoxic mechanism. Moreover, oncogenic MCT-1 promotes the tumorigenicity in mice xenografts of p53-null and p53-positive lung cancer cells. In support of the tumor growth are irrepressible by p53 reactivation in vivo, the inhibitors of p53 (MDM2, Pirh2, and Cop1 are constantly stimulated by MCT-1 oncoprotein. Conclusions The oppositions between MCT-1 and p53 are firstly confirmed at multistage processes that include transcription control, mRNA metabolism, and protein expression. MCT-1 oncogenicity can overcome p53 function that persistently advances the tumor development.
Down-Regulation of p53 by Double-Stranded RNA Modulates the Antiviral Response
Marques, Joao T.; Rebouillat, Dominique; Ramana, Chilakamarti V.; Murakami, Junko; Hill, Jason E.; Gudkov, Andrei; Silverman, Robert H.; Stark, George R.; Williams, Bryan R. G.
2005-01-01
p53 has been well characterized as a tumor suppressor gene, but its role in antiviral defense remains unclear. A recent report has demonstrated that p53 can be induced by interferons and is activated after vesicular stomatitis virus (VSV) infection. We observed that different nononcogenic viruses, including encephalomyocarditis virus (EMCV) and human parainfluenza virus type 3 (HPIV3), induced down-regulation of p53 in infected cells. Double-stranded RNA (dsRNA) and a mutant vaccinia virus la...
Acetylation Is Crucial for p53-Mediated Ferroptosis and Tumor Suppression
Directory of Open Access Journals (Sweden)
Shang-Jui Wang
2016-10-01
Full Text Available Although previous studies indicate that loss of p53-mediated cell cycle arrest, apoptosis, and senescence does not completely abrogate its tumor suppression function, it is unclear how the remaining activities of p53 are regulated. Here, we have identified an acetylation site at lysine K98 in mouse p53 (or K101 for human p53. Whereas the loss of K98 acetylation (p53K98R alone has very modest effects on p53-mediated transactivation, simultaneous mutations at all four acetylation sites (p534KR: K98R+ 3KR[K117R+K161R+K162R] completely abolish its ability to regulate metabolic targets, such as TIGAR and SLC7A11. Notably, in contrast to p533KR, p534KR is severely defective in suppressing tumor growth in mouse xenograft models. Moreover, p534KR is still capable of inducing the p53-Mdm2 feedback loop, but p53-dependent ferroptotic responses are markedly abrogated. Together, these data indicate the critical role of p53 acetylation in ferroptotic responses and its remaining tumor suppression activity.
Bladder-like graphical representation of p53 gene alterations in some human cancers
International Nuclear Information System (INIS)
Helal, N.L.; Dorrah, M.; LI, C.
2005-01-01
the p53 tumor suppressor gene is mutated in about half of all human cancer cells. These mutations are not only important in tumor progression but apparently also in the response of some tumors to chemotherapy and radiation treatment, thus to clinical outcome. Recent studies have shown that cells carrying p53 mutations are more resistant to radiation and chemotherapy than cells with functional p53. More than 15000 tumors with Tp53 mutations were published, leadingto the description of more than 1500 different Tp53 mutants (at the site http:// p53. curie.fr). To exploit this huge bulk of data, specific analytic tools were highly warranted. Also, new computational techniques for rapid determination of such information and comparative studies of different mutations are required. In the present study, a mathematical method for the IARC library p53 mutation database comparing p53 mutations occurring in four different cancers was described. The sizes of the four cancers in the database were bladder (860), liver (786), brain (1170) and skin (38) cancers, for a total of 2854 of p53 mutations. The study was carried out on exons 4-8 of p53 for the four cancers under investigation. From this study, it can be quantitatively obtained some information for each characteristic sequence. The data showed that exon 8 was the most mutant exon in skin cancer and exon 7 was the lowest one. In hepatocellular carcinoma, exon 4 was the most mutant exon and exon 7 was the lowest mutant exon. Brain cancer showed high mutation in exon 8 and low mutation at exon 6. Finally, bladder mutation was mostly mutated at exon 6 comparing to the least value of exon 7. It is expected that this study of p53 mutation may provide useful information for the diagnosis, prognosis and treatment of cancer
Robustness of the p53 network and biological hackers.
Dartnell, Lewis; Simeonidis, Evangelos; Hubank, Michael; Tsoka, Sophia; Bogle, I David L; Papageorgiou, Lazaros G
2005-06-06
The p53 protein interaction network is crucial in regulating the metazoan cell cycle and apoptosis. Here, the robustness of the p53 network is studied by analyzing its degeneration under two modes of attack. Linear Programming is used to calculate average path lengths among proteins and the network diameter as measures of functionality. The p53 network is found to be robust to random loss of nodes, but vulnerable to a targeted attack against its hubs, as a result of its architecture. The significance of the results is considered with respect to mutational knockouts of proteins and the directed attacks mounted by tumour inducing viruses.
P53-dependent ceramide generation in response ro ionizing irradiation is caspase-dependent
International Nuclear Information System (INIS)
Dbaibo, G.; El-Assaad, W.
2000-01-01
Full text.We have previously reported that p53-dependent apoptosis is accompanied by ceramide accumulation. Lack of p53 prevents ceramide accumulation in response to induces such as ionizing irradiation. The mechanisms of ceramide accumulation have not been explored. P53 has been reported to function by inducing the death receptors Fas and DR5 both of which function by initiating a caspase cascade that results in apoptosis. We decided to examine the role of caspases in the elevation of cellular ceramide levels. We treated Molt-4 cells with 5Gy of ionizing irradiation and examined the effects of co-treatment with the general caspase inhibitor z-VAD-fmk at concentration of 50 and 100μM. We found that z-VAD blocked apoptosis induced by irradiation without interfering with p53 accumulation indicating that it was not functioning upstream of p53. However, z-VAD treatment resulted in a significant decrease in ceramide accumulation. Additionally, z-VAD partially blocked the loss of glutathione in response to irradiation. This was important since glutathione has been described as an inhibitor of neutral sphindomyelinase, a major source of cellular ceramide via sphingomyelin hydrolysis. These studies indicate that p53 induces ceramide accumulation in a caspase-dependent manner and that the regulation of cellular glutathione by caspases may be a mechanism by which they regulate ceramide accumulation
Directory of Open Access Journals (Sweden)
Michalis Fragkos
Full Text Available Cell death occurring during mitosis, or mitotic catastrophe, often takes place in conjunction with apoptosis, but the conditions in which mitotic catastrophe may exhibit features of programmed cell death are still unclear. In the work presented here, we studied mitotic cell death by making use of a UV-inactivated parvovirus (adeno-associated virus; AAV that has been shown to induce a DNA damage response and subsequent death of p53-defective cells in mitosis, without affecting the integrity of the host genome. Osteosarcoma cells (U2OSp53DD that are deficient in p53 and lack the G1 cell cycle checkpoint respond to AAV infection through a transient G2 arrest. We found that the infected U2OSp53DD cells died through mitotic catastrophe with no signs of chromosome condensation or DNA fragmentation. Moreover, cell death was independent of caspases, apoptosis-inducing factor (AIF, autophagy and necroptosis. These findings were confirmed by time-lapse microscopy of cellular morphology following AAV infection. The assays used readily revealed apoptosis in other cell types when it was indeed occurring. Taken together the results indicate that in the absence of the G1 checkpoint, mitotic catastrophe occurs in these p53-null cells predominantly as a result of mechanical disruption induced by centrosome overduplication, and not as a consequence of a suicide signal.
Lv, Jianrui; Tian, Junbin; Zheng, Guoxi; Zhao, Jing
2017-10-01
Sirtuin7 (SIRT7) is known to regulate apoptosis and stress responses. So far, very little is known about the role of SIRT7 in cerebral ischemia/reperfusion injury. In this study, we aimed to investigate the potential role of SIRT7 in regulating oxygen-glucose deprivation and reoxygenation (OGD/R)-induced injury in neurons. We found a significant increase of SIRT7 expression in neurons in response to OGD/R treatment. Knockdown of SIRT7 aggravated OGD/R-induced injury. Knockdown of SIRT7 augmented the levels of total and acetylated p53 protein. Moreover, knockdown of SIRT7 markedly increased the transcriptional activity of p53 toward apoptosis and activated the p53-mediated proapoptotic signaling pathway. By contrast, overexpression of SIRT7 showed the opposite effects. Taken together, the results of our study suggest that SIRT7 is involved in protecting neurons against OGD/R-induced injury, possibly through regulation of the p53-mediated proapoptotic signaling pathway, indicating a potential therapeutic target for cerebral ischemia/reperfusion injury. © 2017 Wiley Periodicals, Inc.
Wang, Lin; Pang, Xiao-Cong; Yu, Zi-Ru; Yang, Sheng-Qian; Liu, Ai-Lin; Wang, Jin-Hua; Du, Guan-Hua
2017-06-01
The aim of this study is to investigate the synergism of low dose of actinomycin D (LDActD) to the cytotoxicity of cisplatin (CDDP) on KB cells. The role of P53 reactivation by LDActD in the synergism and its mechanism were further studied. Cell viability was determined by MTT assay. Apoptosis was determined by AnnexinV-FITC/PI staining. Mitochondrial membrane potential (MMP) was detected by JC-1 staining. Expression of proteins was detected by Western blotting (WB) and/or immunofluorescence (IF). Molecular docking of actinomycin D (ACTD) to Mouse double minute 2 homolog (MDM2) and Mouse double minute 2 homolog X (MDMX). MDMX was analyzed by Discovery Studio. The content of P53-MDM2 complex was detected by ELISA assay. The cytotoxicity of CDDP was increased by the combination of LDActD in kinds of cancer cells. Molecular docking showed strong interaction between ACTD and MDM2/MDMX. Meanwhile, LDActD significantly decreased P53-MDM2 complex. Significant increase of the apoptotic activity by the combination therapy in KB cells is P53 upregulated modulator of apoptosis (PUMA) dependent. In addition to the decrease in MMP, LDActD increased P53 regulated protein and decreased BCL-XL in KB cells. LDActD efficiently enhanced the cytotoxicity of CDDP in cancer cells and induced P53-PUMA-dependent and mitochondria-mediated apoptosis in KB cells. The reactivation of P53 was probably achieved by disturbing the interaction of P53 and MDM2/MDMX.
Targeting p53 via JNK pathway: a novel role of RITA for apoptotic signaling in multiple myeloma.
Saha, Manujendra N; Jiang, Hua; Yang, Yijun; Zhu, Xiaoyun; Wang, Xiaoming; Schimmer, Aaron D; Qiu, Lugui; Chang, Hong
2012-01-01
The low frequency of p53 alterations e.g., mutations/deletions (∼10%) in multiple myeloma (MM) makes this tumor type an ideal candidate for p53-targeted therapies. RITA is a small molecule which can induce apoptosis in tumor cells by activating the p53 pathway. We previously showed that RITA strongly activates p53 while selectively inhibiting growth of MM cells without inducing genotoxicity, indicating its potential as a drug lead for p53-targeted therapy in MM. However, the molecular mechanisms underlying the pro-apoptotic effect of RITA are largely undefined. Gene expression analysis by microarray identified a significant number of differentially expressed genes associated with stress response including c-Jun N-terminal kinase (JNK) signaling pathway. By Western blot analysis we further confirmed that RITA induced activation of p53 in conjunction with up-regulation of phosphorylated ASK-1, MKK-4 and c-Jun. These results suggest that RITA induced the activation of JNK signaling. Chromatin immunoprecipitation (ChIP) analysis showed that activated c-Jun binds to the activator protein-1 (AP-1) binding site of the p53 promoter region. Disruption of the JNK signal pathway by small interfering RNA (siRNA) against JNK or JNK specific inhibitor, SP-600125 inhibited the activation of p53 and attenuated apoptosis induced by RITA in myeloma cells carrying wild type p53. On the other hand, p53 transcriptional inhibitor, PFT-α or p53 siRNA not only inhibited the activation of p53 transcriptional targets but also blocked the activation of c-Jun suggesting the presence of a positive feedback loop between p53 and JNK. In addition, RITA in combination with dexamethasone, known as a JNK activator, displays synergistic cytotoxic responses in MM cell lines and patient samples. Our study unveils a previously undescribed mechanism of RITA-induced p53-mediated apoptosis through JNK signaling pathway and provides the rationale for combination of p53 activating drugs with JNK
Targeting p53 via JNK pathway: a novel role of RITA for apoptotic signaling in multiple myeloma.
Directory of Open Access Journals (Sweden)
Manujendra N Saha
Full Text Available The low frequency of p53 alterations e.g., mutations/deletions (∼10% in multiple myeloma (MM makes this tumor type an ideal candidate for p53-targeted therapies. RITA is a small molecule which can induce apoptosis in tumor cells by activating the p53 pathway. We previously showed that RITA strongly activates p53 while selectively inhibiting growth of MM cells without inducing genotoxicity, indicating its potential as a drug lead for p53-targeted therapy in MM. However, the molecular mechanisms underlying the pro-apoptotic effect of RITA are largely undefined. Gene expression analysis by microarray identified a significant number of differentially expressed genes associated with stress response including c-Jun N-terminal kinase (JNK signaling pathway. By Western blot analysis we further confirmed that RITA induced activation of p53 in conjunction with up-regulation of phosphorylated ASK-1, MKK-4 and c-Jun. These results suggest that RITA induced the activation of JNK signaling. Chromatin immunoprecipitation (ChIP analysis showed that activated c-Jun binds to the activator protein-1 (AP-1 binding site of the p53 promoter region. Disruption of the JNK signal pathway by small interfering RNA (siRNA against JNK or JNK specific inhibitor, SP-600125 inhibited the activation of p53 and attenuated apoptosis induced by RITA in myeloma cells carrying wild type p53. On the other hand, p53 transcriptional inhibitor, PFT-α or p53 siRNA not only inhibited the activation of p53 transcriptional targets but also blocked the activation of c-Jun suggesting the presence of a positive feedback loop between p53 and JNK. In addition, RITA in combination with dexamethasone, known as a JNK activator, displays synergistic cytotoxic responses in MM cell lines and patient samples. Our study unveils a previously undescribed mechanism of RITA-induced p53-mediated apoptosis through JNK signaling pathway and provides the rationale for combination of p53 activating drugs with
Witt, Kristine L; Hsieh, Jui-Hua; Smith-Roe, Stephanie L; Xia, Menghang; Huang, Ruili; Zhao, Jinghua; Auerbach, Scott S; Hur, Junguk; Tice, Raymond R
2017-08-01
Genotoxicity potential is a critical component of any comprehensive toxicological profile. Compounds that induce DNA or chromosomal damage often activate p53, a transcription factor essential to cell cycle regulation. Thus, within the US Tox21 Program, we screened a library of ∼10,000 (∼8,300 unique) environmental compounds and drugs for activation of the p53-signaling pathway using a quantitative high-throughput screening assay employing HCT-116 cells (p53 +/+ ) containing a stably integrated β-lactamase reporter gene under control of the p53 response element (p53RE). Cells were exposed (-S9) for 16 hr at 15 concentrations (generally 1.2 nM to 92 μM) three times, independently. Excluding compounds that failed analytical chemistry analysis or were suspected of inducing assay interference, 365 (4.7%) of 7,849 unique compounds were concluded to activate p53. As part of an in-depth characterization of our results, we first compared them with results from traditional in vitro genotoxicity assays (bacterial mutation, chromosomal aberration); ∼15% of known, direct-acting genotoxicants in our library activated the p53RE. Mining the Comparative Toxicogenomics Database revealed that these p53 actives were significantly associated with increased expression of p53 downstream genes involved in DNA damage responses. Furthermore, 53 chemical substructures associated with genotoxicity were enriched in certain classes of p53 actives, for example, anthracyclines (antineoplastics) and vinca alkaloids (tubulin disruptors). Interestingly, the tubulin disruptors manifested unusual nonmonotonic concentration response curves suggesting activity through a unique p53 regulatory mechanism. Through the analysis of our results, we aim to define a role for this assay as one component of a comprehensive toxicological characterization of large compound libraries. Environ. Mol. Mutagen. 58:494-507, 2017. © 2017 Wiley Periodicals, Inc. © 2017 Wiley Periodicals, Inc.
3-MCPD 1-palmitate induced renal tubular cell apoptosis in vivo via JNK/p53 pathway
Fatty acid esters of 3-chloro-1, 2-propanediol (3-MCPD esters) are a group of processing-induced food contaminants with nephrotoxicity, but the molecular mechanism(s) remains unclear. This study investigated whether and how the JNK/p53 pathway may play a role in the nephrotoxic effect of 3-MCPD este...
Mitofusin-2 is a novel direct target of p53
International Nuclear Information System (INIS)
Wang, Weilin; Cheng, Xiaofei; Lu, Jianju; Wei, Jianfeng; Fu, Guanghou; Zhu, Feng; Jia, Changku; Zhou, Lin; Xie, Haiyang; Zheng, Shusen
2010-01-01
Research highlights: → Mfn2 is a novel target gene of p53. → Mfn2 mRNA and protein levels can be up-regulated in a p53-dependent manner. → Mfn2 promoter activity can be elevated by the p53 protein. → P53 protein binds the Mfn2 promoter directly both in vitro and in vivo. -- Abstract: The tumor suppressor p53 modulates transcription of a number of target genes involved in cell cycle arrest, apoptosis, DNA repair, and other important cellular responses. Mitofusin-2 (Mfn2) is a novel suppressor of cell proliferation that may also exert apoptotic effects via the mitochondrial apoptotic pathway. Through bioinformatics analysis, we identified a p53 binding site in the Mfn2 promoter. Consistent with this, we showed that the p53 protein binds the Mfn2 promoter directly both in vitro and in vivo. Additionally, we found that Mfn2 mRNA and protein levels are up-regulated in a p53-dependent manner. Furthermore, luciferase assays revealed that the activity of the wild-type Mfn2 promoter, but not a mutated version of the promoter, was up-regulated by p53. These results indicate that Mfn2 is a novel p53-inducible target gene, which provides insight into the regulation of Mfn2 and its associated activities in the inhibition of cell proliferation, promotion of apoptosis, and modulation of tumor suppression.
Identification of a p53-response element in the promoter of the proline oxidase gene
International Nuclear Information System (INIS)
Maxwell, Steve A.; Kochevar, Gerald J.
2008-01-01
Proline oxidase (POX) is a p53-induced proapoptotic gene. We investigated whether p53 could bind directly to the POX gene promoter. Chromatin immunoprecipitation (ChIP) assays detected p53 bound to POX upstream gene sequences. In support of the ChIP results, sequence analysis of the POX gene and its 5' flanking sequences revealed a potential p53-binding site, GGGCTTGTCTTCGTGTGACTTCTGTCT, located at 1161 base pairs (bp) upstream of the transcriptional start site. A 711-bp DNA fragment containing the candidate p53-binding site exhibited reporter gene activity that was induced by p53. In contrast, the same DNA region lacking the candidate p53-binding site did not show significant p53-response activity. Electrophoretic mobility shift assay (EMSA) in ACHN renal carcinoma cell nuclear lysates confirmed that p53 could bind to the 711-bp POX DNA fragment. We concluded from these experiments that a p53-binding site is positioned at -1161 to -1188 bp upstream of the POX transcriptional start site
p53 Acetylation: Regulation and Consequences
International Nuclear Information System (INIS)
Reed, Sara M.; Quelle, Dawn E.
2014-01-01
Post-translational modifications of p53 are critical in modulating its tumor suppressive functions. Ubiquitylation, for example, plays a major role in dictating p53 stability, subcellular localization and transcriptional vs. non-transcriptional activities. Less is known about p53 acetylation. It has been shown to govern p53 transcriptional activity, selection of growth inhibitory vs. apoptotic gene targets, and biological outcomes in response to diverse cellular insults. Yet recent in vivo evidence from mouse models questions the importance of p53 acetylation (at least at certain sites) as well as canonical p53 functions (cell cycle arrest, senescence and apoptosis) to tumor suppression. This review discusses the cumulative findings regarding p53 acetylation, with a focus on the acetyltransferases that modify p53 and the mechanisms regulating their activity. We also evaluate what is known regarding the influence of other post-translational modifications of p53 on its acetylation, and conclude with the current outlook on how p53 acetylation affects tumor suppression. Due to redundancies in p53 control and growing understanding that individual modifications largely fine-tune p53 activity rather than switch it on or off, many questions still remain about the physiological importance of p53 acetylation to its role in preventing cancer
p53 Acetylation: Regulation and Consequences
Energy Technology Data Exchange (ETDEWEB)
Reed, Sara M. [Department of Pharmacology, The University of Iowa Carver College of Medicine, Iowa City, IA 52242 (United States); Medical Scientist Training Program, The University of Iowa Carver College of Medicine, Iowa City, IA 52242 (United States); Quelle, Dawn E., E-mail: dawn-quelle@uiowa.edu [Department of Pharmacology, The University of Iowa Carver College of Medicine, Iowa City, IA 52242 (United States); Medical Scientist Training Program, The University of Iowa Carver College of Medicine, Iowa City, IA 52242 (United States); Department of Pathology, The University of Iowa Carver College of Medicine, Iowa City, IA 52242 (United States)
2014-12-23
Post-translational modifications of p53 are critical in modulating its tumor suppressive functions. Ubiquitylation, for example, plays a major role in dictating p53 stability, subcellular localization and transcriptional vs. non-transcriptional activities. Less is known about p53 acetylation. It has been shown to govern p53 transcriptional activity, selection of growth inhibitory vs. apoptotic gene targets, and biological outcomes in response to diverse cellular insults. Yet recent in vivo evidence from mouse models questions the importance of p53 acetylation (at least at certain sites) as well as canonical p53 functions (cell cycle arrest, senescence and apoptosis) to tumor suppression. This review discusses the cumulative findings regarding p53 acetylation, with a focus on the acetyltransferases that modify p53 and the mechanisms regulating their activity. We also evaluate what is known regarding the influence of other post-translational modifications of p53 on its acetylation, and conclude with the current outlook on how p53 acetylation affects tumor suppression. Due to redundancies in p53 control and growing understanding that individual modifications largely fine-tune p53 activity rather than switch it on or off, many questions still remain about the physiological importance of p53 acetylation to its role in preventing cancer.
P53 autoantibodies in 1006 patients followed up for breast cancer
International Nuclear Information System (INIS)
Metcalfe, Su; Wheeler, Terence K; Picken, Sheila; Negus, Susanne; Jo Milner, A
2000-01-01
to p53 would reflect tumour behaviour. However, we found that the presence or absence of p53 autoantibodies was not predictive of presence or absence of recurrent disease. There was an equivalent incidence of active disease at the time of sampling in both the autoantibody-negative and autoantibody-positive groups, these being 25.2 and 28.7%, respectively. Thus, humoral immune activity against p53 appeared to be relatively restricted to a subgroup of patients in whom, once an autoantibody response had been generated, antibody was likely to persist regardless of tumour behaviour. Conversely, where no detectable p53 autoantibody was present at the time of primary diagnosis, these patients remained similarly negative for antibody, irrespective of subsequent disease activity (Table 3). In contrast to shed markers that correlate with tumour mass, such as CA15.3 for cancer of the breast, any tumour-related immune response will be subject to complex regulation. Autoantibody responses to p53 will require appropriate primary immunization; initial low-dose antigen exposure may induce immune tolerance and lack of response. Higher antigen doses may activate either antibody-mediated immunity, or cellular immunity. In breast cancer patients, our results suggest that, once an active humoral response against p53 is established, then this remains active. This persistent humoral reaction may be driven by persistent antigenic stimulation by p53 protein derived from overexpression of p53 at distant metastatic sites; alternatively, irradiated normal tissue may be a source of continued antigenic stimulation, because a long-term side effect of radiation therapy is an increased expression of p53 in normal breast tissue that persists for several years [12]. Since the great majority of our total patient cohort had received radiotherapy, humoral immunity to p53 associated with primary disease might persist, even in those patients who enter remission, due to tumour-independent antigenic
Influence of p53 and bcl-2 on chemosensitivity in benign and malignant prostatic cell lines.
Serafin, Antonio M; Bohm, Lothar
2005-01-01
The administration of cancer chemotherapeutic agents results in an increase in the apoptotic cells in the tumor: therefore, it has been assumed that anticancer drugs exhibit their cytotoxic effects via apoptotic signaling pathways. Characteristics that confer sensitivity to drug-induced apoptosis are, a functional p53 protein and expression of the apoptosis-promoting protein, bax. The role of p53 and bax/bcl-2 in drug-induced apoptosis was assessed in six prostate cell lines, 1532T, 1535T, 1542T, 1542N, BPH-1 and LNCaP using TD(50) concentrations of etoposide, vinblastine and estramustine. Cell death was monitored morphologically by fluorescent microscopy, and by flow cytometry (Annexin-V assay). Apoptotic morphology was rather low and ranged from 0.1% to 12.1%, 3.0% to 6.0% and 0.1% to 8.5% for etoposide, estramustine and vinblastine, respectively. Annexin-V binding and flow cytometry indicated apoptotic propensities of 0% to 4%, 0% to 3% and 0% to 5%, respectively. The percentage of cells responding to drug-induced apoptosis was, on average, higher in the tumor cell lines than in the normal cell lines, but showed no correlation with p53 status. The percentage of cells showing necrosis, assessed by Annexin binding and Propidium Iodide permeability in aqueous medium, tended to be much higher, and was found to be at the level of 5% to 30%. Immunoblotting demonstrated that bax and bcl-2 proteins were expressed at a basal level in all cell lines, but did not increase after exposure to TD(50) doses of the three drugs. The ratio of bax and bcl-2, measured by laser scanning densitometry, was not altered by the drug-induced DNA damage. The results suggest that apoptosis is not a major mechanism of drug-induced cell death in prostate cell lines and appears to be independent of p53 status and bax/bcl-2 expression.
Differential p53 engagement in response to oxidative and oncogenic stresses in Fanconi anemia mice
Rani, Reena; Li, Jie; Pang, Qishen
2008-01-01
Members of the Fanconi anemia (FA) protein family are involved in repair of genetic damage caused by DNA cross-linkers. It is not clear whether the FA proteins function in oxidative DNA damage and oncogenic stress response. Here we report that deficiency in the Fanca gene in mice elicits a p53-dependent growth arrest and DNA damage response to oxidative DNA damage and oncogenic stress. Using a Fanca-/- Trp53-/- double knockout model and a functionally switchable p53 retrovirus, we define the kinetics, dependence, and persistence of p53-mediated response to oxidative and oncogenic stresses in Fanca-/- cells. Notably, oxidative stress induces persistent p53 response in Fanca-/- cells, likely due to accumulation of unrepaired DNA damage. On the other hand, whereas WT cells exhibit prolonged response to oncogene activation, the p53-activating signals induced by oncogenic ras are short-lived in Fanca-/- cells, suggesting that Fanca may be required for the cell to engage p53 during constitutive ras activation. We propose that the FA proteins protect cells from stress-induced proliferative arrest and tumor evolution by acting as a modulator of the signaling pathways that link FA to p53. PMID:19047147
Differential p53 engagement in response to oxidative and oncogenic stresses in Fanconi anemia mice.
Rani, Reena; Li, Jie; Pang, Qishen
2008-12-01
Members of the Fanconi anemia (FA) protein family are involved in repair of genetic damage caused by DNA cross-linkers. It is not clear whether the FA proteins function in oxidative DNA damage and oncogenic stress response. Here, we report that deficiency in the Fanca gene in mice elicits a p53-dependent growth arrest and DNA damage response to oxidative DNA damage and oncogenic stress. Using a Fanca-/-Trp53-/- double knockout model and a functionally switchable p53 retrovirus, we define the kinetics, dependence, and persistence of p53-mediated response to oxidative and oncogenic stresses in Fanca-/- cells. Notably, oxidative stress induces persistent p53 response in Fanca-/- cells, likely due to accumulation of unrepaired DNA damage. On the other hand, whereas wild-type cells exhibit prolonged response to oncogene activation, the p53-activating signals induced by oncogenic ras are short-lived in Fanca-/- cells, suggesting that Fanca may be required for the cell to engage p53 during constitutive ras activation. We propose that the FA proteins protect cells from stress-induced proliferative arrest and tumor evolution by acting as a modulator of the signaling pathways that link FA to p53.
Circumvention and reactivation of the p53 oncogene checkpoint in mouse colon tumors.
Aizu, Wataru; Belinsky, Glenn S; Flynn, Christopher; Noonan, Emily J; Boes, Colleen C; Godman, Cassandra A; Doshi, Bindi; Nambiar, Prashant R; Rosenberg, Daniel W; Giardina, Charles
2006-10-16
The p53 tumor suppressor protein is sequence-normal in azoxymethane (AOM)-induced mouse colon tumors, making them a good model for human colon cancers that retain a wild type p53 gene. Cellular localization and co-immunoprecipitation experiments using a cell line derived from an AOM-induced colon tumor (AJ02-NM(0) cells) pointed to constitutively expressed Mdm2 as being an important negative regulator of p53 in these cells. Although the Mdm2 inhibitory protein p19/ARF was expressed in AJ02-NM(0) cells, its level of expression was not sufficient for p53 activation. We tested the response of AJ02-NM(0) cells to the recently developed Mdm2 inhibitor, Nutlin-3. Nutlin-3 was found to activate p53 DNA binding in AJ02-NM(0) cells, to a level comparable to doxorubicin and 5-fluorouracil (5-FU). In addition, Nutlin-3 increased expression of the p53 target genes Bax and PERP to a greater extent than doxorubicin or 5-FU, and triggered a G2/M phase arrest in these cells, compared to a G1 arrest triggered by doxorubicin and 5-FU. The differences in the cellular response may be related to differences in the kinetics of p53 activation and/or its post-translational modification status. In an ex vivo experiment, Nutlin-3 was found to activate p53 target gene expression and apoptosis in AOM-induced tumor tissue, but not in normal adjacent mucosa. Our data indicate that Mdm2 inhibitors may be an effective means of selectively targeting colon cancers that retain a sequence-normal p53 gene while sparing normal tissue and that the AOM model is an appropriate model for the preclinical development of these drugs.
Urodele p53 tolerates amino acid changes found in p53 variants linked to human cancer
Directory of Open Access Journals (Sweden)
Villiard Éric
2007-09-01
Full Text Available Abstract Background Urodele amphibians like the axolotl are unique among vertebrates in their ability to regenerate and their resistance to develop cancers. It is unknown whether these traits are linked at the molecular level. Results Blocking p53 signaling in axolotls using the p53 inhibitor, pifithrin-α, inhibited limb regeneration and the expression of p53 target genes such as Mdm2 and Gadd45, suggesting a link between tumor suppression and regeneration. To understand this relationship we cloned the p53 gene from axolotl. When comparing its sequence with p53 from other organisms, and more specifically human we observed multiple amino acids changes found in human tumors. Phylogenetic analysis of p53 protein sequences from various species is in general agreement with standard vertebrate phylogeny; however, both mice-like rodents and teleost fishes are fast evolving. This leads to long branch attraction resulting in an artefactual basal emergence of these groups in the phylogenetic tree. It is tempting to assume a correlation between certain life style traits (e.g. lifespan and the evolutionary rate of the corresponding p53 sequences. Functional assays of the axolotl p53 in human or axolotl cells using p53 promoter reporters demonstrated a temperature sensitivity (ts, which was further confirmed by performing colony assays at 37°C. In addition, axolotl p53 was capable of efficient transactivation at the Hmd2 promoter but has moderate activity at the p21 promoter. Endogenous axolotl p53 was activated following UV irradiation (100 j/m2 or treatment with an alkylating agent as measured using serine 15 phosphorylation and the expression of the endogenous p53 target Gadd45. Conclusion Urodele p53 may play a role in regeneration and has evolved to contain multiple amino acid changes predicted to render the human protein defective in tumor suppression. Some of these mutations were probably selected to maintain p53 activity at low temperature. However
Tumor-promoting phorbol ester transiently down-modulates the p53 level and blocks the cell cycle
DEFF Research Database (Denmark)
Skouv, J.; Jensen, P O; Forchhammer, J
1994-01-01
Activation of the protein kinase C signaling pathway by tumor-promoting phorbol esters, such as 4 beta-phorbol 12-myristate 13-acetate (PMA), induced a decrease in the level of p53 mRNA in several serum-starved human cell lines. Also, the tumor-promoting phosphatase inhibitor okadaic acid induced...... a decrease in the p53 mRNA level in the cell lines. Normal diploid as well as various tumor cell lines were tested. Two tumor cell lines, HeLa and A549, both containing the wild-type p53 gene, but very different levels of p53 protein, were studied in detail. In both cell lines, the level of p53 m......RNA was minimal after 9 h of exposure to PMA. After approximately 120 h, the p53 mRNA level was similar to the pretreatment level. PMA induced a similar transient decrease in the level of p53 protein in the A549 cell line. The decrease in the p53 mRNA level could not be explained by changes in the transcriptional...
Basal p53 expression is indispensable for mesenchymal stem cell integrity.
Boregowda, Siddaraju V; Krishnappa, Veena; Strivelli, Jacqueline; Haga, Christopher L; Booker, Cori N; Phinney, Donald G
2018-03-01
Marrow-resident mesenchymal stem cells (MSCs) serve as a functional component of the perivascular niche that regulates hematopoiesis. They also represent the main source of bone formed in adult bone marrow, and their bifurcation to osteoblast and adipocyte lineages plays a key role in skeletal homeostasis and aging. Although the tumor suppressor p53 also functions in bone organogenesis, homeostasis, and neoplasia, its role in MSCs remains poorly described. Herein, we examined the normal physiological role of p53 in primary MSCs cultured under physiologic oxygen levels. Using knockout mice and gene silencing we show that p53 inactivation downregulates expression of TWIST2, which normally restrains cellular differentiation to maintain wild-type MSCs in a multipotent state, depletes mitochondrial reactive oxygen species (ROS) levels, and suppresses ROS generation and PPARG gene and protein induction in response to adipogenic stimuli. Mechanistically, this loss of adipogenic potential skews MSCs toward an osteogenic fate, which is further potentiated by TWIST2 downregulation, resulting in highly augmented osteogenic differentiation. We also show that p53 - /- MSCs are defective in supporting hematopoiesis as measured in standard colony assays because of decreased secretion of various cytokines including CXCL12 and CSF1. Lastly, we show that transient exposure of wild-type MSCs to 21% oxygen upregulates p53 protein expression, resulting in increased mitochondrial ROS production and enhanced adipogenic differentiation at the expense of osteogenesis, and that treatment of cells with FGF2 mitigates these effects by inducing TWIST2. Together, these findings indicate that basal p53 levels are necessary to maintain MSC bi-potency, and oxygen-induced increases in p53 expression modulate cell fate and survival decisions. Because of the critical function of basal p53 in MSCs, our findings question the use of p53 null cell lines as MSC surrogates, and also implicate dysfunctional
Tumor hypoxia, p53, and prognosis in cervical cancers
International Nuclear Information System (INIS)
Haensgen, Gabriele; Krause, Ulf; Becker, Axel; Stadler, Peter; Lautenschlaeger, Christine; Wohlrab, Wolfgang; Rath, Friedrich W.; Molls, Michael; Dunst, Juergen
2001-01-01
=0.01). Sixty of the 70 tumors showed positive immunohistologic staining for p53 protein (transformed p53=tp53), and 10/70 were negative (wild-type p53=wtp53); p53 expression had no significant impact on survival (50% for tp53 vs. 79% for wtp53, p=0.11). FIGO stage and anemia had no impact on p53 expression. Forty-nine of 70 tumors were hypoxic (HF5+), and 21 showed no hypoxia (HF5-). Hypoxic carcinomas were more frequently positive for p53 as compared to nonhypoxic tumors (27% vs. 13%, p=0.011) and showed a trend toward a lower survival (48% vs. 70%, p = 0.07). In a further multivariate analysis, the impact of a combination of p53 expression and hypoxia on survival was examined. After adjusting for FIGO stage and pretreatment anemia, patients with wtp53 tumors had the best prognosis (3-year survival 79%) followed by tp53-HF5(-) patients (57%), and the most unfavorable prognosis was observed for tp53-HF5(+) patients (47%). The DNA index was higher in tp53 carcinomas compared to wtp53 tumors, 1.97±0.4 vs. 1.67±0.1, p=0.05. The highest DNA index was found in hypoxic tumors with transformed p53 (2.2±3.1). Conclusions: Advanced stage and pretreatment hemoglobin level are independent prognostic factors in cervical carcinomas. The immunohistologic detection of (a functionally inactive) p53 and the presence of hypoxia had no prognostic impact, if analyzed as single parameters. However, the combination of both parameters was able to discriminate different prognostic subgroups. Moreover, hypoxic cancers were more often immunohistologically positive for tp53 protein and had a higher DNA index with the highest DNA index in tumors with both hypoxia and tp53 protein expression. These findings in summary support the theory that the tumor's microenvironment may influence the biologic behavior via hypoxia
Directory of Open Access Journals (Sweden)
Richard Moore
2015-12-01
Full Text Available The p53 tumor suppressor protein plays a critical role in cellular stress and cancer prevention. A number of post-transcriptional regulators, termed microRNAs, are closely connected with the p53-mediated cellular networks. While the molecular interactions among p53 and microRNAs have emerged, a systems-level understanding of the regulatory mechanism and the role of microRNAs-forming feedback loops with the p53 core remains elusive. Here we have identified from literature that there exist three classes of microRNA-mediated feedback loops revolving around p53, all with the nature of positive feedback coincidentally. To explore the relationship between the cellular performance of p53 with the microRNA feedback pathways, we developed a mathematical model of the core p53-MDM2 module coupled with three microRNA-mediated positive feedback loops involving miR-192, miR-34a, and miR-29a. Simulations and bifurcation analysis in relationship to extrinsic noise reproduce the oscillatory behavior of p53 under DNA damage in single cells, and notably show that specific microRNA abrogation can disrupt the wild-type cellular phenotype when the ubiquitous cell-to-cell variability is taken into account. To assess these in silico results we conducted microRNA-perturbation experiments in MCF7 breast cancer cells. Time-lapse microscopy of cell-population behavior in response to DNA double-strand breaks, together with image classification of single-cell phenotypes across a population, confirmed that the cellular p53 oscillations are compromised after miR-192 perturbations, matching well with the model predictions. Our study via modeling in combination with quantitative experiments provides new evidence on the role of microRNA-mediated positive feedback loops in conferring robustness to the system performance of stress-induced response of p53.
Role of Tumor Suppressor P53 in Megakaryopoiesis and Platelet Function
Apostolidis, Pani A.; Woulfe, Donna S.; Chavez, Massiel; Miller, William M.; Papoutsakis, Eleftherios T.
2011-01-01
The pathobiological role of p53 has been widely studied, however its role in normophysiology is relatively unexplored. We previously showed that p53 knock-down increased ploidy in megakaryocytic cultures. This study aims to examine the effect of p53 loss on in vivo megakaryopoiesis, platelet production and function, and to investigate the basis for greater ploidy in p53−/− megakaryocytic cultures. Here, we used flow cytometry to analyze ploidy, DNA synthesis and apoptosis in murine cultured and bone marrow megakaryocytes following thrombopoietin administration and to analyze fibrinogen binding to platelets in vitro. Culture of p53−/− marrow cells for 6 days with thrombopoietin gave rise to 1.7-fold more megakaryocytes, 26.1±3.6% of which reached ploidy classes ≥64N compared to 8.2±0.9% of p53+/+ megakaryocytes. This was due to 30% greater DNA synthesis in p53−/− megakaryocytes and 31% greater apoptosis in p53+/+ megakaryocytes by day 4 of culture. Although the bone marrow and spleen steady-state megakaryocytic content and ploidy were similar in p53+/+ and p53−/− mice, thrombopoietin administration resulted in increased megakaryocytic polyploidization in p53−/− mice. Although their platelet counts were normal, p53−/− mice exhibited significantly longer bleeding times and p53−/− platelets were less sensitive than p53+/+ platelets to agonist-induced fibrinogen binding and P-selectin secretion. In summary, our in vivo and ex-vivo studies indicate that p53 loss leads to increased polyploidization during megakaryopoiesis. Our findings also suggest for the first time a direct link between p53 loss and the development of fully functional platelets resulting in hemostatic deficiencies. PMID:22024107
Perfettini, Jean-Luc; Roumier, Thomas; Castedo, Maria; Larochette, Nathanael; Boya, Patricia; Raynal, Brigitte; Lazar, Vladimir; Ciccosanti, Fabiola; Nardacci, Roberta; Penninger, Josef; Piacentini, Mauro; Kroemer, Guido
2004-03-01
The coculture of cells expressing the HIV-1 envelope glycoprotein complex (Env) with cells expressing CD4 results into cell fusion, deregulated mitosis, and subsequent cell death. Here, we show that NF-kappaB, p53, and AP1 are activated in Env-elicited apoptosis. The nuclear factor kappaB (NF-kappaB) super repressor had an antimitotic and antiapoptotic effect and prevented the Env-elicited phosphorylation of p53 on serine 15 and 46, as well as the activation of AP1. Transfection with dominant-negative p53 abolished apoptosis and AP1 activation. Signs of NF-kappaB and p53 activation were also detected in lymph node biopsies from HIV-1-infected individuals. Microarrays revealed that most (85%) of the transcriptional effects of HIV-1 Env were blocked by the p53 inhibitor pifithrin-alpha. Macroarrays led to the identification of several Env-elicited, p53-dependent proapoptotic transcripts, in particular Puma, a proapoptotic "BH3-only" protein from the Bcl-2 family known to activate Bax/Bak. Down modulation of Puma by antisense oligonucleotides, as well as RNA interference of Bax and Bak, prevented Env-induced apoptosis. HIV-1-infected primary lymphoblasts up-regulated Puma in vitro. Moreover, circulating CD4+ lymphocytes from untreated, HIV-1-infected donors contained enhanced amounts of Puma protein, and these elevated Puma levels dropped upon antiretroviral therapy. Altogether, these data indicate that NF-kappaB and p53 cooperate as the dominant proapoptotic transcription factors participating in HIV-1 infection.
International Nuclear Information System (INIS)
Yasuda, Takako; Nagata, Kento; Igarashi, Kento; Watanabe-Asaka, Tomomi; Oda, Shoji; Mitani, Hiroshi; Kimori, Yoshitaka
2016-01-01
The tumor suppressor protein, p53, plays pivotal roles in regulating apoptosis and proliferation in the embryonic and adult central nervous system (CNS) following neuronal injuries such as those induced by ionizing radiation. There is increasing evidence that p53 negatively regulates the self-renewal of neural stem cells in the adult murine brain; however, it is still unknown whether p53 is essential for self-renewal in the injured developing CNS. Previously, we demonstrated that the numbers of apoptotic cells in medaka (Oryzias latipes) embryos decreased in the absence of p53 at 12-24 h after irradiation with 10-Gy gamma rays. Here, we used histology to examine the later morphological development of the irradiated medaka brain. In p53-deficient larvae, the embryonic brain possessed similar vacuoles in the brain and retina, although the vacuoles were much smaller and fewer than those found in wild-type embryos. At the time of hatching (6 days after irradiation), no brain abnormality was observed. In contrast, severe disorganized neuronal arrangements were still present in the brain of irradiated wild-type embryos. Our present results demonstrated that self-renewal of the brain tissue completed faster in the absence of p53 than wild type at the time of hatching because p53 reduces the acute severe neural apoptosis induced by irradiation, suggesting that p53 is not essential for tissue self-renewal in developing brain. (author)
Štros, Michal; Kučírek, Martin; Sani, Soodabeh Abbasi; Polanská, Eva
2018-03-01
HMGB1 is a chromatin-associated protein that has been implicated in many important biological processes such as transcription, recombination, DNA repair, and genome stability. These functions include the enhancement of binding of a number of transcription factors, including the tumor suppressor protein p53, to their specific DNA-binding sites. HMGB1 is composed of two highly conserved HMG boxes, linked to an intrinsically disordered acidic C-terminal tail. Previous reports have suggested that the ability of HMGB1 to bend DNA may explain the in vitro HMGB1-mediated increase in sequence-specific DNA binding by p53. The aim of this study was to reinvestigate the importance of HMGB1-induced DNA bending in relationship to the ability of the protein to promote the specific binding of p53 to short DNA duplexes in vitro, and to transactivate two major p53-regulated human genes: Mdm2 and p21/WAF1. Using a number of HMGB1 mutants, we report that the HMGB1-mediated increase in sequence-specific p53 binding to DNA duplexes in vitro depends very little on HMGB1-mediated DNA bending. The presence of the acidic C-terminal tail of HMGB1 and/or the oxidation of the protein can reduce the HMGB1-mediated p53 binding. Interestingly, the induction of transactivation of p53-responsive gene promoters by HMGB1 requires both the ability of the protein to bend DNA and the acidic C-terminal tail, and is promoter-specific. We propose that the efficient transactivation of p53-responsive gene promoters by HMGB1 depends on complex events, rather than solely on the promotion of p53 binding to its DNA cognate sites. Copyright © 2018 Elsevier B.V. All rights reserved.
Energy Technology Data Exchange (ETDEWEB)
Eckers, Jaimee C.; Kalen, Amanda L.; Xiao, Wusheng; Sarsour, Ehab H.; Goswami, Prabhat C., E-mail: prabhat-goswami@uiowa.edu
2013-11-01
Purpose: Radiation is a common mode of cancer therapy whose outcome is often limited because of normal tissue toxicity. We have shown previously that the accumulation of radiation-induced late reactive oxygen species (ROS) precedes cell death, suggesting that metabolic oxidative stress could regulate cellular radiation response. The purpose of this study was to investigate whether selenoprotein P (SEPP1), a major supplier of selenium to tissues and an antioxidant, regulates late ROS accumulation and toxicity in irradiated normal human fibroblasts (NHFs). Methods and Materials: Flow cytometry analysis of cell viability, cell cycle phase distribution, and dihydroethidium oxidation, along with clonogenic assays, were used to measure oxidative stress and toxicity. Human antioxidant mechanisms array and quantitative real-time polymerase chain reaction assays were used to measure gene expression during late ROS accumulation in irradiated NHFs. Sodium selenite addition and SEPP1 overexpression were used to determine the causality of SEPP1 regulating late ROS accumulation and toxicity in irradiated NHFs. Results: Irradiated NHFs showed late ROS accumulation (4.5-fold increase from control; P<.05) that occurs after activation of the cell cycle checkpoint pathways and precedes cell death. The mRNA levels of CuZn- and Mn-superoxide dismutase, catalase, peroxiredoxin 3, and thioredoxin reductase 1 increased approximately 2- to 3-fold, whereas mRNA levels of cold shock domain containing E1 and SEPP1 increased more than 6-fold (P<.05). The addition of sodium selenite before the radiation treatment suppressed toxicity (45%; P<.05). SEPP1 overexpression suppressed radiation-induced late ROS accumulation (35%; P<.05) and protected NHFs from radiation-induced toxicity (58%; P<.05). Conclusion: SEPP1 mitigates radiation-induced late ROS accumulation and normal cell injury.
Increased Arf/p53 activity in stem cells, aging and cancer.
Carrasco-Garcia, Estefania; Moreno, Manuel; Moreno-Cugnon, Leire; Matheu, Ander
2017-04-01
Arf/p53 pathway protects the cells against DNA damage induced by acute stress. This characteristic is the responsible for its tumor suppressor activity. Moreover, it regulates the chronic type of stress associated with aging. This is the basis of its anti-aging activity. Indeed, increased gene dosage of Arf/p53 displays elongated longevity and delayed aging. At a cellular level, it has been recently shown that increased dosage of Arf/p53 delays age-associated stem cell exhaustion and the subsequent decline in tissue homeostasis and regeneration. However, p53 can also promote aging if constitutively activated. In this context, p53 reduces tissue regeneration, which correlates with premature exhaustion of stem cells. We discuss here the current evidence linking the Arf/p53 pathway to the processes of aging and cancer through stem cell regulation. © 2017 The Authors. Aging Cell published by the Anatomical Society and John Wiley & Sons Ltd.
Directory of Open Access Journals (Sweden)
Katsuhiko Nosho
2009-01-01
Full Text Available JC virus has a transforming gene encoding JC virus T-antigen (JCVT. JCVT may inactivate wild-type p53, cause chromosomal instability (CIN, and stabilize β-catenin. A link between JCVT and CpG island methylator phenotype (CIMP has been suggested. However, no large-scale study has examined the relations of JCVT with molecular alterations, clinical outcome, or prognosis in colon cancer. We detected JCVT expression (by immunohistochemistry in 271 (35% of 766 colorectal cancers. We quantified DNA methylation in eight CIMP-specific promoters (CACNA1G, CDKN2A, CRABP1, IGF2, MLH1, NEUROG1, RUNX3, and SOCS1 and eight other loci (CHFR, HIC1, IGFBP3, MGMT, MINT1, MINT31, p14, WRN by MethyLight. We examined loss of heterozygosity in 2p, 5q, 17q, and 18q. JCVT was significantly associated with p53 expression (P < .0001, p21 loss (P < .0001, CIN (≥2 chromosomal segments with LOH; P < .0001, nuclear β-catenin (P = .006, LINE-1 hypomethylation (P = .002, and inversely with CIMP-high (P = .0005 and microsatellite instability (MSI (P < .0001, but not with PIK3CA mutation. In multivariate logistic regression analysis, the associations of JCVT with p53 [adjusted odds ratio (OR, 8.45; P < .0001], CIN (adjusted OR, 2.53; P = .003, cyclin D1 (adjusted OR, 1.57; P = .02, LINE-1 hypomethylation (adjusted OR, 1.97 for a 30% decline as a unit; P = .03, BRAF mutation (adjusted OR, 2.20; P = .04, and family history of colorectal cancer (adjusted OR, 0.64; P = .04 remained statistically significant. However, JCVT was no longer significantly associated with CIMP, MSI, β-catenin, or cyclooxygenase-2 expression in multivariate analysis. JCVT was unrelated with patient survival. In conclusion, JCVT expression in colorectal cancer is independently associated with p53 expression and CIN, which may lead to uncontrolled cell proliferation.
Activation of SAT1 engages polyamine metabolism with p53-mediated ferroptotic responses.
Ou, Yang; Wang, Shang-Jui; Li, Dawei; Chu, Bo; Gu, Wei
2016-11-01
Although p53-mediated cell-cycle arrest, senescence, and apoptosis remain critical barriers to cancer development, the emerging role of p53 in cell metabolism, oxidative responses, and ferroptotic cell death has been a topic of great interest. Nevertheless, it is unclear how p53 orchestrates its activities in multiple metabolic pathways into tumor suppressive effects. Here, we identified the SAT1 (spermidine/spermine N 1 -acetyltransferase 1) gene as a transcription target of p53. SAT1 is a rate-limiting enzyme in polyamine catabolism critically involved in the conversion of spermidine and spermine back to putrescine. Surprisingly, we found that activation of SAT1 expression induces lipid peroxidation and sensitizes cells to undergo ferroptosis upon reactive oxygen species (ROS)-induced stress, which also leads to suppression of tumor growth in xenograft tumor models. Notably, SAT1 expression is down-regulated in human tumors, and CRISPR-cas9-mediated knockout of SAT1 expression partially abrogates p53-mediated ferroptosis. Moreover, SAT1 induction is correlated with the expression levels of arachidonate 15-lipoxygenase (ALOX15), and SAT1-induced ferroptosis is significantly abrogated in the presence of PD146176, a specific inhibitor of ALOX15. Thus, our findings uncover a metabolic target of p53 involved in ferroptotic cell death and provide insight into the regulation of polyamine metabolism and ferroptosis-mediated tumor suppression.
Directory of Open Access Journals (Sweden)
Ching-Hao Li
2010-02-01
Full Text Available p53, can regulate cell apoptosis in both transcription-dependent and -independent manners. The transcription-independent pathway was demonstrated by the translocation of p53 to mitochondria. Our study showed that p53 mitochondrial translocation was found in mitomycin C (MMC-treated HepG2. The p53 C-terminal domain is clustered with potential nuclear leading sequences and showed strong electrostatic ion-ion interactions with cardiolipin, phosphatidylglycerol and phosphatidic acid in vitro. Disruption of cardiolipin biosynthesis by phosphatidylglycero-phosphate synthase (PGS or CDP-diacylglycerol synthase 2 (CDS-2 short hairpin RNA (shRNA transfection eliminated the MMC-induced translocation of mitochondrial p53. The elimination of mitochondrial p53 translocation also reduced Bcl-xL and Bcl-2 mitochondrial distribution. In HEK 293T models with saturated p53 expression, the mitochondrial partition of p53, Bcl-xL, and Bcl-2 obviously decreased in their PGS shRNA- or CDS-2 shRNA-expressing stable clones. In p53-null H1299 models, both the mitochondrial partitions of Bcl-xL and Bcl-2 were strongly reduced in relation to the HEK 293T models. The Bcl-xL mitochondrial partition was elevated in H1299 models expressing pCEP4-p53wt suggesting the direct carrier role of p53 in transporting Bcl-xL to the mitochondria. We also found that the cytosolic pool of Bcl-xL and Bcl-2 remained unaffected in the low-dose MMC treatment but decreased in the high-dose MMC treatment. The cytosolic pool of Bcl-2 and Bcl-xL directly regulated their amounts in p53-dependent mitochondrial distribution. In the low-dose MMC treatment, the increased mitochondrial p53, Bcl-xL, and Bcl-2 could attenuate apoptosis. However, in the high-dose MMC treatment, only the p53 translocated to the mitochondria and resulted in apoptosis progression. On the basis of this study, we thought mitochondrial p53 might regulate apoptosis in a biphasic manner.
Radiation-induced adaptive response in fetal mice: a micro-array study
International Nuclear Information System (INIS)
Vares, G.; Bing, Wang; Mitsuru, Nenoi; Tetsuo, Nakajima; Kaoru, Tanaka; Isamu, Hayata
2006-01-01
Exposure of sublethal doses of ionizing radiation can induce protective mechanisms against a subsequent higher dose irradiation. This phenomenon called radio-adaptation (or adaptive response - AR), has been described in a wide range of biological models. In a series of studies, we demonstrated the existence of a radiation-induced AR in mice during late organogenesis. For better understanding of molecular mechanisms underlying AR in our model, we performed a global analysis of transcriptome regulations in cells collected from whole mouse fetuses. Using cDNA micro-arrays, we studied gene expression in these cells after in utero priming exposure to irradiation. Several combinations of radiation dose and dose-rate were applied to induce or not an AR in our system. Gene regulation was observed after exposure to priming radiation in each condition. Student's t-test was performed in order to identify genes whose expression modulation was specifically different in AR-inducing an( non-AR-inducing conditions. Genes were ranked according to their ability in discriminating AR-specific modulations. Since AR genes were implicated in variety of functions and cellular processes, we applied a functional classification algorithm, which clustered genes in a limited number of functionally related group: We established that AR genes are significantly enriched for specific keywords. Our results show a significant modulation of genes implicated in signal transduction pathways. No AR-specific alteration of DNA repair could be observed. Nevertheless, it is likely that modulation of DNA repair activity results, at least partly, from post-transcriptional regulation. One major hypothesis is that de-regulations of signal transduction pathways and apoptosis may be responsible for AR phenotype. In previous work, we demonstrated that radiation-induced AR in mice during organogenesis is related to Trp53 gene status and to the occurrence of radiation-induced apoptosis. Other work proposed that p53
Ionizing radiation-induced cell death
International Nuclear Information System (INIS)
Szumiel, I.
1994-01-01
Selected aspects of radiation-induced cell death, connected with signal transduction pathways are reviewed. Cell death is defined as insufficiency of the cellular signal transducing system to maintain the cell's physiological functions. The insufficiency may be due to impaired signal reception and/or transduction, lack or erroneous transcription activation, and eventual cellular ''misexpression'' of the signal. The molecular basis of this insufficiency would be damage to genomic (but also other cellular) structures and closing of specific signalling pathways or opening of others (like those leading to apoptosis). I describe experimental data that suggest an important role of RAS/NFI and p53/p105 Rb proteins in cell cycle control-coupled responses to DNA damage. (Author)
Wang, Wei; Liu, Haijun; Dai, Xiaoniu; Fang, Shencun; Wang, Xingang; Zhang, Yingming; Yao, Honghong; Zhang, Xilong; Chao, Jie
2015-11-18
Phagocytosis of SiO2 into the lung causes an inflammatory cascade that results in fibroblast proliferation and migration, followed by fibrosis. Clinical evidence has indicated that the activation of alveolar macrophages by SiO2 produces rapid and sustained inflammation characterized by the generation of monocyte chemotactic protein 1, which, in turn, induces fibrosis. However, the details of events downstream of monocyte chemotactic protein 1 activity in pulmonary fibroblasts remain unclear. Here, to elucidate the role of p53 in fibrosis induced by silica, both the upstream molecular mechanisms and the functional effects on cell proliferation and migration were investigated. Experiments using primary cultured adult human pulmonary fibroblasts led to the following results: 1) SiO2 treatment resulted in a rapid and sustained increase in p53 and PUMA protein levels; 2) the MAPK and PI3K pathways were involved in the SiO2-induced alteration of p53 and PUMA expression; and 3) RNA interference targeting p53 and PUMA prevented the SiO2-induced increases in fibroblast activation and migration. Our study elucidated a link between SiO2-induced p53/PUMA expression in fibroblasts and cell migration, thereby providing novel insight into the potential use of p53/PUMA in the development of novel therapeutic strategies for silicosis treatment.
International Nuclear Information System (INIS)
Moonen, Luc; Ong, Francisca; Gallee, Maarten; Verheij, Marcel; Horenblas, Simon; Hart, Augustinus A.M.; Bartelink, Harry
2001-01-01
Purpose: To determine whether the apoptotic index, the Ki67 index, and the expression of the p53, cyclin D1, and retinoblastoma genes correlate with local control, overall survival, and time to distant metastases in invasive bladder cancer treated with external beam radiation. Methods and Materials: Paraffin-embedded pretreatment biopsies from 83 patients with invasive transitional cell carcinoma of the bladder were scored morphologically for apoptosis and immunohistochemically for Ki67, p53, cyclin D1, and retinoblastoma gene expression. Survival analysis methods were used to assess overall survival, local control, and freedom from distant metastases. A multiple proportional hazard (PH) regression analysis was performed to study the prognostic value of the above mentioned biologic parameters (all divided into two categories, except Ki67) in addition to classical prognostic factors such as T stage, histologic grade, multifocality of the tumor, and completeness of transurethral resection. All patients were treated with external beam radiation as sole treatment. Median follow-up for the 19 patients still living was 7.5 years. Results: Apoptotic index varied from 0% to 3.4% with a mean of 0.8% and a median of 0.6%. Ki67 index varied from 0% to 60% with a mean of 14% and a median of 12%. P53 protein was detectable in 61% of the tumors. Overexpression of cyclin D1 was observed in 39% of the tumors and loss of retinoblastoma protein in 23% of the tumors. High Ki67 index was found to be significantly associated with p53 expression (p=0.04) and cyclin D1 overexpression (p=0.023). Cyclin D1 overexpression was found more often in Rb-positive tumors than in Rb-negative tumors (p=0.006). Other associations between the markers are less clear. Biologic markers were not correlated with T stage or grade. In the PH analysis local control was found to be significantly better for tumors with wild-type p53 (p=0.028). Also, tumors with an apoptotic index above the median value (0
Wang, H; Ma, L; Li, Y; Cho, C H
2000-04-01
Cigarette smoking is a major risk factor for gastric cancer and peptic ulcer. The aim of our study was to investigate the relationship between exposure to cigarette smoke and apoptosis in the rat gastric mucosa and the mechanism involved. Rats were exposed to different concentrations of cigarette smoke (0, 2, and 4%) once daily for a different number of 1 h periods (1, 3, 6, and 9 d). Apoptosis was identified by the terminal deoxy-transferase (TdT)-mediated dUTP-biotin nick end labeling (TUNEL) method and caspase-3 activity. The mucosal xanthine oxidase (XO) activity and p53 level were also measured. The results showed that exposure to cigarette smoke produced a time- and concentration-dependent increase in apoptosis in the rat gastric mucosa that was accompanied by an increase in XO activity. The increased apoptosis and XO activity could be detected after even a single exposure. In contrast, the level of p53 was elevated only in the later stage of cigarette smoke exposure. The apoptotic effect could be blocked by pretreatment with an XO inhibitor (allopurinol, 20 mg/kg intraperitoneally) or a hydroxyl free radical scavenger (DMSO, 0.2%, 1 ml/kg intravenously). However, neither of these treatments had any effect on the p53 level of the mucosa. In summary, we conclude that exposure to cigarette smoke can increase apoptosis in the rat gastric mucosa through a reactive oxygen species- (ROS) mediated and a p53-independent pathway.
HEXIM1, a New Player in the p53 Pathway
Energy Technology Data Exchange (ETDEWEB)
Lew, Qiao Jing; Chu, Kai Ling; Chia, Yi Ling; Cheong, Nge [Expression Engineering Group, Bioprocessing Technology Institute, A*STAR (Agency for Science, Technology and Research), 20 Biopolis Way, #06-01, Singapore 138668 (Singapore); Chao, Sheng-Hao, E-mail: jimmy_chao@bti.a-star.edu.sg [Expression Engineering Group, Bioprocessing Technology Institute, A*STAR (Agency for Science, Technology and Research), 20 Biopolis Way, #06-01, Singapore 138668 (Singapore); Department of Microbiology, National University of Singapore, Singapore 117597 (Singapore)
2013-07-04
Hexamethylene bisacetamide-inducible protein 1 (HEXIM1) is best known as the inhibitor of positive transcription elongation factor b (P-TEFb), which controls transcription elongation of RNA polymerase II and Tat transactivation of human immunodeficiency virus. Besides P-TEFb, several proteins have been identified as HEXIM1 binding proteins. It is noteworthy that more than half of the HEXIM1 binding partners are involved in cancers. P53 and two key regulators of the p53 pathway, nucleophosmin (NPM) and human double minute-2 protein (HDM2), are among the factors identified. This review will focus on the functional importance of the interactions between HEXIM1 and p53/NPM/HDM2. NPM and the cytoplasmic mutant of NPM, NPMc+, were found to regulate P-TEFb activity and RNA polymerase II transcription through the interaction with HEXIM1. Importantly, more than one-third of acute myeloid leukemia (AML) patients carry NPMc+, suggesting the involvement of HEXIM1 in tumorigenesis of AML. HDM2 was found to ubiquitinate HEXIM1. The HDM2-mediated ubiquitination of HEXIM1 did not lead to protein degradation of HEXIM1 but enhanced its inhibitory activity on P-TEFb. Recently, HEXIM1 was identified as a novel positive regulator of p53. HEXIM1 prevented p53 ubiquitination by competing with HDM2 in binding to p53. Taken together, the new evidence suggests a role of HEXIM1 in regulating the p53 pathway and tumorigenesis.
Chung, Ki Wung; Choi, Yeon Ja; Park, Min Hi; Jang, Eun Ji; Kim, Dae Hyun; Park, Byung Hyun; Yu, Byung Pal; Chung, Hae Young
2015-08-01
Stresses, such as exposure to ultraviolet radiation and those associated with aging, are known to cause premature cellular senescence that is characterized by growth arrest and morphological and gene expression changes. This study was designed to investigate the protective effect of Sirtuin1 (SIRT1) on the UVB-induced premature senescence. Under in vitro experimental conditions, exposure to a subcytotoxic dose of UVB enhanced human skin fibroblasts senescence, as characterized by increased β-galactosidase activity and increased levels of senescence-associated proteins. However, adenovirus-mediated SIRT1 overexpression significantly protected fibroblasts from UVB-induced cellular deterioration. Exposure to UVB-induced cell senescence was associated with oxidative stress and p38 mitogen-activated protein kinase activation. Molecular analysis demonstrated that deacetylation of Forkhead box O3α (FOXO3α) by SIRT1 changed the transcriptional activity of FOXO3α and increased resistance to the oxidative stress. In addition, SIRT1 suppressed UVB-induced p53 acetylation and its transcriptional activity, which directly affected the cell cycle arrest induced by UVB. Further study demonstrated that SIRT1 activation inhibited cell senescence in the skin of the HR1 hairless mouse exposed to UVB. The study identifies a new role for SIRT1 in the UVB-induced senescence of skin fibroblats and provides a potential target for skin protection through molecuar insights into the mechanisms responsible for UVB-induced photoaging. © The Author 2014. Published by Oxford University Press on behalf of The Gerontological Society of America. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.
Coxsackievirus B5 induced apoptosis of HeLa cells: Effects on p53 and SUMO
International Nuclear Information System (INIS)
Gomes, Rogerio; Guerra-Sa, Renata; Arruda, Eurico
2010-01-01
Coxsackievirus B5 (CVB5), a human enterovirus of the family Picornaviridae, is a frequent cause of acute and chronic human diseases. The pathogenesis of enteroviral infections is not completely understood, and the fate of the CVB5-infected cell has a pivotal role in this process. We have investigated the CVB5-induced apoptosis of HeLa cells and found that it happens by the intrinsic pathway by a mechanism dependent on the ubiquitin-proteasome system, associated with nuclear aggregation of p53. Striking redistribution of both SUMO and UBC9 was noted at 4 h post-infection, simultaneously with a reduction in the levels of the ubiquitin-ligase HDM2. Taken together, these results suggest that CVB5 infection of HeLa cells elicit the intrinsic pathway of apoptosis by MDM2 degradation and p53 activation, destabilizing protein sumoylation, by a mechanism that is dependent on a functional ubiquitin-proteasome system.
p21 is Responsible for Ionizing Radiation-induced Bypass of Mitosis.
Zhang, Xu Rui; Liu, Yong Ai; Sun, Fang; Li, He; Lei, Su Wen; Wang, Ju Fang
2016-07-01
To explore the role of p21 in ionizing radiation-induced changes in protein levels during the G2/M transition and long-term G2 arrest. Protein expression levels were assessed by western blot in the human uveal melanoma 92-1 cells after treatment with ionizing radiation. Depletion of p21 was carried out by employing the siRNA technique. Cell cycle distribution was determined by flow cytometry combined with histone H3 phosphorylation at Ser28, an M-phase marker. Senescence was assessed by senescence- associated-β-galactosidase (SA-β-gal) staining combined with Ki67 staining, a cell proliferation marker. Accompanying increased p21, the protein levels of G2/M transition genes declined significantly in 92-1 cells irradiated with 5 Gy of X-rays. Furthermore, these irradiated cells were blocked at the G2 phase followed by cellular senescence. Depletion of p21 rescued radiation-induced G2 arrest as demonstrated by the upregulation of G2/M transition kinases, as well as the high expression of histone H3 phosphorylated at Ser28. Knockdown of p21 resulted in entry into mitosis of irradiated 92-1 cells. However, cells with serious DNA damage failed to undergo cytokinesis, leading to the accumulation of multinucleated cells. Our results indicated that p21 was responsible for the downregulation of G2/M transition regulatory proteins and the bypass of mitosis induced by irradiation. Downregulation of p21 by siRNA resulted in G2-arrested cells entering into mitosis with serious DNA damage. This is the first report on elucidating the role of p21 in the bypass of mitosis. Copyright © 2016 The Editorial Board of Biomedical and Environmental Sciences. Published by China CDC. All rights reserved.
FATS is a transcriptional target of p53 and associated with antitumor activity
Directory of Open Access Journals (Sweden)
Zhang Xifeng
2010-09-01
Full Text Available Abstract Frequent mutations of p53 in human cancers exemplify its crucial role as a tumor suppressor transcription factor, and p21, a transcriptional target of p53, plays a central role in surveillance of cell-cycle checkpoints. Our previous study has shown that FATS stabilize p21 to preserve genome integrity. In this study we identified a novel transcript variant of FATS (GenBank: GQ499374 through screening a cDNA library from mouse testis, which uncovered the promoter region of mouse FATS. Mouse FATS was highly expressed in testis. The p53-responsive elements existed in proximal region of both mouse and human FATS promoters. Functional study indicated that the transcription of FATS gene was activated by p53, whereas such effect was abolished by site-directed mutagenesis in the p53-RE of FATS promoter. Furthermore, the expression of FATS increased upon DNA damage in a p53-dependent manner. FATS expression was silent or downregulated in human cancers, and overexpression of FATS suppressed tumorigenicity in vivo independently of p53. Our results reveal FATS as a p53-regulated gene to monitor genomic stability.
Study of p53 protein expression levels from irradiated peripheral blood lymphocytes for biodosimetry
International Nuclear Information System (INIS)
Cavalcanti, M.B.; Fernandes, T.S.; Melo, J.A.; Neves, M.A.B.; Machado, C.G.F
2005-01-01
Biodosimetry can be defined as the investigation of radioinduced biological effects in order to correlate them with the absorbed dose. Scoring of unstable chromosomal aberrations and micronuclei, from in vitro irradiated peripheral blood lymphocytes, is commonly used for biodosimetry based on cytogenetic analysis. However, this method of analysis is time-consuming, which may represent a pitfall when fast investigation of a possible exposure to ionizing radiation (IR) is needed. The interaction of IR with the living cell can cause injuries in the DNA molecules. However, normal cells possess mechanisms of repair that are capable to correct those damages. During the repair process of the DNA various proteins are expressed. Among these proteins, p53 plays an important role. This protein is a transcription factor that helps in the maintenance of the genomic integrity. p53 protein is found into the cytoplasm in reduced concentrations and has a short average life. However, expression of p53 protein can be induced by DNA harmful radioinduced, which increases the concentration and the average life of this protein, making possible its detection. Thus, the correlation between the increasing of p53 expression and the irradiation may constitute a fast and reliable method of individual monitoring in cases of accidental or suspected exposures to IR. In this context, the objective of this research was to evaluate the p53 protein expression levels from lymphocytes of the human peripheral blood after in vitro irradiation. For this, samples of peripheral blood from healthy individuals were irradiated with known doses. Lymphocytes were separated on ficoll gradient by centrifugation and re-suspended at 1x 10 6 /mL in RPMI medium enriched with fetal calf serum. Hence, lymphocytes were incubated in 5% CO 2 at 37 deg C prior to the methodology of flow cytometry, using intranuclear antigens for the quantification of p53. In this report, the methodology performed and the results obtained
Study of p53 protein expression levels from irradiated peripheral blood lymphocytes for biodosimetry
Energy Technology Data Exchange (ETDEWEB)
Cavalcanti, M.B.; Fernandes, T.S. [Universidade Federal de Pernambuco (UFPE), Recife, PE (Brazil). Dept. de Energia Nuclear; Amaral, A. [Universite Paris XII (UPXII) (France); Melo, J.A. [Centro de Radioterapia de Pernambuco (CERAPE), PE (Brazil); Neves, M.A.B.; Machado, C.G.F, E-mail: maribrayner@yahoo.com.br [Fundacao de Hematologia e Hemoterapia de Pernambuco, PE (Brazil)
2005-07-01
Biodosimetry can be defined as the investigation of radioinduced biological effects in order to correlate them with the absorbed dose. Scoring of unstable chromosomal aberrations and micronuclei, from in vitro irradiated peripheral blood lymphocytes, is commonly used for biodosimetry based on cytogenetic analysis. However, this method of analysis is time-consuming, which may represent a pitfall when fast investigation of a possible exposure to ionizing radiation (IR) is needed. The interaction of IR with the living cell can cause injuries in the DNA molecules. However, normal cells possess mechanisms of repair that are capable to correct those damages. During the repair process of the DNA various proteins are expressed. Among these proteins, p53 plays an important role. This protein is a transcription factor that helps in the maintenance of the genomic integrity. p53 protein is found into the cytoplasm in reduced concentrations and has a short average life. However, expression of p53 protein can be induced by DNA harmful radioinduced, which increases the concentration and the average life of this protein, making possible its detection. Thus, the correlation between the increasing of p53 expression and the irradiation may constitute a fast and reliable method of individual monitoring in cases of accidental or suspected exposures to IR. In this context, the objective of this research was to evaluate the p53 protein expression levels from lymphocytes of the human peripheral blood after in vitro irradiation. For this, samples of peripheral blood from healthy individuals were irradiated with known doses. Lymphocytes were separated on ficoll gradient by centrifugation and re-suspended at 1x 10{sub 6}/mL in RPMI medium enriched with fetal calf serum. Hence, lymphocytes were incubated in 5% CO{sub 2} at 37 deg C prior to the methodology of flow cytometry, using intranuclear antigens for the quantification of p53. In this report, the methodology performed and the results
Madan, Esha; Gogna, Rajan; Kuppusamy, Periannan; Bhatt, Madan; Mahdi, Abbas Ali; Pati, Uttam
2013-04-01
p53 prevents cancer via cell cycle arrest, apoptosis, and the maintenance of genome stability. p53 also regulates energy-generating metabolic pathways such as oxidative phosphorylation (OXPHOS) and glycolysis via transcriptional regulation of SCO2 and TIGAR. SCO2, a cytochrome c oxidase assembly factor, is a metallochaperone which is involved in the biogenesis of cytochrome c oxidase subunit II. Here we have shown that SCO2 functions as an apoptotic protein in tumor xenografts, thus providing an alternative pathway for p53-mediated apoptosis. SCO2 increases the generation of reactive oxygen species (ROS) and induces dissociation of the protein complex between apoptosis signal-regulating kinase 1 (ASK-1) (mitogen-activated protein kinase kinase kinase [MAPKKK]) and its cellular inhibitor, the redox-active protein thioredoxin (Trx). Furthermore, SCO2 induces phosphorylation of ASK-1 at the Thr(845) residue, resulting in the activation of the ASK-1 kinase pathway. The phosphorylation of ASK-1 induces the activation of mitogen-activated protein kinase kinases 4 and 7 (MAP2K4/7) and MAP2K3/6, which switches the c-Jun N-terminal protein kinase (JNK)/p38-dependent apoptotic cascades in cancer cells. Exogenous addition of the SCO2 gene to hypoxic cancer cells and hypoxic tumors induces apoptosis and causes significant regression of tumor xenografts. We have thus discovered a novel apoptotic function of SCO2, which activates the ASK-1 kinase pathway in switching "on" an alternate mode of p53-mediated apoptosis. We propose that SCO2 might possess a novel tumor suppressor function via the ROS-ASK-1 kinase pathway and thus could be an important candidate for anticancer gene therapy.
Che-1 gene silencing induces osteosarcoma cell apoptosis by inhibiting mutant p53 expression
Energy Technology Data Exchange (ETDEWEB)
Liu, Ming; Wang, Dan, E-mail: danwangwdd@163.com; Li, Ning
2016-04-22
The transcriptional cofactor Che-1 is an RNA polymerase II (Pol II) which is involved in tumorigenesis, such as breast cancer and multiple myeloma. Che-1 can also regulate mutant p53 expression, which plays roles in many types of cancer. In this study, we aimed to investigate the effects and specific mechanism of Che-1 in the regulation of osteosarcoma (OS) cell growth. We found that Che-1 is highly expressed in several kinds of OS cells compared with osteoblast hFOB1.19 cells. MTT and flow cytometry assays showed that Che-1 depletion by siRNA markedly suppressed MG-63 and U2OS cell proliferation and promoted apoptosis. The chromatin immunoprecipitation (ChIP) assay verified the presence of Che-1 on the p53 promoter in MG-63 and U2OS cells carrying mutant p53. Further studies showed that Che-1 depletion inhibited mutant p53 expression. Notably, our study showed that the loss of Che-1 inhibits proliferation and promotes apoptosis in MG-63 cells by decreasing the level of mutant p53. Therefore, these findings open the possibility that silencing of Che-1 will have therapeutic benefit in OS. - Highlights: • Che-1 is highly expressed in several kinds of OS cells. • Che-1 depletion suppressed MG-63 and U2OS cell growth. • Che-1 is existed in the p53 promoter in MG-63 and U2OS cells. • Che-1 depletion inhibited mutant p53 expression. • Che-1 depletion inhibits cell growth by decreasing the level of mutant p53.
Andrographolide Induces Apoptosis of C6 Glioma Cells via the ERK-p53-Caspase 7-PARP Pathway
Directory of Open Access Journals (Sweden)
Shih-Hung Yang
2014-01-01
Full Text Available Background. Glioma is the most malignant tumor of the central nervous system. Efforts on the development of new chemotherapy are mandatory. Andrographolide (AND, a diterpenoid lactone isolated from the Andrographis paniculata, has been shown to have antitumor activities in several types of cancer cells. Whether AND can exert its antitumor activity in glioblastoma cells remains unknown. This study examined the anticancer effects of AND, both in vitro and in vivo. Methods. Cell apoptosis was assayed by flow cytometry and nuclear staining. The signaling pathway for AND was determined by western blotting. The effects of AND on tumor growth was evaluated in a mouse model. Results and Conclusion. In vitro, with application of specific inhibitors and siRNA, AND-induced apoptosis was proven through ROS-ERK-P53-caspase 7-PARP signaling pathway. In vivo, AND significantly retarded tumor growth and caused regression of well-formed tumors in vivo. Furthermore, AND did not induce apoptosis or activate ERK and p53 in primary cultured astrocyte cells, and it may serve as a potential therapeutic candidate for the treatment of glioma.
Takahashi, A.; Ohnishi, T.
2009-04-01
The aim of this work was to clarify the effect of low dose pre-irradiation on radio- and heat-sensitivity. Wild-type (wt) p53 and mutated (m) p53 cells derived from the human lung cancer H1299 cell line were used. The parental H1299 cell line is p53-null. Cellular sensitivities were determined with a colony-forming assay. When wtp53 cells were exposed to a low dose X-irradiation, induction of radio- and heat-resistance was observed only in the absence of RITA (an inhibitor of p53-HDM2 interactions), aminoguanidine (an iNOS inhibitor) and c-PTIO (an NO radical scavenger). In contrast, the induced radio- and heat-resistance was not observed under similar conditions in mp53 cells. Moreover, heat-resistance as well as radio-resistance developed when wtp53 cells were treated with ISDN (an NO generating agent) alone. These findings suggest that NO radicals are an initiator of radio- and heat-resistance, and function through the activation of HDM2 and the depression of p53 accumulation.
Directory of Open Access Journals (Sweden)
Chinthalapally V. Rao
2013-09-01
Full Text Available Lung cancer is the leading cause of cancer deaths worldwide. Expression of the p53 tumor suppressor protein is frequently altered in tobacco-associated lung cancers. We studied chemopreventive effects of p53-modulating agents, namely, CP-31398 and Prima-1, on 4-(methylnitrosamino-1-(3-pyridyl-1-butanone (NNK-induced lung adenoma and adenocarcinoma formation in female A/J mice. Seven-week-old mice were treated with a single dose of NNK (10 µmol/mouse by intraperitoneal injection and, 3 weeks later, were randomized to mice fed a control diet or experimental diets containing 50 or 100 ppm CP-31398 or 150 or 300 ppm Prima-1 for either 17 weeks (10 mice/group or 34 weeks (15 mice/group to assess the efficacy against lung adenoma and adenocarcinoma. Dietary feeding of 50 or 100 ppm CP-31398 significantly suppressed (P < .0001 lung adenocarcinoma by 64% and 73%, respectively, after 17 weeks and by 47% and 56%, respectively, after 34 weeks. Similarly, 150 or 300 ppm Prima-1 significantly suppressed (P < .0001 lung adenocarcinoma formation by 56% and 62%, respectively, after 17 weeks and 39% and 56%, respectively, after 34 weeks. Importantly, these results suggest that both p53 modulators cause a delay in the progression of adenoma to adenocarcinoma. Immunohistochemical analysis of lung tumors from mice exposed to p53-modulating agents showed a significantly reduced tumor cell proliferation and increased accumulation of wild-type p53 in the nucleus. An increase in p21- and apoptotic-positive cells was also observed in lung tumors of mice exposed to p53-modulating agents. These results support a chemopreventive role of p53-modulating agents in tobacco carcinogen-induced lung adenocarcinoma formation.
Long Non-coding RNA, PANDA, Contributes to the Stabilization of p53 Tumor Suppressor Protein.
Kotake, Yojiro; Kitagawa, Kyoko; Ohhata, Tatsuya; Sakai, Satoshi; Uchida, Chiharu; Niida, Hiroyuki; Naemura, Madoka; Kitagawa, Masatoshi
2016-04-01
P21-associated noncoding RNA DNA damage-activated (PANDA) is induced in response to DNA damage and represses apoptosis by inhibiting the function of nuclear transcription factor Y subunit alpha (NF-YA) transcription factor. Herein, we report that PANDA affects regulation of p53 tumor-suppressor protein. U2OS cells were transfected with PANDA siRNAs. At 72 h post-transfection, cells were subjected to immunoblotting and quantitative reverse transcription-polymerase chain reaction. Depletion of PANDA was associated with decreased levels of p53 protein, but not p53 mRNA. The stability of p53 protein was markedly reduced by PANDA silencing. Degradation of p53 protein by silencing PANDA was prevented by treatment of MG132, a proteasome inhibitor. Moreover, depletion of PANDA prevented accumulation of p53 protein, as a result of DNA damage, induced by the genotoxic agent etoposide. These results suggest that PANDA stabilizes p53 protein in response to DNA damage, and provide new insight into the regulatory mechanisms of p53. Copyright© 2016 International Institute of Anticancer Research (Dr. John G. Delinassios), All rights reserved.
BAX/BAK–Independent Mitoptosis during Cell Death Induced by Proteasome Inhibition?
Lomonosova, Elena; Ryerse, Jan; Chinnadurai, G.
2009-01-01
Proteasome inhibitors induce rapid death of cancer cells. We show that in epithelial cancer cells, such death is associated with dramatic and simultaneous up-regulation of several BH3-only proteins, including BIK, BIM, MCL-1S, NOXA, and PUMA, as well as p53. Elevated levels of these proteins seem to be the result of direct inhibition of their proteasomal degradation, induction of transcription, and active translation. Subsequent cell death is independent of BAX, and probably BAK, and proceeds...
International Nuclear Information System (INIS)
Gao Yong; Hao Enzhu; Ni Yanbo
2006-01-01
Objective: To observe the effects of cigarette smoke and green tea on radiation-induced bone marrow cell mutation, and to provide scientific information for prevention and treatment of radiation damage. Methods: There were 8 groups in the factorial experiment design with 3 factors at 2 levels. Mice were randomly divided into each group. There were 8 mice in each group. Mice in seven experimental groups were exposed to cigarette smoke, green tea, radiation or their mixtures respectively. One group was treated as the blank control group. The frequencies of micrnucleated polychromatic erythrocytes (MPCE) were scored by single blinded method. The data were analyzed with factorial experiments analysis of variance using SAS 8.0. Results: Analysis of variance showed that radiation, cigarette smoke and green tea were independently significant factors (P<0.01). Interactions between cigarette smoke and radiation or between green tea and radiation were statistically significant (P<0.01). Conclusion: Radiation and cigarette smoke can cause bone marrow cell mutations independently. There is synergistic effect between cigarette smoke and radiation. Green tea can inhibit radiation-induced cell mutation. (authors)
Apaf-1 is a transcriptional target for E2F and p53
DEFF Research Database (Denmark)
Moroni, M C; Hickman, E S; Lazzerini Denchi, E
2001-01-01
between the deregulation of the pRB pathway and apoptosis. Furthermore, because the pRB pathway is functionally inactivated in most cancers, the identification of Apaf-1 as a transcriptional target for E2F might explain the increased sensitivity of tumour cells to chemotherapy. We also show that......, independently of the pRB pathway, Apaf-1 is a direct transcriptional target of p53, suggesting that p53 might sensitize cells to apoptosis by increasing Apaf-1 levels....
International Nuclear Information System (INIS)
Feng, Chang Wei; Wang, Li Dong; Jiao, Lian Hua; Liu, Bin; Zheng, Shu; Xie, Xin Ji
2002-01-01
The growth and metastasis of tumors depend on the development of an adequate blood supply via angiogenesis. Recent studies indicate that the inducible nitric oxide synthase (iNOS), vascular endothelial growth factor (VEGF) and the tumor suppressor p53 are fundamental play-markers of the angiogenic process. Overexpression of iNOS and VEGF has been shown to induce angiogenesis in tumors. P53 suppresses angiogenesis by down-regulating VEGF and iNOS. The correlation of expression of p53, VEGF and iNOS and clinical features in gastric carcinogenesis, however, has not been well characterized. The expression of p53, iNOS and VEGF in gastric precancerous and cancerous lesions and its relation with the clinical features was determined with immunohistochemistry (avidin-biotin-peroxidase complex method) on 55 randomly selected GC patients and 60 symptom-free subjects from the mass survey in the high-incidence area for GC in Henan, northern China. The positive immunostainig rates for p53, iNOS and VEGF in gastric carcinomas were 51%, 44% and 51%, respectively, and correlated well with TNM stages, but did not show significant difference among the groups with different degrees of gastric wall invasion depth by GC. A positive immunostaining reaction for the iNOS protein was significantly correlated with lymph node metastasis (p = 0.019; Spearman correlation coefficient). P53 protein accumulation was higher in the poorly-differentiated gastric carcinoma than in well-differentiated one. In gastric biopsies, no positive immunosatining was observed for p53, iNOS and VEGF in the histologically normal tissue and chronic superficial gastritis (CSG). However, p53, iNOS and VEGF positive immunostaining was observed in the tissues with different severities of lesions of chronic atrophic gastritis (CAG), intestinal metaplasia (IM) and dysplasia (DYS), and the positive rates increased with the lesion progression from CAG to IM to DYS. A high coincidental positive and negative immunostaining
Energy Technology Data Exchange (ETDEWEB)
Chang, Chun-Yu [Graduate Institute of Biomedical Sciences, National Chung Hsing University, Taichung, Taiwan (China); Shen, Chao-Yu [School of Medical Imaging and Radiological Sciences, Chung Shan Medical University, Taichung, Taiwan (China); Department of Medical Imaging, Chung Shan Medical University Hospital, Taichung, Taiwan (China); School of Medicine, Chung Shan Medical University, Taichung, Taiwan (China); Kang, Chao-Kai [Department of Life Sciences, National Chung Hsing University, Taichung, Taiwan, (China); Sher, Yuh-Pyng [Graduate Institute of Clinical Medical Science, China Medical University, Taichung, Taiwan (China); Center for Molecular Medicine, China Medical University Hospital, Taichung 404, Taiwan (China); Sheu, Wayne H.-H. [Graduate Institute of Biomedical Sciences, National Chung Hsing University, Taichung, Taiwan (China); Division of Endocrinology and Metabolism, Department of Internal Medicine, Taichung Veterans General Hospital, Taichung, Taiwan (China); School of Medicine, National Yang Ming University, Taipei, Taiwan (China); School of Medicine, National Defense Medical Center, Taipei, Taiwan (China); Chang, Chia-Che, E-mail: chia_che@dragon.nchu.edu.tw [Graduate Institute of Biomedical Sciences, National Chung Hsing University, Taichung, Taiwan (China); Agricultural Biotechnology Center, National Chung Hsing University, Taichung, Taiwan (China); Lee, Tsung-Han, E-mail: thlee@email.nchu.edu.tw [Department of Life Sciences, National Chung Hsing University, Taichung, Taiwan, (China); Graduate Institute of Clinical Medical Science, China Medical University, Taichung, Taiwan (China); Agricultural Biotechnology Center, National Chung Hsing University, Taichung, Taiwan (China); Department of Biological Science and Technology, China Medical University, Taichung, Taiwan (China)
2014-09-15
Oxidized LDL (oxLDL) induces a pro-oxidative environment and promotes apoptosis, causing the progression of renal diseases in humans. Taurine is a semi-essential amino acid in mammals and has been shown to be a potent endogenous antioxidant. The kidney plays a pivotal role in maintaining the balance of taurine. However, the mechanisms underlying the protective effects of taurine against oxLDL-induced injury in renal epithelial cells have not been clarified. In the present study, we investigated the anti-apoptotic effects of taurine on human proximal tubular epithelial (HK-2) cells exposed to oxLDL and explored the related mechanisms. We observed that oxLDL increased the contents of ROS and of malondialdehyde (MDA), which is a lipid peroxidation by-product that acts as an indicator of the cellular oxidation status. In addition, oxLDL induced cell death and apoptosis in HK-2 cells. Pretreatment with taurine at 100 μM significantly attenuated the oxLDL-induced cytotoxicity. We determined that oxLDL triggered the phosphorylation of ERK and, in turn, the activation of p53 and other apoptosis-related events, including calcium accumulation, destabilization of the mitochondrial permeability and disruption of the balance between pro-apoptotic Bax and anti-apoptotic Bcl-2 proteins. The malfunctions induced by oxLDL were effectively blocked by taurine. Thus, our results suggested that taurine exhibits potential therapeutic activity by preventing oxLDL-induced nephrotoxicity. The inhibition of oxLDL-induced epithelial apoptosis by taurine was at least partially due to its anti-oxidant activity and its ability to modulate the ERK and p53 apoptotic pathways. - Highlights: • Oxidized LDL induced cytotoxicity and apoptosis in HK-2 cells. • Pretreatment with taurine attenuated oxLDL-induced nephrotoxicity. • Taurine protected against renal damages through inhibition of ROS generation. • Taurine prevented apoptosis through modulation of the p53 phosphorylation.
International Nuclear Information System (INIS)
Chang, Chun-Yu; Shen, Chao-Yu; Kang, Chao-Kai; Sher, Yuh-Pyng; Sheu, Wayne H.-H.; Chang, Chia-Che; Lee, Tsung-Han
2014-01-01
Oxidized LDL (oxLDL) induces a pro-oxidative environment and promotes apoptosis, causing the progression of renal diseases in humans. Taurine is a semi-essential amino acid in mammals and has been shown to be a potent endogenous antioxidant. The kidney plays a pivotal role in maintaining the balance of taurine. However, the mechanisms underlying the protective effects of taurine against oxLDL-induced injury in renal epithelial cells have not been clarified. In the present study, we investigated the anti-apoptotic effects of taurine on human proximal tubular epithelial (HK-2) cells exposed to oxLDL and explored the related mechanisms. We observed that oxLDL increased the contents of ROS and of malondialdehyde (MDA), which is a lipid peroxidation by-product that acts as an indicator of the cellular oxidation status. In addition, oxLDL induced cell death and apoptosis in HK-2 cells. Pretreatment with taurine at 100 μM significantly attenuated the oxLDL-induced cytotoxicity. We determined that oxLDL triggered the phosphorylation of ERK and, in turn, the activation of p53 and other apoptosis-related events, including calcium accumulation, destabilization of the mitochondrial permeability and disruption of the balance between pro-apoptotic Bax and anti-apoptotic Bcl-2 proteins. The malfunctions induced by oxLDL were effectively blocked by taurine. Thus, our results suggested that taurine exhibits potential therapeutic activity by preventing oxLDL-induced nephrotoxicity. The inhibition of oxLDL-induced epithelial apoptosis by taurine was at least partially due to its anti-oxidant activity and its ability to modulate the ERK and p53 apoptotic pathways. - Highlights: • Oxidized LDL induced cytotoxicity and apoptosis in HK-2 cells. • Pretreatment with taurine attenuated oxLDL-induced nephrotoxicity. • Taurine protected against renal damages through inhibition of ROS generation. • Taurine prevented apoptosis through modulation of the p53 phosphorylation
International Nuclear Information System (INIS)
Bandopadhayay, Pratiti; Thomas, David M; Algar, Elizabeth; Ekert, Paul G; Jabbour, Anissa M; Riffkin, Christopher; Salmanidis, Marika; Gordon, Lavinia; Popovski, Dean; Rigby, Lin; Ashley, David M; Watkins, David N
2013-01-01
Desmoplastic small round cell tumor (DSRCT) is characterized by the presence of a fusion protein EWS/WT1, arising from the t (11;22) (p13;q12) translocation. Here we examine the oncogenic properties of two splice variants of EWS/WT1, EWS/WT1-KTS and EWS/WT1 + KTS. We over-expressed both EWS/WT1 variants in murine embryonic fibroblasts (MEFs) of wild-type, p53 +/- and p53 -/- backgrounds and measured effects on cell-proliferation, anchorage-independent growth, clonogenicity after serum withdrawal, and sensitivity to cytotoxic drugs and gamma irradiation in comparison to control cells. We examined gene expression profiles in cells expressing EWS/WT1. Finally we validated our key findings in a small series of DSRCT. Neither isoform of EWS/WT1 was sufficient to transform wild-type MEFs however the oncogenic potential of both was unmasked by p53 loss. Expression of EWS/WT1 in MEFs lacking at least one allele of p53 enhanced cell-proliferation, clonogenic survival and anchorage-independent growth. EWS/WT1 expression in wild-type MEFs conferred resistance to cell-cycle arrest after irradiation and daunorubicin induced apoptosis. We show DSRCT commonly have nuclear localization of p53, and copy-number amplification of MDM2/MDMX. Expression of either isoform of EWS/WT1 induced characteristic mRNA expression profiles. Gene-set enrichment analysis demonstrated enrichment of WNT pathway signatures in MEFs expressing EWS/WT1 + KTS. Wnt-activation was validated in cell lines with over-expression of EWS/WT1 and in DSRCT. In conclusion, we show both isoforms of EWS/WT1 have oncogenic potential in MEFs with loss of p53. In addition we provide the first link between EWS/WT1 and Wnt-pathway signaling. These data provide novel insights into the function of the EWS/WT1 fusion protein which characterize DSRCT
Mathematical Modeling of E6-p53 interactions in Cervical Cancer
Khattak, Faryal; Haseeb, Muhammad; Fazal, Sahar; Bhatti, A I; Ullah, Mukhtar
2017-04-01
Background: Cervical cancer is the third most common cancer in women throughout the world. The human papillomavirus (HPV) E6 viral protein plays an essential role in proteasomal degradation of the cancer suppressant protein p53. As a result, p53 negative regulation and apoptosis relevant activities are abrogated, facilitating development of cervical cancer. Methods: A mathematical model of E6-p53 interactions was developed using mathematical laws. In-silico simulations were carried out on CellDesigner and as a test case the small molecule drug RITA was considered for its ability to rescue the functions of tumor suppressor p53 by inhibiting E6 mediated proteasomal degradation. Results: Using a computational model we scrutinized how p53 responds to RITA, and chemical reactions of this small molecule drug were incorporated to perceive the full effects. The evolved strategy allowed the p53 response and rescue of its tumor suppressor function to be delineated, RITA being found to block p53 interactions with E6 associated proteins. Conclusion: We could develop a model of E6-p53 interactions with incorporation of actions of the small molecule drug RITA. Suppression of E6 associated proteins by RITA induces accumulation of tumor suppressant p53. Using CellDesigner to encode the model ensured that it can be easily modified and extended as more data become available. This strategy should play an effective role in the development of therapies against cancer. Creative Commons Attribution License
p53 Dependent Centrosome Clustering Prevents Multipolar Mitosis in Tetraploid Cells
Yi, Qiyi; Zhao, Xiaoyu; Huang, Yun; Ma, Tieliang; Zhang, Yingyin; Hou, Heli; Cooke, Howard J.; Yang, Da-Qing; Wu, Mian; Shi, Qinghua
2011-01-01
Background p53 abnormality and aneuploidy often coexist in human tumors, and tetraploidy is considered as an intermediate between normal diploidy and aneuploidy. The purpose of this study was to investigate whether and how p53 influences the transformation from tetraploidy to aneuploidy. Principal Findings Live cell imaging was performed to determine the fates and mitotic behaviors of several human and mouse tetraploid cells with different p53 status, and centrosome and spindle immunostaining was used to investigate centrosome behaviors. We found that p53 dominant-negative mutation, point mutation, or knockout led to a 2∼ 33-fold increase of multipolar mitosis in N/TERT1, 3T3 and mouse embryonic fibroblasts (MEFs), while mitotic entry and cell death were not significantly affected. In p53-/- tetraploid MEFs, the ability of centrosome clustering was compromised, while centrosome inactivation was not affected. Suppression of RhoA/ROCK activity by specific inhibitors in p53-/- tetraploid MEFs enhanced centrosome clustering, decreased multipolar mitosis from 38% to 20% and 16% for RhoA and ROCK, respectively, while expression of constitutively active RhoA in p53+/+ tetraploid 3T3 cells increased the frequency of multipolar mitosis from 15% to 35%. Conclusions p53 could not prevent tetraploid cells entering mitosis or induce tetraploid cell death. However, p53 abnormality impaired centrosome clustering and lead to multipolar mitosis in tetraploid cells by modulating the RhoA/ROCK signaling pathway. PMID:22076149
Directory of Open Access Journals (Sweden)
Liang Y
2018-03-01
Full Text Available Yayun Liang,1 Benford Mafuvadze,1 Cynthia Besch-Williford,2 Salman M Hyder1 1Deparment of Biomedical Sciences and Dalton Cardiovascular Research Center, Columbia, MO, USA; 2IDEXX BioResearch, Columbia, MO, USA Background: Between 30 and 40% of human breast cancers express a defective tumor suppressor p53 gene. Wild-type p53 tumor suppressor protein promotes cell-cycle arrest and apoptosis and inhibits vascular endothelial growth factor–dependent angiogenesis, whereas mutant p53 protein (mtp53 lacks these functions, resulting in tumor cell survival and metastasis. Restoration of p53 function is therefore a promising drug-targeted strategy for combating mtp53-expressing breast cancer. Methods: In this study, we sought to determine whether administration of APR-246, a small-molecule drug that restores p53 function, in combination with 2aG4, an antibody that targets phosphatidylserine residues on tumor blood vessels and disrupts tumor vasculature, effectively inhibits advanced hormone-dependent breast cancer tumor growth. Results: APR-246 reduced cell viability in mtp53-expressing BT-474 and T47-D human breast cancer cells in vitro, and significantly induced apoptosis in a dose-dependent manner. However, APR-246 did not reduce cell viability in MCF-7 breast cancer cells, which express wild-type p53. We next examined APR-246’s anti-tumor effects in vivo using BT-474 and T47-D tumor xenografts established in female nude mice. Tumor-bearing mice were treated with APR-246 and/or 2aG4 and tumor volume followed over time. Tumor growth was more effectively suppressed by combination treatment than by either agent alone, and combination therapy completely eradicated some tumors. Immunohistochemistry analysis of tumor tissue sections demonstrated that combination therapy more effectively induced apoptosis and reduced cell proliferation in tumor xenografts than either agent alone. Importantly, combination therapy dramatically reduced the density of blood
Nuclear localization signal of ING4 plays a key role in its binding to p53
International Nuclear Information System (INIS)
Zhang Xin; Wang Kesheng; Wang Zhiqin; Xu Lusheng; Wang Qingwan; Chen Fei; Wei Dongzhi; Han Zeguang
2005-01-01
ING4, a novel member of ING family, is recently reported to interact with tumor suppressor p53 and negatively regulate the cell growth with significant G2/M arrest of cell cycle in HepG2 cells through upregulation of p53-inducible gene p21. However, which region of ING4 could have contributed to the binding to p53 remains largely unclear. Herein, the GST-pulldown experiments revealed that the middle region of ING4, a potential bipartite nuclear localization signal (NLS), could be involved in the binding to p53. Furthermore, the interaction of ING4 to p53 was abrogated in vitro and in vivo when certain mutations or the entire deletion of the NLS domain occurred. More interestingly, the mutations of the NLS domain could alter the ING4 nuclear localization, disrupt the interaction of ING4 with p53, and even, deregulate the p53-inducible gene p21 in MCF-7 cells. All data indicated that the NLS domain of ING4 is essential for the binding of ING4 to p53 and the function of ING4 associated with p53
Directory of Open Access Journals (Sweden)
Ge Q
2016-01-01
Full Text Available Qiangqiang Ge,1,* Chenghe Wang,2,* Yajun Ruan,1,* Zhong Chen,1 Jihong Liu,1 Zhangqun Ye1 1Department of Urology, Tongji Hospital, Tongji Medical College, Huazhong University of Science and Technology, Wuhan, Hubei, 2Department of Urology, Shanghai Jiao Tong University Affiliated Sixth People’s Hospital, Shanghai, People’s Republic of China *These authors contributed equally to this work Abstract: Previous research has reported that a particular double-stranded RNA, named dsP53-285, has the capacity to induce expression of the tumor suppressor gene TP53 in chimpanzee cells by targeting its promoter. Usually, it is the wild-type p53 protein, rather than mutants, which exhibits potent cancer-inhibiting effects. In addition, nonhuman primates, such as chimpanzees, share almost identical genome sequences with humans. This prompted us to speculate whether dsP53-285 can trigger wild-type p53 protein expression in human prostate cancer (PCa cells and consequently suppress cell growth. The human PCa cell lines LNCaP and DU145 were transfected with dsP53-285 for 72 hours. Compared with the dsControl and mock transfection groups, expression of both p53 messenger RNA and p53 protein was significantly enhanced after dsP53-285 transfection, and this enhancement was followed by upregulation of p21, which indirectly indicated that dsP53-285 induced wild-type p53 expression. Moreover, overexpression of wild-type p53 mediated by dsP53-285 downregulated the expression of Cyclin D1 and cyclin-dependent kinase 4/6, thereby inducing PCa cell cycle arrest in G0/G1 phase and then inhibiting cell proliferation and clonogenicity. More importantly, dsP53-285 suppressed PCa cells mainly by modulating wild-type p53 expression. In conclusion, our study provides evidence that dsP53-285 can significantly stimulate wild-type p53 expression in the human PCa cell lines LNCaP and DU145 and can exert potent antitumor effects. Keywords: p53, small activating RNA, prostate
International Nuclear Information System (INIS)
Lu Xiongbin; Lozano, Guillermina; Donehower, Lawrence A.
2003-01-01
DNA repair of double strand breaks, interstrand DNA cross-links, and other types of DNA damage utilizes the processes of homologous recombination and non-homologous end joining to repair the damage. Aberrant homologous recombination is likely to be responsible for a significant fraction of chromosomal deletions, duplications, and translocations that are observed in cancer cells. To facilitate measurement of homologous recombination frequencies in normal cells, mutant cells, and cancer cells, we have developed a high titer retroviral vector containing tandem repeats of mutant versions of a GFP-Zeocin resistance fusion gene and an intact neomycin resistance marker. Recombination between the tandem repeats regenerates a functional GFP-Zeo R marker that can be easily scored. This retroviral vector was used to assess homologous recombination frequencies in human cancer cells and rodent fibroblasts with differing dosages of wild type or mutant p53. Absence of wild type p53 stimulated spontaneous and ionizing radiation-induced homologous recombination, confirming previous studies. Moreover, p53 +/- mouse fibroblasts show elevated levels of homologous recombination compared to their p53 +/+ counterparts following retroviral vector infection, indicating that p53 is haploinsufficient for suppression of homologous recombination. Transfection of vector-containing p53 null Saos-2 cells with various human cancer-associated p53 mutants revealed that these altered p53 proteins retain some recombination suppression function despite being totally inactive for transcriptional transactivation. The retroviral vector utilized in these studies may be useful in performing recombination assays on a wide array of cell types, including those not readily transfected by normal vectors
Role of P53 in Mammary Epithelial Cell Senescence
National Research Council Canada - National Science Library
Dimri, Goberdhan P
2006-01-01
.... We also chose several other targets of p53 that are induced by DNA damage. The RT PCR analysis aws carried out using mRNA prepared from young growing early passage and senescent late passage HMECs...
Phosphorylation of Tip60 by GSK-3 determines the induction of PUMA and apoptosis by p53
Charvet, Céline; Wissler, Manuela; Brauns-Schubert, Prisca; Wang, Shang-Jui; Tang, Yi; Sigloch, Florian C.; Mellert, Hestia; Brandenburg, Martin; Lindner, Silke E.; Breit, Bernhard; Green, Douglas R.; McMahon, Steven B.; Borner, Christoph; Gu, Wei; Maurer, Ulrich
2011-01-01
Summary Activation of p53 by DNA damage results in either cell cycle arrest, allowing DNA repair and cell survival, or induction of apoptosis. As these opposite outcomes are both mediated by p53 stabilization, additional mechanisms to determine this decision must exist. Here we show that glycogen synthase kinase-3 (GSK-3) is required for the p53-mediated induction of the pro-apoptotic BH3 only-protein PUMA, an essential mediator of p53-induced apoptosis. Inhibition of GSK-3 protected from cell death induced by DNA damage and promoted increased long-term cell survival. We demonstrate that GSK-3 phosphorylates serine 86 of the p53-acetyltransferase Tip60. A Tip60S86A mutant was less active to induce p53 K120 acetylation, Histone 4 acetylation and expression of PUMA. Our data suggest that GSK-3 mediated Tip60S86-phosphorylation provides a link between PI3K signaling and the choice for or against apoptosis induction by p53. PMID:21658600
International Nuclear Information System (INIS)
Tierney, L.A.; Johnson, N.F.; Lechner, J.F.
1994-01-01
Mutations in the p53 tumor suppressor gene are the most frequently occurring gene alterations in malignant human cancers, including lung cancer. In lung cancer, common point mutations within conserved exons of the p53 gene result in a stabilized form of mutant protein which is detectable in most cases by immunohistochemistry. In addition to point mutations, allelic loss, rearrangements, and deletions of the p53 gene have also been detected in both human and rodent tumors. It has been suggested that for at least some epithelial neoplasms, the loss of expression of wild-type p53 protein may be more important for malignant transformation than the acquisition of activating mutations. Mechanisms responsible for the loss of expression of wild-type protein include gene deletion or rearrangement, nonsense or stop mutations, mutations within introns or upstream regulatory regions of the gene, and accelerated rates of degradation of the protein by DNA viral oncoproteins
Immunohistochemical study of p53, pRb, p16 in esophageal cancer
International Nuclear Information System (INIS)
Zo, Jae Ill; Zo, Kyung Ja; Park, Jong Ho; Kim, Mi Hee
1998-01-01
To confirm the expression of molecular genetic alterations of p53, pRb, p16 in esophageal cancer and to investigate the expression of p53, pRb, p16 in esophageal cancer according to the pathologic steps of carcinogenesis, immuno-histochemistry was performed in 15 resected esophageal cancer specimens with multiple separated lesions after pathologic mapping. The accumulation of mutant p53 was observed in 60 % of dysplasia and 47 % of invasive cancer, while pRb was not detected in 91 % of dysplasia and 72.7 % of invasive cancer. But p16 was not observed in 0 % in dysplasia and 7 % of invasive cancer. But p16 was not observed in 0 % in dysplasia and 28.6 % in invasive cancer. There was no simultaneous negative pRb and p16 expression. There was no relations between p53 and p16, pRb. As a results, the expression of p53, pRb, p16 was co-related well with molecular genetic changes and inactivation of p53, pRb, p16 was co-related well with molecular genetic changes and inactivation of p53 and pRb was common and early event in esophageal carcinogenesis in Korea, but inactivation of p16 was a infrequent change. (author). 17 refs., 2 tabs., 7 figs
International Nuclear Information System (INIS)
Han, Peng; Kang, Jin-He; Li, Hua-Liang; Hu, Su-Xian; Lian, Hui-Hui; Qiu, Ping-Ping; Zhang, Jian; Li, Wen-Gang; Chen, Qing-Xi
2009-01-01
Tamoxifen (TAM) is a nonsteroidal antiestrogen that has been used in the treatment of breast cancer for over 30 years. Recently, it was shown that TAM also has efficacy on gastrointestinal neoplasms such as hepatocarcinoma and pancreatic carcinoma, and that the chemopreventive activities of TAM might be due to its abilities to inhibit cell growth and induce apoptosis. In the present study, we investigated the effects of tamoxifen on growth and apoptosis in the human bile duct carcinoma (BDC) cell line QBC939 using MTT assay, inverted microscopy, fluorescence microscopy, transmission electron microscopy, classic DNA fragmentation agarose gel electrophoresis assay, PI single- and FITC/PI double-staining flow cytometry, and Western blotting. Our data revealed that TAM could significantly inhibit growth and induce apoptosis in QBC939 cells. Increased expression of p53 was observed in TAM-treated cells, indicating that p53 might play an important role in TAM-induced apoptosis in QBC939 cells. These results provide significant insight into the anticarcinogenic action of TAM on BDC.
Energy Technology Data Exchange (ETDEWEB)
Han, Peng; Kang, Jin-He; Li, Hua-Liang [Key Laboratory of Ministry of Education for Cell Biology and Tumor Cell Engineering, School of Life Sciences, Xiamen University, Xiamen 361005 (China); Hu, Su-Xian [First Hospital Attached to Fujian Medical University, Xiamen 361004 (China); Lian, Hui-Hui; Qiu, Ping-Ping; Zhang, Jian [Key Laboratory of Ministry of Education for Cell Biology and Tumor Cell Engineering, School of Life Sciences, Xiamen University, Xiamen 361005 (China); Li, Wen-Gang [First Hospital Attached to Fujian Medical University, Xiamen 361004 (China); Chen, Qing-Xi [Key Laboratory of Ministry of Education for Cell Biology and Tumor Cell Engineering, School of Life Sciences, Xiamen University, Xiamen 361005 (China); Key Laboratory for Chemical Biology of Fujian Province, Xiamen University, Xiamen 361005 (China)
2009-07-24
Tamoxifen (TAM) is a nonsteroidal antiestrogen that has been used in the treatment of breast cancer for over 30 years. Recently, it was shown that TAM also has efficacy on gastrointestinal neoplasms such as hepatocarcinoma and pancreatic carcinoma, and that the chemopreventive activities of TAM might be due to its abilities to inhibit cell growth and induce apoptosis. In the present study, we investigated the effects of tamoxifen on growth and apoptosis in the human bile duct carcinoma (BDC) cell line QBC939 using MTT assay, inverted microscopy, fluorescence microscopy, transmission electron microscopy, classic DNA fragmentation agarose gel electrophoresis assay, PI single- and FITC/PI double-staining flow cytometry, and Western blotting. Our data revealed that TAM could significantly inhibit growth and induce apoptosis in QBC939 cells. Increased expression of p53 was observed in TAM-treated cells, indicating that p53 might play an important role in TAM-induced apoptosis in QBC939 cells. These results provide significant insight into the anticarcinogenic action of TAM on BDC.
Energy Technology Data Exchange (ETDEWEB)
Kuan, Man I; O’Dowd, John M.; Chughtai, Kamila; Hayman, Ian; Brown, Celeste J.; Fortunato, Elizabeth A., E-mail: lfort@uidaho.edu
2016-10-15
Human Cytomegalovirus (HCMV) infection is compromised in cells lacking p53, a transcription factor that mediates cellular stress responses. In this study we have investigated compromised functional virion production in cells with p53 knocked out (p53KOs). Infectious center assays found most p53KOs released functional virions. Analysis of electron micrographs revealed modestly decreased capsid production in infected p53KOs compared to wt. Substantially fewer p53KOs displayed HCMV-induced infoldings of the inner nuclear membrane (IINMs). In p53KOs, fewer capsids were found in IINMs and in the cytoplasm. The deficit in virus-induced membrane remodeling within the nucleus of p53KOs was mirrored in the cytoplasm, with a disproportionately smaller number of capsids re-enveloped. Reintroduction of p53 substantially recovered these deficits. Overall, the absence of p53 contributed to inhibition of the formation and function of IINMs and re-envelopment of the reduced number of capsids able to reach the cytoplasm. -- Highlights: •The majority of p53KO cells release fewer functional virions than wt cells. •Nucleocapsids do not efficiently exit the nucleus in p53KO cells. •Infoldings of the inner nuclear membrane are not efficiently formed in p53KO cells. •Cytoplasmic capsids are not efficiently re-enveloped in p53KO cells. •Reintroduction of p53 largely ameliorates these phenotypes.
Rajavel, Tamilselvam; Packiyaraj, Pandian; Suryanarayanan, Venkatesan; Singh, Sanjeev Kumar; Ruckmani, Kandasamy; Pandima Devi, Kasi
2018-02-01
β-Sitosterol (BS), a major bioactive constituent present in plants and vegetables has shown potent anticancer effect against many human cancer cells, but the underlying mechanism remain elusive on NSCLC cancers. We found that BS significantly inhibited the growth of A549 cells without harming normal human lung and PBMC cells. Further, BS treatment triggered apoptosis via ROS mediated mitochondrial dysregulation as evidenced by caspase-3 & 9 activation, Annexin-V/PI positive cells, PARP inactivation, loss of MMP, Bcl-2-Bax ratio alteration and cytochrome c release. Moreover, generation of ROS species and subsequent DNA stand break were found upon BS treatment which was reversed by addition of ROS scavenger (NAC). Indeed BS treatment increased p53 expression and its phosphorylation at Ser15, while silencing the p53 expression by pifithrin-α, BS induced apoptosis was reduced in A549 cells. Furthermore, BS induced apoptosis was also observed in NCI-H460 cells (p53 wild) but not in the NCI-H23 cells (p53 mutant). Down-regulation of Trx/Trx1 reductase contributed to the BS induced ROS accumulation and mitochondrial mediated apoptotic cell death in A549 and NCI-H460 cells. Taken together, our findings provide evidence for the novel anti-cancer mechanism of BS which could be developed as a promising chemotherapeutic drug against NSCLC cancers.
Ottolini, Denis; Calì, Tito; Negro, Alessandro; Brini, Marisa
2013-06-01
DJ-1 was first identified as an oncogene. More recently, mutations in its gene have been found causative for autosomal recessive familial Parkinson disease. Numerous studies support the DJ-1 role in the protection against oxidative stress and maintenance of mitochondria structure; however, the mechanism of its protective function remains largely unknown. We investigated whether mitochondrial Ca(2+) homeostasis, a key parameter in cell physiology, could be a target for DJ-1 action. Here, we show that DJ-1 modulates mitochondrial Ca(2+) transients induced upon cell stimulation with an 1,4,5-inositol-tris-phosphate agonist by favouring the endoplasmic reticulum (ER)-mitochondria tethering. A reduction of DJ-1 levels results in mitochondria fragmentation and decreased mitochondrial Ca(2+) uptake in stimulated cells. To functionally couple these effects with the well-recognized cytoprotective role of DJ-1, we investigated its action in respect to the tumour suppressor p53. p53 overexpression in HeLa cells impairs their ability to accumulate Ca(2+) in the mitochondrial matrix, causes alteration of the mitochondrial morphology and reduces ER-mitochondria contact sites. Mitochondrial impairments are independent from Drp1 activation, since the co-expression of the dominant negative mutant of Drp1 failed to abolish them. DJ-1 overexpression prevents these alterations by re-establishing the ER-mitochondria tethering. Similarly, the co-expression of the pro-fusion protein Mitofusin 2 blocks the effects induced by p53 on mitochondria, confirming that the modulation of the ER-mitochondria contact sites is critical to mitochondria integrity. Thus, the impairment of ER-mitochondria communication, as a consequence of DJ-1 loss-of-function, may be detrimental for mitochondria-related processes and be at the basis of mitochondrial dysfunction observed in Parkinson disease.
The Adaptive Response in p53 Cancer Prone Mice: Loss of heterozygosity and Genomic Instability
International Nuclear Information System (INIS)
Lavoie Jose; Dolling Jo-Anna; Mitchel Ron E J; Boreham Douglas R
2004-01-01
mice, only numerical aberrations were observed in 5 to 20% of the cells. There seem to be an age related increase in numerical aberrations as mice grow old. The results indicate that the presence of a defective copy of the Trp53 gene does not seem to affect spontaneous chromosomal instability or in response to chronic low dose exposure to g-radiation. In previous studies it was speculated that low dose and low dose rate in vivo exposure to g-radiation induces an adaptive response, which reduces the risk of cancer death generated by subsequent DNA damage from either spontaneous or radiation induced events due to enhanced recombinational repair. Induced recombination could result from reversion to homozygosity at Trp53 gene locus (Trp53 +/- to +/+) or loss of heterozygosity in unexposed mice (Trp53 +/- to -/-). This hypothesis was investigated using the quantitative real-time Polymerase Chain Reaction (QRT-PCR) quantification method and the novel Rolling Circle Amplification technique (RCA). For these purposes, spleenocytes and bone marrow cells from all the mice were isolated for cell fixation and DNA extraction. The defective Trp53 allele is generated by integration of a portion of the cloning vector pKONEO DNA into the coding sequence. Therefore, the genotypic changes are monitored based on the detection of the NEO allele and the normal Trp53 allele in the cells. To evaluate loss of heterozygosity at the Trp53 gene locus in a cell, detection of the NEO allele and the normal Trp53 allele using the dual color RCA was utilized. In our hands, this protocol did not give the required sensitivity. The gene signal enumeration was inconsistent and not reproducible. The protocol was modified and could not be optimized. Therefore, the QRT-PCR method was selected to evaluate the loss of heterozygosity with greater sensitivity and efficiency. A set of 4 primers was designed to target the NEO allele and the normal Trp53 allele in a PCR experiment using the LightCycler instrument