WorldWideScience

Sample records for quadruplex dna perturbs

  1. DNA and RNA Quadruplex-Binding Proteins

    Czech Academy of Sciences Publication Activity Database

    Brázda, Václav; Haroniková, Lucia; Liao, J.C.C.; Fojta, Miroslav

    2014-01-01

    Roč. 15, č. 10 (2014), s. 17493-17517 E-ISSN 1422-0067 R&D Projects: GA ČR(CZ) GBP206/12/G151 Institutional support: RVO:68081707 Keywords : DNA quadruplex * RNA quadruplex * telomere Subject RIV: BO - Biophysics Impact factor: 2.862, year: 2014

  2. Simultaneous G-Quadruplex DNA Logic.

    Science.gov (United States)

    Bader, Antoine; Cockroft, Scott L

    2018-04-03

    A fundamental principle of digital computer operation is Boolean logic, where inputs and outputs are described by binary integer voltages. Similarly, inputs and outputs may be processed on the molecular level as exemplified by synthetic circuits that exploit the programmability of DNA base-pairing. Unlike modern computers, which execute large numbers of logic gates in parallel, most implementations of molecular logic have been limited to single computing tasks, or sensing applications. This work reports three G-quadruplex-based logic gates that operate simultaneously in a single reaction vessel. The gates respond to unique Boolean DNA inputs by undergoing topological conversion from duplex to G-quadruplex states that were resolved using a thioflavin T dye and gel electrophoresis. The modular, addressable, and label-free approach could be incorporated into DNA-based sensors, or used for resolving and debugging parallel processes in DNA computing applications. © 2018 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

  3. Thermal stability of DNA quadruplex-duplex hybrids.

    Science.gov (United States)

    Lim, Kah Wai; Khong, Zi Jian; Phan, Anh Tuân

    2014-01-14

    DNA has the capacity to adopt several distinct structural forms, such as duplex and quadruplex helices, which have been implicated in cellular processes and shown to exhibit important functional properties. Quadruplex-duplex hybrids, generated from the juxtaposition of these two structural elements, could find applications in therapeutics and nanotechnology. Here we used NMR and CD spectroscopy to investigate the thermal stability of two classes of quadruplex-duplex hybrids comprising fundamentally distinct modes of duplex and quadruplex connectivity: Construct I involves the coaxial orientation of the duplex and quadruplex helices with continual base stacking across the two components; Construct II involves the orthogonal orientation of the duplex and quadruplex helices with no base stacking between the two components. We have found that for both constructs, the stability of the quadruplex generally increases with the length of the stem-loop incorporated, with respect to quadruplexes comprising nonstructured loops of the same length, which showed a continuous drop in stability with increasing loop length. The stability of these complexes, particularly Construct I, can be substantially influenced by the base-pair steps proximal to the quadruplex-duplex junction. Bulges at the junction are largely detrimental to the adoption of the desired G-quadruplex topology for Construct I but not for Construct II. These findings should facilitate future design and prediction of quadruplex-duplex hybrids.

  4. Quadruplexes of human telomere DNA

    Czech Academy of Sciences Publication Activity Database

    Vorlíčková, Michaela; Chládková, Jana; Kejnovská, Iva; Kypr, Jaroslav

    2007-01-01

    Roč. 24, č. 6 (2007), s. 710 ISSN 0739-1102. [The 15th Conversation . 19.06.2007-23.06.2007, Albany] R&D Projects: GA ČR(CZ) GA204/07/0057; GA AV ČR(CZ) IAA100040701 Institutional research plan: CEZ:AV0Z50040507; CEZ:AV0Z50040702 Keywords : DNA tetraplex * human telomere * CD spectroscopy Subject RIV: BO - Biophysics

  5. Stability of Human Telomere Quadruplexes at High DNA Concentrations

    Czech Academy of Sciences Publication Activity Database

    Kejnovská, Iva; Vorlíčková, Michaela; Brázdová, Marie; Sagi, J.

    2014-01-01

    Roč. 101, č. 4 (2014), s. 428-438 ISSN 0006-3525 R&D Projects: GA ČR(CZ) GAP205/12/0466 Institutional support: RVO:68081707 Keywords : quadruplex * DNA concentration * folding topology Subject RIV: BO - Biophysics Impact factor: 2.385, year: 2014

  6. Pyrrolobenzodiazepines (PBDs do not bind to DNA G-quadruplexes.

    Directory of Open Access Journals (Sweden)

    Khondaker M Rahman

    Full Text Available The pyrrolo[2,1-c][1,4] benzodiazepines (PBDs are a family of sequence-selective, minor-groove binding DNA-interactive agents that covalently attach to guanine residues. A recent publication in this journal (Raju et al, PloS One, 2012, 7, 4, e35920 reported that two PBD molecules were observed to bind with high affinity to the telomeric quadruplex of Tetrahymena glaucoma based on Electrospray Ionisation Mass Spectrometry (ESI-MS, Circular Dichroism, UV-Visible and Fluorescence spectroscopy data. This was a surprising result given the close 3-dimensional shape match between the structure of all PBD molecules and the minor groove of duplex DNA, and the completely different 3-dimensional structure of quadruplex DNA. Therefore, we evaluated the interaction of eight PBD molecules of diverse structure with a range of parallel, antiparallel and mixed DNA quadruplexes using DNA Thermal Denaturation, Circular Dichroism and Molecular Dynamics Simulations. Those PBD molecules without large C8-substitutents had an insignificant affinity for the eight quadruplex types, although those with large π-system-containing C8-substituents (as with the compounds evaluated by Raju and co-workers were found to interact to some extent. Our molecular dynamics simulations support the likelihood that molecules of this type, including those examined by Raju and co-workers, interact with quadruplex DNA through their C8-substituents rather than the PBD moiety itself. It is important for the literature to be clear on this matter, as the mechanism of action of these agents will be under close scrutiny in the near future due to the growing number of PBD-based agents entering the clinic as both single-agents and as components of antibody-drug conjugates (ADCs.

  7. Studies of G-quadruplexes formed within self-assembled DNA mini-circles.

    Science.gov (United States)

    Klejevskaja, Beata; Pyne, Alice L B; Reynolds, Matthew; Shivalingam, Arun; Thorogate, Richard; Hoogenboom, Bart W; Ying, Liming; Vilar, Ramon

    2016-10-13

    We have developed self-assembled DNA mini-circles that contain a G-quadruplex-forming sequence from the c-Myc oncogene promoter and demonstrate by FRET that the G-quadruplex unfolding kinetics are 10-fold slower than for the simpler 24-mer G-quadruplex that is commonly used for FRET experiments.

  8. A multi-functional guanine derivative for studying the DNA G-quadruplex structure.

    Science.gov (United States)

    Ishizuka, Takumi; Zhao, Pei-Yan; Bao, Hong-Liang; Xu, Yan

    2017-10-23

    In the present study, we developed a multi-functional guanine derivative, 8F G, as a G-quadruplex stabilizer, a fluorescent probe for the detection of G-quadruplex formation, and a 19 F sensor for the observation of the G-quadruplex. We demonstrate that the functional nucleoside bearing a 3,5-bis(trifluoromethyl)benzene group at the 8-position of guanine stabilizes the DNA G-quadruplex structure and fluoresces following the G-quadruplex formation. Furthermore, we show that the functional sensor can be used to directly observe DNA G-quadruplexes by 19 F-NMR in living cells. To our knowledge, this is the first study showing that the nucleoside derivative simultaneously allows for three kinds of functions at a single G-quadruplex DNA. Our results suggest that the multi-functional nucleoside derivative can be broadly used for studying the G-quadruplex structure and serves as a powerful tool for examining the molecular basis of G-quadruplex formation in vitro and in living cells.

  9. The G-quadruplex DNA stabilizing drug pyridostatin promotes DNA damage and downregulates transcription of Brca1 in neurons.

    Science.gov (United States)

    Moruno-Manchon, Jose F; Koellhoffer, Edward C; Gopakumar, Jayakrishnan; Hambarde, Shashank; Kim, Nayun; McCullough, Louise D; Tsvetkov, Andrey S

    2017-09-12

    The G-quadruplex is a non-canonical DNA secondary structure formed by four DNA strands containing multiple runs of guanines. G-quadruplexes play important roles in DNA recombination, replication, telomere maintenance, and regulation of transcription. Small molecules that stabilize the G-quadruplexes alter gene expression in cancer cells. Here, we hypothesized that the G-quadruplexes regulate transcription in neurons. We discovered that pyridostatin, a small molecule that specifically stabilizes G-quadruplex DNA complexes, induced neurotoxicity and promoted the formation of DNA double-strand breaks (DSBs) in cultured neurons. We also found that pyridostatin downregulated transcription of the Brca1 gene, a gene that is critical for DSB repair. Importantly, in an in vitro gel shift assay, we discovered that an antibody specific to the G-quadruplex structure binds to a synthetic oligonucleotide, which corresponds to the first putative G-quadruplex in the Brca1 gene promoter. Our results suggest that the G-quadruplex complexes regulate transcription in neurons. Studying the G-quadruplexes could represent a new avenue for neurodegeneration and brain aging research.

  10. Repair of O6-methylguanine adducts in human telomeric G-quadruplex DNA by O6-alkylguanine-DNA alkyltransferase

    Science.gov (United States)

    Hellman, Lance M.; Spear, Tyler J.; Koontz, Colton J.; Melikishvili, Manana; Fried, Michael G.

    2014-01-01

    O6-alkylguanine-DNA alkyltransferase (AGT) is a single-cycle DNA repair enzyme that removes pro-mutagenic O6-alkylguanine adducts from DNA. Its functions with short single-stranded and duplex substrates have been characterized, but its ability to act on other DNA structures remains poorly understood. Here, we examine the functions of this enzyme on O6-methylguanine (6mG) adducts in the four-stranded structure of the human telomeric G-quadruplex. On a folded 22-nt G-quadruplex substrate, binding saturated at 2 AGT:DNA, significantly less than the ∼5 AGT:DNA found with linear single-stranded DNAs of similar length, and less than the value found with the telomere sequence under conditions that inhibit quadruplex formation (4 AGT:DNA). Despite these differences, AGT repaired 6mG adducts located within folded G-quadruplexes, at rates that were comparable to those found for a duplex DNA substrate under analogous conditions. Repair was kinetically biphasic with the amplitudes of rapid and slow phases dependent on the position of the adduct within the G-quadruplex: in general, adducts located in the top or bottom tetrads of a quadruplex stack exhibited more rapid-phase repair than did adducts located in the inner tetrad. This distinction may reflect differences in the conformational dynamics of 6mG residues in G-quadruplex DNAs. PMID:25080506

  11. A Selective G-Quadruplex DNA-Stabilizing Ligand Based on a Cyclic Naphthalene Diimide Derivative

    Directory of Open Access Journals (Sweden)

    Md. Monirul Islam

    2015-06-01

    Full Text Available A cyclic naphthalene diimide (cyclic NDI, 1, carrying a benzene moiety as linker chain, was synthesized and its interaction with G-quadruplex DNAs of a-core and a-coreTT as a human telomeric DNA, c-kit and c-myc as DNA sequence at promoter region, or thrombin-binding aptamer (TBA studied based on UV-VIS and circular dichroism (CD spectroscopic techniques, thermal melting temperature measurement, and FRET-melting assay. The circular dichroism spectra showed that 1 induced the formation of different types of G-quadruplex DNA structure. Compound 1 bound to these G-quadruplexes with affinities in the range of 106–107 M−1 order and a 2:1 stoichiometry. Compound 1 showed 270-fold higher selectivity for a-core than dsDNA with a preferable a-core binding than a-coreTT, c-kit, c-myc and TBA in the presence of K+, which is supported by thermal melting studies. The FRET-melting assay also showed that 1 bound preferentially to human telomeric DNA. Compound 1 showed potent inhibition against telomerase activity with an IC50 value of 0.9 μM and preferable binding to G-quadruplexes DNA than our previously published cyclic NDI derivative 3 carrying a benzene moiety as longer linker chain.

  12. Putative DNA G-quadruplex formation within the promoters of Plasmodium falciparum var genes

    Directory of Open Access Journals (Sweden)

    Rowe J

    2009-08-01

    Full Text Available Abstract Background Guanine-rich nucleic acid sequences are capable of folding into an intramolecular four-stranded structure called a G-quadruplex. When found in gene promoter regions, G-quadruplexes can downregulate gene expression, possibly by blocking the transcriptional machinery. Here we have used a genome-wide bioinformatic approach to identify Putative G-Quadruplex Sequences (PQS in the Plasmodium falciparum genome, along with biophysical techniques to examine the physiological stability of P. falciparum PQS in vitro. Results We identified 63 PQS in the non-telomeric regions of the P. falciparum clone 3D7. Interestingly, 16 of these PQS occurred in the upstream region of a subset of the P. falciparum var genes (group B var genes. The var gene family encodes PfEMP1, the parasite's major variant antigen and adhesin expressed at the surface of infected erythrocytes, that plays a key role in malaria pathogenesis and immune evasion. The ability of the PQS found in the upstream regions of group B var genes (UpsB-Q to form stable G-quadruplex structures in vitro was confirmed using 1H NMR, circular dichroism, UV spectroscopy, and thermal denaturation experiments. Moreover, the synthetic compound BOQ1 that shows a higher affinity for DNA forming quadruplex rather than duplex structures was found to bind with high affinity to the UpsB-Q. Conclusion This is the first demonstration of non-telomeric PQS in the genome of P. falciparum that form stable G-quadruplexes under physiological conditions in vitro. These results allow the generation of a novel hypothesis that the G-quadruplex sequences in the upstream regions of var genes have the potential to play a role in the transcriptional control of this major virulence-associated multi-gene family.

  13. Synthesis and Molecular Modeling of Thermally Stable DNA G-Quadruplexes with Anthraquinone Insertions

    DEFF Research Database (Denmark)

    Gouda, Alaa S.; Amine, Mahasen S.; Pedersen, Erik Bjerregaard

    2017-01-01

    Two new phosphoramidite building blocks for DNA synthesis were synthesized from 1,5- and 2,6-dihydroxyanthraquinones through alkylation with 3-bromo-1-propanol followed by DMT-protection. The novel synthesized 1,5- and 2,6-disubstituted anthraquinone monomers H15 and H26 are incorporated into a G...... anthraquinone-modified quadruplexes revealed no change of the antiparallel structure when compared with the wild type under potassium buffer conditions. The significantly increased thermostabilities were interpreted by molecular modeling of anthraquinone-modified G-quadruplexes....

  14. 6-Thioguanine alters the structure and stability of duplex DNA and inhibits quadruplex DNA formation.

    Science.gov (United States)

    Marathias, V M; Sawicki, M J; Bolton, P H

    1999-07-15

    The ability to chemically synthesize biomolecules has opened up the opportunity to observe changes in structure and activity that occur upon single atom substitution. In favorable cases this can provide information about the roles of individual atoms. The substitution of 6-thioguanine (6SG) for guanine is a potentially very useful single atom substitution as 6SG has optical, photocrosslinking, metal ion binding and other properties of potential utility. In addition, 6-mercaptopurine is a clinically important pro-drug that is activated by conversion into 6SG by cells. The results presented here indicate that the presence of 6SG blocks the formation of quadruplex DNA. The presence of 6SG alters the structure and lowers the thermal stability of duplex DNA, but duplex DNA can be formed in the presence of 6SG. These results indicate that some of the cytotoxic activity of 6SG may be due to disruption of the quadruplex structures formed by telomere and other DNAs. This additional mode of action is consistent with the delayed onset of cytotoxicity.

  15. UvrD in Deinococcus radiodurans is optimized for processing G-quadruplex DNA

    International Nuclear Information System (INIS)

    Das, Anubrata; Misra, H.S.

    2015-01-01

    Deinococcus radiodurans R1 is a radiation resistant Gram-positive bacterium capable of tolerating very high doses of DNA-damaging agents such as gamma radiation (D10 ∼ 12kGy) desiccation (∼ 5% relative humidity), UVC radiation (D10 ∼ 800J/m 2 ) and hydrogen peroxide (40 mM). It achieves this by using a complex regulatory mechanism and novel proteins. Recently bioinformatic analysis showed several stretches of guanine runs in D.radiodurans genome, which could form G-quartets. The role of G-quartets in regulatory processes is well documented in various organisms. The presence of G -quartets in D. radiodurans means that there are regulatory or structural proteins which would bind to these elements. Several proteins are known to bind G-quartets. Finding the proteins which would bind to G4 DNA is difficult as no specific motifs are available for binding these elements. Also most of the known proteins that are shown to bind to G-quadruplex DNA are of eukaryotic nature. To overcome these challenges we defined a set of known G-quadruplex binding proteins and used a smith-waterman algorithm with our own scoring matrix to homologs of G-quadruplex binding proteins in D.radiodurans. Using bioinformatics analysis, we showed that UvrD (DR 1775) of D. radiodurans has ability to bind/translocate along G-quadruplex DNA, a novel feature in prokaryotes. The translocase activity of DR1775 is ATP specific and this ATPase activity is attenuated by ssDNA. Data supporting UvrD of D. radiodurans as a G-quadruplex DNA metabolizing proteins would be presented. (author)

  16. Identification of the DNA-Binding Domains of Human Replication Protein A That Recognize G-Quadruplex DNA

    Directory of Open Access Journals (Sweden)

    Aishwarya Prakash

    2011-01-01

    Full Text Available Replication protein A (RPA, a key player in DNA metabolism, has 6 single-stranded DNA-(ssDNA- binding domains (DBDs A-F. SELEX experiments with the DBDs-C, -D, and -E retrieve a 20-nt G-quadruplex forming sequence. Binding studies show that RPA-DE binds preferentially to the G-quadruplex DNA, a unique preference not observed with other RPA constructs. Circular dichroism experiments show that RPA-CDE-core can unfold the G-quadruplex while RPA-DE stabilizes it. Binding studies show that RPA-C binds pyrimidine- and purine-rich sequences similarly. This difference between RPA-C and RPA-DE binding was also indicated by the inability of RPA-CDE-core to unfold an oligonucleotide containing a TC-region 5′ to the G-quadruplex. Molecular modeling studies of RPA-DE and telomere-binding proteins Pot1 and Stn1 reveal structural similarities between the proteins and illuminate potential DNA-binding sites for RPA-DE and Stn1. These data indicate that DBDs of RPA have different ssDNA recognition properties.

  17. DNA Sequences Proximal to Human Mitochondrial DNA Deletion Breakpoints Prevalent in Human Disease Form G-quadruplexes, a Class of DNA Structures Inefficiently Unwound by the Mitochondrial Replicative Twinkle Helicase*

    Science.gov (United States)

    Bharti, Sanjay Kumar; Sommers, Joshua A.; Zhou, Jun; Kaplan, Daniel L.; Spelbrink, Johannes N.; Mergny, Jean-Louis; Brosh, Robert M.

    2014-01-01

    Mitochondrial DNA deletions are prominent in human genetic disorders, cancer, and aging. It is thought that stalling of the mitochondrial replication machinery during DNA synthesis is a prominent source of mitochondrial genome instability; however, the precise molecular determinants of defective mitochondrial replication are not well understood. In this work, we performed a computational analysis of the human mitochondrial genome using the “Pattern Finder” G-quadruplex (G4) predictor algorithm to assess whether G4-forming sequences reside in close proximity (within 20 base pairs) to known mitochondrial DNA deletion breakpoints. We then used this information to map G4P sequences with deletions characteristic of representative mitochondrial genetic disorders and also those identified in various cancers and aging. Circular dichroism and UV spectral analysis demonstrated that mitochondrial G-rich sequences near deletion breakpoints prevalent in human disease form G-quadruplex DNA structures. A biochemical analysis of purified recombinant human Twinkle protein (gene product of c10orf2) showed that the mitochondrial replicative helicase inefficiently unwinds well characterized intermolecular and intramolecular G-quadruplex DNA substrates, as well as a unimolecular G4 substrate derived from a mitochondrial sequence that nests a deletion breakpoint described in human renal cell carcinoma. Although G4 has been implicated in the initiation of mitochondrial DNA replication, our current findings suggest that mitochondrial G-quadruplexes are also likely to be a source of instability for the mitochondrial genome by perturbing the normal progression of the mitochondrial replication machinery, including DNA unwinding by Twinkle helicase. PMID:25193669

  18. Controlling the stoichiometry and strand polarity of a tetramolecular G-quadruplex structure by using a DNA origami frame

    Science.gov (United States)

    Rajendran, Arivazhagan; Endo, Masayuki; Hidaka, Kumi; Lan Thao Tran, Phong; Mergny, Jean-Louis; Sugiyama, Hiroshi

    2013-01-01

    Guanine-rich oligonucleotides often show a strong tendency to form supramolecular architecture, the so-called G-quadruplex structure. Because of the biological significance, it is now considered to be one of the most important conformations of DNA. Here, we describe the direct visualization and single-molecule analysis of the formation of a tetramolecular G-quadruplex in KCl solution. The conformational changes were carried out by incorporating two duplex DNAs, with G–G mismatch repeats in the middle, inside a DNA origami frame and monitoring the topology change of the strands. In the absence of KCl, incorporated duplexes had no interaction and laid parallel to each other. Addition of KCl induced the formation of a G-quadruplex structure by stably binding the duplexes to each other in the middle. Such a quadruplex formation allowed the DNA synapsis without disturbing the duplex regions of the participating sequences, and resulted in an X-shaped structure that was monitored by atomic force microscopy. Further, the G-quadruplex formation in KCl solution and its disruption in KCl-free buffer were analyzed in real-time. The orientation of the G-quadruplex is often difficult to control and investigate using traditional biochemical methods. However, our method using DNA origami could successfully control the strand orientations, topology and stoichiometry of the G-quadruplex. PMID:23863846

  19. Effects of trimethylamine N-oxide and urea on DNA duplex and G-quadruplex.

    Science.gov (United States)

    Ueda, Yu-Mi; Zouzumi, Yu-Ki; Maruyama, Atsushi; Nakano, Shu-Ichi; Sugimoto, Naoki; Miyoshi, Daisuke

    2016-01-01

    We systematically investigated effects of molecular crowding with trimethylamine N -oxide (TMAO) as a zwitterionic and protective osmolyte and urea as a nonionic denaturing osmolyte on conformation and thermodynamics of the canonical DNA duplex and the non-canonical DNA G-quadruplex. It was found that TMAO and urea stabilized and destabilized, respectively, the G-quadruplex. On the other hand, these osmolytes generally destabilize the duplex; however, it was observed that osmolytes having the trimethylamine group stabilized the duplex at the lower concentrations because of a direct binding to a groove of the duplex. These results are useful not only to predict DNA structures and their thermodynamics under physiological environments in living cells, but also design of polymers and materials to regulate structure and stability of DNA sequences.

  20. Human telomeric DNA: G-quadruplex, i-motif and Watson–Crick double helix

    Science.gov (United States)

    Phan, Anh Tuân; Mergny, Jean-Louis

    2002-01-01

    Human telomeric DNA composed of (TTAGGG/CCCTAA)n repeats may form a classical Watson–Crick double helix. Each individual strand is also prone to quadruplex formation: the G-rich strand may adopt a G-quadruplex conformation involving G-quartets whereas the C-rich strand may fold into an i-motif based on intercalated C·C+ base pairs. Using an equimolar mixture of the telomeric oligonucleotides d[AGGG(TTAGGG)3] and d[(CCCTAA)3CCCT], we defined which structures existed and which would be the predominant species under a variety of experimental conditions. Under near-physiological conditions of pH, temperature and salt concentration, telomeric DNA was predominantly in a double-helix form. However, at lower pH values or higher temperatures, the G-quadruplex and/or the i-motif efficiently competed with the duplex. We also present kinetic and thermodynamic data for duplex association and for G-quadruplex/i-motif unfolding. PMID:12409451

  1. Escherichia coli DNA polymerase I can disrupt G-quadruplex structures during DNA replication.

    Science.gov (United States)

    Teng, Fang-Yuan; Hou, Xi-Miao; Fan, San-Hong; Rety, Stephane; Dou, Shuo-Xing; Xi, Xu-Guang

    2017-12-01

    Non-canonical four-stranded G-quadruplex (G4) DNA structures can form in G-rich sequences that are widely distributed throughout the genome. The presence of G4 structures can impair DNA replication by hindering the progress of replicative polymerases (Pols), and failure to resolve these structures can lead to genetic instability. In the present study, we combined different approaches to address the question of whether and how Escherichia coli Pol I resolves G4 obstacles during DNA replication and/or repair. We found that E. coli Pol I-catalyzed DNA synthesis could be arrested by G4 structures at low protein concentrations and the degree of inhibition was strongly dependent on the stability of the G4 structures. Interestingly, at high protein concentrations, E. coli Pol I was able to overcome some kinds of G4 obstacles without the involvement of other molecules and could achieve complete replication of G4 DNA. Mechanistic studies suggested that multiple Pol I proteins might be implicated in G4 unfolding, and the disruption of G4 structures requires energy derived from dNTP hydrolysis. The present work not only reveals an unrealized function of E. coli Pol I, but also presents a possible mechanism by which G4 structures can be resolved during DNA replication and/or repair in E. coli. © 2017 Federation of European Biochemical Societies.

  2. Cation binding to 15-TBA quadruplex DNA is a multiple-pathway cation-dependent process.

    Science.gov (United States)

    Reshetnikov, Roman V; Sponer, Jiri; Rassokhina, Olga I; Kopylov, Alexei M; Tsvetkov, Philipp O; Makarov, Alexander A; Golovin, Andrey V

    2011-12-01

    A combination of explicit solvent molecular dynamics simulation (30 simulations reaching 4 µs in total), hybrid quantum mechanics/molecular mechanics approach and isothermal titration calorimetry was used to investigate the atomistic picture of ion binding to 15-mer thrombin-binding quadruplex DNA (G-DNA) aptamer. Binding of ions to G-DNA is complex multiple pathway process, which is strongly affected by the type of the cation. The individual ion-binding events are substantially modulated by the connecting loops of the aptamer, which play several roles. They stabilize the molecule during time periods when the bound ions are not present, they modulate the route of the ion into the stem and they also stabilize the internal ions by closing the gates through which the ions enter the quadruplex. Using our extensive simulations, we for the first time observed full spontaneous exchange of internal cation between quadruplex molecule and bulk solvent at atomistic resolution. The simulation suggests that expulsion of the internally bound ion is correlated with initial binding of the incoming ion. The incoming ion then readily replaces the bound ion while minimizing any destabilization of the solute molecule during the exchange. © The Author(s) 2011. Published by Oxford University Press.

  3. Cation binding to 15-TBA quadruplex DNA is a multiple-pathway cation-dependent process

    Science.gov (United States)

    Reshetnikov, Roman V.; Sponer, Jiri; Rassokhina, Olga I.; Kopylov, Alexei M.; Tsvetkov, Philipp O.; Makarov, Alexander A.; Golovin, Andrey V.

    2011-01-01

    A combination of explicit solvent molecular dynamics simulation (30 simulations reaching 4 µs in total), hybrid quantum mechanics/molecular mechanics approach and isothermal titration calorimetry was used to investigate the atomistic picture of ion binding to 15-mer thrombin-binding quadruplex DNA (G-DNA) aptamer. Binding of ions to G-DNA is complex multiple pathway process, which is strongly affected by the type of the cation. The individual ion-binding events are substantially modulated by the connecting loops of the aptamer, which play several roles. They stabilize the molecule during time periods when the bound ions are not present, they modulate the route of the ion into the stem and they also stabilize the internal ions by closing the gates through which the ions enter the quadruplex. Using our extensive simulations, we for the first time observed full spontaneous exchange of internal cation between quadruplex molecule and bulk solvent at atomistic resolution. The simulation suggests that expulsion of the internally bound ion is correlated with initial binding of the incoming ion. The incoming ion then readily replaces the bound ion while minimizing any destabilization of the solute molecule during the exchange. PMID:21893589

  4. Biochemical techniques for the characterization of G-quadruplex structures: EMSA, DMS footprinting, and DNA polymerase stop assay.

    Science.gov (United States)

    Sun, Daekyu; Hurley, Laurence H

    2010-01-01

    The proximal promoter region of many human growth-related genes contains a polypurine/polypyrimidine tract that serves as multiple binding sites for Sp1 or other transcription factors. These tracts often contain a guanine-rich sequence consisting of four runs of three or more contiguous guanines separated by one or more bases, corresponding to a general motif known for the formation of an intramolecular G-quadruplex. Recent results provide strong evidence that specific G-quadruplex structures form naturally within these polypurine/polypyrimidine tracts in many human promoter regions, raising the possibility that the transcriptional control of these genes can be modulated by G-quadruplex-interactive agents. In this chapter, we describe three general biochemical methodologies, electrophoretic mobility shift assay (EMSA), dimethylsulfate (DMS) footprinting, and the DNA polymerase stop assay, which can be useful for initial characterization of G-quadruplex structures formed by G-rich sequences.

  5. Volumetric contributions of loop regions of G-quadruplex DNA to the formation of the tertiary structure.

    Science.gov (United States)

    Takahashi, Shuntaro; Sugimoto, Naoki

    2017-12-01

    DNA guanine-quadruplexes (G-quadruplexes) are unique DNA structures formed by guanine-rich sequences. The loop regions of G-quadruplexes play key roles in stability and topology of G-quadruplexes. Here, we investigated volumetric changes induced by pressure in the folding of the G-quadruplex formed by the thrombin binding aptamer (TBA) with mutations within the loop regions. The change of partial molar volume in the transition from coil to G-quadruplex, ∆V tr , of TBA with a mutation from T to A in the 5' most loop (TBA T3A) was 75.5cm 3 mol -1 , which was larger than that of TBA (54.6cm 3 mol -1 ). TBA with a G to T mutation in the central loop (TBA G8T) had thermal stability similar to TBA T3A but a smaller ∆V tr of 41.1cm 3 mol -1 . In the presence of poly(ethylene)glycol 200 (PEG200), ∆V tr values were 14.7cm 3 mol -1 for TBA T3A and 13.2cm 3 mol -1 for TBA G8T. These results suggest that the two mutations destabilize the G-quadruplex structure differently. Thus, volumetric data obtained using pressure-based thermodynamic analyses provides information about the dynamics of the loop regions and the roles of loops in the stabilities and folding of G-quadruplex structures. Copyright © 2017 Elsevier B.V. All rights reserved.

  6. G-Quadruplexes in DNA Replication: A Problem or a Necessity?

    Science.gov (United States)

    Valton, Anne-Laure; Prioleau, Marie-Noëlle

    2016-11-01

    DNA replication is a highly regulated process that ensures the correct duplication of the genome at each cell cycle. A precise cell type-specific temporal program controls the duplication of complex vertebrate genomes in an orderly manner. This program is based on the regulation of both replication origin firing and replication fork progression. G-quadruplexes (G4s), DNA secondary structures displaying noncanonical Watson-Crick base pairing, have recently emerged as key controllers of genome duplication. Here we discuss the various means by which G4s affect this fundamental cellular process. Copyright © 2016 Elsevier Ltd. All rights reserved.

  7. Prospect of bioflavonoid fisetin as a quadruplex DNA ligand: a biophysical approach.

    Directory of Open Access Journals (Sweden)

    Bidisha Sengupta

    Full Text Available Quadruplex (G4 forming sequences in telomeric DNA and c-myc promoter regions of human DNA are associated with tumorogenesis. Ligands that can facilitate or stabilize the formation and increase the stabilization of G4 can prevent tumor cell proliferation and have been regarded as potential anti-cancer drugs. In the present study, steady state and time-resolved fluorescence measurements provide important structural and dynamical insights into the free and bound states of the therapeutically potent plant flavonoid fisetin (3,3',4',7-tetrahydroxyflavone in a G4 DNA matrix. The excited state intra-molecular proton transfer (ESPT of fisetin plays an important role in observing and understanding the binding of fisetin with the G4 DNA. Differential absorption spectra, thermal melting, and circular dichroism spectroscopic studies provide evidences for the formation of G4 DNA and size exclusion chromatography (SEC proves the binding and 1∶1 stoichiometry of fisetin in the DNA matrix. Comparative analysis of binding in the presence of EtBr proves that fisetin favors binding at the face of the G-quartet, mostly along the diagonal loop. Time resolved fluorescence anisotropy decay analysis indicates the increase in the restrictions in motion from the free to bound fisetin. We have also investigated the fingerprints of the binding of fisetin in the antiparallel quadruplex using Raman spectroscopy. Preliminary results indicate fisetin to be a prospective candidate as a G4 ligand.

  8. Prospect of Bioflavonoid Fisetin as a Quadruplex DNA Ligand: A Biophysical Approach

    Science.gov (United States)

    Sengupta, Bidisha; Pahari, Biswapathik; Blackmon, Laura; Sengupta, Pradeep K.

    2013-01-01

    Quadruplex (G4) forming sequences in telomeric DNA and c-myc promoter regions of human DNA are associated with tumorogenesis. Ligands that can facilitate or stabilize the formation and increase the stabilization of G4 can prevent tumor cell proliferation and have been regarded as potential anti-cancer drugs. In the present study, steady state and time-resolved fluorescence measurements provide important structural and dynamical insights into the free and bound states of the therapeutically potent plant flavonoid fisetin (3,3′,4′,7-tetrahydroxyflavone) in a G4 DNA matrix. The excited state intra-molecular proton transfer (ESPT) of fisetin plays an important role in observing and understanding the binding of fisetin with the G4 DNA. Differential absorption spectra, thermal melting, and circular dichroism spectroscopic studies provide evidences for the formation of G4 DNA and size exclusion chromatography (SEC) proves the binding and 1∶1 stoichiometry of fisetin in the DNA matrix. Comparative analysis of binding in the presence of EtBr proves that fisetin favors binding at the face of the G-quartet, mostly along the diagonal loop. Time resolved fluorescence anisotropy decay analysis indicates the increase in the restrictions in motion from the free to bound fisetin. We have also investigated the fingerprints of the binding of fisetin in the antiparallel quadruplex using Raman spectroscopy. Preliminary results indicate fisetin to be a prospective candidate as a G4 ligand. PMID:23785423

  9. G-Quadruplexes Involving Both Strands of Genomic DNA Are Highly Abundant and Colocalize with Functional Sites in the Human Genome.

    Directory of Open Access Journals (Sweden)

    Andrzej S Kudlicki

    Full Text Available The G-quadruplex is a non-canonical DNA structure biologically significant in DNA replication, transcription and telomere stability. To date, only G4s with all guanines originating from the same strand of DNA have been considered in the context of the human nuclear genome. Here, I discuss interstrand topological configurations of G-quadruplex DNA, consisting of guanines from both strands of genomic DNA; an algorithm is presented for predicting such structures. I have identified over 550,000 non-overlapping interstrand G-quadruplex forming sequences in the human genome--significantly more than intrastrand configurations. Functional analysis of interstrand G-quadruplex sites shows strong association with transcription initiation, the results are consistent with the XPB and XPD transcriptional helicases binding only to G-quadruplex DNA with interstrand topology. Interstrand quadruplexes are also enriched in origin of replication sites. Several topology classes of interstrand quadruplex-forming sequences are possible, and different topologies are enriched in different types of structural elements. The list of interstrand quadruplex forming sequences, and the computer program used for their prediction are available at the web address http://moment.utmb.edu/allquads.

  10. Binding modes and pathway of RHPS4 to human telomeric G-quadruplex and duplex DNA probed by all-atom molecular dynamics simulations with explicit solvent.

    Science.gov (United States)

    Mulholland, Kelly; Siddiquei, Farzana; Wu, Chun

    2017-07-19

    RHPS4, a potent binder to human telomeric DNA G-quadruplex, shows high efficacy in tumor cell growth inhibition. However, it's preferential binding to DNA G-quadruplex over DNA duplex (about 10 fold) remains to be improved toward its clinical application. A high resolution structure of the single-stranded telomeric DNA G-quadruplexes, or B-DNA duplex, in complex with RHPS4 is not available yet, and the binding nature of this ligand to these DNA forms remains to be elusive. In this study, we carried out 40 μs molecular dynamics binding simulations with a free ligand to decipher the binding pathway of RHPS4 to a DNA duplex and three G-quadruplex folders (parallel, antiparallel and hybrid) of the human telomeric DNA sequence. The most stable binding mode identified for the duplex, parallel, antiparallel and hybrid G-quadruplexes is an intercalation, bottom stacking, top intercalation and bottom intercalation mode, respectively. The intercalation mode with similar binding strength to both the duplex and the G-quadruplexes, explains the lack of binding selectivity of RHPS4 to the G-quadruplex form. Therefore, a ligand modification that destabilizes the duplex intercalation mode but stabilizes the G-quadruplex intercalation mode will improve the binding selectivity toward G-quadruplex. The intercalation mode of RHPS4 to both the duplex and the antiparallel and the hybrid G-quadruplex follows a base flipping-insertion mechanism rather than an open-insertion mechanism. The groove binding, the side binding and the intercalation with flipping out of base were observed to be intermediate states before the full intercalation state with paired bases.

  11. Cation binding to 15-TBA quadruplex DNA is a multiple-pathway cation-dependent process

    Czech Academy of Sciences Publication Activity Database

    Reshetnikov, R.V.; Šponer, Jiří; Rassokhina, O.I.; Kopylov, A.M.; Tsvetkov, P.O.; Makarov, A.A.; Golovin, A.V.

    2011-01-01

    Roč. 39, č. 22 (2011), s. 9789-9802 ISSN 0305-1048 R&D Projects: GA AV ČR(CZ) IAA400040802; GA ČR(CZ) GA203/09/1476; GA ČR(CZ) GAP208/11/1822; GA MŠk(CZ) LC06030 Institutional research plan: CEZ:AV0Z50040507; CEZ:AV0Z50040702 Keywords : QM/MM * quadruplex DNA * molecular dynamics simulation Subject RIV: BO - Biophysics Impact factor: 8.026, year: 2011

  12. DNA adducts of antitumor cisplatin preclude telomeric sequences from forming G quadruplexes

    Czech Academy of Sciences Publication Activity Database

    Heringová, Pavla; Kašpárková, Jana; Brabec, Viktor

    2009-01-01

    Roč. 14, č. 6 (2009), s. 959-968 ISSN 0949-8257 R&D Projects: GA MZd(CZ) NR8562; GA MŠk(CZ) LC06030; GA MŠk(CZ) ME08017; GA MŠk(CZ) OC08003; GA AV ČR(CZ) 1QS500040581; GA AV ČR(CZ) KAN200200651; GA AV ČR(CZ) IAA400040803 Grant - others:GA MŠk(CZ) OC09018 Institutional research plan: CEZ:AV0Z50040507; CEZ:AV0Z50040702 Keywords : cisplatin * DNA quadruplex * telomere Subject RIV: BO - Biophysics Impact factor: 3.415, year: 2009

  13. DNA secondary structures: stability and function of G-quadruplex structures

    Science.gov (United States)

    Bochman, Matthew L.; Paeschke, Katrin; Zakian, Virginia A.

    2013-01-01

    In addition to the canonical double helix, DNA can fold into various other inter- and intramolecular secondary structures. Although many such structures were long thought to be in vitro artefacts, bioinformatics demonstrates that DNA sequences capable of forming these structures are conserved throughout evolution, suggesting the existence of non-B-form DNA in vivo. In addition, genes whose products promote formation or resolution of these structures are found in diverse organisms, and a growing body of work suggests that the resolution of DNA secondary structures is critical for genome integrity. This Review focuses on emerging evidence relating to the characteristics of G-quadruplex structures and the possible influence of such structures on genomic stability and cellular processes, such as transcription. PMID:23032257

  14. Intermolecular G-quadruplex structure-based fluorescent DNA detection system.

    Science.gov (United States)

    Zhou, Hui; Wu, Zai-Sheng; Shen, Guo-Li; Yu, Ru-Qin

    2013-03-15

    Adopting multi-donors to pair with one acceptor could improve the performance of fluorogenic detection probes. However, common dyes (e.g., fluorescein) in close proximity to each other would self-quench the fluorescence, and the fluorescence is difficult to restore. In this contribution, we constructed a novel "multi-donors-to-one acceptor" fluorescent DNA detection system by means of the intermolecular G-quadruplex (IGQ) structure-based fluorescence signal enhancement combined with the hairpin oligonucleotide. The novel IGQ-hairpin system was characterized using the p53 gene as the model target DNA. The proposed system showed an improved assay performance due to the introduction of IGQ-structure into fluorescent signaling probes, which could inhibit the background fluorescence and increase fluorescence restoration amplitude of fluoresceins upon target DNA hybridization. The proof-of-concept scheme is expected to provide new insight into the potential of G-quadruplex structure and promote the application of fluorescent oligonucleotide probes in fundamental research, diagnosis, and treatment of genetic diseases. Copyright © 2012 Elsevier B.V. All rights reserved.

  15. Simultaneous Binding of Hybrid Molecules Constructed with Dual DNA-Binding Components to a G-Quadruplex and Its Proximal Duplex.

    Science.gov (United States)

    Asamitsu, Sefan; Obata, Shunsuke; Phan, Anh Tuân; Hashiya, Kaori; Bando, Toshikazu; Sugiyama, Hiroshi

    2018-03-20

    A G-quadruplex (quadruplex) is a nucleic acid secondary structure adopted by guanine-rich sequences and is considered to be relevant to various pharmacological and biological contexts. Although a number of researchers have endeavored to discover and develop quadruplex-interactive molecules, poor ligand designability originating from topological similarity of the skeleton of diverse quadruplexes has remained a bottleneck for gaining specificity for individual quadruplexes. This work reports on hybrid molecules that were constructed with dual DNA-binding components, a cyclic imidazole/lysine polyamide (cIKP), and a hairpin pyrrole/imidazole polyamide (hPIP), with the aim toward specific quadruplex targeting by reading out the local duplex DNA sequence adjacent to designated quadruplexes in the genome. By means of circular dichroism (CD), fluorescence resonance energy transfer (FRET), surface plasmon resonance (SPR), and NMR techniques, we showed the dual and simultaneous recognition of the respective segment via hybrid molecules, and the synergistic and mutual effect of each binding component that was appropriately linked on higher binding affinity and modest sequence specificity. Monitoring quadruplex and duplex imino protons of the quadruplex/duplex motif titrated with hybrid molecules clearly revealed distinct features of the binding of hybrid molecules to the respective segments upon their simultaneous recognition. A series of the systematic and detailed binding assays described here showed that the concept of simultaneous recognition of quadruplex and its proximal duplex by hybrid molecules constructed with the dual DNA-binding components may provide a new strategy for ligand design, enabling targeting of a large variety of designated quadruplexes at specific genome locations. © 2018 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

  16. Nucleotide Pool Depletion Induces G-Quadruplex-Dependent Perturbation of Gene Expression

    Directory of Open Access Journals (Sweden)

    Charikleia Papadopoulou

    2015-12-01

    Full Text Available Nucleotide pool imbalance has been proposed to drive genetic instability in cancer. Here, we show that slowing replication forks by depleting nucleotide pools with hydroxyurea (HU can also give rise to both transient and permanent epigenetic instability of a reporter locus, BU-1, in DT40 cells. HU induces stochastic formation of Bu-1low variants in dividing cells, which have lost the H3K4me3 present in untreated cells. This instability is potentiated by an intragenic G quadruplex, which also promotes local H2Ax phosphorylation and transient heterochromatinization. Genome-wide, gene expression changes induced by HU significantly overlap with those resulting from loss of the G4-helicases FANCJ, WRN, and BLM. Thus, the effects of global replication stress induced by nucleotide pool depletion can be focused by local replication impediments caused by G quadruplex formation to induce epigenetic instability and changes in gene expression, a mechanism that may contribute to selectable transcriptional changes in cancer.

  17. Targeting G-quadruplex DNA Structures by EMICORON has a strong antitumor efficacy against advanced models of human colon cancer

    DEFF Research Database (Denmark)

    Porru, Manuela; Artuso, Simona; Salvati, Erica

    2015-01-01

    We previously identified EMICORON as a novel G-quadruplex (G4) ligand showing high selectivity for G4 structures over the duplex DNA, causing telomere damage and inhibition of cell proliferation in transformed and tumor cells. Here, we evaluated the antitumoral effect of EMICORON on advanced mode...

  18. Electrochemical single-molecule conductivity of duplex and quadruplex DNA

    DEFF Research Database (Denmark)

    Zhang, Ling; Zhang, Jingdong; Ulstrup, Jens

    2017-01-01

    Photoinduced and electrochemical charge transport in DNA (oligonucleotides, OGNs) and the notions “hopping”, superexchange, polaron, and vibrationally gated charge transport have been in focus over more than two decades. In recent years mapping of electrochemical charge transport of pure and redo...

  19. Long-range charge transport in single G-quadruplex DNA molecules

    DEFF Research Database (Denmark)

    Livshits, Gideon I.; Stern, Avigail; Rotem, Dvir

    2014-01-01

    DNA and DNA-based polymers are of interest in molecular electronics because of their versatile and programmable structures. However, transport measurements have produced a range of seemingly contradictory results due to differences in the measured molecules and experimental set-ups, and transport......DNA and DNA-based polymers are of interest in molecular electronics because of their versatile and programmable structures. However, transport measurements have produced a range of seemingly contradictory results due to differences in the measured molecules and experimental set......-ups, and transporting significant current through individual DNA-based molecules remains a considerable challenge. Here, we report reproducible charge transport in guanine-quadruplex (G4) DNA molecules adsorbed on a mica substrate. Currents ranging from tens of picoamperes to more than 100 pA were measured in the G4......-DNA over distances ranging from tens of nanometres to more than 100 nm. Our experimental results, combined with theoretical modelling, suggest that transport occurs via a thermally activated long-range hopping between multi-tetrad segments of DNA. These results could re-ignite interest in DNA...

  20. APTO-253 Stabilizes G-quadruplex DNA, Inhibits MYC Expression, and Induces DNA Damage in Acute Myeloid Leukemia Cells.

    Science.gov (United States)

    Local, Andrea; Zhang, Hongying; Benbatoul, Khalid D; Folger, Peter; Sheng, Xia; Tsai, Cheng-Yu; Howell, Stephen B; Rice, William G

    2018-06-01

    APTO-253 is a phase I clinical stage small molecule that selectively induces CDKN1A (p21), promotes G 0 -G 1 cell-cycle arrest, and triggers apoptosis in acute myeloid leukemia (AML) cells without producing myelosuppression in various animal species and humans. Differential gene expression analysis identified a pharmacodynamic effect on MYC expression, as well as induction of DNA repair and stress response pathways. APTO-253 was found to elicit a concentration- and time-dependent reduction in MYC mRNA expression and protein levels. Gene ontogeny and structural informatic analyses suggested a mechanism involving G-quadruplex (G4) stabilization. Intracellular pharmacokinetic studies in AML cells revealed that APTO-253 is converted intracellularly from a monomer to a ferrous complex [Fe(253) 3 ]. FRET assays demonstrated that both monomeric APTO-253 and Fe(253) 3 stabilize G4 structures from telomeres, MYC, and KIT promoters but do not bind to non-G4 double-stranded DNA. Although APTO-253 exerts a host of mechanistic sequelae, the effect of APTO-253 on MYC expression and its downstream target genes, on cell-cycle arrest, DNA damage, and stress responses can be explained by the action of Fe(253) 3 and APTO-253 on G-quadruplex DNA motifs. Mol Cancer Ther; 17(6); 1177-86. ©2018 AACR . ©2018 American Association for Cancer Research.

  1. Distance-dependent duplex DNA destabilization proximal to G-quadruplex/i-motif sequences

    Science.gov (United States)

    König, Sebastian L. B.; Huppert, Julian L.; Sigel, Roland K. O.; Evans, Amanda C.

    2013-01-01

    G-quadruplexes and i-motifs are complementary examples of non-canonical nucleic acid substructure conformations. G-quadruplex thermodynamic stability has been extensively studied for a variety of base sequences, but the degree of duplex destabilization that adjacent quadruplex structure formation can cause has yet to be fully addressed. Stable in vivo formation of these alternative nucleic acid structures is likely to be highly dependent on whether sufficient spacing exists between neighbouring duplex- and quadruplex-/i-motif-forming regions to accommodate quadruplexes or i-motifs without disrupting duplex stability. Prediction of putative G-quadruplex-forming regions is likely to be assisted by further understanding of what distance (number of base pairs) is required for duplexes to remain stable as quadruplexes or i-motifs form. Using oligonucleotide constructs derived from precedented G-quadruplexes and i-motif-forming bcl-2 P1 promoter region, initial biophysical stability studies indicate that the formation of G-quadruplex and i-motif conformations do destabilize proximal duplex regions. The undermining effect that quadruplex formation can have on duplex stability is mitigated with increased distance from the duplex region: a spacing of five base pairs or more is sufficient to maintain duplex stability proximal to predicted quadruplex/i-motif-forming regions. PMID:23771141

  2. G-quadruplexes Significantly Stimulate Pif1 Helicase-catalyzed Duplex DNA Unwinding*

    Science.gov (United States)

    Duan, Xiao-Lei; Liu, Na-Nv; Yang, Yan-Tao; Li, Hai-Hong; Li, Ming; Dou, Shuo-Xing; Xi, Xu-Guang

    2015-01-01

    The evolutionarily conserved G-quadruplexes (G4s) are faithfully inherited and serve a variety of cellular functions such as telomere maintenance, gene regulation, DNA replication initiation, and epigenetic regulation. Different from the Watson-Crick base-pairing found in duplex DNA, G4s are formed via Hoogsteen base pairing and are very stable and compact DNA structures. Failure of untangling them in the cell impedes DNA-based transactions and leads to genome instability. Cells have evolved highly specific helicases to resolve G4 structures. We used a recombinant nuclear form of Saccharomyces cerevisiae Pif1 to characterize Pif1-mediated DNA unwinding with a substrate mimicking an ongoing lagging strand synthesis stalled by G4s, which resembles a replication origin and a G4-structured flap in Okazaki fragment maturation. We find that the presence of G4 may greatly stimulate the Pif1 helicase to unwind duplex DNA. Further studies reveal that this stimulation results from G4-enhanced Pif1 dimerization, which is required for duplex DNA unwinding. This finding provides new insights into the properties and functions of G4s. We discuss the observed activation phenomenon in relation to the possible regulatory role of G4s in the rapid rescue of the stalled lagging strand synthesis by helping the replicator recognize and activate the replication origin as well as by quickly removing the G4-structured flap during Okazaki fragment maturation. PMID:25627683

  3. Co-transcriptional formation of DNA:RNA hybrid G-quadruplex and potential function as constitutional cis element for transcription control.

    Science.gov (United States)

    Zheng, Ke-wei; Xiao, Shan; Liu, Jia-quan; Zhang, Jia-yu; Hao, Yu-hua; Tan, Zheng

    2013-05-01

    G-quadruplex formation in genomic DNA is considered to regulate transcription. Previous investigations almost exclusively focused on intramolecular G-quadruplexes formed by DNA carrying four or more G-tracts, and structure formation has rarely been studied in physiologically relevant processes. Here, we report an almost entirely neglected, but actually much more prevalent form of G-quadruplexes, DNA:RNA hybrid G-quadruplexes (HQ) that forms in transcription. HQ formation requires as few as two G-tracts instead of four on a non-template DNA strand. Potential HQ sequences (PHQS) are present in >97% of human genes, with an average of 73 PHQSs per gene. HQ modulates transcription under both in vitro and in vivo conditions. Transcriptomal analysis of human tissues implies that maximal gene expression may be limited by the number of PHQS in genes. These features suggest that HQs may play fundamental roles in transcription regulation and other transcription-mediated processes.

  4. Intramolecular telomeric G-quadruplexes dramatically inhibit DNA synthesis by replicative and translesion polymerases, revealing their potential to lead to genetic change.

    Directory of Open Access Journals (Sweden)

    Deanna N Edwards

    Full Text Available Recent research indicates that hundreds of thousands of G-rich sequences within the human genome have the potential to form secondary structures known as G-quadruplexes. Telomeric regions, consisting of long arrays of TTAGGG/AATCCC repeats, are among the most likely areas in which these structures might form. Since G-quadruplexes assemble from certain G-rich single-stranded sequences, they might arise when duplex DNA is unwound such as during replication. Coincidentally, these bulky structures when present in the DNA template might also hinder the action of DNA polymerases. In this study, single-stranded telomeric templates with the potential to form G-quadruplexes were examined for their effects on a variety of replicative and translesion DNA polymerases from humans and lower organisms. Our results demonstrate that single-stranded templates containing four telomeric GGG runs fold into intramolecular G-quadruplex structures. These intramolecular G quadruplexes are somewhat dynamic in nature and stabilized by increasing KCl concentrations and decreasing temperatures. Furthermore, the presence of these intramolecular G-quadruplexes in the template dramatically inhibits DNA synthesis by various DNA polymerases, including the human polymerase δ employed during lagging strand replication of G-rich telomeric strands and several human translesion DNA polymerases potentially recruited to sites of replication blockage. Notably, misincorporation of nucleotides is observed when certain translesion polymerases are employed on substrates containing intramolecular G-quadruplexes, as is extension of the resulting mismatched base pairs upon dynamic unfolding of this secondary structure. These findings reveal the potential for blockage of DNA replication and genetic changes related to sequences capable of forming intramolecular G-quadruplexes.

  5. A colorimetric platform for sensitively differentiating telomere DNA with different lengths, monitoring G-quadruplex and dsDNA based on silver nanoclusters and unmodified gold nanoparticles

    Science.gov (United States)

    Qu, Fei; Chen, Zeqiu; You, Jinmao; Song, Cuihua

    2018-05-01

    Human telomere DNA plays a vital role in genome integrity control and carcinogenesis as an indication for extensive cell proliferation. Herein, silver nanoclusters (Ag NCs) templated by polymer and unmodified gold nanoparticles (Au NPs) are designed as a new colorimetric platform for sensitively differentiating telomere DNA with different lengths, monitoring G-quadruplex and dsDNA. Ag NCs can produce the aggregation of Au NPs, so the color of Au NPs changes to blue and the absorption peak moves to 700 nm. While the telomere DNA can protect Au NPs from aggregation, the color turns to red again and the absorption band blue shift. Benefiting from the obvious color change, we can differentiate the length of telomere DNA by naked eyes. As the length of telomere DNA is longer, the variation of color becomes more noticeable. The detection limits of telomere DNA containing 10, 22, 40, 64 bases are estimated to be 1.41, 1.21, 0.23 and 0.22 nM, respectively. On the other hand, when telomere DNA forms G-quadruplex in the presence of K+, or dsDNA with complementary sequence, both G-quadruplex and dsDNA can protect Au NPs better than the unfolded telomere DNA. Hence, a new colorimetric platform for monitoring structure conversion of DNA is established by Ag NCs-Au NPs system, and to prove this type of application, a selective K+ sensor is developed.

  6. Mms1 is an assistant for regulating G-quadruplex DNA structures.

    Science.gov (United States)

    Schwindt, Eike; Paeschke, Katrin

    2017-11-02

    The preservation of genome stability is fundamental for every cell. Genomic integrity is constantly challenged. Among those challenges are also non-canonical nucleic acid structures. In recent years, scientists became aware of the impact of G-quadruplex (G4) structures on genome stability. It has been shown that folded G4-DNA structures cause changes in the cell, such as transcriptional up/down-regulation, replication stalling, or enhanced genome instability. Multiple helicases have been identified to regulate G4 structures and by this preserve genome stability. Interestingly, although these helicases are mostly ubiquitous expressed, they show specificity for G4 regulation in certain cellular processes (e.g., DNA replication). To this date, it is not clear how this process and target specificity of helicases are achieved. Recently, Mms1, an ubiquitin ligase complex protein, was identified as a novel G4-DNA-binding protein that supports genome stability by aiding Pif1 helicase binding to these regions. In this perspective review, we discuss the question if G4-DNA interacting proteins are fundamental for helicase function and specificity at G4-DNA structures.

  7. Perturbed soliton excitations in inhomogeneous DNA

    International Nuclear Information System (INIS)

    Daniel, M.; Vasumathi, V.

    2005-05-01

    We study nonlinear dynamics of inhomogeneous DNA double helical chain under dynamic plane-base rotator model by considering angular rotation of bases in a plane normal to the helical axis. The DNA dynamics in this case is found to be governed by a perturbed sine-Gordon equation when taking into account the interstrand hydrogen bonding energy and intrastrand inhomogeneous stacking energy and making an analogy with the Heisenberg model of the Hamiltonian for an inhomogeneous anisotropic spin ladder with ferromagnetic legs and antiferromagentic rung coupling. In the homogeneous limit the dynamics is governed by the kink-antikink soliton of the sine-Gordon equation which represents the formation of open state configuration in DNA double helix. The effect of inhomogeneity in stacking energy in the form of localized and periodic variations on the formation of open states in DNA is studied under perturbation. The perturbed soliton is obtained using a multiple scale soliton perturbation theory by solving the associated linear eigen value problem and constructing the complete set of eigen functions. The inhomogeneity in stacking energy is found to modulate the width and speed of the soliton depending on the nature of inhomogeneity. Also it introduces fluctuations in the form of train of pulses or periodic oscillation in the open state configuration (author)

  8. Atomistic picture for the folding pathway of a hybrid-1 type human telomeric DNA G-quadruplex.

    Directory of Open Access Journals (Sweden)

    Yunqiang Bian

    2014-04-01

    Full Text Available In this work we studied the folding process of the hybrid-1 type human telomeric DNA G-quadruplex with solvent and K(+ ions explicitly modeled. Enabled by the powerful bias-exchange metadynamics and large-scale conventional molecular dynamic simulations, the free energy landscape of this G-DNA was obtained for the first time and four folding intermediates were identified, including a triplex and a basically formed quadruplex. The simulations also provided atomistic pictures for the structures and cation binding patterns of the intermediates. The results showed that the structure formation and cation binding are cooperative and mutually supporting each other. The syn/anti reorientation dynamics of the intermediates was also investigated. It was found that the nucleotides usually take correct syn/anti configurations when they form native and stable hydrogen bonds with the others, while fluctuating between two configurations when they do not. Misfolded intermediates with wrong syn/anti configurations were observed in the early intermediates but not in the later ones. Based on the simulations, we also discussed the roles of the non-native interactions. Besides, the formation process of the parallel conformation in the first two G-repeats and the associated reversal loop were studied. Based on the above results, we proposed a folding pathway for the hybrid-1 type G-quadruplex with atomistic details, which is new and more complete compared with previous ones. The knowledge gained for this type of G-DNA may provide a general insight for the folding of the other G-quadruplexes.

  9. Ball with hair: modular functionalization of highly stable G-quadruplex DNA nano-scaffolds through N2-guanine modification.

    Science.gov (United States)

    Lech, Christopher Jacques; Phan, Anh Tuân

    2017-06-20

    Functionalized nanoparticles have seen valuable applications, particularly in the delivery of therapeutic and diagnostic agents in biological systems. However, the manufacturing of such nano-scale systems with the consistency required for biological application can be challenging, as variation in size and shape have large influences in nanoparticle behavior in vivo. We report on the development of a versatile nano-scaffold based on the modular functionalization of a DNA G-quadruplex. DNA sequences are functionalized in a modular fashion using well-established phosphoramidite chemical synthesis with nucleotides containing modification of the amino (N2) position of the guanine base. In physiological conditions, these sequences fold into well-defined G-quadruplex structures. The resulting DNA nano-scaffolds are thermally stable, consistent in size, and functionalized in a manner that allows for control over the density and relative orientation of functional chemistries on the nano-scaffold surface. Various chemistries including small modifications (N2-methyl-guanine), bulky aromatic modifications (N2-benzyl-guanine), and long chain-like modifications (N2-6-amino-hexyl-guanine) are tested and are found to be generally compatible with G-quadruplex formation. Furthermore, these modifications stabilize the G-quadruplex scaffold by 2.0-13.3 °C per modification in the melting temperature, with concurrent modifications producing extremely stable nano-scaffolds. We demonstrate the potential of this approach by functionalizing nano-scaffolds for use within the biotin-avidin conjugation approach. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.

  10. G-quadruplex DNA sequences are evolutionarily conserved and associated with distinct genomic features in Saccharomyces cerevisiae.

    Directory of Open Access Journals (Sweden)

    John A Capra

    2010-07-01

    Full Text Available G-quadruplex DNA is a four-stranded DNA structure formed by non-Watson-Crick base pairing between stacked sets of four guanines. Many possible functions have been proposed for this structure, but its in vivo role in the cell is still largely unresolved. We carried out a genome-wide survey of the evolutionary conservation of regions with the potential to form G-quadruplex DNA structures (G4 DNA motifs across seven yeast species. We found that G4 DNA motifs were significantly more conserved than expected by chance, and the nucleotide-level conservation patterns suggested that the motif conservation was the result of the formation of G4 DNA structures. We characterized the association of conserved and non-conserved G4 DNA motifs in Saccharomyces cerevisiae with more than 40 known genome features and gene classes. Our comprehensive, integrated evolutionary and functional analysis confirmed the previously observed associations of G4 DNA motifs with promoter regions and the rDNA, and it identified several previously unrecognized associations of G4 DNA motifs with genomic features, such as mitotic and meiotic double-strand break sites (DSBs. Conserved G4 DNA motifs maintained strong associations with promoters and the rDNA, but not with DSBs. We also performed the first analysis of G4 DNA motifs in the mitochondria, and surprisingly found a tenfold higher concentration of the motifs in the AT-rich yeast mitochondrial DNA than in nuclear DNA. The evolutionary conservation of the G4 DNA motif and its association with specific genome features supports the hypothesis that G4 DNA has in vivo functions that are under evolutionary constraint.

  11. Spectroscopic studies on the interactions of 5-ethyl-6-phenyl-3,8-bis((3-aminoalkyl)propanamido)phenanthridin-5-ium derivatives with G-quadruplex DNA

    Science.gov (United States)

    Yalçın, Ergin; Duyar, Halil; Ihmels, Heiko; Seferoğlu, Zeynel

    2018-05-01

    An improved microwave-induced synthesis of five ethidium derivatives (Ethidium derivatives, 2a-d) is presented. As the derivatives 2a-d have been proposed previously to be telomerase inhibitors, the binding interactions of these ethidium derivatives with G-quadruplex DNA were evaluated by means of photometric and fluorimetric titration, thermal DNA denaturation, CD and 1H NMR spectroscopy. In particular, the compound bearing 3,8-bis(pyrrolidin-1-yl)propanamido substituent 2a exhibits high selectivity for G-quadruplex DNA relative to duplex DNA.

  12. Mechanism and manipulation of DNA:RNA hybrid G-quadruplex formation in transcription of G-rich DNA.

    Science.gov (United States)

    Zhang, Jia-yu; Zheng, Ke-wei; Xiao, Shan; Hao, Yu-hua; Tan, Zheng

    2014-01-29

    We recently reported that a DNA:RNA hybrid G-quadruplex (HQ) forms during transcription of DNA that bears two or more tandem guanine tracts (G-tract) on the nontemplate strand. Putative HQ-forming sequences are enriched in the nearby 1000 nt region right downstream of transcription start sites in the nontemplate strand of warm-blooded animals, and HQ regulates transcription under both in vitro and in vivo conditions. Therefore, knowledge of the mechanism of HQ formation is important for understanding the biological function of HQ as well as for manipulating gene expression by targeting HQ. In this work, we studied the mechanism of HQ formation using an in vitro T7 transcription model. We show that RNA synthesis initially produces an R-loop, a DNA:RNA heteroduplex formed by a nascent RNA transcript and the template DNA strand. In the following round of transcription, the RNA in the R-loop is displaced, releasing the RNA in single-stranded form (ssRNA). Then the G-tracts in the RNA can jointly form HQ with those in the nontemplate DNA strand. We demonstrate that the structural cascade R-loop → ssRNA → HQ offers opportunities to intercept HQ formation, which may provide a potential method to manipulate gene expression.

  13. Exploring the Dynamics of Propeller Loops in Human Telomeric DNA Quadruplexes Using Atomistic Simulations

    Science.gov (United States)

    2017-01-01

    We have carried out a series of extended unbiased molecular dynamics (MD) simulations (up to 10 μs long, ∼162 μs in total) complemented by replica-exchange with the collective variable tempering (RECT) approach for several human telomeric DNA G-quadruplex (GQ) topologies with TTA propeller loops. We used different AMBER DNA force-field variants and also processed simulations by Markov State Model (MSM) analysis. The slow conformational transitions in the propeller loops took place on a scale of a few μs, emphasizing the need for long simulations in studies of GQ dynamics. The propeller loops sampled similar ensembles for all GQ topologies and for all force-field dihedral-potential variants. The outcomes of standard and RECT simulations were consistent and captured similar spectrum of loop conformations. However, the most common crystallographic loop conformation was very unstable with all force-field versions. Although the loss of canonical γ-trans state of the first propeller loop nucleotide could be related to the indispensable bsc0 α/γ dihedral potential, even supporting this particular dihedral by a bias was insufficient to populate the experimentally dominant loop conformation. In conclusion, while our simulations were capable of providing a reasonable albeit not converged sampling of the TTA propeller loop conformational space, the force-field description still remained far from satisfactory. PMID:28475322

  14. Integration of G-quadruplex and DNA-templated Ag NCs for nonarithmetic information processing.

    Science.gov (United States)

    Gao, Ru-Ru; Yao, Tian-Ming; Lv, Xiao-Yan; Zhu, Yan-Yan; Zhang, Yi-Wei; Shi, Shuo

    2017-06-01

    To create sophisticated molecular logic circuits from scratch, you may not believe how common the building blocks can be and how diverse and powerful such circuits can be when scaled up. Using the two simple building blocks of G-quadruplex and silver nanoclusters (Ag NCs), we experimentally construct a series of multifunctional, label-free, and multi-output logic circuits to perform nonarithmetic functions: a 1-to-2 decoder, a 4-to-2 encoder, an 8-to-3 encoder, dual transfer gates, a 2 : 1 multiplexer, and a 1 : 2 demultiplexer. Moreover, a parity checker which is capable of identifying odd and even numbers from natural numbers is constructed conceptually. Finally, a multi-valued logic gate (ternary inhibit gate) is readily achieved by taking this DNA/Ag NC system as a universal platform. All of the above logic circuits share the same building blocks, indicating the great prospects of the assembly of nanomaterials and DNA for biochemical logic devices. Considering its biocompatibility, the novel prototypes developed here may have potential applications in the fields of biological computers and medical diagnosis and serve as a promising proof of principle in the not-too-distant future.

  15. “One Ring to Bind Them All”—Part I: The Efficiency of the Macrocyclic Scaffold for G-Quadruplex DNA Recognition

    Directory of Open Access Journals (Sweden)

    David Monchaud

    2010-01-01

    Full Text Available Macrocyclic scaffolds are particularly attractive for designing selective G-quadruplex ligands essentially because, on one hand, they show a poor affinity for the “standard” B-DNA conformation and, on the other hand, they fit nicely with the external G-quartets of quadruplexes. Stimulated by the pioneering studies on the cationic porphyrin TMPyP4 and the natural product telomestatin, follow-up studies have developed, rapidly leading to a large diversity of macrocyclic structures with remarkable-quadruplex binding properties and biological activities. In this review we summarize the current state of the art in detailing the three main categories of quadruplex-binding macrocycles described so far (telomestatin-like polyheteroarenes, porphyrins and derivatives, polyammonium cyclophanes, and in addressing both synthetic issues and biological aspects.

  16. Ligand binding to telomeric G-quadruplex DNA investigated by funnel-metadynamics simulations.

    Science.gov (United States)

    Moraca, Federica; Amato, Jussara; Ortuso, Francesco; Artese, Anna; Pagano, Bruno; Novellino, Ettore; Alcaro, Stefano; Parrinello, Michele; Limongelli, Vittorio

    2017-03-14

    G-quadruplexes (G4s) are higher-order DNA structures typically present at promoter regions of genes and telomeres. Here, the G4 formation decreases the replicative DNA at each cell cycle, finally leading to apoptosis. The ability to control this mitotic clock, particularly in cancer cells, is fascinating and passes through a rational understanding of the ligand/G4 interaction. We demonstrate that an accurate description of the ligand/G4 binding mechanism is possible using an innovative free-energy method called funnel-metadynamics (FM), which we have recently developed to investigate ligand/protein interaction. Using FM simulations, we have elucidated the binding mechanism of the anticancer alkaloid berberine to the human telomeric G4 ( d [AG 3 (T 2 AG 3 ) 3 ]), computing also the binding free-energy landscape. Two ligand binding modes have been identified as the lowest energy states. Furthermore, we have found prebinding sites, which are preparatory to reach the final binding mode. In our simulations, the ions and the water molecules have been explicitly represented and the energetic contribution of the solvent during ligand binding evaluated. Our theoretical results provide an accurate estimate of the absolute ligand/DNA binding free energy ([Formula: see text] = -10.3 ± 0.5 kcal/mol) that we validated through steady-state fluorescence binding assays. The good agreement between the theoretical and experimental value demonstrates that FM is a most powerful method to investigate ligand/DNA interaction and can be a useful tool for the rational design also of G4 ligands.

  17. Studies of G-quadruplex DNA structures at the single molecule level

    DEFF Research Database (Denmark)

    Kragh, Sofie Louise

    2015-01-01

    Folding of G-quaduplex structures adopted by the human telomeric repeat is here studied by single molecule FRET microscopy. This method allows for the investigation of G-quadruplex structures and their conformational dynamic. Telomeres are located at the ends of our chromosomes and end in a single...... with human telomeric repeat adopt several different G-quadruplex conformations in the presence of K+ ions. G-quadruplexes inhibit telomerase activity and are therefore potential targets for anti-cancer drugs, which can be small molecule ligands capable of stabilizing G-quadruplex structures. Understanding...... range. FRET spectroscopy can be performed on an ensemble of molecules, or on the single molecule level. In single molecule FRET experiments it is possible to follow the behaviour in time for each molecule independently, allowing insight into both dynamically and statistically heterogeneous molecular...

  18. Toward the design of new DNA G-quadruplex ligands through rational analysis of polymorphism and binding data.

    Science.gov (United States)

    Artese, Anna; Costa, Giosuè; Distinto, Simona; Moraca, Federica; Ortuso, Francesco; Parrotta, Lucia; Alcaro, Stefano

    2013-10-01

    Human telomeres play a key role in protecting chromosomal ends from fusion events; they are composed of d(TTAGGG) repeats, ranging in size from 3 to 15 kb. They form G-quadruplex DNA structures, stabilized by G-quartets in the presence of cations, and are involved in several biological processes. In particular, a telomere maintenance mechanism is provided by a specialized enzyme called telomerase, a reverse transcriptase able to add multiple copies of the 5'-GGTTAG-3' motif to the end of the G-strand of the telomere and which is over-expressed in the majority of cancer cells. The central cation has a crucial role in maintaining the stability of the structure. Based on its nature, it can be associated with different topological telomeric quadruplexes, which depend also on the orientation of the DNA strands and the syn/anti conformation of the guanines. Such a polymorphism, confirmed by the different structures deposited in the Protein Data Bank (PDB), prompted us to apply a computational protocol in order to investigate the conformational properties of a set of known G-quadruplex ligands and their molecular recognition against six different experimental models of the human telomeric sequence d[AG3(T2AG3)3]. The average AutoDock correlation between theoretical and experimental data yielded an r2 value equal to 0.882 among all the studied models. Such a result was always improved with respect to those of the single folds, with the exception of the parallel structure (r2 equal to 0.886), thus suggesting a key role of this G4 conformation in the stacking interaction network. Among the studied binders, a trisubstituted acridine and a dibenzophenanthroline derivative were well recognized by the parallel and the mixed G-quadruplex structures, allowing the identification of specific key contacts with DNA and the further design of more potent or target specific G-quadruplex ligands. Copyright © 2013 Elsevier Masson SAS. All rights reserved.

  19. DNA sensors and aptasensors based on the hemin/G-quadruplex-controlled aggregation of Au NPs in the presence of L-cysteine.

    Science.gov (United States)

    Niazov-Elkan, Angelica; Golub, Eyal; Sharon, Etery; Balogh, Dora; Willner, Itamar

    2014-07-23

    L-cysteine induces the aggregation of Au nanoparticles (NPs), resulting in a color transition from red to blue due to interparticle plasmonic coupling in the aggregated structure. The hemin/G-quadruplex horseradish peroxidase-mimicking DNAzyme catalyzes the aerobic oxidation of L-cysteine to cystine, a process that inhibits the aggregation of the NPs. The degree of inhibition of the aggregation process is controlled by the concentration of the DNAzyme in the system. These functions are implemented to develop sensing platforms for the detection of a target DNA, for the analysis of aptamer-substrate complexes, and for the analysis of L-cysteine in human urine samples. A hairpin DNA structure that includes a recognition site for the DNA analyte and a caged G-quadruplex sequence, is opened in the presence of the target DNA. The resulting self-assembled hemin/G-quadruplex acts as catalyst that controls the aggregation of the Au NPs. Also, the thrombin-binding aptamer folds into a G-quadruplex nanostructure upon binding to thrombin. The association of hemin to the resulting G-quadruplex aptamer-thrombin complex leads to a catalytic label that controls the L-cysteine-mediated aggregation of the Au NPs. The hemin/G-qaudruplex-controlled aggregation of Au NPs process is further implemented for visual and spectroscopic detection of L-cysteine concentration in urine samples. © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  20. Development of a carbazole-based fluorescence probe for G-quadruplex DNA: The importance of side-group effect on binding specificity

    Science.gov (United States)

    Wang, Ming-Qi; Ren, Gui-Ying; Zhao, Shuang; Lian, Guang-Chang; Chen, Ting-Ting; Ci, Yang; Li, Hong-Yao

    2018-06-01

    G-quadruplex DNAs are highly prevalent in the human genome and involved in many important biological processes. However, many aspects of their biological mechanism and significance still need to be elucidated. Therefore, the development of fluorescent probes for G-quadruplex detection is important for the basic research. We report here on the development of small molecular dyes designed on the basis of carbazole scaffold by introducing styrene-like substituents at its 9-position, for the purpose of G-quadruplex recognition. Results revealed that the side group on the carbazole scaffold was very important for their ability to selectively recognize G-quadruplex DNA structures. 1a with the pyridine side group displayed excellent fluorescence signal turn-on property for the specific discrimination of G-quadruplex DNAs against other nucleic acids. The characteristics of 1a were further investigated with UV-vis spectrophotometry, fluorescence, circular dichroism, FID assay and molecular docking to validate the selectivity, sensitivity and detailed binding mode toward G-quadruplex DNAs.

  1. Fluorescence detection of DNA, adenosine-5'-triphosphate (ATP), and telomerase activity by zinc(II)-protoporphyrin IX/G-quadruplex labels.

    Science.gov (United States)

    Zhang, Zhanxia; Sharon, Etery; Freeman, Ronit; Liu, Xiaoqing; Willner, Itamar

    2012-06-05

    The zinc(II)-protoporphyrin IX (ZnPPIX) fluorophore binds to G-quadruplexes, and this results in the enhanced fluorescence of the fluorophore. This property enabled the development of DNA sensors, aptasensors, and a sensor following telomerase activity. The DNA sensor is based on the design of a hairpin structure that includes a "caged" inactive G-quadruplex sequence. Upon opening the hairpin by the analyte DNA, the resulting fluorescence of the ZnPPIX/G-quadruplex provides the readout signal for the sensing event (detection limit 5 nM). Addition of Exonuclease III to the system allows the recycling of the analyte and its amplified analysis (detection limit, 200 pM). The association of the ZnPPIX to G-quadruplex aptamer-substrate complexes allowed the detection of adenosine-5'-triphosphate (ATP, detection limit 10 μM). Finally, the association of ZnPPIX to the G-quadruplex repeat units of telomers allowed the detection of telomerase activity originating from 380 ± 20 cancer 293T cell extract.

  2. Structural dynamics of thrombin-binding DNA aptamer d(GGTTGGTGTGGTTGG) quadruplex DNA studied by large-scale explicit solvent simulations

    Czech Academy of Sciences Publication Activity Database

    Reshetnikov, R.; Golovin, A.; Spiridonova, V.; Kopylov, A.; Šponer, Jiří

    2010-01-01

    Roč. 6, č. 10 (2010), s. 3003-3014 ISSN 1549-9618 R&D Projects: GA AV ČR(CZ) IAA400040802; GA ČR(CZ) GA203/09/1476; GA MŠk(CZ) LC06030 Institutional research plan: CEZ:AV0Z50040507; CEZ:AV0Z50040702 Keywords : molecular dynamics * quadruplex DNA * thrombin Subject RIV: BO - Biophysics Impact factor: 5.138, year: 2010

  3. Multifunctional energy landscape for a DNA G-quadruplex: An evolved molecular switch

    Czech Academy of Sciences Publication Activity Database

    Cragnolini, T.; Chakraborty, D.; Šponer, Jiří; Derreumaux, P.; Pasquali, S.; Wales, D.J.

    2017-01-01

    Roč. 147, č. 15 (2017), č. článku 152715. ISSN 0021-9606 R&D Projects: GA ČR(CZ) GA16-13721S Institutional support: RVO:68081707 Keywords : telomeric g-quadruplex * gb1 hairpin peptide Subject RIV: CF - Physical ; Theoretical Chemistry OBOR OECD: Physical chemistry Impact factor: 2.965, year: 2016

  4. Spectroscopic insights into quadruplexes of five-repeat telomere DNA sequences upon G-block damage

    Czech Academy of Sciences Publication Activity Database

    Dvořáková, Zuzana; Vorlíčková, Michaela; Renčiuk, Daniel

    2017-01-01

    Roč. 1861, č. 11 (2017), s. 2750-2757 ISSN 0304-4165 R&D Projects: GA ČR(CZ) GJ17-19170Y Institutional support: RVO:68081707 Keywords : k+ solution * guanine quadruplexes Subject RIV: CE - Biochemistry OBOR OECD: Biochemistry and molecular biology Impact factor: 4.702, year: 2016

  5. Toehold strand displacement-driven assembly of G-quadruplex DNA for enzyme-free and non-label sensitive fluorescent detection of thrombin.

    Science.gov (United States)

    Xu, Yunying; Zhou, Wenjiao; Zhou, Ming; Xiang, Yun; Yuan, Ruo; Chai, Yaqin

    2015-02-15

    Based on a new signal amplification strategy by the toehold strand displacement-driven cyclic assembly of G-quadruplex DNA, the development of an enzyme-free and non-label aptamer sensing approach for sensitive fluorescent detection of thrombin is described. The target thrombin associates with the corresponding aptamer of the partial dsDNA probes and liberates single stranded initiation sequences, which trigger the toehold strand displacement assembly of two G-quadruplex containing hairpin DNAs. This toehold strand displacement reaction leads to the cyclic reuse of the initiation sequences and the production of DNA assemblies with numerous G-quadruplex structures. The fluorescent dye, N-Methyl mesoporphyrin IX, binds to these G-quadruplex structures and generates significantly amplified fluorescent signals to achieve highly sensitive detection of thrombin down to 5 pM. Besides, this method shows high selectivity towards the target thrombin against other control proteins. The developed thrombin sensing method herein avoids the modification of the probes and the involvement of any enzyme or nanomaterial labels for signal amplification. With the successful demonstration for thrombin detection, our approach can be easily adopted to monitor other target molecules in a simple, low-cost, sensitive and selective way by choosing appropriate aptamer/ligand pairs. Copyright © 2014 Elsevier B.V. All rights reserved.

  6. Identification of New Natural DNA G-Quadruplex Binders Selected by a Structure-Based Virtual Screening Approach

    Directory of Open Access Journals (Sweden)

    Stefano Alcaro

    2013-09-01

    Full Text Available The G-quadruplex DNA structures are mainly present at the terminal portion of telomeres and can be stabilized by ligands able to recognize them in a specific manner. The recognition process is usually related to the inhibition of the enzyme telomerase indirectly involved and over-expressed in a high percentage of human tumors. There are several ligands, characterized by different chemical structures, already reported in the literature for their ability to bind and stabilize the G-quadruplex structures. Using the structural and biological information available on these structures; we performed a high throughput in silico screening of commercially natural compounds databases by means of a structure-based approach followed by docking experiments against the human telomeric sequence d[AG3(T2AG33]. We identified 12 best hits characterized by different chemical scaffolds and conformational and physicochemical properties. All of them were associated to an improved theoretical binding affinity with respect to that of known selective G-binders. Among these hits there is a chalcone derivative; structurally very similar to the polyphenol butein; known to remarkably inhibit the telomerase activity.

  7. Sites of instability in the human TCF3 (E2A) gene adopt G-quadruplex DNA structures in vitro

    Science.gov (United States)

    Williams, Jonathan D.; Fleetwood, Sara; Berroyer, Alexandra; Kim, Nayun; Larson, Erik D.

    2015-01-01

    The formation of highly stable four-stranded DNA, called G-quadruplex (G4), promotes site-specific genome instability. G4 DNA structures fold from repetitive guanine sequences, and increasing experimental evidence connects G4 sequence motifs with specific gene rearrangements. The human transcription factor 3 (TCF3) gene (also termed E2A) is subject to genetic instability associated with severe disease, most notably a common translocation event t(1;19) associated with acute lymphoblastic leukemia. The sites of instability in TCF3 are not randomly distributed, but focused to certain sequences. We asked if G4 DNA formation could explain why TCF3 is prone to recombination and mutagenesis. Here we demonstrate that sequences surrounding the major t(1;19) break site and a region associated with copy number variations both contain G4 sequence motifs. The motifs identified readily adopt G4 DNA structures that are stable enough to interfere with DNA synthesis in physiological salt conditions in vitro. When introduced into the yeast genome, TCF3 G4 motifs promoted gross chromosomal rearrangements in a transcription-dependent manner. Our results provide a molecular rationale for the site-specific instability of human TCF3, suggesting that G4 DNA structures contribute to oncogenic DNA breaks and recombination. PMID:26029241

  8. Label-free detection of kanamycin based on a G-quadruplex DNA aptamer-based fluorescent intercalator displacement assay

    Science.gov (United States)

    Xing, Yun-Peng; Liu, Chun; Zhou, Xiao-Hong; Shi, Han-Chang

    2015-01-01

    This work was the first to report that the kanamycin-binding DNA aptamer (5'-TGG GGG TTG AGG CTA AGC CGA-3') can form stable parallel G-quadruplex DNA (G4-DNA) structures by themselves and that this phenomenon can be verified by nondenaturing polyacrylamide gel electrophoresis and circular dichroism spectroscopy. Based on these findings, we developed a novel label-free strategy for kanamycin detection based on the G4-DNA aptamer-based fluorescent intercalator displacement assay with thiazole orange (TO) as the fluorescence probe. In the proposed strategy, TO became strongly fluorescent upon binding to kanamycin-binding G4-DNA. However, the addition of kanamycin caused the displacement of TO from the G4-DNA-TO conjugate, thereby resulting in decreased fluorescent signal, which was inversely related to the kanamycin concentration. The detection limit of the proposed assay decreased to 59 nM with a linear working range of 0.1 μM to 20 μM for kanamycin. The cross-reactivity against six other antibiotics was negligible compared with the response to kanamycin. A satisfactory recovery of kanamycin in milk samples ranged from 80.1% to 98.0%, confirming the potential of this bioassay in the measurement of kanamycin in various applications. Our results also served as a good reference for developing similar fluorescent G4-DNA-based bioassays in the future.

  9. Multifunctional energy landscape for a DNA G-quadruplex: An evolved molecular switch

    Science.gov (United States)

    Cragnolini, Tristan; Chakraborty, Debayan; Šponer, Jiří; Derreumaux, Philippe; Pasquali, Samuela; Wales, David J.

    2017-10-01

    We explore the energy landscape for a four-fold telomere repeat, obtaining interconversion pathways between six experimentally characterised G-quadruplex topologies. The results reveal a multi-funnel system, with a variety of intermediate configurations and misfolded states. This organisation is identified with the intrinsically multi-functional nature of the system, suggesting a new paradigm for the classification of such biomolecules and clarifying issues regarding apparently conflicting experimental results.

  10. Human telomere sequence DNA in water-free and high-viscosity solvents: G-quadruplex folding governed by Kramers rate theory.

    Science.gov (United States)

    Lannan, Ford M; Mamajanov, Irena; Hud, Nicholas V

    2012-09-19

    Structures formed by human telomere sequence (HTS) DNA are of interest due to the implication of telomeres in the aging process and cancer. We present studies of HTS DNA folding in an anhydrous, high viscosity deep eutectic solvent (DES) comprised of choline choride and urea. In this solvent, the HTS DNA forms a G-quadruplex with the parallel-stranded ("propeller") fold, consistent with observations that reduced water activity favors the parallel fold, whereas alternative folds are favored at high water activity. Surprisingly, adoption of the parallel structure by HTS DNA in the DES, after thermal denaturation and quick cooling to room temperature, requires several months, as opposed to less than 2 min in an aqueous solution. This extended folding time in the DES is, in part, due to HTS DNA becoming kinetically trapped in a folded state that is apparently not accessed in lower viscosity solvents. A comparison of times required for the G-quadruplex to convert from its aqueous-preferred folded state to its parallel fold also reveals a dependence on solvent viscosity that is consistent with Kramers rate theory, which predicts that diffusion-controlled transitions will slow proportionally with solvent friction. These results provide an enhanced view of a G-quadruplex folding funnel and highlight the necessity to consider solvent viscosity in studies of G-quadruplex formation in vitro and in vivo. Additionally, the solvents and analyses presented here should prove valuable for understanding the folding of many other nucleic acids and potentially have applications in DNA-based nanotechnology where time-dependent structures are desired.

  11. G-quadruplex and G-rich sequence stimulate Pif1p-catalyzed downstream duplex DNA unwinding through reducing waiting time at ss/dsDNA junction

    Science.gov (United States)

    Zhang, Bo; Wu, Wen-Qiang; Liu, Na-Nv; Duan, Xiao-Lei; Li, Ming; Dou, Shuo-Xing; Hou, Xi-Miao; Xi, Xu-Guang

    2016-01-01

    Alternative DNA structures that deviate from B-form double-stranded DNA such as G-quadruplex (G4) DNA can be formed by G-rich sequences that are widely distributed throughout the human genome. We have previously shown that Pif1p not only unfolds G4, but also unwinds the downstream duplex DNA in a G4-stimulated manner. In the present study, we further characterized the G4-stimulated duplex DNA unwinding phenomenon by means of single-molecule fluorescence resonance energy transfer. It was found that Pif1p did not unwind the partial duplex DNA immediately after unfolding the upstream G4 structure, but rather, it would dwell at the ss/dsDNA junction with a ‘waiting time’. Further studies revealed that the waiting time was in fact related to a protein dimerization process that was sensitive to ssDNA sequence and would become rapid if the sequence is G-rich. Furthermore, we identified that the G-rich sequence, as the G4 structure, equally stimulates duplex DNA unwinding. The present work sheds new light on the molecular mechanism by which G4-unwinding helicase Pif1p resolves physiological G4/duplex DNA structures in cells. PMID:27471032

  12. Utilization of circular dichroism and electrospray ionization mass spectrometry to understand the formation and conversion of G-quadruplex DNA at the human c-myb proto-oncogene.

    Science.gov (United States)

    Fu, Hengqing; Yang, Pengfei; Hai, Jinhui; Li, Huihui

    2018-10-05

    G-quadruplex DNAs are involved in a number of key biological processes, including gene expression, transcription, and apoptosis. The c-myb oncogene contains a number of GGA repeats in its promoter which forms G-quadruplex, thus it could be used as a target in cancer therapeutics. Several in-vitro studies have used Circular Dichroism (CD) spectroscopy or electrospray ionization mass spectrometry (ESI-MS) to demonstrate formation and stability of G-quadruplex DNA structure in the promoter region of human c-myb oncogene. The factors affecting the c-myb G-quadruplex structures were investigated, such as cations (i.e. K + , NH 4 + and Na + ) and co-solutes (methanol and polyethylene glycol). The results indicated that the presence of cations and co-solutes could change the G-quadruplex structural population and promote its thermodynamic stabilization as indicated by CD melting curves. It indicated that the co-solutes preferentially stabilize the c-myb G-quadruplex structure containing both homo- and hetero-stacking. In addition, protopine was demonstrated as a binder of c-myb G-quadruplex as screened from a library of natural alkaloids using ESI-MS method. CD spectra showed that it could selectively stabilize the c-myb G-quadruplex structure compared to other six G-quadruplexes from tumor-related G-rich sequences and the duplex DNAs (both long and short-chain ones). The binding of protopine could induce the change in the G-quadruplex structural populations. Therefore, protopine with its high binding specificity could be considered as a precursor for the design of drugs to target and regulate c-myb oncogene transcription. Copyright © 2018 Elsevier B.V. All rights reserved.

  13. Higher-order human telomeric G-quadruplex DNA metalloenzymes enhance enantioselectivity in the Diels-Alder reaction.

    Science.gov (United States)

    Li, Yinghao; Jia, Guoqing; Wang, Changhao; Cheng, Mingpan; Li, Can

    2015-03-02

    Short human telomeric (HT) DNA sequences form single G-quadruplex (G4 ) units and exhibit structure-based stereocontrol for a series of reactions. However, for more biologically relevant higher-order HT G4 -DNAs (beyond a single G4 unit), the catalytic performances are unknown. Here, we found that higher-order HT G4 -DNA copper metalloenzymes (two or three G4 units) afford remarkably higher enantioselectivity (>90 % ee) and a five- to sixfold rate increase, compared to a single G4 unit, for the Diels-Alder reaction. Electron paramagnetic resonance (EPR) and enzymatic kinetic studies revealed that the distinct catalytic function between single and higher-order G4 -DNA copper metalloenzymes can be attributed to different Cu(II) coordination environments and substrate specificity. Our finding suggests that, like protein enzymes and ribozymes, higher-order structural organization is crucial for G4 -DNA-based catalysis. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  14. Selectivity in ligand recognition of G-quadruplex loops.

    Science.gov (United States)

    Campbell, Nancy H; Patel, Manisha; Tofa, Amina B; Ghosh, Ragina; Parkinson, Gary N; Neidle, Stephen

    2009-03-03

    A series of disubstituted acridine ligands have been cocrystallized with a bimolecular DNA G-quadruplex. The ligands have a range of cyclic amino end groups of varying size. The crystal structures show that the diagonal loop in this quadruplex results in a large cavity for these groups, in contrast to the steric constraints imposed by propeller loops in human telomeric quadruplexes. We conclude that the nature of the loop has a significant influence on ligand selectivity for particular quadruplex folds.

  15. Determinants for Tight and Selective Binding of a Medicinal Dicarbene Gold(I) Complex to a Telomeric DNA G-Quadruplex: a Joint ESI MS and XRD Investigation.

    Science.gov (United States)

    Bazzicalupi, Carla; Ferraroni, Marta; Papi, Francesco; Massai, Lara; Bertrand, Benoît; Messori, Luigi; Gratteri, Paola; Casini, Angela

    2016-03-18

    The dicarbene gold(I) complex [Au(9-methylcaffein-8-ylidene)2 ]BF4 is an exceptional organometallic compound of profound interest as a prospective anticancer agent. This gold(I) complex was previously reported to be highly cytotoxic toward various cancer cell lines in vitro and behaves as a selective G-quadruplex stabilizer. Interactions of the gold complex with various telomeric DNA models have been analyzed by a combined ESI MS and X-ray diffraction (XRD) approach. ESI MS measurements confirmed formation of stable adducts between the intact gold(I) complex and Tel 23 DNA sequence. The crystal structure of the adduct formed between [Au(9-methylcaffein-8-ylidene)2 ](+) and Tel 23 DNA G-quadruplex was solved. Tel 23 maintains a characteristic propeller conformation while binding three gold(I) dicarbene moieties at two distinct sites. Stacking interactions appear to drive noncovalent binding of the gold(I) complex. The structural basis for tight gold(I) complex/G-quadruplex recognition and its selectivity are described. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  16. Disordering of human telomeric G-quadruplex with novel antiproliferative anthrathiophenedione.

    Directory of Open Access Journals (Sweden)

    Dmitry Kaluzhny

    Full Text Available Linear heteroareneanthracenediones have been shown to interfere with DNA functions, thereby causing death of human tumor cells and their drug resistant counterparts. Here we report the interaction of our novel antiproliferative agent 4,11-bis[(2-{[acetimido]amino}ethylamino]anthra[2,3-b]thiophene-5,10-dione with telomeric DNA structures studied by isothermal titration calorimetry, circular dichroism and UV absorption spectroscopy. New compound demonstrated a high affinity (K(ass∼10⁶ M⁻¹ for human telomeric antiparallel quadruplex d(TTAGGG₄ and duplex d(TTAGGG₄∶d(CCCTAA₄. Importantly, a ∼100-fold higher affinity was determined for the ligand binding to an unordered oligonucleotide d(TTAGGG TTAGAG TTAGGG TTAGGG unable to form quadruplex structures. Moreover, in the presence of Na+ the compound caused dramatic conformational perturbation of the telomeric G-quadruplex, namely, almost complete disordering of G-quartets. Disorganization of a portion of G-quartets in the presence of K+ was also detected. Molecular dynamics simulations were performed to illustrate how the binding of one molecule of the ligand might disrupt the G-quartet adjacent to the diagonal loop of telomeric G-quadruplex. Our results provide evidence for a non-trivial mode of alteration of G-quadruplex structure by tentative antiproliferative drugs.

  17. Reference simulations of noncanonical nucleic acids with different chí variants of the AMBER force field: Quadruplex DNA, quadruplex RNA, and Z-DNA

    Czech Academy of Sciences Publication Activity Database

    Krepl, Miroslav; Zgarbová, M.; Stadlbauer, Petr; Otyepka, M.; Banáš, P.; Koča, J.; Cheatham III, T.E.; Jurečka, P.; Šponer, Jiří

    2012-01-01

    Roč. 8, č. 7 (2012), s. 2506-2520 ISSN 1549-9618 R&D Projects: GA ČR(CZ) GD203/09/H046; GA ČR(CZ) GA203/09/1476; GA ČR(CZ) GAP208/11/1822; GA ČR(CZ) GBP305/12/G034 Institutional research plan: CEZ:AV0Z50040702 Keywords : refinement of empirical force fields * DNA * Z-DNA backbone Subject RIV: BO - Biophysics Impact factor: 5.389, year: 2012

  18. Profiling DNA damage response following mitotic perturbations

    DEFF Research Database (Denmark)

    Pedersen, Ronni Sølvhøi; Karemore, Gopal; Gudjonsson, Thorkell

    2016-01-01

    that a broad spectrum of mitotic errors correlates with increased DNA breakage in daughter cells. Unexpectedly, we find that only a subset of these correlations are functionally linked. We identify the genuine mitosis-born DNA damage events and sub-classify them according to penetrance of the observed...

  19. Cation Coordination Alters the Conformation of a Thrombin-Binding G-Quadruplex DNA Aptamer That Affects Inhibition of Thrombin.

    Science.gov (United States)

    Zavyalova, Elena; Tagiltsev, Grigory; Reshetnikov, Roman; Arutyunyan, Alexander; Kopylov, Alexey

    2016-10-01

    Thrombin-binding aptamers are promising anticoagulants. HD1 is a monomolecular antiparallel G-quadruplex with two G-quartets linked by three loops. Aptamer-thrombin interactions are mediated with two TT-loops that bind thrombin exosite I. Several cations were shown to be coordinated inside the G-quadruplex, including K + , Na + , NH 4 + , Ba 2+ , and Sr 2+ ; on the contrary, Mn 2+ was coordinated in the grooves, outside the G-quadruplex. K + or Na + coordination provides aptamer functional activity. The effect of other cations on aptamer functional activity has not yet been described, because of a lack of relevant tests. Interactions between aptamer HD1 and a series of cations were studied. A previously developed enzymatic method was applied to evaluate aptamer inhibitory activity. The structure-function correlation was studied using the characterization of G-quadruplex conformation by circular dichroism spectroscopy. K + coordination provided the well-known high inhibitory activity of the aptamer, whereas Na + coordination supported low activity. Although NH 4 + coordination yielded a typical antiparallel G-quadruplex, no inhibitory activity was shown; a similar effect was observed for Ba 2+ and Sr 2+ coordination. Mn 2+ coordination destabilized the G-quadruplex that drastically diminished aptamer inhibitory activity. Therefore, G-quadruplex existence per se is insufficient for aptamer inhibitory activity. To elicit the nature of these effects, we thoroughly analyzed nuclear magnetic resonance (NMR) and X-ray data on the structure of the HD1 G-quadruplex with various cations. The most reasonable explanation is that cation coordination changes the conformation of TT-loops, affecting thrombin binding and inhibition. HD1 counterparts, aptamers 31-TBA and NU172, behaved similarly with some distinctions. In 31-TBA, an additional duplex module stabilized antiparallel G-quadruplex conformation at high concentrations of divalent cations; whereas in NU172, a different

  20. Allelic Dropout During Polymerase Chain Reaction due to G-Quadruplex Structures and DNA Methylation Is Widespread at Imprinted Human Loci

    Directory of Open Access Journals (Sweden)

    Aaron J. Stevens

    2017-03-01

    Full Text Available Loss of one allele during polymerase chain reaction (PCR amplification of DNA, known as allelic dropout, can be caused by a variety of mechanisms. Allelic dropout during PCR may have profound implications for molecular diagnostic and research procedures that depend on PCR and assume biallelic amplification has occurred. Complete allelic dropout due to the combined effects of cytosine methylation and G-quadruplex formation was previously described for a differentially methylated region of the human imprinted gene, MEST. We now demonstrate that this parent-of-origin specific allelic dropout can potentially occur at several other genomic regions that display genomic imprinting and have propensity for G-quadruplex formation, including AIM1, BLCAP, DNMT1, PLAGL1, KCNQ1, and GRB10. These findings demonstrate that systematic allelic dropout during PCR is a general phenomenon for regions of the genome where differential allelic methylation and G-quadruplex motifs coincide, and suggest that great care must be taken to ensure biallelic amplification is occurring in such situations.

  1. Allelic Dropout During Polymerase Chain Reaction due to G-Quadruplex Structures and DNA Methylation Is Widespread at Imprinted Human Loci.

    Science.gov (United States)

    Stevens, Aaron J; Taylor, Millie G; Pearce, Frederick Grant; Kennedy, Martin A

    2017-03-10

    Loss of one allele during polymerase chain reaction (PCR) amplification of DNA, known as allelic dropout, can be caused by a variety of mechanisms. Allelic dropout during PCR may have profound implications for molecular diagnostic and research procedures that depend on PCR and assume biallelic amplification has occurred. Complete allelic dropout due to the combined effects of cytosine methylation and G-quadruplex formation was previously described for a differentially methylated region of the human imprinted gene, MEST We now demonstrate that this parent-of-origin specific allelic dropout can potentially occur at several other genomic regions that display genomic imprinting and have propensity for G-quadruplex formation, including AIM1 , BLCAP , DNMT1 , PLAGL1 , KCNQ1 , and GRB10 These findings demonstrate that systematic allelic dropout during PCR is a general phenomenon for regions of the genome where differential allelic methylation and G-quadruplex motifs coincide, and suggest that great care must be taken to ensure biallelic amplification is occurring in such situations. Copyright © 2017 Stevens et al.

  2. Phenolic promiscuity in the cell nucleus--epigallocatechingallate (EGCG) and theaflavin-3,3'-digallate from green and black tea bind to model cell nuclear structures including histone proteins, double stranded DNA and telomeric quadruplex DNA.

    Science.gov (United States)

    Mikutis, Gediminas; Karaköse, Hande; Jaiswal, Rakesh; LeGresley, Adam; Islam, Tuhidul; Fernandez-Lahore, Marcelo; Kuhnert, Nikolai

    2013-02-01

    Flavanols from tea have been reported to accumulate in the cell nucleus in considerable concentrations. The nature of this phenomenon, which could provide novel approaches in understanding the well-known beneficial health effects of tea phenols, is investigated in this contribution. The interaction between epigallocatechin gallate (EGCG) from green tea and a selection of theaflavins from black tea with selected cell nuclear structures such as model histone proteins, double stranded DNA and quadruplex DNA was investigated using mass spectrometry, Circular Dichroism spectroscopy and fluorescent assays. The selected polyphenols were shown to display affinity to all of the selected cell nuclear structures, thereby demonstrating a degree of unexpected molecular promiscuity. Most interestingly theaflavin-digallate was shown to display the highest affinity to quadruplex DNA reported for any naturally occurring molecule reported so far. This finding has immediate implications in rationalising the chemopreventive effect of the tea beverage against cancer and possibly the role of tea phenolics as "life span essentials".

  3. Enantioselective light switch effect of Δ- and Λ-[Ru(phenanthroline)2 dipyrido[3,2-a:2', 3'-c]phenazine]2+ bound to G-quadruplex DNA.

    Science.gov (United States)

    Park, Jin Ha; Lee, Hyun Suk; Jang, Myung Duk; Han, Sung Wook; Kim, Seog K; Lee, Young-Ae

    2018-06-01

    The interaction of Δ- and Λ-[Ru(phen) 2 DPPZ] 2+ (DPPZ = dipyrido[3,2-a:2', 3'-c]phenazine, phen = phenanthroline) with a G-quadruplex formed from 5'-G 2 T 2 G 2 TGTG 2 T 2 G 2-3 '(15-mer) was investigated. The well-known enhancement of luminescence intensity (the 'light-switch' effect) was observed for the [Ru(phen) 2 DPPZ] 2+ complexes upon formation of an adduct with the G-quadruplex. The emission intensity of the G-quadruplex-bound Λ-isomer was 3-fold larger than that of the Δ-isomer when bound to the G-quadruplex, which is opposite of the result observed in the case of double stranded DNA (dsDNA); the light switch effect is larger for the dsDNA-bound Δ-isomer. In the job plot of the G-quadruplex with Δ- and Λ-[Ru(phen) 2 DPPZ] 2+ , a major inflection point for the two isomers was observed at x ≈ .65, which suggests a binding stoichiometry of 2:1 for both enantiomers. When the G base at the 8th position was replaced with 6-methyl isoxanthopterin (6MI), a fluorescent guanine analog, the excited energy of 6-MI transferred to bound Δ- or Λ-[Ru(phen) 2 DPPZ] 2+ , which suggests that at least a part of both Ru(II) enantiomers is close to or in contact with the diagonal loop of the G-quadruplex. A luminescence quenching experiment using [Fe(CN) 6 ] 4- for the G-quadruplex-bound Ru(II) complex revealed downward bending curves for both enantiomers in the Stern-Volmer plot, which suggests the presence of Ru(II) complexes that are both accessible and inaccessible to the quencher and may be related to the 2:1 binding stoichiometry.

  4. Quantification of Chemical and Mechanical Effects on the Formation of the G-Quadruplex and i-Motif in Duplex DNA.

    Science.gov (United States)

    Selvam, Sangeetha; Mandal, Shankar; Mao, Hanbin

    2017-09-05

    The formation of biologically significant tetraplex DNA species, such as G-quadruplexes and i-motifs, is affected by chemical (ions and pH) and mechanical [superhelicity (σ) and molecular crowding] factors. Because of the extremely challenging experimental conditions, the relative importance of these factors on tetraplex folding is unknown. In this work, we quantitatively evaluated the chemical and mechanical effects on the population dynamics of DNA tetraplexes in the insulin-linked polymorphic region using magneto-optical tweezers. By mechanically unfolding individual tetraplexes, we found that ions and pH have the largest effects on the formation of the G-quadruplex and i-motif, respectively. Interestingly, superhelicity has the second largest effect followed by molecular crowding conditions. While chemical effects are specific to tetraplex species, mechanical factors have generic influences. The predominant effect of chemical factors can be attributed to the fact that they directly change the stability of a specific tetraplex, whereas the mechanical factors, superhelicity in particular, reduce the stability of the competing species by changing the kinetics of the melting and annealing of the duplex DNA template in a nonspecific manner. The substantial dependence of tetraplexes on superhelicity provides strong support that DNA tetraplexes can serve as topological sensors to modulate fundamental cellular processes such as transcription.

  5. Nonlinear optical and G-Quadruplex DNA stabilization properties of novel mixed ligand copper(II) complexes and coordination polymers: Synthesis, structural characterization and computational studies

    Science.gov (United States)

    Rajasekhar, Bathula; Bodavarapu, Navya; Sridevi, M.; Thamizhselvi, G.; RizhaNazar, K.; Padmanaban, R.; Swu, Toka

    2018-03-01

    The present study reports the synthesis and evaluation of nonlinear optical property and G-Quadruplex DNA Stabilization of five novel copper(II) mixed ligand complexes. They were synthesized from copper(II) salt, 2,5- and 2,3- pyridinedicarboxylic acid, diethylenetriamine and amide based ligand (AL). The crystal structure of these complexes were determined through X-ray diffraction and supported by ESI-MAS, NMR, UV-Vis and FT-IR spectroscopic methods. Their nonlinear optical property was studied using Gaussian09 computer program. For structural optimization and nonlinear optical property, density functional theory (DFT) based B3LYP method was used with LANL2DZ basis set for metal ion and 6-31G∗ for C,H,N,O and Cl atoms. The present work reveals that pre-polarized Complex-2 showed higher β value (29.59 × 10-30e.s.u) as compared to that of neutral complex-1 (β = 0.276 × 10-30e.s.u.) which may be due to greater advantage of polarizability. Complex-2 is expected to be a potential material for optoelectronic and photonic technologies. Docking studies using AutodockVina revealed that complex-2 has higher binding energy for both G-Quadruplex DNA (-8.7 kcal/mol) and duplex DNA (-10.1 kcal/mol). It was also observed that structure plays an important role in binding efficiency.

  6. Electrochemical and AFM Characterization of G-Quadruplex Electrochemical Biosensors and Applications

    Science.gov (United States)

    2018-01-01

    Guanine-rich DNA sequences are able to form G-quadruplexes, being involved in important biological processes and representing smart self-assembling nanomaterials that are increasingly used in DNA nanotechnology and biosensor technology. G-quadruplex electrochemical biosensors have received particular attention, since the electrochemical response is particularly sensitive to the DNA structural changes from single-stranded, double-stranded, or hairpin into a G-quadruplex configuration. Furthermore, the development of an increased number of G-quadruplex aptamers that combine the G-quadruplex stiffness and self-assembling versatility with the aptamer high specificity of binding to a variety of molecular targets allowed the construction of biosensors with increased selectivity and sensitivity. This review discusses the recent advances on the electrochemical characterization, design, and applications of G-quadruplex electrochemical biosensors in the evaluation of metal ions, G-quadruplex ligands, and other small organic molecules, proteins, and cells. The electrochemical and atomic force microscopy characterization of G-quadruplexes is presented. The incubation time and cations concentration dependence in controlling the G-quadruplex folding, stability, and nanostructures formation at carbon electrodes are discussed. Different G-quadruplex electrochemical biosensors design strategies, based on the DNA folding into a G-quadruplex, the use of G-quadruplex aptamers, or the use of hemin/G-quadruplex DNAzymes, are revisited. PMID:29666699

  7. Exploring the Interactions of the Dietary Plant Flavonoids Fisetin and Naringenin with G-Quadruplex and Duplex DNA, Showing Contrasting Binding Behavior: Spectroscopic and Molecular Modeling Approaches.

    Science.gov (United States)

    Bhattacharjee, Snehasish; Chakraborty, Sandipan; Sengupta, Pradeep K; Bhowmik, Sudipta

    2016-09-01

    Guanine-rich sequences have the propensity to fold into a four-stranded DNA structure known as a G-quadruplex (G4). G4 forming sequences are abundant in the promoter region of several oncogenes and become a key target for anticancer drug binding. Here we have studied the interactions of two structurally similar dietary plant flavonoids fisetin and naringenin with G4 as well as double stranded (duplex) DNA by using different spectroscopic and modeling techniques. Our study demonstrates the differential binding ability of the two flavonoids with G4 and duplex DNA. Fisetin more strongly interacts with parallel G4 structure than duplex DNA, whereas naringenin shows stronger binding affinity to duplex rather than G4 DNA. Molecular docking results also corroborate our spectroscopic results, and it was found that both of the ligands are stacked externally in the G4 DNA structure. C-ring planarity of the flavonoid structure appears to be a crucial factor for preferential G4 DNA recognition of flavonoids. The goal of this study is to explore the critical effects of small differences in the structure of closely similar chemical classes of such small molecules (flavonoids) which lead to the contrasting binding properties with the two different forms of DNA. The resulting insights may be expected to facilitate the designing of the highly selective G4 DNA binders based on flavonoid scaffolds.

  8. Conformational dynamics of the human propeller telomeric DNA quadruplex on a microsecond time scale

    Czech Academy of Sciences Publication Activity Database

    Islam, B.; Sgobba, M.; Laughton, C.; Orozco, M.; Šponer, Jiří; Neidle, S.; Haider, S.

    2013-01-01

    Roč. 41, č. 4 (2013), s. 2723-2735 ISSN 0305-1048 R&D Projects: GA ČR(CZ) GAP208/11/1822 Grant - others:GA ČR(CZ) ED1.1.00/02.0068 Program:ED Institutional support: RVO:68081707 Keywords : MOLECULAR-DYNAMICS * CRYSTAL-STRUCTURE * B-DNA Subject RIV: BO - Biophysics Impact factor: 8.808, year: 2013

  9. Transcriptional control by G-quadruplexes: In vivo roles and perspectives for specific intervention.

    Science.gov (United States)

    Armas, Pablo; David, Aldana; Calcaterra, Nora B

    2017-01-01

    G-quadruplexes are non-canonical DNA secondary structures involved in several genomic and molecular processes. Here, we summarize the main G-quadruplex features and evidences proving the in vivo role on the transcriptional regulation of genes required for zebrafish embryonic development. We also discuss alternative strategies for specifically interfering G-quadruplex in vivo.

  10. Seven essential questions on G-quadruplexes.

    Science.gov (United States)

    König, Sebastian L B; Evans, Amanda C; Huppert, Julian L

    2010-08-01

    The helical duplex architecture of DNA was discovered by Francis Crick and James Watson in 1951 and is well known and understood. However, nucleic acids can also adopt alternative structural conformations that are less familiar, although no less biologically relevant, such as the G-quadruplex. G-quadruplexes continue to be the subject of a rapidly expanding area of research, owing to their significant potential as therapeutic targets and their unique biophysical properties. This review begins by focusing on G-quadruplex structure, elucidating the intermolecular and intramolecular interactions underlying its formation and highlighting several substructural variants. A variety of methods used to characterize these structures are also outlined. The current state of G-quadruplex research is then addressed by proffering seven pertinent questions for discussion. This review concludes with an overview of possible directions for future research trajectories in this exciting and relevant field.

  11. Dual Recognition of Human Telomeric G-quadruplex by Neomycin-anthraquinone Conjugate

    Science.gov (United States)

    Ranjan, Nihar; Davis, Erik; Xue, Liang

    2013-01-01

    The authors report the recognition of a G-quadruplex formed by four repeat human telomeric DNA with aminosugar intercalator conjugates. The recognition of G-quadruplex through dual binding mode ligands significantly increased the affinity of ligands for G-quadruplex. One such example is a neomycin-anthraquinone 2 which exhibited nanomolar affinity for the quadruplex, and the affinity of 2 is nearly 1000 fold higher for human telomeric G-quadruplex DNA than its constituent units, neomycin and anthraquinone. PMID:23698792

  12. Microwave-Assisted Synthesis of Arene Ru(II Complexes Induce Tumor Cell Apoptosis Through Selectively Binding and Stabilizing bcl-2 G-Quadruplex DNA

    Directory of Open Access Journals (Sweden)

    Yanhua Chen

    2016-05-01

    Full Text Available A series of arene Ru(II complexes coordinated with phenanthroimidazole derivatives, [(η6-C6H6Ru(lCl]Cl(1b L = p-ClPIP = 2-(4-Chlorophenylimidazole[4,5f] 1,10-phenanthroline; 2b L = m-ClPIP = 2-(3-Chlorophenylimidazole[4,5f] 1,10-phenanthroline; 3b L = p-NPIP = 2-(4-Nitrophenylimidazole[4,5f] 1,10-phenanthroline; 4b L = m-NPIP = 2-(3-Nitrophenyl imidazole [4,5f] 1,10-phenanthroline were synthesized in yields of 89.9%–92.7% under conditions of microwave irradiation heating for 30 min to liberate four arene Ru(II complexes (1b, 2b, 3b, 4b. The anti-tumor activity of 1b against various tumor cells was evaluated by MTT assay. The results indicated that this complex blocked the growth of human lung adenocarcinoma A549 cells with an IC50 of 16.59 μM. Flow cytometric analysis showed that apoptosis of A549 cells was observed following treatment with 1b. Furthermore, the in vitro DNA-binding behaviors that were confirmed by spectroscopy indicated that 1b could selectively bind and stabilize bcl-2 G-quadruplex DNA to induce apoptosis of A549 cells. Therefore, the synthesized 1b has impressive bcl-2 G-quadruplex DNA-binding and stabilizing activities with potential applications in cancer chemotherapy.

  13. Extended molecular dynamics of a c-kit promoter quadruplex

    Czech Academy of Sciences Publication Activity Database

    Islam, B.; Stadlbauer, Petr; Krepl, Miroslav; Koča, J.; Neidle, S.; Haider, S.; Šponer, Jiří

    2015-01-01

    Roč. 43, č. 18 (2015), s. 8673-8693 ISSN 0305-1048 R&D Projects: GA ČR(CZ) GAP208/11/1822 Institutional support: RVO:68081707 Keywords : TELOMERIC G-QUADRUPLEX * INTRAMOLECULAR DNA QUADRUPLEXES * GASTROINTESTINAL STROMAL TUMOR Subject RIV: BO - Biophysics Impact factor: 9.202, year: 2015

  14. Aminoglycosylation can enhance the G-quadruplex binding activity of epigallocatechin.

    Directory of Open Access Journals (Sweden)

    Li-Ping Bai

    Full Text Available With the aim of enhancing G-quadruplex binding activity, two new glucosaminosides (16, 18 of penta-methylated epigallocatechin were synthesized by chemical glycosylation. Subsequent ESI-TOF-MS analysis demonstrated that these two glucosaminoside derivatives exhibit much stronger binding activity to human telomeric DNA and RNA G-quadruplexes than their parent structure (i.e., methylated EGC (14 as well as natural epigallocatechin (EGC, 6. The DNA G-quadruplex binding activity of 16 and 18 is even more potent than strong G-quadruplex binder quercetin, which has a more planar structure. These two synthetic compounds also showed a higher binding strength to human telomeric RNA G-quadruplex than its DNA counterpart. Analysis of the structure-activity relationship revealed that the more basic compound, 16, has a higher binding capacity with DNA and RNA G-quadruplexes than its N-acetyl derivative, 18, suggesting the importance of the basicity of the aminoglycoside for G-quadruplex binding activity. Molecular docking simulation predicted that the aromatic ring of 16 π-stacks with the aromatic ring of guanine nucleotides, with the glucosamine moiety residing in the groove of G-quadruplex. This research indicates that glycosylation of natural products with aminosugar can significantly enhance their G-quadruplex binding activities, thus is an effective way to generate small molecules targeting G-quadruplexes in nucleic acids. In addition, this is the first report that green tea catechin can bind to nucleic acid G-quadruplex structures.

  15. Xanthene and Xanthone Derivatives as G-Quadruplex Stabilizing Ligands

    Directory of Open Access Journals (Sweden)

    Alessandro Altieri

    2013-10-01

    Full Text Available Following previous studies on anthraquinone and acridine-based G-quadruplex ligands, here we present a study of similar aromatic cores, with the specific aim of increasing G-quadruplex binding and selectivity with respect to duplex DNA. Synthesized compounds include two and three-side chain xanthone and xanthene derivatives, as well as a dimeric “bridged” form. ESI and FRET measurements suggest that all the studied molecules are good G-quadruplex ligands, both at telomeres and on G-quadruplex forming sequences of oncogene promoters. The dimeric compound and the three-side chain xanthone derivative have been shown to represent the best compounds emerging from the different series of ligands presented here, having also high selectivity for G-quadruplex structures with respect to duplex DNA. Molecular modeling simulations are in broad agreement with the experimental data.

  16. Yeast Sub1 and human PC4 are G-quadruplex binding proteins that suppress genome instability at co-transcriptionally formed G4 DNA.

    Science.gov (United States)

    Lopez, Christopher R; Singh, Shivani; Hambarde, Shashank; Griffin, Wezley C; Gao, Jun; Chib, Shubeena; Yu, Yang; Ira, Grzegorz; Raney, Kevin D; Kim, Nayun

    2017-06-02

    G-quadruplex or G4 DNA is a non-B secondary DNA structure consisting of a stacked array of guanine-quartets that can disrupt critical cellular functions such as replication and transcription. When sequences that can adopt Non-B structures including G4 DNA are located within actively transcribed genes, the reshaping of DNA topology necessary for transcription process stimulates secondary structure-formation thereby amplifying the potential for genome instability. Using a reporter assay designed to study G4-induced recombination in the context of an actively transcribed locus in Saccharomyces cerevisiae, we tested whether co-transcriptional activator Sub1, recently identified as a G4-binding factor, contributes to genome maintenance at G4-forming sequences. Our data indicate that, upon Sub1-disruption, genome instability linked to co-transcriptionally formed G4 DNA in Top1-deficient cells is significantly augmented and that its highly conserved DNA binding domain or the human homolog PC4 is sufficient to suppress G4-associated genome instability. We also show that Sub1 interacts specifically with co-transcriptionally formed G4 DNA in vivo and that yeast cells become highly sensitivity to G4-stabilizing chemical ligands by the loss of Sub1. Finally, we demonstrate the physical and genetic interaction of Sub1 with the G4-resolving helicase Pif1, suggesting a possible mechanism by which Sub1 suppresses instability at G4 DNA. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.

  17. A light-up probe targeting for Bcl-2 2345 G-quadruplex DNA with carbazole TO

    Science.gov (United States)

    Gu, Yingchun; Lin, Dayong; Tang, Yalin; Fei, Xuening; Wang, Cuihong; Zhang, Baolian; Zhou, Jianguo

    2018-02-01

    As its significant role, the selective recognition of G-quadruplex with specific structures and functions is important in biological and medicinal chemistry. Carbazole derivatives have been reported as a kind of fluorescent probe with many excellent optical properties. In the present study, the fluorescence of the dye (carbazole TO) increased almost 70 fold in the presence of bcl-2 2345 G4 compared to that alone in aqueous buffer condition with almost no fluorescence and 10-30 fold than those in the presence of other DNAs. The binding study results by activity inhibition of G4/Hemin peroxidase experiment, NMR titration and molecular docking simulation showed the high affinity and selectivity to bcl-2 2345 G4 arises from its end-stacking interaction with G-quartet. It is said that a facile approach with excellent sensitive, good selectivity and quick response for bcl-2 2345 G-quadruplex was developed and may be used for antitumor recognition or antitumor agents.

  18. c-MYC G-quadruplex binding by the RNA polymerase I inhibitor BMH-21 and analogues revealed by a combined NMR and biochemical Approach.

    Science.gov (United States)

    Musso, Loana; Mazzini, Stefania; Rossini, Anna; Castagnoli, Lorenzo; Scaglioni, Leonardo; Artali, Roberto; Di Nicola, Massimo; Zunino, Franco; Dallavalle, Sabrina

    2018-03-01

    Pyridoquinazolinecarboxamides have been reported as RNA polymerase I inhibitors and represent a novel class of potential antitumor agents. BMH-21, was reported to intercalate with GC-rich rDNA, resulting in nucleolar stress as a primary mechanism of cytotoxicity. The interaction of BMH-21 and analogues with DNA G-quadruplex structures was studied by NMR and molecular modelling. The cellular response was investigated in a panel of human tumor cell lines and protein expression was examined by Western Blot analysis. We explored the ability of BMH-21 and its analogue 2 to bind to G-quadruplex present in the c-MYC promoter, by NMR and molecular modelling studies. We provide evidence that both compounds are not typical DNA intercalators but are effective binders of the tested G-quadruplex. The interaction with c-MYC G-quadruplex was reflected in down-regulation of c-Myc expression in human tumor cells. The inhibitory effect was almost complete in lymphoma cells SUDHL4 characterized by overexpression of c-Myc protein. This downregulation reflected an early and persistent modulation of cMyc mRNA. Given the relevance of c-MYC in regulation of ribosome biogenesis, it is conceivable that the inhibition of c-MYC contributes to the perturbation of nuclear functions and RNA polymerase I activity. Similar experiments with CX-5461, another RNA polymerase I transcription inhibitor, indicate the same behaviour in G-quadruplex stabilization. Our results support the hypothesis that BMH-21 and analogue compounds share the same mechanism, i.e. G-quadruplex binding as a primary event of a cascade leading to inhibition of RNA polymerase I and apoptosis. Copyright © 2017 Elsevier B.V. All rights reserved.

  19. Efficient Long-Range Hole Transport Through G-Quadruplexes.

    Science.gov (United States)

    Wu, Jingyuan; Meng, Zhenyu; Lu, Yunpeng; Shao, Fangwei

    2017-10-09

    DNA offers a means of long-range charge transport for biology and electric nanodevices. Here, a series of tetra-stranded G-quadruplexes were assembled within a dendritic DNA architecture to explore oxidative charge transport (hole transport) through the G-quadruplex. Efficient charge transport was achieved over 28 Å upon UV irradiation. Over a longer G-quadruplex bridge, hole transport was escalated to a higher efficiency, which resulted in a higher yield than that of the optimal duplex DNA for charge transport, that is, the adenine tract. Efficient long-range hole transport suggests tetra-stranded G-quadruplexes, instead of an oxidation hotspot, hold better potential as an electron conduit than duplex DNA. © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

  20. Stwl modifies chromatin compaction and is required to maintain DNA integrity in the presence of perturbed DNA replication

    NARCIS (Netherlands)

    Yi, X.; Vries, de H.I.; Siudeja, K.; Rana, A.; Lemstra, W.; Brunsting, J.F.; Kok, R.J.M.; Smulders, Y.M.; Schaefer, M.; Dijk, F.; Shang, Y.F.; Eggen, B.J.L.; Kampinga, H.H.; Sibon, O.C.M.

    2009-01-01

    Hydroxyurea, a well-known DNA replication inhibitor, induces cell cycle arrest and intact checkpoint functions are required to survive DNA replication stress induced by this genotoxic agent. Perturbed DNA synthesis also results in elevated levels of DNA damage. It is unclear how organisms prevent

  1. Stwl Modifies Chromatin Compaction and Is Required to Maintain DNA Integrity in the Presence of Perturbed DNA Replication

    NARCIS (Netherlands)

    Yi, Xia; Vries, Hilda I. de; Siudeja, Katarzyna; Rana, Anil; Lemstra, Willy; Brunsting, Jeanette F.; Kok, Rob M.; Smulders, Yvo M.; Schaefer, Matthias; Dijk, Freark; Shang, Yongfeng; Eggen, Bart J.L.; Kampinga, Harm H.; Sibon, Ody C.M.

    Hydroxyurea, a well-known DNA replication inhibitor, induces cell cycle arrest and intact checkpoint functions are required to survive DNA replication stress induced by this genotoxic agent. Perturbed DNA synthesis also results in elevated levels of DNA damage. It is unclear how organisms prevent

  2. Molecular recognition of naphthalene diimide ligands by telomeric quadruplex-DNA: the importance of the protonation state and mediated hydrogen bonds.

    Science.gov (United States)

    Spinello, A; Barone, G; Grunenberg, J

    2016-01-28

    In depth Monte Carlo conformational scans in combination with molecular dynamics (MD) simulations and electronic structure calculations were applied in order to study the molecular recognition process between tetrasubstituted naphthalene diimide (ND) guests and G-quadruplex (G4) DNA receptors. ND guests are a promising class of telomere stabilizers due to which they are used in novel anticancer therapeutics. Though several ND guests have been studied experimentally in the past, the protonation state under physiological conditions is still unclear. Based on chemical intuition, in the case of N-methyl-piperazine substitution, different protonation states are possible and might play a crucial role in the molecular recognition process by G4-DNA. Depending on the proton concentration, different nitrogen atoms of the N-methyl-piperazine might (or might not) be protonated. This fact was considered in our simulation in terms of a case by case analysis, since the process of molecular recognition is determined by possible donor or acceptor positions. The results of our simulations show that the electrostatic interactions between the ND ligands and the G4 receptor are maximized in the case of the protonation of the terminal nitrogen atoms, forming compact ND G4 complexes inside the grooves. The influence of different protonation states in terms of the ability to form hydrogen bonds with the sugar-phosphate backbone, as well as the importance of mediated vs. direct hydrogen bonding, was analyzed in detail by MD and relaxed force constant (compliance constant) simulations.

  3. Derivation of Reliable Geometries in QM Calculations of DNA Structures: Explicit Solvent QM/MM and Restrained Implicit Solvent QM Optimizations of G-Quadruplexes.

    Science.gov (United States)

    Gkionis, Konstantinos; Kruse, Holger; Šponer, Jiří

    2016-04-12

    Modern dispersion-corrected DFT methods have made it possible to perform reliable QM studies on complete nucleic acid (NA) building blocks having hundreds of atoms. Such calculations, although still limited to investigations of potential energy surfaces, enhance the portfolio of computational methods applicable to NAs and offer considerably more accurate intrinsic descriptions of NAs than standard MM. However, in practice such calculations are hampered by the use of implicit solvent environments and truncation of the systems. Conventional QM optimizations are spoiled by spurious intramolecular interactions and severe structural deformations. Here we compare two approaches designed to suppress such artifacts: partially restrained continuum solvent QM and explicit solvent QM/MM optimizations. We report geometry relaxations of a set of diverse double-quartet guanine quadruplex (GQ) DNA stems. Both methods provide neat structures without major artifacts. However, each one also has distinct weaknesses. In restrained optimizations, all errors in the target geometries (i.e., low-resolution X-ray and NMR structures) are transferred to the optimized geometries. In QM/MM, the initial solvent configuration causes some heterogeneity in the geometries. Nevertheless, both approaches represent a decisive step forward compared to conventional optimizations. We refine earlier computations that revealed sizable differences in the relative energies of GQ stems computed with AMBER MM and QM. We also explore the dependence of the QM/MM results on the applied computational protocol.

  4. pH-Modulated Watson-Crick duplex-quadruplex equilibria of guanine-rich and cytosine-rich DNA sequences 140 base pairs upstream of the c-kit transcription initiation site.

    Science.gov (United States)

    Bucek, Pavel; Jaumot, Joaquim; Aviñó, Anna; Eritja, Ramon; Gargallo, Raimundo

    2009-11-23

    Guanine-rich regions of DNA are sequences capable of forming G-quadruplex structures. The formation of a G-quadruplex structure in a region 140 base pairs (bp) upstream of the c-kit transcription initiation site was recently proposed (Fernando et al., Biochemistry, 2006, 45, 7854). In the present study, the acid-base equilibria and the thermally induced unfolding of the structures formed by a guanine-rich region and by its complementary cytosine-rich strand in c-kit were studied by means of circular dichroism and molecular absorption spectroscopies. In addition, competition between the Watson-Crick duplex and the isolated structures was studied as a function of pH value and temperature. Multivariate data analysis methods based on both hard and soft modeling were used to allow accurate quantification of the various acid-base species present in the mixtures. Results showed that the G-quadruplex and i-motif coexist with the Watson-Crick duplex over the pH range from 3.0 to 6.5, approximately, under the experimental conditions tested in this study. At pH 7.0, the duplex is practically the only species present.

  5. A Dual-Specific Targeting Approach Based on the Simultaneous Recognition of Duplex and Quadruplex Motifs.

    Science.gov (United States)

    Nguyen, Thi Quynh Ngoc; Lim, Kah Wai; Phan, Anh Tuân

    2017-09-20

    Small-molecule ligands targeting nucleic acids have been explored as potential therapeutic agents. Duplex groove-binding ligands have been shown to recognize DNA in a sequence-specific manner. On the other hand, quadruplex-binding ligands exhibit high selectivity between quadruplex and duplex, but show limited discrimination between different quadruplex structures. Here we propose a dual-specific approach through the simultaneous application of duplex- and quadruplex-binders. We demonstrated that a quadruplex-specific ligand and a duplex-specific ligand can simultaneously interact at two separate binding sites of a quadruplex-duplex hybrid harbouring both quadruplex and duplex structural elements. Such a dual-specific targeting strategy would combine the sequence specificity of duplex-binders and the strong binding affinity of quadruplex-binders, potentially allowing the specific targeting of unique quadruplex structures. Future research can be directed towards the development of conjugated compounds targeting specific genomic quadruplex-duplex sites, for which the linker would be highly context-dependent in terms of length and flexibility, as well as the attachment points onto both ligands.

  6. G-quadruplex-based structural transitions in 15-mer DNA oligonucleotides varying in lengths of internal oligo(dG) stretches detected by voltammetric techniques

    Czech Academy of Sciences Publication Activity Database

    Vidláková, Pavlína; Pivoňková, Hana; Kejnovská, Iva; Trnková, L.; Vorlíčková, Michaela; Fojta, Miroslav; Havran, Luděk

    2015-01-01

    Roč. 407, č. 19 (2015), s. 5817-5826 ISSN 1618-2642 R&D Projects: GA ČR GAP206/12/2378 Institutional support: RVO:68081707 Keywords : Oligonucleotides * Electrochemical methods * G-quadruplex Subject RIV: BO - Biophysics Impact factor: 3.125, year: 2015

  7. A label-free ultrasensitive fluorescence detection of viable Salmonella enteritidis using enzyme-induced cascade two-stage toehold strand-displacement-driven assembly of G-quadruplex DNA.

    Science.gov (United States)

    Zhang, Peng; Liu, Hui; Ma, Suzhen; Men, Shuai; Li, Qingzhou; Yang, Xin; Wang, Hongning; Zhang, Anyun

    2016-06-15

    The harm of Salmonella enteritidis (S. enteritidis ) to public health mainly by contaminating fresh food and water emphasizes the urgent need for rapid detection techniques to help control the spread of the pathogen. In this assay, an newly designed capture probe complex that contained specific S. enteritidis-aptamer and hybridized signal target sequence was used for viable S. enteritidis recognition directly. In the presence of the target S. enteritidis, single-stranded target sequences were liberated and initiated the replication-cleavage reaction, producing numerous G-quadruplex structures with a linker on the 3'-end. And then, the sensing system took innovative advantage of quadratic linker-induced strand-displacement for the first time to release target sequence in succession, leading to the cyclic reuse of the target sequences and cascade signal amplification, thereby achieving the successive production of G-quadruplex structures. The fluorescent dye, N-Methyl mesoporphyrin IX, binded to these G-quadruplex structures and generated significantly enhanced fluorescent signals to achieve highly sensitive detection of S. enteritidis down to 60 CFU/mL with a linear range from 10(2) to 10(7)CFU/mL. By coupling the cascade two-stage target sequences-recyclable toehold strand-displacement with aptamer-based target recognition successfully, it is the first report on a novel non-label, modification-free and DNA extraction-free ultrasensitive fluorescence biosensor for detecting viable S. enteritidis directly, which can discriminate from dead S. enteritidis. Copyright © 2016 Elsevier B.V. All rights reserved.

  8. Guanine base stacking in G-quadruplex nucleic acids

    Science.gov (United States)

    Lech, Christopher Jacques; Heddi, Brahim; Phan, Anh Tuân

    2013-01-01

    G-quadruplexes constitute a class of nucleic acid structures defined by stacked guanine tetrads (or G-tetrads) with guanine bases from neighboring tetrads stacking with one another within the G-tetrad core. Individual G-quadruplexes can also stack with one another at their G-tetrad interface leading to higher-order structures as observed in telomeric repeat-containing DNA and RNA. In this study, we investigate how guanine base stacking influences the stability of G-quadruplexes and their stacked higher-order structures. A structural survey of the Protein Data Bank is conducted to characterize experimentally observed guanine base stacking geometries within the core of G-quadruplexes and at the interface between stacked G-quadruplex structures. We couple this survey with a systematic computational examination of stacked G-tetrad energy landscapes using quantum mechanical computations. Energy calculations of stacked G-tetrads reveal large energy differences of up to 12 kcal/mol between experimentally observed geometries at the interface of stacked G-quadruplexes. Energy landscapes are also computed using an AMBER molecular mechanics description of stacking energy and are shown to agree quite well with quantum mechanical calculated landscapes. Molecular dynamics simulations provide a structural explanation for the experimentally observed preference of parallel G-quadruplexes to stack in a 5′–5′ manner based on different accessible tetrad stacking modes at the stacking interfaces of 5′–5′ and 3′–3′ stacked G-quadruplexes. PMID:23268444

  9. Superhelicity Constrains a Localized and R-Loop-Dependent Formation of G-Quadruplexes at the Upstream Region of Transcription.

    Science.gov (United States)

    Zheng, Ke-Wei; He, Yi-de; Liu, Hong-He; Li, Xin-Min; Hao, Yu-Hua; Tan, Zheng

    2017-10-20

    Transcription induces formation of intramolecular G-quadruplex structures at the upstream region of a DNA duplex by an upward transmission of negative supercoiling through the DNA. Currently the regulation of such G-quadruplex formation remains unclear. Using plasmid as a model, we demonstrate that while it is the dynamic negative supercoiling generated by a moving RNA polymerase that triggers a formation of a G-quadruplex, the constitutional superhelicity determines the potential and range of the formation of a G-quadruplex by constraining the propagation of the negative supercoiling. G-quadruplex formation is maximal in negatively supercoiled and nearly abolished in relaxed plasmids while being moderate in nicked and linear ones. The formation of a G-quadruplex strongly correlates with the presence of an R-loop. Preventing R-loop formation virtually abolished G-quadruplex formation even in the negatively supercoiled plasmid. Enzymatic action and protein binding that manipulate supercoiling or its propagation all impact the formation of G-quadruplexes. Because chromosomes and plasmids in cells in their natural form are maintained in a supercoiled state, our findings reveal a physical basis that justifies the formation and regulation of G-quadruplexes in vivo. The structural features involved in G-quadruplex formation may all serve as potential targets in clinical and therapeutic applications.

  10. Local stability perturbation in DNA structure induced by chain discontinuities

    International Nuclear Information System (INIS)

    Jorcano, J.L.; Mingot, F.; Davila, C.A.

    1976-01-01

    The thermal dependence of parameter ''h'' (number of base pairs broken near to internucleotide breaks) is studied. At 25degC, 0,2 M Na + and pH 7, the ''h'' value is about 12. Far from DNA melting temperature, ''h'' is not dependent upon ionic strength and it depends very little on temperature. This behavior suggests a non cooperative, entropically driven chain unzipping from terminals. Near melting temperature, ''h'' shows a thermal dependence asymptotic to Tm, and correlated with DNA composition. It seems to correspond to the cooperative denaturation. ''h'' values have been calculated from double and single break probabilities evaluated from hydrodynamically determined molecular weight distributions. (author)

  11. Thermodynamic fingerprints of ligand binding to human telomeric G-quadruplexes

    OpenAIRE

    Bon?ina, Matja?; Podlipnik, ?rtomir; Piantanida, Ivo; Eilmes, Julita; Teulade-Fichou, Marie-Paule; Vesnaver, Gorazd; Lah, Jurij

    2015-01-01

    Thermodynamic studies of ligand binding to human telomere (ht) DNA quadruplexes, as a rule, neglect the involvement of various ht-DNA conformations in the binding process. Therefore, the thermodynamic driving forces and the mechanisms of ht-DNA G-quadruplex-ligand recognition remain poorly understood. In this work we characterize thermodynamically and structurally binding of netropsin (Net), dibenzotetraaza[14]annulene derivatives (DP77, DP78), cationic porphyrin (TMPyP4) and two bisquinolini...

  12. Ion Binding to Quadruplex DNA Stems. Comparison of MM and QM Descriptions Reveals Sizable Polarization Effects Not Included in Contemporary Simulations

    Czech Academy of Sciences Publication Activity Database

    Gkionis, K.; Kruse, H.; Platts, J. A.; Mládek, Arnošt; Koča, J.; Šponer, Jiří

    2014-01-01

    Roč. 10, č. 3 (2014), s. 1326-1340 ISSN 1549-9618 R&D Projects: GA ČR(CZ) GAP208/11/1822; GA MŠk(CZ) ED1.1.00/02.0068 Institutional support: RVO:68081707 Keywords : MOLECULAR-DYNAMICS SIMULATIONS * GAUSSIAN-BASIS SETS * TETRAMOLECULAR G-QUADRUPLEXES Subject RIV: BO - Biophysics Impact factor: 5.498, year: 2014

  13. A new cationic porphyrin derivative (TMPipEOPP with large side arm substituents: a highly selective G-quadruplex optical probe.

    Directory of Open Access Journals (Sweden)

    Li-Na Zhu

    Full Text Available The discovery of uncommon DNA structures and speculation about their potential functions in genes has brought attention to specific DNA structure recognition. G-quadruplexes are four-stranded nucleic acid structures formed by G-rich DNA (or RNA sequences. G-rich sequences with a high potential to form G-quadruplexes have been found in many important genomic regions. Porphyrin derivatives with cationic side arm substituents are important G-quadruplex-binding ligands. For example, 5,10,15,20-Tetrakis(N-methylpyridinium-4-yl-21H,23H-porphyrin (TMPyP4, interacts strongly with G-quadruplexes, but has poor selectivity for G-quadruplex versus duplex DNA. To increase the G-quadruplex recognition specificity, a new cationic porphyrin derivative, 5,10,15,20-tetra-{4-[2-(1-methyl-1-piperidinylethoxy]phenyl} porphyrin (TMPipEOPP, with large side arm substituents was synthesized, and the interactions between TMPipEOPP and different DNA structures were compared. The results show that G-quadruplexes cause large changes in the UV-Vis absorption and fluorescence spectra of TMPipEOPP, but duplex and single-stranded DNAs do not, indicating that TMPipEOPP can be developed as a highly specific optical probe for discriminating G-quadruplex from duplex and single-stranded DNA. Visual discrimination is also possible. Job plot and Scatchard analysis suggest that a complicated binding interaction occurs between TMPipEOPP and G-quadruplexes. At a low [G-quadruplex]/[TMPipEOPP] ratio, one G-quadruplex binds two TMPipEOPP molecules by end-stacking and outside binding modes. At a high [G-quadruplex]/[TMPipEOPP] ratio, two G-quadruplexes bind to one TMPipEOPP molecule in a sandwich-like end-stacking mode.

  14. A new cationic porphyrin derivative (TMPipEOPP) with large side arm substituents: a highly selective G-quadruplex optical probe.

    Science.gov (United States)

    Zhu, Li-Na; Zhao, Shu-Juan; Wu, Bin; Li, Xiao-Zeng; Kong, De-Ming

    2012-01-01

    The discovery of uncommon DNA structures and speculation about their potential functions in genes has brought attention to specific DNA structure recognition. G-quadruplexes are four-stranded nucleic acid structures formed by G-rich DNA (or RNA) sequences. G-rich sequences with a high potential to form G-quadruplexes have been found in many important genomic regions. Porphyrin derivatives with cationic side arm substituents are important G-quadruplex-binding ligands. For example, 5,10,15,20-Tetrakis(N-methylpyridinium-4-yl)-21H,23H-porphyrin (TMPyP4), interacts strongly with G-quadruplexes, but has poor selectivity for G-quadruplex versus duplex DNA. To increase the G-quadruplex recognition specificity, a new cationic porphyrin derivative, 5,10,15,20-tetra-{4-[2-(1-methyl-1-piperidinyl)ethoxy]phenyl} porphyrin (TMPipEOPP), with large side arm substituents was synthesized, and the interactions between TMPipEOPP and different DNA structures were compared. The results show that G-quadruplexes cause large changes in the UV-Vis absorption and fluorescence spectra of TMPipEOPP, but duplex and single-stranded DNAs do not, indicating that TMPipEOPP can be developed as a highly specific optical probe for discriminating G-quadruplex from duplex and single-stranded DNA. Visual discrimination is also possible. Job plot and Scatchard analysis suggest that a complicated binding interaction occurs between TMPipEOPP and G-quadruplexes. At a low [G-quadruplex]/[TMPipEOPP] ratio, one G-quadruplex binds two TMPipEOPP molecules by end-stacking and outside binding modes. At a high [G-quadruplex]/[TMPipEOPP] ratio, two G-quadruplexes bind to one TMPipEOPP molecule in a sandwich-like end-stacking mode.

  15. Effect of Urea on G-Quadruplex Stability.

    Science.gov (United States)

    Aslanyan, Lusine; Ko, Jordan; Kim, Byul G; Vardanyan, Ishkhan; Dalyan, Yeva B; Chalikian, Tigran V

    2017-07-13

    G-quadruplexes represent a class of noncanonical nucleic acid structures implicated in transcriptional regulation, cellular function, and disease. An understanding of the forces involved in stabilization and destabilization of the G-quadruplex conformation relative to the duplex or single-stranded conformation is a key to elucidating the biological role of G-quadruplex-based genomic switches and the quest for therapeutic means for controlled induction or suppression of a G-quadruplex at selected genomic loci. Solute-solvent interactions provide a ubiquitous and, in many cases, the determining thermodynamic force in maintaining and modulating the stability of nucleic acids. These interactions involve water as well as water-soluble cosolvents that may be present in the solution or in the crowded environment in the cell. We present here the first quantitative investigation of the effect of urea, a destabilizing cosolvent, on the conformational preferences of a G-quadruplex formed by the telomeric d[A(G 3 T 2 A) 3 G 3 ] sequence (Tel22). At 20 mM NaCl and room temperature, Tel22 undergoes a two-state urea-induced unfolding transition. An increase in salt mitigates the deleterious effect of urea on Tel22. The urea m-value of Tel22 normalized per change in solvent-accessible surface area, ΔS A , is similar to those for other DNA and RNA structures while being several-fold larger than that of proteins. Our results suggest that urea can be employed as an analytical tool in thermodynamic characterizations of G-quadruplexes in a manner similar to the use of urea in protein studies. We emphasize the need for further studies involving a larger selection of G-quadruplexes varying in sequence, topology (parallel, antiparallel, hybrid), and molecularity (monomolecular, bimolecular, tetramolecular) to outline the advantages and the limits of the use of urea in G-quadruplex studies. A deeper understanding of the effect of solvent and cosolvents on the differential stability of the

  16. Experimental approaches to identify cellular G-quadruplex structures and functions.

    Science.gov (United States)

    Di Antonio, Marco; Rodriguez, Raphaël; Balasubramanian, Shankar

    2012-05-01

    Guanine-rich nucleic acids can fold into non-canonical DNA secondary structures called G-quadruplexes. The formation of these structures can interfere with the biology that is crucial to sustain cellular homeostases and metabolism via mechanisms that include transcription, translation, splicing, telomere maintenance and DNA recombination. Thus, due to their implication in several biological processes and possible role promoting genomic instability, G-quadruplex forming sequences have emerged as potential therapeutic targets. There has been a growing interest in the development of synthetic molecules and biomolecules for sensing G-quadruplex structures in cellular DNA. In this review, we summarise and discuss recent methods developed for cellular imaging of G-quadruplexes, and the application of experimental genomic approaches to detect G-quadruplexes throughout genomic DNA. In particular, we will discuss the use of engineered small molecules and natural proteins to enable pull-down, ChIP-Seq, ChIP-chip and fluorescence imaging of G-quadruplex structures in cellular DNA. Copyright © 2012 Elsevier Inc. All rights reserved.

  17. A Molecular Toolbox to Engineer Site-Specific DNA Replication Perturbation.

    Science.gov (United States)

    Larsen, Nicolai B; Hickson, Ian D; Mankouri, Hocine W

    2018-01-01

    Site-specific arrest of DNA replication is a useful tool for analyzing cellular responses to DNA replication perturbation. The E. coli Tus-Ter replication barrier can be reconstituted in eukaryotic cells as a system to engineer an unscheduled collision between a replication fork and an "alien" impediment to DNA replication. To further develop this system as a versatile tool, we describe a set of reagents and a detailed protocol that can be used to engineer Tus-Ter barriers into any locus in the budding yeast genome. Because the Tus-Ter complex is a bipartite system with intrinsic DNA replication-blocking activity, the reagents and protocols developed and validated in yeast could also be optimized to engineer site-specific replication fork barriers into other eukaryotic cell types.

  18. Tus-Ter as a tool to study site-specific DNA replication perturbation in eukaryotes

    DEFF Research Database (Denmark)

    Larsen, Nicolai B; Hickson, Ian D; Mankouri, Hocine W

    2014-01-01

    The high-affinity binding of the Tus protein to specific 21-bp sequences, called Ter, causes site-specific, and polar, DNA replication fork arrest in E coli. The Tus-Ter complex serves to coordinate DNA replication with chromosome segregation in this organism. A number of recent and ongoing studies...... have demonstrated that Tus-Ter can be used as a heterologous tool to generate site-specific perturbation of DNA replication when reconstituted in eukaryotes. Here, we review these recent findings and explore the molecular mechanism by which Tus-Ter mediates replication fork (RF) arrest in the budding...... yeast, S. cerevisiae. We propose that Tus-Ter is a versatile, genetically tractable, and regulatable RF blocking system that can be utilized for disrupting DNA replication in a diverse range of host cells....

  19. Tus-Ter as a tool to study site-specific DNA replication perturbation in eukaryotes.

    Science.gov (United States)

    Larsen, Nicolai B; Hickson, Ian D; Mankouri, Hocine W

    2014-01-01

    The high-affinity binding of the Tus protein to specific 21-bp sequences, called Ter, causes site-specific, and polar, DNA replication fork arrest in E coli. The Tus-Ter complex serves to coordinate DNA replication with chromosome segregation in this organism. A number of recent and ongoing studies have demonstrated that Tus-Ter can be used as a heterologous tool to generate site-specific perturbation of DNA replication when reconstituted in eukaryotes. Here, we review these recent findings and explore the molecular mechanism by which Tus-Ter mediates replication fork (RF) arrest in the budding yeast, S. cerevisiae. We propose that Tus-Ter is a versatile, genetically tractable, and regulatable RF blocking system that can be utilized for disrupting DNA replication in a diverse range of host cells.

  20. A Molecular Toolbox to Engineer Site-Specific DNA Replication Perturbation

    DEFF Research Database (Denmark)

    Larsen, Nicolai B; Hickson, Ian D; Mankouri, Hocine W

    2018-01-01

    " impediment to DNA replication. To further develop this system as a versatile tool, we describe a set of reagents and a detailed protocol that can be used to engineer Tus-Ter barriers into any locus in the budding yeast genome. Because the Tus-Ter complex is a bipartite system with intrinsic DNA replication......Site-specific arrest of DNA replication is a useful tool for analyzing cellular responses to DNA replication perturbation. The E. coli Tus-Ter replication barrier can be reconstituted in eukaryotic cells as a system to engineer an unscheduled collision between a replication fork and an "alien......-blocking activity, the reagents and protocols developed and validated in yeast could also be optimized to engineer site-specific replication fork barriers into other eukaryotic cell types....

  1. Detection of perturbation phases and developmental stages in organisms from DNA microarray time series data.

    Directory of Open Access Journals (Sweden)

    Marianne Rooman

    Full Text Available Available DNA microarray time series that record gene expression along the developmental stages of multicellular eukaryotes, or in unicellular organisms subject to external perturbations such as stress and diauxie, are analyzed. By pairwise comparison of the gene expression profiles on the basis of a translation-invariant and scale-invariant distance measure corresponding to least-rectangle regression, it is shown that peaks in the average distance values are noticeable and are localized around specific time points. These points systematically coincide with the transition points between developmental phases or just follow the external perturbations. This approach can thus be used to identify automatically, from microarray time series alone, the presence of external perturbations or the succession of developmental stages in arbitrary cell systems. Moreover, our results show that there is a striking similarity between the gene expression responses to these a priori very different phenomena. In contrast, the cell cycle does not involve a perturbation-like phase, but rather continuous gene expression remodeling. Similar analyses were conducted using three other standard distance measures, showing that the one we introduced was superior. Based on these findings, we set up an adapted clustering method that uses this distance measure and classifies the genes on the basis of their expression profiles within each developmental stage or between perturbation phases.

  2. The Escherichia coli Tus-Ter replication fork barrier causes site-specific DNA replication perturbation in yeast

    DEFF Research Database (Denmark)

    Larsen, Nicolai B; Sass, Ehud; Suski, Catherine

    2014-01-01

    Replication fork (RF) pausing occurs at both 'programmed' sites and non-physiological barriers (for example, DNA adducts). Programmed RF pausing is required for site-specific DNA replication termination in Escherichia coli, and this process requires the binding of the polar terminator protein, Tus...... as a versatile, site-specific, heterologous DNA replication-perturbing system, with a variety of potential applications....

  3. Heterocyclic Dications as a New Class of Telomeric G-Quadruplex Targeting Agents

    Science.gov (United States)

    Nanjunda, Rupesh; Musetti, Caterina; Kumar, Arvind; Ismail, Mohamed A.; Farahat, Abdelbasset A.; Wang, Siming; Sissi, Claudia; Palumbo, Manlio; Boykin, David W.; Wilson, W. David

    2013-01-01

    Small molecules that can induce and stabilize G-quadruplex DNA structures represent a novel approach for anti-cancer and anti-parasitic therapy and extensive efforts have been directed towards discovering lead compounds that are capable of stabilizing quadruplexes. The purpose of this study is to explore conformational modifications in a series of heterocyclic dications to discover structural motifs that can selectively bind and stabilize specific G-quadruplexes, such as those present in the human telomere. The G-quadruplex has various potential recognition sites for small molecules; however, the primary interaction site of most of these ligands is the terminal tetrads. Similar to duplex-DNA groove recognition, quadruplex groove recognition by small molecules offers the potential for enhanced selectivity that can be developed into a viable therapeutic strategy. The compounds investigated were selected based on preliminary studies with DB832, a bifuryl-phenyl diamidine with a unique telomere interaction. This compound provides a paradigm that can help in understanding the optimum compound-DNA interactions that lead to quadruplex groove recognition. DNA recognition by the DB832 derivatives was investigated by biophysical experiments such as thermal melting, circular dichroism, mass spectrometry and NMR. Biological studies were also performed to complement the biophysical data. The results suggest a complex binding mechanism which involves the recognition of grooves for some ligands as well as stacking at the terminal tetrads of the human telomeric G-quadruplex for most of the ligands. These molecules represent an excellent starting point for further SAR analysis for diverse modes of quadruplex recognition and subsequent structure optimization for drug development. PMID:22380518

  4. A twice-as-smart synthetic G-quartet: PyroTASQ is both a smart quadruplex ligand and a smart fluorescent probe.

    Science.gov (United States)

    Laguerre, Aurélien; Stefan, Loic; Larrouy, Manuel; Genest, David; Novotna, Jana; Pirrotta, Marc; Monchaud, David

    2014-09-03

    Recent and unambiguous evidences of the formation of DNA and RNA G-quadruplexes in cells has provided solid support for these structures to be considered as valuable targets in oncology. Beyond this, they have lent further credence to the anticancer strategies relying on small molecules that selectively target these higher-order DNA/RNA architectures, referred to as G-quadruplex ligands. They have also shed bright light on the necessity of designing multitasking ligands, displaying not only enticing quadruplex interacting properties (affinity, structural selectivity) but also additional features that make them usable for detecting quadruplexes in living cells, notably for determining whether, when, and where these structures fold and unfold during the cell cycle and also for better assessing the consequences of their stabilization by external agents. Herein, we report a brand new design of such multitasking ligands, whose structure experiences a quadruplex-promoted conformational switch that triggers not only its quadruplex affinity (i.e., smart ligands, which display high affinity and selectivity for DNA/RNA quadruplexes) but also its fluorescence (i.e., smart probes, which behave as selective light-up fluorescent reporters on the basis of a fluorogenic electron redistribution). The first prototype of such multifunctional ligands, termed PyroTASQ, represents a brand new generation of quadruplex ligands that can be referred to as "twice-as-smart" quadruplex ligands.

  5. Integration of G-quadruplex and DNA-templated Ag NCs for nonarithmetic information processing† †Electronic supplementary information (ESI) available. See DOI: 10.1039/c7sc00361g Click here for additional data file.

    Science.gov (United States)

    Gao, Ru-Ru; Lv, Xiao-Yan; Zhu, Yan-Yan; Zhang, Yi-Wei

    2017-01-01

    To create sophisticated molecular logic circuits from scratch, you may not believe how common the building blocks can be and how diverse and powerful such circuits can be when scaled up. Using the two simple building blocks of G-quadruplex and silver nanoclusters (Ag NCs), we experimentally construct a series of multifunctional, label-free, and multi-output logic circuits to perform nonarithmetic functions: a 1-to-2 decoder, a 4-to-2 encoder, an 8-to-3 encoder, dual transfer gates, a 2 : 1 multiplexer, and a 1 : 2 demultiplexer. Moreover, a parity checker which is capable of identifying odd and even numbers from natural numbers is constructed conceptually. Finally, a multi-valued logic gate (ternary inhibit gate) is readily achieved by taking this DNA/Ag NC system as a universal platform. All of the above logic circuits share the same building blocks, indicating the great prospects of the assembly of nanomaterials and DNA for biochemical logic devices. Considering its biocompatibility, the novel prototypes developed here may have potential applications in the fields of biological computers and medical diagnosis and serve as a promising proof of principle in the not-too-distant future. PMID:28626564

  6. G-quadruplex induced chirality of methylazacalix[6]pyridine via unprecedented binding stoichiometry: en route to multiplex controlled molecular switch

    Science.gov (United States)

    Guan, Ai-Jiao; Shen, Meng-Jie; Xiang, Jun-Feng; Zhang, En-Xuan; Li, Qian; Sun, Hong-Xia; Wang, Li-Xia; Xu, Guang-Zhi; Tang, Ya-Lin; Xu, Li-Jin; Gong, Han-Yuan

    2015-05-01

    Nucleic acid based molecular device is a developing research field which attracts great interests in material for building machinelike nanodevices. G-quadruplex, as a new type of DNA secondary structures, can be harnessed to construct molecular device owing to its rich structural polymorphism. Herein, we developed a switching system based on G-quadruplexes and methylazacalix[6]pyridine (MACP6). The induced circular dichroism (CD) signal of MACP6 was used to monitor the switch controlled by temperature or pH value. Furthermore, the CD titration, Job-plot, variable temperature CD and 1H-NMR experiments not only confirmed the binding mode between MACP6 and G-quadruplex, but also explained the difference switching effect of MACP6 and various G-quadruplexes. The established strategy has the potential to be used as the chiral probe for specific G-quadruplex recognition.

  7. Selection of G-quadruplex folding topology with LNA-modified human telomeric sequences in K+ solution

    DEFF Research Database (Denmark)

    Pradhan, Devranjan; Hansen, Lykke H; Vester, Birte

    2011-01-01

    G-rich nucleic acid oligomers can form G-quadruplexes built by G-tetrads stacked upon each other. Depending on the nucleotide sequence, G-quadruplexes fold mainly with two topologies: parallel, in which all G-tracts are oriented parallel to each other, or antiparallel, in which one or more G......-tracts are oriented antiparallel to the other G-tracts. In the former topology, all glycosidic bond angles conform to anti conformations, while in the latter topology they adopt both syn and anti conformations. It is of interest to understand the molecular forces that govern G-quadruplex folding. Here, we approach...... this problem by examining the impact of LNA (locked nucleic acid) modifications on the folding topology of the dimeric model system of the human telomere sequence. In solution, this DNA G-quadruplex forms a mixture of G-quadruplexes with antiparallel and parallel topologies. Using CD and NMR spectroscopies, we...

  8. G-Quadruplex conformational change driven by pH variation with potential application as a nanoswitch.

    Science.gov (United States)

    Yan, Yi-Yong; Tan, Jia-Heng; Lu, Yu-Jing; Yan, Siu-Cheong; Wong, Kwok-Yin; Li, Ding; Gu, Lian-Quan; Huang, Zhi-Shu

    2013-10-01

    G-Quadruplex is a highly polymorphic structure, and its behavior in acidic condition has not been well studied. Circular dichroism (CD) spectra were used to study the conformational change of G-quadruplex. The thermal stabilities of the G-quadruplex were measured with CD melting. Interconversion kinetics profiles were investigated by using CD kinetics. The fluorescence of the inserted 2-Aminopurine (Ap) was monitored during pH change and acrylamide quenching, indicating the status of the loop. Proton NMR was adopted to help illustrate the change of the conformation. G-Quadruplex of specific loop was found to be able to transform upon pH variation. The transformation was resulted from the loop rearrangement. After screening of a library of diverse G-quadruplex, a sequence exhibiting the best transformation property was found. A pH-driven nanoswitch with three gears was obtained based on this transition cycle. Certain G-quadruplex was found to go through conformational change at low pH. Loop was the decisive factor controlling the interconversion upon pH variation. G-Quadruplex with TT central loop could be converted in a much milder condition than the one with TTA loop. It can be used to design pH-driven nanodevices such as a nanoswitch. These results provide more insights into G-quadruplex polymorphism, and also contribute to the design of DNA-based nanomachines and logic gates. © 2013.

  9. Mutant p53 perturbs DNA replication checkpoint control through TopBP1 and Treslin.

    Science.gov (United States)

    Liu, Kang; Lin, Fang-Tsyr; Graves, Joshua D; Lee, Yu-Ju; Lin, Weei-Chin

    2017-05-09

    Accumulating evidence supports the gain-of-function of mutant forms of p53 (mutp53s). However, whether mutp53 directly perturbs the DNA replication checkpoint remains unclear. Previously, we have demonstrated that TopBP1 forms a complex with mutp53s and mediates their gain-of-function through NF-Y and p63/p73. Akt phosphorylates TopBP1 and induces its oligomerization, which inhibits its ATR-activating function. Here we show that various contact and conformational mutp53s bypass Akt to induce TopBP1 oligomerization and attenuate ATR checkpoint response during replication stress. The effect on ATR response caused by mutp53 can be exploited in a synthetic lethality strategy, as depletion of another ATR activator, DNA2, in mutp53-R273H-expressing cancer cells renders cells hypersensitive to cisplatin. Expression of mutp53-R273H also makes cancer cells more sensitive to DNA2 depletion or DNA2 inhibitors. In addition to ATR-activating function during replication stress, TopBP1 interacts with Treslin in a Cdk-dependent manner to initiate DNA replication during normal growth. We find that mutp53 also interferes with TopBP1 replication function. Several contact, but not conformational, mutp53s enhance the interaction between TopBP1 and Treslin and promote DNA replication despite the presence of a Cdk2 inhibitor. Together, these data uncover two distinct mechanisms by which mutp53 enhances DNA replication: ( i ) Both contact and conformational mutp53s can bind TopBP1 and attenuate the checkpoint response to replication stress, and ( ii ) during normal growth, contact (but not conformational) mutp53s can override the Cdk2 requirement to promote replication by facilitating the TopBP1/Treslin interaction.

  10. G-quadruplexes as novel cis-elements controlling transcription during embryonic development.

    Science.gov (United States)

    David, Aldana P; Margarit, Ezequiel; Domizi, Pablo; Banchio, Claudia; Armas, Pablo; Calcaterra, Nora B

    2016-05-19

    G-quadruplexes are dynamic structures folded in G-rich single-stranded DNA regions. These structures have been recognized as a potential nucleic acid based mechanism for regulating multiple cellular processes such as replication, transcription and genomic maintenance. So far, their transcriptional role in vivo during vertebrate embryonic development has not yet been addressed. Here, we performed an in silico search to find conserved putative G-quadruplex sequences (PQSs) within proximal promoter regions of human, mouse and zebrafish developmental genes. Among the PQSs able to fold in vitro as G-quadruplex, those present in nog3, col2a1 and fzd5 promoters were selected for further studies. In cellulo studies revealed that the selected G-quadruplexes affected the transcription of luciferase controlled by the SV40 nonrelated promoter. G-quadruplex disruption in vivo by microinjection in zebrafish embryos of either small ligands or DNA oligonucleotides complementary to the selected PQSs resulted in lower transcription of the targeted genes. Moreover, zebrafish embryos and larvae phenotypes caused by the presence of complementary oligonucleotides fully resembled those ones reported for nog3, col2a1 and fzd5 morphants. To our knowledge, this is the first work revealing in vivo the role of conserved G-quadruplexes in the embryonic development, one of the most regulated processes of the vertebrates biology. © The Author(s) 2016. Published by Oxford University Press on behalf of Nucleic Acids Research.

  11. Bis-guanylhydrazone diimidazo[1,2-a:1,2-c]pyrimidine as a novel and specific G-quadruplex binding motif.

    Science.gov (United States)

    Sparapani, Silvia; Bellini, Stefania; Gunaratnam, Mekala; Haider, Shozeb M; Andreani, Aldo; Rambaldi, Mirella; Locatelli, Alessandra; Morigi, Rita; Granaiola, Massimiliano; Varoli, Lucilla; Burnelli, Silvia; Leoni, Alberto; Neidle, Stephen

    2010-08-21

    A bis-guanylhydrazone derivative of diimidazo[1,2-a:1,2-c]pyrimidine has unexpectedly been found to be a potent stabiliser of several quadruplex DNAs, whereas there is no significant interaction with duplex DNA. Molecular modeling suggests that the guanylhydrazone groups play an active role in quadruplex binding.

  12. Structural Insights into the Quadruplex-Duplex 3' Interface Formed from a Telomeric Repeat: A Potential Molecular Target.

    Science.gov (United States)

    Russo Krauss, Irene; Ramaswamy, Sneha; Neidle, Stephen; Haider, Shozeb; Parkinson, Gary N

    2016-02-03

    We report here on an X-ray crystallographic and molecular modeling investigation into the complex 3' interface formed between putative parallel stranded G-quadruplexes and a duplex DNA sequence constructed from the human telomeric repeat sequence TTAGGG. Our crystallographic approach provides a detailed snapshot of a telomeric 3' quadruplex-duplex junction: a junction that appears to have the potential to form a unique molecular target for small molecule binding and interference with telomere-related functions. This unique target is particularly relevant as current high-affinity compounds that bind putative G-quadruplex forming sequences only rarely have a high degree of selectivity for a particular quadruplex. Here DNA junctions were assembled using different putative quadruplex-forming scaffolds linked at the 3' end to a telomeric duplex sequence and annealed to a complementary strand. We successfully generated a series of G-quadruplex-duplex containing crystals, both alone and in the presence of ligands. The structures demonstrate the formation of a parallel folded G-quadruplex and a B-form duplex DNA stacked coaxially. Most strikingly, structural data reveals the consistent formation of a TAT triad platform between the two motifs. This triad allows for a continuous stack of bases to link the quadruplex motif with the duplex region. For these crystal structures formed in the absence of ligands, the TAT triad interface occludes ligand binding at the 3' quadruplex-duplex interface, in agreement with in silico docking predictions. However, with the rearrangement of a single nucleotide, a stable pocket can be produced, thus providing an opportunity for the binding of selective molecules at the interface.

  13. Fluorescent Dansyl-Guanosine Conjugates that Bind c-MYC Promoter G-Quadruplex and Downregulate c-MYC Expression.

    Science.gov (United States)

    Pavan Kumar, Y; Saha, Puja; Saha, Dhurjhoti; Bessi, Irene; Schwalbe, Harald; Chowdhury, Shantanu; Dash, Jyotirmayee

    2016-03-02

    The four-stranded G-quadruplex present in the c-MYC P1 promoter has been shown to play a pivotal role in the regulation of c-MYC transcription. Small-molecule compounds capable of inhibiting the c-MYC promoter activity by stabilising the c-MYC G-quadruplex could potentially be used as anticancer agents. In this context, here we report the synthesis of dansyl-guanosine conjugates through one-pot modular click reactions. The dansyl-guanosine conjugates can selectively detect c-MYC G-quadruplex over other biologically relevant quadruplexes and duplex DNA and can be useful as staining reagents for selective visualisation of c-MYC G-quadruplex over duplex DNA by gel electrophoresis. NMR spectroscopic titrations revealed the preferential binding sites of these dansyl ligands to the c-MYC G-quadruplex. A dual luciferase assay and qRT-PCR revealed that a dansyl-bisguanosine ligand represses the c-MYC expression, possibly by stabilising the c-MYC G-quadruplex. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  14. GNG Motifs Can Replace a GGG Stretch during G-Quadruplex Formation in a Context Dependent Manner.

    Directory of Open Access Journals (Sweden)

    Kohal Das

    Full Text Available G-quadruplexes are one of the most commonly studied non-B DNA structures. Generally, these structures are formed using a minimum of 4, three guanine tracts, with connecting loops ranging from one to seven. Recent studies have reported deviation from this general convention. One such deviation is the involvement of bulges in the guanine tracts. In this study, guanines along with bulges, also referred to as GNG motifs have been extensively studied using recently reported HOX11 breakpoint fragile region I as a model template. By strategic mutagenesis approach we show that the contribution from continuous G-tracts may be dispensible during G-quadruplex formation when such motifs are flanked by GNGs. Importantly, the positioning and number of GNG/GNGNG can also influence the formation of G-quadruplexes. Further, we assessed three genomic regions from HIF1 alpha, VEGF and SHOX gene for G-quadruplex formation using GNG motifs. We show that HIF1 alpha sequence harbouring GNG motifs can fold into intramolecular G-quadruplex. In contrast, GNG motifs in mutant VEGF sequence could not participate in structure formation, suggesting that the usage of GNG is context dependent. Importantly, we show that when two continuous stretches of guanines are flanked by two independent GNG motifs in a naturally occurring sequence (SHOX, it can fold into an intramolecular G-quadruplex. Finally, we show the specific binding of G-quadruplex binding protein, Nucleolin and G-quadruplex antibody, BG4 to SHOX G-quadruplex. Overall, our study provides novel insights into the role of GNG motifs in G-quadruplex structure formation which may have both physiological and pathological implications.

  15. Interaction of Pyrrolobenzodiazepine (PBD) Ligands with Parallel Intermolecular G-Quadruplex Complex Using Spectroscopy and ESI-MS

    Science.gov (United States)

    Raju, Gajjela; Srinivas, Ragampeta; Santhosh Reddy, Vangala; Idris, Mohammed M.; Kamal, Ahmed; Nagesh, Narayana

    2012-01-01

    Studies on ligand interaction with quadruplex DNA, and their role in stabilizing the complex at concentration prevailing under physiological condition, has attained high interest. Electrospray ionization mass spectrometry (ESI-MS) and spectroscopic studies in solution were used to evaluate the interaction of PBD and TMPyP4 ligands, stoichiometry and selectivity to G-quadruplex DNA. Two synthetic ligands from PBD family, namely pyrene-linked pyrrolo[2,1-c][1,4]benzodiazepine hybrid (PBD1), mixed imine-amide pyrrolobenzodiazepine dimer (PBD2) and 5,10,15,20-tetrakis(N-methyl-4-pyridyl)porphyrin (TMPyP4) were studied. G-rich single-stranded oligonucleotide d(5′GGGGTTGGGG3′) designated as d(T2G8), from the telomeric region of Tetrahymena Glaucoma, was considered for the interaction with ligands. ESI-MS and spectroscopic methods viz., circular dichroism (CD), UV-Visible, and fluorescence were employed to investigate the G-quadruplex structures formed by d(T2G8) sequence and its interaction with PBD and TMPyP4 ligands. From ESI-MS spectra, it is evident that the majority of quadruplexes exist as d(T2G8)2 and d(T2G8)4 forms possessing two to ten cations in the centre, thereby stabilizing the complex. CD band of PBD1 and PBD2 showed hypo and hyperchromicity, on interaction with quadruplex DNA, indicating unfolding and stabilization of quadruplex DNA complex, respectively. UV-Visible and fluorescence experiments suggest that PBD1 bind externally where as PBD2 intercalate moderately and bind externally to G-quadruplex DNA. Further, melting experiments using SYBR Green indicate that PBD1 unfolds and PBD2 stabilizes the G-quadruplex complex. ITC experiments using d(T2G8) quadruplex with PBD ligands reveal that PBD1 and PBD2 prefer external/loop binding and external/intercalative binding to quadruplex DNA, respectively. From experimental results it is clear that the interaction of PBD2 and TMPyP4 impart higher stability to the quadruplex complex. PMID:22558271

  16. Interaction of pyrrolobenzodiazepine (PBD ligands with parallel intermolecular G-quadruplex complex using spectroscopy and ESI-MS.

    Directory of Open Access Journals (Sweden)

    Gajjela Raju

    Full Text Available Studies on ligand interaction with quadruplex DNA, and their role in stabilizing the complex at concentration prevailing under physiological condition, has attained high interest. Electrospray ionization mass spectrometry (ESI-MS and spectroscopic studies in solution were used to evaluate the interaction of PBD and TMPyP4 ligands, stoichiometry and selectivity to G-quadruplex DNA. Two synthetic ligands from PBD family, namely pyrene-linked pyrrolo[2,1-c][1,4]benzodiazepine hybrid (PBD1, mixed imine-amide pyrrolobenzodiazepine dimer (PBD2 and 5,10,15,20-tetrakis(N-methyl-4-pyridylporphyrin (TMPyP4 were studied. G-rich single-stranded oligonucleotide d(5'GGGGTTGGGG3' designated as d(T(2G(8, from the telomeric region of Tetrahymena Glaucoma, was considered for the interaction with ligands. ESI-MS and spectroscopic methods viz., circular dichroism (CD, UV-Visible, and fluorescence were employed to investigate the G-quadruplex structures formed by d(T(2G(8 sequence and its interaction with PBD and TMPyP4 ligands. From ESI-MS spectra, it is evident that the majority of quadruplexes exist as d(T(2G(8(2 and d(T(2G(8(4 forms possessing two to ten cations in the centre, thereby stabilizing the complex. CD band of PBD1 and PBD2 showed hypo and hyperchromicity, on interaction with quadruplex DNA, indicating unfolding and stabilization of quadruplex DNA complex, respectively. UV-Visible and fluorescence experiments suggest that PBD1 bind externally where as PBD2 intercalate moderately and bind externally to G-quadruplex DNA. Further, melting experiments using SYBR Green indicate that PBD1 unfolds and PBD2 stabilizes the G-quadruplex complex. ITC experiments using d(T(2G(8 quadruplex with PBD ligands reveal that PBD1 and PBD2 prefer external/loop binding and external/intercalative binding to quadruplex DNA, respectively. From experimental results it is clear that the interaction of PBD2 and TMPyP4 impart higher stability to the quadruplex complex.

  17. Macrocyclic G-quadruplex ligands

    DEFF Research Database (Denmark)

    Nielsen, M C; Ulven, Trond

    2010-01-01

    are macrocyclic structures which have been modeled after the natural product telomestatin or from porphyrin-based ligands discovered in the late 1990s. These two structural classes of G-quadruplex ligands are reviewed here with special attention to selectivity and structure-activity relationships, and with focus...

  18. Investigation of hyperfine interactions in DNA nitrogenous bases using perturbed angular correlation spectroscopy

    International Nuclear Information System (INIS)

    Silva, Andreia dos Santos; Carbonari, Artur Wilson; Lapolli, Andre Luis; Saxena, Rajendra Narain; Saitovitch, Henrique

    2013-01-01

    Perturbed γγ angular correlations (PAC) spectroscopy has been used to study the DNA nitrogenous bases (adenine, cytosine, guanine, thymine), using 111 In→ 111 Cd and 111m Cd→ 111 Cd probe nuclei. One of the advantages of applying PAC technique to biological molecules is that the experiments can be carried out on molecules in aqueous solution [1], approaching the function of molecules under conditions that are close to in vivo conditions. The measurements were carried out for DNA nitrogenous bases molecules at 295 K and 77 K in order to investigate dynamic and static hyperfine interactions, respectively. The interpretation of the results was based on the measurements of dynamic interaction characterized by the decay constant from which valuable information on the macroscopic behavior of the molecules was obtained [2; 3]. On the other hand, PAC measurements at low temperature showed interaction frequency (ν Q ), asymmetry parameter (η) and the distribution of the quadrupole frequency (δ). These parameters provide a local microscopic description of the chemical environment in the neighborhood of the probe nuclei. Results showed differences in the hyperfine interactions of probe nuclei bound to the studied biomolecules. Such differences were observed by variations in the hyperfine parameters, which depended on the type of biomolecule and the results also showed that the probe nuclei bounded at the molecules in some cases and at others did not. (author)

  19. Perturbation of DNA replication and cell cycle progression by commonly used [3H]thymidine labeling protocols

    International Nuclear Information System (INIS)

    Hoy, C.A.; Lewis, E.D.; Schimke, R.T.

    1990-01-01

    The effect of tritiated thymidine incorporation on DNA replication was studied in Chinese hamster ovary cells. Rapidly eluting (small) DNA from cells labeled with 2 microCi of [ 3 H]thymidine per ml (200 microCi/mmol) for 60 min matured to a large nonelutable size within approximately 2 to 4 h, as measured by the alkaline elution technique. However, DNA from cells exposed to 10 microCi of [ 3 H]thymidine per ml (66 microCi/mmol) was more rapidly eluting initially and did not mature to a nonelutable size during subsequent incubation. Semiconservative DNA replication measured by cesium chloride gradient analysis of bromodeoxyuridine-substituted DNA was also found to be affected by the final specific activity of the [ 3 H]thymidine used in the labeling protocol. Dramatic cell cycle perturbations accompanied these effects on DNA replication, suggesting that labeling protocols commonly used to study DNA metabolism produce aberrant DNA replication and subsequent cell cycle perturbations

  20. G-Quadruplex DNAzyme Molecular Beacon for Amplified Colorimetric Biosensing of Pseudostellaria heterophylla

    Directory of Open Access Journals (Sweden)

    Juan Hu

    2013-01-01

    Full Text Available With an internal transcribed spacer of 18 S, 5.8 S and 26 S nuclear ribosomal DNA (nrDNA ITS as DNA marker, we report a colorimetric approach for authentication of Pseudostellaria heterophylla (PH and its counterfeit species based on the differentiation of the nrDNA ITS sequence. The assay possesses an unlabelled G-quadruplex DNAzyme molecular beacon (MB probe, employing complementary sequence as biorecognition element and 1:1:1:1 split G-quadruplex halves as reporter. In the absence of target DNA (T-DNA, the probe can shape intermolecular G-quadruplex structures capable of binding hemin to form G-quadruplex-hemin DNAzyme and catalyze the oxidation of ABTS2− to blue-green ABTS•− by H2O2. In the presence of T-DNA, T-DNA can hybridize with the complementary sequence to form a duplex structure, hindering the formation of the G-quadruplex structure and resulting in the loss of the catalytic activity. Consequently, a UV-Vis absorption signal decrease is observed in the ABTS2−-H2O2 system. The “turn-off” assay allows the detection of T-DNA from 1.0 × 10−9 to 3.0 × 10−7 mol·L−1 (R2 = 0.9906, with a low detection limit of 3.1 × 10−10 mol·L−1. The present study provides a sensitive and selective method and may serve as a foundation of utilizing the DNAzyme MB sensor for identifying traditional Chinese medicines.

  1. Sugar-modified G-quadruplexes: effects of LNA-, 2′F-RNA– and 2′F-ANA-guanosine chemistries on G-quadruplex structure and stability

    Science.gov (United States)

    Li, Zhe; Lech, Christopher Jacques; Phan, Anh Tuân

    2014-01-01

    G-quadruplex-forming oligonucleotides containing modified nucleotide chemistries have demonstrated promising pharmaceutical potential. In this work, we systematically investigate the effects of sugar-modified guanosines on the structure and stability of a (4+0) parallel and a (3+1) hybrid G-quadruplex using over 60 modified sequences containing a single-position substitution of 2′-O-4′-C-methylene-guanosine (LNAG), 2′-deoxy-2′-fluoro-riboguanosine (FG) or 2′-deoxy-2′-fluoro-arabinoguanosine (FANAG). Our results are summarized in two parts: (I) Generally, LNAG substitutions into ‘anti’ position guanines within a guanine-tetrad lead to a more stable G-quadruplex, while substitutions into ‘syn’ positions disrupt the native G-quadruplex conformation. However, some interesting exceptions to this trend are observed. We discover that a LNAG modification upstream of a short propeller loop hinders G-quadruplex formation. (II) A single substitution of either FG or FANAG into a ‘syn’ position is powerful enough to perturb the (3+1) G-quadruplex. Substitution of either FG or FANAG into any ‘anti’ position is well tolerated in the two G-quadruplex scaffolds. FANAG substitutions to ‘anti’ positions are better tolerated than their FG counterparts. In both scaffolds, FANAG substitutions to the central tetrad layer are observed to be the most stabilizing. The observations reported herein on the effects of LNAG, FG and FANAG modifications on G-quadruplex structure and stability will enable the future design of pharmaceutically relevant oligonucleotides. PMID:24371274

  2. Biophysical Characterization of G-Quadruplex Recognition in the PITX1 mRNA by the Specificity Domain of the Helicase RHAU.

    Directory of Open Access Journals (Sweden)

    Emmanuel O Ariyo

    Full Text Available Nucleic acids rich in guanine are able to fold into unique structures known as G-quadruplexes. G-quadruplexes consist of four tracts of guanylates arranged in parallel or antiparallel strands that are aligned in stacked G-quartet planes. The structure is further stabilized by Hoogsteen hydrogen bonds and monovalent cations centered between the planes. RHAU (RNA helicase associated with AU-rich element is a member of the ATP-dependent DExH/D family of RNA helicases and can bind and resolve G-quadruplexes. RHAU contains a core helicase domain with an N-terminal extension that enables recognition and full binding affinity to RNA and DNA G-quadruplexes. PITX1, a member of the bicoid class of homeobox proteins, is a transcriptional activator active during development of vertebrates, chiefly in the anterior pituitary gland and several other organs. We have previously demonstrated that RHAU regulates PITX1 levels through interaction with G-quadruplexes at the 3'-end of the PITX1 mRNA. To understand the structural basis of G-quadruplex recognition by RHAU, we characterize a purified minimal PITX1 G-quadruplex using a variety of biophysical techniques including electrophoretic mobility shift assays, UV-VIS spectroscopy, circular dichroism, dynamic light scattering, small angle X-ray scattering and nuclear magnetic resonance spectroscopy. Our biophysical analysis provides evidence that the RNA G-quadruplex, but not its DNA counterpart, can adopt a parallel orientation, and that only the RNA can interact with N-terminal domain of RHAU via the tetrad face of the G-quadruplex. This work extends our insight into how the N-terminal region of RHAU recognizes parallel G-quadruplexes.

  3. Multimerization rules for G-quadruplexes

    Czech Academy of Sciences Publication Activity Database

    Kolesnikova, Sofia; Hubálek, Martin; Bednárová, Lucie; Cvačka, Josef; Curtis, Edward A.

    2017-01-01

    Roč. 45, č. 15 (2017), s. 8684-8696 ISSN 0305-1048 Institutional support: RVO:61388963 Keywords : tetramolecular G-quadruplexes * RNA G-quadruplexes * circular dichroism Subject RIV: CE - Biochemistry OBOR OECD: Biochemistry and molecular biology Impact factor: 10.162, year: 2016 https://academic.oup.com/nar/article/45/15/8684/4002725/Multimerization-rules-for-Gquadruplexes

  4. Unexpected Position-Dependent Effects of Ribose G-Quartets in G-Quadruplexes

    Czech Academy of Sciences Publication Activity Database

    Zhou, J.; Amrane, S.; Rosu, F.; Salgado, G.; Bian, Y.; Tateishi-Karimata, H.; Largy, E.; Korkut, D. N.; Bourdoncle, A.; Miyoshi, D.; Zhang, J.; Ju, H.; Wang, W.; Sugimoto, N.; Gabelica, V.; Mergny, Jean-Louis

    2017-01-01

    Roč. 139, č. 23 (2017), s. 7768-7779 ISSN 0002-7863 Institutional support: RVO:68081707 Keywords : human telomeric rna * electrospray mass-spectrometry * molecular crowding conditions * dna g-quadruplexes Subject RIV: BO - Biophysics OBOR OECD: Electrochemistry (dry cells, batteries, fuel cells, corrosion metals, electrolysis) Impact factor: 13.858, year: 2016

  5. Triplex intermediates in folding of human telomeric quadruplexes probed by microsecond-scale molecular dynamics simulations

    Czech Academy of Sciences Publication Activity Database

    Stadlbauer, Petr; Trantírek, L.; Cheatham III, T. E.; Koča, J.; Šponer, Jiří

    105C, OCT2014 (2014), s. 22-35 ISSN 0300-9084 R&D Projects: GA ČR(CZ) GAP208/12/1822; GA ČR(CZ) GA13-28310S Institutional support: RVO:68081707 Keywords : G-DNA folding * Quadruplex * Triplex Subject RIV: BO - Biophysics Impact factor: 2.963, year: 2014

  6. Local epigenetic reprogramming induced by G-quadruplex ligands

    Science.gov (United States)

    Guilbaud, Guillaume; Murat, Pierre; Recolin, Bénédicte; Campbell, Beth C.; Maiter, Ahmed; Sale, Julian E.; Balasubramanian, Shankar

    2017-11-01

    DNA and histone modifications regulate transcriptional activity and thus represent valuable targets to reprogram the activity of genes. Current epigenetic therapies target the machinery that regulates these modifications, leading to global transcriptional reprogramming with the potential for extensive undesired effects. Epigenetic information can also be modified as a consequence of disrupting processive DNA replication. Here, we demonstrate that impeding replication by small-molecule-mediated stabilization of G-quadruplex nucleic acid secondary structures triggers local epigenetic plasticity. We report the use of the BU-1 locus of chicken DT40 cells to screen for small molecules able to induce G-quadruplex-dependent transcriptional reprogramming. Further characterization of the top hit compound revealed its ability to induce a dose-dependent inactivation of BU-1 expression in two steps: the loss of H3K4me3 and then subsequent DNA cytosine methylation, changes that were heritable across cell divisions even after the compound was removed. Targeting DNA secondary structures thus represents a potentially new approach for locus-specific epigenetic reprogramming.

  7. Stabilization of Telomere G-Quadruplexes Interferes with Human Herpesvirus 6A Chromosomal Integration.

    Science.gov (United States)

    Gilbert-Girard, Shella; Gravel, Annie; Artusi, Sara; Richter, Sara N; Wallaschek, Nina; Kaufer, Benedikt B; Flamand, Louis

    2017-07-15

    Human herpesviruses 6A and 6B (HHV-6A/B) can integrate their genomes into the telomeres of human chromosomes using a mechanism that remains poorly understood. To achieve a better understanding of the HHV-6A/B integration mechanism, we made use of BRACO-19, a compound that stabilizes G-quadruplex secondary structures and prevents telomere elongation by the telomerase complex. First, we analyzed the folding of telomeric sequences into G-quadruplex structures and their binding to BRACO-19 using G-quadruplex-specific antibodies and surface plasmon resonance. Circular dichroism studies indicate that BRACO-19 modifies the conformation and greatly stabilizes the G-quadruplexes formed in G-rich telomeric DNA. Subsequently we assessed the effects of BRACO-19 on the HHV-6A initial phase of infection. Our results indicate that BRACO-19 does not affect entry of HHV-6A DNA into cells. We next investigated if stabilization of G-quadruplexes by BRACO-19 affected HHV-6A's ability to integrate its genome into host chromosomes. Incubation of telomerase-expressing cells with BRACO-19, such as HeLa and MCF-7, caused a significant reduction in the HHV-6A integration frequency ( P integration frequency in U2OS cells that lack telomerase activity and elongate their telomeres through alternative lengthening mechanisms. Our data suggest that the fluidity of telomeres is important for efficient chromosomal integration of HHV-6A and that interference with telomerase activity negatively affects the generation of cellular clones containing integrated HHV-6A. IMPORTANCE HHV-6A/B can integrate their genomes into the telomeres of infected cells. Telomeres consist of repeated hexanucleotides (TTAGGG) of various lengths (up to several kilobases) and end with a single-stranded 3' extension. To avoid recognition and induce a DNA damage response, the single-stranded overhang folds back on itself and forms a telomeric loop (T-loop) or adopts a tertiary structure, referred to as a G-quadruplex. In the

  8. Xanthine and 8-oxoguanine in G-quadruplexes: formation of a G·G·X·O tetrad.

    Science.gov (United States)

    Cheong, Vee Vee; Heddi, Brahim; Lech, Christopher Jacques; Phan, Anh Tuân

    2015-12-02

    G-quadruplexes are four-stranded structures built from stacked G-tetrads (G·G·G·G), which are planar cyclical assemblies of four guanine bases interacting through Hoogsteen hydrogen bonds. A G-quadruplex containing a single guanine analog substitution, such as 8-oxoguanine (O) or xanthine (X), would suffer from a loss of a Hoogsteen hydrogen bond within a G-tetrad and/or potential steric hindrance. We show that a proper arrangement of O and X bases can reestablish the hydrogen-bond pattern within a G·G·X·O tetrad. Rational incorporation of G·G·X·O tetrads in a (3+1) G-quadruplex demonstrated a similar folding topology and thermal stability to that of the unmodified G-quadruplex. pH titration conducted on X·O-modified G-quadruplexes indicated a protonation-deprotonation equilibrium of X with a pKa ∼6.7. The solution structure of a G-quadruplex containing a G·G·X·O tetrad was determined, displaying the same folding topology in both the protonated and deprotonated states. A G-quadruplex containing a deprotonated X·O pair was shown to exhibit a more electronegative groove compared to that of the unmodified one. These differences are likely to manifest in the electronic properties of G-quadruplexes and may have important implications for drug targeting and DNA-protein interactions. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.

  9. Loss of loop adenines alters human telomere d[AG3(TTAG3)3] quadruplex folding

    Czech Academy of Sciences Publication Activity Database

    Babinský, M.; Fiala, R.; Kejnovská, Iva; Bednářová, Klára; Marek, R.; Sagi, J.; Sklenář, V.; Vorlíčková, Michaela

    2014-01-01

    Roč. 42, č. 22 (2014), s. 14031-14041 ISSN 0305-1048 R&D Projects: GA ČR(CZ) GAP205/12/0466 Institutional support: RVO:68081707 Keywords : human telomere * DNA quadruplex * cellular DNA Subject RIV: BO - Biophysics Impact factor: 9.112, year: 2014

  10. Designing a New Class of Bases for Nucleic Acid Quadruplexes and Quadruplex-Active Ligands.

    Science.gov (United States)

    Bazzi, Sophia; Novotný, Jan; Yurenko, Yevgen P; Marek, Radek

    2015-06-22

    A new class of quadruplex nucleobases, derived from 3-deazaguanine, has been designed for various applications as smart quadruplex ligands as well as quadruplex-based aptamers, receptors, and sensors. An efficient strategy for modifying the guanine quadruplex core has been developed and tested by using quantum chemistry methods. Several potential guanine derivatives modified at the 3- or 8-position or both are analyzed, and the results compared to reference systems containing natural guanine. Analysis of the formation energies (BLYP-D3(BJ)/def2-TZVPP level of theory, in combination with the COSMO model for water) in model systems consisting of two and three stacked tetrads with Na(+) /K(+) ion(s) inside the internal channel indicates that the formation of structures with 3-halo-3-deazaguanine bases leads to a substantial gain in energy, as compared to the corresponding reference guanine complexes. The results cast light on changes in the noncovalent interactions (hydrogen bonding, stacking, and ion coordination) in a quadruplex stem upon modification of the guanine core. In particular, the enhanced stability of the modified quadruplexes was shown to originate mainly from increased π-π stacking. Our study suggests the 3-halo-3-deazaguanine skeleton as a potential building unit for quadruplex systems and smart G-quadruplex ligands. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  11. Sulforaphane enhances irradiation effects in terms of perturbed cell cycle progression and increased DNA damage in pancreatic cancer cells.

    Directory of Open Access Journals (Sweden)

    Patrick Naumann

    Full Text Available Sulforaphane (SFN, an herbal isothiocyanate enriched in cruciferous vegetables like broccoli and cauliflower, has gained popularity for its antitumor effects in cell lines such as pancreatic cancer. Antiproliferative as well as radiosensitizing properties were reported for head and neck cancer but little is known about its effects in pancreatic cancer cells in combination with irradiation (RT.In four established pancreatic cancer cell lines we investigated clonogenic survival, analyzed cell cycle distribution and compared DNA damage via flow cytometry and western blot after treatment with SFN and RT.Both SFN and RT show a strong and dose dependent survival reduction in clonogenic assays, an induction of a G2/M cell cycle arrest and an increase in γH2AX protein level indicating DNA damage. Effects were more pronounced in combined treatment and both cell cycle perturbation and DNA damage persisted for a longer period than after SFN or RT alone. Moreover, SFN induced a loss of DNA repair proteins Ku 70, Ku 80 and XRCC4.Our results suggest that combination of SFN and RT exerts a more distinct DNA damage and growth inhibition than each treatment alone. SFN seems to be a viable option to improve treatment efficacy of chemoradiation with hopefully higher rates of secondary resectability after neoadjuvant treatment for pancreatic cancer.

  12. Effect of ATRX and G-Quadruplex Formation by the VNTR Sequence on α-Globin Gene Expression.

    Science.gov (United States)

    Li, Yue; Syed, Junetha; Suzuki, Yuki; Asamitsu, Sefan; Shioda, Norifumi; Wada, Takahito; Sugiyama, Hiroshi

    2016-05-17

    ATR-X (α-thalassemia/mental retardation X-linked) syndrome is caused by mutations in chromatin remodeler ATRX. ATRX can bind the variable number of tandem repeats (VNTR) sequence in the promoter region of the α-globin gene cluster. The VNTR sequence, which contains the potential G-quadruplex-forming sequence CGC(GGGGCGGGG)n , is involved in the downregulation of α-globin expression. We investigated G-quadruplex and i-motif formation in single-stranded DNA and long double-stranded DNA. The promoter region without the VNTR sequence showed approximately twofold higher luciferase activity than the promoter region harboring the VNTR sequence. G-quadruplex stabilizers hemin and TMPyP4 reduced the luciferase activity, whereas expression of ATRX led to a recovery in reporter activity. Our results demonstrate that stable G-quadruplex formation by the VNTR sequence downregulates the expression of α-globin genes and that ATRX might bind to and resolve the G-quadruplex. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  13. Thermodynamic fingerprints of ligand binding to human telomeric G-quadruplexes.

    Science.gov (United States)

    Bončina, Matjaž; Podlipnik, Črtomir; Piantanida, Ivo; Eilmes, Julita; Teulade-Fichou, Marie-Paule; Vesnaver, Gorazd; Lah, Jurij

    2015-12-02

    Thermodynamic studies of ligand binding to human telomere (ht) DNA quadruplexes, as a rule, neglect the involvement of various ht-DNA conformations in the binding process. Therefore, the thermodynamic driving forces and the mechanisms of ht-DNA G-quadruplex-ligand recognition remain poorly understood. In this work we characterize thermodynamically and structurally binding of netropsin (Net), dibenzotetraaza[14]annulene derivatives (DP77, DP78), cationic porphyrin (TMPyP4) and two bisquinolinium ligands (Phen-DC3, 360A-Br) to the ht-DNA fragment (Tel22) AGGG(TTAGGG)3 using isothermal titration calorimetry, CD and fluorescence spectroscopy, gel electrophoresis and molecular modeling. By global thermodynamic analysis of experimental data we show that the driving forces characterized by contributions of specific interactions, changes in solvation and conformation differ significantly for binding of ligands with low quadruplex selectivity over duplexes (Net, DP77, DP78, TMPyP4; KTel22 ≈ KdsDNA). These contributions are in accordance with the observed structural features (changes) and suggest that upon binding Net, DP77, DP78 and TMPyP4 select hybrid-1 and/or hybrid-2 conformation while Phen-DC3 and 360A-Br induce the transition of hybrid-1 and hybrid-2 to the structure with characteristics of antiparallel or hybrid-3 type conformation. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.

  14. The Escherichia coli Tus-Ter replication fork barrier causes site-specific DNA replication perturbation in yeast.

    Science.gov (United States)

    Larsen, Nicolai B; Sass, Ehud; Suski, Catherine; Mankouri, Hocine W; Hickson, Ian D

    2014-04-07

    Replication fork (RF) pausing occurs at both 'programmed' sites and non-physiological barriers (for example, DNA adducts). Programmed RF pausing is required for site-specific DNA replication termination in Escherichia coli, and this process requires the binding of the polar terminator protein, Tus, to specific DNA sequences called Ter. Here, we demonstrate that Tus-Ter modules also induce polar RF pausing when engineered into the Saccharomyces cerevisiae genome. This heterologous RF barrier is distinct from a number of previously characterized, protein-mediated, RF pause sites in yeast, as it is neither Tof1-dependent nor counteracted by the Rrm3 helicase. Although the yeast replisome can overcome RF pausing at Tus-Ter modules, this event triggers site-specific homologous recombination that requires the RecQ helicase, Sgs1, for its timely resolution. We propose that Tus-Ter can be utilized as a versatile, site-specific, heterologous DNA replication-perturbing system, with a variety of potential applications.

  15. Hairpins participating in folding of human telomeric sequence quadruplexes studied by standard and T-REMD simulations

    Czech Academy of Sciences Publication Activity Database

    Stadlbauer, Petr; Kuehrova, P.; Banáš, P.; Koča, J.; Bussi, G.; Trantírek, L.; Otyepka, M.; Šponer, Jiří

    2016-01-01

    Roč. 43, č. 20 (2016), s. 9626-9644 ISSN 0305-1048 R&D Projects: GA ČR(CZ) GAP208/11/1822 Institutional support: RVO:68081707 Keywords : MOLECULAR-DYNAMICS SIMULATIONS * INTRAMOLECULAR DNA QUADRUPLEXES * PARTICLE MESH EWALD Subject RIV: BO - Biophysics Impact factor: 10.162, year: 2016

  16. Quadruplexes in 'Dicty': crystal structure of a four-quartet G-quadruplex formed by G-rich motif found in the Dictyostelium discoideum genome.

    Science.gov (United States)

    Guédin, Aurore; Lin, Linda Yingqi; Armane, Samir; Lacroix, Laurent; Mergny, Jean-Louis; Thore, Stéphane; Yatsunyk, Liliya A

    2018-06-01

    Guanine-rich DNA has the potential to fold into non-canonical G-quadruplex (G4) structures. Analysis of the genome of the social amoeba Dictyostelium discoideum indicates a low number of sequences with G4-forming potential (249-1055). Therefore, D. discoideum is a perfect model organism to investigate the relationship between the presence of G4s and their biological functions. As a first step in this investigation, we crystallized the dGGGGGAGGGGTACAGGGGTACAGGGG sequence from the putative promoter region of two divergent genes in D. discoideum. According to the crystal structure, this sequence folds into a four-quartet intramolecular antiparallel G4 with two lateral and one diagonal loops. The G-quadruplex core is further stabilized by a G-C Watson-Crick base pair and a A-T-A triad and displays high thermal stability (Tm > 90°C at 100 mM KCl). Biophysical characterization of the native sequence and loop mutants suggests that the DNA adopts the same structure in solution and in crystalline form, and that loop interactions are important for the G4 stability but not for its folding. Four-tetrad G4 structures are sparse. Thus, our work advances understanding of the structural diversity of G-quadruplexes and yields coordinates for in silico drug screening programs and G4 predictive tools.

  17. The Effects of Molecular Crowding on the Structure and Stability of G-Quadruplexes with an Abasic Site

    Science.gov (United States)

    Fujimoto, Takeshi; Nakano, Shu-ichi; Miyoshi, Daisuke; Sugimoto, Naoki

    2011-01-01

    Both cellular environmental factors and chemical modifications critically affect the properties of nucleic acids. However, the structure and stability of DNA containing abasic sites under cell-mimicking molecular crowding conditions remain unclear. Here, we investigated the molecular crowding effects on the structure and stability of the G-quadruplexes including a single abasic site. Structural analysis by circular dichroism showed that molecular crowding by PEG200 did not affect the topology of the G-quadruplex structure with or without an abasic site. Thermodynamic analysis further demonstrated that the degree of stabilization of the G-quadruplex by molecular crowding decreased with substitution of an abasic site for a single guanine. Notably, we found that the molecular crowding effects on the enthalpy change for G-quadruplex formation had a linear relationship with the abasic site effects depending on its position. These results are useful for predicting the structure and stability of G-quadruplexes with abasic sites in the cell-mimicking conditions. PMID:21949901

  18. Perturbations in DNA structure upon interaction with porphyrins revealed by chemical probes, DNA footprinting and molecular modelling.

    Science.gov (United States)

    Ford, K G; Neidle, S

    1995-06-01

    The interactions of several porphyrins with a 74 base-pair DNA sequence have been examined by footprinting and chemical protection methods. Tetra-(4-N-methyl-(pyridyl)) porphyrin (TMPy), two of its metal complexes and tetra-(4-trimethylanilinium) porphyrin (TMAP) bind to closely similar AT-rich sequences. The three TMPy ligands produce modest changes in DNA structure and base accessibility on binding, in contrast to the large-scale conformational changes observed with TMAP. Molecular modelling studies have been performed on TMPy and TMAP bound in the AT-rich minor groove of an oligonucleotide. These have shown that significant structural change is needed to accommodate the bulky trimethyl substituent groups of TMAP, in contrast to the facile minor groove fit of TMPy.

  19. Synthesis of potent G-quadruplex binders of macrocyclic heptaoxazole and evaluation of their activities.

    Science.gov (United States)

    Tera, Masayuki; Iida, Keisuke; Shin-ya, Kazuo; Nagasawa, Kazuo

    2009-01-01

    Guanine-rich DNA sequences form unique three-dimensional conformation known as G-quadruplexes (G-q). G-q structures have been found in telomere and in some oncogene promoter. Recently, it was suggested that G-q showed some biological activities including telomere shortening and transcriptional regulation. In this paper, we synthesized selective G-q binders and evaluated of their biological activities.

  20. RecQ-core of BLM unfolds telomeric G-quadruplex in the absence of ATP

    Czech Academy of Sciences Publication Activity Database

    Budhathoki, J.B.; Ray, S.; Urban, Václav; Janščák, Pavel; Jodh, J.G.; Balci, H.

    2014-01-01

    Roč. 42, č. 18 (2014), s. 11528-11545 ISSN 0305-1048 R&D Projects: GA ČR GA204/09/0565 Grant - others:U.S. National Science Foundation through the Physics Frontiers Center Program(US) 1430124 Institutional support: RVO:68378050 Keywords : single-stranded DNA * RECQ5 helicase * G-quadruplex structures Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 9.112, year: 2014

  1. Investigation of ‘Head-to-Tail’-Connected Oligoaryl N,O-Ligands as Recognition Motifs for Cancer-Relevant G-Quadruplexes

    Directory of Open Access Journals (Sweden)

    Natalia Rizeq

    2017-12-01

    Full Text Available Oligomeric compounds, constituted of consecutive N,O-heteroaromatic rings, introduce useful and tunable properties as alternative ligands for biomolecular recognition. In this study, we have explored a synthetic scheme relying on Van Leusen oxazole formation, in conjunction with C–H activation of the formed oxazoles and their subsequent C–C cross-coupling to 2-bromopyridines in order to assemble a library of variable-length, ‘head-to-tail’-connected, pyridyl-oxazole ligands. Through investigation of the interaction of the three longer ligands (5-mer, 6-mer, 7-mer with cancer-relevant G-quadruplex structures (human telomeric/22AG and c-Myc oncogene promoter/Myc2345-Pu22, the asymmetric pyridyl-oxazole motif has been demonstrated to be a prominent recognition element for G-quadruplexes. Fluorescence titrations reveal excellent binding affinities of the 7-mer and 6-mer for a Na+-induced antiparallel 22AG G-quadruplex (KD = 0.6 × 10−7 M−1 and 0.8 × 10−7 M−1, respectively, and satisfactory (albeit lower affinities for the 22AG/K+ and Myc2345-Pu22/K+ G-quadruplexes. All ligands tested exhibit substantial selectivity for G-quadruplex versus duplex (ds26 DNA, as evidenced by competitive Förster resonance energy transfer (FRET melting assays. Additionally, the 7-mer and 6-mer are capable of promoting a sharp morphology transition of 22AG/K+ G-quadruplex.

  2. Identification of a New G-Quadruplex Motif in the KRAS Promoter and Design of Pyrene-Modified G4-Decoys with Antiproliferative Activity in Pancreatic Cancer Cells

    DEFF Research Database (Denmark)

    Cogoi, Susanna; Paramasivam, Manikandan; Filitchev, Vyacheslav Viatcheslav

    2009-01-01

    A new quadruplex motif located in the promoter of the human KRAS gene, within a nuclease hypersensitive element (NHE), has been characterized. Oligonucleotides mimicking this quadruplex are found to compete with a DNA-protein complex between NHE and a nuclear extract from pancreatic cancer cells........ When modified with (R)-1-O-[4-1-(1-pyrenylethynyl) phenylmethyl]glycerol insertions (TINA), the quadruplex oligonucleotides showed a dramatic increase of the Tm (ΔTm from 22 to 32 °C) and a strong antiproliferative effects in Panc-1 cells....

  3. New insights into transcription fidelity: thermal stability of non-canonical structures in template DNA regulates transcriptional arrest, pause, and slippage.

    Science.gov (United States)

    Tateishi-Karimata, Hisae; Isono, Noburu; Sugimoto, Naoki

    2014-01-01

    The thermal stability and topology of non-canonical structures of G-quadruplexes and hairpins in template DNA were investigated, and the effect of non-canonical structures on transcription fidelity was evaluated quantitatively. We designed ten template DNAs: A linear sequence that does not have significant higher-order structure, three sequences that form hairpin structures, and six sequences that form G-quadruplex structures with different stabilities. Templates with non-canonical structures induced the production of an arrested, a slipped, and a full-length transcript, whereas the linear sequence produced only a full-length transcript. The efficiency of production for run-off transcripts (full-length and slipped transcripts) from templates that formed the non-canonical structures was lower than that from the linear. G-quadruplex structures were more effective inhibitors of full-length product formation than were hairpin structure even when the stability of the G-quadruplex in an aqueous solution was the same as that of the hairpin. We considered that intra-polymerase conditions may differentially affect the stability of non-canonical structures. The values of transcription efficiencies of run-off or arrest transcripts were correlated with stabilities of non-canonical structures in the intra-polymerase condition mimicked by 20 wt% polyethylene glycol (PEG). Transcriptional arrest was induced when the stability of the G-quadruplex structure (-ΔG°37) in the presence of 20 wt% PEG was more than 8.2 kcal mol(-1). Thus, values of stability in the presence of 20 wt% PEG are an important indicator of transcription perturbation. Our results further our understanding of the impact of template structure on the transcription process and may guide logical design of transcription-regulating drugs.

  4. DNA Replication Dynamics of the GGGGCC Repeat of the C9orf72 Gene.

    Science.gov (United States)

    Thys, Ryan Griffin; Wang, Yuh-Hwa

    2015-11-27

    DNA has the ability to form a variety of secondary structures in addition to the normal B-form DNA, including hairpins and quadruplexes. These structures are implicated in a number of neurological diseases and cancer. Expansion of a GGGGCC repeat located at C9orf72 is associated with familial amyotrophic lateral sclerosis and frontotemporal dementia. This repeat expands from two to 24 copies in normal individuals to several hundreds or thousands of repeats in individuals with the disease. Biochemical studies have demonstrated that as little as four repeats have the ability to form a stable DNA secondary structure known as a G-quadruplex. Quadruplex structures have the ability to disrupt normal DNA processes such as DNA replication and transcription. Here we examine the role of GGGGCC repeat length and orientation on DNA replication using an SV40 replication system in human cells. Replication through GGGGCC repeats leads to a decrease in overall replication efficiency and an increase in instability in a length-dependent manner. Both repeat expansions and contractions are observed, and replication orientation is found to influence the propensity for expansions or contractions. The presence of replication stress, such as low-dose aphidicolin, diminishes replication efficiency but has no effect on instability. Two-dimensional gel electrophoresis analysis demonstrates a replication stall with as few as 20 GGGGCC repeats. These results suggest that replication of the GGGGCC repeat at C9orf72 is perturbed by the presence of expanded repeats, which has the potential to result in further expansion, leading to disease. © 2015 by The American Society for Biochemistry and Molecular Biology, Inc.

  5. RNA synthesis is modulated by G-quadruplex formation in Hepatitis C virus negative RNA strand.

    Science.gov (United States)

    Chloé, Jaubert; Amina, Bedrat; Laura, Bartolucci; Carmelo, Di Primo; Michel, Ventura; Jean-Louis, Mergny; Samir, Amrane; Marie-Line, Andreola

    2018-05-25

    DNA and RNA guanine-rich oligonucleotides can form non-canonical structures called G-quadruplexes or "G4" that are based on the stacking of G-quartets. The role of DNA and RNA G4 is documented in eukaryotic cells and in pathogens such as viruses. Yet, G4 have been identified only in a few RNA viruses, including the Flaviviridae family. In this study, we analysed the last 157 nucleotides at the 3'end of the HCV (-) strand. This sequence is known to be the minimal sequence required for an efficient RNA replication. Using bioinformatics and biophysics, we identified a highly conserved G4-prone sequence located in the stem-loop IIy' of the negative strand. We also showed that the formation of this G-quadruplex inhibits the in vitro RNA synthesis by the RdRp. Furthermore, Phen-DC3, a specific G-quadruplex binder, is able to inhibit HCV viral replication in cells in conditions where no cytotoxicity was measured. Considering that this domain of the negative RNA strand is well conserved among HCV genotypes, G4 ligands could be of interest for new antiviral therapies.

  6. Evaluation of the effect of polymorphism on G-quadruplex-ligand interaction by means of spectroscopic and chromatographic techniques

    Science.gov (United States)

    Benito, S.; Ferrer, A.; Benabou, S.; Aviñó, A.; Eritja, R.; Gargallo, R.

    2018-05-01

    Guanine-rich sequences may fold into highly ordered structures known as G-quadruplexes. Apart from the monomeric G-quadruplex, these sequences may form multimeric structures that are not usually considered when studying interaction with ligands. This work studies the interaction of a ligand, crystal violet, with three guanine-rich DNA sequences with the capacity to form multimeric structures. These sequences correspond to short stretches found near the promoter regions of c-kit and SMARCA4 genes. Instrumental techniques (circular dichroism, molecular fluorescence, size-exclusion chromatography and electrospray ionization mass spectrometry) and multivariate data analysis were used for this purpose. The polymorphism of G-quadruplexes was characterized prior to the interaction studies. The ligand was shown to interact preferentially with the monomeric G-quadruplex; the binding stoichiometry was 1:1 and the binding constant was in the order of 105 M-1 for all three sequences. The results highlight the importance of DNA treatment prior to interaction studies.

  7. Identifying the impact of G-quadruplexes on Affymetrix 3' arrays using cloud computing.

    Science.gov (United States)

    Memon, Farhat N; Owen, Anne M; Sanchez-Graillet, Olivia; Upton, Graham J G; Harrison, Andrew P

    2010-01-15

    A tetramer quadruplex structure is formed by four parallel strands of DNA/ RNA containing runs of guanine. These quadruplexes are able to form because guanine can Hoogsteen hydrogen bond to other guanines, and a tetrad of guanines can form a stable arrangement. Recently we have discovered that probes on Affymetrix GeneChips that contain runs of guanine do not measure gene expression reliably. We associate this finding with the likelihood that quadruplexes are forming on the surface of GeneChips. In order to cope with the rapidly expanding size of GeneChip array datasets in the public domain, we are exploring the use of cloud computing to replicate our experiments on 3' arrays to look at the effect of the location of G-spots (runs of guanines). Cloud computing is a recently introduced high-performance solution that takes advantage of the computational infrastructure of large organisations such as Amazon and Google. We expect that cloud computing will become widely adopted because it enables bioinformaticians to avoid capital expenditure on expensive computing resources and to only pay a cloud computing provider for what is used. Moreover, as well as financial efficiency, cloud computing is an ecologically-friendly technology, it enables efficient data-sharing and we expect it to be faster for development purposes. Here we propose the advantageous use of cloud computing to perform a large data-mining analysis of public domain 3' arrays.

  8. Altered biochemical specificity of G-quadruplexes with mutated tetrads

    Czech Academy of Sciences Publication Activity Database

    Švehlová, Kateřina; Lawrence, M. S.; Bednárová, Lucie; Curtis, Edward A.

    2016-01-01

    Roč. 44, č. 22 (2016), s. 10789-10803 ISSN 0305-1048 Institutional support: RVO:61388963 Keywords : G-quadruplex * G motif GTP aptamer * peroxidase deoxyribozyme Subject RIV: CE - Biochemistry Impact factor: 10.162, year: 2016 https://academic.oup.com/nar/article/44/22/10789/2333933/Altered-biochemical-specificity-of-G-quadruplexes

  9. A G-quadruplex-based Label-free Fluorometric Aptasensor for Adenosine Triphosphate Detection.

    Science.gov (United States)

    Li, Li Juan; Tian, Xue; Kong, Xiang Juan; Chu, Xia

    2015-01-01

    A G-quadruplex-based, label-free fluorescence assay was demonstrated for the detection of adenosine triphosphate (ATP). A double-stranded DNA (dsDNA), hybridized by ATP-aptamer and its complementary sequence, was employed as a substrate for ATP binding. SYBR Green I (SG I) was a fluorescent probe and exonuclease III (Exo III) was a nuclease to digest the dsDNA. Consequently, in the absence of ATP, the dsDNA was inset with SG I and was digested by Exo III, resulting in a low background signal. In the presence of ATP, the aptamer in dsDNA folded into a G-quadruplex structure that resisted the digestion of Exo III. SG I was inserted into the structure, showing high fluorescence. Owing to a decrease of the background noise, a high signal-to-noise ratio could be obtained. This sensor can detect ATP with a concentration ranging from 50 μM to 5 mM, and possesses a capacity for the sensitive determination of other targets.

  10. Voltammetry and Molecular Assembly of G-quadruplex DNAzyme on Single-crystal Au(111)-electrode Surfaces – Hemin as an Electrochemical Intercalator

    DEFF Research Database (Denmark)

    Zhang, Ling; Ulstrup, Jens; Zhang, Jingdong

    2016-01-01

    DNA quadruplexes (qs’s) are a class of “non-canonical” oligonucleotides (OGNs) composed of stacked guanine (G) quartets generally stabilized by monovalent cations. Metal porphyrins selectively bind to G-qs complexes to form DNAzyme, which can exhibit peroxidase and other catalytic activity simila...

  11. Charge splitters and charge transport junctions based on guanine quadruplexes

    Science.gov (United States)

    Sha, Ruojie; Xiang, Limin; Liu, Chaoren; Balaeff, Alexander; Zhang, Yuqi; Zhang, Peng; Li, Yueqi; Beratan, David N.; Tao, Nongjian; Seeman, Nadrian C.

    2018-04-01

    Self-assembling circuit elements, such as current splitters or combiners at the molecular scale, require the design of building blocks with three or more terminals. A promising material for such building blocks is DNA, wherein multiple strands can self-assemble into multi-ended junctions, and nucleobase stacks can transport charge over long distances. However, nucleobase stacking is often disrupted at junction points, hindering electric charge transport between the two terminals of the junction. Here, we show that a guanine-quadruplex (G4) motif can be used as a connector element for a multi-ended DNA junction. By attaching specific terminal groups to the motif, we demonstrate that charges can enter the structure from one terminal at one end of a three-way G4 motif, and can exit from one of two terminals at the other end with minimal carrier transport attenuation. Moreover, we study four-way G4 junction structures by performing theoretical calculations to assist in the design and optimization of these connectors.

  12. Solid-state NMR chemical-shift perturbations indicate domain reorientation of the DnaG primase in the primosome of Helicobacter pylori

    Energy Technology Data Exchange (ETDEWEB)

    Gardiennet, Carole [Université de Lorraine, CNRS, CRM2, UMR 7036 (France); Wiegand, Thomas [ETH Zurich, Physical Chemistry (Switzerland); Bazin, Alexandre [Université de Lyon 1, Molecular Microbiology and Structural Biochemistry, Labex Ecofect, UMR 5086 CNRS (France); Cadalbert, Riccardo [ETH Zurich, Physical Chemistry (Switzerland); Kunert, Britta; Lacabanne, Denis [Université de Lyon 1, Molecular Microbiology and Structural Biochemistry, Labex Ecofect, UMR 5086 CNRS (France); Gutsche, Irina [Université Grenoble Alpes, Institut de Biologie Structurale (IBS), CNRS, IBS, CEA, IBS (France); Terradot, Laurent, E-mail: l.terradot@ibcp.fr [Université de Lyon 1, Molecular Microbiology and Structural Biochemistry, Labex Ecofect, UMR 5086 CNRS (France); Meier, Beat H., E-mail: beme@ethz.ch [ETH Zurich, Physical Chemistry (Switzerland); Böckmann, Anja, E-mail: a.bockmann@ibcp.fr [Université de Lyon 1, Molecular Microbiology and Structural Biochemistry, Labex Ecofect, UMR 5086 CNRS (France)

    2016-03-15

    We here investigate the interactions between the DnaB helicase and the C-terminal domain of the corresponding DnaG primase of Helicobacter pylori using solid-state NMR. The difficult crystallization of this 387 kDa complex, where the two proteins interact in a six to three ratio, is circumvented by simple co-sedimentation of the two proteins directly into the MAS-NMR rotor. While the amount of information that can be extracted from such a large protein is still limited, we can assign a number of amino-acid residues experiencing significant chemical-shift perturbations upon helicase-primase complex formation. The location of these residues is used as a guide to model the interaction interface between the two proteins in the complex. Chemical-shift perturbations also reveal changes at the interaction interfaces of the hexameric HpDnaB assembly on HpDnaG binding. A structural model of the complex that explains the experimental findings is obtained.

  13. Quadruplex-forming sequences occupy discrete regions inside plant LTR retrotransposons

    Czech Academy of Sciences Publication Activity Database

    Lexa, M.; Kejnovský, Eduard; Šteflová, Pavlína; Konvalinová, H.; Vorlíčková, Michaela; Vyskot, Boris

    2014-01-01

    Roč. 42, č. 2 (2014), s. 968-978 ISSN 0305-1048 R&D Projects: GA ČR(CZ) GAP205/12/0466; GA ČR(CZ) GAP305/10/0930; GA ČR(CZ) GAP501/10/0102; GA ČR(CZ) GA522/09/0083; GA ČR GPP501/10/P483 Institutional support: RVO:68081707 Keywords : INTRAMOLECULAR DNA QUADRUPLEXES * VIRUS TYPE-1 RNA * CIRCULAR-DICHROISM Subject RIV: BO - Biophysics Impact factor: 9.112, year: 2014

  14. Clustered abasic lesions profoundly change the structure and stability of human telomeric G-quadruplexes

    Czech Academy of Sciences Publication Activity Database

    Kejnovská, Iva; Bednářová, Klára; Renčiuk, Daniel; Dvořáková, Zuzana; Školáková, Petra; Trantírek, L.; Fiala, R.; Vorlíčková, Michaela; Sagi, J.

    2017-01-01

    Roč. 45, č. 8 (2017), s. 4294-4305 ISSN 0305-1048 R&D Projects: GA MŠk EF15_003/0000477; GA ČR GAP205/12/0466; GA ČR GA13-28310S; GA ČR(CZ) GA15-06785S; GA MŠk(CZ) LQ1601 Institutional support: RVO:68081707 Keywords : dna-damage clusters * k+ solution * guanine quadruplexes Subject RIV: CE - Biochemistry OBOR OECD: Biochemistry and molecular biology Impact factor: 10.162, year: 2016

  15. Quinone methides tethered to naphthalene diimides as selective G-quadruplex alkylating agents.

    Science.gov (United States)

    Di Antonio, Marco; Doria, Filippo; Richter, Sara N; Bertipaglia, Carolina; Mella, Mariella; Sissi, Claudia; Palumbo, Manlio; Freccero, Mauro

    2009-09-16

    We have developed novel G-quadruplex (G-4) ligand/alkylating hybrid structures, tethering the naphthalene diimide moiety to quaternary ammonium salts of Mannich bases, as quinone-methide precursors, activatable by mild thermal digestion (40 degrees C). The bis-substituted naphthalene diimides were efficiently synthesized, and their reactivity as activatable bis-alkylating agents was investigated in the presence of thiols and amines in aqueous buffered solutions. The electrophilic intermediate, quinone-methide, involved in the alkylation process was trapped, in the presence of ethyl vinyl ether, in a hetero Diels-Alder [4 + 2] cycloaddition reaction, yielding a substituted 2-ethoxychroman. The DNA recognition and alkylation properties of these new derivatives were investigated by gel electrophoresis, circular dichroism, and enzymatic assays. The alkylation process occurred preferentially on the G-4 structure in comparison to other DNA conformations. By dissecting reversible recognition and alkylation events, we found that the reversible process is a prerequisite to DNA alkylation, which in turn reinforces the G-quadruplex structural rearrangement.

  16. G Quadruplex in Plants: A Ubiquitous Regulatory Element and Its Biological Relevance.

    Science.gov (United States)

    Yadav, Vikas; Hemansi; Kim, Nayun; Tuteja, Narendra; Yadav, Puja

    2017-01-01

    G quadruplexes (G4) are higher-order DNA and RNA secondary structures formed by G-rich sequences that are built around tetrads of hydrogen-bonded guanine bases. Potential G4 quadruplex sequences have been identified in G-rich eukaryotic non-telomeric and telomeric genomic regions. Upon function, G4 formation is known to involve in chromatin remodeling, gene regulation and has been associated with genomic instability, genetic diseases and cancer progression. The natural role and biological validation of G4 structures is starting to be explored, and is of particular interest for the therapeutic interventions for human diseases. However, the existence and physiological role of G4 DNA and G4 RNA in plants species have not been much investigated yet and therefore, is of great interest for the development of improved crop varieties for sustainable agriculture. In this context, several recent studies suggests that these highly diverse G4 structures in plants can be employed to regulate expression of genes involved in several pathophysiological conditions including stress response to biotic and abiotic stresses as well as DNA damage. In the current review, we summarize the recent findings regarding the emerging functional significance of G4 structures in plants and discuss their potential value in the development of improved crop varieties.

  17. G Quadruplex in Plants: A Ubiquitous Regulatory Element and Its Biological Relevance

    Directory of Open Access Journals (Sweden)

    Vikas Yadav

    2017-07-01

    Full Text Available G quadruplexes (G4 are higher-order DNA and RNA secondary structures formed by G-rich sequences that are built around tetrads of hydrogen-bonded guanine bases. Potential G4 quadruplex sequences have been identified in G-rich eukaryotic non-telomeric and telomeric genomic regions. Upon function, G4 formation is known to involve in chromatin remodeling, gene regulation and has been associated with genomic instability, genetic diseases and cancer progression. The natural role and biological validation of G4 structures is starting to be explored, and is of particular interest for the therapeutic interventions for human diseases. However, the existence and physiological role of G4 DNA and G4 RNA in plants species have not been much investigated yet and therefore, is of great interest for the development of improved crop varieties for sustainable agriculture. In this context, several recent studies suggests that these highly diverse G4 structures in plants can be employed to regulate expression of genes involved in several pathophysiological conditions including stress response to biotic and abiotic stresses as well as DNA damage. In the current review, we summarize the recent findings regarding the emerging functional significance of G4 structures in plants and discuss their potential value in the development of improved crop varieties.

  18. Colorimetric detection of genetically modified organisms based on exonuclease III-assisted target recycling and hemin/G-quadruplex DNAzyme amplification.

    Science.gov (United States)

    Zhang, Decai; Wang, Weijia; Dong, Qian; Huang, Yunxiu; Wen, Dongmei; Mu, Yuejing; Yuan, Yong

    2017-12-21

    An isothermal colorimetric method is described for amplified detection of the CaMV 35S promoter sequence in genetically modified organism (GMO). It is based on (a) target DNA-triggered unlabeled molecular beacon (UMB) termini binding, and (b) exonuclease III (Exo III)-assisted target recycling, and (c) hemin/G-quadruplex (DNAzyme) based signal amplification. The specific binding of target to the G-quadruplex sequence-locked UMB triggers the digestion of Exo III. This, in turn, releases an active G-quadruplex segment and target DNA for successive hybridization and cleavage. The Exo III impellent recycling of targets produces numerous G-quadruplex sequences. These further associate with hemin to form DNAzymes and hence will catalyze H 2 O 2 -mediated oxidation of the chromogenic enzyme substrate ABTS 2- causing the formation of a green colored product. This finding enables a sensitive colorimetric determination of GMO DNA (at an analytical wavelength of 420 nm) at concentrations as low as 0.23 nM. By taking advantage of isothermal incubation, this method does not require sophisticated equipment or complicated syntheses. Analyses can be performed within 90 min. The method also discriminates single base mismatches. In our perception, it has a wide scope in that it may be applied to the detection of many other GMOs. Graphical abstract An isothermal and sensitive colorimetric method is described for amplified detection of CaMV 35S promoter sequence in genetically modified organism (GMO). It is based on target DNA-triggered molecular beacon (UMB) termini-binding and exonuclease III assisted target recycling, and on hemin/G-quadruplex (DNAzyme) signal amplification.

  19. Cockayne syndrome group A and B proteins converge on transcription-linked resolution of non-B DNA

    DEFF Research Database (Denmark)

    Scheibye-Knudsen, Morten; Tseng, Anne; Jensen, Martin Borch

    2016-01-01

    of CSA or CSB in a neuroblastoma cell line converges on mitochondrial dysfunction caused by defects in ribosomal DNA transcription and activation of the DNA damage sensor poly-ADP ribose polymerase 1 (PARP1). Indeed, inhibition of ribosomal DNA transcription leads to mitochondrial dysfunction in a number...... to polymerase stalling at non-B DNA in a neuroblastoma cell line, in particular at G-quadruplex structures, and recombinant CSB can melt G-quadruplex structures. Indeed, stabilization of G-quadruplex structures activates PARP1 and leads to accelerated aging in Caenorhabditis elegans. In conclusion, this work...

  20. Chemosensitivity of human small cell carcinoma of the lung detected by flow cytometric DNA analysis of drug-induced cell cycle perturbations in vitro

    DEFF Research Database (Denmark)

    Engelholm, S A; Spang-Thomsen, M; Vindeløv, L L

    1986-01-01

    A method based on detection of drug-induced cell cycle perturbation by flow cytometric DNA analysis has previously been described in Ehrlich ascites tumors as a way to estimate chemosensitivity. The method is extended to test human small-cell carcinoma of the lung. Three tumors with different...... sensitivities to melphalan in nude mice were used. Tumors were disaggregated by a combined mechanical and enzymatic method and thereafter have incubated with different doses of melphalan. After incubation the cells were plated in vitro on agar, and drug induced cell cycle changes were monitored by flow...

  1. Phenanthroline-2,9-bistriazoles as selective G-quadruplex ligands

    DEFF Research Database (Denmark)

    Nielsen, Mads Corvinius; Larsen, Anders Foller; Abdikadir, Faisal Hussein

    2014-01-01

    G-quadruplex (G4) ligands are currently receiving considerable attention as potential anticancer therapeutics. A series of phenanthroline-2,9-bistriazoles carrying tethered positive end groups has been synthesized and evaluated as G4 stabilizers. The compounds were efficiently assembled by copper......(I)-catalyzed azide-alkyne cycloaddition (CuAAC) in CH2Cl2 and water in the presence of a complexing agent. Characterization of the target compounds on telomeric and c-KIT G4 sequences led to the identification of guanidinium-substituted compounds as potent G4 DNA ligands with high selectivity over duplex DNA....... The diisopropylguanidium ligands exhibited high selectivity for the proto-oncogenic sequence c-KIT over the human telomeric sequence in the surface plasmon resonance (SPR) assay, whereas the compounds appeared potent on both G4 structures in the FRET melting temperature assay. The phenanthroline-2,9-bistriazole ligands...

  2. G-Quadruplex Forming Oligonucleotides as Anti-HIV Agents.

    Science.gov (United States)

    Musumeci, Domenica; Riccardi, Claudia; Montesarchio, Daniela

    2015-09-22

    Though a variety of different non-canonical nucleic acids conformations have been recognized, G-quadruplex structures are probably the structural motifs most commonly found within known oligonucleotide-based aptamers. This could be ascribed to several factors, as their large conformational diversity, marked responsiveness of their folding/unfolding processes to external stimuli, high structural compactness and chemo-enzymatic and thermodynamic stability. A number of G-quadruplex-forming oligonucleotides having relevant in vitro anti-HIV activity have been discovered in the last two decades through either SELEX or rational design approaches. Improved aptamers have been obtained by chemical modifications of natural oligonucleotides, as terminal conjugations with large hydrophobic groups, replacement of phosphodiester linkages with phosphorothioate bonds or other surrogates, insertion of base-modified monomers, etc. In turn, detailed structural studies have elucidated the peculiar architectures adopted by many G-quadruplex-based aptamers and provided insight into their mechanism of action. An overview of the state-of-the-art knowledge of the relevance of putative G-quadruplex forming sequences within the viral genome and of the most studied G-quadruplex-forming aptamers, selectively targeting HIV proteins, is here presented.

  3. DNA methylation perturbations in genes involved in polyunsaturated Fatty Acid biosynthesis associated with depression and suicide risk.

    Science.gov (United States)

    Haghighi, Fatemeh; Galfalvy, Hanga; Chen, Sean; Huang, Yung-Yu; Cooper, Thomas B; Burke, Ainsley K; Oquendo, Maria A; Mann, J John; Sublette, M Elizabeth

    2015-01-01

    Polyunsaturated fatty acid (PUFA) status has been associated with neuropsychiatric disorders, including depression and risk of suicide. Long-chain PUFAs (LC-PUFAs) are obtained in the diet or produced by sequential desaturation and elongation of shorter-chain precursor fatty acids linoleic acid (LA, 18:2n-6) and α-linolenic acid (ALA, 18:3n-3). We compared DNA methylation patterns in genes involved in LC-PUFA biosynthesis in major depressive disorder (MDD) with (n = 22) and without (n = 39) history of suicide attempt, and age- and sex-matched healthy volunteers (n = 59). Plasma levels of selected PUFAs along the LC-PUFA biosynthesis pathway were determined by transesterification and gas chromatography. CpG methylation levels for the main human LC-PUFA biosynthetic genes, fatty acid desaturases 1 (Fads1) and 2 (Fads2), and elongation of very long-chain fatty acids protein 5 (Elovl5), were assayed by bisulfite pyrosequencing. Associations between PUFA levels and diagnosis or suicide attempt status did not survive correction for multiple testing. However, MDD diagnosis and suicide attempts were significantly associated with DNA methylation in Elovl5 gene regulatory regions. Also the relative roles of PUFA levels and DNA methylation with respect to diagnostic and suicide attempt status were determined by least absolute shrinkage and selection operator logistic regression analyses. We found that PUFA associations with suicide attempt status were explained by effects of Elovl5 DNA methylation within the regulatory regions. The observed link between plasma PUFA levels, DNA methylation, and suicide risk may have implications for modulation of disease-associated epigenetic marks by nutritional intervention.

  4. DNA methylation perturbations in genes involved in polyunsaturated fatty acid biosynthesis associated with depression and suicide risk

    Directory of Open Access Journals (Sweden)

    Fatemeh eHaghighi

    2015-04-01

    Full Text Available Polyunsaturated fatty acid (PUFA status has been associated with neuropsychiatric disorders, including depression and risk of suicide. Long-chain PUFAs (LC-PUFAs are obtained in the diet or produced by sequential desaturation and elongation of shorter-chain precursor fatty acids linoleic acid (LA, 18:2n-6 and α-linolenic acid (ALA, 18:3n-3. We compared DNA methylation patterns in genes involved in LC-PUFA biosynthesis in major depressive disorder (MDD with (n=22 and without (n=39 history of suicide attempt, and age- and sex-matched healthy volunteers (n=59. Plasma levels of selected PUFAs along the LC-PUFA biosynthesis pathway were determined by transesterification and gas chromatography. CpG methylation levels for the main human LC-PUFA biosynthetic genes, fatty acid desaturases 1 (Fads1 and 2 (Fads2, and elongation of very long chain fatty acids protein 5 (Elovl5, were assayed by bisulfite pyrosequencing. Associations between PUFA levels and diagnosis or suicide attempt status did not survive correction for multiple testing. However, MDD diagnosis and suicide attempts were significantly associated with DNA methylation in Elovl5 gene regulatory regions. Also the relative roles of PUFA levels and DNA methylation with respect to diagnostic and suicide attempt status were determined by least absolute shrinkage and selection operator (LASSO logistic regression analyses. We found that PUFA associations with suicide attempt status were explained by effects of Elovl5 DNA methylation within the regulatory regions. The observed link between plasma PUFA levels, DNA methylation, and suicide risk may have implications for modulation of disease-associated epigenetic marks by nutritional intervention.

  5. Label-free logic modules and two-layer cascade based on stem-loop probes containing a G-quadruplex domain.

    Science.gov (United States)

    Guo, Yahui; Cheng, Junjie; Wang, Jine; Zhou, Xiaodong; Hu, Jiming; Pei, Renjun

    2014-09-01

    A simple, versatile, and label-free DNA computing strategy was designed by using toehold-mediated strand displacement and stem-loop probes. A full set of logic gates (YES, NOT, OR, NAND, AND, INHIBIT, NOR, XOR, XNOR) and a two-layer logic cascade were constructed. The probes contain a G-quadruplex domain, which was blocked or unfolded through inputs initiating strand displacement and the obviously distinguishable light-up fluorescent signal of G-quadruplex/NMM complex was used as the output readout. The inputs are the disease-specific nucleotide sequences with potential for clinic diagnosis. The developed versatile computing system based on our label-free and modular strategy might be adapted in multi-target diagnosis through DNA hybridization and aptamer-target interaction. © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  6. Large-scale symmetry-adapted perturbation theory computations via density fitting and Laplace transformation techniques: investigating the fundamental forces of DNA-intercalator interactions.

    Science.gov (United States)

    Hohenstein, Edward G; Parrish, Robert M; Sherrill, C David; Turney, Justin M; Schaefer, Henry F

    2011-11-07

    Symmetry-adapted perturbation theory (SAPT) provides a means of probing the fundamental nature of intermolecular interactions. Low-orders of SAPT (here, SAPT0) are especially attractive since they provide qualitative (sometimes quantitative) results while remaining tractable for large systems. The application of density fitting and Laplace transformation techniques to SAPT0 can significantly reduce the expense associated with these computations and make even larger systems accessible. We present new factorizations of the SAPT0 equations with density-fitted two-electron integrals and the first application of Laplace transformations of energy denominators to SAPT. The improved scalability of the DF-SAPT0 implementation allows it to be applied to systems with more than 200 atoms and 2800 basis functions. The Laplace-transformed energy denominators are compared to analogous partial Cholesky decompositions of the energy denominator tensor. Application of our new DF-SAPT0 program to the intercalation of DNA by proflavine has allowed us to determine the nature of the proflavine-DNA interaction. Overall, the proflavine-DNA interaction contains important contributions from both electrostatics and dispersion. The energetics of the intercalator interaction are are dominated by the stacking interactions (two-thirds of the total), but contain important contributions from the intercalator-backbone interactions. It is hypothesized that the geometry of the complex will be determined by the interactions of the intercalator with the backbone, because by shifting toward one side of the backbone, the intercalator can form two long hydrogen-bonding type interactions. The long-range interactions between the intercalator and the next-nearest base pairs appear to be negligible, justifying the use of truncated DNA models in computational studies of intercalation interaction energies.

  7. Separation of the potential G-quadruplex ligands from the butanol extract of Zanthoxylum ailanthoides Sieb. & Zucc. by countercurrent chromatography and preparative high performance liquid chromatography.

    Science.gov (United States)

    Han, Tian; Cao, Xueli; Xu, Jing; Pei, Hairun; Zhang, Hong; Tang, Yalin

    2017-07-21

    G-quadruplex DNA structure is considered to be a very attractive target for antitumor drug design due to its unique role in maintaining telomerase activities. Therefore, discovering ligands with high stability of G-quadruplex structure is of great interest. In this paper, pH-zone refining counter current chromatography (CCC) and preparative high performance liquid chromatography (HPLC) were employed for the separation of potent G-quadruplex ligands from the n-butanol fraction of the crude extract of Zanthoxylum ailanthoides, which is a traditional Chinese medicine recently found to display high inhibitory activity against several human cancer cells. The 75% aqueous ethanol extract of the stem bark of Z. ailanthoides and its fractions with petroleum ether, ethyl acetate and n-butanol displayed almost the same G-quadruplex stabilization ability. Here, pH-zone refining CCC was used for the separation of the alkaloids from the n-butanol fraction by a seldom used solvent system composed of dichloromethane-methanol-water (4:1:2.5) with 10mM TEA in the organic stationary phase as retainer and 10mM HCl in the aqueous mobile phase as eluter. Compounds I, II and III were obtained, with purity greater than 95%, in the quantities of 31.2, 94.0, and 26.4mg respectively from 300mg of lipophilic fraction within 80min, which were identified as three tetrahydroprotoberberines isolated for the first time in this plant. In addition, a phenylpropanoid glycoside compound IV (Syringin), an isoquinoline (Magnoflorine, V), and two lignin isomers (+)-lyoniresiol-3α-O-β-d-glucopyranoside (VI) and (-)-lyoniresinol -3α-O-β-D -glucopyranoside (VII) were isolated by traditional CCC together with preparative HPLC. Compounds IV, V, VI and VII were obtained, with purity greater than 95%, in the quantities of 4.0, 13.2, 6.7, and 6.5mg respectively from 960mg of hydrophilic fraction. Among the seven isolated compounds, tetrahydroprotoberberine I, II and III were found to display remarkable

  8. Expression of Telomere-Associated Proteins is Interdependent to Stabilize Native Telomere Structure and Telomere Dysfunction by G-Quadruplex Ligand Causes TERRA Upregulation.

    Science.gov (United States)

    Sadhukhan, Ratan; Chowdhury, Priyanka; Ghosh, Sourav; Ghosh, Utpal

    2018-06-01

    Telomere DNA can form specialized nucleoprotein structure with telomere-associated proteins to hide free DNA ends or G-quadruplex structures under certain conditions especially in presence of G-quadruplex ligand. Telomere DNA is transcribed to form non-coding telomere repeat-containing RNA (TERRA) whose biogenesis and function is poorly understood. Our aim was to find the role of telomere-associated proteins and telomere structures in TERRA transcription. We silenced four [two shelterin (TRF1, TRF2) and two non-shelterin (PARP-1, SLX4)] telomere-associated genes using siRNA and verified depletion in protein level. Knocking down of one gene modulated expression of other telomere-associated genes and increased TERRA from 10q, 15q, XpYp and XqYq chromosomes in A549 cells. Telomere was destabilized or damaged by G-quadruplex ligand pyridostatin (PDS) and bleomycin. Telomere dysfunction-induced foci (TIFs) were observed for each case of depletion of proteins, treatment with PDS or bleomycin. TERRA level was elevated by PDS and bleomycin treatment alone or in combination with depletion of telomere-associated proteins.

  9. Binding polarity of RPA to telomeric sequences and influence of G-quadruplex stability.

    Science.gov (United States)

    Safa, Layal; Delagoutte, Emmanuelle; Petruseva, Irina; Alberti, Patrizia; Lavrik, Olga; Riou, Jean-François; Saintomé, Carole

    2014-08-01

    Replication protein A (RPA) is a single-stranded DNA binding protein that plays an essential role in telomere maintenance. RPA binds to and unfolds G-quadruplex (G4) structures formed in telomeric DNA, thus facilitating lagging strand DNA replication and telomerase activity. To investigate the effect of G4 stability on the interactions with human RPA (hRPA), we used a combination of biochemical and biophysical approaches. Our data revealed an inverse relationship between G4 stability and ability of hRPA to bind to telomeric DNA; notably small G4 ligands that enhance G4 stability strongly impaired G4 unfolding by hRPA. To gain more insight into the mechanism of binding and unfolding of telomeric G4 structures by RPA, we carried out photo-crosslinking experiments to elucidate the spatial arrangement of the RPA subunits along the DNA strands. Our results showed that RPA1 and RPA2 are arranged from 5' to 3' along the unfolded telomeric G4, as already described for unstructured single-stranded DNA, while no contact is possible with RPA3 on this short oligonucleotide. In addition, these data are compatible with a 5' to 3' directionality in G4 unfolding by hRPA. Copyright © 2014 Elsevier Masson SAS. All rights reserved.

  10. Tetrasubstituted phenanthrolines as highly potent, water-soluble, and selective g-quadruplex ligands

    DEFF Research Database (Denmark)

    Larsen, Anders Foller; Nielsen, Mads Corvinius; Ulven, Trond

    2012-01-01

    Small molecules capable of stabilizing the G-quadruplex (G4) structure are of interest for the development of improved anticancer drugs. Novel 4,7-diamino-substituted 1,10-phenanthroline-2,9-dicarboxamides that represent hybrid structures of known phenanthroline-based ligands have been designed....... An efficient synthetic route to the compounds has been developed and their interactions with various G4 sequences have been evaluated by Förster resonance energy transfer (FRET) melting assays, fluorescent intercalator displacement (FID), electrospray ionization mass spectrometry (ESI-MS), and circular...... dichroism (CD) spectroscopy. The preferred compounds have high aqueous solubility and are strong and potent G4 binders with a high selectivity over duplex DNA; thus, they represent a significant improvement over the lead compounds. Two of the compounds are inhibitors of HeLa and HT1080 cell proliferation....

  11. Use of alternative alkali chlorides in RT and PCR of polynucleotides containing G quadruplex structures.

    Science.gov (United States)

    Ramos-Alemán, Fabiola; González-Jasso, Eva; Pless, Reynaldo C

    2018-02-15

    Several alkali chlorides were compared for their use in reverse transcription (RT) and PCR of different types of nucleic acid templates. On a test region of biological DNA incapable of forming G quadruplex (G4) structures, Taq DNA polymerase showed similar PCR performance with 50 mM KCl, CsCl, LiCl, and NaCl. In contrast, on a synthetic model polydeoxyribonucleotide prone to G4 formation, good PCR amplification was obtained with 50 mM CsCl, but little or none with LiCl or KCl. Similarly, in RT of a G4-prone model polyribonucleotide, MMLV reverse transcriptase produced a good yield with 50 mM CsCl, mediocre yields with LiCl or without added alkali chloride, and a poor yield with 50 mM KCl. The full RT-PCR assay starting from the G4-prone polyribonucleotide, showed good results with CsCl in both stages, poor results with LiCl, and no product formation with KCl. The model polynucleotides showed fast G quadruplex formation under PCR or RT conditions with 50 mM KCl, but not with CsCl or LiCl. The results argue for the use of CsCl instead of KCl for RT and PCR of G4-prone sequences. No advantage was observed when using the 7-deaza type nucleotide analog c 7 dGTP in PCR amplification of the G4-prone polydeoxyribonucleotide. Copyright © 2017 Elsevier Inc. All rights reserved.

  12. Perturbation theory

    International Nuclear Information System (INIS)

    Bartlett, R.; Kirtman, B.; Davidson, E.R.

    1978-01-01

    After noting some advantages of using perturbation theory some of the various types are related on a chart and described, including many-body nonlinear summations, quartic force-field fit for geometry, fourth-order correlation approximations, and a survey of some recent work. Alternative initial approximations in perturbation theory are also discussed. 25 references

  13. Fully integrated graphene electronic biosensor for label-free detection of lead (II) ion based on G-quadruplex structure-switching.

    Science.gov (United States)

    Li, Yijun; Wang, Cheng; Zhu, Yibo; Zhou, Xiaohong; Xiang, Yu; He, Miao; Zeng, Siyu

    2017-03-15

    This work presents a fully integrated graphene field-effect transistor (GFET) biosensor for the label-free detection of lead ions (Pb 2+ ) in aqueous-media, which first implements the G-quadruplex structure-switching biosensing principle in graphene nanoelectronics. We experimentally illustrate the biomolecular interplay that G-rich DNA single-strands with one-end confined on graphene surface can specifically interact with Pb 2+ ions and switch into G-quadruplex structures. Since the structure-switching of electrically charged DNA strands can disrupt the charge distribution in the vicinity of graphene surface, the carrier equilibrium in graphene sheet might be altered, and manifested by the conductivity variation of GFET. The experimental data and theoretical analysis show that our devices are capable of the label-free and specific quantification of Pb 2+ with a detection limit down to 163.7ng/L. These results first verify the signaling principle competency of G-quadruplex structure-switching in graphene electronic biosensors. Combining with the advantages of the compact device structure and convenient electrical signal, a label-free GFET biosensor for Pb 2+ monitoring is enabled with promising application potential. Copyright © 2016 Elsevier B.V. All rights reserved.

  14. Investigation of hyperfine interactions in DNA and antibody of different lineages of mice infected by T. cruzi by perturbed gamma-gamma angular correlation spectroscopy

    International Nuclear Information System (INIS)

    Silva, Andreia dos Santos

    2012-01-01

    In the present work perturbed angular correlation (PAC) spectroscopy was used to measured electric quadrupole interactions in DNA biomolecules of different mice lineages (A/J, C57BL/6, B6AF1, BXA1 e BXA2), samples of different isotypes of immunoglobulin G (IgG1, IgG2a e IgG2b) and active portions of complete and fragmented immunoglobulin responsible by the immune response. Electric quadrupole interactions were also measured in DNA nitrogenous bases (adenine, cytosine, guanine, thymine). PAC measurements were performed using 111 In → 111C d; 111mC d → 111 Cd; 111 Ag → 111 Cd; e 181 Hf → 181 Ta as probe nuclei, and carried out at room temperature and liquid nitrogen temperature, in order to investigate dynamic and static hyperfine interactions, respectively. The biomolecule samples were directly marked with the radioactive parent nuclei, whose atom link to a certain site in the biomolecules. The biological materials as well as the probe nuclei were chosen to investigate the possibility to use PAC spectroscopy to measure hyperfine parameters at nuclei from metallic elements bound to biomolecules (including the use of different probe nuclei produced in the decay of parent nuclei of four different metals) and also to study the behavior of different biomolecules by means of the measured hyperfine parameters. Results show differences in the hyperfine interactions of probe nuclei bound to the studied biomolecules. Such differences were observed by variations in the hyperfine parameters, which depend on the type of biomolecule and the results also show that the probe nuclei atom bound to the molecule in some cases and in others do not. (author)

  15. G-quadruplex formation in telomeres enhances POT1/TPP1 protection against RPA binding

    Science.gov (United States)

    Ray, Sujay; Bandaria, Jigar N.; Qureshi, Mohammad H.; Yildiz, Ahmet; Balci, Hamza

    2014-01-01

    Human telomeres terminate with a single-stranded 3′ G overhang, which can be recognized as a DNA damage site by replication protein A (RPA). The protection of telomeres (POT1)/POT1-interacting protein 1 (TPP1) heterodimer binds specifically to single-stranded telomeric DNA (ssTEL) and protects G overhangs against RPA binding. The G overhang spontaneously folds into various G-quadruplex (GQ) conformations. It remains unclear whether GQ formation affects the ability of POT1/TPP1 to compete against RPA to access ssTEL. Using single-molecule Förster resonance energy transfer, we showed that POT1 stably loads to a minimal DNA sequence adjacent to a folded GQ. At 150 mM K+, POT1 loading unfolds the antiparallel GQ, as the parallel conformation remains folded. POT1/TPP1 loading blocks RPA’s access to both folded and unfolded telomeres by two orders of magnitude. This protection is not observed at 150 mM Na+, in which ssTEL forms only a less-stable antiparallel GQ. These results suggest that GQ formation of telomeric overhangs may contribute to suppression of DNA damage signals. PMID:24516170

  16. Small Molecule Microarrays Enable the Identification of a Selective, Quadruplex-Binding Inhibitor of MYC Expression.

    Science.gov (United States)

    Felsenstein, Kenneth M; Saunders, Lindsey B; Simmons, John K; Leon, Elena; Calabrese, David R; Zhang, Shuling; Michalowski, Aleksandra; Gareiss, Peter; Mock, Beverly A; Schneekloth, John S

    2016-01-15

    The transcription factor MYC plays a pivotal role in cancer initiation, progression, and maintenance. However, it has proven difficult to develop small molecule inhibitors of MYC. One attractive route to pharmacological inhibition of MYC has been the prevention of its expression through small molecule-mediated stabilization of the G-quadruplex (G4) present in its promoter. Although molecules that bind globally to quadruplex DNA and influence gene expression are well-known, the identification of new chemical scaffolds that selectively modulate G4-driven genes remains a challenge. Here, we report an approach for the identification of G4-binding small molecules using small molecule microarrays (SMMs). We use the SMM screening platform to identify a novel G4-binding small molecule that inhibits MYC expression in cell models, with minimal impact on the expression of other G4-associated genes. Surface plasmon resonance (SPR) and thermal melt assays demonstrated that this molecule binds reversibly to the MYC G4 with single digit micromolar affinity, and with weaker or no measurable binding to other G4s. Biochemical and cell-based assays demonstrated that the compound effectively silenced MYC transcription and translation via a G4-dependent mechanism of action. The compound induced G1 arrest and was selectively toxic to MYC-driven cancer cell lines containing the G4 in the promoter but had minimal effects in peripheral blood mononucleocytes or a cell line lacking the G4 in its MYC promoter. As a measure of selectivity, gene expression analysis and qPCR experiments demonstrated that MYC and several MYC target genes were downregulated upon treatment with this compound, while the expression of several other G4-driven genes was not affected. In addition to providing a novel chemical scaffold that modulates MYC expression through G4 binding, this work suggests that the SMM screening approach may be broadly useful as an approach for the identification of new G4-binding small

  17. G-quadruplex recognition activities of E. Coli MutS

    Directory of Open Access Journals (Sweden)

    Ehrat Edward A

    2012-07-01

    Full Text Available Abstract Background Guanine quadruplex (G4 DNA is a four-stranded structure that contributes to genome instability and site-specific recombination. G4 DNA folds from sequences containing tandemly repetitive guanines, sequence motifs that are found throughout prokaryote and eukaryote genomes. While some cellular activities have been identified with binding or processing G4 DNA, the factors and pathways governing G4 DNA metabolism are largely undefined. Highly conserved mismatch repair factors have emerged as potential G4-responding complexes because, in addition to initiating heteroduplex correction, the human homologs bind non-B form DNA with high affinity. Moreover, the MutS homologs across species have the capacity to recognize a diverse range of DNA pairing variations and damage, suggesting a conserved ability to bind non-B form DNA. Results Here, we asked if E. coli MutS and a heteroduplex recognition mutant, MutS F36A, were capable of recognizing and responding to G4 DNA structures. We find by mobility shift assay that E. coli MutS binds to G4 DNA with high affinity better than binding to G-T heteroduplexes. In the same assay, MutS F36A failed to recognize G-T mismatched oligonucleotides, as expected, but retained an ability to bind to G4 DNA. Association with G4 DNA by MutS is not likely to activate the mismatch repair pathway because nucleotide binding did not promote release of MutS or MutS F36A from G4 DNA as it does for heteroduplexes. G4 recognition activities occur under physiological conditions, and we find that M13 phage harboring G4-capable DNA poorly infected a MutS deficient strain of E. coli compared to M13mp18, suggesting functional roles for mismatch repair factors in the cellular response to unstable genomic elements. Conclusions Taken together, our findings demonstrate that E. coli MutS has a binding activity specific for non-B form G4 DNA, but such binding appears independent of canonical heteroduplex repair activation.

  18. Thrombin-Binding Aptamer Quadruplex Formation: AFM and Voltammetric Characterization

    Directory of Open Access Journals (Sweden)

    Victor Constantin Diculescu

    2010-01-01

    Full Text Available The adsorption and the redox behaviour of thrombin-binding aptamer (TBA and extended TBA (eTBA were studied using atomic force microscopy and voltammetry at highly oriented pyrolytic graphite and glassy carbon. The different adsorption patterns and degree of surface coverage were correlated with the sequence base composition, presence/absence of K+, and voltammetric behaviour of TBA and eTBA. In the presence of K+, only a few single-stranded sequences present adsorption, while the majority of the molecules forms stable and rigid quadruplexes with no adsorption. Both TBA and eTBA are oxidized and the only anodic peak corresponds to guanine oxidation. Upon addition of K+ ions, TBA and eTBA fold into a quadruplex, causing the decrease of guanine oxidation peak and occurrence of a new peak at a higher potential due to the oxidation of G-quartets. The higher oxidation potential of G-quartets is due to the greater difficulty of electron transfer from the inside of the quadruplex to the electrode surface than electron transfer from the more flexible single strands.

  19. Exonuclease-assisted multicolor aptasensor for visual detection of ochratoxin A based on G-quadruplex-hemin DNAzyme-mediated etching of gold nanorod.

    Science.gov (United States)

    Yu, Xinhui; Lin, Yaohui; Wang, Xusheng; Xu, Liangjun; Wang, Zongwen; Fu, FengFu

    2018-04-21

    An exonuclease-assisted multicolor aptasensor was developed for the visual detection of ochratoxin A (OTA). It is based on the etching of gold nanorods (AuNRs) mediated by a G-quadruplex-hemin DNAzyme. A DNA sequence (AG4-OTA) was designed that comprises a hemin aptamer and an OTA aptamer. OTA binds to AG4-OTA to form an antiparallel G-quadruplex, which halts its digestion by exonuclease I (Exo I) from the 3'-end of AG4-OTA. Thus, the retained hemin aptamer can bind to hemin to form a G-quadruplex-hemin DNAzyme. This DNAzyme has peroxidase-like activity that catalyzes the oxidation of 3,3',5,5'-tetramethylbenzidine (TMB) by H 2 O 2 to produce its diimine derivative (TMB 2+ ) in acidic solution. TMB 2+ can etch the AuNRs by oxidizing Au(0) into Au(I). This results in the generation of rainbow-like colors and provides a multicolor platform for the visual detection of OTA. The assay is based on the use of a single isolated aptamer and possesses obvious advantages such as multi-color visual inspection, relatively high sensitivity and accuracy. It can be used to detect as little as 30 nM concentrations of OTA by visual observation and even 10 nM concentrations by spectrophotometry. The method was successfully applied to the determination of OTA in spiked beer where it gave recoveries of 101-108%, with a relative standard deviation (RSD, n = 5) of <5%. Graphical abstract Schematic of an exonuclease-assisted multicolor bioassay based on the G-quadruplex-hemin DNAzyme-mediated etching of gold nanorods (AuNRs). It enables visual detection of ochratoxin A (OTA) with a detection limit of 30 nM.

  20. A single thiazole orange molecule forms an exciplex in a DNA i-motif.

    Science.gov (United States)

    Xu, Baochang; Wu, Xiangyang; Yeow, Edwin K L; Shao, Fangwei

    2014-06-18

    A fluorescent exciplex of thiazole orange (TO) is formed in a single-dye conjugated DNA i-motif. The exciplex fluorescence exhibits a large Stokes shift, high quantum yield, robust response to pH oscillation and little structural disturbance to the DNA quadruplex, which can be used to monitor the folding of high-order DNA structures.

  1. Computational Analysis of G-Quadruplex Forming Sequences across Chromosomes Reveals High Density Patterns Near the Terminal Ends.

    Directory of Open Access Journals (Sweden)

    Julia H Chariker

    Full Text Available G-quadruplex structures (G4 are found throughout the human genome and are known to play a regulatory role in a variety of molecular processes. Structurally, they have many configurations and can form from one or more DNA strands. At the gene level, they regulate gene expression and protein synthesis. In this paper, chromosomal-level patterns of distribution are analyzed on the human genome to identify high-level distribution patterns potentially related to global functional processes. Here we show unique high density banding patterns on individual chromosomes that are highly correlated, appearing in a mirror pattern, across forward and reverse DNA strands. The highest density of G4 sequences occurs within four megabases of one end of most chromosomes and contains G4 motifs that bind with zinc finger proteins. These findings suggest that G4 may play a role in global chromosomal processes such as those found in meiosis.

  2. Thioflavin T binds dimeric parallel-stranded GA-containing non-G-quadruplex DNAs: a general approach to lighting up double-stranded scaffolds.

    Science.gov (United States)

    Liu, Shuangna; Peng, Pai; Wang, Huihui; Shi, Lili; Li, Tao

    2017-12-01

    A molecular rotor thioflavin T (ThT) is usually used as a fluorescent ligand specific for G-quadruplexes. Here, we demonstrate that ThT can tightly bind non-G-quadruplex DNAs with several GA motifs and dimerize them in a parallel double-stranded mode, accompanied by over 100-fold enhancement in the fluorescence emission of ThT. The introduction of reverse Watson-Crick T-A base pairs into these dimeric parallel-stranded DNA systems remarkably favors the binding of ThT into the pocket between G•G and A•A base pairs, where ThT is encapsulated thereby restricting its two rotary aromatic rings in the excited state. A similar mechanism is also demonstrated in antiparallel DNA duplexes where several motifs of two consecutive G•G wobble base pairs are incorporated and serve as the active pockets for ThT binding. The insight into the interactions of ThT with non-G-quadruplex DNAs allows us to introduce a new concept for constructing DNA-based sensors and devices. As proof-of-concept experiments, we design a DNA triplex containing GA motifs in its Hoogsteen hydrogen-bonded two parallel strands as a pH-driven nanoswitch and two GA-containing parallel duplexes as novel metal sensing platforms where C-C and T-T mismatches are included. This work may find further applications in biological systems (e.g. disease gene detection) where parallel duplex or triplex stretches are involved. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.

  3. Traffic Perturbation

    CERN Multimedia

    C. Colloca TS/FM

    2004-01-01

    TS/FM group informs you that, for the progress of the works at the Prévessin site entrance, some perturbation of the traffic may occur during the week between the 14th and 18th of June for a short duration. Access will be assured at any time. For more information, please contact 160239. C. Colloca TS/FM

  4. QuadBase2: web server for multiplexed guanine quadruplex mining and visualization

    Science.gov (United States)

    Dhapola, Parashar; Chowdhury, Shantanu

    2016-01-01

    DNA guanine quadruplexes or G4s are non-canonical DNA secondary structures which affect genomic processes like replication, transcription and recombination. G4s are computationally identified by specific nucleotide motifs which are also called putative G4 (PG4) motifs. Despite the general relevance of these structures, there is currently no tool available that can allow batch queries and genome-wide analysis of these motifs in a user-friendly interface. QuadBase2 (quadbase.igib.res.in) presents a completely reinvented web server version of previously published QuadBase database. QuadBase2 enables users to mine PG4 motifs in up to 178 eukaryotes through the EuQuad module. This module interfaces with Ensembl Compara database, to allow users mine PG4 motifs in the orthologues of genes of interest across eukaryotes. PG4 motifs can be mined across genes and their promoter sequences in 1719 prokaryotes through ProQuad module. This module includes a feature that allows genome-wide mining of PG4 motifs and their visualization as circular histograms. TetraplexFinder, the module for mining PG4 motifs in user-provided sequences is now capable of handling up to 20 MB of data. QuadBase2 is a comprehensive PG4 motif mining tool that further expands the configurations and algorithms for mining PG4 motifs in a user-friendly way. PMID:27185890

  5. Transposable elements and G-quadruplexes

    Czech Academy of Sciences Publication Activity Database

    Kejnovský, Eduard; Tokan, Viktor; Lexa, M.

    2015-01-01

    Roč. 23, č. 3 (2015), s. 615-623 ISSN 0967-3849 R&D Projects: GA ČR(CZ) GA15-02891S Institutional support: RVO:68081707 Keywords : TRINUCLEOTIDE REPEAT DNA * LTR RETROTRANSPOSONS * BINDING PROTEIN Subject RIV: BO - Biophysics Impact factor: 2.590, year: 2015

  6. Racemic DNA crystallography.

    Science.gov (United States)

    Mandal, Pradeep K; Collie, Gavin W; Kauffmann, Brice; Huc, Ivan

    2014-12-22

    Racemates increase the chances of crystallization by allowing molecular contacts to be formed in a greater number of ways. With the advent of protein synthesis, the production of protein racemates and racemic-protein crystallography are now possible. Curiously, racemic DNA crystallography had not been investigated despite the commercial availability of L- and D-deoxyribo-oligonucleotides. Here, we report a study into racemic DNA crystallography showing the strong propensity of racemic DNA mixtures to form racemic crystals. We describe racemic crystal structures of various DNA sequences and folded conformations, including duplexes, quadruplexes, and a four-way junction, showing that the advantages of racemic crystallography should extend to DNA. © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  7. Tetrahelical structural family adopted by AGCGA-rich regulatory DNA regions

    Science.gov (United States)

    Kocman, Vojč; Plavec, Janez

    2017-05-01

    Here we describe AGCGA-quadruplexes, an unexpected addition to the well-known tetrahelical families, G-quadruplexes and i-motifs, that have been a focus of intense research due to their potential biological impact in G- and C-rich DNA regions, respectively. High-resolution structures determined by solution-state nuclear magnetic resonance (NMR) spectroscopy demonstrate that AGCGA-quadruplexes comprise four 5'-AGCGA-3' tracts and are stabilized by G-A and G-C base pairs forming GAGA- and GCGC-quartets, respectively. Residues in the core of the structure are connected with edge-type loops. Sequences of alternating 5'-AGCGA-3' and 5'-GGG-3' repeats could be expected to form G-quadruplexes, but are shown herein to form AGCGA-quadruplexes instead. Unique structural features of AGCGA-quadruplexes together with lower sensitivity to cation and pH variation imply their potential biological relevance in regulatory regions of genes responsible for basic cellular processes that are related to neurological disorders, cancer and abnormalities in bone and cartilage development.

  8. Isolation of deletion alleles by G4 DNA-induced mutagenesis

    NARCIS (Netherlands)

    Pontier, Daphne B; Kruisselbrink, Evelien; Guryev, Victor; Tijsterman, Marcel

    Metazoan genomes contain thousands of sequence tracts that match the guanine-quadruplex (G4) DNA signature G(3)N(x)G(3)N(x)G(3)N(x)G(3), a motif that is intrinsically mutagenic, probably because it can form secondary structures during DNA replication. Here we show how and to what extent this feature

  9. Interdependence of pyrene interactions and tetramolecular G4-DNA assembly.

    Science.gov (United States)

    Doluca, Osman; Withers, Jamie M; Loo, Trevor S; Edwards, Patrick J B; González, Carlos; Filichev, Vyacheslav V

    2015-03-28

    Controlling the arrangement of organic chromophores in supramolecular architectures is of primary importance for the development of novel functional molecules. Insertion of a twisted intercalating nucleic acid (TINA) moiety, containing phenylethynylpyren-1-yl derivatives, into a G-rich DNA sequence alters G-quadruplex folding, resulting in supramolecular structures with defined pyrene arrangements. Based on CD, NMR and ESI-mass-spectra, as well as TINA excited dimer (excimer) fluorescence emission we propose that insertion of the TINA monomer in the middle of a dTG4T sequence (i.e. dTGGXGGT, where X is TINA) converts a parallel tetramolecular G-quadruplex into an assembly composed of two identical antiparallel G-quadruplex subunits stacked via TINA-TINA interface. Kinetic analysis showed that TINA-TINA association controls complex formation in the presence of Na(+) but barely competes with guanine-mediated association in K(+) or in the sequence with the longer G-run (dTGGGXGGGT). These results demonstrate new perspectives in the design of molecular entities that can kinetically control G-quadruplex formation and show how tetramolecular G-quadruplexes can be used as a tuneable scaffold to control the arrangement of organic chromophores.

  10. Design, synthesis and evaluation of 4,7-diamino-1,10-phenanthroline G-quadruplex ligands

    DEFF Research Database (Denmark)

    Nielsen, Mads Corvinius; Borch, Jonas; Ulven, Trond

    2009-01-01

    the central ionic column. Introduction of positively charged side chains results in compounds with appreciable G-quadruplex stabilizing properties and high aqueous solubility, with the longer side chains giving more potent compounds. Ligands carrying guanidine side chains in general show higher quadruplex...... stabilizing activity and distinctly slower kinetic properties than their amino and dimethylamino analogues, possibly due to specific hydrogen bond interactions with the G-quadruplex loops....

  11. RPA-mediated unfolding of systematically varying G-quadruplex structures.

    Science.gov (United States)

    Ray, Sujay; Qureshi, Mohammad H; Malcolm, Dominic W; Budhathoki, Jagat B; Celik, Uğur; Balci, Hamza

    2013-05-21

    G-quadruplex (GQ) is a noncanonical nucleic acid structure that is formed by guanine rich sequences. Unless it is destabilized by proteins such as replication protein A (RPA), GQ could interfere with DNA metabolic functions, such as replication or repair. We studied RPA-mediated GQ unfolding using single-molecule FRET on two groups of GQ structures that have different loop lengths and different numbers of G-tetrad layers. We observed a linear increase in the steady-state stability of the GQ against RPA-mediated unfolding with increasing number of layers or decreasing loop length. The stability demonstrated by different GQ structures varied by at least three orders of magnitude. Those with shorter loops (less than three nucleotides long) or a greater number of layers (more than three layers) maintained a significant folded population even at physiological RPA concentration (≈1 μM), raising the possibility of physiological viability of such GQ structures. Finally, we measured the transition time between the start and end of the RPA-mediated GQ unfolding process to be 0.35 ± 0.10 s for all GQ constructs we studied, despite significant differences in their steady-state stabilities. We propose a two-step RPA-mediated GQ unfolding mechanism that is consistent with our observations. Copyright © 2013 Biophysical Society. Published by Elsevier Inc. All rights reserved.

  12. Modular Assembly of Cell-targeting Devices Based on an Uncommon G-quadruplex Aptamer

    Directory of Open Access Journals (Sweden)

    Felipe Opazo

    2015-01-01

    Full Text Available Aptamers are valuable tools that provide great potential to develop cost-effective diagnostics and therapies in the biomedical field. Here, we report a novel DNA aptamer that folds into an unconventional G-quadruplex structure able to recognize and enter specifically into human Burkitt's lymphoma cells. We further optimized this aptamer to a highly versatile and stable minimized version. The minimized aptamer can be easily equipped with different functionalities like quantum dots, organic dyes, or even a second different aptamer domain yielding a bi-paratopic aptamer. Although the target molecule of the aptamer remains unknown, our microscopy and pharmacological studies revealed that the aptamer hijacks the clathrin-mediated endocytosis pathway for its cellular internalization. We conclude that this novel class of aptamers can be used as a modular tool to specifically deliver different cargoes into malignant cells. This work provides a thorough characterization of the aptamer and we expect that our strategy will pave the path for future therapeutic applications.

  13. Effect of Monovalent Ion Parameters on Molecular Dynamics Simulations of G-Quadruplexes

    Czech Academy of Sciences Publication Activity Database

    Havrila, Marek; Stadlbauer, Petr; Islam, Barira; Otyepka, M.; Šponer, Jiří

    2017-01-01

    Roč. 13, č. 8 (2017), s. 3911-3926 ISSN 1549-9618 R&D Projects: GA MŠk EF15_003/0000477; GA ČR(CZ) GA16-13721S Institutional support: RVO:68081707 Keywords : telomeric g-quadruplex * amber force-field * nucleic-acid quadruplexes Subject RIV: CF - Physical ; Theoretical Chemistry OBOR OECD: Physical chemistry Impact factor: 5.245, year: 2016

  14. Amyloid Precursor Protein Translation Is Regulated by a 3'UTR Guanine Quadruplex.

    Directory of Open Access Journals (Sweden)

    Ezekiel Crenshaw

    Full Text Available A central event in Alzheimer's disease is the accumulation of amyloid β (Aβ peptides generated by the proteolytic cleavage of the amyloid precursor protein (APP. APP overexpression leads to increased Aβ generation and Alzheimer's disease in humans and altered neuronal migration and increased long term depression in mice. Conversely, reduction of APP expression results in decreased Aβ levels in mice as well as impaired learning and memory and decreased numbers of dendritic spines. Together these findings indicate that therapeutic interventions that aim to restore APP and Aβ levels must do so within an ideal range. To better understand the effects of modulating APP levels, we explored the mechanisms regulating APP expression focusing on post-transcriptional regulation. Such regulation can be mediated by RNA regulatory elements such as guanine quadruplexes (G-quadruplexes, non-canonical structured RNA motifs that affect RNA stability and translation. Via a bioinformatics approach, we identified a candidate G-quadruplex within the APP mRNA in its 3'UTR (untranslated region at residues 3008-3027 (NM_201414.2. This sequence exhibited characteristics of a parallel G-quadruplex structure as revealed by circular dichroism spectrophotometry. Further, as with other G-quadruplexes, the formation of this structure was dependent on the presence of potassium ions. This G-quadruplex has no apparent role in regulating transcription or mRNA stability as wild type and mutant constructs exhibited equivalent mRNA levels as determined by real time PCR. Instead, we demonstrate that this G-quadruplex negatively regulates APP protein expression using dual luciferase reporter and Western blot analysis. Taken together, our studies reveal post-transcriptional regulation by a 3'UTR G-quadruplex as a novel mechanism regulating APP expression.

  15. Conformation and stability of intramolecular telomeric G-quadruplexes: sequence effects in the loops.

    Directory of Open Access Journals (Sweden)

    Giovanna Sattin

    Full Text Available Telomeres are guanine-rich sequences that protect the ends of chromosomes. These regions can fold into G-quadruplex structures and their stabilization by G-quadruplex ligands has been employed as an anticancer strategy. Genetic analysis in human telomeres revealed extensive allelic variation restricted to loop bases, indicating that the variant telomeric sequences maintain the ability to fold into G-quadruplex. To assess the effect of mutations in loop bases on G-quadruplex folding and stability, we performed a comprehensive analysis of mutant telomeric sequences by spectroscopic techniques, molecular dynamics simulations and gel electrophoresis. We found that when the first position in the loop was mutated from T to C or A the resulting structure adopted a less stable antiparallel topology; when the second position was mutated to C or A, lower thermal stability and no evident conformational change were observed; in contrast, substitution of the third position from A to C induced a more stable and original hybrid conformation, while mutation to T did not significantly affect G-quadruplex topology and stability. Our results indicate that allelic variations generate G-quadruplex telomeric structures with variable conformation and stability. This aspect needs to be taken into account when designing new potential anticancer molecules.

  16. Aphidicolin synchronization of mouse L cells perturbs the relationship between cell killing and DNA double-strand breakage after X-irradiation

    International Nuclear Information System (INIS)

    Radford, I.R.; Broadhurst, S.

    1988-01-01

    The relationship between X-ray-induced cell killing and DNA double-strand breakage was examined for synchronized mouse L cells that had entered S-phase, G2-phase, mitosis, and G1-phase following release from aphidicolin and compared to asynchronous culture response. Aphidicolin-synchronized cells showed cycle phase-dependent changes in dose-responses for both killing and DNA dsb. However, on the basis of DNA dsb per unit length of DNA required to produce a lethal lesion, aphidicolin-synchronized cells were more sensitive to X-rays than asynchronous cultures. This sensitivity peaked 2 h after release from aphidicolin treatment, and then progressively declined towards the asynchronous culture value. It is argued that results are due to deregulation of the temporal order of DNA replication following aphidicolin treatment, and can be incorporated into the critical DNA target size model by postulating that the targets for radiation action in mammalian cells are DNA-associated with potentially transcriptionally active proto-oncogenes or constitutive fragile sites. (author)

  17. Label-Free and Ultrasensitive Biomolecule Detection Based on Aggregation Induced Emission Fluorogen via Target-Triggered Hemin/G-Quadruplex-Catalyzed Oxidation Reaction.

    Science.gov (United States)

    Li, Haiyin; Chang, Jiafu; Gai, Panpan; Li, Feng

    2018-02-07

    Fluorescence biosensing strategy has drawn substantial attention due to their advantages of simplicity, convenience, sensitivity, and selectivity, but unsatisfactory structure stability, low fluorescence quantum yield, high cost of labeling, and strict reaction conditions associated with current fluorescence methods severely prohibit their potential application. To address these challenges, we herein propose an ultrasensitive label-free fluorescence biosensor by integrating hemin/G-quadruplex-catalyzed oxidation reaction with aggregation induced emission (AIE) fluorogen-based system. l-Cysteine/TPE-M, which is carefully and elaborately designed and developed, obviously contributes to strong fluorescence emission. In the presence of G-rich DNA along with K + and hemin, efficient destruction of l-cysteine occurs due to hemin/G-quadruplex-catalyzed oxidation reactions. As a result, highly sensitive fluorescence detection of G-rich DNA is readily realized, with a detection limit down to 33 pM. As a validation for the further development of the proposed strategy, we also successfully construct ultrasensitive platforms for microRNA by incorporating the l-cysteine/TPE-M system with target-triggered cyclic amplification reaction. Thus, this proposed strategy is anticipated to find use in basic biochemical research and clinical diagnosis.

  18. Selenium nanoparticles synthesized in aqueous extract of Allium sativum perturbs the structural integrity of Calf thymus DNA through intercalation and groove binding

    International Nuclear Information System (INIS)

    Ezhuthupurakkal, Preedia Babu; Polaki, Lokeswara Rao; Suyavaran, Arumugam; Subastri, Ariraman; Sujatha, Venugopal; Thirunavukkarasu, Chinnasamy

    2017-01-01

    Biomedical application of selenium nanoparticles (SeNPs) demands the eco-friendly composite for synthesis of SeNPs. The present study reports an aqueous extract of Allium sativum (AqEAS) plug-up the current need. Modern spectroscopic, microscopic and gravimetric techniques were employed to characterize the synthesized nanoparticles. Characterization studies revealed the formation of crystalline spherical shaped SeNPs. FTIR spectrum brings out the presence of different functional groups in AqEAS, which influence the SeNPs formation and stabilization. Furthermore the different aspects of the interaction between SeNPs and CT-DNA were scrutinized by various spectroscopic and cyclic voltametric studies. The results reveals the intercalation and groove binding mode of interaction of SeNPs with stacked base pair of CT-DNA. The Stern–Volmer quenching constant (K SV ) were found to be 7.02 × 10 6 Mˉ 1 (ethidium bromide), 4.22 × 10 6 Mˉ 1 (acridine orange) and 7.6 × 10 6 Mˉ 1 (Hoechst) indicating strong binding of SeNPs with CT–DNA. The SeNPs - CT-DNA interactions were directly visualized by atomic force microscopy. The present study unveils the cost effective, innocuous, highly stable SeNPs intricate mechanism of DNA interaction, which will be a milestone in DNA targeted chemotherapy. - Graphical abstract: Highly stable, innocuous, biocompatible SeNPs nanoparticle has been synthesized using Allium sativum (garlic) extract as reductant. The purity and crystallinity were characterized, further divulge the base pare interaction with Calf –Thymus DNA through various spectroscopic methods and atomic force microscopy. Display Omitted - Highlights: • Synthesis of SeNPs in aqueous extract of Allium sativum. • Characterization of synthesized SeNPs using high throughput techniques. • SeNPs directly interact with CT-DNA through intercalation and groove binding.

  19. Selenium nanoparticles synthesized in aqueous extract of Allium sativum perturbs the structural integrity of Calf thymus DNA through intercalation and groove binding

    Energy Technology Data Exchange (ETDEWEB)

    Ezhuthupurakkal, Preedia Babu; Polaki, Lokeswara Rao; Suyavaran, Arumugam; Subastri, Ariraman [Department of Biochemistry and Molecular Biology, Pondicherry University, Puducherry 605 014 (India); Sujatha, Venugopal [Department of Chemistry, Periyar University, Salem 636011 (India); Thirunavukkarasu, Chinnasamy, E-mail: tchinnasamy@hotmail.com [Department of Biochemistry and Molecular Biology, Pondicherry University, Puducherry 605 014 (India)

    2017-05-01

    Biomedical application of selenium nanoparticles (SeNPs) demands the eco-friendly composite for synthesis of SeNPs. The present study reports an aqueous extract of Allium sativum (AqEAS) plug-up the current need. Modern spectroscopic, microscopic and gravimetric techniques were employed to characterize the synthesized nanoparticles. Characterization studies revealed the formation of crystalline spherical shaped SeNPs. FTIR spectrum brings out the presence of different functional groups in AqEAS, which influence the SeNPs formation and stabilization. Furthermore the different aspects of the interaction between SeNPs and CT-DNA were scrutinized by various spectroscopic and cyclic voltametric studies. The results reveals the intercalation and groove binding mode of interaction of SeNPs with stacked base pair of CT-DNA. The Stern–Volmer quenching constant (K{sub SV}) were found to be 7.02 × 10{sup 6} Mˉ{sup 1} (ethidium bromide), 4.22 × 10{sup 6} Mˉ{sup 1} (acridine orange) and 7.6 × 10{sup 6} Mˉ{sup 1} (Hoechst) indicating strong binding of SeNPs with CT–DNA. The SeNPs - CT-DNA interactions were directly visualized by atomic force microscopy. The present study unveils the cost effective, innocuous, highly stable SeNPs intricate mechanism of DNA interaction, which will be a milestone in DNA targeted chemotherapy. - Graphical abstract: Highly stable, innocuous, biocompatible SeNPs nanoparticle has been synthesized using Allium sativum (garlic) extract as reductant. The purity and crystallinity were characterized, further divulge the base pare interaction with Calf –Thymus DNA through various spectroscopic methods and atomic force microscopy. Display Omitted - Highlights: • Synthesis of SeNPs in aqueous extract of Allium sativum. • Characterization of synthesized SeNPs using high throughput techniques. • SeNPs directly interact with CT-DNA through intercalation and groove binding.

  20. Selenium nanoparticles synthesized in aqueous extract of Allium sativum perturbs the structural integrity of Calf thymus DNA through intercalation and groove binding.

    Science.gov (United States)

    Ezhuthupurakkal, Preedia Babu; Polaki, Lokeswara Rao; Suyavaran, Arumugam; Subastri, Ariraman; Sujatha, Venugopal; Thirunavukkarasu, Chinnasamy

    2017-05-01

    Biomedical application of selenium nanoparticles (SeNPs) demands the eco-friendly composite for synthesis of SeNPs. The present study reports an aqueous extract of Allium sativum (AqEAS) plug-up the current need. Modern spectroscopic, microscopic and gravimetric techniques were employed to characterize the synthesized nanoparticles. Characterization studies revealed the formation of crystalline spherical shaped SeNPs. FTIR spectrum brings out the presence of different functional groups in AqEAS, which influence the SeNPs formation and stabilization. Furthermore the different aspects of the interaction between SeNPs and CT-DNA were scrutinized by various spectroscopic and cyclic voltametric studies. The results reveals the intercalation and groove binding mode of interaction of SeNPs with stacked base pair of CT-DNA. The Stern-Volmer quenching constant (K SV ) were found to be 7.02×10 6 M- 1 (ethidium bromide), 4.22×10 6 M- 1 (acridine orange) and 7.6×10 6 M- 1 (Hoechst) indicating strong binding of SeNPs with CT-DNA. The SeNPs - CT-DNA interactions were directly visualized by atomic force microscopy. The present study unveils the cost effective, innocuous, highly stable SeNPs intricate mechanism of DNA interaction, which will be a milestone in DNA targeted chemotherapy. Copyright © 2017 Elsevier B.V. All rights reserved.

  1. Real-Time Study of the Interaction between G-Rich DNA Oligonucleotides and Lead Ion on DNA Tetrahedron-Functionalized Sensing Platform by Dual Polarization Interferometry.

    Science.gov (United States)

    Wang, Shuang; Lu, Shasha; Zhao, Jiahui; Huang, Jianshe; Yang, Xiurong

    2017-11-29

    G-quadruplex plays roles in numerous physiological and pathological processes of organisms. Due to the unique properties of G-quadruplex (e.g., forming G4/hemin complexes with catalytic activity and electron acceptability, binding with metal ions, proteins, fluorescent ligands, and so on), it has been widely applied in biosensing. But the formation process of G-quadruplex is not yet fully understood. Here, a DNA tetrahedron platform with higher reproducibility, regenerative ability, and time-saving building process was coupled with dual polarization interferometry technique for the real-time and label-free investigation of the specific interaction process of guanine-rich singled-stranded DNA (G-rich ssDNA) and Pb 2+ . The oriented immobilization of probes greatly decreased the spatial hindrance effect and improved the accessibility of the probes to the Pb 2+ ions. Through real-time monitoring of the whole formation process of the G-quadruplex, we speculated that the probes on the tetrahedron platform initially stood on the sensing surface with a random coil conformation, then the G-rich ssDNA preliminarily formed unstable G-quartets by H-bonding and cation binding, subsequently forming a completely folded and stable quadruplex structure through relatively slow strand rearrangements. On the basis of these studies, we also developed a novel sensing platform for the specific and sensitive determination of Pb 2+ and its chelating agent ethylenediaminetetraacetic acid. This study not only provides a proof-of-concept for conformational dynamics of G-quadruplex-related drugs and pathogenes, but also enriches the biosensor tools by combining nanomaterial with interfaces technique.

  2. Fine-tuning alkyne cycloadditions: Insights into photochemistry responsible for the double-strand DNA cleavage via structural perturbations in diaryl alkyne conjugates

    Directory of Open Access Journals (Sweden)

    Igor V. Alabugin

    2011-06-01

    Full Text Available Hybrid molecules combining photoactivated aryl acetylenes and a dicationic lysine moiety cause the most efficient double-strand (ds DNA cleavage known to date for a small molecule. In order to test the connection between the alkylating ability and the DNA-damaging properties of these compounds, we investigated the photoreactivity of three isomeric aryl–tetrafluoropyridinyl (TFP alkynes with amide substituents in different positions (o-, m-, and p- toward a model π-system. Reactions with 1,4-cyclohexadiene (1,4-CHD were used to probe the alkylating properties of the triplet excited states in these three isomers whilst Stern–Volmer quenching experiments were used to investigate the kinetics of photoinduced electron transfer (PET. The three analogous isomeric lysine conjugates cleaved DNA with different efficiencies (34, 15, and 0% of ds DNA cleavage for p-, m-, and o-substituted lysine conjugates, respectively consistent with the alkylating ability of the respective acetamides. The significant protecting effect of the hydroxyl radical and singlet oxygen scavengers to DNA cleavage was shown only with m-lysine conjugate. All three isomeric lysine conjugates inhibited human melanoma cell growth under photoactivation: The p-conjugate had the lowest CC50 (50% cell cytotoxicity value of 1.49 × 10−7 M.

  3. Supersingular quantum perturbations

    International Nuclear Information System (INIS)

    Detwiler, L.C.; Klauder, J.R.

    1975-01-01

    A perturbation potential is called supersingular whenever generally every matrix element of the perturbation in the unperturbed eigenstates is infinite. It follows that supersingular perturbations do not have conventional perturbation expansions, say for energy eigenvalues. By invoking variational arguments, we determine the asymptotic behavior of the energy eigenvalues for asymptotically small values of the coupling constant of the supersingular perturbation

  4. Folding of guanine quadruplex molecules-funnel-like mechanism or kinetic partitioning? An overview from MD simulation studies

    Czech Academy of Sciences Publication Activity Database

    Šponer, Jiří; Bussi, G.; Stadlbauer, Petr; Kührová, P.; Banáš, P.; Islam, Barira; Haider, S.; Neidle, S.; Otyepka, M.

    2017-01-01

    Roč. 1861, č. 5 (2017), s. 1246-1263 ISSN 0304-4165 R&D Projects: GA ČR(CZ) GA16-13721S Institutional support: RVO:68081707 Keywords : telomeric g-quadruplex * parallel g-quadruplex Subject RIV: CE - Biochemistry OBOR OECD: Biochemistry and molecular biology Impact factor: 4.702, year: 2016

  5. TMPyP4 porphyrin distorts RNA G-quadruplex structures of the disease-associated r(GGGGCC)n repeat of the C9orf72 gene and blocks interaction of RNA-binding proteins.

    Science.gov (United States)

    Zamiri, Bita; Reddy, Kaalak; Macgregor, Robert B; Pearson, Christopher E

    2014-02-21

    Certain DNA and RNA sequences can form G-quadruplexes, which can affect genetic instability, promoter activity, RNA splicing, RNA stability, and neurite mRNA localization. Amyotrophic lateral sclerosis and frontotemporal dementia can be caused by expansion of a (GGGGCC)n repeat in the C9orf72 gene. Mutant r(GGGGCC)n- and r(GGCCCC)n-containing transcripts aggregate in nuclear foci, possibly sequestering repeat-binding proteins such as ASF/SF2 and hnRNPA1, suggesting a toxic RNA pathogenesis, as occurs in myotonic dystrophy. Furthermore, the C9orf72 repeat RNA was recently demonstrated to undergo the noncanonical repeat-associated non-AUG translation (RAN translation) into pathologic dipeptide repeats in patient brains, a process that is thought to depend upon RNA structure. We previously demonstrated that the r(GGGGCC)n RNA forms repeat tract length-dependent G-quadruplex structures that bind the ASF/SF2 protein. Here we show that the cationic porphyrin (5,10,15,20-tetra(N-methyl-4-pyridyl) porphyrin (TMPyP4)), which can bind some G-quadruplex-forming sequences, can bind and distort the G-quadruplex formed by r(GGGGCC)8, and this ablates the interaction of either hnRNPA1 or ASF/SF2 with the repeat. These findings provide proof of concept that nucleic acid binding small molecules, such as TMPyP4, can distort the secondary structure of the C9orf72 repeat, which may beneficially disrupt protein interactions, which may ablate either protein sequestration and/or RAN translation into potentially toxic dipeptides. Disruption of secondary structure formation of the C9orf72 RNA repeats may be a viable therapeutic avenue, as well as a means to test the role of RNA structure upon RAN translation.

  6. The binding efficiency of RPA to telomeric G-strands folded into contiguous G-quadruplexes is independent of the number of G4 units.

    Science.gov (United States)

    Lancrey, Astrid; Safa, Layal; Chatain, Jean; Delagoutte, Emmanuelle; Riou, Jean-François; Alberti, Patrizia; Saintomé, Carole

    2018-03-01

    Replication protein A (RPA) is a single-stranded DNA binding protein involved in replication and in telomere maintenance. During telomere replication, G-quadruplexes (G4) can accumulate on the lagging strand template and need to be resolved. It has been shown that human RPA is able to unfold a single G4. Nevertheless, the G-strand of human telomeres is prone to fold into higher-order structures formed by contiguous G-quadruplexes. To understand how RPA deals with these structures, we studied its interaction with telomeric G-strands folding into an increasing number of contiguous G4s. The aim of this study was to determine whether the efficiency of binding/unfolding of hRPA to telomeric G-strands depends on the number of G4 units. Our data show that the number n of contiguous G4 units (n ≥ 2) does not affect the efficiency of hRPA to coat transiently exposed single-stranded telomeric G-strands. This feature may be essential in preventing instability due to G4 structures during telomere replication. Copyright © 2017 Elsevier B.V. and Société Française de Biochimie et Biologie Moléculaire (SFBBM). All rights reserved.

  7. 6-Thioguanine alters the structure and stability of duplex DNA and inhibits quadruplex DNA formation.

    OpenAIRE

    Marathias, V M; Sawicki, M J; Bolton, P H

    1999-01-01

    The ability to chemically synthesize biomolecules has opened up the opportunity to observe changes in structure and activity that occur upon single atom substitution. In favorable cases this can provide information about the roles of individual atoms. The substitution of 6-thioguanine (6SG) for guanine is a potentially very useful single atom substitution as 6SG has optical, photocrosslinking, metal ion binding and other properties of potential utility. In addition, 6-mercaptopurine is a clin...

  8. Expanding the potential of G-quadruplex structures: formation of a heterochiral TBA analogue.

    Science.gov (United States)

    Virgilio, Antonella; Varra, Michela; Scuotto, Maria; Capuozzo, Antonella; Irace, Carlo; Mayol, Luciano; Esposito, Veronica; Galeone, Aldo

    2014-03-21

    In order to expand the potential applications of G-quadruplex structures, we explored the ability of heterochiral oligodeoxynucleotides based on the thrombin-binding aptamer (TBA) sequence to fold into similar complexes, with particular focus on their resistance in biological environments. A combination of CD and NMR techniques was used. Similarly to TBA, the ODN ggTTggtgtggTTgg (lower case letters indicate L residues) is able to fold into a chair-like antiparallel G-quadruplex structure, but has a slightly higher thermal stability. The discovery that heterochiral ODNs are able to form stable G-quadruplex structures opens up new possibilities for their development in several fields, as aptamers, sensors and, as recently shown, as catalysts for enantioselective reactions. © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  9. Dual inhibition of ATR and ATM potentiates the activity of trabectedin and lurbinectedin by perturbing the DNA damage response and homologous recombination repair.

    Science.gov (United States)

    Lima, Michelle; Bouzid, Hana; Soares, Daniele G; Selle, Frédéric; Morel, Claire; Galmarini, Carlos M; Henriques, João A P; Larsen, Annette K; Escargueil, Alexandre E

    2016-05-03

    Trabectedin (Yondelis®, ecteinascidin-743, ET-743) is a marine-derived natural product approved for treatment of advanced soft tissue sarcoma and relapsed platinum-sensitive ovarian cancer. Lurbinectedin is a novel anticancer agent structurally related to trabectedin. Both ecteinascidins generate DNA double-strand breaks that are processed through homologous recombination repair (HRR), thereby rendering HRR-deficient cells particularly sensitive. We here characterize the DNA damage response (DDR) to trabectedin and lurbinectedin in HeLa cells. Our results show that both compounds activate the ATM/Chk2 (ataxia-telangiectasia mutated/checkpoint kinase 2) and ATR/Chk1 (ATM and RAD3-related/checkpoint kinase 1) pathways. Interestingly, pharmacological inhibition of Chk1/2, ATR or ATM is not accompanied by any significant improvement of the cytotoxic activity of the ecteinascidins while dual inhibition of ATM and ATR strongly potentiates it. Accordingly, concomitant inhibition of both ATR and ATM is an absolute requirement to efficiently block the formation of γ-H2AX, MDC1, BRCA1 and Rad51 foci following exposure to the ecteinascidins. These results are not restricted to HeLa cells, but are shared by cisplatin-sensitive and -resistant ovarian carcinoma cells. Together, our data identify ATR and ATM as central coordinators of the DDR to ecteinascidins and provide a mechanistic rationale for combining these compounds with ATR and ATM inhibitors.

  10. Transcription arrest by a G quadruplex forming-trinucleotide repeat sequence from the human c-myb gene.

    Science.gov (United States)

    Broxson, Christopher; Beckett, Joshua; Tornaletti, Silvia

    2011-05-17

    Non canonical DNA structures correspond to genomic regions particularly susceptible to genetic instability. The transcription process facilitates formation of these structures and plays a major role in generating the instability associated with these genomic sites. However, little is known about how non canonical structures are processed when encountered by an elongating RNA polymerase. Here we have studied the behavior of T7 RNA polymerase (T7RNAP) when encountering a G quadruplex forming-(GGA)(4) repeat located in the human c-myb proto-oncogene. To make direct correlations between formation of the structure and effects on transcription, we have taken advantage of the ability of the T7 polymerase to transcribe single-stranded substrates and of G4 DNA to form in single-stranded G-rich sequences in the presence of potassium ions. Under physiological KCl concentrations, we found that T7 RNAP transcription was arrested at two sites that mapped to the c-myb (GGA)(4) repeat sequence. The extent of arrest did not change with time, indicating that the c-myb repeat represented an absolute block and not a transient pause to T7 RNAP. Consistent with G4 DNA formation, arrest was not observed in the absence of KCl or in the presence of LiCl. Furthermore, mutations in the c-myb (GGA)(4) repeat, expected to prevent transition to G4, also eliminated the transcription block. We show T7 RNAP arrest at the c-myb repeat in double-stranded DNA under conditions mimicking the cellular concentration of biomolecules and potassium ions, suggesting that the G4 structure formed in the c-myb repeat may represent a transcription roadblock in vivo. Our results support a mechanism of transcription-coupled DNA repair initiated by arrest of transcription at G4 structures.

  11. G-Quadruplex Identification in the Genome of Protozoan Parasites Points to Naphthalene Diimide Ligands as New Antiparasitic Agents.

    Science.gov (United States)

    Belmonte-Reche, Efres; Martínez-García, Marta; Guédin, Aurore; Zuffo, Michela; Arévalo-Ruiz, Matilde; Doria, Filippo; Campos-Salinas, Jenny; Maynadier, Marjorie; López-Rubio, José Juan; Freccero, Mauro; Mergny, Jean-Louis; Pérez-Victoria, José María; Morales, Juan Carlos

    2018-02-08

    G-quadruplexes (G4) are DNA secondary structures that take part in the regulation of gene expression. Putative G4 forming sequences (PQS) have been reported in mammals, yeast, bacteria, and viruses. Here, we present PQS searches on the genomes of T. brucei, L. major, and P. falciparum. We found telomeric sequences and new PQS motifs. Biophysical experiments showed that EBR1, a 29 nucleotide long highly repeated PQS in T. brucei, forms a stable G4 structure. G4 ligands based on carbohydrate conjugated naphthalene diimides (carb-NDIs) that bind G4's including hTel could bind EBR1 with selectivity versus dsDNA. These ligands showed important antiparasitic activity. IC 50 values were in the nanomolar range against T. brucei with high selectivity against MRC-5 human cells. Confocal microscopy confirmed these ligands localize in the nucleus and kinetoplast of T. brucei suggesting they can reach their potential G4 targets. Cytotoxicity and zebrafish toxicity studies revealed sugar conjugation reduces intrinsic toxicity of NDIs.

  12. Monovalent cation induced structural transitions in telomeric DNAs: G-DNA folding intermediates

    International Nuclear Information System (INIS)

    Hardin, C.C.; Watson, T.; Henderson, E.; Prosser, J.K.

    1991-01-01

    Telomeric DNA consists of G- and C-rich strands that are always polarized such that the G-rich strand extends past the 3' end of the duplex to form a 12-16-base overhang. These overhanging strands can self-associate in vitro to form intramolecular structures that have several unusual physical properties and at least one common feature, the presence of non-Watson-Crick G·G base pairs. The term G-DNA was coined for this class of structures. On the basis of gel electrophoresis, imino proton NMR, and circular dichroism (CD) results, the authors find that changing the counterions from sodium to potassium specifically induces conformational transitions in the G-rich telomeric DNA from Tetrahymena, d(T 2 G 4 ) 4 (TET4), which results in a change from the intramolecular species to an apparent multistranded structure, accompanied by an increase in the melting temperature of the base pairs of >25 degree, as monitored by loss of the imino proton NMR signals. They infer that the multistranded structure is a quadruplex. The results indicate that specific differences in ionic interactions can result in a switch in telomeric DNAs between intramolecular hairpin-like or quadruplex-containing species and intermolecular quadruplex structures, all of which involve G·G base pairing interaction. They propose a model in which duplex or hairpin forms of G-DNA are folding intermediates in the formation of either 1-, 2-, or 4-stranded quadruplex structures

  13. Complete-active-space second-order perturbation theory (CASPT2//CASSCF) study of the dissociative electron attachment in canonical DNA nucleobases caused by low-energy electrons (0-3 eV)

    Energy Technology Data Exchange (ETDEWEB)

    Francés-Monerris, Antonio; Segarra-Martí, Javier; Merchán, Manuela; Roca-Sanjuán, Daniel, E-mail: Daniel.Roca@uv.es [Instituto de Ciencia Molecular, Universitat de València, P.O. Box 22085, 46071 València (Spain)

    2015-12-07

    Low-energy (0-3 eV) ballistic electrons originated during the irradiation of biological material can interact with DNA/RNA nucleobases yielding transient-anion species which undergo decompositions. Since the discovery that these reactions can eventually lead to strand breaking of the DNA chains, great efforts have been dedicated to their study. The main fragmentation at the 0-3 eV energy range is the ejection of a hydrogen atom from the specific nitrogen positions. In the present study, the methodological approach introduced in a previous work on uracil [I. González-Ramírez et al., J. Chem. Theory Comput. 8, 2769-2776 (2012)] is employed to study the DNA canonical nucleobases fragmentations of N–H bonds induced by low-energy electrons. The approach is based on minimum energy path and linear interpolation of internal coordinates computations along the N–H dissociation channels carried out at the complete-active-space self-consistent field//complete-active-space second-order perturbation theory level. On the basis of the calculated theoretical quantities, new assignations for the adenine and cytosine anion yield curves are provided. In addition, the π{sub 1}{sup −} and π{sub 2}{sup −} states of the pyrimidine nucleobases are expected to produce the temporary anions at electron energies close to 1 and 2 eV, respectively. Finally, the present theoretical results do not allow to discard neither the dipole-bound nor the valence-bound mechanisms in the range of energies explored, suggesting that both possibilities may coexist in the experiments carried out with the isolated nucleobases.

  14. G-Quadruplexes influence pri-microRNA processing.

    Science.gov (United States)

    Rouleau, Samuel G; Garant, Jean-Michel; Bolduc, François; Bisaillon, Martin; Perreault, Jean-Pierre

    2018-02-01

    RNA G-Quadruplexes (G4) have been shown to possess many biological functions, including the regulation of microRNA (miRNA) biogenesis and function. However, their impact on pri-miRNA processing remains unknown. We identified G4 located near the Drosha cleavage site in three distinct pri-miRNAs: pri-mir200c, pri-mir451a, and pri-mir497. The folding of the potential G4 motifs was determined in solution. Subsequently, mutations disrupting G4 folding led to important changes in the mature miRNAs levels in cells. Moreover, using small antisense oligonucleotides binding to the pri-miRNA, it was possible to modulate, either positively or negatively, the mature miRNA levels. Together, these data demonstrate that G4 motifs could contribute to the regulation of pri-mRNA processing, a novel role for G4. Considering that bio-informatics screening indicates that between 9% and 50% of all pri-miRNAs contain a putative G4, these structures possess interesting potential as future therapeutic targets.

  15. Characterizing and controlling intrinsic biases of lambda exonuclease in nascent strand sequencing reveals phasing between nucleosomes and G-quadruplex motifs around a subset of human replication origins

    DEFF Research Database (Denmark)

    Foulk, M. S.; Urban, J. M.; Casella, Cinzia

    2015-01-01

    Nascent strand sequencing (NS-seq) is used to discover DNA replication origins genome-wide, allowing identification of features for their specification. NS-seq depends on the ability of lambda exonuclease (lambda-exo) to efficiently digest parental DNA while leaving RNA-primer protected nascent...... strands intact. We used genomics and biochemical approaches to determine if lambda-exo digests all parental DNA sequences equally. We report that lambda-exo does not efficiently digest G-quadruplex (G4) structures in a plasmid. Moreover, lambda-exo digestion of nonreplicating genomic DNA (LexoG0) enriches...... GC-rich DNA and G4 motifs genome-wide. We used LexoG0 data to control for nascent strand-independent lambda-exo biases in NSseq and validated this approach at the rDNA locus. The lambda-exo-controlled NS-seq peaks are not GC-rich, and only 35.5% overlap with 6.8% of all G4s, suggesting that G4s...

  16. Developments in perturbation theory

    International Nuclear Information System (INIS)

    Greenspan, E.

    1976-01-01

    Included are sections dealing with perturbation expressions for reactivity, methods for the calculation of perturbed fluxes, integral transport theory formulations for reactivity, generalized perturbation theory, sensitivity and optimization studies, multigroup calculations of bilinear functionals, and solution of inhomogeneous Boltzmann equations with singular operators

  17. Inverting the G-Tetrad Polarity of a G-Quadruplex by Using Xanthine and 8-Oxoguanine.

    Science.gov (United States)

    Cheong, Vee Vee; Lech, Christopher Jacques; Heddi, Brahim; Phan, Anh Tuân

    2016-01-04

    G-quadruplexes are four-stranded nucleic acid structures that are built from consecutively stacked guanine tetrad (G-tetrad) assemblies. The simultaneous incorporation of two guanine base lesions, xanthine (X) and 8-oxoguanine (O), within a single G-tetrad of a G-quadruplex was recently shown to lead to the formation of a stable G⋅G⋅X⋅O tetrad. Herein, a judicious introduction of X and O into a human telomeric G-quadruplex-forming sequence is shown to reverse the hydrogen-bond polarity of the modified G-tetrad while preserving the original folding topology. The control exerted over G-tetrad polarity by joint X⋅O modification will be valuable for the design and programming of G-quadruplex structures and their properties. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  18. Detection of G-Quadruplex Structures Formed by G-Rich Sequences from Rice Genome and Transcriptome Using Combined Probes.

    Science.gov (United States)

    Chang, Tianjun; Li, Weiguo; Ding, Zhan; Cheng, Shaofei; Liang, Kun; Liu, Xiangjun; Bing, Tao; Shangguan, Dihua

    2017-08-01

    Putative G-quadruplex (G4) forming sequences (PQS) are highly prevalent in the genome and transcriptome of various organisms and are considered as potential regulation elements in many biological processes by forming G4 structures. The formation of G4 structures highly depends on the sequences and the environment. In most cases, it is difficult to predict G4 formation by PQS, especially PQS containing G2 tracts. Therefore, the experimental identification of G4 formation is essential in the study of G4-related biological functions. Herein, we report a rapid and simple method for the detection of G4 structures by using a pair of complementary reporters, hemin and BMSP. This method was applied to detect G4 structures formed by PQS (DNA and RNA) searched in the genome and transcriptome of Oryza sativa. Unlike most of the reported G4 probes that only recognize part of G4 structures, the proposed method based on combined probes positively responded to almost all G4 conformations, including parallel, antiparallel, and mixed/hybrid G4, but did not respond to non-G4 sequences. This method shows potential for high-throughput identification of G4 structures in genome and transcriptome. Furthermore, BMSP was observed to drive some PQS to form more stable G4 structures or induce the G4 formation of some PQS that cannot form G4 in normal physiological conditions, which may provide a powerful molecular tool for gene regulation.

  19. Behavior of the guanine base in G-quadruplexes probed by the fluorescent guanine analog, 6-methyl isozanthopterin

    Energy Technology Data Exchange (ETDEWEB)

    Han, Ji Hoon; Chitrapriya, Nataraj; Lee, Hyun Suk; Lee, Young Ae; Kim, Seog K. [Dept. of Chemistry, Yeungnam University, Gyeongsan (Korea, Republic of); Jung, Maeng Joon [Dept. of Chemistry, Kyungpook National University, Daegu (Korea, Republic of)

    2017-02-15

    In this study, circular dichroism (CD) spectrum and fluorescence techniques were used to examine the dynamic properties and microenvironment of the guanine base (G) at the central loop and at the middle of the G-stem of the G-quadruplex formed from the G{sub 3}T{sub 2}G{sub 3}TGTG{sub 3}T{sub 2}G{sub 3} sequence (G-quadruplex 1), in which the G base at the 10th and 13th position were replaced with a fluorescent G analog, 6-methyl isoxanthopterin (6MI) (G-quadruplex 2 and 3, respectively). For all G-quadruplexes, the CD spectrum revealed a positive band at 263 nm and a shoulder at 298 nm, and the thermal melting profiles were the sum of at least two sigmoidal curves. These observations indicated the presence of two conformers in the G-quadruplex. The fluorescence intensity of G-quadruplex 2 was greater than 3, as expected from the extent of stacking interaction, which is larger in the G(6MI)G sequence than the T(6MI)T sequence. The efficiency of fluorescence quenching by the polar acrylamide quencher and negatively charged I− quencher were larger for G-quadruplex 3, suggesting that 6MI in the G(6MI)G stem is exposed more to the aqueous environment compared to that in the T(6MI)T central loop. In the latter case, 6MI may direct to the center of the top G-quartet layer. The possibility of hydrogen bond formation between the carbonyl group of 6MI and the acrylamide of the G-quadruplex 3 was proposed.

  20. Complex DNA structures and structures of DNA complexes

    International Nuclear Information System (INIS)

    Chazin, W.J.; Carlstroem, G.; Shiow-Meei Chen; Miick, S.; Gomez-Paloma, L.; Smith, J.; Rydzewski, J.

    1994-01-01

    Complex DNA structures (for example, triplexes, quadruplexes, junctions) and DNA-ligand complexes are more difficult to study by NMR than standard DNA duplexes are because they have high molecular weights, show nonstandard or distorted local conformations, and exhibit large resonance linewidths and severe 1 H spectral overlap. These systems also tend to have limited solubility and may require specialized solution conditions to maintain favorable spectral characteristics, which adds to the spectroscopic difficulties. Furthermore, with more atoms in the system, both assignment and structure calculation become more challenging. In this article, we focus on demonstrating the current status of NMR studies of such systems and the limitations to further progress; we also indicate in what ways isotopic enrichment can be useful

  1. Complex DNA structures and structures of DNA complexes

    Energy Technology Data Exchange (ETDEWEB)

    Chazin, W.J.; Carlstroem, G.; Shiow-Meei Chen; Miick, S.; Gomez-Paloma, L.; Smith, J.; Rydzewski, J. [Scripps Research Institute, La Jolla, CA (United States)

    1994-12-01

    Complex DNA structures (for example, triplexes, quadruplexes, junctions) and DNA-ligand complexes are more difficult to study by NMR than standard DNA duplexes are because they have high molecular weights, show nonstandard or distorted local conformations, and exhibit large resonance linewidths and severe {sup 1}H spectral overlap. These systems also tend to have limited solubility and may require specialized solution conditions to maintain favorable spectral characteristics, which adds to the spectroscopic difficulties. Furthermore, with more atoms in the system, both assignment and structure calculation become more challenging. In this article, we focus on demonstrating the current status of NMR studies of such systems and the limitations to further progress; we also indicate in what ways isotopic enrichment can be useful.

  2. Cockayne syndrome group A and B proteins converge on transcription-linked resolution of non-B DNA.

    Science.gov (United States)

    Scheibye-Knudsen, Morten; Tseng, Anne; Borch Jensen, Martin; Scheibye-Alsing, Karsten; Fang, Evandro Fei; Iyama, Teruaki; Bharti, Sanjay Kumar; Marosi, Krisztina; Froetscher, Lynn; Kassahun, Henok; Eckley, David Mark; Maul, Robert W; Bastian, Paul; De, Supriyo; Ghosh, Soumita; Nilsen, Hilde; Goldberg, Ilya G; Mattson, Mark P; Wilson, David M; Brosh, Robert M; Gorospe, Myriam; Bohr, Vilhelm A

    2016-11-01

    Cockayne syndrome is a neurodegenerative accelerated aging disorder caused by mutations in the CSA or CSB genes. Although the pathogenesis of Cockayne syndrome has remained elusive, recent work implicates mitochondrial dysfunction in the disease progression. Here, we present evidence that loss of CSA or CSB in a neuroblastoma cell line converges on mitochondrial dysfunction caused by defects in ribosomal DNA transcription and activation of the DNA damage sensor poly-ADP ribose polymerase 1 (PARP1). Indeed, inhibition of ribosomal DNA transcription leads to mitochondrial dysfunction in a number of cell lines. Furthermore, machine-learning algorithms predict that diseases with defects in ribosomal DNA (rDNA) transcription have mitochondrial dysfunction, and, accordingly, this is found when factors involved in rDNA transcription are knocked down. Mechanistically, loss of CSA or CSB leads to polymerase stalling at non-B DNA in a neuroblastoma cell line, in particular at G-quadruplex structures, and recombinant CSB can melt G-quadruplex structures. Indeed, stabilization of G-quadruplex structures activates PARP1 and leads to accelerated aging in Caenorhabditis elegans In conclusion, this work supports a role for impaired ribosomal DNA transcription in Cockayne syndrome and suggests that transcription-coupled resolution of secondary structures may be a mechanism to repress spurious activation of a DNA damage response.

  3. A new signal-on method for the detection of protein based on binding-induced strategy and photoinduced electron transfer between Ag nanoclusters and split G-quadruplex-hemin complexes

    Energy Technology Data Exchange (ETDEWEB)

    Zhang, Kai, E-mail: zhangkai@jsinm.org; Wang, Ke; Zhu, Xue; Xie, Minhao

    2015-08-05

    Proteins play important roles in biological and cellular processes. The levels of proteins can be useful biomarkers for cellular events or disease diagnosis, thus the method for sensitive and selective detection of proteins is imperative to proteins express, study, and clinical diagnosis. Herein, we report a “signal-on” platform for the assay of protein based on binding-induced strategy and photoinduced electron transfer between Ag nanoclusters and split G-quadruplex-hemin complexes. By using biotin as the affinity ligand, this simple protocol could sensitively detect streptavidin with a detection limit down to 10 pM. With the use of an antibody as the affinity ligand, a method for homogeneous fluorescence detection of Prostate Specific Antigen (PSA) was also proposed with a detection limit of 10 pM. The one-step and wash-free assay showed good selectivity. Its high sensitivity, acceptable accuracy, and satisfactory versatility of analytes led to various applications in bioanalysis. - Highlights: • AgNCs have great potential for application in biomedicine. • Binding of two affinity ligands can result in binding-induced DNA assemblies. • PET can be happened between DNA/AgNCs and G-quadruplex/hemin complexes. • A platform for the detection of proteins was proposed by using PET and binding-induced strategy.

  4. A G-quadruplex-containing RNA activates fluorescence in a GFP-like fluorophore

    Energy Technology Data Exchange (ETDEWEB)

    Huang, Hao; Suslov, Nikolai B.; Li, Nan-Sheng; Shelke, Sandip A.; Evans, Molly E.; Koldobskaya, Yelena; Rice, Phoebe A.; Piccirilli, Joseph A. [UC

    2014-08-21

    Spinach is an in vitro–selected RNA aptamer that binds a GFP-like ligand and activates its green fluorescence. Spinach is thus an RNA analog of GFP and has potentially widespread applications for in vivo labeling and imaging. We used antibody-assisted crystallography to determine the structures of Spinach both with and without bound fluorophore at 2.2-Å and 2.4-Å resolution, respectively. Spinach RNA has an elongated structure containing two helical domains separated by an internal bulge that folds into a G-quadruplex motif of unusual topology. The G-quadruplex motif and adjacent nucleotides comprise a partially preformed binding site for the fluorophore. The fluorophore binds in a planar conformation and makes extensive aromatic stacking and hydrogen bond interactions with the RNA. Our findings provide a foundation for structure-based engineering of new fluorophore-binding RNA aptamers.

  5. Status of perturbative QCD

    International Nuclear Information System (INIS)

    Collins, J.C.

    1985-01-01

    Progress in quantum chromodynamics in the past year is reviewed in these specific areas: proof of factorization for hadron-hadron collisions, fast calculation of higher order graphs, perturbative Monte Carlo calculations for hadron-hadron scattering, applicability of perturbative methods to heavy quark production, and understanding of the small-x problem. 22 refs

  6. A mRNA-Responsive G-Quadruplex-Based Drug Release System

    Directory of Open Access Journals (Sweden)

    Hidenobu Yaku

    2015-04-01

    Full Text Available G-quadruplex-based drug delivery carriers (GDDCs were designed to capture and release a telomerase inhibitor in response to a target mRNA. Hybridization between a loop on the GDDC structure and the mRNA should cause the G-quadruplex structure of the GDDC to unfold and release the bound inhibitor, anionic copper(II phthalocyanine (CuAPC. As a proof of concept, GDDCs were designed with a 10-30-mer loop, which can hybridize with a target sequence in epidermal growth factor receptor (EGFR mRNA. Structural analysis using circular dichroism (CD spectroscopy showed that the GDDCs form a (3 + 1 type G-quadruplex structure in 100 mM KCl and 10 mM MgCl2 in the absence of the target RNA. Visible absorbance titration experiments showed that the GDDCs bind to CuAPC with Ka values of 1.5 × 105 to 5.9 × 105 M−1 (Kd values of 6.7 to 1.7 μM at 25 °C, depending on the loop length. Fluorescence titration further showed that the G-quadruplex structure unfolds upon binding to the target RNA with Ka values above 1.0 × 108 M−1 (Kd values below 0.01 μM at 25 °C. These results suggest the carrier can sense and bind to the target RNA, which should result in release of the bound drug. Finally, visible absorbance titration experiments demonstrated that the GDDC release CuAPC in response to the target RNA.

  7. G-quadruplex formation in the Oct4 promoter positively regulates Oct4 expression

    Czech Academy of Sciences Publication Activity Database

    Renčiuk, Daniel; Ryneš, J.; Kejnovská, Iva; Foldynova-Trantirkova, S.; Andaeng, M.; Trantírek, L.; Vorlíčková, Michaela

    2017-01-01

    Roč. 1860, č. 2 (2017), s. 175-183 ISSN 1874-9399 R&D Projects: GA ČR(CZ) GP14-33947P; GA ČR GAP205/12/0466; GA ČR(CZ) GA15-06785S Institutional support: RVO:68081707 Keywords : linked polymorphic region * guanine quadruplexes * transcription factor Subject RIV: CE - Biochemistry OBOR OECD: Biochemistry and molecular biology Impact factor: 5.018, year: 2016

  8. Molecular dynamics simulations of guanine quadruplex loops: Advances and force field limitations

    Czech Academy of Sciences Publication Activity Database

    Fadrná, E.; Špačková, Naďa; Štefl, R.; Koča, J.; Cheatham III, T. E.; Šponer, Jiří

    2004-01-01

    Roč. 87, č. 1 (2004), s. 227-242 ISSN 0006-3495 R&D Projects: GA MŠk LN00A016 Grant - others:Wellcome Trust(GB) GR067507MF Institutional research plan: CEZ:AV0Z5004920 Keywords : quanine quadruplex * four-thymidine loop * locally enhanced sampling Subject RIV: BO - Biophysics Impact factor: 4.585, year: 2004

  9. Quadruplex-forming properties of FRAXA (CGG) repeats interrupted by (AGG) triplets

    Czech Academy of Sciences Publication Activity Database

    Renčiuk, Daniel; Zemánek, Michal; Kejnovská, Iva; Vorlíčková, Michaela

    2009-01-01

    Roč. 91, č. 3 (2009), s. 416-422 ISSN 0300-9084 R&D Projects: GA ČR(CZ) GA204/07/0057; GA AV ČR(CZ) IAA100040701 Institutional research plan: CEZ:AV0Z50040507; CEZ:AV0Z50040702 Keywords : fragile X-chromosome * quadruplex * CD spectroscopy Subject RIV: BO - Biophysics Impact factor: 3.897, year: 2009

  10. Perturbative and constructive renormalization

    International Nuclear Information System (INIS)

    Veiga, P.A. Faria da

    2000-01-01

    These notes are a survey of the material treated in a series of lectures delivered at the X Summer School Jorge Andre Swieca. They are concerned with renormalization in Quantum Field Theories. At the level of perturbation series, we review classical results as Feynman graphs, ultraviolet and infrared divergences of Feynman integrals. Weinberg's theorem and Hepp's theorem, the renormalization group and the Callan-Symanzik equation, the large order behavior and the divergence of most perturbation series. Out of the perturbative regime, as an example of a constructive method, we review Borel summability and point out how it is possible to circumvent the perturbation diseases. These lectures are a preparation for the joint course given by professor V. Rivasseau at the same school, where more sophisticated non-perturbative analytical methods based on rigorous renormalization group techniques are presented, aiming at furthering our understanding about the subject and bringing field theoretical models to a satisfactory mathematical level. (author)

  11. Hsa-miR-1587 G-quadruplex formation and dimerization induced by NH4+, molecular crowding environment and jatrorrhizine derivatives.

    Science.gov (United States)

    Tan, Wei; Yi, Long; Zhu, Zhentao; Zhang, Lulu; Zhou, Jiang; Yuan, Gu

    2018-03-01

    A guanine-rich human mature microRNA, miR-1587, was discovered to form stable intramolecular G-quadruplexes in the presence of K + , Na + and low concentration of NH 4 + (25mM) by electrospray ionization mass spectrometry (ESI-MS) combined with circular dichroism (CD) spectroscopy. Furthermore, under high concentration of NH 4 + (100mM) or molecular crowding environments, miR-1587 formed a dimeric G-quadruplex through 3'-to-3' stacking of two monomeric G-quadruplex subunits with one ammonium ion sandwiched between the interfaces. Specifically, two synthesized jatrorrhizine derivatives with terminal amine groups could also induce the dimerization of miR-1587 G-quadruplex and formed 1:1 and 2:1 complexes with the dimeric G-quadruplex. In contrast, jatrorrhizine could bind with the dimeric miR-1587 G-quadruplex, but could not induce dimerization of miR-1587 G-quadruplex. These results provide a new strategy to regulate the functions of miR-1587 through induction of G-quadruplex formation and dimerization. Copyright © 2017 Elsevier B.V. All rights reserved.

  12. The role of alkali metal cations in the stabilization of guanine quadruplexes: why K(+) is the best.

    Science.gov (United States)

    Zaccaria, F; Paragi, G; Fonseca Guerra, C

    2016-08-21

    The alkali metal ion affinity of guanine quadruplexes has been studied using dispersion-corrected density functional theory (DFT-D). We have done computational investigations in aqueous solution that mimics artificial supramolecular conditions where guanine bases assemble into stacked quartets as well as biological environments in which telomeric quadruplexes are formed. In both cases, an alkali metal cation is needed to assist self-assembly. Our quantum chemical computations on these supramolecular systems are able to reproduce the experimental order of affinity of the guanine quadruplexes for the cations Li(+), Na(+), K(+), Rb(+), and Cs(+). The strongest binding is computed between the potassium cation and the quadruplex as it occurs in nature. The desolvation and the size of alkali metal cations are thought to be responsible for the order of affinity. Until now, the relative importance of these two factors has remained unclear and debated. By assessing the quantum chemical 'size' of the cation, determining the amount of deformation of the quadruplex needed to accommodate the cation and through the energy decomposition analysis (EDA) of the interaction energy between the cation and the guanines, we reveal that the desolvation and size of the alkali metal cation are both almost equally responsible for the order of affinity.

  13. Structure and possible function of a G-quadruplex in the long terminal repeat of the proviral HIV-1 genome.

    Science.gov (United States)

    De Nicola, Beatrice; Lech, Christopher J; Heddi, Brahim; Regmi, Sagar; Frasson, Ilaria; Perrone, Rosalba; Richter, Sara N; Phan, Anh Tuân

    2016-07-27

    The long terminal repeat (LTR) of the proviral human immunodeficiency virus (HIV)-1 genome is integral to virus transcription and host cell infection. The guanine-rich U3 region within the LTR promoter, previously shown to form G-quadruplex structures, represents an attractive target to inhibit HIV transcription and replication. In this work, we report the structure of a biologically relevant G-quadruplex within the LTR promoter region of HIV-1. The guanine-rich sequence designated LTR-IV forms a well-defined structure in physiological cationic solution. The nuclear magnetic resonance (NMR) structure of this sequence reveals a parallel-stranded G-quadruplex containing a single-nucleotide thymine bulge, which participates in a conserved stacking interaction with a neighboring single-nucleotide adenine loop. Transcription analysis in a HIV-1 replication competent cell indicates that the LTR-IV region may act as a modulator of G-quadruplex formation in the LTR promoter. Consequently, the LTR-IV G-quadruplex structure presented within this work could represent a valuable target for the design of HIV therapeutics. © The Author(s) 2016. Published by Oxford University Press on behalf of Nucleic Acids Research.

  14. Characterizing and controlling intrinsic biases of lambda exonuclease in nascent strand sequencing reveals phasing between nucleosomes and G-quadruplex motifs around a subset of human replication origins.

    Science.gov (United States)

    Foulk, Michael S; Urban, John M; Casella, Cinzia; Gerbi, Susan A

    2015-05-01

    Nascent strand sequencing (NS-seq) is used to discover DNA replication origins genome-wide, allowing identification of features for their specification. NS-seq depends on the ability of lambda exonuclease (λ-exo) to efficiently digest parental DNA while leaving RNA-primer protected nascent strands intact. We used genomics and biochemical approaches to determine if λ-exo digests all parental DNA sequences equally. We report that λ-exo does not efficiently digest G-quadruplex (G4) structures in a plasmid. Moreover, λ-exo digestion of nonreplicating genomic DNA (LexoG0) enriches GC-rich DNA and G4 motifs genome-wide. We used LexoG0 data to control for nascent strand-independent λ-exo biases in NS-seq and validated this approach at the rDNA locus. The λ-exo-controlled NS-seq peaks are not GC-rich, and only 35.5% overlap with 6.8% of all G4s, suggesting that G4s are not general determinants for origin specification but may play a role for a subset. Interestingly, we observed a periodic spacing of G4 motifs and nucleosomes around the peak summits, suggesting that G4s may position nucleosomes at this subset of origins. Finally, we demonstrate that use of Na(+) instead of K(+) in the λ-exo digestion buffer reduced the effect of G4s on λ-exo digestion and discuss ways to increase both the sensitivity and specificity of NS-seq. © 2015 Foulk et al.; Published by Cold Spring Harbor Laboratory Press.

  15. Perturbative QCD and jets

    International Nuclear Information System (INIS)

    Mueller, A.H.

    1986-03-01

    A brief review of some of the recent progress in perturbative QCD is given (heavy quark production, small-x physics, minijets and related topics, classical simulations in high energy reactions, coherence and the string effect)

  16. Generalized chiral perturbation theory

    International Nuclear Information System (INIS)

    Knecht, M.; Stern, J.

    1994-01-01

    The Generalized Chiral Perturbation Theory enlarges the framework of the standard χPT (Chiral Perturbation Theory), relaxing certain assumptions which do not necessarily follow from QCD or from experiment, and which are crucial for the usual formulation of the low energy expansion. In this way, experimental tests of the foundations of the standard χPT become possible. Emphasis is put on physical aspects rather than on formal developments of GχPT. (author). 31 refs

  17. Investigation of hyperfine interactions in DNA and antibody of different lineages of mice infected by T. cruzi by perturbed gamma-gamma angular correlation spectroscopy; Investigacao de interacoes hiperfinas em DNA e anticorpos de diferentes linhagens de camundongos frente a infeccao por T. cruzi pela epectroscopia de correlacao angular gama-gama perturbada

    Energy Technology Data Exchange (ETDEWEB)

    Silva, Andreia dos Santos

    2012-07-01

    In the present work perturbed angular correlation (PAC) spectroscopy was used to measured electric quadrupole interactions in DNA biomolecules of different mice lineages (A/J, C57BL/6, B6AF1, BXA1 e BXA2), samples of different isotypes of immunoglobulin G (IgG1, IgG2a e IgG2b) and active portions of complete and fragmented immunoglobulin responsible by the immune response. Electric quadrupole interactions were also measured in DNA nitrogenous bases (adenine, cytosine, guanine, thymine). PAC measurements were performed using {sup 111}In {yields} {sup 111C}d; {sup 111mC}d {yields} {sup 111}Cd; {sup 111}Ag {yields} {sup 111}Cd; e {sup 181}Hf {yields} {sup 181}Ta as probe nuclei, and carried out at room temperature and liquid nitrogen temperature, in order to investigate dynamic and static hyperfine interactions, respectively. The biomolecule samples were directly marked with the radioactive parent nuclei, whose atom link to a certain site in the biomolecules. The biological materials as well as the probe nuclei were chosen to investigate the possibility to use PAC spectroscopy to measure hyperfine parameters at nuclei from metallic elements bound to biomolecules (including the use of different probe nuclei produced in the decay of parent nuclei of four different metals) and also to study the behavior of different biomolecules by means of the measured hyperfine parameters. Results show differences in the hyperfine interactions of probe nuclei bound to the studied biomolecules. Such differences were observed by variations in the hyperfine parameters, which depend on the type of biomolecule and the results also show that the probe nuclei atom bound to the molecule in some cases and in others do not. (author)

  18. Enhanced anti-HIV-1 activity of G-quadruplexes comprising locked nucleic acids and intercalating nucleic acids

    DEFF Research Database (Denmark)

    Pedersen, Erik Bjerregaard; Nielsen, Jakob Toudahl; Nielsen, Claus

    2011-01-01

    Two G-quadruplex forming sequences, 50-TGGGAG and the 17-mer sequence T30177, which exhibit anti-HIV-1 activity on cell lines, were modified using either locked nucleic acids (LNA) or via insertions of (R)-1-O-(pyren-1-ylmethyl)glycerol (intercalating nucleic acid, INA) or (R)-1-O-[4-(1......-pyrenylethynyl)phenylmethyl]glycerol (twisted intercalating nucleic acid, TINA). Incorporation of LNA or INA/TINA monomers provide as much as 8-fold improvement of anti-HIV-1 activity. We demonstrate for the first time a detailed analysis of the effect the incorporation of INA/TINA monomers in quadruplex forming...

  19. p53 binds human telomeric G-quadruplex in vitro

    Czech Academy of Sciences Publication Activity Database

    Adámik, Matěj; Kejnovská, Iva; Bažantová, Pavla; Petr, Marek; Renčiuk, Daniel; Vorlíčková, Michaela; Brázdová, Marie

    2016-01-01

    Roč. 128, SEPT2016 (2016), s. 83-91 ISSN 0300-9084 R&D Projects: GA ČR GA13-36108S; GA ČR(CZ) GP14-33947P Institutional support: RVO:68081707 Keywords : crystal-structure * human-chromosomes * supercoiled dna Subject RIV: BO - Biophysics Impact factor: 3.112, year: 2016

  20. Perturbative anyon gas

    International Nuclear Information System (INIS)

    Dasnieres de Veigy, A.; Ouvry, S.; Paris-6 Univ., 75

    1992-06-01

    The problem of the statistical mechanics of an anyon gas is addressed. A perturbative analysis in the anyonic coupling constant α is reviewed, and the thermodynamical potential is computed at first and second order. An adequate second quantized formalism (field theory at finite temperature) is proposed. At first order in perturbation theory, the results are strikingly simple: only the second virial coefficient close to bosonic statistics is corrected. At second order, however, the complexity of the anyon model appears. One can compute exactly the perturbative correction to each cluster coefficient. However, and contrary to first order, a closed expression for the equation of state seems out of reach. As an illustration, the perturbative expressions of a 3 , a 4 , a 5 and a 6 are given at second order. Finally, using the same formalism, the equation of state of an anyon gas in a constant magnetic field is analyzed at first order in perturbation theory. (K.A.) 16 refs.; 3 figs.; 7 tabs

  1. DNA methylation

    DEFF Research Database (Denmark)

    Williams, Kristine; Christensen, Jesper; Helin, Kristian

    2012-01-01

    DNA methylation is involved in key cellular processes, including X-chromosome inactivation, imprinting and transcriptional silencing of specific genes and repetitive elements. DNA methylation patterns are frequently perturbed in human diseases such as imprinting disorders and cancer. The recent...... discovery that the three members of the TET protein family can convert 5-methylcytosine (5mC) into 5-hydroxymethylcytosine (5hmC) has provided a potential mechanism leading to DNA demethylation. Moreover, the demonstration that TET2 is frequently mutated in haematopoietic tumours suggests that the TET...... proteins are important regulators of cellular identity. Here, we review the current knowledge regarding the function of the TET proteins, and discuss various mechanisms by which they contribute to transcriptional control. We propose that the TET proteins have an important role in regulating DNA methylation...

  2. Formation of a unique cluster of G-quadruplex structures in the HIV-1 Nef coding region: implications for antiviral activity.

    Directory of Open Access Journals (Sweden)

    Rosalba Perrone

    Full Text Available G-quadruplexes are tetraplex structures of nucleic acids that can form in G-rich sequences. Their presence and functional role have been established in telomeres, oncogene promoters and coding regions of the human chromosome. In particular, they have been proposed to be directly involved in gene regulation at the level of transcription. Because the HIV-1 Nef protein is a fundamental factor for efficient viral replication, infectivity and pathogenesis in vitro and in vivo, we investigated G-quadruplex formation in the HIV-1 nef gene to assess the potential for viral inhibition through G-quadruplex stabilization. A comprehensive computational analysis of the nef coding region of available strains showed the presence of three conserved sequences that were uniquely clustered. Biophysical testing proved that G-quadruplex conformations were efficiently stabilized or induced by G-quadruplex ligands in all three sequences. Upon incubation with a G-quadruplex ligand, Nef expression was reduced in a reporter gene assay and Nef-dependent enhancement of HIV-1 infectivity was significantly repressed in an antiviral assay. These data constitute the first evidence of the possibility to regulate HIV-1 gene expression and infectivity through G-quadruplex targeting and therefore open a new avenue for viral treatment.

  3. Duplex/quadruplex oligonucleotides: Role of the duplex domain in the stabilization of a new generation of highly effective anti-thrombin aptamers.

    Science.gov (United States)

    Russo Krauss, Irene; Napolitano, Valeria; Petraccone, Luigi; Troisi, Romualdo; Spiridonova, Vera; Mattia, Carlo Andrea; Sica, Filomena

    2018-02-01

    Recently, mixed duplex/quadruplex oligonucleotides have attracted great interest for use as biomedical aptamers. In the case of anti-thrombin aptamers, the addition of duplex-forming sequences to a G-quadruplex module identical or very similar to the best-known G-quadruplex of the Thrombin Binding Aptamer (HD1) results in new or improved biological properties, such as higher activity or different recognition properties with respect to HD1. Remarkably, this bimodular fold was hypothesized, based on its sequence, for the only anti-thrombin aptamer in advanced clinical trial, NU172. Whereas cation modulation of G-quadruplex conformation and stability is well characterized, only few data from similar analysis on duplex/quadruplex oligonucleotides exist. Here we have performed a characterization of structure and stability of four different duplex/quadruplex anti-thrombin aptamers, including NU172, in the presence of different cations and in physiological-mimicking conditions in comparison to HD1, by means of spectroscopic techniques (UV and circular dichroism) and differential scanning calorimetry. Our data show a strong reciprocal influence of each domain on the stability of the other and in particular suggest a stabilizing effect of the duplex region in the presence of solutions mimicking the physiological conditions, strengthening the idea that bimodular aptamers present better therapeutic potentialities than those containing a single G-quadruplex domain. Copyright © 2017 Elsevier B.V. All rights reserved.

  4. Synthesis of New DNA G-Quadruplex Constructs with Anthraquinone Insertions and Their Anticoagulant Activity

    DEFF Research Database (Denmark)

    Gouda, Alaa S.; Amine, Mahasen S.; Pedersen, Erik Bjerregaard

    2016-01-01

    1,4-Dihydroxyanthraquinone and 1,8-dihydroxyanthraquinone were alkylated with 3-bromopropan-1-ol and subsequently transformed into the corresponding DMT protected phosphoramidite building blocks for insertion into loops of the Gquadruplex of the thrombin binding aptamer (TBA). The 1,4-disubstituted...... potassium buffer conditions as previously observed for TBA. Although the majority of the anthraquinone modified TBA analogues showed a decrease in clotting times in a fibrinogen clotting assay when compared to TBA, modified aptamers containing a 1,8-disubstituted anthraquinone linker replacing G8 or T9...

  5. Exploring the Dynamics of Propeller Loops in Human Telomeric DNA Quadruplexes Using Atomistic Simulations

    Czech Academy of Sciences Publication Activity Database

    Islam, Barira; Stadlbauer, Petr; Gil-Ley, A.; Perez-Hernandez, J.A.; Haider, S.M.; Neidle, S.; Bussi, G.; Banáš, P.; Otyepka, Michal; Šponer, Jiří

    2017-01-01

    Roč. 13, č. 6 (2017), s. 2458-2480 ISSN 1549-9618 R&D Projects: GA ČR(CZ) GA16-13721S Institutional support: RVO:68081707 Keywords : amber force -field * particle mesh ewald Subject RIV: CF - Physical ; Theoretical Chemistry OBOR OECD: Physical chemistry Impact factor: 5.245, year: 2016

  6. Enzyme-free colorimetric detection systems based on the DNA strand displacement competition reaction

    DEFF Research Database (Denmark)

    Zhang, Zhao; Birkedal, Victoria; Gothelf, Kurt Vesterager

    2016-01-01

    The strand displacement competition assay is based on the dynamic equilibrium of the competitive hybridization of two oligonucleotides (A and B) to a third oligonucleotide (S). In the presence of an analyte that binds to a specific affinity-moiety conjugated to strand B, the equilibrium shifts, w...... G-quadruplex DNAzyme for colorimetric readout of the detection of streptavidin by the naked eye. Finally, we integrate the whole G-quadruplex DNAzyme system in a single DNA strand and show that it is applicable to colorimetric detection......., which can be detected by a shift in the fluorescence resonance energy transfer signal between dyes attached to the DNA strands. In the present study we have integrated an ATP aptamer in the strand B and demonstrated the optical detection of ATP. Furthermore we explore a new readout method using a split...

  7. Enzyme-free colorimetric detection systems based on the DNA strand displacement competition reaction

    Science.gov (United States)

    Zhang, Z.; Birkedal, V.; Gothelf, K. V.

    2016-05-01

    The strand displacement competition assay is based on the dynamic equilibrium of the competitive hybridization of two oligonucleotides (A and B) to a third oligonucleotide (S). In the presence of an analyte that binds to a specific affinity-moiety conjugated to strand B, the equilibrium shifts, which can be detected by a shift in the fluorescence resonance energy transfer signal between dyes attached to the DNA strands. In the present study we have integrated an ATP aptamer in the strand B and demonstrated the optical detection of ATP. Furthermore we explore a new readout method using a split G-quadruplex DNAzyme for colorimetric readout of the detection of streptavidin by the naked eye. Finally, we integrate the whole G-quadruplex DNAzyme system in a single DNA strand and show that it is applicable to colorimetric detection.

  8. Giardia telomeric sequence d(TAGGG)4 forms two intramolecular G-quadruplexes in K+ solution: effect of loop length and sequence on the folding topology.

    Science.gov (United States)

    Hu, Lanying; Lim, Kah Wai; Bouaziz, Serge; Phan, Anh Tuân

    2009-11-25

    Recently, it has been shown that in K(+) solution the human telomeric sequence d[TAGGG(TTAGGG)(3)] forms a (3 + 1) intramolecular G-quadruplex, while the Bombyx mori telomeric sequence d[TAGG(TTAGG)(3)], which differs from the human counterpart only by one G deletion in each repeat, forms a chair-type intramolecular G-quadruplex, indicating an effect of G-tract length on the folding topology of G-quadruplexes. To explore the effect of loop length and sequence on the folding topology of G-quadruplexes, here we examine the structure of the four-repeat Giardia telomeric sequence d[TAGGG(TAGGG)(3)], which differs from the human counterpart only by one T deletion within the non-G linker in each repeat. We show by NMR that this sequence forms two different intramolecular G-quadruplexes in K(+) solution. The first one is a novel basket-type antiparallel-stranded G-quadruplex containing two G-tetrads, a G x (A-G) triad, and two A x T base pairs; the three loops are consecutively edgewise-diagonal-edgewise. The second one is a propeller-type parallel-stranded G-quadruplex involving three G-tetrads; the three loops are all double-chain-reversal. Recurrence of several structural elements in the observed structures suggests a "cut and paste" principle for the design and prediction of G-quadruplex topologies, for which different elements could be extracted from one G-quadruplex and inserted into another.

  9. Ultrasensitive photoelectrochemical aptasensor for lead ion detection based on sensitization effect of CdTe QDs on MoS2-CdS:Mn nanocomposites by the formation of G-quadruplex structure.

    Science.gov (United States)

    Shi, Jian-Jun; Zhu, Jing-Chun; Zhao, Ming; Wang, Yan; Yang, Ping; He, Jie

    2018-06-01

    An ultrasensitive photoelectrochemical (PEC) aptasensor for lead ion (Pb 2+ ) detection was fabricated based on MoS 2 -CdS:Mn nanocomposites and sensitization effect of CdTe quantum dots (QDs). MoS 2 -CdS:Mn modified electrode was used as the PEC matrix for the immobilization of probe DNA (pDNA) labeled with CdTe QDs. Target DNA (tDNA) were hybridized with pDNA to made the QDs locate away from the electrode surface by the rod-like double helix. The detection of Pb 2+ was based on the conformational change of the pDNA to G-quadruplex structure in the presence of Pb 2+ , which made the labeled QDs move close to the electrode surface, leading to the generation of sensitization effect and evident increase of the photocurrent intensity. The linear range was 50 fM to 100 nM with a detection limit of 16.7 fM. The recoveries of the determination of Pb 2+ in real samples were in the range of 102.5-108.0%. This proposed PEC aptasensor provides a new sensing strategy for various heavy metal ions at ultralow levels. Copyright © 2018 Elsevier B.V. All rights reserved.

  10. Chiral perturbation theory

    International Nuclear Information System (INIS)

    Ecker, G.

    1996-06-01

    After a general introduction to the structure of effective field theories, the main ingredients of chiral perturbation theory are reviewed. Applications include the light quark mass ratios and pion-pion scattering to two-loop accuracy. In the pion-nucleon system, the linear σ model is contrasted with chiral perturbation theory. The heavy-nucleon expansion is used to construct the effective pion-nucleon Lagrangian to third order in the low-energy expansion, with applications to nucleon Compton scattering. (author)

  11. Equilibrious Strand Exchange Promoted by DNA Conformational Switching

    Science.gov (United States)

    Wu, Zhiguo; Xie, Xiao; Li, Puzhen; Zhao, Jiayi; Huang, Lili; Zhou, Xiang

    2013-01-01

    Most of DNA strand exchange reactions in vitro are based on toehold strategy which is generally nonequilibrium, and intracellular strand exchange mediated by proteins shows little sequence specificity. Herein, a new strand exchange promoted by equilibrious DNA conformational switching is verified. Duplexes containing c-myc sequence which is potentially converted into G-quadruplex are designed in this strategy. The dynamic equilibrium between duplex and G4-DNA is response to the specific exchange of homologous single-stranded DNA (ssDNA). The SER is enzyme free and sequence specific. No ATP is needed and the displaced ssDNAs are identical to the homologous ssDNAs. The SER products and exchange kenetics are analyzed by PAGE and the RecA mediated SER is performed as the contrast. This SER is a new feature of G4-DNAs and a novel strategy to utilize the dynamic equilibrium of DNA conformations.

  12. i-Motif of cytosine-rich human telomere DNA fragments containing natural base lesions

    Czech Academy of Sciences Publication Activity Database

    Dvořáková, Zuzana; Renčiuk, Daniel; Kejnovská, Iva; Školáková, Petra; Bednářová, Klára; Sagi, J.; Vorlíčková, Michaela

    2018-01-01

    Roč. 46, č. 4 (2018), s. 1624-1634 ISSN 1362-4962 R&D Projects: GA ČR(CZ) GA15-06785S; GA ČR GA17-12075S; GA ČR(CZ) GJ17-19170Y; GA MŠk EF15_003/0000477 Institutional support: RVO:68081707 Keywords : pair opening kinetics * g-quadruplex dna Subject RIV: CE - Biochemistry OBOR OECD: Biochemistry and molecular biology

  13. Evaluation of the Stability of DNA i-Motifs in the Nuclei of Living Mammalian Cells

    Czech Academy of Sciences Publication Activity Database

    Dzatko, S.; Krafčíková, M.; Haensel-Hertsch, R.; Fessl, T.; Fiala, R.; Loja, T.; Krafčík, D.; Mergny, Jean-Louis; Foldynova-Trantirkova, Silvie; Trantírek, L.

    2018-01-01

    Roč. 57, č. 8 (2018), s. 2165-2169 ISSN 1433-7851 R&D Projects: GA MŠk EF15_003/0000477 Institutional support: RVO:68081707 Keywords : g-quadruplex * telomeric dna * base-pairs * molecular switch Subject RIV: CG - Electrochemistry OBOR OECD: Electrochemistry (dry cells, batteries, fuel cells, corrosion metals, electrolysis) Impact factor: 11.994, year: 2016

  14. Oligomer formation and G-quadruplex binding by purified murine Rif1 protein, a key organizer of higher-order chromatin architecture.

    Science.gov (United States)

    Moriyama, Kenji; Yoshizawa-Sugata, Naoko; Masai, Hisao

    2018-03-09

    Rap1-interacting protein 1 (Rif1) regulates telomere length in budding yeast. We previously reported that, in metazoans and fission yeast, Rif1 also plays pivotal roles in controlling genome-wide DNA replication timing. We proposed that Rif1 may assemble chromatin compartments that contain specific replication-timing domains by promoting chromatin loop formation. Rif1 also is involved in DNA lesion repair, restart after replication fork collapse, anti-apoptosis activities, replicative senescence, and transcriptional regulation. Although multiple physiological functions of Rif1 have been characterized, biochemical and structural information on mammalian Rif1 is limited, mainly because of difficulties in purifying the full-length protein. Here, we expressed and purified the 2418-amino-acid-long, full-length murine Rif1 as well as its partially truncated variants in human 293T cells. Hydrodynamic analyses indicated that Rif1 forms elongated or extended homo-oligomers in solution, consistent with the presence of a HEAT-type helical repeat segment known to adopt an elongated shape. We also observed that the purified murine Rif1 bound G-quadruplex (G4) DNA with high specificity and affinity, as was previously shown for Rif1 from fission yeast. Both the N-terminal (HEAT-repeat) and C-terminal segments were involved in oligomer formation and specifically bound G4 DNA, and the central intrinsically disordered polypeptide segment increased the affinity for G4. Of note, pulldown assays revealed that Rif1 simultaneously binds multiple G4 molecules. Our findings support a model in which Rif1 modulates chromatin loop structures through binding to multiple G4 assemblies and by holding chromatin fibers together. © 2018 by The American Society for Biochemistry and Molecular Biology, Inc.

  15. Preheating curvaton perturbations

    International Nuclear Information System (INIS)

    Bastero-Gil, M.; Di Clemente, V.; King, S.F.

    2005-01-01

    We discuss the potentially important role played by preheating in certain variants of the curvaton mechanism in which isocurvature perturbations of a D-flat (and F-flat) direction become converted to curvature perturbations during reheating. We discover that parametric resonance of the isocurvature components amplifies the superhorizon fluctuations by a significant amount. As an example of these effects we develop a particle physics motivated model which involves hybrid inflation with the waterfall field N being responsible for generating the μ term, the right-handed neutrino mass scale, and the Peccei-Quinn symmetry breaking scale. The role of the curvaton field can be played either by usual Higgs field, or the lightest right-handed sneutrino. Our new results show that it is possible to achieve the correct curvature perturbations for initial values of the curvaton fields of order the weak scale. In this model we show that the prediction for the spectral index of the final curvature perturbation only depends on the mass of the curvaton during inflation, where consistency with current observational data requires the ratio of this mass to the Hubble constant to be 0.3

  16. String perturbation theory diverges

    International Nuclear Information System (INIS)

    Gross, D.J.; Periwal, V.

    1988-01-01

    We prove that perturbation theory for the bosonic string diverges for arbitrary values of the coupling constant and is not Borel summable. This divergence is independent of the existence of the infinities that occur in the theory due to the presence of tachyons and dilaton tadpoles. We discuss the physical implications of such a divergence

  17. Divergent Perturbation Series

    International Nuclear Information System (INIS)

    Suslov, I.M.

    2005-01-01

    Various perturbation series are factorially divergent. The behavior of their high-order terms can be determined by Lipatov's method, which involves the use of instanton configurations of appropriate functional integrals. When the Lipatov asymptotic form is known and several lowest order terms of the perturbation series are found by direct calculation of diagrams, one can gain insight into the behavior of the remaining terms of the series, which can be resummed to solve various strong-coupling problems in a certain approximation. This approach is demonstrated by determining the Gell-Mann-Low functions in φ 4 theory, QED, and QCD with arbitrary coupling constants. An overview of the mathematical theory of divergent series is presented, and interpretation of perturbation series is discussed. Explicit derivations of the Lipatov asymptotic form are presented for some basic problems in theoretical physics. A solution is proposed to the problem of renormalon contributions, which hampered progress in this field in the late 1970s. Practical perturbation-series summation schemes are described both for a coupling constant of order unity and in the strong-coupling limit. An interpretation of the Borel integral is given for 'non-Borel-summable' series. Higher order corrections to the Lipatov asymptotic form are discussed

  18. Instantaneous stochastic perturbation theory

    International Nuclear Information System (INIS)

    Lüscher, Martin

    2015-01-01

    A form of stochastic perturbation theory is described, where the representative stochastic fields are generated instantaneously rather than through a Markov process. The correctness of the procedure is established to all orders of the expansion and for a wide class of field theories that includes all common formulations of lattice QCD.

  19. Cosmological perturbations in antigravity

    Science.gov (United States)

    Oltean, Marius; Brandenberger, Robert

    2014-10-01

    We compute the evolution of cosmological perturbations in a recently proposed Weyl-symmetric theory of two scalar fields with oppositely signed conformal couplings to Einstein gravity. It is motivated from the minimal conformal extension of the standard model, such that one of these scalar fields is the Higgs while the other is a new particle, the dilaton, introduced to make the Higgs mass conformally symmetric. At the background level, the theory admits novel geodesically complete cyclic cosmological solutions characterized by a brief period of repulsive gravity, or "antigravity," during each successive transition from a big crunch to a big bang. For simplicity, we consider scalar perturbations in the absence of anisotropies, with potential set to zero and without any radiation. We show that despite the necessarily wrong-signed kinetic term of the dilaton in the full action, these perturbations are neither ghostlike nor tachyonic in the limit of strongly repulsive gravity. On this basis, we argue—pending a future analysis of vector and tensor perturbations—that, with respect to perturbative stability, the cosmological solutions of this theory are viable.

  20. Perturbed Markov chains

    OpenAIRE

    Solan, Eilon; Vieille, Nicolas

    2015-01-01

    We study irreducible time-homogenous Markov chains with finite state space in discrete time. We obtain results on the sensitivity of the stationary distribution and other statistical quantities with respect to perturbations of the transition matrix. We define a new closeness relation between transition matrices, and use graph-theoretic techniques, in contrast with the matrix analysis techniques previously used.

  1. Scalar cosmological perturbations

    International Nuclear Information System (INIS)

    Uggla, Claes; Wainwright, John

    2012-01-01

    Scalar perturbations of Friedmann-Lemaitre cosmologies can be analyzed in a variety of ways using Einstein's field equations, the Ricci and Bianchi identities, or the conservation equations for the stress-energy tensor, and possibly introducing a timelike reference congruence. The common ground is the use of gauge invariants derived from the metric tensor, the stress-energy tensor, or from vectors associated with a reference congruence, as basic variables. Although there is a complication in that there is no unique choice of gauge invariants, we will show that this can be used to advantage. With this in mind our first goal is to present an efficient way of constructing dimensionless gauge invariants associated with the tensors that are involved, and of determining their inter-relationships. Our second goal is to give a unified treatment of the various ways of writing the governing equations in dimensionless form using gauge-invariant variables, showing how simplicity can be achieved by a suitable choice of variables and normalization factors. Our third goal is to elucidate the connection between the metric-based approach and the so-called 1 + 3 gauge-invariant approach to cosmological perturbations. We restrict our considerations to linear perturbations, but our intent is to set the stage for the extension to second-order perturbations. (paper)

  2. Generalized perturbation series

    International Nuclear Information System (INIS)

    Baird, L.C.; Stinchcomb, G.

    1973-01-01

    An approximate solution of the Green's function equation may be used to generate an exact solution of the Schroedinger equation. This is accomplished through an iterative procedure. The procedure is equivalent to a perturbation expansion if the approximate Green's function is exact with respect to some reference potential

  3. Perturbed S3 neutrinos

    DEFF Research Database (Denmark)

    jora, Renata; Schechter, Joseph; Naeem Shahid, M.

    2009-01-01

    We study the effects of the perturbation which violates the permutation symmetry of three Majorana neutrinos but preserves the well known (23) interchange symmetry. This is done in the presenceof an arbitrary Majorana phase which serves to insure the degeneracy of the three neutrinos at the unper...... at the unperturbed level....

  4. DNA nanotechnology: On-command molecular Trojans

    Science.gov (United States)

    Niemeyer, Christof M.

    2017-12-01

    Lipid-motif-decorated DNA nanocapsules filled with photoresponsive polymers are capable of delivering signalling molecules into target organisms for biological perturbations at high spatiotemporal resolution.

  5. Development of an Efficient G-Quadruplex-Stabilised Thrombin-Binding Aptamer Containing a Three-Carbon Spacer Molecule

    DEFF Research Database (Denmark)

    Aaldering, Lukas J.; Poongavanam, Vasanthanathan; Langkjær, Niels

    2017-01-01

    The thrombin-binding aptamer (TBA), which shows anticoagulant properties, is one of the most studied G-quadruplex-forming aptamers. In this study, we investigated the impact of different chemical modifications such as a three-carbon spacer (spacer-C3), unlocked nucleic acid (UNA) and 3′-amino-mod...

  6. Can We Execute Reliable MM-PBSA Free Energy Computations of Relative Stabilities of Different Guanine Quadruplex Folds?

    Czech Academy of Sciences Publication Activity Database

    Islam, B.; Stadlbauer, Petr; Neidle, S.; Haider, S.; Šponer, Jiří

    2016-01-01

    Roč. 120, č. 11 (2016), s. 2899-2912 ISSN 1520-6106 R&D Projects: GA ČR(CZ) GA16-13721S Institutional support: RVO:68081707 Keywords : MOLECULAR-DYNAMICS SIMULATIONS * TELOMERIC G-QUADRUPLEX * AMBER FORCE-FIELD Subject RIV: BO - Biophysics Impact factor: 3.177, year: 2016

  7. The G-quadruplex augments translation in the 5' untranslated region of transforming growth factor β2.

    Science.gov (United States)

    Agarwala, Prachi; Pandey, Satyaprakash; Mapa, Koyeli; Maiti, Souvik

    2013-03-05

    Transforming growth factor β2 (TGFβ2) is a versatile cytokine with a prominent role in cell migration, invasion, cellular development, and immunomodulation. TGFβ2 promotes the malignancy of tumors by inducing epithelial-mesenchymal transition, angiogenesis, and immunosuppression. As it is well-documented that nucleic acid secondary structure can regulate gene expression, we assessed whether any secondary motif regulates its expression at the post-transcriptional level. Bioinformatics analysis predicts an existence of a 23-nucleotide putative G-quadruplex sequence (PG4) in the 5' untranslated region (UTR) of TGFβ2 mRNA. The ability of this stretch of sequence to form a highly stable, intramolecular parallel quadruplex was demonstrated using ultraviolet and circular dichroism spectroscopy. Footprinting studies further validated its existence in the presence of a neighboring nucleotide sequence. Following structural characterization, we evaluated the biological relevance of this secondary motif using a dual luciferase assay. Although PG4 inhibits the expression of the reporter gene, its presence in the context of the entire 5' UTR sequence interestingly enhances gene expression. Mutation or removal of the G-quadruplex sequence from the 5' UTR of the gene diminished the level of expression of this gene at the translational level. Thus, here we highlight an activating role of the G-quadruplex in modulating gene expression of TGFβ2 at the translational level and its potential to be used as a target for the development of therapeutics against cancer.

  8. Structure variations of TBA G-quadruplex induced by 2'-O-methyl nucleotide in K+ and Ca2+ environments.

    Science.gov (United States)

    Zhao, Xiaoyang; Liu, Bo; Yan, Jing; Yuan, Ying; An, Liwen; Guan, Yifu

    2014-10-01

    Thrombin binding aptamer (TBA), a 15-mer oligonucleotide of d(GGTTGGTGTGGTTGG) sequence, folds into a chair-type antiparallel G-quadruplex in the K(+) environment, and each of two G-tetrads is characterized by a syn-anti-syn-anti glycosidic conformation arrangement. To explore its folding topology and structural stability, 2'-O-methyl nucleotide (OMe) with the C3'-endo sugar pucker conformation and anti glycosidic angle was used to selectively substitute for the guanine residues of G-tetrads of TBA, and these substituted TBAs were characterized using a circular dichroism spectrum, thermally differential spectrum, ultraviolet stability analysis, electrophoresis mobility shift assay, and thermodynamic analysis in K(+) and Ca(2+) environments. Results showed that single substitutions for syn-dG residues destabilized the G-quadruplex structure, while single substitutions for anti-dG residues could preserve the G-quadruplex in the K(+) environment. When one or two G-tetrads were modified with OMe, TBA became unstructured. In contrast, in Ca(2+) environment, the native TBA appeared to be unstructured. When two G-tetrads were substituted with OMe, TBA seemed to become a more stable parallel G-4 structure. Further thermodynamic data suggested that OMe-substitutions were an enthalpy-driven event. The results in this study enrich our understanding about the effects of nucleotide derivatives on the G-quadruplex structure stability in different ionic environments, which will help to design G-quadruplex for biological and medical applications. © The Author 2014. Published by ABBS Editorial Office in association with Oxford University Press on behalf of the Institute of Biochemistry and Cell Biology, Shanghai Institutes for Biological Sciences, Chinese Academy of Sciences.

  9. Studying the perturbative Reggeon

    International Nuclear Information System (INIS)

    Griffiths, S.; Ross, D.A.

    2000-01-01

    We consider the flavour non-singlet Reggeon within the context of perturbative QCD. This consists of ladders built out of ''reggeized'' quarks. We propose a method for the numerical solution of the integro-differential equation for the amplitude describing the exchange of such a Reggeon. The solution is known to have a sharp rise at low values of Bjorken-x when applied to non-singlet quantities in deep-inelastic scattering. We show that when the running of the coupling is taken into account this sharp rise is further enhanced, although the Q 2 dependence is suppressed by the introduction of the running coupling. We also investigate the effects of simulating non-perturbative physics by introducing a constituent mass for the soft quarks and an effective mass for the soft gluons exchanged in the t-channel. (orig.)

  10. Renormalized Lie perturbation theory

    International Nuclear Information System (INIS)

    Rosengaus, E.; Dewar, R.L.

    1981-07-01

    A Lie operator method for constructing action-angle transformations continuously connected to the identity is developed for area preserving mappings. By a simple change of variable from action to angular frequency a perturbation expansion is obtained in which the small denominators have been renormalized. The method is shown to lead to the same series as the Lagrangian perturbation method of Greene and Percival, which converges on KAM surfaces. The method is not superconvergent, but yields simple recursion relations which allow automatic algebraic manipulation techniques to be used to develop the series to high order. It is argued that the operator method can be justified by analytically continuing from the complex angular frequency plane onto the real line. The resulting picture is one where preserved primary KAM surfaces are continuously connected to one another

  11. Nonperturbative perturbation theory

    International Nuclear Information System (INIS)

    Bender, C.M.

    1989-01-01

    In this talk we describe a recently proposed graphical perturbative calculational scheme for quantum field theory. The basic idea is to expand in the power of the interaction term. For example, to solve a λφ 4 theory in d-dimensional space-time, we introduce a small parameter δ and consider a λ(φ 2 ) 1+δ field theory. We show how to expand such a theory as a series in powers of δ. The resulting perturbation series appears to have a finite radius of convergence and numerical results for low-dimensional models are good. We have computed the two-point and four-point Green's functions to second order in powers of δ and the 2n-point Green's functions (n>2) to order δ. We explain how to renormalize the theory and show that, to first order in powers of δ, when δ>0 and d≥4 the theory is free. This conclusion remains valid to second order in powers of δ, and we believe that it remains valid to all orders in powers of δ. The new perturbative scheme is consistent with global supersymmetry invariance. We examine a two-dimensional supersymmetric quantum field theory in which we do not know of any other means for doing analytical calculations. We illustrate the power of this new technique by computing the ground-state energy density E to second order in this new perturbation theory. We show that there is a beautiful and delicate cancellation between infinite classes of graphs which leads to the result that E=0. (orig.)

  12. Perturbed asymptotically linear problems

    OpenAIRE

    Bartolo, R.; Candela, A. M.; Salvatore, A.

    2012-01-01

    The aim of this paper is investigating the existence of solutions of some semilinear elliptic problems on open bounded domains when the nonlinearity is subcritical and asymptotically linear at infinity and there is a perturbation term which is just continuous. Also in the case when the problem has not a variational structure, suitable procedures and estimates allow us to prove that the number of distinct crtitical levels of the functional associated to the unperturbed problem is "stable" unde...

  13. Fragile X mental retardation protein recognizes a G quadruplex structure within the survival motor neuron domain containing 1 mRNA 5'-UTR.

    Science.gov (United States)

    McAninch, Damian S; Heinaman, Ashley M; Lang, Cara N; Moss, Kathryn R; Bassell, Gary J; Rita Mihailescu, Mihaela; Evans, Timothy L

    2017-07-25

    G quadruplex structures have been predicted by bioinformatics to form in the 5'- and 3'-untranslated regions (UTRs) of several thousand mature mRNAs and are believed to play a role in translation regulation. Elucidation of these roles has primarily been focused on the 3'-UTR, with limited focus on characterizing the G quadruplex structures and functions in the 5'-UTR. Investigation of the affinity and specificity of RNA binding proteins for 5'-UTR G quadruplexes and the resulting regulatory effects have also been limited. Among the mRNAs predicted to form a G quadruplex structure within the 5'-UTR is the survival motor neuron domain containing 1 (SMNDC1) mRNA, encoding a protein that is critical to the spliceosome. Additionally, this mRNA has been identified as a potential target of the fragile X mental retardation protein (FMRP), whose loss of expression leads to fragile X syndrome. FMRP is an RNA binding protein involved in translation regulation that has been shown to bind mRNA targets that form G quadruplex structures. In this study we have used biophysical methods to investigate G quadruplex formation in the 5'-UTR of SMNDC1 mRNA and analyzed its interactions with FMRP. Our results show that SMNDC1 mRNA 5'-UTR forms an intramolecular, parallel G quadruplex structure comprised of three G quartet planes, which is bound specifically by FMRP both in vitro and in mouse brain lysates. These findings suggest a model by which FMRP might regulate the translation of a subset of its mRNA targets by recognizing the G quadruplex structure present in their 5'-UTR, and affecting their accessibility by the protein synthesis machinery.

  14. Twisting perturbed parafermions

    Directory of Open Access Journals (Sweden)

    A.V. Belitsky

    2017-07-01

    Full Text Available The near-collinear expansion of scattering amplitudes in maximally supersymmetric Yang–Mills theory at strong coupling is governed by the dynamics of stings propagating on the five sphere. The pentagon transitions in the operator product expansion which systematize the series get reformulated in terms of matrix elements of branch-point twist operators in the two-dimensional O(6 nonlinear sigma model. The facts that the latter is an asymptotically free field theory and that there exists no local realization of twist fields prevents one from explicit calculation of their scaling dimensions and operator product expansion coefficients. This complication is bypassed making use of the equivalence of the sigma model to the infinite-level limit of WZNW models perturbed by current–current interactions, such that one can use conformal symmetry and conformal perturbation theory for systematic calculations. Presently, to set up the formalism, we consider the O(3 sigma model which is reformulated as perturbed parafermions.

  15. Delineation of G-Quadruplex Alkylation Sites Mediated by 3,6-Bis(1-methyl-4-vinylpyridinium iodide)carbazole-Aniline Mustard Conjugates.

    Science.gov (United States)

    Chen, Chien-Han; Hu, Tsung-Hao; Huang, Tzu-Chiao; Chen, Ying-Lan; Chen, Yet-Ran; Cheng, Chien-Chung; Chen, Chao-Tsen

    2015-11-23

    A new G-quadruplex (G-4)-directing alkylating agent BMVC-C3M was designed and synthesized to integrate 3,6-bis(1-methyl-4-vinylpyridinium iodide)carbazole (BMVC) with aniline mustard. Various telomeric G-4 structures (hybrid-2 type and antiparallel) and an oncogene promoter, c-MYC (parallel), were constructed to react with BMVC-C3M, yielding 35 % alkylation yield toward G-4 DNA over other DNA categories (alkylation adducts by electrospray ionization mass spectroscopy (ESI-MS) revealed the stepwise DNA alkylation mechanism of aniline mustard for the first time. Furthermore, the monoalkylation sites and intrastrand cross-linking sites were determined and found to be dependent on G-4 topology based on the results of footprinting analysis in combination with mass spectroscopic techniques and in silico modeling. The results indicated that BMVC-C3M preferentially alkylated at A15 (H26), G12 (H24), and G2 (c-MYC), respectively, as monoalkylated adducts and formed A15-C3M-A21 (H26), G12-C3M-G4 (H24), and G2-C3M-G4/G17 (c-MYC), respectively, as cross-linked dialkylated adducts. Collectively, the stability and site-selective cross-linking capacity of BMVC-C3M provides a credible tool for the structural and functional characterization of G-4 DNAs in biological systems. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  16. A bouquet of DNA structures: Emerging diversity.

    Science.gov (United States)

    Kaushik, Mahima; Kaushik, Shikha; Roy, Kapil; Singh, Anju; Mahendru, Swati; Kumar, Mohan; Chaudhary, Swati; Ahmed, Saami; Kukreti, Shrikant

    2016-03-01

    Structural polymorphism of DNA has constantly been evolving from the time of illustration of the double helical model of DNA by Watson and Crick. A variety of non-canonical DNA structures have constantly been documented across the globe. DNA attracted worldwide attention as a carrier of genetic information. In addition to the classical Watson-Crick duplex, DNA can actually adopt diverse structures during its active participation in cellular processes like replication, transcription, recombination and repair. Structures like hairpin, cruciform, triplex, G-triplex, quadruplex, i-motif and other alternative non-canonical DNA structures have been studied at length and have also shown their in vivo occurrence. This review mainly focuses on non-canonical structures adopted by DNA oligonucleotides which have certain prerequisites for their formation in terms of sequence, its length, number and orientation of strands along with varied solution conditions. This conformational polymorphism of DNA might be the basis of different functional properties of a specific set of DNA sequences, further giving some insights for various extremely complicated biological phenomena. Many of these structures have already shown their linkages with diseases like cancer and genetic disorders, hence making them an extremely striking target for structure-specific drug designing and therapeutic applications.

  17. A bouquet of DNA structures: Emerging diversity

    Directory of Open Access Journals (Sweden)

    Mahima Kaushik

    2016-03-01

    Full Text Available Structural polymorphism of DNA has constantly been evolving from the time of illustration of the double helical model of DNA by Watson and Crick. A variety of non-canonical DNA structures have constantly been documented across the globe. DNA attracted worldwide attention as a carrier of genetic information. In addition to the classical Watson–Crick duplex, DNA can actually adopt diverse structures during its active participation in cellular processes like replication, transcription, recombination and repair. Structures like hairpin, cruciform, triplex, G-triplex, quadruplex, i-motif and other alternative non-canonical DNA structures have been studied at length and have also shown their in vivo occurrence. This review mainly focuses on non-canonical structures adopted by DNA oligonucleotides which have certain prerequisites for their formation in terms of sequence, its length, number and orientation of strands along with varied solution conditions. This conformational polymorphism of DNA might be the basis of different functional properties of a specific set of DNA sequences, further giving some insights for various extremely complicated biological phenomena. Many of these structures have already shown their linkages with diseases like cancer and genetic disorders, hence making them an extremely striking target for structure-specific drug designing and therapeutic applications.

  18. DNA-Mediated Electrochemistry

    Science.gov (United States)

    Gorodetsky, Alon A.; Buzzeo, Marisa C.

    2009-01-01

    The base pair stack of DNA has been demonstrated as a medium for long range charge transport chemistry both in solution and at DNA-modified surfaces. This chemistry is exquisitely sensitive to structural perturbations in the base pair stack as occur with lesions, single base mismatches, and protein binding. We have exploited this sensitivity for the development of reliable electrochemical assays based on DNA charge transport at self-assembled DNA monolayers. Here we discuss the characteristic features, applications, and advantages of DNA-mediated electrochemistry. PMID:18980370

  19. Identification and characterisation of a G-quadruplex forming sequence in the promoter region of nuclear factor (erythroid-derived 2)-like 2 (Nrf2)

    Energy Technology Data Exchange (ETDEWEB)

    Waller, Zoë A.E., E-mail: z.waller@uea.ac.uk; Howell, Lesley A.; MacDonald, Colin J.; O’Connell, Maria A.; Searcey, Mark, E-mail: m.searcey@uea.ac.uk

    2014-04-25

    Highlights: • Discovery of a G-quadruplex forming sequence in the promoter sequence of Nrf2. • Characterisation of the G-quadruplex by UV, CD and NMR. • Conformational switching of G-quadruplex induced by 9-aminoacridine. - Abstract: The transcription factor nuclear factor (erythroid-derived 2)-like 2 (Nrf2) regulates multiple antioxidants, Phase II detoxification enzymes and other cytoprotective enzymes in cells. Activation of Nrf2 is recognised as being of potential therapeutic benefit in inflammatory-diseases whereas more recently, it has become clear that the inhibition of Nrf2 may have benefit in the alleviation of resistance in some tumour types. A potential G-quadruplex forming sequence was identified in the promoter region of Nrf2, close to a number of putative transcription factor binding sites. Characterisation of the sequence 5’-d[GGGAAGGGAGCAAGGGCGGGAGGG]-3’ using CD spectroscopy, imino proton NMR resonances and UV melting experiments demonstrated the formation of a parallel intramolecular G-quadruplex in the presence of K{sup +} ions. Incubation with 9-aminoacridine ligands induced a switch from antiparallel to parallel forms. The presence of a G-quadruplex forming sequence in the promoter region of Nrf2 suggests an approach to targeting the production of the protein through stabilisation of the structure, thereby avoiding resistance to antitumour drugs.

  20. Phylo-typing of clinical Escherichia coli isolates originating from bovine mastitis and canine pyometra and urinary tract infection by means of quadruplex PCR.

    Science.gov (United States)

    Müştak, Hamit Kaan; Günaydin, Elçin; Kaya, İnci Başak; Salar, Merve Özdal; Babacan, Orkun; Önat, Kaan; Ata, Zafer; Diker, Kadir Serdar

    2015-01-01

    Escherichia coli is one of the major causative agents of bovine mastitis worldwide, and is typically associated with acute, clinical mastitis. Besides this, E. coli strains which belong to the extra-intestinal pathogenic group are also the major cause of urinary tract infections and pyometra in dogs. In this study, it was aimed to investigate phylo-groups/subgroups in 155 E. coli isolates obtained from acute bovine mastitis, 43 from urinary tract infections of dogs and 20 from canine pyometra by a formerly described triplex PCR and recently described new quadruplex polymerase chain reaction (PCR) method. Group A1 (n = 118; 76%) and B1 (n = 71; 46%) were found to be the most prevalent groups by triplex and quadruplex PCR assays in mastitis isolates, respectively. Phylo-typing of 43 urinary tract isolates also revealed that most of the isolates belonged to A1 (n = 23; 54%) by triplex and B2 (n = 36; 84%) by quadruplex PCR assays. The isolates assigned as group A1 (n = 17; 85%) by triplex PCR could not be classified by quadruplex PCR in pyometra isolates. The results support the hypothesis that E. coli strains isolated from bovine mastitis cases are environmental. Also, groups C, E and F were identified as new phylo-groups for the first time in acute bovine mastitis cases. The comparison of triplex PCR with quadruplex PCR results revealed that most of the groups assigned in triplex PCR were altered by quadruplex PCR assay.

  1. Tyramine Hydrochloride Based Label-Free System for Operating Various DNA Logic Gates and a DNA Caliper for Base Number Measurements.

    Science.gov (United States)

    Fan, Daoqing; Zhu, Xiaoqing; Dong, Shaojun; Wang, Erkang

    2017-07-05

    DNA is believed to be a promising candidate for molecular logic computation, and the fluorogenic/colorimetric substrates of G-quadruplex DNAzyme (G4zyme) are broadly used as label-free output reporters of DNA logic circuits. Herein, for the first time, tyramine-HCl (a fluorogenic substrate of G4zyme) is applied to DNA logic computation and a series of label-free DNA-input logic gates, including elementary AND, OR, and INHIBIT logic gates, as well as a two to one encoder, are constructed. Furthermore, a DNA caliper that can measure the base number of target DNA as low as three bases is also fabricated. This DNA caliper can also perform concatenated AND-AND logic computation to fulfil the requirements of sophisticated logic computing. © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

  2. Non-Perturbative Renormalization

    CERN Document Server

    Mastropietro, Vieri

    2008-01-01

    The notion of renormalization is at the core of several spectacular achievements of contemporary physics, and in the last years powerful techniques have been developed allowing to put renormalization on a firm mathematical basis. This book provides a self-consistent and accessible introduction to the sophisticated tools used in the modern theory of non-perturbative renormalization, allowing an unified and rigorous treatment of Quantum Field Theory, Statistical Physics and Condensed Matter models. In particular the first part of this book is devoted to Constructive Quantum Field Theory, providi

  3. Perturbative quantum chromodynamics

    CERN Document Server

    1989-01-01

    This book will be of great interest to advanced students and researchers in the area of high energy theoretical physics. Being the most complete and updated review volume on Perturbative QCD, it serves as an extremely useful textbook or reference book. Some of the reviews in this volume are the best that have been written on the subject anywhere. Contents: Factorization of Hard Processes in QCD (J C Collins, D E Soper & G Sterman); Exclusive Processes in Quantum Chromodynamics (S J Brodsky & G P Lepage); Coherence and Physics of QCD Jets (Yu L Dokshitzer, V A Khoze & S I Troyan); Pomeron in Qu

  4. Perturbative quantum chromodynamics

    International Nuclear Information System (INIS)

    Radyushkin, A.V.

    1987-01-01

    The latest achievements in perturbative quantum chromodynamics (QCD) relating to the progress in factorization of small and large distances are presented. The following problems are concerned: Development of the theory of Sudakov effects on the basis of mean contour formalism. Development of nonlocal condensate formalism. Calculation of hadron wave functions and hadron distribution functions using QCD method of sum rules. Development of the theory of Regge behaviour in QCD, behaviour of structure functions at small x. Study of polarization effects in hadron processes with high momentum transfer

  5. Perturbed effects at radiation physics

    International Nuclear Information System (INIS)

    Külahcı, Fatih; Şen, Zekâi

    2013-01-01

    Perturbation methodology is applied in order to assess the linear attenuation coefficient, mass attenuation coefficient and cross-section behavior with random components in the basic variables such as the radiation amounts frequently used in the radiation physics and chemistry. Additionally, layer attenuation coefficient (LAC) and perturbed LAC (PLAC) are proposed for different contact materials. Perturbation methodology provides opportunity to obtain results with random deviations from the average behavior of each variable that enters the whole mathematical expression. The basic photon intensity variation expression as the inverse exponential power law (as Beer–Lambert's law) is adopted for perturbation method exposition. Perturbed results are presented not only in terms of the mean but additionally the standard deviation and the correlation coefficients. Such perturbation expressions provide one to assess small random variability in basic variables. - Highlights: • Perturbation methodology is applied to Radiation Physics. • Layer attenuation coefficient (LAC) and perturbed LAC are proposed for contact materials. • Perturbed linear attenuation coefficient is proposed. • Perturbed mass attenuation coefficient (PMAC) is proposed. • Perturbed cross-section is proposed

  6. A Role for the Fifth G-Track in G-Quadruplex Forming Oncogene Promoter Sequences during Oxidative Stress: Do These "Spare Tires" Have an Evolved Function?

    Science.gov (United States)

    Fleming, Aaron M; Zhou, Jia; Wallace, Susan S; Burrows, Cynthia J

    2015-08-26

    Uncontrolled inflammation or oxidative stress generates electron-deficient species that oxidize the genome increasing its instability in cancer. The G-quadruplex (G4) sequences regulating the c-MYC , KRAS , VEGF , BCL-2 , HIF-1α , and RET oncogenes, as examples, are targets for oxidation at loop and 5'-core guanines (G) as showcased in this study by CO 3 •- oxidation of the VEGF G4. Products observed include 8-oxo-7,8-dihydroguanine (OG), spiroiminodihydantoin (Sp), and 5-guanidinohydantoin (Gh). Our previous studies found that OG and Gh, when present in the four G-tracks of the solved structure for VEGF and c-MY C, were not substrates for the base excision repair (BER) DNA glycosylases in biologically relevant KCl solutions. We now hypothesize that a fifth G-track found a few nucleotides distant from the G4 tracks involved in folding can act as a "spare tire," facilitating extrusion of a damaged G-run into a large loop that then becomes a substrate for BER. Thermodynamic, spectroscopic, and DMS footprinting studies verified the fifth domain replacing a damaged G-track with OG or Gh at a loop or core position in the VEGF G4. These new "spare tire"-containing strands with Gh in loops are now found to be substrates for initiation of BER with the NEIL1, NEIL2, and NEIL3 DNA glycosylases. The results support a hypothesis in which regulatory G4s carry a "spare-tire" fifth G-track for aiding in the repair process when these sequences are damaged by radical oxygen species, a feature observed in a large number of these sequences. Furthermore, formation and repair of oxidized bases in promoter regions may constitute an additional example of epigenetic modification, in this case of guanine bases, to regulate gene expression in which the G4 sequences act as sensors of oxidative stress.

  7. Investigation of a Quadruplex-Forming Repeat Sequence Highly Enriched in Xanthomonas and Nostoc sp.

    Science.gov (United States)

    Rehm, Charlotte; Wurmthaler, Lena A; Li, Yuanhao; Frickey, Tancred; Hartig, Jörg S

    2015-01-01

    In prokaryotes simple sequence repeats (SSRs) with unit sizes of 1-5 nucleotides (nt) are causative for phase and antigenic variation. Although an increased abundance of heptameric repeats was noticed in bacteria, reports about SSRs of 6-9 nt are rare. In particular G-rich repeat sequences with the propensity to fold into G-quadruplex (G4) structures have received little attention. In silico analysis of prokaryotic genomes show putative G4 forming sequences to be abundant. This report focuses on a surprisingly enriched G-rich repeat of the type GGGNATC in Xanthomonas and cyanobacteria such as Nostoc. We studied in detail the genomes of Xanthomonas campestris pv. campestris ATCC 33913 (Xcc), Xanthomonas axonopodis pv. citri str. 306 (Xac), and Nostoc sp. strain PCC7120 (Ana). In all three organisms repeats are spread all over the genome with an over-representation in non-coding regions. Extensive variation of the number of repetitive units was observed with repeat numbers ranging from two up to 26 units. However a clear preference for four units was detected. The strong bias for four units coincides with the requirement of four consecutive G-tracts for G4 formation. Evidence for G4 formation of the consensus repeat sequences was found in biophysical studies utilizing CD spectroscopy. The G-rich repeats are preferably located between aligned open reading frames (ORFs) and are under-represented in coding regions or between divergent ORFs. The G-rich repeats are preferentially located within a distance of 50 bp upstream of an ORF on the anti-sense strand or within 50 bp from the stop codon on the sense strand. Analysis of whole transcriptome sequence data showed that the majority of repeat sequences are transcribed. The genetic loci in the vicinity of repeat regions show increased genomic stability. In conclusion, we introduce and characterize a special class of highly abundant and wide-spread quadruplex-forming repeat sequences in bacteria.

  8. Non-perturbative versus perturbative renormalization of lattice operators

    International Nuclear Information System (INIS)

    Goeckeler, M.; Technische Hochschule Aachen; Horsley, R.; Ilgenfritz, E.M.; Oelrich, H.; Forschungszentrum Juelich GmbH; Schierholz, G.; Forschungszentrum Juelich GmbH; Perlt, H.; Schiller, A.; Rakow, P.

    1995-09-01

    Our objective is to compute the moments of the deep-inelastic structure functions of the nucleon on the lattice. A major source of uncertainty is the renormalization of the lattice operators that enter the calculation. In this talk we compare the renormalization constants of the most relevant twist-two bilinear quark operators which we have computed non-perturbatively and perturbatively to one loop order. Furthermore, we discuss the use of tadpole improved perturbation theory. (orig.)

  9. Perturbation studies on KAHTER

    Energy Technology Data Exchange (ETDEWEB)

    Rueckert, M.; Jonas, H.; Neef, R. D.

    1974-10-15

    The paper describes experimental and analytical results by both transport theory and diffusion theory calculations of perturbation tests in the KAHTER pebble bed critical experiment. The fission-weighted adjoint flux is measured from in-core detector responses by introducing a Cf-source into the core. Adjoint-weighted reactivities are calculated and compared to reactivity measurements for the introduction of a fuel and graphite pebble onto the top of the critical pile, the central rod worth, and the effect of replacing B4C with varying amounts of HfC in the central rod. In addition, analytical studies were made of the sensitivity of criticality to the fuel to graphite pebble ratio as measured in tests and of the effect of the upper void cavity as simulated in tests by placing cadmium layer across the top of the pebble pile to force a zero flux boundary condition.

  10. Introduction to perturbation methods

    CERN Document Server

    Holmes, M

    1995-01-01

    This book is an introductory graduate text dealing with many of the perturbation methods currently used by applied mathematicians, scientists, and engineers. The author has based his book on a graduate course he has taught several times over the last ten years to students in applied mathematics, engineering sciences, and physics. The only prerequisite for the course is a background in differential equations. Each chapter begins with an introductory development involving ordinary differential equations. The book covers traditional topics, such as boundary layers and multiple scales. However, it also contains material arising from current research interest. This includes homogenization, slender body theory, symbolic computing, and discrete equations. One of the more important features of this book is contained in the exercises. Many are derived from problems of up- to-date research and are from a wide range of application areas.

  11. Perturbation theory with instantons

    International Nuclear Information System (INIS)

    Carruthers, P.; Pinsky, S.S.; Zachariasen, F.

    1977-05-01

    ''Perturbation theory'' rules are developed for calculating the effect of instantons in a pure Yang-Mills theory with no fermions, in the ''dilute gas'' approximation in which the N-instanton solution is assumed to be the sum of N widely separated one-instanton solutions. These rules are then used to compute the gluon propagator and proper vertex function including all orders of the instanton interaction but only to lowest order in the gluon coupling. It is to be expected that such an approximation is valid only for momenta q larger than the physical mass μ. The result is that in this regime instantons cause variations in the propagator and vertex of the form (μ 2 /q 2 )/sup -8π 2 b/ where b is the coefficient in the expansion of the β function: β = bg 3 +...

  12. Nanomechanical DNA Origami pH Sensors

    Directory of Open Access Journals (Sweden)

    Akinori Kuzuya

    2014-10-01

    Full Text Available Single-molecule pH sensors have been developed by utilizing molecular imaging of pH-responsive shape transition of nanomechanical DNA origami devices with atomic force microscopy (AFM. Short DNA fragments that can form i-motifs were introduced to nanomechanical DNA origami devices with pliers-like shape (DNA Origami Pliers, which consist of two levers of 170-nm long and 20-nm wide connected at a Holliday-junction fulcrum. DNA Origami Pliers can be observed as in three distinct forms; cross, antiparallel and parallel forms, and cross form is the dominant species when no additional interaction is introduced to DNA Origami Pliers. Introduction of nine pairs of 12-mer sequence (5'-AACCCCAACCCC-3', which dimerize into i-motif quadruplexes upon protonation of cytosine, drives transition of DNA Origami Pliers from open cross form into closed parallel form under acidic conditions. Such pH-dependent transition was clearly imaged on mica in molecular resolution by AFM, showing potential application of the system to single-molecular pH sensors.

  13. Nanomechanical DNA origami pH sensors.

    Science.gov (United States)

    Kuzuya, Akinori; Watanabe, Ryosuke; Yamanaka, Yusei; Tamaki, Takuya; Kaino, Masafumi; Ohya, Yuichi

    2014-10-16

    Single-molecule pH sensors have been developed by utilizing molecular imaging of pH-responsive shape transition of nanomechanical DNA origami devices with atomic force microscopy (AFM). Short DNA fragments that can form i-motifs were introduced to nanomechanical DNA origami devices with pliers-like shape (DNA Origami Pliers), which consist of two levers of 170-nm long and 20-nm wide connected at a Holliday-junction fulcrum. DNA Origami Pliers can be observed as in three distinct forms; cross, antiparallel and parallel forms, and cross form is the dominant species when no additional interaction is introduced to DNA Origami Pliers. Introduction of nine pairs of 12-mer sequence (5'-AACCCCAACCCC-3'), which dimerize into i-motif quadruplexes upon protonation of cytosine, drives transition of DNA Origami Pliers from open cross form into closed parallel form under acidic conditions. Such pH-dependent transition was clearly imaged on mica in molecular resolution by AFM, showing potential application of the system to single-molecular pH sensors.

  14. Singular perturbation of simple eigenvalues

    International Nuclear Information System (INIS)

    Greenlee, W.M.

    1976-01-01

    Two operator theoretic theorems which generalize those of asymptotic regular perturbation theory and which apply to singular perturbation problems are proved. Application of these theorems to concrete problems is involved, but the perturbation expansions for eigenvalues and eigenvectors are developed in terms of solutions of linear operator equations. The method of correctors, as well as traditional boundary layer techniques, can be used to apply these theorems. The current formulation should be applicable to highly singular ''hard core'' potential perturbations of the radial equation of quantum mechanics. The theorems are applied to a comparatively simple model problem whose analysis is basic to that of the quantum mechanical problem

  15. Surface Plasmon Resonance kinetic analysis of the interaction between G-quadruplex nucleic acids and an anti-G-quadruplex monoclonal antibody.

    Science.gov (United States)

    Lago, Sara; Nadai, Matteo; Rossetto, Monica; Richter, Sara N

    2018-06-01

    G-quadruplexes (G4s) are nucleic acids secondary structures formed in guanine-rich sequences. Anti-G4 antibodies represent a tool for the direct investigation of G4s in cells. Surface Plasmon Resonance (SPR) is a highly sensitive technology, suitable for assessing the affinity between biomolecules. We here aimed at improving the orientation of an anti-G4 antibody on the SPR sensor chip to optimize detection of binding antigens. SPR was employed to characterize the anti-G4 antibody interaction with G4 and non-G4 oligonucleotides. Dextran-functionalized sensor chips were used both in covalent coupling and capturing procedures. The use of two leading molecule for orienting the antibody of interest allowed to improve its activity from completely non-functional to 65% active. The specificity of the anti-G4 antobody for G4 structures could thus be assessed with high sensitivity and reliability. Optimization of the immobilization protocol for SPR biosensing, allowed us to determine the anti-G4 antibody affinity and specificity for G4 antigens with higher sensitivity with respect to other in vitro assays such as ELISA. Anti-G4 antibody specificity is a fundamental assumption for the future utilization of this kind of antibodies for monitoring G4s directly in cells. The heterogeneous orientation of amine-coupling immobilized ligands is a general problem that often leads to partial or complete inactivation of the molecules. Here we describe a new strategy for improving ligand orientation: driving it from two sides. This principle can be virtually applied to every molecule that loses its activity or is poorly immobilized after standard coupling to the SPR chip surface. Copyright © 2018 The Authors. Published by Elsevier B.V. All rights reserved.

  16. Internal Light Source-Driven Photoelectrochemical 3D-rGO/Cellulose Device Based on Cascade DNA Amplification Strategy Integrating Target Analog Chain and DNA Mimic Enzyme.

    Science.gov (United States)

    Lan, Feifei; Liang, Linlin; Zhang, Yan; Li, Li; Ren, Na; Yan, Mei; Ge, Shenguang; Yu, Jinghua

    2017-11-01

    In this work, a chemiluminescence-driven collapsible greeting card-like photoelectrochemical lab-on-paper device (GPECD) with hollow channel was demonstrated, in which target-triggering cascade DNA amplification strategy was ingeniously introduced. The GPECD had the functions of reagents storage and signal collection, and the change of configuration could control fluidic path, reaction time and alterations in electrical connectivity. In addition, three-dimentional reduced graphene oxide affixed Au flower was in situ grown on paper cellulose fiber for achieving excellent conductivity and biocompatibility. The cascade DNA amplification strategy referred to the cyclic formation of target analog chain and its trigger action to hybridization chain reaction (HCR), leading to the formation of numerous hemin/G-quadruplex DNA mimic enzyme with the presence of hemin. Subjected to the catalysis of hemin/G-quadruplex, the strong chemiluminiscence of luminol-H 2 O 2 system was obtained, which then was used as internal light source to excite photoactive materials realizing the simplification of instrument. In this analyzing process, thrombin served as proof-of-concept, and the concentration of target was converted into the DNA signal output by the specific recognition of aptamer-protein and target analog chain recycling. The target analog chain was produced in quantity with the presence of target, which further triggered abundant HCR and introduced hemin/G-quadruplex into the system. The photocurrent signal was obtained after the nitrogen-doped carbon dots sensitized ZnO was stimulated by chemiluminescence. The proposed GPECD exhibited excellent specificity and sensitivity toward thrombin with a detection limit of 16.7 fM. This judiciously engineered GPECD paved a luciferous way for detecting other protein with trace amounts in bioanalysis and clinical biomedicine.

  17. Chiral perturbation theory

    International Nuclear Information System (INIS)

    Harada, Masayasu

    2009-01-01

    Chiral perturbation theory has been used for great number of phenomenological analyses in low energy QCD as well as the lattice QCD analyses since the creation of the theory by Weinberg in 1979 followed by its consolidation by Gasser and Leutwyler in 1984 and 85. The theory is now the highly established one as the approach based on the effective field theory to search for Green function including quantum correlations in the frame of the systematic expansion technique using Lagrangian which includes all of the terms allowed by the symmetry. This review has been intended to describe how systematically physical quantities are calculated in the framework of the chiral symmetry. Consequently many of the various phenomenological analyses are not taken up here for which other reports are to be referred. Further views are foreseen to be developed based on the theory in addition to numbers of results reported up to the present. Finally π-π scattering is taken up to discuss to what energy scale the theory is available. (S. Funahashi)

  18. Perturbed angular correlation

    International Nuclear Information System (INIS)

    Fabris, J.D.

    1977-01-01

    The electric quadrupolar interaction in some hafnium complexes, measured at the metal nucleus level is studied. For that purpose, the technique of γ-γ perturbed angular correlation is used: the frequencies of quadrupolar interaction are compared with some hafnium α-hydroxicarboxilates, namely glycolate, lactate, mandelate and benzylate; the influence of the temperature on the quadrupolar coupling on the hafnium tetramandelate is studied; finally, the effects associated with the capture of thermal neutrons by hafnium tetramandelate are examined locally at the nuclear level. The first group of results shows significant differences in a series of complexes derived from glycolic acid. On the other hand, the substitution of the protons in hafnium tetramandelate structure by some alkaline cations permits to verify a correlation between the variations in the quadrupolar coupling and the electronegativities of the substituent elements. Measurements at high temperatures show that this complex is thermally stable at 100 and 150 0 C. It is possible to see the appearance of two distinct sites for the probe nucleus, after heating the sample at 100 0 C for prolonged time. This fact is attributed to a probable interconversion among the postulated structural isomers for the octacoordinated compounds. Finally, measurements of angular correlation on the irradiated complex show that there is an effective destruction of the target molecule by neutron capture [pt

  19. Perturbative quantum chromodynamics

    International Nuclear Information System (INIS)

    Brodsky, S.J.

    1979-12-01

    The application of QCD to hadron dynamics at short distances, where asymptotic freedom allows a systematic perturbative approach, is addressed. The main theme of the approach is to incorporate systematically the effects of the hadronic wave function in large momentum transfer exclusive and inclusive reactions. Although it is conventional to treat the hadron as a classical source of on-shell quarks, there are important dynamical effects due to hadronic constituent structure which lead to a broader testing ground for QCD. QCD predictions are discussed for exclusive processes and form factors at large momentum transfer in which the short-distance behavior and the finite compositeness of the hadronic wave functions play crucial roles. Many of the standard tests of QCD are reviewed including the predictions for R = sigma/sub e + e - →had//sigma/sub e + e - →μ + μ - /, the structure functions of hadrons and photons, jet phenomena, and the QCD corrections to deep inelastic processes. The exclusive-inclusive connection in QCD, the effects of power-law scale-breaking contributions, and the important role of the available energy in controlling logarithmic scale violations are also discussed. 150 references, 44 figures

  20. Lattice regularized chiral perturbation theory

    International Nuclear Information System (INIS)

    Borasoy, Bugra; Lewis, Randy; Ouimet, Pierre-Philippe A.

    2004-01-01

    Chiral perturbation theory can be defined and regularized on a spacetime lattice. A few motivations are discussed here, and an explicit lattice Lagrangian is reviewed. A particular aspect of the connection between lattice chiral perturbation theory and lattice QCD is explored through a study of the Wess-Zumino-Witten term

  1. Perturbative QCD (1/3)

    CERN Multimedia

    CERN. Geneva

    2013-01-01

    Perturbative QCD is the general theoretical framework for describing hard scattering processes yielding multiparticle production at hadron colliders. In these lectures, we shall introduce fundamental features of perturbative QCD and describe its application to several high energy collider processes, including jet production in electron-positron annihilation, deep inelastic scattering, Higgs boson and gauge boson production at the LHC.

  2. Propagation of Ion Acoustic Perturbations

    DEFF Research Database (Denmark)

    Pécseli, Hans

    1975-01-01

    Equations describing the propagation of ion acoustic perturbations are considered, using the assumption that the electrons are Boltzman distributed and isothermal at all times. Quasi-neutrality is also considered.......Equations describing the propagation of ion acoustic perturbations are considered, using the assumption that the electrons are Boltzman distributed and isothermal at all times. Quasi-neutrality is also considered....

  3. On summation of perturbation expansions

    International Nuclear Information System (INIS)

    Horzela, A.

    1985-04-01

    The problem of the restoration of physical quantities defined by divergent perturbation expansions is analysed. The Pad'e and Borel summability is proved for alternating perturbation expansions with factorially growing coefficients. The proof is based on the methods of the classical moments theory. 17 refs. (author)

  4. Continual integral in perturbation theory

    International Nuclear Information System (INIS)

    Slavnov, A.A.

    1975-01-01

    It is shown that all results obtained by means of continual integration within the framework of perturbation theory are completely equivalent to those obtained by the usual diagram technique and are therfore just as rigorous. A rigorous justification is given for the rules for operating with continual integrals in perturbation theory. (author)

  5. On dark energy isocurvature perturbation

    International Nuclear Information System (INIS)

    Liu, Jie; Zhang, Xinmin; Li, Mingzhe

    2011-01-01

    Determining the equation of state of dark energy with astronomical observations is crucially important to understand the nature of dark energy. In performing a likelihood analysis of the data, especially of the cosmic microwave background and large scale structure data the dark energy perturbations have to be taken into account both for theoretical consistency and for numerical accuracy. Usually, one assumes in the global fitting analysis that the dark energy perturbations are adiabatic. In this paper, we study the dark energy isocurvature perturbation analytically and discuss its implications for the cosmic microwave background radiation and large scale structure. Furthermore, with the current astronomical observational data and by employing Markov Chain Monte Carlo method, we perform a global analysis of cosmological parameters assuming general initial conditions for the dark energy perturbations. The results show that the dark energy isocurvature perturbations are very weakly constrained and that purely adiabatic initial conditions are consistent with the data

  6. Investigation of a Quadruplex-Forming Repeat Sequence Highly Enriched in Xanthomonas and Nostoc sp.

    Directory of Open Access Journals (Sweden)

    Charlotte Rehm

    Full Text Available In prokaryotes simple sequence repeats (SSRs with unit sizes of 1-5 nucleotides (nt are causative for phase and antigenic variation. Although an increased abundance of heptameric repeats was noticed in bacteria, reports about SSRs of 6-9 nt are rare. In particular G-rich repeat sequences with the propensity to fold into G-quadruplex (G4 structures have received little attention. In silico analysis of prokaryotic genomes show putative G4 forming sequences to be abundant. This report focuses on a surprisingly enriched G-rich repeat of the type GGGNATC in Xanthomonas and cyanobacteria such as Nostoc. We studied in detail the genomes of Xanthomonas campestris pv. campestris ATCC 33913 (Xcc, Xanthomonas axonopodis pv. citri str. 306 (Xac, and Nostoc sp. strain PCC7120 (Ana. In all three organisms repeats are spread all over the genome with an over-representation in non-coding regions. Extensive variation of the number of repetitive units was observed with repeat numbers ranging from two up to 26 units. However a clear preference for four units was detected. The strong bias for four units coincides with the requirement of four consecutive G-tracts for G4 formation. Evidence for G4 formation of the consensus repeat sequences was found in biophysical studies utilizing CD spectroscopy. The G-rich repeats are preferably located between aligned open reading frames (ORFs and are under-represented in coding regions or between divergent ORFs. The G-rich repeats are preferentially located within a distance of 50 bp upstream of an ORF on the anti-sense strand or within 50 bp from the stop codon on the sense strand. Analysis of whole transcriptome sequence data showed that the majority of repeat sequences are transcribed. The genetic loci in the vicinity of repeat regions show increased genomic stability. In conclusion, we introduce and characterize a special class of highly abundant and wide-spread quadruplex-forming repeat sequences in bacteria.

  7. Disformal transformation of cosmological perturbations

    Directory of Open Access Journals (Sweden)

    Masato Minamitsuji

    2014-10-01

    Full Text Available We investigate the gauge-invariant cosmological perturbations in the gravity and matter frames in the general scalar–tensor theory where two frames are related by the disformal transformation. The gravity and matter frames are the extensions of the Einstein and Jordan frames in the scalar–tensor theory where two frames are related by the conformal transformation, respectively. First, it is shown that the curvature perturbation in the comoving gauge to the scalar field is disformally invariant as well as conformally invariant, which gives the predictions from the cosmological model where the scalar field is responsible both for inflation and cosmological perturbations. Second, in case that the disformally coupled matter sector also contributes to curvature perturbations, we derive the evolution equations of the curvature perturbation in the uniform matter energy density gauge from the energy (nonconservation in the matter sector, which are independent of the choice of the gravity sector. While in the matter frame the curvature perturbation in the uniform matter energy density gauge is conserved on superhorizon scales for the vanishing nonadiabatic pressure, in the gravity frame it is not conserved even if the nonadiabatic pressure vanishes. The formula relating two frames gives the amplitude of the curvature perturbation in the matter frame, once it is evaluated in the gravity frame.

  8. Disformal transformation of cosmological perturbations

    International Nuclear Information System (INIS)

    Minamitsuji, Masato

    2014-01-01

    We investigate the gauge-invariant cosmological perturbations in the gravity and matter frames in the general scalar–tensor theory where two frames are related by the disformal transformation. The gravity and matter frames are the extensions of the Einstein and Jordan frames in the scalar–tensor theory where two frames are related by the conformal transformation, respectively. First, it is shown that the curvature perturbation in the comoving gauge to the scalar field is disformally invariant as well as conformally invariant, which gives the predictions from the cosmological model where the scalar field is responsible both for inflation and cosmological perturbations. Second, in case that the disformally coupled matter sector also contributes to curvature perturbations, we derive the evolution equations of the curvature perturbation in the uniform matter energy density gauge from the energy (non)conservation in the matter sector, which are independent of the choice of the gravity sector. While in the matter frame the curvature perturbation in the uniform matter energy density gauge is conserved on superhorizon scales for the vanishing nonadiabatic pressure, in the gravity frame it is not conserved even if the nonadiabatic pressure vanishes. The formula relating two frames gives the amplitude of the curvature perturbation in the matter frame, once it is evaluated in the gravity frame

  9. Cosmological perturbations beyond linear order

    CERN Multimedia

    CERN. Geneva

    2013-01-01

    Cosmological perturbation theory is the standard tool to understand the formation of the large scale structure in the Universe. However, its degree of applicability is limited by the growth of the amplitude of the matter perturbations with time. This problem can be tackled with by using N-body simulations or analytical techniques that go beyond the linear calculation. In my talk, I'll summarise some recent efforts in the latter that ameliorate the bad convergence of the standard perturbative expansion. The new techniques allow better analytical control on observables (as the matter power spectrum) over scales very relevant to understand the expansion history and formation of structure in the Universe.

  10. Instabilities in mimetic matter perturbations

    Energy Technology Data Exchange (ETDEWEB)

    Firouzjahi, Hassan; Gorji, Mohammad Ali [School of Astronomy, Institute for Research in Fundamental Sciences (IPM), P.O. Box 19395-5531, Tehran (Iran, Islamic Republic of); Mansoori, Seyed Ali Hosseini, E-mail: firouz@ipm.ir, E-mail: gorji@ipm.ir, E-mail: shosseini@shahroodut.ac.ir, E-mail: shossein@ipm.ir [Physics Department, Shahrood University of Technology, P.O. Box 3619995161 Shahrood (Iran, Islamic Republic of)

    2017-07-01

    We study cosmological perturbations in mimetic matter scenario with a general higher derivative function. We calculate the quadratic action and show that both the kinetic term and the gradient term have the wrong sings. We perform the analysis in both comoving and Newtonian gauges and confirm that the Hamiltonians and the associated instabilities are consistent with each other in both gauges. The existence of instabilities is independent of the specific form of higher derivative function which generates gradients for mimetic field perturbations. It is verified that the ghost instability in mimetic perturbations is not associated with the higher derivative instabilities such as the Ostrogradsky ghost.

  11. Perturbation theory of effective Hamiltonians

    International Nuclear Information System (INIS)

    Brandow, B.H.

    1975-01-01

    This paper constitutes a review of the many papers which have used perturbation theory to derive ''effective'' or ''model'' Hamiltonians. It begins with a brief review of nondegenerate and non-many-body perturbation theory, and then considers the degenerate but non-many-body problem in some detail. It turns out that the degenerate perturbation problem is not uniquely defined, but there are some practical criteria for choosing among the various possibilities. Finally, the literature dealing with the linked-cluster aspects of open-shell many-body systems is reviewed. (U.S.)

  12. The theory of singular perturbations

    CERN Document Server

    De Jager, E M

    1996-01-01

    The subject of this textbook is the mathematical theory of singular perturbations, which despite its respectable history is still in a state of vigorous development. Singular perturbations of cumulative and of boundary layer type are presented. Attention has been given to composite expansions of solutions of initial and boundary value problems for ordinary and partial differential equations, linear as well as quasilinear; also turning points are discussed. The main emphasis lies on several methods of approximation for solutions of singularly perturbed differential equations and on the mathemat

  13. The power of perturbation theory

    Energy Technology Data Exchange (ETDEWEB)

    Serone, Marco [SISSA International School for Advanced Studies and INFN Trieste, Via Bonomea 265, 34136, Trieste (Italy); Abdus Salam International Centre for Theoretical Physics, Strada Costiera 11, 34151, Trieste (Italy); Spada, Gabriele [SISSA International School for Advanced Studies and INFN Trieste, Via Bonomea 265, 34136, Trieste (Italy); Villadoro, Giovanni [Abdus Salam International Centre for Theoretical Physics, Strada Costiera 11, 34151, Trieste (Italy)

    2017-05-10

    We study quantum mechanical systems with a discrete spectrum. We show that the asymptotic series associated to certain paths of steepest-descent (Lefschetz thimbles) are Borel resummable to the full result. Using a geometrical approach based on the Picard-Lefschetz theory we characterize the conditions under which perturbative expansions lead to exact results. Even when such conditions are not met, we explain how to define a different perturbative expansion that reproduces the full answer without the need of transseries, i.e. non-perturbative effects, such as real (or complex) instantons. Applications to several quantum mechanical systems are presented.

  14. Tunnelling instability via perturbation theory

    Energy Technology Data Exchange (ETDEWEB)

    Graffi, S. (Bologna Univ. (Italy). Dip. di Matematica); Grecchi, V. (Moderna Univ. (Italy). Dip. di Matematica); Jona-Lasinio, G. (Paris-11 Univ., 91 - Orsay (France). Lab. de Physique Theorique et Hautes Energies)

    1984-10-21

    The semiclassical limit of low lying states in a multiwell potential is studied by rigorous perturbative techniques. In particular tunnelling instability and localisation of wave functions is obtained in a simple way under small deformations of symmetric potentials.

  15. Perturbation theory of quantum resonances

    Czech Academy of Sciences Publication Activity Database

    Durand, P.; Paidarová, Ivana

    2016-01-01

    Roč. 135, č. 7 (2016), s. 159 ISSN 1432-2234 Institutional support: RVO:61388955 Keywords : Partitioning technique * Analytic continuation * Perturbative expansion Subject RIV: CF - Physical ; Theoretical Chemistry

  16. Perturbation Theory of Embedded Eigenvalues

    DEFF Research Database (Denmark)

    Engelmann, Matthias

    project gives a general and systematic approach to analytic perturbation theory of embedded eigenvalues. The spectral deformation technique originally developed in the theory of dilation analytic potentials in the context of Schrödinger operators is systematized by the use of Mourre theory. The group...... of dilations is thereby replaced by the unitary group generated y the conjugate operator. This then allows to treat the perturbation problem with the usual Kato theory.......We study problems connected to perturbation theory of embedded eigenvalues in two different setups. The first part deals with second order perturbation theory of mass shells in massive translation invariant Nelson type models. To this end an expansion of the eigenvalues w.r.t. fiber parameter up...

  17. Perturbative tests of quantum chromodynamics

    International Nuclear Information System (INIS)

    Michael, C.

    1978-01-01

    A review is given of perturbation theory results for quantum chromodynamics and of tests in deep inelastic lepton scattering, electron-positron annihilation, hadronic production of massive dileptons and hadronic large-momentum-transfer processes. (author)

  18. Large-order perturbation theory

    International Nuclear Information System (INIS)

    Wu, T.T.

    1982-01-01

    The original motivation for studying the asymptotic behavior of the coefficients of perturbation series came from quantum field theory. An overview is given of some of the attempts to understand quantum field theory beyond finite-order perturbation series. At least is the case of the Thirring model and probably in general, the full content of a relativistic quantum field theory cannot be recovered from its perturbation series. This difficulty, however, does not occur in quantum mechanics, and the anharmonic oscillator is used to illustrate the methods used in large-order perturbation theory. Two completely different methods are discussed, the first one using the WKB approximation, and a second one involving the statistical analysis of Feynman diagrams. The first one is well developed and gives detailed information about the desired asymptotic behavior, while the second one is still in its infancy and gives instead information about the distribution of vertices of the Feynman diagrams

  19. Review of chiral perturbation theory

    Indian Academy of Sciences (India)

    Abstract. A review of chiral perturbation theory and recent developments on the comparison of its predictions with experiment is presented. Some interesting topics with scope for further elaboration are touched upon.

  20. Quadruplex gold immunochromatogaraphic assay for four families of antibiotic residues in milk.

    Science.gov (United States)

    Zhou, Jinyu; Nie, Wei; Chen, Yiqiang; Yang, Chunjiang; Gong, Lu; Zhang, Chi; Chen, Qian; He, Lidong; Feng, Xiaoyu

    2018-08-01

    In this study, we developed a quadruplex gold immunochromatogaraphic assay (GICA) for the simultaneous determination of four families of antibiotics including β-lactams, tetracyclines, streptomycin and chloramphenicol in milk. For qualitative analysis, the visual cut-off values were measured to be 2-100 ng/mL, 16-32 ng/mL, 50 ng/mL and 2.4 ng/mL for β-lactams, tetracyclines, streptomycin and chloramphenicol, respectively. For quantitative analysis, the detection ranges were 0.13-1 ng/mL for penicillin G, 0.13-8 ng/mL for tetracycline, 0.78-25 ng/mL for streptomycin, 0.019-1.2 ng/mL for chloramphenicol in milk respectively, with linear correlation coefficients higher than 0.97. The spiked experiment indicated that the mean recoveries ranged from 84.5% to 107.6% with coefficient of variations less than 16.2%, and real sample analysis revealed that the GICA can produce consistent results with instrumental analysis. These results demonstrated that this novel immunoassay is a promising approach for rapidly screening common antibiotic residues in milk. Copyright © 2018 Elsevier Ltd. All rights reserved.

  1. Perturbation theory in light-cone gauge

    International Nuclear Information System (INIS)

    Vianello, Eliana

    2000-01-01

    Perturbation calculations are presented for the light-cone gauge Schwinger model. Eigenstates can be calculated perturbatively but the perturbation theory is nonstandard. We hope to extend the work to QCD 2 to resolve some outstanding issues in those theories

  2. Ancient DNA

    DEFF Research Database (Denmark)

    Willerslev, Eske; Cooper, Alan

    2004-01-01

    ancient DNA, palaeontology, palaeoecology, archaeology, population genetics, DNA damage and repair......ancient DNA, palaeontology, palaeoecology, archaeology, population genetics, DNA damage and repair...

  3. Base case and perturbation scenarios

    Energy Technology Data Exchange (ETDEWEB)

    Edmunds, T

    1998-10-01

    This report describes fourteen energy factors that could affect electricity markets in the future (demand, process, source mix, etc.). These fourteen factors are believed to have the most influence on the State's energy environment. A base case, or most probable, characterization is given for each of these fourteen factors over a twenty year time horizon. The base case characterization is derived from quantitative and qualitative information provided by State of California government agencies, where possible. Federal government databases are nsed where needed to supplement the California data. It is envisioned that a initial selection of issue areas will be based upon an evaluation of them under base case conditions. For most of the fourteen factors, the report identities possible perturbations from base case values or assumptions that may be used to construct additional scenarios. Only those perturbations that are plausible and would have a significant effect on energy markets are included in the table. The fourteen factors and potential perturbations of the factors are listed in Table 1.1. These perturbations can be combined to generate internally consist.ent. combinations of perturbations relative to the base case. For example, a low natural gas price perturbation should be combined with a high natural gas demand perturbation. The factor perturbations are based upon alternative quantitative forecasts provided by other institutions (the Department of Energy - Energy Information Administration in some cases), changes in assumptions that drive the quantitative forecasts, or changes in assumptions about the structure of the California energy markets. The perturbations are intended to be used for a qualitative reexamination of issue areas after an initial evaluation under the base case. The perturbation information would be used as a "tiebreaker;" to make decisions regarding those issue areas that were marginally accepted or rejected under the base case. Hf a

  4. Perturbation theory in large order

    International Nuclear Information System (INIS)

    Bender, C.M.

    1978-01-01

    For many quantum mechanical models, the behavior of perturbation theory in large order is strikingly simple. For example, in the quantum anharmonic oscillator, which is defined by -y'' + (x 2 /4 + ex 4 /4 - E) y = 0, y ( +- infinity) = 0, the perturbation coefficients, A/sub n/, in the expansion for the ground-state energy, E(ground state) approx. EPSILON/sub n = 0//sup infinity/ A/sub n/epsilon/sup n/, simplify dramatically as n → infinity: A/sub n/ approx. (6/π 3 )/sup 1/2/(-3)/sup n/GAMMA(n + 1/2). Methods of applied mathematics are used to investigate the nature of perturbation theory in quantum mechanics and show that its large-order behavior is determined by the semiclassical content of the theory. In quantum field theory the perturbation coefficients are computed by summing Feynman graphs. A statistical procedure in a simple lambda phi 4 model for summing the set of all graphs as the number of vertices → infinity is presented. Finally, the connection between the large-order behavior of perturbation theory in quantum electrodynamics and the value of α, the charge on the electron, is discussed. 7 figures

  5. Porous platinum nanotubes labeled with hemin/G-quadruplex based electrochemical aptasensor for sensitive thrombin analysis via the cascade signal amplification.

    Science.gov (United States)

    Sun, Aili; Qi, Qingan; Wang, Xuannian; Bie, Ping

    2014-07-15

    For the first time, a sensitive electrochemical aptasensor for thrombin (TB) was developed by using porous platinum nanotubes (PtNTs) labeled with hemin/G-quadruplex and glucose dehydrogenase (GDH) as labels. Porous PtNTs with large surface area exhibited the peroxidase-like activity. Coupling with GDH and hemin/G-quadruplex as NADH oxidase and HRP-mimicking DNAzyme, the cascade signal amplification was achieved by the following ways: in the presence of glucose and NAD(+) in the working buffer, GDH electrocatalyzed the oxidation of glucose with the production of NADH. Then, hemin/G-quadruplex as NADH oxidase catalyzed the oxidation of NADH to in situ generate H2O2. Based on the corporate electrocatalysis of PtNTs and hemin/G-quadruplex toward H2O2, the electrochemical signal was significantly amplified, allowing the detection limit of TB down to 0.15 pM level. Moreover, the proposed strategy was simple because the intercalated hemin offered the readout signal, avoiding the adding of additional redox mediator as signal donator. Such an electrochemical aptasensor is highly promising for sensitive detection of other proteins in clinical diagnostics. Copyright © 2014 Elsevier B.V. All rights reserved.

  6. Perturbations of the Friedmann universe

    International Nuclear Information System (INIS)

    Novello, M.; Salim, J.M.; Heintzmann, H.

    1982-01-01

    Correcting and extending previous work by Hawking (1966) and Olson (1976) the complete set of perturbation equations of a Friedmann Universe in the quasi-Maxwellian form is derived and analized. The formalism is then applied to scalar, vector and tensor perturbations of a phenomenological fluid, which is modelled such as to comprise shear and heat flux. Depending on the equation of state of the background it is found that there exist unstable (growing) modes of purely rotational character. It is further found that (to linear order at least) any vortex perturbation is equivalent to a certain heat flux vector. The equation for the gravitational waves are derived in a completely equivalent method as in case of the propagation, in a curved space-time, of electromagnetic waves in a plasma endowed with some definite constitutive relations. (Author) [pt

  7. Analytic continuation in perturbative QCD

    International Nuclear Information System (INIS)

    Caprini, Irinel

    2002-01-01

    We discuss some attempts to improve standard perturbative expansion in QCD by using the analytic continuation in the momentum and the Borel complex planes. We first analyse the momentum-plane analyticity properties of the Borel-summed Green functions in perturbative QCD and the connection between the Landau singularities and the infrared renormalons. By using the analytic continuation in the Borel complex plane, we propose a new perturbative series replacing the standard expansion in powers of the normalized coupling constant a. The new expansion functions have branch point and essential singularities at the origin of the complex a-plane and divergent Taylor expansions in powers of a. On the other hand the modified expansion of the QCD correlators is convergent under rather conservative conditions. (author)

  8. Perturbative coherence in field theory

    International Nuclear Information System (INIS)

    Aldrovandi, R.; Kraenkel, R.A.

    1987-01-01

    A general condition for coherent quantization by perturbative methods is given, because the basic field equations of a fild theory are not always derivable from a Lagrangian. It's seen that non-lagrangian models way have well defined vertices, provided they satisfy what they call the 'coherence condition', which is less stringent than the condition for the existence of a Lagrangian. They note that Lagrangian theories are perturbatively coherent, in the sense that they have well defined vertices, and that they satisfy automatically that condition. (G.D.F.) [pt

  9. Cosmological perturbation theory and quantum gravity

    Energy Technology Data Exchange (ETDEWEB)

    Brunetti, Romeo [Dipartimento di Matematica, Università di Trento,Via Sommarive 14, 38123 Povo TN (Italy); Fredenhagen, Klaus [II Institute für Theoretische Physik, Universität Hamburg,Luruper Chaussee 149, 22761 Hamburg (Germany); Hack, Thomas-Paul [Institute für Theoretische Physik, Universität Leipzig,Brüderstr. 16, 04103 Leipzig (Germany); Pinamonti, Nicola [Dipartimento di Matematica, Università di Genova,Via Dodecaneso 35, 16146 Genova (Italy); INFN, Sezione di Genova,Via Dodecaneso 33, 16146 Genova (Italy); Rejzner, Katarzyna [Department of Mathematics, University of York,Heslington, York YO10 5DD (United Kingdom)

    2016-08-04

    It is shown how cosmological perturbation theory arises from a fully quantized perturbative theory of quantum gravity. Central for the derivation is a non-perturbative concept of gauge-invariant local observables by means of which perturbative invariant expressions of arbitrary order are generated. In particular, in the linearised theory, first order gauge-invariant observables familiar from cosmological perturbation theory are recovered. Explicit expressions of second order quantities are presented as well.

  10. Chaotic inflation with metric and matter perturbations

    International Nuclear Information System (INIS)

    Feldman, H.A.; Brandenberger, R.H.

    1989-01-01

    A perturbative scheme to analyze the evolution of both metric and scalar field perturbations in an expanding universe is developed. The scheme is applied to study chaotic inflation with initial metric and scalar field perturbations present. It is shown that initial gravitational perturbations with wavelength smaller than the Hubble radius rapidly decay. The metric simultaneously picks up small perturbations determined by the matter inhomogeneities. Both are frozen in once the wavelength exceeds the Hubble radius. (orig.)

  11. Basics of QCD perturbation theory

    International Nuclear Information System (INIS)

    Soper, D.E.

    1997-01-01

    This is an introduction to the use of QCD perturbation theory, emphasizing generic features of the theory that enable one to separate short-time and long-time effects. The author also covers some important classes of applications: electron-positron annihilation to hadrons, deeply inelastic scattering, and hard processes in hadron-hadron collisions. 31 refs., 38 figs

  12. Current issues in perturbative QCD

    International Nuclear Information System (INIS)

    Hinchliffe, I.

    1994-12-01

    This review talk discusses some issues of active research in perturbative QCD. The following topics are discussed: (1) current value of αs; (2) heavy quark production in hadron collisions; (3) production of Ψ and Υ in p anti p collisions; (4) prompt photon production; (5) small-x and related phenomena; and (6) particle multiplicity in heavy quark jets

  13. New results in perturbative QCD

    International Nuclear Information System (INIS)

    Ellis, R.K.

    1986-01-01

    Three topics in perturbative QCD important for Super-collider physics are reviewed. The topics are: 1. (2 → 2) jet phenomena calculated in O(αs 3 ). 2. New techniques for the calculation of tree graphs. 3. Color coherence in jet phenomena. 31 references, 6 figures

  14. Perturbation theory from stochastic quantization

    International Nuclear Information System (INIS)

    Hueffel, H.

    1984-01-01

    By using a diagrammatical method it is shown that in scalar theories the stochastic quantization method of Parisi and Wu gives the usual perturbation series in Feynman diagrams. It is further explained how to apply the diagrammatical method to gauge theories, discussing the origin of ghost effects. (Author)

  15. Seven topics in perturbative QCD

    International Nuclear Information System (INIS)

    Buras, A.J.

    1980-09-01

    The following topics of perturbative QCD are discussed: (1) deep inelastic scattering; (2) higher order corrections to e + e - annihilation, to photon structure functions and to quarkonia decays; (3) higher order corrections to fragmentation functions and to various semi-inclusive processes; (4) higher twist contributions; (5) exclusive processes; (6) transverse momentum effects; (7) jet and photon physics

  16. Reggeon interactions in perturbative QCD

    International Nuclear Information System (INIS)

    Kirschner, R.

    1994-08-01

    We study the pairwise interaction of reggeized gluons and quarks in the Regge limit of perturbative QCD. The interactions are represented as integral kernels in the transverse momentum space and as operators in the impact parameter space. We observe conformal symmetry and holomorphic factorization in all cases. (orig.)

  17. Basics of QCD perturbation theory

    Energy Technology Data Exchange (ETDEWEB)

    Soper, D.E. [Univ. of Oregon, Eugene, OR (United States). Inst. of Theoretical Science

    1997-06-01

    This is an introduction to the use of QCD perturbation theory, emphasizing generic features of the theory that enable one to separate short-time and long-time effects. The author also covers some important classes of applications: electron-positron annihilation to hadrons, deeply inelastic scattering, and hard processes in hadron-hadron collisions. 31 refs., 38 figs.

  18. Status of chiral perturbation theory

    International Nuclear Information System (INIS)

    Ecker, G.

    1996-10-01

    A survey is made of semileptonic and nonleptonic kaon decays in the framework of chiral perturbation theory. The emphasis is on what has been done rather than how it was done. The theoretical predictions are compared with available experimental results. (author)

  19. Principles of chiral perturbation theory

    International Nuclear Information System (INIS)

    Leutwyler, H.

    1995-01-01

    An elementary discussion of the main concepts used in chiral perturbation theory is given in textbooks and a more detailed picture of the applications may be obtained from the reviews. Concerning the foundations of the method, the literature is comparatively scarce. So, I will concentrate on the basic concepts and explain why the method works. (author)

  20. Superfield perturbation theory and renormalization

    International Nuclear Information System (INIS)

    Delbourgo, R.

    1975-01-01

    The perturbation theory graphs and divergences in super-symmetric Lagrangian models are studied by using superfield techniques. In super PHI 3 -theory very little effort is needed to arrive at the single infinite (wave function) renormalization counterterm, while in PHI 4 -theory the method indicates the counter-Lagrangians needed at the one-loop level and possibly beyond

  1. Chiral symmetry in perturbative QCD

    International Nuclear Information System (INIS)

    Trueman, T.L.

    1979-04-01

    The chiral symmetry of quantum chromodynamics with massless quarks is unbroken in perturbation theory. Dimensional regularization is used. The ratio of the vector and axial vector renormalization constante is shown to be independent of the renormalization mass. The general results are explicitly verified to fourth order in g, the QCD coupling constant

  2. Perturbative QCD and exclusive processes

    International Nuclear Information System (INIS)

    Bennett, J.; Hawes, F.; Zhao, M.; Zyla, P.

    1991-01-01

    The authors discuss perturbation theory as applied to particle physics calculations. In particle physics one is generally interested in the scattering amplitude for a system going from some initial state to a final state. The intermediate state or states are unknown. To get the scattering amplitude it is necessary to sum the contributions from processes which pass through all possible intermediate states. Intermediate states involve the exchange of intermediate vector bosons between the particles, and with this interaction is associated a coupling constant α. Each additional boson exchange involves an additional contribution of α to the coupling. If α is less than 1, one can see that the relative contribution of higher order processes is less and less important as α falls. In QCD the gluons serve as the intermediate vector bosons exchanged by quarks and gluons, and the interaction constant is not really a constant, but depends upon the distance between the particles. At short distances the coupling is small, and one can assume perturbative expansions may converge rapidly. Exclusive scattering processes, as opposed to inclusive, are those in which all of the final state products are detected. The authors then discuss the application of perturbative QCD to the deuteron. The issues of chiral conservation and color transparancy are also discussed, in the scheme of large Q 2 interations, where perturbative QCD should be applicable

  3. Perturbative treatment of nuclear rotations

    International Nuclear Information System (INIS)

    Civitarese, O.

    1980-01-01

    In this work, it is described the case corresponding to perturbative quantum treatment of a fermion system in free rotation and the divergences which resulted from the 'break' in symmetry, associated by the adoption of a deformed basis as a non pertubed solution. (A.C.A.S.) [pt

  4. Relative Stability of Different DNA Guanine Quadruplex Stem Topologies Derived Using Large-Scale Quantum-Chemical Computations

    Czech Academy of Sciences Publication Activity Database

    Šponer, Jiří (ed.); Mládek, Arnošt; Špačková, Naďa; Cang, X.; Cheatham III, Thomas E.; Grimme, S.

    2013-01-01

    Roč. 135, č. 26 (2013), s. 9785-9796 ISSN 0002-7863 R&D Projects: GA MŠk(CZ) ED1.1.00/02.0068; GA ČR(CZ) GAP208/11/1822 Institutional research plan: CEZ:AV0Z50040702 Institutional support: RVO:68081707 Keywords : DENSITY -FUNCTIONAL THEORY * MOLECULAR-DYNAMICS SIMULATIONS * SUGAR-PHOSPHATE BACKBONE Subject RIV: BO - Biophysics Impact factor: 11.444, year: 2013

  5. Molecular Dynamics Simulation Study of Parallel Telomeric DNA Quadruplexes at Different Ionic Strengths: Evaluation of Water and Ion Models

    Czech Academy of Sciences Publication Activity Database

    Rebic, M.; Laaksonen, A.; Šponer, Jiří; Uličný, J.; Mocci, F.

    2016-01-01

    Roč. 120, č. 30 (2016), s. 7380-7391 ISSN 1520-6106 R&D Projects: GA ČR(CZ) GA16-13721S Institutional support: RVO:68081707 Keywords : amber force-field * nucleic-acids * biomolecular simulations Subject RIV: BO - Biophysics OBOR OECD: Physical chemistry Impact factor: 3.177, year: 2016

  6. Regulation of gene expression by the BLM helicase correlates with the presence of G-quadruplex DNA motifs

    DEFF Research Database (Denmark)

    Nguyen, Giang Huong; Tang, Weiliang; Robles, Ana I

    2014-01-01

    Bloom syndrome is a rare autosomal recessive disorder characterized by genetic instability and cancer predisposition, and caused by mutations in the gene encoding the Bloom syndrome, RecQ helicase-like (BLM) protein. To determine whether altered gene expression might be responsible for pathologic...

  7. Perturbations in electromagnetic dark energy

    International Nuclear Information System (INIS)

    Jiménez, Jose Beltrán; Maroto, Antonio L.; Koivisto, Tomi S.; Mota, David F.

    2009-01-01

    It has been recently proposed that the presence of a temporal electromagnetic field on cosmological scales could explain the phase of accelerated expansion that the universe is currently undergoing. The field contributes as a cosmological constant and therefore, the homogeneous cosmology produced by such a model is exactly the same as that of ΛCDM. However, unlike a cosmological constant term, electromagnetic fields can acquire perturbations which in principle could affect CMB anisotropies and structure formation. In this work, we study the evolution of inhomogeneous scalar perturbations in this model. We show that provided the initial electromagnetic fluctuations generated during inflation are small, the model is perfectly compatible with both CMB and large scale structure observations at the same level of accuracy as ΛCDM

  8. Perturbative instabilities in Horava gravity

    International Nuclear Information System (INIS)

    Bogdanos, Charalampos; Saridakis, Emmanuel N

    2010-01-01

    We investigate the scalar and tensor perturbations in Horava gravity, with and without detailed balance, around a flat background. Once both types of perturbations are taken into account, it is revealed that the theory is plagued by ghost-like scalar instabilities in the range of parameters which would render it power-counting renormalizable, that cannot be overcome by simple tricks such as analytic continuation. Implementing a consistent flow between the UV and IR limits seems thus more challenging than initially presumed, regardless of whether the theory approaches general relativity at low energies or not. Even in the phenomenologically viable parameter space, the tensor sector leads to additional potential problems, such as fine-tunings and super-luminal propagation.

  9. The status of perturbative QCD

    International Nuclear Information System (INIS)

    Ellis, R.K.

    1988-10-01

    The advances in perturbative QCD are reviewed. The status of determinations of the coupling constant α/sub S/ and the parton distribution functions is presented. New theoretical results on the spin dependent structure functions of the proton are also reviewed. The theoretical description of the production of vector bosons, jets and heavy quarks is outlined with special emphasis on new results. Expected rates for top quark production at hadronic colliders are presented. 111 refs., 8 figs

  10. Scalar perturbations and conformal transformation

    International Nuclear Information System (INIS)

    Fabris, J.C.; Tossa, J.

    1995-11-01

    The non-minimal coupling of gravity to a scalar field can be transformed into a minimal coupling through a conformal transformation. We show how to connect the results of a perturbation calculation, performed around a Friedman-Robertson-Walker background solution, before and after the conformal transformation. We work in the synchronous gauge, but we discuss the implications of employing other frames. (author). 16 refs

  11. Perturbative QCD at finite temperature

    International Nuclear Information System (INIS)

    Altherr, T.

    1989-03-01

    We discuss an application of finite temperature QCD to lepton-pair production in a quark-gluon plasma. The perturbative calculation is performed within the realtime formalism. After cancellation of infrared and mass singularities, the corrections at O (α s ) are found to be very small in the region where the mass of the Drell-Yan pair is much larger than the temperature of the plasma. Interesting effects, however, appear at the annihilation threshold of the thermalized quarks

  12. Learning gene networks under SNP perturbations using eQTL datasets.

    Directory of Open Access Journals (Sweden)

    Lingxue Zhang

    2014-02-01

    identified computationally by our method under SNP perturbations is well supported by the results from experimental perturbation studies related to DNA replication stress response.

  13. Gauge-invariant cosmological density perturbations

    International Nuclear Information System (INIS)

    Sasaki, Misao.

    1986-06-01

    Gauge-invariant formulation of cosmological density perturbation theory is reviewed with special emphasis on its geometrical aspects. Then the gauge-invariant measure of the magnitude of a given perturbation is presented. (author)

  14. Perturbation of an exact strong gravity solution

    International Nuclear Information System (INIS)

    Baran, S.A.

    1982-10-01

    Perturbations of an exact strong gravity solution are investigated. It is shown, by using the new multipole expansions previously presented, that this exact and static spherically symmetric solution is stable under odd parity perturbations. (author)

  15. Senescent intervertebral disc cells exhibit perturbed matrix homeostasis phenotype.

    Science.gov (United States)

    Ngo, Kevin; Patil, Prashanti; McGowan, Sara J; Niedernhofer, Laura J; Robbins, Paul D; Kang, James; Sowa, Gwendolyn; Vo, Nam

    2017-09-01

    Aging greatly increases the risk for intervertebral disc degeneration (IDD) as a result of proteoglycan loss due to reduced synthesis and enhanced degradation of the disc matrix proteoglycan (PG). How disc matrix PG homeostasis becomes perturbed with age is not known. The goal of this study is to determine whether cellular senescence is a source of this perturbation. We demonstrated that disc cellular senescence is dramatically increased in the DNA repair-deficient Ercc1 -/Δ mouse model of human progeria. In these accelerated aging mice, increased disc cellular senescence is closely associated with the rapid loss of disc PG. We also directly examine PG homeostasis in oxidative damage-induced senescent human cells using an in vitro cell culture model system. Senescence of human disc cells treated with hydrogen peroxide was confirmed by growth arrest, senescence-associated β-galactosidase activity, γH2AX foci, and acquisition of senescence-associated secretory phenotype. Senescent human disc cells also exhibited perturbed matrix PG homeostasis as evidenced by their decreased capacity to synthesize new matrix PG and enhanced degradation of aggrecan, a major matrix PG. of the disc. Our in vivo and in vitro findings altogether suggest that disc cellular senescence is an important driver of PG matrix homeostatic perturbation and PG loss. Published by Elsevier B.V.

  16. The dynamic interplay between DNA topoisomerases and DNA topology.

    Science.gov (United States)

    Seol, Yeonee; Neuman, Keir C

    2016-11-01

    Topological properties of DNA influence its structure and biochemical interactions. Within the cell, DNA topology is constantly in flux. Transcription and other essential processes, including DNA replication and repair, not only alter the topology of the genome but also introduce additional complications associated with DNA knotting and catenation. These topological perturbations are counteracted by the action of topoisomerases, a specialized class of highly conserved and essential enzymes that actively regulate the topological state of the genome. This dynamic interplay among DNA topology, DNA processing enzymes, and DNA topoisomerases is a pervasive factor that influences DNA metabolism in vivo. Building on the extensive structural and biochemical characterization over the past four decades that has established the fundamental mechanistic basis of topoisomerase activity, scientists have begun to explore the unique roles played by DNA topology in modulating and influencing the activity of topoisomerases. In this review we survey established and emerging DNA topology-dependent protein-DNA interactions with a focus on in vitro measurements of the dynamic interplay between DNA topology and topoisomerase activity.

  17. Geometric Hamiltonian structures and perturbation theory

    International Nuclear Information System (INIS)

    Omohundro, S.

    1984-08-01

    We have been engaged in a program of investigating the Hamiltonian structure of the various perturbation theories used in practice. We describe the geometry of a Hamiltonian structure for non-singular perturbation theory applied to Hamiltonian systems on symplectic manifolds and the connection with singular perturbation techniques based on the method of averaging

  18. Multiplicative perturbations of local C-semigroups

    Indian Academy of Sciences (India)

    2016-08-26

    Aug 26, 2016 ... In this paper, we establish some left and right multiplicative perturbation theorems concerning local -semigroups when the generator of a perturbed local -semigroup S(⋅) may not be densely defined and the perturbation operator is a bounded linear operator from ¯D(A) into () such that = ...

  19. Multiplicative perturbations of local C-semigroups

    Indian Academy of Sciences (India)

    In this paper, we establish some left and right multiplicative perturbation theorems concerning local -semigroups when the generator of a perturbed local -semigroup S ( ⋅ ) may not be densely defined and the perturbation operator is a bounded linear operator from D ( A ) ¯ into () such that = on D ( A ) ¯ ...

  20. FRW Cosmological Perturbations in Massive Bigravity

    CERN Document Server

    Comelli, D; Pilo, L

    2014-01-01

    Cosmological perturbations of FRW solutions in ghost free massive bigravity, including also a second matter sector, are studied in detail. At early time, we find that sub horizon exponential instabilities are unavoidable and they lead to a premature departure from the perturbative regime of cosmological perturbations.

  1. A label-free luminescent switch-on assay for ATP using a G-quadruplex-selective iridium(III) complex.

    Science.gov (United States)

    Leung, Ka-Ho; Lu, Lihua; Wang, Modi; Mak, Tsun-Yin; Chan, Daniel Shiu-Hin; Tang, Fung-Kit; Leung, Chung-Hang; Kwan, Hiu-Yee; Yu, Zhiling; Ma, Dik-Lung

    2013-01-01

    We report herein the G-quadruplex-selective property of a luminescent cyclometallated iridium(III) complex for the detection of adenosine-5'-triphosphate (ATP) in aqueous solution. The ATP-binding aptamer was employed as the ATP recognition unit, while the iridium(III) complex was used to monitor the formation of the G-quadruplex structure induced by ATP. The sensitivity and fold enhancement of the assay were higher than those of the previously reported assay using the organic dye crystal violet as a fluorescent probe. This label-free luminescent switch-on assay exhibits high sensitivity and selectivity towards ATP with a limit of detection of 2.5 µM.

  2. A label-free luminescent switch-on assay for ATP using a G-quadruplex-selective iridium(III complex.

    Directory of Open Access Journals (Sweden)

    Ka-Ho Leung

    Full Text Available We report herein the G-quadruplex-selective property of a luminescent cyclometallated iridium(III complex for the detection of adenosine-5'-triphosphate (ATP in aqueous solution. The ATP-binding aptamer was employed as the ATP recognition unit, while the iridium(III complex was used to monitor the formation of the G-quadruplex structure induced by ATP. The sensitivity and fold enhancement of the assay were higher than those of the previously reported assay using the organic dye crystal violet as a fluorescent probe. This label-free luminescent switch-on assay exhibits high sensitivity and selectivity towards ATP with a limit of detection of 2.5 µM.

  3. Triple Quenching of a Novel Self-Enhanced Ru(II) Complex by Hemin/G-Quadruplex DNAzymes and Its Potential Application to Quantitative Protein Detection.

    Science.gov (United States)

    Zhao, Min; Liao, Ni; Zhuo, Ying; Chai, Ya-Qin; Wang, Ji-Peng; Yuan, Ruo

    2015-08-04

    Herein, a novel "on-off" electrochemiluminescence (ECL) aptasensor for highly sensitive determination of thrombin has been constructed based on the triple quenching of the effect of hemin/G-quadruplex DNAzymes upon the Ru(II) complex-based ECL system. First, a strong initial ECL signal was achieved by the dual amplification strategies of (i) intramolecular coreaction of a self-enhanced Ru(II)-based molecule (PTCA-PEI-Ru(II)) and (ii) intermolecular coreaction between PTCA-PEI-Ru(II) and nicotinamide adenine dinucleotide (NADH), which was named the signal-on state. Then, a novel triple quenching of the effect of multifunctional hemin/G-quadruplex DNAzymes upon the Ru(II) complex-based ECL system was designed to realize the desirable signal-off state, which was outlined as follows: (i) the hemin/G-quadruplex DNAzymes mimicked NADH oxidase to oxidize NADH and in situ generate the H2O2, consuming the coreactant of NADH; (ii) its active center of hemin could oxidize the excited state PTCA-PEI-Ru(II)* to PTCA-PEI-Ru(III), making the energy and electron transfer quench; (iii) it also acted as horseradish peroxidase (HRP) to catalyze the H2O2 for in situ producing the quencher of O2. Based on triple quenching of the effect of hemin/G-quadruplex DNAzymes, the highly sensitive "on-off" thrombin aptasensor was developed with a wide linear detection range of 1.0 × 10(-14) M to 1.0 × 10(-10) M and a detection limit down to the femtomolar level.

  4. Hadronic Structure from Perturbative Dressing

    Energy Technology Data Exchange (ETDEWEB)

    Arash, Firooz [Physics Department, Tafresh University, Tafresh, Iran and Center for theoretical physics and Mathematics, AEOI, P.O. Box 11365-8486, Tehran (Iran, Islamic Republic of)]. E-mail: farash@cic.aut.ac.ir

    2005-09-15

    Perturbative dressing of a valence quark in QCD produces the internal structure of an extended object, the so-called Valon. The valon structure is universal and independent of the hosting hadron. Polarized and unpolarized proton and pion structure functions are calculated in the valon representation. One finds that although all the available data on g{sub 1}{sup p,n,d} are easily reproduced, a sizable orbital angular momentum associated with the partonic structure of the valon is required in order to have a spin 1/2 valon.

  5. Perturbations in loop quantum cosmology

    International Nuclear Information System (INIS)

    Nelson, W; Agullo, I; Ashtekar, A

    2014-01-01

    The era of precision cosmology has allowed us to accurately determine many important cosmological parameters, in particular via the CMB. Confronting Loop Quantum Cosmology with these observations provides us with a powerful test of the theory. For this to be possible, we need a detailed understanding of the generation and evolution of inhomogeneous perturbations during the early, quantum gravity phase of the universe. Here, we have described how Loop Quantum Cosmology provides a completion of the inflationary paradigm, that is consistent with the observed power spectra of the CMB

  6. Perturbation calculations with Wilson loop

    International Nuclear Information System (INIS)

    Peixoto Junior, L.B.

    1984-01-01

    We present perturbative calculations with the Wilson loop (WL). The dimensional regularization method is used with a special attention concerning to the problem of divergences in the WL expansion in second and fourth orders, in three and four dimensions. We show that the residue in the pole, in 4d, of the fourth order graphs contribution sum is important for the charge renormalization. We compute up to second order the exact expression of the WL, in three-dimensional gauge theories with topological mass as well as its assimptotic behaviour for small and large distances. the author [pt

  7. Mobile ankle and knee perturbator.

    Science.gov (United States)

    Andersen, Jacob Buus; Sinkjaer, Thomas

    2003-10-01

    A mobile ankle and knee perturbator has been developed. It consists of a functional joint with an integrated clutch. Four Bowden wires connect the joint to a powerful motor and a double pneumatic cylinder. When needed during any time of the gait cycle, it is possible to impose an ankle rotation by engaging the clutch and rotating the ankle or knee joint with a predefined displacement. The system is designed to investigate electrophysiological and biomechanical features of the human ankle or knee joint during gait.

  8. DNA based identification of medicinal materials in Chinese patent medicines

    Science.gov (United States)

    Chen, Rong; Dong, Juan; Cui, Xin; Wang, Wei; Yasmeen, Afshan; Deng, Yun; Zeng, Xiaomao; Tang, Zhuo

    2012-12-01

    Chinese patent medicines (CPM) are highly processed and easy to use Traditional Chinese Medicine (TCM). The market for CPM in China alone is tens of billions US dollars annually and some of the CPM are also used as dietary supplements for health augmentation in the western countries. But concerns continue to be raised about the legality, safety and efficacy of many popular CPM. Here we report a pioneer work of applying molecular biotechnology to the identification of CPM, particularly well refined oral liquids and injections. What's more, this PCR based method can also be developed to an easy to use and cost-effective visual chip by taking advantage of G-quadruplex based Hybridization Chain Reaction. This study demonstrates that DNA identification of specific Medicinal materials is an efficient and cost-effective way to audit highly processed CPM and will assist in monitoring their quality and legality.

  9. Label-free and sensitive detection of T4 polynucleotide kinase activity via coupling DNA strand displacement reaction with enzymatic-aided amplification.

    Science.gov (United States)

    Cheng, Rui; Tao, Mangjuan; Shi, Zhilu; Zhang, Xiafei; Jin, Yan; Li, Baoxin

    2015-11-15

    Several fluorescence signal amplification strategies have been developed for sensitive detection of T4 polynucleotide kinase (T4 PNK) activity, but they need fluorescence dye labeled DNA probe. We have addressed the limitation and report here a label-free strategy for sensitive detection of PNK activity by coupling DNA strand displacement reaction with enzymatic-aided amplification. A hairpin oligonucleotide (hpDNA) with blunt ends was used as the substrate for T4 PNK phosphorylation. In the presence of T4 PNK, the stem of hpDNA was phosphorylated and further degraded by lambda exonuclease (λ exo) from 5' to 3' direction to release a single-stranded DNA as a trigger of DNA strand displacement reaction (SDR). The trigger DNA can continuously displace DNA P2 from P1/P2 hybrid with the help of specific cleavage of nicking endonuclease (Nt.BbvCI). Then, DNA P2 can form G-quadruplex in the presence of potassium ions and quadruplex-selective fluorphore, N-methyl mesoporphyrin IX (NMM), resulting in a significant increase in fluorescence intensity of NMM. Thus, the accumulative release of DNA P2 led to fluorescence signal amplification for determining T4 PNK activity with a detection limit of 6.6×10(-4) U/mL, which is superior or comparative with established approaches. By ingeniously utilizing T4 PNK-triggered DNA SDR, T4 PNK activity can be specifically and facilely studied in homogeneous solution containing complex matrix without any external fluorescence labeling. Moreover, the influence of different inhibitors on the T4 PNK activity revealed that it also can be explored to screen T4 PNK inhibitors. Therefore, this label-free amplification strategy presents a facile and cost-effective approach for nucleic acid phosphorylation related research. Copyright © 2015 Elsevier B.V. All rights reserved.

  10. "Phonon" scattering beyond perturbation theory

    Science.gov (United States)

    Qiu, WuJie; Ke, XueZhi; Xi, LiLi; Wu, LiHua; Yang, Jiong; Zhang, WenQing

    2016-02-01

    Searching and designing materials with intrinsically low lattice thermal conductivity (LTC) have attracted extensive consideration in thermoelectrics and thermal management community. The concept of part-crystalline part-liquid state, or even part-crystalline part-amorphous state, has recently been proposed to describe the exotic structure of materials with chemical- bond hierarchy, in which a set of atoms is weakly bonded to the rest species while the other sublattices retain relatively strong rigidity. The whole system inherently manifests the coexistence of rigid crystalline sublattices and fluctuating noncrystalline substructures. Representative materials in the unusual state can be classified into two categories, i.e., caged and non-caged ones. LTCs in both systems deviate from the traditional T -1 relationship ( T, the absolute temperature), which can hardly be described by small-parameter-based perturbation approaches. Beyond the classical perturbation theory, an extra rattling-like scattering should be considered to interpret the liquid-like and sublattice-amorphization-induced heat transport. Such a kind of compounds could be promising high-performance thermoelectric materials, due to the extremely low LTCs. Other physical properties for these part-crystalline substances should also exhibit certain novelty and deserve further exploration.

  11. Perturbation theory for Alfven wave

    International Nuclear Information System (INIS)

    Yoshida, Z.; Mahajan, S.M.

    1995-01-01

    The Alfven wave is the dominant low frequency transverse mode of a magnetized plasma. The Alfven wave propagation along the magnetic field, and displays a continuous spectrum even in a bounded plasma. This is essentially due to the degeneracy of the wave characteristics, i.e. the frequency (ω) is primarily determined by the wave number in the direction parallel to the ambient magnetic field (k parallel ) and is independent of the perpendicular wavenumbers. The characteristics, that are the direction along which the wave energy propagates, are identical to the ambient magnetic field lines. Therefore, the spectral structure of the Alfven wave has a close relationship with the geometric structure of the magnetic field lines. In an inhomogeneous plasma, the Alfven resonance constitutes a singularity for the defining wave equation; this results in a singular eigenfunction corresponding to the continuous spectrum. The aim of this review is to present an overview of the perturbation theory for the Alfven wave. Emphasis is placed on those perturbations of the continuous spectrum which lead to the creation of point spectra. Such qualitative changes in the spectrum are relevant to many plasma phenomena

  12. DNA origami nanorobot fiber optic genosensor to TMV.

    Science.gov (United States)

    Torelli, Emanuela; Manzano, Marisa; Srivastava, Sachin K; Marks, Robert S

    2018-01-15

    In the quest of greater sensitivity and specificity of diagnostic systems, one continually searches for alternative DNA hybridization methods, enabling greater versatility and where possible field-enabled detection of target analytes. We present, herein, a hybrid molecular self-assembled scaffolded DNA origami entity, intimately immobilized via capture probes linked to aminopropyltriethoxysilane, onto a glass optical fiber end-face transducer, thus producing a novel biosensor. Immobilized DNA nanorobots with a switchable flap can then be actuated by a specific target DNA present in a sample, by exposing a hemin/G-quadruplex DNAzyme, which then catalyzes the generation of chemiluminescence, once the specific fiber probes are immersed in a luminol-based solution. Integrating organic nanorobots to inorganic fiber optics creates a hybrid system that we demonstrate as a proof-of-principle can be utilized in specific DNA sequence detection. This system has potential applications in a wide range of fields, including point-of-care diagnostics or cellular in vivo biosensing when using ultrathin fiber optic probes for research purposes. Copyright © 2017 Elsevier B.V. All rights reserved.

  13. Perturbations i have Known and Loved

    Science.gov (United States)

    Field, Robert W.

    2011-06-01

    A spectroscopic perturbation is a disruption of a ^1Σ-^1Σ-like regular pattern that can embody level-shifts, extra lines, and intensity anomalies. Once upon a time, when a band was labeled ``perturbed,'' it was considered worthless because it could at best yield molecular constants unsuited for archival tables. Nevertheless, a few brave spectroscopists, notably Albin Lagerqvist and Richard Barrow, collected perturbations because they knew that the pattern of multiple perturbations formed an intricate puzzle that would eventually reveal the presence and electronic symmetry of otherwise unobservable electronic states. There are many kinds of patterns of broken patterns. In my PhD thesis I showed how to determine absolute vibrational assignments for the perturber from patterns among the observed values of perturbation matrix elements. When a ^3Π state is perturbed, its six (Ω, parity) components capture a pattern of level shifts and intensity anomalies that reveals more about the nature of the perturber than a simple perturbation of the single component of a ^1Σ state. In perturbation-facilitated OODR, a perturbed singlet level acts as a spectroscopic doorway through which the entire triplet manifold may be systematically explored. For polyatomic molecule vibrations, a vibrational polyad (a group of mutually perturbing vibrational levels, among which the perturbation matrix elements are expected to follow harmonic oscillator scaling rules) can contain more components than a ^3Π state and intrapolyad patterns can be exquisitely sensitive not merely to the nature of an interloper within the polyad but also to the eigenvector character of the vibronic state from which the polyad is viewed. Variation of scaled polyad interaction parameters from one polyad to the next, a pattern of patterns, can signal proximity to an isomerization barrier. Everything in Rydberg-land seems to scale as N⋆-3, yet a trespassing valence state causes all scaling and propensity rules go

  14. New Methods in Non-Perturbative QCD

    Energy Technology Data Exchange (ETDEWEB)

    Unsal, Mithat [North Carolina State Univ., Raleigh, NC (United States)

    2017-01-31

    In this work, we investigate the properties of quantum chromodynamics (QCD), by using newly developing mathematics and physics formalisms. Almost all of the mass in the visible universe emerges from a quantum chromodynamics (QCD), which has a completely negligible microscopic mass content. An intimately related issue in QCD is the quark confinement problem. Answers to non-perturbative questions in QCD remained largely elusive despite much effort over the years. It is also believed that the usual perturbation theory is inadequate to address these kinds of problems. Perturbation theory gives a divergent asymptotic series (even when the theory is properly renormalized), and there are non-perturbative phenomena which never appear at any order in perturbation theory. Recently, a fascinating bridge between perturbation theory and non-perturbative effects has been found: a formalism called resurgence theory in mathematics tells us that perturbative data and non-perturbative data are intimately related. Translating this to the language of quantum field theory, it turns out that non-perturbative information is present in a coded form in perturbation theory and it can be decoded. We take advantage of this feature, which is particularly useful to understand some unresolved mysteries of QCD from first principles. In particular, we use: a) Circle compactifications which provide a semi-classical window to study confinement and mass gap problems, and calculable prototypes of the deconfinement phase transition; b) Resurgence theory and transseries which provide a unified framework for perturbative and non-perturbative expansion; c) Analytic continuation of path integrals and Lefschetz thimbles which may be useful to address sign problem in QCD at finite density.

  15. Perturbativity in the seesaw mechanism

    International Nuclear Information System (INIS)

    Asaka, Takehiko; Tsuyuki, Takanao

    2016-01-01

    We consider the Standard Model extended by right-handed neutrinos to explain massive neutrinos through the seesaw mechanism. The new fermion can be observed when it has a sufficiently small mass and large mixings to left-handed neutrinos. If such a particle is the lightest right-handed neutrino, its contribution to the mass matrix of active neutrinos needs to be canceled by that of a heavier one. Yukawa couplings of the heavier one are then larger than those of the lightest one. We show that the perturbativity condition gives a severe upper bound on the mixing of the lightest right-handed neutrino, depending on the masses of heavier ones. Models of high energy phenomena, such as leptogenesis, can be constrained by low energy experiments.

  16. Initial conditions for cosmological perturbations

    Science.gov (United States)

    Ashtekar, Abhay; Gupt, Brajesh

    2017-02-01

    Penrose proposed that the big bang singularity should be constrained by requiring that the Weyl curvature vanishes there. The idea behind this past hypothesis is attractive because it constrains the initial conditions for the universe in geometric terms and is not confined to a specific early universe paradigm. However, the precise statement of Penrose’s hypothesis is tied to classical space-times and furthermore restricts only the gravitational degrees of freedom. These are encapsulated only in the tensor modes of the commonly used cosmological perturbation theory. Drawing inspiration from the underlying idea, we propose a quantum generalization of Penrose’s hypothesis using the Planck regime in place of the big bang, and simultaneously incorporating tensor as well as scalar modes. Initial conditions selected by this generalization constrain the universe to be as homogeneous and isotropic in the Planck regime as permitted by the Heisenberg uncertainty relations.

  17. Initial conditions for cosmological perturbations

    International Nuclear Information System (INIS)

    Ashtekar, Abhay; Gupt, Brajesh

    2017-01-01

    Penrose proposed that the big bang singularity should be constrained by requiring that the Weyl curvature vanishes there. The idea behind this past hypothesis is attractive because it constrains the initial conditions for the universe in geometric terms and is not confined to a specific early universe paradigm. However, the precise statement of Penrose’s hypothesis is tied to classical space-times and furthermore restricts only the gravitational degrees of freedom. These are encapsulated only in the tensor modes of the commonly used cosmological perturbation theory. Drawing inspiration from the underlying idea, we propose a quantum generalization of Penrose’s hypothesis using the Planck regime in place of the big bang, and simultaneously incorporating tensor as well as scalar modes. Initial conditions selected by this generalization constrain the universe to be as homogeneous and isotropic in the Planck regime as permitted by the Heisenberg uncertainty relations . (paper)

  18. Curvature perturbations from dimensional decoupling

    CERN Document Server

    Giovannini, Massimo

    2005-01-01

    The scalar modes of the geometry induced by dimensional decoupling are investigated. In the context of the low energy string effective action, solutions can be found where the spatial part of the background geometry is the direct product of two maximally symmetric Euclidean manifolds whose related scale factors evolve at a dual rate so that the expanding dimensions first accelerate and then decelerate while the internal dimensions always contract. After introducing the perturbative treatment of the inhomogeneities, a class of five-dimensional geometries is discussed in detail. Quasi-normal modes of the system are derived and the numerical solution for the evolution of the metric inhomogeneities shows that the fluctuations of the internal dimensions provide a term that can be interpreted, in analogy with the well-known four-dimensional situation, as a non-adiabatic pressure density variation. Implications of this result are discussed with particular attention to string cosmological scenarios.

  19. Closed form bound-state perturbation theory

    Directory of Open Access Journals (Sweden)

    Ollie J. Rose

    1980-01-01

    Full Text Available The perturbed Schrödinger eigenvalue problem for bound states is cast into integral form using Green's Functions. A systematic algorithm is developed and applied to the resulting equation giving rise to approximate solutions expressed as functions of the given perturbation parameter. As a by-product, convergence radii for the traditional Rayleigh-Schrödinger and Brillouin-Wigner perturbation theories emerge in a natural way.

  20. Kato expansion in quantum canonical perturbation theory

    Energy Technology Data Exchange (ETDEWEB)

    Nikolaev, Andrey, E-mail: Andrey.Nikolaev@rdtex.ru [Institute of Computing for Physics and Technology, Protvino, Moscow Region, Russia and RDTeX LTD, Moscow (Russian Federation)

    2016-06-15

    This work establishes a connection between canonical perturbation series in quantum mechanics and a Kato expansion for the resolvent of the Liouville superoperator. Our approach leads to an explicit expression for a generator of a block-diagonalizing Dyson’s ordered exponential in arbitrary perturbation order. Unitary intertwining of perturbed and unperturbed averaging superprojectors allows for a description of ambiguities in the generator and block-diagonalized Hamiltonian. We compare the efficiency of the corresponding computational algorithm with the efficiencies of the Van Vleck and Magnus methods for high perturbative orders.

  1. Perturbative spacetimes from Yang-Mills theory

    Energy Technology Data Exchange (ETDEWEB)

    Luna, Andrés [School of Physics and Astronomy, University of Glasgow,Glasgow G12 8QQ, Scotland (United Kingdom); Monteiro, Ricardo [Theoretical Physics Department, CERN,Geneva (Switzerland); Nicholson, Isobel; Ochirov, Alexander; O’Connell, Donal [Higgs Centre for Theoretical Physics,School of Physics and Astronomy, The University of Edinburgh,Edinburgh EH9 3JZ, Scotland (United Kingdom); Westerberg, Niclas [Institute of Photonics and Quantum Sciences,School of Engineering and Physical Sciences, Heriot-Watt University,Edinburgh (United Kingdom); Higgs Centre for Theoretical Physics,School of Physics and Astronomy, The University of Edinburgh,Edinburgh EH9 3JZ, Scotland (United Kingdom); White, Chris D. [Centre for Research in String Theory,School of Physics and Astronomy, Queen Mary University of London,327 Mile End Road, London E1 4NS (United Kingdom)

    2017-04-12

    The double copy relates scattering amplitudes in gauge and gravity theories. In this paper, we expand the scope of the double copy to construct spacetime metrics through a systematic perturbative expansion. The perturbative procedure is based on direct calculation in Yang-Mills theory, followed by squaring the numerator of certain perturbative diagrams as specified by the double-copy algorithm. The simplest spherically symmetric, stationary spacetime from the point of view of this procedure is a particular member of the Janis-Newman-Winicour family of naked singularities. Our work paves the way for applications of the double copy to physically interesting problems such as perturbative black-hole scattering.

  2. Kato expansion in quantum canonical perturbation theory

    International Nuclear Information System (INIS)

    Nikolaev, Andrey

    2016-01-01

    This work establishes a connection between canonical perturbation series in quantum mechanics and a Kato expansion for the resolvent of the Liouville superoperator. Our approach leads to an explicit expression for a generator of a block-diagonalizing Dyson’s ordered exponential in arbitrary perturbation order. Unitary intertwining of perturbed and unperturbed averaging superprojectors allows for a description of ambiguities in the generator and block-diagonalized Hamiltonian. We compare the efficiency of the corresponding computational algorithm with the efficiencies of the Van Vleck and Magnus methods for high perturbative orders.

  3. Perturbation methods for power and reactivity reconstruction

    International Nuclear Information System (INIS)

    Palmiotti, G.; Salvatores, M.; Estiot, J.C.; Broccoli, U.; Bruna, G.; Gomit, J.M.

    1987-01-01

    This paper deals with recent developments and applications in perturbation methods. Two types of methods are used. The first one is an explicit method, which allows the explicit reconstruction of a perturbed flux using a linear combination of a library of functions. In our application, these functions are the harmonics (i.e. the high order eigenfunctions of the system). The second type is based on the Generalized Perturbation Theory GPT and needs the calculation of an importance function for each integral parameter of interest. Recent developments of a particularly useful high order formulation allows to obtain satisfactory results also for very large perturbations

  4. On adiabatic perturbations in the ekpyrotic scenario

    International Nuclear Information System (INIS)

    Linde, A.; Mukhanov, V.; Vikman, A.

    2010-01-01

    In a recent paper, Khoury and Steinhardt proposed a way to generate adiabatic cosmological perturbations with a nearly flat spectrum in a contracting Universe. To produce these perturbations they used a regime in which the equation of state exponentially rapidly changed during a short time interval. Leaving aside the singularity problem and the difficult question about the possibility to transmit these perturbations from a contracting Universe to the expanding phase, we will show that the methods used in Khoury are inapplicable for the description of the cosmological evolution and of the process of generation of perturbations in this scenario

  5. Label-Free Ag+ Detection by Enhancing DNA Sensitized Tb3+ Luminescence

    Directory of Open Access Journals (Sweden)

    Kimberly Kleinke

    2016-08-01

    Full Text Available In this work, the effect of Ag+ on DNA sensitized Tb3+ luminescence was studied initially using the Ag+-specific RNA-cleaving DNAzyme, Ag10c. While we expected to observe luminescence quenching by Ag+, a significant enhancement was produced. Based on this observation, simple DNA oligonucleotide homopolymers were used with systematically varied sequence and length. We discovered that both poly-G and poly-T DNA have a significant emission enhancement by Ag+, while the absolute intensity is stronger with the poly-G DNA, indicating that a G-quadruplex DNA is not required for this enhancement. Using the optimized length of the G7 DNA (an oligo constituted with seven guanines, Ag+ was measured with a detection limit of 57.6 nM. The signaling kinetics, G7 DNA conformation, and the binding affinity of Tb3+ to the DNA in the presence or absence of Ag+ are also studied to reveal the mechanism of emission enhancement. This observation is useful not only for label-free detection of Ag+, but also interesting for the rational design of new biosensors using Tb3+ luminescence.

  6. The SARS-unique domain (SUD of SARS coronavirus contains two macrodomains that bind G-quadruplexes.

    Directory of Open Access Journals (Sweden)

    Jinzhi Tan

    2009-05-01

    Full Text Available Since the outbreak of severe acute respiratory syndrome (SARS in 2003, the three-dimensional structures of several of the replicase/transcriptase components of SARS coronavirus (SARS-CoV, the non-structural proteins (Nsps, have been determined. However, within the large Nsp3 (1922 amino-acid residues, the structure and function of the so-called SARS-unique domain (SUD have remained elusive. SUD occurs only in SARS-CoV and the highly related viruses found in certain bats, but is absent from all other coronaviruses. Therefore, it has been speculated that it may be involved in the extreme pathogenicity of SARS-CoV, compared to other coronaviruses, most of which cause only mild infections in humans. In order to help elucidate the function of the SUD, we have determined crystal structures of fragment 389-652 ("SUD(core" of Nsp3, which comprises 264 of the 338 residues of the domain. Both the monoclinic and triclinic crystal forms (2.2 and 2.8 A resolution, respectively revealed that SUD(core forms a homodimer. Each monomer consists of two subdomains, SUD-N and SUD-M, with a macrodomain fold similar to the SARS-CoV X-domain. However, in contrast to the latter, SUD fails to bind ADP-ribose, as determined by zone-interference gel electrophoresis. Instead, the entire SUD(core as well as its individual subdomains interact with oligonucleotides known to form G-quadruplexes. This includes oligodeoxy- as well as oligoribonucleotides. Mutations of selected lysine residues on the surface of the SUD-N subdomain lead to reduction of G-quadruplex binding, whereas mutations in the SUD-M subdomain abolish it. As there is no evidence for Nsp3 entering the nucleus of the host cell, the SARS-CoV genomic RNA or host-cell mRNA containing long G-stretches may be targets of SUD. The SARS-CoV genome is devoid of G-stretches longer than 5-6 nucleotides, but more extended G-stretches are found in the 3'-nontranslated regions of mRNAs coding for certain host-cell proteins

  7. High-Resolution Profiling of Drosophila Replication Start Sites Reveals a DNA Shape and Chromatin Signature of Metazoan Origins

    Directory of Open Access Journals (Sweden)

    Federico Comoglio

    2015-05-01

    Full Text Available At every cell cycle, faithful inheritance of metazoan genomes requires the concerted activation of thousands of DNA replication origins. However, the genetic and chromatin features defining metazoan replication start sites remain largely unknown. Here, we delineate the origin repertoire of the Drosophila genome at high resolution. We address the role of origin-proximal G-quadruplexes and suggest that they transiently stall replication forks in vivo. We dissect the chromatin configuration of replication origins and identify a rich spatial organization of chromatin features at initiation sites. DNA shape and chromatin configurations, not strict sequence motifs, mark and predict origins in higher eukaryotes. We further examine the link between transcription and origin firing and reveal that modulation of origin activity across cell types is intimately linked to cell-type-specific transcriptional programs. Our study unravels conserved origin features and provides unique insights into the relationship among DNA topology, chromatin, transcription, and replication initiation across metazoa.

  8. Poly-ADP-ribosylation of proteins responds to cellular perturbations

    International Nuclear Information System (INIS)

    Schneeweiss, F.H.A.; Sharan, R.N.

    1999-01-01

    From the results presented above it is quite obvious that poly-ADP-ribosylation reaction is a sensitive parameter to monitor cellular responses to a wide variety of perturbations. Having developed a monolayer assay system using 32 P-NAD + as a marker, it has become possible to measure levels of cellular ADP-ribosylation more precisely. It has been demonstrated that the trigger of poly-ADP-ribosylation reaction may involve different cellular components for different perturbations. In this, membrane has been found to be important. The study has been particularly informative in the realm of DNA damage and repair following qualitatively different radiation assaults. As poly-ADP-ribosylation in eukaryotic cells primarily affects chromosomal proteins, notably histones, the reaction is strongly triggered in response to single and double strand breaks in DNA. Therefore, level of cellular poly-ADP-ribosylation can potentially be used as a biosensor of radiation induced strand breaks and can be specially useful in clinical monitoring of progress of radiotherapy. The assay of poly-ADP-ribosylation, however, requires use of radiolabelled tracer, e.g. 32 P-NAD + . Due to this, study of poly-ADP-ribosylation can not be extended to monitor effects of incorporated radionuclides. In order to overcome this shortcoming and to make the assay more sensitive and quick, a Western blot immunoassay has been developed. The preliminary indications are that the immunoassay of poly-ADP-ribosylation will fulfil the requirements to use poly-ADP-ribosylation as a sensitive, convenient and clinically applicable biosensor of cell response not only to radiations but also to different perturbations. (orig.)

  9. Perturbed angular correlations and distributions

    International Nuclear Information System (INIS)

    Makaryunas, K.

    1976-01-01

    The present index comprises original works and review papers on the perturbed angular correlations (PAC) and distributions (PAD). The articles published in the Soviet and foreign journals as well as the materials of conferences, monographs and collections published in the USSR and abroad, the preprints produced by various institutes and abstracts of disertations are included from 1948 up to 1973. The whole material compiled in this index is divided into three parts. Part one is a bibliographic index. All papers in this part are divided into three sections. Section one comprises the papers devoted to the theoretical works on PAC, review papers, monographs, materials of conferences. Section two deals with the works of methodical character where correlation spectrometers as well as the treatment of experimental data are described. In section three experimental works with concrete nuclei are compiled. Part two gives the characteristic of works performed with concrete nuclei. This part is presented in the form of the table in which the works are systematized according to the chemical elements and isotopes. The table shows the characteristics of the nuclear levels used in the investigations by PAC as well as brief characteristics of experiments and results obtained. Part three - appendix contains alphabetic index of the authors, the list of the used editions with the abbreviations of the titles of these editions. The lists indicating the dynamic of the quantity of works on PAC and the distribution according to the literature sources are also given

  10. Chiral perturbation theory with nucleons

    International Nuclear Information System (INIS)

    Meissner, U.G.

    1991-09-01

    I review the constraints posed on the interactions of pions, nucleons and photons by the spontaneously broken chiral symmetry of QCD. The framework to perform these calculations, chiral perturbation theory, is briefly discussed in the meson sector. The method is a simultaneous expansion of the Greens functions in powers of external moments and quark masses around the massless case, the chiral limit. To perform this expansion, use is made of a phenomenological Lagrangian which encodes the Ward-identities and pertinent symmetries of QCD. The concept of chiral power counting is introduced. The main part of the lectures of consists in describing how to include baryons (nucleons) and how the chiral structure is modified by the fact that the nucleon mass in the chiral limit does not vanish. Particular emphasis is put on working out applications to show the strengths and limitations of the methods. Some processes which are discussed are threshold photopion production, low-energy compton scattering off nucleons, πN scattering and the σ-term. The implications of the broken chiral symmetry on the nuclear forces are briefly described. An alternative approach, in which the baryons are treated as very heavy fields, is touched upon

  11. BLM helicase suppresses recombination at G-quadruplex motifs in transcribed genes

    NARCIS (Netherlands)

    van Wietmarschen, Niek; Merzouk, Sarra; Halsema, Nancy; Spierings, Diana C J; Guryev, Victor; Lansdorp, Peter M

    2018-01-01

    Bloom syndrome is a cancer predisposition disorder caused by mutations in the BLM helicase gene. Cells from persons with Bloom syndrome exhibit striking genomic instability characterized by excessive sister chromatid exchange events (SCEs). We applied single-cell DNA template strand sequencing

  12. Massive states in chiral perturbation theory

    Energy Technology Data Exchange (ETDEWEB)

    Mallik, S [Saha Inst. of Nuclear Physics, Calcutta (India)

    1995-08-01

    It is shown that the chiral nonanalytic terms generated by {Delta}{sub 33} resonance in the nucleon self-energy is reproduced in chiral perturbation theory by perturbing appropriate local operators contained in the pion-nucleon effective Lagrangian itself. (orig.)

  13. On the non-perturbative effects

    International Nuclear Information System (INIS)

    Manjavidze, J.; Voronyuk, V.

    2004-01-01

    The quantum correspondence principle based on the time reversibility is adopted to take into account the non-Abelian symmetry constrains. The main properties of the new strong-coupling perturbation theory which take into account non-perturbative effects are described. (author)

  14. Scalar Quantum Electrodynamics: Perturbation Theory and Beyond

    International Nuclear Information System (INIS)

    Bashir, A.; Gutierrez-Guerrero, L. X.; Concha-Sanchez, Y.

    2006-01-01

    In this article, we calculate scalar propagator in arbitrary dimensions and gauge and the three-point scalar-photon vertex in arbitrary dimensions and Feynman gauge, both at the one loop level. We also discuss constraints on their non perturbative structure imposed by requirements of gauge invariance and perturbation theory

  15. G-quadruplex aptamer targeting Protein A and its capability to detect Staphylococcus aureus demonstrated by ELONA.

    Science.gov (United States)

    Stoltenburg, Regina; Krafčiková, Petra; Víglaský, Viktor; Strehlitz, Beate

    2016-09-21

    Aptamers for whole cell detection are selected mostly by the Cell-SELEX procedure. Alternatively, the use of specific cell surface epitopes as target during aptamer selections allows the development of aptamers with ability to bind whole cells. In this study, we integrated a formerly selected Protein A-binding aptamer PA#2/8 in an assay format called ELONA (Enzyme-Linked OligoNucleotide Assay) and evaluated the ability of the aptamer to recognise and bind to Staphylococcus aureus presenting Protein A on the cell surface. The full-length aptamer and one of its truncated variants could be demonstrated to specifically bind to Protein A-expressing intact cells of S. aureus, and thus have the potential to expand the portfolio of aptamers that can act as an analytical agent for the specific recognition and rapid detection of the bacterial pathogen. The functionality of the aptamer was found to be based on a very complex, but also highly variable structure. Two structural key elements were identified. The aptamer sequence contains several G-clusters allowing folding into a G-quadruplex structure with the potential of dimeric and multimeric assembly. An inverted repeat able to form an imperfect stem-loop at the 5'-end also contributes essentially to the aptameric function.

  16. Development of a Novel Fluorescence Assay Based on the Use of the Thrombin-Binding Aptamer for the Detection of O6-Alkylguanine-DNA Alkyltransferase Activity

    Directory of Open Access Journals (Sweden)

    Maria Tintoré

    2010-01-01

    Full Text Available Human O6-alkylguanine-DNA alkyltransferase (hAGT is a DNA repair protein that reverses the effects of alkylating agents by removing DNA adducts from the O6 position of guanine. Here, we developed a real-time fluorescence hAGT activity assay that is based on the detection of conformational changes of the thrombin-binding aptamer (TBA. The quadruplex structure of TBA is disrupted when a central guanine is replaced by an O6-methyl-guanine. The sequence also contains a fluorophore (fluorescein and a quencher (dabsyl attached to the opposite ends. In the unfolded structure, the fluorophore and the quencher are separated. When hAGT removes the methyl group from the central guanine of TBA, it folds back immediately into its quadruplex structure. Consequently, the fluorophore and the quencher come into close proximity, thereby resulting in decreased fluorescence intensity. Here, we developed a new method to quantify the hAGT without using radioactivity. This new fluorescence resonance energy transfer assay has been designed to detect the conformational change of TBA that is induced by the removal of the O6-methyl group.

  17. Ultrasensitive electrochemical detection of avian influenza A (H7N9) virus DNA based on isothermal exponential amplification coupled with hybridization chain reaction of DNAzyme nanowires.

    Science.gov (United States)

    Yu, Yanyan; Chen, Zuanguang; Jian, Wensi; Sun, Duanping; Zhang, Beibei; Li, Xinchun; Yao, Meicun

    2015-02-15

    In this work, a simple and label-free electrochemical biosensor with duel amplification strategy was developed for DNA detection based on isothermal exponential amplification (EXPAR) coupled with hybridization chain reaction (HCR) of DNAzymes nanowires. Through rational design, neither the primer nor the DNAzymes containing molecular beacons (MBs) could react with the duplex probe which were fixed on the electrode surface. Once challenged with target, the duplex probe cleaved and triggered the EXPAR mediated target recycle and regeneration circles as well as the HCR process. As a result, a greater amount of targets were generated to cleave the duplex probes. Subsequently, the nanowires consisting of the G-quadruplex units were self-assembled through hybridization with the strand fixed on the electrode surface. In the presence of hemin, the resulting catalytic G-quadruplex-hemin HRP-mimicking DNAzymes were formed. Electrochemical signals can be obtained by measuring the increase in reduction current of oxidized 3.3',5.5'-tetramethylbenzidine sulfate (TMB), which was generated by DNAzyme in the presence of H2O2. This method exhibited ultrahigh sensitivity towards avian influenza A (H7N9) virus DNA sequence with detection limits of 9.4 fM and a detection range of 4 orders of magnitude. The biosensor was also capable of discriminating single-nucleotide difference among concomitant DNA sequences and performed well in spiked cell lysates. Copyright © 2014 Elsevier B.V. All rights reserved.

  18. Difference scheme for a singularly perturbed parabolic convection-diffusion equation in the presence of perturbations

    Science.gov (United States)

    Shishkin, G. I.

    2015-11-01

    An initial-boundary value problem is considered for a singularly perturbed parabolic convection-diffusion equation with a perturbation parameter ɛ (ɛ ∈ (0, 1]) multiplying the highest order derivative. The stability of a standard difference scheme based on monotone approximations of the problem on a uniform mesh is analyzed, and the behavior of discrete solutions in the presence of perturbations is examined. The scheme does not converge ɛ-uniformly in the maximum norm as the number of its grid nodes is increased. When the solution of the difference scheme converges, which occurs if N -1 ≪ ɛ and N -1 0 ≪ 1, where N and N 0 are the numbers of grid intervals in x and t, respectively, the scheme is not ɛ-uniformly well conditioned or stable to data perturbations in the grid problem and to computer perturbations. For the standard difference scheme in the presence of data perturbations in the grid problem and/or computer perturbations, conditions on the "parameters" of the difference scheme and of the computer (namely, on ɛ, N, N 0, admissible data perturbations in the grid problem, and admissible computer perturbations) are obtained that ensure the convergence of the perturbed solutions. Additionally, the conditions are obtained under which the perturbed numerical solution has the same order of convergence as the solution of the unperturbed standard difference scheme.

  19. Hybrid ligand-alkylating agents targeting telomeric G-quadruplex structures.

    Science.gov (United States)

    Doria, Filippo; Nadai, Matteo; Folini, Marco; Di Antonio, Marco; Germani, Luca; Percivalle, Claudia; Sissi, Claudia; Zaffaroni, Nadia; Alcaro, Stefano; Artese, Anna; Richter, Sara N; Freccero, Mauro

    2012-04-14

    The synthesis, physico-chemical properties and biological effects of a new class of naphthalene diimides (NDIs) capable of reversibly binding telomeric DNA and alkylate it through an electrophilic quinone methide moiety (QM), are reported. FRET and circular dichroism assays showed a marked stabilization and selectivity towards telomeric G4 DNA folded in a hybrid topology. NDI-QMs' alkylating properties revealed a good reactivity on single nucleosides and selectivity towards telomeric G4. A selected NDI was able to significantly impair the growth of melanoma cells by causing telomere dysfunction and down-regulation of telomerase expression. These findings points to our hybrid ligand-alkylating NDIs as possible tools for the development of novel targeted anticancer therapies. This journal is © The Royal Society of Chemistry 2012

  20. Label-free and enzyme-free detection of transcription factors with graphene oxide fluorescence switch-based multifunctional G-quadruplex-hairpin probe.

    Science.gov (United States)

    Zhu, Desong; Wang, Lei; Xu, Xiaowen; Jiang, Wei

    2016-01-15

    Transcription factors (TFs) play pivotal roles in the regulation of a variety of essential cellular processes and some of them have been recognized as potential diagnostic markers and therapeutic targets of some diseases. Sensitive and accurate detection of TFs is of great importance to better understanding their roles in gene regulation and evaluation of disease state. Here, we developed a simple, label-free and enzyme-free new fluorescent strategy for the detection of TFs by graphene oxide (GO) fluorescence switch-based multifunctional G-quadruplex-hairpin probe (MGHP). The MGHP possessed of three functions simultaneously, adsorbing onto GO with the loop part, binding to target with the stem part and serving as signal carrier with the terminal G-quadruplex. First, the MGHP was adsorbed quickly to GO. Next, the TF bound to the stem part of MGHP to form a huge target-MGHP complex, which led to desorption of the complex from GO. Finally, NMM was inserted into G-quadruplex in the complex to yield an enhanced fluorescence response. The GO used here, as a fluorescence switch, could quickly and efficiently quench the fluorescence of NMM inserted into the MGHP absorbed on the GO, guaranteeing a high signal-to-noise ratio. Sensitive detection of purified NF-κB p50 and HeLa cell nuclear extracts were achieved with detection limits of 0.2nM and 7.8ng/µL, respectively. Moreover, this proposed strategy could be used to screen inhibitors of NF-κB p50 activity. The strategy proposed here might offer a new potential approach for reliable quantification of TFs in clinical diagnostics and treatment research of some diseases. Copyright © 2015 Elsevier B.V. All rights reserved.

  1. Novel molecular targets for kRAS downregulation: promoter G-quadruplexes

    Science.gov (United States)

    2016-11-01

    proteins studied. 6. Products: • Publications, conference papers , and presentations o Journal Publications • Morgan, RK; Batra, H; Gaerig, VC; Hockings, J... papers , and presentations • Batra, H; Brooks, TA. Binding and function of regulatory proteins to the kRAS promoter: a role in pancreatic cancer. 6th...development due to difficulties with delivery and excessive albumin binding, and antisoma’s G-rich phosphodiester oligonucleotide AS1411, a DNA aptamer with

  2. Strings as perturbations of evolving spin networks

    International Nuclear Information System (INIS)

    Smolin, Lee

    2000-01-01

    One step in the construction of a background independent formulation of string theory is detailed, in which it is shown how perturbative strings may arise as small fluctuations around histories in a formulation of non-perturbative dynamics of spin networks due to Markopoulou. In this formulation the dynamics of spin network states and their generalizations is described in terms of histories which have discrete analogues of the causal structure and many fingered time of Lorentzian spacetimes. Perturbations of these histories turn out to be described in terms of spin systems defined on 2-dimensional timelike surfaces embedded in the discrete spacetime. When the history has a classical limit which is Minkowski spacetime, the action of the perturbation theory is given to leading order by the spacetime area of the surface, as in bosonic string theory. This map between a non-perturbative formulation of quantum gravity and a 1+1 dimensional theory generalizes to a large class of theories in which the group SU(2) i s extended to any quantum group or supergroup. It is argued that a necessary condition for the non-perturbative theory to have a good classical limit is that the resulting 1+1 dimensional theory defines a consistent and stable perturbative string theory

  3. Perturbation analysis of linear control problems

    International Nuclear Information System (INIS)

    Petkov, Petko; Konstantinov, Mihail

    2017-01-01

    The paper presents a brief overview of the technique of splitting operators, proposed by the authors and intended for perturbation analysis of control problems involving unitary and orthogonal matrices. Combined with the technique of Lyapunov majorants and the implementation of the Banach and Schauder fixed point principles, it allows to obtain rigorous non-local perturbation bounds for a set of sensitivity analysis problems. Among them are the reduction of linear systems into orthogonal canonical forms, the feedback synthesis problem and pole assignment problem in particular, as well as other important problems in control theory and linear algebra. Key words: perturbation analysis, canonical forms, feedback synthesis

  4. Kerr-CFT and gravitational perturbations

    International Nuclear Information System (INIS)

    Dias, Oscar J.C.; Reall, Harvey S.; Santos, Jorge E.

    2009-01-01

    Motivated by the Kerr-CFT conjecture, we investigate perturbations of the near-horizon extreme Kerr spacetime. The Teukolsky equation for a massless field of arbitrary spin is solved. Solutions fall into two classes: normal modes and traveling waves. Imposing suitable (outgoing) boundary conditions, we find that there are no unstable modes. The explicit form of metric perturbations is obtained using the Hertz potential formalism, and compared with the Kerr-CFT boundary conditions. The energy and angular momentum associated with scalar field and gravitational normal modes are calculated. The energy is positive in all cases. The behaviour of second order perturbations is discussed.

  5. Resolution of ambiguities in perturbative QCD

    International Nuclear Information System (INIS)

    Nakkagawa, Hisao; Niegawa, Akira.

    1984-01-01

    In the perturbative QCD analyses of the deeply inelastic processes, the coupling constant depends on at least two mass-scales, the renormalization scale and the factorization scale. By integrating the coupled renormalization group equations with respect to these two mass-scales, the running coupling constant is defined. A perturbative approximation then introduces a new ambiguity, the integration-path dependence, into the theory. We show that the problem of this new ambiguity is resolved by imposing Stevenson's principle of minimal sensitivity. Together with the analogous analysis of the operator matrix element or the cut vertex, we can completely solve the problem of getting an unambiguous perturbative QCD prediction. (author)

  6. Mass generation in perturbed massless integrable models

    International Nuclear Information System (INIS)

    Controzzi, D.; Mussardo, G.

    2005-01-01

    We extend form-factor perturbation theory to non-integrable deformations of massless integrable models, in order to address the problem of mass generation in such systems. With respect to the standard renormalisation group analysis this approach is more suitable for studying the particle content of the perturbed theory. Analogously to the massive case, interesting information can be obtained already at first order, such as the identification of the operators which create a mass gap and those which induce the confinement of the massless particles in the perturbed theory

  7. Non-perturbative effects in supersymmetry

    International Nuclear Information System (INIS)

    Veneziano, G.

    1987-01-01

    Some non perturbative aspects of globally supersymmetric (SUSY) gauge theories are discussed. These share with their non-supersymmetric analogues interesting non perturbative features, such as the spontaneous breaking of chiral symmetries via condensates. What is peculiar about supersymmetric theories, however, is that one is able to say a lot about non-perturbative effects even without resorting to elaborate numerical calculations: general arguments, supersymmetric and chiral Ward identities and analytic, dynamical calculations will turn out to effectively determine most of the supersymmetric vacuum properties. 28 references, 5 figures

  8. On perturbation theory for distance dependent statistics.

    Energy Technology Data Exchange (ETDEWEB)

    Mashkevich, S V

    1994-12-31

    It is known that perturbation theory for anyons has to be modified near Bose statistics in order to get correct finite results. For ``distance dependent statistics`` or anyons with smeared flux tubes, perturbation theory is in principle applicable directly but gives results which hold for too small values of the statistical parameter and, in particular, are not valid as the flux tube radius tends to zero. In this paper we discuss the way to modify perturbation theory for this situation, which allows to obtain the appropriate results. (author). 6 refs.

  9. Solitonic Integrable Perturbations of Parafermionic Theories

    CERN Document Server

    Fernández-Pousa, C R; Hollowood, Timothy J; Miramontes, J L

    1997-01-01

    The quantum integrability of a class of massive perturbations of the parafermionic conformal field theories associated to compact Lie groups is established by showing that they have quantum conserved densities of scale dimension 2 and 3. These theories are integrable for any value of a continuous vector coupling constant, and they generalize the perturbation of the minimal parafermionic models by their first thermal operator. The classical equations-of-motion of these perturbed theories are the non-abelian affine Toda equations which admit (charged) soliton solutions whose semi-classical quantization is expected to permit the identification of the exact S-matrix of the theory.

  10. Critical behaviors of gravity under quantum perturbations

    Directory of Open Access Journals (Sweden)

    ZHANG Hongsheng

    2014-02-01

    Full Text Available Phase transition and critical phenomenon is a very interesting topic in thermodynamics and statistical mechanics. Gravity is believed to have deep and inherent relation to thermodynamics. Near the critical point,the perturbation becomes significant. Thus for ordinary matter (governed by interactions besides gravity the critical behavior will become very different if we ignore the perturbations around the critical point,such as mean field theory. We find that the critical exponents for RN-AdS spacetime keep the same values even when we consider the full quantum perturbations. This indicates a key difference between gravity and ordinary thermodynamic system.

  11. DNA adducts in senescent cells

    International Nuclear Information System (INIS)

    Gaubatz, J.W.

    1987-01-01

    Perturbations in DNA repair and other metabolic processes during development and aging might affect the steady-state level of genomic damage. The persistence or accumulation of DNA lesions in postmitotic cells could have a significant impact on proper cellular function, interfering with gene regulation for example. To test the notion that DNA damage increases as a function of age in non-dividing cells, DNA was purified from heart tissue of C57BL/6Nia mice at different ages and analyzed by post labeling techniques to detect DNA adducts. In the present experiments, four-dimensional, thin-layer chromatography was used to isolate aromatic adducts that were labeled with carrier-free (γ- 32 P) ATP under DNA-P excess conditions. The complexity and frequency of aromatic adducts varied between DNA samples. Several adducts were present in all preparations and were clearly more abundant in nucleotide maps of mature and old heart DNA. However, a direct correlation with age was not observed. In contrast, experiments in which aromatic adducts were first isolated by phase-transfer to 1-butanol, then labeled with excess (γ- 32 P)ATP indicated that there was an age-related increase in these adducts. The results are consistent with their earlier studies that showed alkyl adducts increased during aging of mouse myocardium and suggest that a common repair pathway might be involved

  12. A Role for the Fifth G-Track in G-Quadruplex Forming Oncogene Promoter Sequences during Oxidative Stress: Do These “Spare Tires” Have an Evolved Function?

    Science.gov (United States)

    2015-01-01

    Uncontrolled inflammation or oxidative stress generates electron-deficient species that oxidize the genome increasing its instability in cancer. The G-quadruplex (G4) sequences regulating the c-MYC, KRAS, VEGF, BCL-2, HIF-1α, and RET oncogenes, as examples, are targets for oxidation at loop and 5′-core guanines (G) as showcased in this study by CO3•– oxidation of the VEGF G4. Products observed include 8-oxo-7,8-dihydroguanine (OG), spiroiminodihydantoin (Sp), and 5-guanidinohydantoin (Gh). Our previous studies found that OG and Gh, when present in the four G-tracks of the solved structure for VEGF and c-MYC, were not substrates for the base excision repair (BER) DNA glycosylases in biologically relevant KCl solutions. We now hypothesize that a fifth G-track found a few nucleotides distant from the G4 tracks involved in folding can act as a “spare tire,” facilitating extrusion of a damaged G-run into a large loop that then becomes a substrate for BER. Thermodynamic, spectroscopic, and DMS footprinting studies verified the fifth domain replacing a damaged G-track with OG or Gh at a loop or core position in the VEGF G4. These new “spare tire”-containing strands with Gh in loops are now found to be substrates for initiation of BER with the NEIL1, NEIL2, and NEIL3 DNA glycosylases. The results support a hypothesis in which regulatory G4s carry a “spare-tire” fifth G-track for aiding in the repair process when these sequences are damaged by radical oxygen species, a feature observed in a large number of these sequences. Furthermore, formation and repair of oxidized bases in promoter regions may constitute an additional example of epigenetic modification, in this case of guanine bases, to regulate gene expression in which the G4 sequences act as sensors of oxidative stress. PMID:26405692

  13. Stability under persistent perturbation by white noise

    International Nuclear Information System (INIS)

    Kalyakin, L

    2014-01-01

    Deterministic dynamical system which has an asymptotical stable equilibrium is considered under persistent perturbation by white noise. It is well known that if the perturbation does not vanish in the equilibrium position then there is not Lyapunov's stability. The trajectories of the perturbed system diverge from the equilibrium to arbitrarily large distances with probability 1 in finite time. New concept of stability on a large time interval is discussed. The length of interval agrees the reciprocal quantity of the perturbation parameter. The measure of stability is the expectation of the square distance from the trajectory till the equilibrium position. The method of parabolic equation is applied to both estimate the expectation and prove such stability. The main breakthrough is the barrier function derived for the parabolic equation. The barrier is constructed by using the Lyapunov function of the unperturbed system

  14. Inflation and the theory of cosmological perturbations

    International Nuclear Information System (INIS)

    Riotto, A.

    2003-01-01

    These lectures provide a pedagogical introduction to inflation and the theory of cosmological perturbations generated during inflation which are thought to be the origin of structure in the universe. (author)

  15. 't Hooft loops and perturbation theory

    CERN Document Server

    De Forcrand, Philippe; Noth, D; Forcrand, Philippe de; Lucini, Biagio; Noth, David

    2005-01-01

    We show that high-temperature perturbation theory describes extremely well the area law of SU(N) spatial 't Hooft loops, or equivalently the tension of the interface between different Z_N vacua in the deconfined phase. For SU(2), the disagreement between Monte Carlo data and lattice perturbation theory for sigma(T)/T^2 is less than 2%, down to temperatures O(10) T_c. For SU(N), N>3, the ratios of interface tensions, (sigma_k/sigma_1)(T), agree with perturbation theory, which predicts tiny deviations from the ratio of Casimirs, down to nearly T_c. In contrast, individual tensions differ markedly from the perturbative expression. In all cases, the required precision Monte Carlo measurements are made possible by a simple but powerful modification of the 'snake' algorithm.

  16. Isocurvature perturbations in the Ekpyrotic Universe

    International Nuclear Information System (INIS)

    Notari, A.; Riotto, A.

    2002-01-01

    The Ekpyrotic scenario assumes that our visible Universe is a boundary brane in a five-dimensional bulk and that the hot Big Bang occurs when a nearly supersymmetric five-brane travelling along the fifth dimension collides with our visible brane. We show that the generation of isocurvature perturbations is a generic prediction of the Ekpyrotic Universe. This is due to the interactions in the kinetic terms between the brane modulus parameterizing the position of the five-brane in the bulk and the dilaton and volume moduli. We show how to separate explicitly the adiabatic and isocurvature modes by performing a rotation in field space. Our results indicate that adiabatic and isocurvature perturbations might be cross-correlated and that curvature perturbations might be entirely seeded by isocurvature perturbations

  17. Simple Perturbation Example for Quantum Chemistry.

    Science.gov (United States)

    Goodfriend, P. L.

    1985-01-01

    Presents a simple example that illustrates various aspects of the Rayleigh-Schrodinger perturbation theory. The example is a particularly good one because it is straightforward and can be compared with both the exact solution and with experimental data. (JN)

  18. SHARP ENTRYWISE PERTURBATION BOUNDS FOR MARKOV CHAINS.

    Science.gov (United States)

    Thiede, Erik; VAN Koten, Brian; Weare, Jonathan

    For many Markov chains of practical interest, the invariant distribution is extremely sensitive to perturbations of some entries of the transition matrix, but insensitive to others; we give an example of such a chain, motivated by a problem in computational statistical physics. We have derived perturbation bounds on the relative error of the invariant distribution that reveal these variations in sensitivity. Our bounds are sharp, we do not impose any structural assumptions on the transition matrix or on the perturbation, and computing the bounds has the same complexity as computing the invariant distribution or computing other bounds in the literature. Moreover, our bounds have a simple interpretation in terms of hitting times, which can be used to draw intuitive but rigorous conclusions about the sensitivity of a chain to various types of perturbations.

  19. Renormalization scheme-invariant perturbation theory

    International Nuclear Information System (INIS)

    Dhar, A.

    1983-01-01

    A complete solution to the problem of the renormalization scheme dependence of perturbative approximants to physical quantities is presented. An equation is derived which determines any physical quantity implicitly as a function of only scheme independent variables. (orig.)

  20. Cosmological perturbations in the new Higgs inflation

    Energy Technology Data Exchange (ETDEWEB)

    Germani, Cristiano [Arnold Sommerfeld Center, Ludwig-Maximilians-University, Theresienstr, 37 80333 Muenchen (Germany); Kehagias, Alex, E-mail: cristiano.germani@lmu.de, E-mail: kehagias@central.ntua.gr [Physics Division, National Technical University of Athens, 15780 Zografou Campus, Athens (Greece)

    2010-05-01

    We study the cosmological perturbations created during the New Higgs inflationary phase. In the New Higgs Inflation, the Higgs boson is kinetically coupled to the Einstein tensor and only three perturbative degrees of freedom, a scalar and two tensorial (gravitational waves), propagate during Inflation. Scalar perturbations are found to match the latest WMAP-7yrs data within Standard Model Higgs parameters. Primordial gravitational waves also, although propagating with superluminal speed, are consistent with present data. Finally, we estimate the values of the parameter of the New Higgs Inflation in relation to the Higgs mass, the spectral index and amplitude of the primordial scalar perturbations showing that the unitarity bound of the theory is not violated.

  1. Prospects of inflation with perturbed throat geometry

    International Nuclear Information System (INIS)

    Ali, Amna; Chingangbam, R.; Panda, Sudhakar; Sami, M.

    2009-01-01

    We study brane inflation in a warped deformed conifold background that includes general possible corrections to the throat geometry sourced by coupling to the bulk of a compact Calabi-Yau space. We focus specifically, on the perturbation by chiral operator of dimension 3/2 in the CFT. We find that the effective potential in this case can give rise to required number of e-foldings and the spectral index n S consistent with observation. The tensor to scalar ratio of perturbations is generally very low in this scenario. The COBE normalization, however, poses certain difficulties which can be circumvented provided model parameters are properly fine tuned. We find the numerical values of parameters which can give rise to enough inflation, observationally consistent values of density perturbations, scalar to tensor ratio of perturbations and the spectral index n S .

  2. A sensitive electrochemical aptasensor based on the co-catalysis of hemin/G-quadruplex, platinum nanoparticles and flower-like MnO2 nanosphere functionalized multi-walled carbon nanotubes.

    Science.gov (United States)

    Xu, Wenju; Xue, Shuyan; Yi, Huayu; Jing, Pei; Chai, Yaqin; Yuan, Ruo

    2015-01-28

    In this work, a sensitive electrochemical aptasensor for the detection of thrombin (TB) is developed and demonstrated based on the co-catalysis of hemin/G-quadruplex, platinum nanoparticles (PtNPs) and flower-like MnO2 nanosphere functionalized multi-walled carbon nanotubes (MWCNT-MnO2).

  3. The Effect of INA [(R)-1-O-(1-Pyrenylmethyl)Glycerol] Insertions on the Structure and Biological Activity of a G-Quadruplex from a Critical Kras G-Rich Sequence

    DEFF Research Database (Denmark)

    Cogoi, Susanna; Paramasivan, Manikandan; Xodo, Luigi E.

    2007-01-01

    Quadruplex-forming oligonucleotides containing INA [(R)-1-O-(1-pyrenylmethyl)glycerol] insertions have been designed and studied for their capacity to inhibit the expression of the KRAS oncogene in pancreatic adenocarcinoma cells. It is found that INA can influence the folding topology of the G-q...

  4. Discrete state perturbation theory via Green's functions

    International Nuclear Information System (INIS)

    Rubinson, W.

    1975-01-01

    The exposition of stationary-state perturbation theory via the Green's function method in Goldberger and Watson's Collision Theory is reworked in a way that makes explicit its mathematical basis. It is stressed that the theory consists of the construction of, and manipulations on, a mathematical identity. The perturbation series fall out of the identity almost immediately. The logical status of the method is commented on

  5. Algebraic renormalization. Perturbative renormalization, symmetries and anomalies

    International Nuclear Information System (INIS)

    Piguet, O.

    1995-01-01

    This book is an introduction to the algebraic method in the perturbative renormalization of relativistic quantum field theory. After a general introduction to renormalized perturbation theory the quantum action principle and Ward identities are described. Then Yang-Mills gauge theories are considered. Thereafter the BRS cohomology and descent equations are described. Then nonrenormalization theorems and topological field theories are considered. Finally an application to the bosonic string is described. (HSI)

  6. A new perturbative approach to QCD

    International Nuclear Information System (INIS)

    Pervushin, V.N.; Kallies, W.; Sarikov, N.A.

    1988-01-01

    For the description of bound states in QED and QCD the physical perturbation theory on the spatial components of the vector over the exact solution, defined by the time one, is proposed. It is shown this perturbation theory in QCD can be redefined so that it reproduces the main elements of hadron physics: confinement, spectroscopy of light and heavy quarkonia, dual-resonance amplitudes, chiral Lagrangians and the parton model

  7. Cylindrical dust acoustic waves with transverse perturbation

    International Nuclear Information System (INIS)

    Xue Jukui

    2003-01-01

    The nonlinear dust acoustic waves in dusty plasmas with the combined effects of bounded cylindrical geometry and the transverse perturbation are studied. Using the perturbation method, a cylindrical Kadomtsev-Petviashvili (CKP) equation that describes the dust acoustic waves is deduced for the first time. A particular solution of this CKP equation is also obtained. It is shown that the dust acoustic solitary waves can exist in the CKP equation

  8. The triangulation in a perturbed Friedmann universe

    International Nuclear Information System (INIS)

    Kasai, Masumi.

    1987-12-01

    A formula for the parallax distance in a general space-time is shown and it is applied to the linearly perturbed Friedmann universe. Its invariance under any coordinate-gauge transformations and any infinitesimal affine transformations is also shown. Then it is applied to the Einstein-de Sitter background model, and it is found that the perturbed space-time behaves as a Friedmann-like universe with the direction-dependent H 0 and q 0 . (author)

  9. Alternative perturbation approaches in classical mechanics

    International Nuclear Information System (INIS)

    Amore, Paolo; Raya, Alfredo; Fernandez, Francisco M

    2005-01-01

    We discuss two alternative methods, based on the Lindstedt-Poincare technique, for the removal of secular terms from the equations of perturbation theory. We calculate the period of an anharmonic oscillator by means of both approaches and show that one of them is more accurate for all values of the coupling constant. We believe that present discussion and comparison may be a suitable exercise for teaching perturbation theory in advanced undergraduate courses on classical mechanics

  10. Double soft theorem for perturbative gravity

    OpenAIRE

    Saha, Arnab

    2016-01-01

    Following up on the recent work of Cachazo, He and Yuan \\cite{arXiv:1503.04816 [hep-th]}, we derive the double soft graviton theorem in perturbative gravity. We show that the double soft theorem derived using CHY formula precisely matches with the perturbative computation involving Feynman diagrams. In particular, we find how certain delicate limits of Feynman diagrams play an important role in obtaining this equivalence.

  11. On perturbations of a quintom bounce

    International Nuclear Information System (INIS)

    Cai Yifu; Qiu Taotao; Zhang Xinmin; Brandenberger, Robert; Piao Yunsong

    2008-01-01

    A quintom universe with an equation of state crossing the cosmological constant boundary can provide a bouncing solution dubbed the quintom bounce and thus resolve the big bang singularity. In this paper, we investigate the cosmological perturbations of the quintom bounce both analytically and numerically. We find that the fluctuations in the dominant mode in the post-bounce expanding phase couple to the growing mode of the perturbations in the pre-bounce contracting phase

  12. Computer fan performance enhancement via acoustic perturbations

    Energy Technology Data Exchange (ETDEWEB)

    Greenblatt, David, E-mail: davidg@technion.ac.il [Faculty of Mechanical Engineering, Technion - Israel Institute of Technology, Haifa (Israel); Avraham, Tzahi; Golan, Maayan [Faculty of Mechanical Engineering, Technion - Israel Institute of Technology, Haifa (Israel)

    2012-04-15

    Highlights: Black-Right-Pointing-Pointer Computer fan effectiveness was increased by introducing acoustic perturbations. Black-Right-Pointing-Pointer Acoustic perturbations controlled blade boundary layer separation. Black-Right-Pointing-Pointer Optimum frequencies corresponded with airfoils studies. Black-Right-Pointing-Pointer Exploitation of flow instabilities was responsible for performance improvements. Black-Right-Pointing-Pointer Peak pressure and peak flowrate were increased by 40% and 15% respectively. - Abstract: A novel technique for increasing computer fan effectiveness, based on introducing acoustic perturbations onto the fan blades to control boundary layer separation, was assessed. Experiments were conducted in a specially designed facility that simultaneously allowed characterization of fan performance and introduction of the perturbations. A parametric study was conducted to determine the optimum control parameters, namely those that deliver the largest increase in fan pressure for a given flowrate. The optimum reduced frequencies corresponded with those identified on stationary airfoils and it was thus concluded that the exploitation of Kelvin-Helmholtz instabilities, commonly observed on airfoils, was responsible for the fan blade performance improvements. The optimum control inputs, such as acoustic frequency and sound pressure level, showed some variation with different fan flowrates. With the near-optimum control conditions identified, the full operational envelope of the fan, when subjected to acoustic perturbations, was assessed. The peak pressure and peak flowrate were increased by up to 40% and 15% respectively. The peak fan efficiency increased with acoustic perturbations but the overall system efficiency was reduced when the speaker input power was accounted for.

  13. Secondary isocurvature perturbations from acoustic reheating

    Science.gov (United States)

    Ota, Atsuhisa; Yamaguchi, Masahide

    2018-06-01

    The superhorizon (iso)curvature perturbations are conserved if the following conditions are satisfied: (i) (each) non adiabatic pressure perturbation is zero, (ii) the gradient terms are ignored, that is, at the leading order of the gradient expansion (iii) (each) total energy momentum tensor is conserved. We consider the case with the violation of the last two requirements and discuss the generation of secondary isocurvature perturbations during the late time universe. Second order gradient terms are not necessarily ignored even if we are interested in the long wavelength modes because of the convolutions which may pick products of short wavelength perturbations up. We then introduce second order conserved quantities on superhorizon scales under the conditions (i) and (iii) even in the presence of the gradient terms by employing the full second order cosmological perturbation theory. We also discuss the violation of the condition (iii), that is, the energy momentum tensor is conserved for the total system but not for each component fluid. As an example, we explicitly evaluate second order heat conduction between baryons and photons due to the weak Compton scattering, which dominates during the period just before recombination. We show that such secondary effects can be recast into the isocurvature perturbations on superhorizon scales if the local type primordial non Gaussianity exists a priori.

  14. Computer fan performance enhancement via acoustic perturbations

    International Nuclear Information System (INIS)

    Greenblatt, David; Avraham, Tzahi; Golan, Maayan

    2012-01-01

    Highlights: ► Computer fan effectiveness was increased by introducing acoustic perturbations. ► Acoustic perturbations controlled blade boundary layer separation. ► Optimum frequencies corresponded with airfoils studies. ► Exploitation of flow instabilities was responsible for performance improvements. ► Peak pressure and peak flowrate were increased by 40% and 15% respectively. - Abstract: A novel technique for increasing computer fan effectiveness, based on introducing acoustic perturbations onto the fan blades to control boundary layer separation, was assessed. Experiments were conducted in a specially designed facility that simultaneously allowed characterization of fan performance and introduction of the perturbations. A parametric study was conducted to determine the optimum control parameters, namely those that deliver the largest increase in fan pressure for a given flowrate. The optimum reduced frequencies corresponded with those identified on stationary airfoils and it was thus concluded that the exploitation of Kelvin–Helmholtz instabilities, commonly observed on airfoils, was responsible for the fan blade performance improvements. The optimum control inputs, such as acoustic frequency and sound pressure level, showed some variation with different fan flowrates. With the near-optimum control conditions identified, the full operational envelope of the fan, when subjected to acoustic perturbations, was assessed. The peak pressure and peak flowrate were increased by up to 40% and 15% respectively. The peak fan efficiency increased with acoustic perturbations but the overall system efficiency was reduced when the speaker input power was accounted for.

  15. Human telomeric G-quadruplex formation and highly selective fluorescence detection of toxic strontium ions.

    Science.gov (United States)

    Qu, Konggang; Zhao, Chuanqi; Ren, Jinsong; Qu, Xiaogang

    2012-03-01

    Strontium ions play important roles in biological systems. The inhalation of strontium can cause severe respiratory difficulties, anaphylactic reaction and extreme tachycardia. Strontium can replace calcium in organisms, inhibit normal calcium absorption and induce strontium "rickets" in childhood. Thus, the development of sensitive and selective methods for the determination of trace amounts of Sr(2+) in aqueous media is of considerable importance for environmental and human health protection. A number of methodologies, such as X-ray energy dispersive spectrometry, inductively coupled argon plasma atomic emission spectroscopy (ICP-AES), atomic absorption spectrometry (AAS) and instrumental thermal neutron activation analysis, have been reported. However, these methods are somewhat complex, costly, time consuming and, especially, need special instruments. Thus, the design of convenient and inexpensive approaches for the sensitive and selective detection of Sr(2+) with rapid, easy manipulation is in ever-increasing demand. To the best of our knowledge, using DNA conformational change to detect Sr(2+) has not yet been reported. Herein we utilized thiazole orange (TO) as a signal reporter to devise a simple Sr(2+) detection assay based on Sr(2+) induced human telomeric DNA conformational change in the presence of SWNTs. The limit of detection is 10 nM Sr(2+) (0.87 μg L(-1)), far below 4 mg L(-1), the U.S. Federal threshold in drinking water defined by the U.S. EPA.

  16. MTBP, the partner of Treslin, contains a novel DNA-binding domain that is essential for proper initiation of DNA replication.

    Science.gov (United States)

    Kumagai, Akiko; Dunphy, William G

    2017-11-01

    Treslin, which is essential for incorporation of Cdc45 into the replicative helicase, possesses a partner called MTBP (Mdm2-binding protein). We have analyzed Xenopus and human MTBP to assess its role in DNA replication. Depletion of MTBP from Xenopus egg extracts, which also removes Treslin, abolishes DNA replication. These extracts be can rescued with recombinant Treslin-MTBP but not Treslin or MTBP alone. Thus, Treslin-MTBP is collectively necessary for replication. We have identified a C-terminal region of MTBP (the CTM domain) that binds efficiently to both double-stranded DNA and G-quadruplex (G4) DNA. This domain also exhibits homology with budding yeast Sld7. Mutants of MTBP without a functional CTM domain are defective for DNA replication in Xenopus egg extracts. These mutants display an impaired localization to chromatin and the inability to support loading of Cdc45. Human cells harboring such a mutant also display severe S-phase defects. Thus, the CTM domain of MTBP plays a critical role in localizing Treslin-MTBP to the replication apparatus for initiation. © 2017 Kumagai and Dunphy. This article is distributed by The American Society for Cell Biology under license from the author(s). Two months after publication it is available to the public under an Attribution–Noncommercial–Share Alike 3.0 Unported Creative Commons License (http://creativecommons.org/licenses/by-nc-sa/3.0).

  17. Fluorescence enhancement upon G-quadruplex folding: synthesis, structure, and biophysical characterization of a dansyl/cyclodextrin-tagged thrombin binding aptamer.

    Science.gov (United States)

    De Tito, Stefano; Morvan, François; Meyer, Albert; Vasseur, Jean-Jacques; Cummaro, Annunziata; Petraccone, Luigi; Pagano, Bruno; Novellino, Ettore; Randazzo, Antonio; Giancola, Concetta; Montesarchio, Daniela

    2013-11-20

    A novel fluorescent thrombin binding aptamer (TBA), conjugated with the environmentally sensitive dansyl probe at the 3'-end and a β-cyclodextrin residue at the 5'-end, has been efficiently synthesized exploiting Cu(I)-catalyzed azide-alkyne cycloaddition procedures. Its conformation and stability in solution have been studied by an integrated approach, combining in-depth NMR, CD, fluorescence, and DSC studies. ITC measurements have allowed us to analyze in detail its interaction with human thrombin. All the collected data show that this bis-conjugated aptamer fully retains its G-quadruplex formation ability and thrombin recognition properties, with the terminal appendages only marginally interfering with the conformational behavior of TBA. Folding of this modified aptamer into the chairlike, antiparallel G-quadruplex structure, promoted by K(+) and/or thrombin binding, typical of TBA, is associated with a net fluorescence enhancement, due to encapsulation of dansyl, attached at the 3'-end, into the apolar cavity of the β-cyclodextrin at the 5'-end. Overall, the structural characterization of this novel, bis-conjugated TBA fully demonstrates its potential as a diagnostic tool for thrombin recognition, also providing a useful basis for the design of suitable aptamer-based devices for theranostic applications, allowing simultaneously both detection and inhibition or modulation of the thrombin activity.

  18. Modeling DNA

    Science.gov (United States)

    Robertson, Carol

    2016-01-01

    Deoxyribonucleic acid (DNA) is life's most amazing molecule. It carries the genetic instructions that almost every organism needs to develop and reproduce. In the human genome alone, there are some three billion DNA base pairs. The most difficult part of teaching DNA structure, however, may be getting students to visualize something as small as a…

  19. PerturbationAnalyzer: a tool for investigating the effects of concentration perturbation on protein interaction networks.

    Science.gov (United States)

    Li, Fei; Li, Peng; Xu, Wenjian; Peng, Yuxing; Bo, Xiaochen; Wang, Shengqi

    2010-01-15

    The propagation of perturbations in protein concentration through a protein interaction network (PIN) can shed light on network dynamics and function. In order to facilitate this type of study, PerturbationAnalyzer, which is an open source plugin for Cytoscape, has been developed. PerturbationAnalyzer can be used in manual mode for simulating user-defined perturbations, as well as in batch mode for evaluating network robustness and identifying significant proteins that cause large propagation effects in the PINs when their concentrations are perturbed. Results from PerturbationAnalyzer can be represented in an intuitive and customizable way and can also be exported for further exploration. PerturbationAnalyzer has great potential in mining the design principles of protein networks, and may be a useful tool for identifying drug targets. PerturbationAnalyzer can be accessed from the Cytoscape web site http://www.cytoscape.org/plugins/index.php or http://biotech.bmi.ac.cn/PerturbationAnalyzer. Supplementary data are available at Bioinformatics online.

  20. Probing of miniPEGγ-PNA-DNA Hybrid Duplex Stability with AFM Force Spectroscopy.

    Science.gov (United States)

    Dutta, Samrat; Armitage, Bruce A; Lyubchenko, Yuri L

    2016-03-15

    Peptide nucleic acids (PNA) are synthetic polymers, the neutral peptide backbone of which provides elevated stability to PNA-PNA and PNA-DNA hybrid duplexes. It was demonstrated that incorporation of diethylene glycol (miniPEG) at the γ position of the peptide backbone increased the thermal stability of the hybrid duplexes (Sahu, B. et al. J. Org. Chem. 2011, 76, 5614-5627). Here, we applied atomic force microscopy (AFM) based single molecule force spectroscopy and dynamic force spectroscopy (DFS) to test the strength and stability of the hybrid 10 bp duplex. This hybrid duplex consisted of miniPEGγ-PNA and DNA of the same length (γ(MP)PNA-DNA), which we compared to a DNA duplex with a homologous sequence. AFM force spectroscopy data obtained at the same conditions showed that the γ(MP)PNA-DNA hybrid is more stable than the DNA counterpart, 65 ± 15 pN vs 47 ± 15 pN, respectively. The DFS measurements performed in a range of pulling speeds analyzed in the framework of the Bell-Evans approach yielded a dissociation constant, koff ≈ 0.030 ± 0.01 s⁻¹ for γ(MP)PNA-DNA hybrid duplex vs 0.375 ± 0.18 s⁻¹ for the DNA-DNA duplex suggesting that the hybrid duplex is much more stable. Correlating the high affinity of γ(MP)PNA-DNA to slow dissociation kinetics is consistent with prior bulk characterization by surface plasmon resonance. Given the growing interest in γ(MP)PNA as well as other synthetic DNA analogues, the use of single molecule experiments along with computational analysis of force spectroscopy data will provide direct characterization of various modifications as well as higher order structures such as triplexes and quadruplexes.

  1. Disintegration of cruciform and G-quadruplex structures during the course of helicase-dependent amplification (HDA).

    Science.gov (United States)

    Li, Dawei; Lv, Bei; Zhang, Hao; Lee, Jasmine Yiqin; Li, Tianhu

    2015-04-15

    Unlike chemical damages on DNA, physical alterations of B-form of DNA occur commonly in organisms that serve as signals for specified cellular events. Although the modes of action for repairing of chemically damaged DNA have been well studied nowadays, the repairing mechanisms for physically altered DNA structures have not yet been understood. Our current in vitro studies show that both breakdown of stable non-B DNA structures and resumption of canonical B-conformation of DNA can take place during the courses of isothermal helicase-dependent amplification (HDA). The pathway that makes the non-B DNA structures repairable is presumably the relieving of the accumulated torsional stress that was caused by the positive supercoiling. Our new findings suggest that living organisms might have evolved this distinct and economical pathway for repairing their physically altered DNA structures. Copyright © 2015 Elsevier Ltd. All rights reserved.

  2. Stepping stability: effects of sensory perturbation

    Directory of Open Access Journals (Sweden)

    Krebs David E

    2005-05-01

    Full Text Available Abstract Background Few tools exist for quantifying locomotor stability in balance impaired populations. The objective of this study was to develop and evaluate a technique for quantifying stability of stepping in healthy people and people with peripheral (vestibular hypofunction, VH and central (cerebellar pathology, CB balance dysfunction by means a sensory (auditory perturbation test. Methods Balance impaired and healthy subjects performed a repeated bench stepping task. The perturbation was applied by suddenly changing the cadence of the metronome (100 beat/min to 80 beat/min at a predetermined time (but unpredictable by the subject during the trial. Perturbation response was quantified by computing the Euclidian distance, expressed as a fractional error, between the anterior-posterior center of gravity attractor trajectory before and after the perturbation was applied. The error immediately after the perturbation (Emax, error after recovery (Emin and the recovery response (Edif were documented for each participant, and groups were compared with ANOVA. Results Both balance impaired groups exhibited significantly higher Emax (p = .019 and Emin (p = .028 fractional errors compared to the healthy (HE subjects, but there were no significant differences between CB and VH groups. Although response recovery was slower for CB and VH groups compared to the HE group, the difference was not significant (p = .051. Conclusion The findings suggest that individuals with balance impairment have reduced ability to stabilize locomotor patterns following perturbation, revealing the fragility of their impairment adaptations and compensations. These data suggest that auditory perturbations applied during a challenging stepping task may be useful for measuring rehabilitation outcomes.

  3. Perturbations of ultralight vector field dark matter

    Energy Technology Data Exchange (ETDEWEB)

    Cembranos, J.A.R.; Maroto, A.L.; Jareño, S.J. Núñez [Departamento de Física Teórica I, Universidad Complutense de Madrid, E-28040 Madrid (Spain)

    2017-02-13

    We study the dynamics of cosmological perturbations in models of dark matter based on ultralight coherent vector fields. Very much as for scalar field dark matter, we find two different regimes in the evolution: for modes with k{sup 2}≪Hma, we have a particle-like behaviour indistinguishable from cold dark matter, whereas for modes with k{sup 2}≫Hma, we get a wave-like behaviour in which the sound speed is non-vanishing and of order c{sub s}{sup 2}≃k{sup 2}/m{sup 2}a{sup 2}. This implies that, also in these models, structure formation could be suppressed on small scales. However, unlike the scalar case, the fact that the background evolution contains a non-vanishing homogeneous vector field implies that, in general, the evolution of the three kinds of perturbations (scalar, vector and tensor) can no longer be decoupled at the linear level. More specifically, in the particle regime, the three types of perturbations are actually decoupled, whereas in the wave regime, the three vector field perturbations generate one scalar-tensor and two vector-tensor perturbations in the metric. Also in the wave regime, we find that a non-vanishing anisotropic stress is present in the perturbed energy-momentum tensor giving rise to a gravitational slip of order (Φ−Ψ)/Φ∼c{sub s}{sup 2}. Moreover in this regime the amplitude of the tensor to scalar ratio of the scalar-tensor modes is also h/Φ∼c{sub s}{sup 2}. This implies that small-scale density perturbations are necessarily associated to the presence of gravity waves in this model. We compare their spectrum with the sensitivity of present and future gravity waves detectors.

  4. Acoustic anisotropic wavefields through perturbation theory

    KAUST Repository

    Alkhalifah, Tariq Ali

    2013-09-01

    Solving the anisotropic acoustic wave equation numerically using finite-difference methods introduces many problems and media restriction requirements, and it rarely contributes to the ability to resolve the anisotropy parameters. Among these restrictions are the inability to handle media with η<0 and the presence of shear-wave artifacts in the solution. Both limitations do not exist in the solution of the elliptical anisotropic acoustic wave equation. Using perturbation theory in developing the solution of the anisotropic acoustic wave equation allows direct access to the desired limitation-free solutions, that is, solutions perturbed from the elliptical anisotropic background medium. It also provides a platform for parameter estimation because of the ability to isolate the wavefield dependency on the perturbed anisotropy parameters. As a result, I derive partial differential equations that relate changes in the wavefield to perturbations in the anisotropy parameters. The solutions of the perturbation equations represented the coefficients of a Taylor-series-type expansion of the wavefield as a function of the perturbed parameter, which is in this case η or the tilt of the symmetry axis. The expansion with respect to the symmetry axis allows use of an acoustic transversely isotropic media with a vertical symmetry axis (VTI) kernel to estimate the background wavefield and the corresponding perturbation coefficients. The VTI extrapolation kernel is about one-fourth the cost of the transversely isotropic model with a tilt in the symmetry axis kernel. Thus, for a small symmetry axis tilt, the cost of migration using a first-order expansion can be reduced. The effectiveness of the approach was demonstrated on the Marmousi model.

  5. Application of linear and higher perturbation theory in reactor physics

    International Nuclear Information System (INIS)

    Woerner, D.

    1978-01-01

    For small perturbations in the material composition of a reactor according to the first approximation of perturbation theory the eigenvalue perturbation is proportional to the perturbation of the system. This assumption is true for the neutron flux not influenced by the perturbance. The two-dimensional code LINESTO developed for such problems in this paper on the basis of diffusion theory determines the relative change of the multiplication constant. For perturbations varying the neutron flux in the space of energy and position the eigenvalue perturbation is also influenced by this changed neutron flux. In such cases linear perturbation theory yields larger errors. Starting from the methods of calculus of variations there is additionally developed in this paper a perturbation method of calculation permitting in a quick and simple manner to assess the influence of flux perturbation on the eigenvalue perturbation. While the source of perturbations is evaluated in isotropic approximation of diffusion theory the associated inhomogeneous equation may be used to determine the flux perturbation by means of diffusion or transport theory. Possibilities of application and limitations of this method are studied in further systematic investigations on local perturbations. It is shown that with the integrated code system developed in this paper a number of local perturbations may be checked requiring little computing time. With it flux perturbations in first approximation and perturbations of the multiplication constant in second approximation can be evaluated. (orig./RW) [de

  6. Local perturbations perturb—exponentially–locally

    International Nuclear Information System (INIS)

    De Roeck, W.; Schütz, M.

    2015-01-01

    We elaborate on the principle that for gapped quantum spin systems with local interaction, “local perturbations [in the Hamiltonian] perturb locally [the groundstate].” This principle was established by Bachmann et al. [Commun. Math. Phys. 309, 835–871 (2012)], relying on the “spectral flow technique” or “quasi-adiabatic continuation” [M. B. Hastings, Phys. Rev. B 69, 104431 (2004)] to obtain locality estimates with sub-exponential decay in the distance to the spatial support of the perturbation. We use ideas of Hamza et al. [J. Math. Phys. 50, 095213 (2009)] to obtain similarly a transformation between gapped eigenvectors and their perturbations that is local with exponential decay. This allows to improve locality bounds on the effect of perturbations on the low lying states in certain gapped models with a unique “bulk ground state” or “topological quantum order.” We also give some estimate on the exponential decay of correlations in models with impurities where some relevant correlations decay faster than one would naively infer from the global gap of the system, as one also expects in disordered systems with a localized groundstate

  7. Mode coupling of Schwarzschild perturbations: Ringdown frequencies

    International Nuclear Information System (INIS)

    Pazos, Enrique; Brizuela, David; Martin-Garcia, Jose M.; Tiglio, Manuel

    2010-01-01

    Within linearized perturbation theory, black holes decay to their final stationary state through the well-known spectrum of quasinormal modes. Here we numerically study whether nonlinearities change this picture. For that purpose we study the ringdown frequencies of gauge-invariant second-order gravitational perturbations induced by self-coupling of linearized perturbations of Schwarzschild black holes. We do so through high-accuracy simulations in the time domain of first and second-order Regge-Wheeler-Zerilli type equations, for a variety of initial data sets. We consider first-order even-parity (l=2, m=±2) perturbations and odd-parity (l=2, m=0) ones, and all the multipoles that they generate through self-coupling. For all of them and all the initial data sets considered we find that--in contrast to previous predictions in the literature--the numerical decay frequencies of second-order perturbations are the same ones of linearized theory, and we explain the observed behavior. This would indicate, in particular, that when modeling or searching for ringdown gravitational waves, appropriately including the standard quasinormal modes already takes into account nonlinear effects.

  8. Supersymmetry restoration in superstring perturbation theory

    International Nuclear Information System (INIS)

    Sen, Ashoke

    2015-01-01

    Superstring perturbation theory based on the 1PI effective theory approach has been useful for addressing the problem of mass renormalization and vacuum shift. We derive Ward identities associated with space-time supersymmetry transformation in this approach. This leads to a proof of the equality of renormalized masses of bosons and fermions and identities relating fermionic amplitudes to bosonic amplitudes after taking into account the effect of mass renormalization. This also relates unbroken supersymmetry to a given order in perturbation theory to absence of tadpoles of massless scalars to higher order. The results are valid at the perturbative vacuum as well as in the shifted vacuum when the latter describes the correct ground state of the theory. We apply this to SO(32) heterotic string theory on Calabi-Yau 3-folds where a one loop Fayet-Iliopoulos term apparently breaks supersymmetry at one loop, but analysis of the low energy effective field theory indicates that there is a nearby vacuum where supersymmetry is restored. We explicitly prove that the perturbative amplitudes of this theory around the shifted vacuum indeed satisfy the Ward identities associated with unbroken supersymmetry. We also test the general arguments by explicitly verifying the equality of bosonic and fermionic masses at one loop order in the shifted vacuum, and the appearance of two loop dilaton tadpole in the perturbative vacuum where supersymmetry is expected to be broken.

  9. Supersymmetry restoration in superstring perturbation theory

    Energy Technology Data Exchange (ETDEWEB)

    Sen, Ashoke [Harish-Chandra Research Institute,Chhatnag Road, Jhusi, Allahabad 211019 (India)

    2015-12-14

    Superstring perturbation theory based on the 1PI effective theory approach has been useful for addressing the problem of mass renormalization and vacuum shift. We derive Ward identities associated with space-time supersymmetry transformation in this approach. This leads to a proof of the equality of renormalized masses of bosons and fermions and identities relating fermionic amplitudes to bosonic amplitudes after taking into account the effect of mass renormalization. This also relates unbroken supersymmetry to a given order in perturbation theory to absence of tadpoles of massless scalars to higher order. The results are valid at the perturbative vacuum as well as in the shifted vacuum when the latter describes the correct ground state of the theory. We apply this to SO(32) heterotic string theory on Calabi-Yau 3-folds where a one loop Fayet-Iliopoulos term apparently breaks supersymmetry at one loop, but analysis of the low energy effective field theory indicates that there is a nearby vacuum where supersymmetry is restored. We explicitly prove that the perturbative amplitudes of this theory around the shifted vacuum indeed satisfy the Ward identities associated with unbroken supersymmetry. We also test the general arguments by explicitly verifying the equality of bosonic and fermionic masses at one loop order in the shifted vacuum, and the appearance of two loop dilaton tadpole in the perturbative vacuum where supersymmetry is expected to be broken.

  10. DNA breaks and repair in interstitial telomere sequences: Influence of chromatin structure

    International Nuclear Information System (INIS)

    Revaud, D.

    2009-06-01

    Interstitial Telomeric Sequences (ITS) are over-involved in spontaneous and radiationinduced chromosome aberrations in chinese hamster cells. We have performed a study to investigate the origin of their instability, spontaneously or after low doses irradiation. Our results demonstrate that ITS have a particular chromatin structure: short nucleotide repeat length, less compaction of the 30 nm chromatin fiber, presence of G-quadruplex structures. These features would modulate breaks production and would favour the recruitment of alternative DNA repair mechanisms, which are prone to produce chromosome aberrations. These pathways could be at the origin of chromosome aberrations in ITS whereas NHEJ and HR Double Strand Break repair pathways are rather required for a correct repair in these regions. (author)

  11. Optimal random perturbations for stochastic approximation using a simultaneous perturbation gradient approximation

    DEFF Research Database (Denmark)

    Sadegh, Payman; Spall, J. C.

    1998-01-01

    simultaneous perturbation approximation to the gradient based on loss function measurements. SPSA is based on picking a simultaneous perturbation (random) vector in a Monte Carlo fashion as part of generating the approximation to the gradient. This paper derives the optimal distribution for the Monte Carlo...

  12. Tension perturbations of black brane spacetimes

    International Nuclear Information System (INIS)

    Traschen, Jennie; Fox, Daniel

    2004-01-01

    We consider black brane spacetimes that have at least one spatial translation Killing field that is tangent to the brane. A new parameter, the tension of a spacetime, is defined. The tension parameter is associated with spatial translations in much the same way that the ADM mass is associated with the time translation Killing field. In this work, we explore the implications of the spatial translation symmetry for small perturbations around a background black brane. For static-charged black branes we derive a law which relates the tension perturbation to the surface gravity times the change in the horizon area, plus terms that involve variations in the charges and currents. We find that as a black brane evaporates the tension decreases. We also give a simple derivation of a first law for black brane spacetimes. These constructions hold when the background stress-energy is governed by a Hamiltonian, and the results include arbitrary perturbative stress-energy sources

  13. Perturbation measurement of waveguides for acoustic thermometry

    Science.gov (United States)

    Lin, H.; Feng, X. J.; Zhang, J. T.

    2013-09-01

    Acoustic thermometers normally embed small acoustic transducers in the wall bounding a gas-filled cavity resonator. At high temperature, insulators of transducers loss electrical insulation and degrade the signal-to-noise ratio. One essential solution to this technical trouble is to couple sound by acoustic waveguides between resonator and transducers. But waveguide will break the ideal acoustic surface and bring perturbations(Δf+ig) to the ideal resonance frequency. The perturbation model for waveguides was developed based on the first-order acoustic theory in this paper. The frequency shift Δf and half-width change g caused by the position, length and radius of waveguides were analyzed using this model. Six different length of waveguides (52˜1763 mm) were settled on the cylinder resonator and the perturbation (Δf+ig) were measured at T=332 K and p=250˜500 kPa. The experiment results agreed with the theoretical prediction very well.

  14. Microfluidic mixing through oscillatory transverse perturbations

    Science.gov (United States)

    Wu, J. W.; Xia, H. M.; Zhang, Y. Y.; Zhu, P.

    2018-05-01

    Fluid mixing in miniaturized fluidic devices is a challenging task. In this work, the mixing enhancement through oscillatory transverse perturbations coupling with divergent circular chambers is studied. To simplify the design, an autonomous microfluidic oscillator is used to produce the oscillatory flow. It is then applied to four side-channels that intersect with a central channel of constant flow. The mixing performance is tested at high fluid viscosities of up to 16 cP. Results show that the oscillatory flow can cause strong transverse perturbations which effectively enhance the mixing. The influence of a fluidic capacitor in the central channel is also examined, which at low viscosities can intensify the perturbations and further improve the mixing.

  15. One dimensional systems with singular perturbations

    International Nuclear Information System (INIS)

    Alvarez, J J; Gadella, M; Nieto, L M; Glasser, L M; Lara, L P

    2011-01-01

    This paper discusses some one dimensional quantum models with singular perturbations. Eventually, a mass discontinuity is added at the points that support the singular perturbations. The simplest model includes an attractive singular potential with a mass jump both located at the origin. We study the form of the only bound state. Another model exhibits a hard core at the origin plus one or more repulsive deltas with mass jumps at the points supporting these deltas. We study the location and the multiplicity of these resonances for the case of one or two deltas and settle the basis for a generalization. Finally, we consider the harmonic oscillator and the infinite square well plus a singular potential at the origin. We see how the energy of bound states is affected by the singular perturbation.

  16. Perturbations of higher-dimensional spacetimes

    Energy Technology Data Exchange (ETDEWEB)

    Durkee, Mark; Reall, Harvey S, E-mail: M.N.Durkee@damtp.cam.ac.uk, E-mail: H.S.Reall@damtp.cam.ac.uk [DAMTP, Centre for Mathematical Sciences, University of Cambridge, Wilberforce Road, Cambridge, CB3 0WA (United Kingdom)

    2011-02-07

    We discuss linearized gravitational perturbations of higher-dimensional spacetimes. For algebraically special spacetimes (e.g. Myers-Perry black holes), we show that there exist local gauge invariant quantities linear in the metric perturbation. These are the higher-dimensional generalizations of the 4D Newman-Penrose scalars that (in an algebraically special vacuum spacetime) satisfy decoupled equations of motion. We show that decoupling occurs in more than four dimensions if, and only if, the spacetime admits a null geodesic congruence with vanishing expansion, rotation and shear. Decoupling of electromagnetic perturbations occurs under the same conditions. Although these conditions are not satisfied in black hole spacetimes, they are satisfied in the near-horizon geometry of an extreme black hole.

  17. On the domain of string perturbation theory

    International Nuclear Information System (INIS)

    Davis, S.

    1989-06-01

    For a large class of effectively closed surfaces, it is shown that the only divergences in string scattering amplitudes at each order in perturbation theory are those associated with the coincidence of vertex operators and the boundary of moduli space. This class includes all closed surfaces of finite genus, and infinite-genus surfaces which can be uniformized by a group of Schottky type. While the computation is done explicitly for bosonic strings in their ground states, it can also be extended to excited states and to superstrings. The properties of these amplitudes lead to a definition of the domain of perturbation theory as the set of effectively closed surfaces. The implications of the restriction to effectively closed surfaces on the behavior of the perturbation series are discussed. (author). 20 refs, 6 figs

  18. Perturbation theory for continuous stochastic equations

    International Nuclear Information System (INIS)

    Chechetkin, V.R.; Lutovinov, V.S.

    1987-01-01

    The various general perturbational schemes for continuous stochastic equations are considered. These schemes have many analogous features with the iterational solution of Schwinger equation for S-matrix. The following problems are discussed: continuous stochastic evolution equations for probability distribution functionals, evolution equations for equal time correlators, perturbation theory for Gaussian and Poissonian additive noise, perturbation theory for birth and death processes, stochastic properties of systems with multiplicative noise. The general results are illustrated by diffusion-controlled reactions, fluctuations in closed systems with chemical processes, propagation of waves in random media in parabolic equation approximation, and non-equilibrium phase transitions in systems with Poissonian breeding centers. The rate of irreversible reaction X + X → A (Smoluchowski process) is calculated with the use of general theory based on continuous stochastic equations for birth and death processes. The threshold criterion and range of fluctuational region for synergetic phase transition in system with Poissonian breeding centers are also considered. (author)

  19. MCNP perturbation technique for criticality analysis

    International Nuclear Information System (INIS)

    McKinney, G.W.; Iverson, J.L.

    1995-01-01

    The differential operator perturbation technique has been incorporated into the Monte Carlo N-Particle transport code MCNP and will become a standard feature of future releases. This feature includes first and/or second order terms of the Taylor Series expansion for response perturbations related to cross-section data (i.e., density, composition, etc.). Criticality analyses can benefit from this technique in that predicted changes in the track-length tally estimator of K eff may be obtained for multiple perturbations in a single run. A key advantage of this method is that a precise estimate of a small change in response (i.e., < 1%) is easily obtained. This technique can also offer acceptable accuracy, to within a few percent, for up to 20-30% changes in a response

  20. Gravitational perturbation theory and synchrotron radiation

    Energy Technology Data Exchange (ETDEWEB)

    Breuer, R A [Max-Planck-Institut fuer Physik und Astrophysik, Muenchen (F.R. Germany). Inst. fuer Astrophysik

    1975-01-01

    This article presents methods and results for a gravitational perturbation theory which treats massless fields as linearized perturbations of an arbitrary gravitational vacuum background spacetime. The formalism is outlined for perturbations of type (22) spacetimes. As an application, high-frequency radiation emitted by particles moving approximately on relativistic circular geodesic orbits is computed. More precisely, the test particle assumption is made; throughout it is therefore assumed that the reaction of the radiation on the particle motion is negligible. In particular, these orbits are studied in the gravitational field of a spherically symmetric (Schwarzschild-) black hole as well as of a rotating (Kerr-) black hole. In this model, the outgoing radiation is highly focussed and of much higher fequency than the orbital frequency, i.e. one is dealing with 'gravitational synchrotron radiation'.

  1. Gribov ambiguity, perturbation theory, and confinement

    International Nuclear Information System (INIS)

    Greensite, J.P.

    1978-01-01

    The generating functional proposed for gauge theories by Bender, Eguchi, and Pagels (BEP) is shown to be equivalent to a truncated form of the functional integral, in which only one field configuration from each gauge-equivalent Gribov set contributes to the functional integration. The standard perturbation technique provides a method of realizing this truncation condition. It is shown that any gauge-covariant quantity (such as the quark N-point functions), evaluated by perturbating around a field configuration gauge-equivalent to A = 0, is related by a gauge transformation to the same quantity evaluated perturbatively around the trivial vacuum. It follows that, contrary to the conclusion of BEP, the existence of degeneracies in the Coulomb gauge-fixing condition (the Gribov ambiguity) is not directly related to the physics of confinement

  2. Non-Perturbative Quantum Geometry III

    CERN Document Server

    Krefl, Daniel

    2016-08-02

    The Nekrasov-Shatashvili limit of the refined topological string on toric Calabi-Yau manifolds and the resulting quantum geometry is studied from a non-perturbative perspective. The quantum differential and thus the quantum periods exhibit Stockes phenomena over the combined string coupling and quantized Kaehler moduli space. We outline that the underlying formalism of exact quantization is generally applicable to points in moduli space featuring massless hypermultiplets, leading to non-perturbative band splitting. Our prime example is local P1xP1 near a conifold point in moduli space. In particular, we will present numerical evidence that in a Stockes chamber of interest the string based quantum geometry reproduces the non-perturbative corrections for the Nekrasov-Shatashvili limit of 4d supersymmetric SU(2) gauge theory at strong coupling found in the previous part of this series. A preliminary discussion of local P2 near the conifold point in moduli space is also provided.

  3. Redshift-space distortions from vector perturbations

    Science.gov (United States)

    Bonvin, Camille; Durrer, Ruth; Khosravi, Nima; Kunz, Martin; Sawicki, Ignacy

    2018-02-01

    We compute a general expression for the contribution of vector perturbations to the redshift space distortion of galaxy surveys. We show that they contribute to the same multipoles of the correlation function as scalar perturbations and should thus in principle be taken into account in data analysis. We derive constraints for next-generation surveys on the amplitude of two sources of vector perturbations, namely non-linear clustering and topological defects. While topological defects leave a very small imprint on redshift space distortions, we show that the multipoles of the correlation function are sensitive to vorticity induced by non-linear clustering. Therefore future redshift surveys such as DESI or the SKA should be capable of measuring such vector modes, especially with the hexadecapole which appears to be the most sensitive to the presence of vorticity.

  4. Quadruplex MAPH: improvement of throughput in high-resolution copy number screening.

    Science.gov (United States)

    Tyson, Jess; Majerus, Tamsin Mo; Walker, Susan; Armour, John Al

    2009-09-28

    Copy number variation (CNV) in the human genome is recognised as a widespread and important source of human genetic variation. Now the challenge is to screen for these CNVs at high resolution in a reliable, accurate and cost-effective way. Multiplex Amplifiable Probe Hybridisation (MAPH) is a sensitive, high-resolution technology appropriate for screening for CNVs in a defined region, for a targeted population. We have developed MAPH to a highly multiplexed format ("QuadMAPH") that allows the user a four-fold increase in the number of loci tested simultaneously. We have used this method to analyse a genomic region of 210 kb, including the MSH2 gene and 120 kb of flanking DNA. We show that the QuadMAPH probes report copy number with equivalent accuracy to simplex MAPH, reliably demonstrating diploid copy number in control samples and accurately detecting deletions in Hereditary Non-Polyposis Colorectal Cancer (HNPCC) samples. QuadMAPH is an accurate, high-resolution method that allows targeted screening of large numbers of subjects without the expense of genome-wide approaches. Whilst we have applied this technique to a region of the human genome, it is equally applicable to the genomes of other organisms.

  5. Quadruplex MAPH: improvement of throughput in high-resolution copy number screening

    Directory of Open Access Journals (Sweden)

    Walker Susan

    2009-09-01

    Full Text Available Abstract Background Copy number variation (CNV in the human genome is recognised as a widespread and important source of human genetic variation. Now the challenge is to screen for these CNVs at high resolution in a reliable, accurate and cost-effective way. Results Multiplex Amplifiable Probe Hybridisation (MAPH is a sensitive, high-resolution technology appropriate for screening for CNVs in a defined region, for a targeted population. We have developed MAPH to a highly multiplexed format ("QuadMAPH" that allows the user a four-fold increase in the number of loci tested simultaneously. We have used this method to analyse a genomic region of 210 kb, including the MSH2 gene and 120 kb of flanking DNA. We show that the QuadMAPH probes report copy number with equivalent accuracy to simplex MAPH, reliably demonstrating diploid copy number in control samples and accurately detecting deletions in Hereditary Non-Polyposis Colorectal Cancer (HNPCC samples. Conclusion QuadMAPH is an accurate, high-resolution method that allows targeted screening of large numbers of subjects without the expense of genome-wide approaches. Whilst we have applied this technique to a region of the human genome, it is equally applicable to the genomes of other organisms.

  6. Operator Decomposition Framework for Perturbation Theory

    Energy Technology Data Exchange (ETDEWEB)

    Abdel-Khalik, Hany S.; Wang, Congjian; Bang, Young Suk [North Carolina State University, Raleigh (United States)

    2012-05-15

    This summary describes a new framework for perturbation theory intended to improve its performance, in terms of the associated computational cost and the complexity of implementation, for routine reactor calculations in support of design, analysis, and regulation. Since its first introduction in reactor analysis by Winger, perturbation theory has assumed an aura of sophistication with regard to its implementation and its capabilities. Only few reactor physicists, typically mathematically proficient, have contributed to its development, with the general body of the nuclear engineering community remaining unaware of its current status, capabilities, and challenges. Given its perceived sophistication and the small body of community users, the application of perturbation theory has been limited to investigatory analyses only. It is safe to say that the nuclear community is split into two groups, a small one which understands the theory and, and a much bigger group with the perceived notion that perturbation theory is nothing but a fancy mathematical approach that has very little use in practice. Over the past three years, research has demonstrated two goals. First, reduce the computational cost of perturbation theory in order to enable its use for routine reactor calculations. Second, expose some of the myth about perturbation theory and present it in a form that is simple and relatable in order to stimulate the interest of nuclear practitioners, especially those who are currently working on the development of next generation reactor design and analysis tools. The operator decomposition approach has its roots in linear algebra and can be easily understood by code developers, especially those involved in the design of iterative numerical solution strategies

  7. Schroedinger operators with singular perturbation potentials

    International Nuclear Information System (INIS)

    Harrell, E.M. II.

    1976-01-01

    This is a perturbative analysis of the eigenvalues and eigenfunctions of Schroedinger operators of the form -Δ + A + lambda V, defined on the Hilbert space L 2 (R/sup n/). A is a potential function (a smooth, real multiplication operator), and V is a ''spikelike'' perturbation, i.e., a perturbative potential function which diverges at some finite point. Lambda is a small real or complex parameter. The emphasis is on one-dimensional problems, and in particular the typical example is the ''spiked harmonic oscillator'' Hamiltonian, -d 2 /dx 2 + x 2 + lambda x/sup -α/, where α is a positive constant. An earlier study by L. Detwiler and J. R. Klauder [Phys. Rev. D 11 (1975) 1436] indicated that the lowest-order corrections to the ground-state eigenvalue of the spiked harmonic oscillator with lambda greater than 0 were proportional to lambda ln lambda when α = 3, and to lambda/sup 1/(α-2) when α is greater than 3. These and analogous results for a large class of operators and arbitrary eigenvalues are proved. Explicit constants in a modified perturbation series with a complicated dependence on lambda are determined and exhibited. Higher-order corrections for real lambda and lowest-order corrections for complex lambda are also discussed. While the substance of the dissertation is mathematical, its main applications are to quantum physics. The immediate cause of interest in such problems was the use of their peculiar convergence properties by J. R. Klauder as models for the behavior of nonrenormalizable quantum field theories. However, the results of this study are likely to be of greater importance in chemical or nuclear physics, as positive spikelike perturbations represent repulsive core interactions for quantum mechanical particles. The modified perturbation series are a new calculation technique for this situation

  8. RTEL1 dismantles T loops and counteracts telomeric G4-DNA to maintain telomere integrity.

    Science.gov (United States)

    Vannier, Jean-Baptiste; Pavicic-Kaltenbrunner, Visnja; Petalcorin, Mark I R; Ding, Hao; Boulton, Simon J

    2012-05-11

    T loops and telomeric G-quadruplex (G4) DNA structures pose a potential threat to genome stability and must be dismantled to permit efficient telomere replication. Here we implicate the helicase RTEL1 in the removal of telomeric DNA secondary structures, which is essential for preventing telomere fragility and loss. In the absence of RTEL1, T loops are inappropriately resolved by the SLX4 nuclease complex, resulting in loss of the telomere as a circle. Depleting SLX4 or blocking DNA replication abolished telomere circles (TCs) and rescued telomere loss in RTEL1(-/-) cells but failed to suppress telomere fragility. Conversely, stabilization of telomeric G4-DNA or loss of BLM dramatically enhanced telomere fragility in RTEL1-deficient cells but had no impact on TC formation or telomere loss. We propose that RTEL1 performs two distinct functions at telomeres: it disassembles T loops and also counteracts telomeric G4-DNA structures, which together ensure the dynamics and stability of the telomere. Copyright © 2012 Elsevier Inc. All rights reserved.

  9. Perturbation expansions generated by an approximate propagator

    International Nuclear Information System (INIS)

    Znojil, M.

    1987-01-01

    Starting from a knowledge of an approximate propagator R at some trial energy guess E 0 , a new perturbative prescription for p-plet of bound states and of their energies is proposed. It generalizes the Rayleigh-Schroedinger (RS) degenerate perturbation theory to the nondiagonal operators R (eliminates a RS need of their diagnolisation) and defines an approximate Hamiltonian T by mere inversion. The deviation V of T from the exact Hamiltonian H is assumed small only after a substraction of a further auxiliary Hartree-Fock-like separable ''selfconsistent'' potential U of rank p. The convergence is illustrated numerically on the anharmonic oscillator example

  10. On algebraically special perturbations of black holes

    International Nuclear Information System (INIS)

    Chandrasekhar, S.

    1984-01-01

    Algebraically special perturbations of black holes excite gravitational waves that are either purely ingoing or purely outgoing. Solutions, appropriate to such perturbations of the Kerr, the Schwarzschild, and the Reissner-Nordstroem black-holes, are obtained in explicit forms by different methods. The different methods illustrate the remarkable inner relations among different facets of the mathematical theory. In the context of the Kerr black-hole they derive from the different ways in which the explicit value of the Starobinsky constant emerges, and in the context of the Schwarzschild and the Reissner-Nordstroem black-holes they derive from the potential barriers surrounding them belonging to a special class. (author)

  11. Primordial perturbations with pre-inflationary bounce

    Science.gov (United States)

    Cai, Yong; Wang, Yu-Tong; Zhao, Jin-Yun; Piao, Yun-Song

    2018-05-01

    Based on the effective field theory (EFT) of nonsingular cosmologies, we build a stable model, without the ghost and gradient instabilities, of bounce-inflation (inflation is preceded by a cosmological bounce). We perform a full simulation for the evolution of scalar perturbation, and find that the perturbation spectrum has a large-scale suppression (as expected), which is consistent with the power deficit of the cosmic microwave background (CMB) TT-spectrum at low multipoles, but unexpectedly, it also shows itself one marked lower valley. The depth of valley is relevant with the physics around the bounce scale, which is model-dependent.

  12. Perturbative evaluation of the Thermal Wilson Loop

    International Nuclear Information System (INIS)

    Gava, E.; Jengo, R.

    1981-06-01

    The Thermal Wilson Loop 0 sup(β) dtauA 0 (tau, x-vector)>, representing an order parameter for the gauge theory and expected to be zero in the confining phase, is perturbatively evaluated up to the O(g 4 ) included for an SU(N) pure Yang-Mills theory. This evaluation should be meaningful at high temperature, β → 0. Its behaviour is discussed and a possible need for non-perturbative instanton-like contributions is pointed out. (author)

  13. A generalized perturbation program for CANDU reactor

    Energy Technology Data Exchange (ETDEWEB)

    Kim, Do Heon; Kim, Jong Kyung [Hanyang University, Seoul (Korea, Republic of); Choi, Hang Bok; Roh, Gyu Hong [Korea Atomic Energy Research Institute, Taejon (Korea, Republic of); Yang, Won Sik [Chosun University, Kwangju (Korea, Republic of)

    1999-12-31

    A generalized perturbation program has been developed for the purpose of estimating zonal power variation of a CANDU reactor upon refueling operation. The forward and adjoint calculation modules of RFSP code were used to construct the generalized perturbation program. The numerical algorithm for the generalized adjoint flux calculation was verified by comparing the zone power estimates upon refueling with those of forward calculation. It was, however, noticed that the truncation error from the iteration process of the generalized adjoint flux is not negligible. 2 refs., 1 figs., 1 tab. (Author)

  14. Pre-inflation physics and scalar perturbations

    International Nuclear Information System (INIS)

    Hirai, Shiro

    2005-01-01

    The effect of pre-inflation physics on the power spectrum of scalar perturbations is investigated. Considering various pre-inflation models with radiation-dominated or matter-dominated periods before inflation, the power spectra of curvature perturbations for large scales are calculated, and the spectral index and running spectral index are derived. It is shown that pre-inflation models in which the length of inflation is near 60 e-folds may reproduce some key properties implied by the Wilkinson microwave anisotropy probe data

  15. Non-perturbative QCD and hadron physics

    International Nuclear Information System (INIS)

    Cobos-Martínez, J J

    2016-01-01

    A brief exposition of contemporary non-perturbative methods based on the Schwinger-Dyson (SDE) and Bethe-Salpeter equations (BSE) of Quantum Chromodynamics (QCD) and their application to hadron physics is given. These equations provide a non-perturbative continuum formulation of QCD and are a powerful and promising tool for the study of hadron physics. Results on some properties of hadrons based on this approach, with particular attention to the pion distribution amplitude, elastic, and transition electromagnetic form factors, and their comparison to experimental data are presented. (paper)

  16. Perturbative approach to Markovian open quantum systems.

    Science.gov (United States)

    Li, Andy C Y; Petruccione, F; Koch, Jens

    2014-05-08

    The exact treatment of Markovian open quantum systems, when based on numerical diagonalization of the Liouville super-operator or averaging over quantum trajectories, is severely limited by Hilbert space size. Perturbation theory, standard in the investigation of closed quantum systems, has remained much less developed for open quantum systems where a direct application to the Lindblad master equation is desirable. We present such a perturbative treatment which will be useful for an analytical understanding of open quantum systems and for numerical calculation of system observables which would otherwise be impractical.

  17. Free-boundary perturbed MHD equilibria

    International Nuclear Information System (INIS)

    Nührenberg, C

    2012-01-01

    The concept of perturbed ideal MHD equilibria [Boozer A H and Nuhrenberg C 2006 Phys. Plasmas 13 102501] is employed to study the influence of external error-fields and of small plasma-pressure changes on toroidal plasma equilibria. In tokamak and stellarator free-boundary calculations, benchmarks were successful of the perturbed-equilibrium version of the CAS3D stability code [Nührenberg C et al. 2009 Phys. Rev. Lett. 102 235001] with the ideal MHD equilibrium code NEMEC [Hirshman S P et al. 1986 Comput. Phys. Commun. 43 143].

  18. Death to perturbative QCD in exclusive processes?

    Energy Technology Data Exchange (ETDEWEB)

    Eckardt, R.; Hansper, J.; Gari, M.F. [Institut fuer Theoretische Physik, Bochum (Germany)

    1994-04-01

    The authors discuss the question of whether perturbative QCD is applicable in calculations of exclusive processes at available momentum transfers. They show that the currently used method of determining hadronic quark distribution amplitudes from QCD sum rules yields wave functions which are completely undetermined because the polynomial expansion diverges. Because of the indeterminacy of the wave functions no statement can be made at present as to whether perturbative QCD is valid. The authors emphasize the necessity of a rigorous discussion of the subject and the importance of experimental data in the range of interest.

  19. Perturbative and nonperturbative renormalization in lattice QCD

    Energy Technology Data Exchange (ETDEWEB)

    Goeckeler, M. [Regensburg Univ. (Germany). Institut fuer Theoretische Physik; Horsley, R. [University of Edinburgh (United Kingdom). School of Physics and Astronomy; Perlt, H. [Leipzig Univ. (DE). Institut fuer Theoretische Physik] (and others)

    2010-03-15

    We investigate the perturbative and nonperturbative renormalization of composite operators in lattice QCD restricting ourselves to operators that are bilinear in the quark fields (quark-antiquark operators). These include operators which are relevant to the calculation of moments of hadronic structure functions. The nonperturbative computations are based on Monte Carlo simulations with two flavors of clover fermions and utilize the Rome-Southampton method also known as the RI-MOM scheme. We compare the results of this approach with various estimates from lattice perturbation theory, in particular with recent two-loop calculations. (orig.)

  20. A generalized perturbation program for CANDU reactor

    Energy Technology Data Exchange (ETDEWEB)

    Kim, Do Heon; Kim, Jong Kyung [Hanyang University, Seoul (Korea, Republic of); Choi, Hang Bok; Roh, Gyu Hong [Korea Atomic Energy Research Institute, Taejon (Korea, Republic of); Yang, Won Sik [Chosun University, Kwangju (Korea, Republic of)

    1998-12-31

    A generalized perturbation program has been developed for the purpose of estimating zonal power variation of a CANDU reactor upon refueling operation. The forward and adjoint calculation modules of RFSP code were used to construct the generalized perturbation program. The numerical algorithm for the generalized adjoint flux calculation was verified by comparing the zone power estimates upon refueling with those of forward calculation. It was, however, noticed that the truncation error from the iteration process of the generalized adjoint flux is not negligible. 2 refs., 1 figs., 1 tab. (Author)