Simultaneous Binding of Hybrid Molecules Constructed with Dual DNA-Binding Components to a G-Quadruplex and Its Proximal Duplex.

Science.gov (United States)

Asamitsu, Sefan; Obata, Shunsuke; Phan, Anh Tuân; Hashiya, Kaori; Bando, Toshikazu; Sugiyama, Hiroshi

2018-03-20

A G-quadruplex (quadruplex) is a nucleic acid secondary structure adopted by guanine-rich sequences and is considered to be relevant to various pharmacological and biological contexts. Although a number of researchers have endeavored to discover and develop quadruplex-interactive molecules, poor ligand designability originating from topological similarity of the skeleton of diverse quadruplexes has remained a bottleneck for gaining specificity for individual quadruplexes. This work reports on hybrid molecules that were constructed with dual DNA-binding components, a cyclic imidazole/lysine polyamide (cIKP), and a hairpin pyrrole/imidazole polyamide (hPIP), with the aim toward specific quadruplex targeting by reading out the local duplex DNA sequence adjacent to designated quadruplexes in the genome. By means of circular dichroism (CD), fluorescence resonance energy transfer (FRET), surface plasmon resonance (SPR), and NMR techniques, we showed the dual and simultaneous recognition of the respective segment via hybrid molecules, and the synergistic and mutual effect of each binding component that was appropriately linked on higher binding affinity and modest sequence specificity. Monitoring quadruplex and duplex imino protons of the quadruplex/duplex motif titrated with hybrid molecules clearly revealed distinct features of the binding of hybrid molecules to the respective segments upon their simultaneous recognition. A series of the systematic and detailed binding assays described here showed that the concept of simultaneous recognition of quadruplex and its proximal duplex by hybrid molecules constructed with the dual DNA-binding components may provide a new strategy for ligand design, enabling targeting of a large variety of designated quadruplexes at specific genome locations. © 2018 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

Volumetric contributions of loop regions of G-quadruplex DNA to the formation of the tertiary structure.

Science.gov (United States)

Takahashi, Shuntaro; Sugimoto, Naoki

2017-12-01

DNA guanine-quadruplexes (G-quadruplexes) are unique DNA structures formed by guanine-rich sequences. The loop regions of G-quadruplexes play key roles in stability and topology of G-quadruplexes. Here, we investigated volumetric changes induced by pressure in the folding of the G-quadruplex formed by the thrombin binding aptamer (TBA) with mutations within the loop regions. The change of partial molar volume in the transition from coil to G-quadruplex, ∆V tr , of TBA with a mutation from T to A in the 5' most loop (TBA T3A) was 75.5cm 3 mol -1 , which was larger than that of TBA (54.6cm 3 mol -1 ). TBA with a G to T mutation in the central loop (TBA G8T) had thermal stability similar to TBA T3A but a smaller ∆V tr of 41.1cm 3 mol -1 . In the presence of poly(ethylene)glycol 200 (PEG200), ∆V tr values were 14.7cm 3 mol -1 for TBA T3A and 13.2cm 3 mol -1 for TBA G8T. These results suggest that the two mutations destabilize the G-quadruplex structure differently. Thus, volumetric data obtained using pressure-based thermodynamic analyses provides information about the dynamics of the loop regions and the roles of loops in the stabilities and folding of G-quadruplex structures. Copyright © 2017 Elsevier B.V. All rights reserved.

Fluorescence detection of DNA, adenosine-5'-triphosphate (ATP), and telomerase activity by zinc(II)-protoporphyrin IX/G-quadruplex labels.

Science.gov (United States)

Zhang, Zhanxia; Sharon, Etery; Freeman, Ronit; Liu, Xiaoqing; Willner, Itamar

2012-06-05

The zinc(II)-protoporphyrin IX (ZnPPIX) fluorophore binds to G-quadruplexes, and this results in the enhanced fluorescence of the fluorophore. This property enabled the development of DNA sensors, aptasensors, and a sensor following telomerase activity. The DNA sensor is based on the design of a hairpin structure that includes a "caged" inactive G-quadruplex sequence. Upon opening the hairpin by the analyte DNA, the resulting fluorescence of the ZnPPIX/G-quadruplex provides the readout signal for the sensing event (detection limit 5 nM). Addition of Exonuclease III to the system allows the recycling of the analyte and its amplified analysis (detection limit, 200 pM). The association of the ZnPPIX to G-quadruplex aptamer-substrate complexes allowed the detection of adenosine-5'-triphosphate (ATP, detection limit 10 μM). Finally, the association of ZnPPIX to the G-quadruplex repeat units of telomers allowed the detection of telomerase activity originating from 380 ± 20 cancer 293T cell extract.

Co-transcriptional formation of DNA:RNA hybrid G-quadruplex and potential function as constitutional cis element for transcription control.

Science.gov (United States)

Zheng, Ke-wei; Xiao, Shan; Liu, Jia-quan; Zhang, Jia-yu; Hao, Yu-hua; Tan, Zheng

2013-05-01

G-quadruplex formation in genomic DNA is considered to regulate transcription. Previous investigations almost exclusively focused on intramolecular G-quadruplexes formed by DNA carrying four or more G-tracts, and structure formation has rarely been studied in physiologically relevant processes. Here, we report an almost entirely neglected, but actually much more prevalent form of G-quadruplexes, DNA:RNA hybrid G-quadruplexes (HQ) that forms in transcription. HQ formation requires as few as two G-tracts instead of four on a non-template DNA strand. Potential HQ sequences (PHQS) are present in >97% of human genes, with an average of 73 PHQSs per gene. HQ modulates transcription under both in vitro and in vivo conditions. Transcriptomal analysis of human tissues implies that maximal gene expression may be limited by the number of PHQS in genes. These features suggest that HQs may play fundamental roles in transcription regulation and other transcription-mediated processes.

Binding modes and pathway of RHPS4 to human telomeric G-quadruplex and duplex DNA probed by all-atom molecular dynamics simulations with explicit solvent.

Science.gov (United States)

Mulholland, Kelly; Siddiquei, Farzana; Wu, Chun

2017-07-19

RHPS4, a potent binder to human telomeric DNA G-quadruplex, shows high efficacy in tumor cell growth inhibition. However, it's preferential binding to DNA G-quadruplex over DNA duplex (about 10 fold) remains to be improved toward its clinical application. A high resolution structure of the single-stranded telomeric DNA G-quadruplexes, or B-DNA duplex, in complex with RHPS4 is not available yet, and the binding nature of this ligand to these DNA forms remains to be elusive. In this study, we carried out 40 μs molecular dynamics binding simulations with a free ligand to decipher the binding pathway of RHPS4 to a DNA duplex and three G-quadruplex folders (parallel, antiparallel and hybrid) of the human telomeric DNA sequence. The most stable binding mode identified for the duplex, parallel, antiparallel and hybrid G-quadruplexes is an intercalation, bottom stacking, top intercalation and bottom intercalation mode, respectively. The intercalation mode with similar binding strength to both the duplex and the G-quadruplexes, explains the lack of binding selectivity of RHPS4 to the G-quadruplex form. Therefore, a ligand modification that destabilizes the duplex intercalation mode but stabilizes the G-quadruplex intercalation mode will improve the binding selectivity toward G-quadruplex. The intercalation mode of RHPS4 to both the duplex and the antiparallel and the hybrid G-quadruplex follows a base flipping-insertion mechanism rather than an open-insertion mechanism. The groove binding, the side binding and the intercalation with flipping out of base were observed to be intermediate states before the full intercalation state with paired bases.

6-Thioguanine alters the structure and stability of duplex DNA and inhibits quadruplex DNA formation.

Science.gov (United States)

Marathias, V M; Sawicki, M J; Bolton, P H

1999-07-15

The ability to chemically synthesize biomolecules has opened up the opportunity to observe changes in structure and activity that occur upon single atom substitution. In favorable cases this can provide information about the roles of individual atoms. The substitution of 6-thioguanine (6SG) for guanine is a potentially very useful single atom substitution as 6SG has optical, photocrosslinking, metal ion binding and other properties of potential utility. In addition, 6-mercaptopurine is a clinically important pro-drug that is activated by conversion into 6SG by cells. The results presented here indicate that the presence of 6SG blocks the formation of quadruplex DNA. The presence of 6SG alters the structure and lowers the thermal stability of duplex DNA, but duplex DNA can be formed in the presence of 6SG. These results indicate that some of the cytotoxic activity of 6SG may be due to disruption of the quadruplex structures formed by telomere and other DNAs. This additional mode of action is consistent with the delayed onset of cytotoxicity.

Cation binding to 15-TBA quadruplex DNA is a multiple-pathway cation-dependent process

Science.gov (United States)

Reshetnikov, Roman V.; Sponer, Jiri; Rassokhina, Olga I.; Kopylov, Alexei M.; Tsvetkov, Philipp O.; Makarov, Alexander A.; Golovin, Andrey V.

2011-01-01

A combination of explicit solvent molecular dynamics simulation (30 simulations reaching 4 µs in total), hybrid quantum mechanics/molecular mechanics approach and isothermal titration calorimetry was used to investigate the atomistic picture of ion binding to 15-mer thrombin-binding quadruplex DNA (G-DNA) aptamer. Binding of ions to G-DNA is complex multiple pathway process, which is strongly affected by the type of the cation. The individual ion-binding events are substantially modulated by the connecting loops of the aptamer, which play several roles. They stabilize the molecule during time periods when the bound ions are not present, they modulate the route of the ion into the stem and they also stabilize the internal ions by closing the gates through which the ions enter the quadruplex. Using our extensive simulations, we for the first time observed full spontaneous exchange of internal cation between quadruplex molecule and bulk solvent at atomistic resolution. The simulation suggests that expulsion of the internally bound ion is correlated with initial binding of the incoming ion. The incoming ion then readily replaces the bound ion while minimizing any destabilization of the solute molecule during the exchange. PMID:21893589

Synthesis and Molecular Modeling of Thermally Stable DNA G-Quadruplexes with Anthraquinone Insertions

DEFF Research Database (Denmark)

Gouda, Alaa S.; Amine, Mahasen S.; Pedersen, Erik Bjerregaard

2017-01-01

Two new phosphoramidite building blocks for DNA synthesis were synthesized from 1,5- and 2,6-dihydroxyanthraquinones through alkylation with 3-bromo-1-propanol followed by DMT-protection. The novel synthesized 1,5- and 2,6-disubstituted anthraquinone monomers H15 and H26 are incorporated into a G...... anthraquinone-modified quadruplexes revealed no change of the antiparallel structure when compared with the wild type under potassium buffer conditions. The significantly increased thermostabilities were interpreted by molecular modeling of anthraquinone-modified G-quadruplexes....

Electrochemical and AFM Characterization of G-Quadruplex Electrochemical Biosensors and Applications

Science.gov (United States)

2018-01-01

Guanine-rich DNA sequences are able to form G-quadruplexes, being involved in important biological processes and representing smart self-assembling nanomaterials that are increasingly used in DNA nanotechnology and biosensor technology. G-quadruplex electrochemical biosensors have received particular attention, since the electrochemical response is particularly sensitive to the DNA structural changes from single-stranded, double-stranded, or hairpin into a G-quadruplex configuration. Furthermore, the development of an increased number of G-quadruplex aptamers that combine the G-quadruplex stiffness and self-assembling versatility with the aptamer high specificity of binding to a variety of molecular targets allowed the construction of biosensors with increased selectivity and sensitivity. This review discusses the recent advances on the electrochemical characterization, design, and applications of G-quadruplex electrochemical biosensors in the evaluation of metal ions, G-quadruplex ligands, and other small organic molecules, proteins, and cells. The electrochemical and atomic force microscopy characterization of G-quadruplexes is presented. The incubation time and cations concentration dependence in controlling the G-quadruplex folding, stability, and nanostructures formation at carbon electrodes are discussed. Different G-quadruplex electrochemical biosensors design strategies, based on the DNA folding into a G-quadruplex, the use of G-quadruplex aptamers, or the use of hemin/G-quadruplex DNAzymes, are revisited. PMID:29666699

Efficient Long-Range Hole Transport Through G-Quadruplexes.

Science.gov (United States)

Wu, Jingyuan; Meng, Zhenyu; Lu, Yunpeng; Shao, Fangwei

2017-10-09

DNA offers a means of long-range charge transport for biology and electric nanodevices. Here, a series of tetra-stranded G-quadruplexes were assembled within a dendritic DNA architecture to explore oxidative charge transport (hole transport) through the G-quadruplex. Efficient charge transport was achieved over 28 Å upon UV irradiation. Over a longer G-quadruplex bridge, hole transport was escalated to a higher efficiency, which resulted in a higher yield than that of the optimal duplex DNA for charge transport, that is, the adenine tract. Efficient long-range hole transport suggests tetra-stranded G-quadruplexes, instead of an oxidation hotspot, hold better potential as an electron conduit than duplex DNA. © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

Experimental approaches to identify cellular G-quadruplex structures and functions.

Science.gov (United States)

Di Antonio, Marco; Rodriguez, Raphaël; Balasubramanian, Shankar

2012-05-01

Guanine-rich nucleic acids can fold into non-canonical DNA secondary structures called G-quadruplexes. The formation of these structures can interfere with the biology that is crucial to sustain cellular homeostases and metabolism via mechanisms that include transcription, translation, splicing, telomere maintenance and DNA recombination. Thus, due to their implication in several biological processes and possible role promoting genomic instability, G-quadruplex forming sequences have emerged as potential therapeutic targets. There has been a growing interest in the development of synthetic molecules and biomolecules for sensing G-quadruplex structures in cellular DNA. In this review, we summarise and discuss recent methods developed for cellular imaging of G-quadruplexes, and the application of experimental genomic approaches to detect G-quadruplexes throughout genomic DNA. In particular, we will discuss the use of engineered small molecules and natural proteins to enable pull-down, ChIP-Seq, ChIP-chip and fluorescence imaging of G-quadruplex structures in cellular DNA. Copyright © 2012 Elsevier Inc. All rights reserved.

Cation binding to 15-TBA quadruplex DNA is a multiple-pathway cation-dependent process.

Science.gov (United States)

Reshetnikov, Roman V; Sponer, Jiri; Rassokhina, Olga I; Kopylov, Alexei M; Tsvetkov, Philipp O; Makarov, Alexander A; Golovin, Andrey V

2011-12-01

A combination of explicit solvent molecular dynamics simulation (30 simulations reaching 4 µs in total), hybrid quantum mechanics/molecular mechanics approach and isothermal titration calorimetry was used to investigate the atomistic picture of ion binding to 15-mer thrombin-binding quadruplex DNA (G-DNA) aptamer. Binding of ions to G-DNA is complex multiple pathway process, which is strongly affected by the type of the cation. The individual ion-binding events are substantially modulated by the connecting loops of the aptamer, which play several roles. They stabilize the molecule during time periods when the bound ions are not present, they modulate the route of the ion into the stem and they also stabilize the internal ions by closing the gates through which the ions enter the quadruplex. Using our extensive simulations, we for the first time observed full spontaneous exchange of internal cation between quadruplex molecule and bulk solvent at atomistic resolution. The simulation suggests that expulsion of the internally bound ion is correlated with initial binding of the incoming ion. The incoming ion then readily replaces the bound ion while minimizing any destabilization of the solute molecule during the exchange. © The Author(s) 2011. Published by Oxford University Press.

Aminoglycosylation can enhance the G-quadruplex binding activity of epigallocatechin.

Directory of Open Access Journals (Sweden)

Li-Ping Bai

Full Text Available With the aim of enhancing G-quadruplex binding activity, two new glucosaminosides (16, 18 of penta-methylated epigallocatechin were synthesized by chemical glycosylation. Subsequent ESI-TOF-MS analysis demonstrated that these two glucosaminoside derivatives exhibit much stronger binding activity to human telomeric DNA and RNA G-quadruplexes than their parent structure (i.e., methylated EGC (14 as well as natural epigallocatechin (EGC, 6. The DNA G-quadruplex binding activity of 16 and 18 is even more potent than strong G-quadruplex binder quercetin, which has a more planar structure. These two synthetic compounds also showed a higher binding strength to human telomeric RNA G-quadruplex than its DNA counterpart. Analysis of the structure-activity relationship revealed that the more basic compound, 16, has a higher binding capacity with DNA and RNA G-quadruplexes than its N-acetyl derivative, 18, suggesting the importance of the basicity of the aminoglycoside for G-quadruplex binding activity. Molecular docking simulation predicted that the aromatic ring of 16 π-stacks with the aromatic ring of guanine nucleotides, with the glucosamine moiety residing in the groove of G-quadruplex. This research indicates that glycosylation of natural products with aminosugar can significantly enhance their G-quadruplex binding activities, thus is an effective way to generate small molecules targeting G-quadruplexes in nucleic acids. In addition, this is the first report that green tea catechin can bind to nucleic acid G-quadruplex structures.

Putative DNA G-quadruplex formation within the promoters of Plasmodium falciparum var genes

Directory of Open Access Journals (Sweden)

Rowe J

2009-08-01

Full Text Available Abstract Background Guanine-rich nucleic acid sequences are capable of folding into an intramolecular four-stranded structure called a G-quadruplex. When found in gene promoter regions, G-quadruplexes can downregulate gene expression, possibly by blocking the transcriptional machinery. Here we have used a genome-wide bioinformatic approach to identify Putative G-Quadruplex Sequences (PQS in the Plasmodium falciparum genome, along with biophysical techniques to examine the physiological stability of P. falciparum PQS in vitro. Results We identified 63 PQS in the non-telomeric regions of the P. falciparum clone 3D7. Interestingly, 16 of these PQS occurred in the upstream region of a subset of the P. falciparum var genes (group B var genes. The var gene family encodes PfEMP1, the parasite's major variant antigen and adhesin expressed at the surface of infected erythrocytes, that plays a key role in malaria pathogenesis and immune evasion. The ability of the PQS found in the upstream regions of group B var genes (UpsB-Q to form stable G-quadruplex structures in vitro was confirmed using 1H NMR, circular dichroism, UV spectroscopy, and thermal denaturation experiments. Moreover, the synthetic compound BOQ1 that shows a higher affinity for DNA forming quadruplex rather than duplex structures was found to bind with high affinity to the UpsB-Q. Conclusion This is the first demonstration of non-telomeric PQS in the genome of P. falciparum that form stable G-quadruplexes under physiological conditions in vitro. These results allow the generation of a novel hypothesis that the G-quadruplex sequences in the upstream regions of var genes have the potential to play a role in the transcriptional control of this major virulence-associated multi-gene family.

Dual Recognition of Human Telomeric G-quadruplex by Neomycin-anthraquinone Conjugate

Science.gov (United States)

Ranjan, Nihar; Davis, Erik; Xue, Liang

2013-01-01

The authors report the recognition of a G-quadruplex formed by four repeat human telomeric DNA with aminosugar intercalator conjugates. The recognition of G-quadruplex through dual binding mode ligands significantly increased the affinity of ligands for G-quadruplex. One such example is a neomycin-anthraquinone 2 which exhibited nanomolar affinity for the quadruplex, and the affinity of 2 is nearly 1000 fold higher for human telomeric G-quadruplex DNA than its constituent units, neomycin and anthraquinone. PMID:23698792

DNA sensors and aptasensors based on the hemin/G-quadruplex-controlled aggregation of Au NPs in the presence of L-cysteine.

Science.gov (United States)

Niazov-Elkan, Angelica; Golub, Eyal; Sharon, Etery; Balogh, Dora; Willner, Itamar

2014-07-23

L-cysteine induces the aggregation of Au nanoparticles (NPs), resulting in a color transition from red to blue due to interparticle plasmonic coupling in the aggregated structure. The hemin/G-quadruplex horseradish peroxidase-mimicking DNAzyme catalyzes the aerobic oxidation of L-cysteine to cystine, a process that inhibits the aggregation of the NPs. The degree of inhibition of the aggregation process is controlled by the concentration of the DNAzyme in the system. These functions are implemented to develop sensing platforms for the detection of a target DNA, for the analysis of aptamer-substrate complexes, and for the analysis of L-cysteine in human urine samples. A hairpin DNA structure that includes a recognition site for the DNA analyte and a caged G-quadruplex sequence, is opened in the presence of the target DNA. The resulting self-assembled hemin/G-quadruplex acts as catalyst that controls the aggregation of the Au NPs. Also, the thrombin-binding aptamer folds into a G-quadruplex nanostructure upon binding to thrombin. The association of hemin to the resulting G-quadruplex aptamer-thrombin complex leads to a catalytic label that controls the L-cysteine-mediated aggregation of the Au NPs. The hemin/G-qaudruplex-controlled aggregation of Au NPs process is further implemented for visual and spectroscopic detection of L-cysteine concentration in urine samples. © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

DNA secondary structures: stability and function of G-quadruplex structures

Science.gov (United States)

Bochman, Matthew L.; Paeschke, Katrin; Zakian, Virginia A.

2013-01-01

In addition to the canonical double helix, DNA can fold into various other inter- and intramolecular secondary structures. Although many such structures were long thought to be in vitro artefacts, bioinformatics demonstrates that DNA sequences capable of forming these structures are conserved throughout evolution, suggesting the existence of non-B-form DNA in vivo. In addition, genes whose products promote formation or resolution of these structures are found in diverse organisms, and a growing body of work suggests that the resolution of DNA secondary structures is critical for genome integrity. This Review focuses on emerging evidence relating to the characteristics of G-quadruplex structures and the possible influence of such structures on genomic stability and cellular processes, such as transcription. PMID:23032257

A colorimetric platform for sensitively differentiating telomere DNA with different lengths, monitoring G-quadruplex and dsDNA based on silver nanoclusters and unmodified gold nanoparticles

Science.gov (United States)

Qu, Fei; Chen, Zeqiu; You, Jinmao; Song, Cuihua

2018-05-01

Human telomere DNA plays a vital role in genome integrity control and carcinogenesis as an indication for extensive cell proliferation. Herein, silver nanoclusters (Ag NCs) templated by polymer and unmodified gold nanoparticles (Au NPs) are designed as a new colorimetric platform for sensitively differentiating telomere DNA with different lengths, monitoring G-quadruplex and dsDNA. Ag NCs can produce the aggregation of Au NPs, so the color of Au NPs changes to blue and the absorption peak moves to 700 nm. While the telomere DNA can protect Au NPs from aggregation, the color turns to red again and the absorption band blue shift. Benefiting from the obvious color change, we can differentiate the length of telomere DNA by naked eyes. As the length of telomere DNA is longer, the variation of color becomes more noticeable. The detection limits of telomere DNA containing 10, 22, 40, 64 bases are estimated to be 1.41, 1.21, 0.23 and 0.22 nM, respectively. On the other hand, when telomere DNA forms G-quadruplex in the presence of K+, or dsDNA with complementary sequence, both G-quadruplex and dsDNA can protect Au NPs better than the unfolded telomere DNA. Hence, a new colorimetric platform for monitoring structure conversion of DNA is established by Ag NCs-Au NPs system, and to prove this type of application, a selective K+ sensor is developed.

Human telomere sequence DNA in water-free and high-viscosity solvents: G-quadruplex folding governed by Kramers rate theory.

Science.gov (United States)

Lannan, Ford M; Mamajanov, Irena; Hud, Nicholas V

2012-09-19

Structures formed by human telomere sequence (HTS) DNA are of interest due to the implication of telomeres in the aging process and cancer. We present studies of HTS DNA folding in an anhydrous, high viscosity deep eutectic solvent (DES) comprised of choline choride and urea. In this solvent, the HTS DNA forms a G-quadruplex with the parallel-stranded ("propeller") fold, consistent with observations that reduced water activity favors the parallel fold, whereas alternative folds are favored at high water activity. Surprisingly, adoption of the parallel structure by HTS DNA in the DES, after thermal denaturation and quick cooling to room temperature, requires several months, as opposed to less than 2 min in an aqueous solution. This extended folding time in the DES is, in part, due to HTS DNA becoming kinetically trapped in a folded state that is apparently not accessed in lower viscosity solvents. A comparison of times required for the G-quadruplex to convert from its aqueous-preferred folded state to its parallel fold also reveals a dependence on solvent viscosity that is consistent with Kramers rate theory, which predicts that diffusion-controlled transitions will slow proportionally with solvent friction. These results provide an enhanced view of a G-quadruplex folding funnel and highlight the necessity to consider solvent viscosity in studies of G-quadruplex formation in vitro and in vivo. Additionally, the solvents and analyses presented here should prove valuable for understanding the folding of many other nucleic acids and potentially have applications in DNA-based nanotechnology where time-dependent structures are desired.

Prospect of bioflavonoid fisetin as a quadruplex DNA ligand: a biophysical approach.

Directory of Open Access Journals (Sweden)

Bidisha Sengupta

Full Text Available Quadruplex (G4 forming sequences in telomeric DNA and c-myc promoter regions of human DNA are associated with tumorogenesis. Ligands that can facilitate or stabilize the formation and increase the stabilization of G4 can prevent tumor cell proliferation and have been regarded as potential anti-cancer drugs. In the present study, steady state and time-resolved fluorescence measurements provide important structural and dynamical insights into the free and bound states of the therapeutically potent plant flavonoid fisetin (3,3',4',7-tetrahydroxyflavone in a G4 DNA matrix. The excited state intra-molecular proton transfer (ESPT of fisetin plays an important role in observing and understanding the binding of fisetin with the G4 DNA. Differential absorption spectra, thermal melting, and circular dichroism spectroscopic studies provide evidences for the formation of G4 DNA and size exclusion chromatography (SEC proves the binding and 1∶1 stoichiometry of fisetin in the DNA matrix. Comparative analysis of binding in the presence of EtBr proves that fisetin favors binding at the face of the G-quartet, mostly along the diagonal loop. Time resolved fluorescence anisotropy decay analysis indicates the increase in the restrictions in motion from the free to bound fisetin. We have also investigated the fingerprints of the binding of fisetin in the antiparallel quadruplex using Raman spectroscopy. Preliminary results indicate fisetin to be a prospective candidate as a G4 ligand.

Prospect of Bioflavonoid Fisetin as a Quadruplex DNA Ligand: A Biophysical Approach

Science.gov (United States)

Sengupta, Bidisha; Pahari, Biswapathik; Blackmon, Laura; Sengupta, Pradeep K.

2013-01-01

Quadruplex (G4) forming sequences in telomeric DNA and c-myc promoter regions of human DNA are associated with tumorogenesis. Ligands that can facilitate or stabilize the formation and increase the stabilization of G4 can prevent tumor cell proliferation and have been regarded as potential anti-cancer drugs. In the present study, steady state and time-resolved fluorescence measurements provide important structural and dynamical insights into the free and bound states of the therapeutically potent plant flavonoid fisetin (3,3′,4′,7-tetrahydroxyflavone) in a G4 DNA matrix. The excited state intra-molecular proton transfer (ESPT) of fisetin plays an important role in observing and understanding the binding of fisetin with the G4 DNA. Differential absorption spectra, thermal melting, and circular dichroism spectroscopic studies provide evidences for the formation of G4 DNA and size exclusion chromatography (SEC) proves the binding and 1∶1 stoichiometry of fisetin in the DNA matrix. Comparative analysis of binding in the presence of EtBr proves that fisetin favors binding at the face of the G-quartet, mostly along the diagonal loop. Time resolved fluorescence anisotropy decay analysis indicates the increase in the restrictions in motion from the free to bound fisetin. We have also investigated the fingerprints of the binding of fisetin in the antiparallel quadruplex using Raman spectroscopy. Preliminary results indicate fisetin to be a prospective candidate as a G4 ligand. PMID:23785423

G-Quadruplexes in DNA Replication: A Problem or a Necessity?

Science.gov (United States)

Valton, Anne-Laure; Prioleau, Marie-Noëlle

2016-11-01

DNA replication is a highly regulated process that ensures the correct duplication of the genome at each cell cycle. A precise cell type-specific temporal program controls the duplication of complex vertebrate genomes in an orderly manner. This program is based on the regulation of both replication origin firing and replication fork progression. G-quadruplexes (G4s), DNA secondary structures displaying noncanonical Watson-Crick base pairing, have recently emerged as key controllers of genome duplication. Here we discuss the various means by which G4s affect this fundamental cellular process. Copyright © 2016 Elsevier Ltd. All rights reserved.

Atomistic picture for the folding pathway of a hybrid-1 type human telomeric DNA G-quadruplex.

Directory of Open Access Journals (Sweden)

Yunqiang Bian

2014-04-01

Full Text Available In this work we studied the folding process of the hybrid-1 type human telomeric DNA G-quadruplex with solvent and K(+ ions explicitly modeled. Enabled by the powerful bias-exchange metadynamics and large-scale conventional molecular dynamic simulations, the free energy landscape of this G-DNA was obtained for the first time and four folding intermediates were identified, including a triplex and a basically formed quadruplex. The simulations also provided atomistic pictures for the structures and cation binding patterns of the intermediates. The results showed that the structure formation and cation binding are cooperative and mutually supporting each other. The syn/anti reorientation dynamics of the intermediates was also investigated. It was found that the nucleotides usually take correct syn/anti configurations when they form native and stable hydrogen bonds with the others, while fluctuating between two configurations when they do not. Misfolded intermediates with wrong syn/anti configurations were observed in the early intermediates but not in the later ones. Based on the simulations, we also discussed the roles of the non-native interactions. Besides, the formation process of the parallel conformation in the first two G-repeats and the associated reversal loop were studied. Based on the above results, we proposed a folding pathway for the hybrid-1 type G-quadruplex with atomistic details, which is new and more complete compared with previous ones. The knowledge gained for this type of G-DNA may provide a general insight for the folding of the other G-quadruplexes.

Biochemical techniques for the characterization of G-quadruplex structures: EMSA, DMS footprinting, and DNA polymerase stop assay.

Science.gov (United States)

Sun, Daekyu; Hurley, Laurence H

2010-01-01

The proximal promoter region of many human growth-related genes contains a polypurine/polypyrimidine tract that serves as multiple binding sites for Sp1 or other transcription factors. These tracts often contain a guanine-rich sequence consisting of four runs of three or more contiguous guanines separated by one or more bases, corresponding to a general motif known for the formation of an intramolecular G-quadruplex. Recent results provide strong evidence that specific G-quadruplex structures form naturally within these polypurine/polypyrimidine tracts in many human promoter regions, raising the possibility that the transcriptional control of these genes can be modulated by G-quadruplex-interactive agents. In this chapter, we describe three general biochemical methodologies, electrophoretic mobility shift assay (EMSA), dimethylsulfate (DMS) footprinting, and the DNA polymerase stop assay, which can be useful for initial characterization of G-quadruplex structures formed by G-rich sequences.

Development of a carbazole-based fluorescence probe for G-quadruplex DNA: The importance of side-group effect on binding specificity

Science.gov (United States)

Wang, Ming-Qi; Ren, Gui-Ying; Zhao, Shuang; Lian, Guang-Chang; Chen, Ting-Ting; Ci, Yang; Li, Hong-Yao

2018-06-01

G-quadruplex DNAs are highly prevalent in the human genome and involved in many important biological processes. However, many aspects of their biological mechanism and significance still need to be elucidated. Therefore, the development of fluorescent probes for G-quadruplex detection is important for the basic research. We report here on the development of small molecular dyes designed on the basis of carbazole scaffold by introducing styrene-like substituents at its 9-position, for the purpose of G-quadruplex recognition. Results revealed that the side group on the carbazole scaffold was very important for their ability to selectively recognize G-quadruplex DNA structures. 1a with the pyridine side group displayed excellent fluorescence signal turn-on property for the specific discrimination of G-quadruplex DNAs against other nucleic acids. The characteristics of 1a were further investigated with UV-vis spectrophotometry, fluorescence, circular dichroism, FID assay and molecular docking to validate the selectivity, sensitivity and detailed binding mode toward G-quadruplex DNAs.

Long-range charge transport in single G-quadruplex DNA molecules

DEFF Research Database (Denmark)

Livshits, Gideon I.; Stern, Avigail; Rotem, Dvir

2014-01-01

DNA and DNA-based polymers are of interest in molecular electronics because of their versatile and programmable structures. However, transport measurements have produced a range of seemingly contradictory results due to differences in the measured molecules and experimental set-ups, and transport......DNA and DNA-based polymers are of interest in molecular electronics because of their versatile and programmable structures. However, transport measurements have produced a range of seemingly contradictory results due to differences in the measured molecules and experimental set......-ups, and transporting significant current through individual DNA-based molecules remains a considerable challenge. Here, we report reproducible charge transport in guanine-quadruplex (G4) DNA molecules adsorbed on a mica substrate. Currents ranging from tens of picoamperes to more than 100 pA were measured in the G4......-DNA over distances ranging from tens of nanometres to more than 100 nm. Our experimental results, combined with theoretical modelling, suggest that transport occurs via a thermally activated long-range hopping between multi-tetrad segments of DNA. These results could re-ignite interest in DNA...

Toehold strand displacement-driven assembly of G-quadruplex DNA for enzyme-free and non-label sensitive fluorescent detection of thrombin.

Science.gov (United States)

Xu, Yunying; Zhou, Wenjiao; Zhou, Ming; Xiang, Yun; Yuan, Ruo; Chai, Yaqin

2015-02-15

Based on a new signal amplification strategy by the toehold strand displacement-driven cyclic assembly of G-quadruplex DNA, the development of an enzyme-free and non-label aptamer sensing approach for sensitive fluorescent detection of thrombin is described. The target thrombin associates with the corresponding aptamer of the partial dsDNA probes and liberates single stranded initiation sequences, which trigger the toehold strand displacement assembly of two G-quadruplex containing hairpin DNAs. This toehold strand displacement reaction leads to the cyclic reuse of the initiation sequences and the production of DNA assemblies with numerous G-quadruplex structures. The fluorescent dye, N-Methyl mesoporphyrin IX, binds to these G-quadruplex structures and generates significantly amplified fluorescent signals to achieve highly sensitive detection of thrombin down to 5 pM. Besides, this method shows high selectivity towards the target thrombin against other control proteins. The developed thrombin sensing method herein avoids the modification of the probes and the involvement of any enzyme or nanomaterial labels for signal amplification. With the successful demonstration for thrombin detection, our approach can be easily adopted to monitor other target molecules in a simple, low-cost, sensitive and selective way by choosing appropriate aptamer/ligand pairs. Copyright © 2014 Elsevier B.V. All rights reserved.

Xanthene and Xanthone Derivatives as G-Quadruplex Stabilizing Ligands

Directory of Open Access Journals (Sweden)

Alessandro Altieri

2013-10-01

Full Text Available Following previous studies on anthraquinone and acridine-based G-quadruplex ligands, here we present a study of similar aromatic cores, with the specific aim of increasing G-quadruplex binding and selectivity with respect to duplex DNA. Synthesized compounds include two and three-side chain xanthone and xanthene derivatives, as well as a dimeric “bridged” form. ESI and FRET measurements suggest that all the studied molecules are good G-quadruplex ligands, both at telomeres and on G-quadruplex forming sequences of oncogene promoters. The dimeric compound and the three-side chain xanthone derivative have been shown to represent the best compounds emerging from the different series of ligands presented here, having also high selectivity for G-quadruplex structures with respect to duplex DNA. Molecular modeling simulations are in broad agreement with the experimental data.

Selectivity in ligand recognition of G-quadruplex loops.

Science.gov (United States)

Campbell, Nancy H; Patel, Manisha; Tofa, Amina B; Ghosh, Ragina; Parkinson, Gary N; Neidle, Stephen

2009-03-03

A series of disubstituted acridine ligands have been cocrystallized with a bimolecular DNA G-quadruplex. The ligands have a range of cyclic amino end groups of varying size. The crystal structures show that the diagonal loop in this quadruplex results in a large cavity for these groups, in contrast to the steric constraints imposed by propeller loops in human telomeric quadruplexes. We conclude that the nature of the loop has a significant influence on ligand selectivity for particular quadruplex folds.

Distance-dependent duplex DNA destabilization proximal to G-quadruplex/i-motif sequences

Science.gov (United States)

König, Sebastian L. B.; Huppert, Julian L.; Sigel, Roland K. O.; Evans, Amanda C.

2013-01-01

G-quadruplexes and i-motifs are complementary examples of non-canonical nucleic acid substructure conformations. G-quadruplex thermodynamic stability has been extensively studied for a variety of base sequences, but the degree of duplex destabilization that adjacent quadruplex structure formation can cause has yet to be fully addressed. Stable in vivo formation of these alternative nucleic acid structures is likely to be highly dependent on whether sufficient spacing exists between neighbouring duplex- and quadruplex-/i-motif-forming regions to accommodate quadruplexes or i-motifs without disrupting duplex stability. Prediction of putative G-quadruplex-forming regions is likely to be assisted by further understanding of what distance (number of base pairs) is required for duplexes to remain stable as quadruplexes or i-motifs form. Using oligonucleotide constructs derived from precedented G-quadruplexes and i-motif-forming bcl-2 P1 promoter region, initial biophysical stability studies indicate that the formation of G-quadruplex and i-motif conformations do destabilize proximal duplex regions. The undermining effect that quadruplex formation can have on duplex stability is mitigated with increased distance from the duplex region: a spacing of five base pairs or more is sufficient to maintain duplex stability proximal to predicted quadruplex/i-motif-forming regions. PMID:23771141

Toward the design of new DNA G-quadruplex ligands through rational analysis of polymorphism and binding data.

Science.gov (United States)

Artese, Anna; Costa, Giosuè; Distinto, Simona; Moraca, Federica; Ortuso, Francesco; Parrotta, Lucia; Alcaro, Stefano

2013-10-01

Human telomeres play a key role in protecting chromosomal ends from fusion events; they are composed of d(TTAGGG) repeats, ranging in size from 3 to 15 kb. They form G-quadruplex DNA structures, stabilized by G-quartets in the presence of cations, and are involved in several biological processes. In particular, a telomere maintenance mechanism is provided by a specialized enzyme called telomerase, a reverse transcriptase able to add multiple copies of the 5'-GGTTAG-3' motif to the end of the G-strand of the telomere and which is over-expressed in the majority of cancer cells. The central cation has a crucial role in maintaining the stability of the structure. Based on its nature, it can be associated with different topological telomeric quadruplexes, which depend also on the orientation of the DNA strands and the syn/anti conformation of the guanines. Such a polymorphism, confirmed by the different structures deposited in the Protein Data Bank (PDB), prompted us to apply a computational protocol in order to investigate the conformational properties of a set of known G-quadruplex ligands and their molecular recognition against six different experimental models of the human telomeric sequence d[AG3(T2AG3)3]. The average AutoDock correlation between theoretical and experimental data yielded an r2 value equal to 0.882 among all the studied models. Such a result was always improved with respect to those of the single folds, with the exception of the parallel structure (r2 equal to 0.886), thus suggesting a key role of this G4 conformation in the stacking interaction network. Among the studied binders, a trisubstituted acridine and a dibenzophenanthroline derivative were well recognized by the parallel and the mixed G-quadruplex structures, allowing the identification of specific key contacts with DNA and the further design of more potent or target specific G-quadruplex ligands. Copyright © 2013 Elsevier Masson SAS. All rights reserved.

Spectroscopic studies on the interactions of 5-ethyl-6-phenyl-3,8-bis((3-aminoalkyl)propanamido)phenanthridin-5-ium derivatives with G-quadruplex DNA

Science.gov (United States)

Yalçın, Ergin; Duyar, Halil; Ihmels, Heiko; Seferoğlu, Zeynel

2018-05-01

An improved microwave-induced synthesis of five ethidium derivatives (Ethidium derivatives, 2a-d) is presented. As the derivatives 2a-d have been proposed previously to be telomerase inhibitors, the binding interactions of these ethidium derivatives with G-quadruplex DNA were evaluated by means of photometric and fluorimetric titration, thermal DNA denaturation, CD and 1H NMR spectroscopy. In particular, the compound bearing 3,8-bis(pyrrolidin-1-yl)propanamido substituent 2a exhibits high selectivity for G-quadruplex DNA relative to duplex DNA.

APTO-253 Stabilizes G-quadruplex DNA, Inhibits MYC Expression, and Induces DNA Damage in Acute Myeloid Leukemia Cells.

Science.gov (United States)

Local, Andrea; Zhang, Hongying; Benbatoul, Khalid D; Folger, Peter; Sheng, Xia; Tsai, Cheng-Yu; Howell, Stephen B; Rice, William G

2018-06-01

APTO-253 is a phase I clinical stage small molecule that selectively induces CDKN1A (p21), promotes G 0 -G 1 cell-cycle arrest, and triggers apoptosis in acute myeloid leukemia (AML) cells without producing myelosuppression in various animal species and humans. Differential gene expression analysis identified a pharmacodynamic effect on MYC expression, as well as induction of DNA repair and stress response pathways. APTO-253 was found to elicit a concentration- and time-dependent reduction in MYC mRNA expression and protein levels. Gene ontogeny and structural informatic analyses suggested a mechanism involving G-quadruplex (G4) stabilization. Intracellular pharmacokinetic studies in AML cells revealed that APTO-253 is converted intracellularly from a monomer to a ferrous complex [Fe(253) 3 ]. FRET assays demonstrated that both monomeric APTO-253 and Fe(253) 3 stabilize G4 structures from telomeres, MYC, and KIT promoters but do not bind to non-G4 double-stranded DNA. Although APTO-253 exerts a host of mechanistic sequelae, the effect of APTO-253 on MYC expression and its downstream target genes, on cell-cycle arrest, DNA damage, and stress responses can be explained by the action of Fe(253) 3 and APTO-253 on G-quadruplex DNA motifs. Mol Cancer Ther; 17(6); 1177-86. ©2018 AACR . ©2018 American Association for Cancer Research.

Ball with hair: modular functionalization of highly stable G-quadruplex DNA nano-scaffolds through N2-guanine modification.

Science.gov (United States)

Lech, Christopher Jacques; Phan, Anh Tuân

2017-06-20

Functionalized nanoparticles have seen valuable applications, particularly in the delivery of therapeutic and diagnostic agents in biological systems. However, the manufacturing of such nano-scale systems with the consistency required for biological application can be challenging, as variation in size and shape have large influences in nanoparticle behavior in vivo. We report on the development of a versatile nano-scaffold based on the modular functionalization of a DNA G-quadruplex. DNA sequences are functionalized in a modular fashion using well-established phosphoramidite chemical synthesis with nucleotides containing modification of the amino (N2) position of the guanine base. In physiological conditions, these sequences fold into well-defined G-quadruplex structures. The resulting DNA nano-scaffolds are thermally stable, consistent in size, and functionalized in a manner that allows for control over the density and relative orientation of functional chemistries on the nano-scaffold surface. Various chemistries including small modifications (N2-methyl-guanine), bulky aromatic modifications (N2-benzyl-guanine), and long chain-like modifications (N2-6-amino-hexyl-guanine) are tested and are found to be generally compatible with G-quadruplex formation. Furthermore, these modifications stabilize the G-quadruplex scaffold by 2.0-13.3 °C per modification in the melting temperature, with concurrent modifications producing extremely stable nano-scaffolds. We demonstrate the potential of this approach by functionalizing nano-scaffolds for use within the biotin-avidin conjugation approach. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.

“One Ring to Bind Them All”—Part I: The Efficiency of the Macrocyclic Scaffold for G-Quadruplex DNA Recognition

Directory of Open Access Journals (Sweden)

David Monchaud

2010-01-01

Full Text Available Macrocyclic scaffolds are particularly attractive for designing selective G-quadruplex ligands essentially because, on one hand, they show a poor affinity for the “standard” B-DNA conformation and, on the other hand, they fit nicely with the external G-quartets of quadruplexes. Stimulated by the pioneering studies on the cationic porphyrin TMPyP4 and the natural product telomestatin, follow-up studies have developed, rapidly leading to a large diversity of macrocyclic structures with remarkable-quadruplex binding properties and biological activities. In this review we summarize the current state of the art in detailing the three main categories of quadruplex-binding macrocycles described so far (telomestatin-like polyheteroarenes, porphyrins and derivatives, polyammonium cyclophanes, and in addressing both synthetic issues and biological aspects.

Heterocyclic Dications as a New Class of Telomeric G-Quadruplex Targeting Agents

Science.gov (United States)

Nanjunda, Rupesh; Musetti, Caterina; Kumar, Arvind; Ismail, Mohamed A.; Farahat, Abdelbasset A.; Wang, Siming; Sissi, Claudia; Palumbo, Manlio; Boykin, David W.; Wilson, W. David

2013-01-01

Small molecules that can induce and stabilize G-quadruplex DNA structures represent a novel approach for anti-cancer and anti-parasitic therapy and extensive efforts have been directed towards discovering lead compounds that are capable of stabilizing quadruplexes. The purpose of this study is to explore conformational modifications in a series of heterocyclic dications to discover structural motifs that can selectively bind and stabilize specific G-quadruplexes, such as those present in the human telomere. The G-quadruplex has various potential recognition sites for small molecules; however, the primary interaction site of most of these ligands is the terminal tetrads. Similar to duplex-DNA groove recognition, quadruplex groove recognition by small molecules offers the potential for enhanced selectivity that can be developed into a viable therapeutic strategy. The compounds investigated were selected based on preliminary studies with DB832, a bifuryl-phenyl diamidine with a unique telomere interaction. This compound provides a paradigm that can help in understanding the optimum compound-DNA interactions that lead to quadruplex groove recognition. DNA recognition by the DB832 derivatives was investigated by biophysical experiments such as thermal melting, circular dichroism, mass spectrometry and NMR. Biological studies were also performed to complement the biophysical data. The results suggest a complex binding mechanism which involves the recognition of grooves for some ligands as well as stacking at the terminal tetrads of the human telomeric G-quadruplex for most of the ligands. These molecules represent an excellent starting point for further SAR analysis for diverse modes of quadruplex recognition and subsequent structure optimization for drug development. PMID:22380518

c-MYC G-quadruplex binding by the RNA polymerase I inhibitor BMH-21 and analogues revealed by a combined NMR and biochemical Approach.

Science.gov (United States)

Musso, Loana; Mazzini, Stefania; Rossini, Anna; Castagnoli, Lorenzo; Scaglioni, Leonardo; Artali, Roberto; Di Nicola, Massimo; Zunino, Franco; Dallavalle, Sabrina

2018-03-01

Pyridoquinazolinecarboxamides have been reported as RNA polymerase I inhibitors and represent a novel class of potential antitumor agents. BMH-21, was reported to intercalate with GC-rich rDNA, resulting in nucleolar stress as a primary mechanism of cytotoxicity. The interaction of BMH-21 and analogues with DNA G-quadruplex structures was studied by NMR and molecular modelling. The cellular response was investigated in a panel of human tumor cell lines and protein expression was examined by Western Blot analysis. We explored the ability of BMH-21 and its analogue 2 to bind to G-quadruplex present in the c-MYC promoter, by NMR and molecular modelling studies. We provide evidence that both compounds are not typical DNA intercalators but are effective binders of the tested G-quadruplex. The interaction with c-MYC G-quadruplex was reflected in down-regulation of c-Myc expression in human tumor cells. The inhibitory effect was almost complete in lymphoma cells SUDHL4 characterized by overexpression of c-Myc protein. This downregulation reflected an early and persistent modulation of cMyc mRNA. Given the relevance of c-MYC in regulation of ribosome biogenesis, it is conceivable that the inhibition of c-MYC contributes to the perturbation of nuclear functions and RNA polymerase I activity. Similar experiments with CX-5461, another RNA polymerase I transcription inhibitor, indicate the same behaviour in G-quadruplex stabilization. Our results support the hypothesis that BMH-21 and analogue compounds share the same mechanism, i.e. G-quadruplex binding as a primary event of a cascade leading to inhibition of RNA polymerase I and apoptosis. Copyright © 2017 Elsevier B.V. All rights reserved.

Structural dynamics of thrombin-binding DNA aptamer d(GGTTGGTGTGGTTGG) quadruplex DNA studied by large-scale explicit solvent simulations

Czech Academy of Sciences Publication Activity Database

Reshetnikov, R.; Golovin, A.; Spiridonova, V.; Kopylov, A.; Šponer, Jiří

2010-01-01

Roč. 6, č. 10 (2010), s. 3003-3014 ISSN 1549-9618 R&D Projects: GA AV ČR(CZ) IAA400040802; GA ČR(CZ) GA203/09/1476; GA MŠk(CZ) LC06030 Institutional research plan: CEZ:AV0Z50040507; CEZ:AV0Z50040702 Keywords : molecular dynamics * quadruplex DNA * thrombin Subject RIV: BO - Biophysics Impact factor: 5.138, year: 2010

G-quadruplex DNA sequences are evolutionarily conserved and associated with distinct genomic features in Saccharomyces cerevisiae.

Directory of Open Access Journals (Sweden)

John A Capra

2010-07-01

Full Text Available G-quadruplex DNA is a four-stranded DNA structure formed by non-Watson-Crick base pairing between stacked sets of four guanines. Many possible functions have been proposed for this structure, but its in vivo role in the cell is still largely unresolved. We carried out a genome-wide survey of the evolutionary conservation of regions with the potential to form G-quadruplex DNA structures (G4 DNA motifs across seven yeast species. We found that G4 DNA motifs were significantly more conserved than expected by chance, and the nucleotide-level conservation patterns suggested that the motif conservation was the result of the formation of G4 DNA structures. We characterized the association of conserved and non-conserved G4 DNA motifs in Saccharomyces cerevisiae with more than 40 known genome features and gene classes. Our comprehensive, integrated evolutionary and functional analysis confirmed the previously observed associations of G4 DNA motifs with promoter regions and the rDNA, and it identified several previously unrecognized associations of G4 DNA motifs with genomic features, such as mitotic and meiotic double-strand break sites (DSBs. Conserved G4 DNA motifs maintained strong associations with promoters and the rDNA, but not with DSBs. We also performed the first analysis of G4 DNA motifs in the mitochondria, and surprisingly found a tenfold higher concentration of the motifs in the AT-rich yeast mitochondrial DNA than in nuclear DNA. The evolutionary conservation of the G4 DNA motif and its association with specific genome features supports the hypothesis that G4 DNA has in vivo functions that are under evolutionary constraint.

Thermodynamic fingerprints of ligand binding to human telomeric G-quadruplexes

OpenAIRE

Bon?ina, Matja?; Podlipnik, ?rtomir; Piantanida, Ivo; Eilmes, Julita; Teulade-Fichou, Marie-Paule; Vesnaver, Gorazd; Lah, Jurij

2015-01-01

Thermodynamic studies of ligand binding to human telomere (ht) DNA quadruplexes, as a rule, neglect the involvement of various ht-DNA conformations in the binding process. Therefore, the thermodynamic driving forces and the mechanisms of ht-DNA G-quadruplex-ligand recognition remain poorly understood. In this work we characterize thermodynamically and structurally binding of netropsin (Net), dibenzotetraaza[14]annulene derivatives (DP77, DP78), cationic porphyrin (TMPyP4) and two bisquinolini...

A new cationic porphyrin derivative (TMPipEOPP with large side arm substituents: a highly selective G-quadruplex optical probe.

Directory of Open Access Journals (Sweden)

Li-Na Zhu

Full Text Available The discovery of uncommon DNA structures and speculation about their potential functions in genes has brought attention to specific DNA structure recognition. G-quadruplexes are four-stranded nucleic acid structures formed by G-rich DNA (or RNA sequences. G-rich sequences with a high potential to form G-quadruplexes have been found in many important genomic regions. Porphyrin derivatives with cationic side arm substituents are important G-quadruplex-binding ligands. For example, 5,10,15,20-Tetrakis(N-methylpyridinium-4-yl-21H,23H-porphyrin (TMPyP4, interacts strongly with G-quadruplexes, but has poor selectivity for G-quadruplex versus duplex DNA. To increase the G-quadruplex recognition specificity, a new cationic porphyrin derivative, 5,10,15,20-tetra-{4-[2-(1-methyl-1-piperidinylethoxy]phenyl} porphyrin (TMPipEOPP, with large side arm substituents was synthesized, and the interactions between TMPipEOPP and different DNA structures were compared. The results show that G-quadruplexes cause large changes in the UV-Vis absorption and fluorescence spectra of TMPipEOPP, but duplex and single-stranded DNAs do not, indicating that TMPipEOPP can be developed as a highly specific optical probe for discriminating G-quadruplex from duplex and single-stranded DNA. Visual discrimination is also possible. Job plot and Scatchard analysis suggest that a complicated binding interaction occurs between TMPipEOPP and G-quadruplexes. At a low [G-quadruplex]/[TMPipEOPP] ratio, one G-quadruplex binds two TMPipEOPP molecules by end-stacking and outside binding modes. At a high [G-quadruplex]/[TMPipEOPP] ratio, two G-quadruplexes bind to one TMPipEOPP molecule in a sandwich-like end-stacking mode.

A new cationic porphyrin derivative (TMPipEOPP) with large side arm substituents: a highly selective G-quadruplex optical probe.

Science.gov (United States)

Zhu, Li-Na; Zhao, Shu-Juan; Wu, Bin; Li, Xiao-Zeng; Kong, De-Ming

2012-01-01

The discovery of uncommon DNA structures and speculation about their potential functions in genes has brought attention to specific DNA structure recognition. G-quadruplexes are four-stranded nucleic acid structures formed by G-rich DNA (or RNA) sequences. G-rich sequences with a high potential to form G-quadruplexes have been found in many important genomic regions. Porphyrin derivatives with cationic side arm substituents are important G-quadruplex-binding ligands. For example, 5,10,15,20-Tetrakis(N-methylpyridinium-4-yl)-21H,23H-porphyrin (TMPyP4), interacts strongly with G-quadruplexes, but has poor selectivity for G-quadruplex versus duplex DNA. To increase the G-quadruplex recognition specificity, a new cationic porphyrin derivative, 5,10,15,20-tetra-{4-[2-(1-methyl-1-piperidinyl)ethoxy]phenyl} porphyrin (TMPipEOPP), with large side arm substituents was synthesized, and the interactions between TMPipEOPP and different DNA structures were compared. The results show that G-quadruplexes cause large changes in the UV-Vis absorption and fluorescence spectra of TMPipEOPP, but duplex and single-stranded DNAs do not, indicating that TMPipEOPP can be developed as a highly specific optical probe for discriminating G-quadruplex from duplex and single-stranded DNA. Visual discrimination is also possible. Job plot and Scatchard analysis suggest that a complicated binding interaction occurs between TMPipEOPP and G-quadruplexes. At a low [G-quadruplex]/[TMPipEOPP] ratio, one G-quadruplex binds two TMPipEOPP molecules by end-stacking and outside binding modes. At a high [G-quadruplex]/[TMPipEOPP] ratio, two G-quadruplexes bind to one TMPipEOPP molecule in a sandwich-like end-stacking mode.

Seven essential questions on G-quadruplexes.

Science.gov (United States)

König, Sebastian L B; Evans, Amanda C; Huppert, Julian L

2010-08-01

The helical duplex architecture of DNA was discovered by Francis Crick and James Watson in 1951 and is well known and understood. However, nucleic acids can also adopt alternative structural conformations that are less familiar, although no less biologically relevant, such as the G-quadruplex. G-quadruplexes continue to be the subject of a rapidly expanding area of research, owing to their significant potential as therapeutic targets and their unique biophysical properties. This review begins by focusing on G-quadruplex structure, elucidating the intermolecular and intramolecular interactions underlying its formation and highlighting several substructural variants. A variety of methods used to characterize these structures are also outlined. The current state of G-quadruplex research is then addressed by proffering seven pertinent questions for discussion. This review concludes with an overview of possible directions for future research trajectories in this exciting and relevant field.

Enantioselective light switch effect of Δ- and Λ-[Ru(phenanthroline)2 dipyrido[3,2-a:2', 3'-c]phenazine]2+ bound to G-quadruplex DNA.

Science.gov (United States)

Park, Jin Ha; Lee, Hyun Suk; Jang, Myung Duk; Han, Sung Wook; Kim, Seog K; Lee, Young-Ae

2018-06-01

The interaction of Δ- and Λ-[Ru(phen) 2 DPPZ] 2+ (DPPZ = dipyrido[3,2-a:2', 3'-c]phenazine, phen = phenanthroline) with a G-quadruplex formed from 5'-G 2 T 2 G 2 TGTG 2 T 2 G 2-3 '(15-mer) was investigated. The well-known enhancement of luminescence intensity (the 'light-switch' effect) was observed for the [Ru(phen) 2 DPPZ] 2+ complexes upon formation of an adduct with the G-quadruplex. The emission intensity of the G-quadruplex-bound Λ-isomer was 3-fold larger than that of the Δ-isomer when bound to the G-quadruplex, which is opposite of the result observed in the case of double stranded DNA (dsDNA); the light switch effect is larger for the dsDNA-bound Δ-isomer. In the job plot of the G-quadruplex with Δ- and Λ-[Ru(phen) 2 DPPZ] 2+ , a major inflection point for the two isomers was observed at x ≈ .65, which suggests a binding stoichiometry of 2:1 for both enantiomers. When the G base at the 8th position was replaced with 6-methyl isoxanthopterin (6MI), a fluorescent guanine analog, the excited energy of 6-MI transferred to bound Δ- or Λ-[Ru(phen) 2 DPPZ] 2+ , which suggests that at least a part of both Ru(II) enantiomers is close to or in contact with the diagonal loop of the G-quadruplex. A luminescence quenching experiment using [Fe(CN) 6 ] 4- for the G-quadruplex-bound Ru(II) complex revealed downward bending curves for both enantiomers in the Stern-Volmer plot, which suggests the presence of Ru(II) complexes that are both accessible and inaccessible to the quencher and may be related to the 2:1 binding stoichiometry.

G-Quadruplex DNAzyme Molecular Beacon for Amplified Colorimetric Biosensing of Pseudostellaria heterophylla

Directory of Open Access Journals (Sweden)

Juan Hu

2013-01-01

Full Text Available With an internal transcribed spacer of 18 S, 5.8 S and 26 S nuclear ribosomal DNA (nrDNA ITS as DNA marker, we report a colorimetric approach for authentication of Pseudostellaria heterophylla (PH and its counterfeit species based on the differentiation of the nrDNA ITS sequence. The assay possesses an unlabelled G-quadruplex DNAzyme molecular beacon (MB probe, employing complementary sequence as biorecognition element and 1:1:1:1 split G-quadruplex halves as reporter. In the absence of target DNA (T-DNA, the probe can shape intermolecular G-quadruplex structures capable of binding hemin to form G-quadruplex-hemin DNAzyme and catalyze the oxidation of ABTS2− to blue-green ABTS•− by H2O2. In the presence of T-DNA, T-DNA can hybridize with the complementary sequence to form a duplex structure, hindering the formation of the G-quadruplex structure and resulting in the loss of the catalytic activity. Consequently, a UV-Vis absorption signal decrease is observed in the ABTS2−-H2O2 system. The “turn-off” assay allows the detection of T-DNA from 1.0 × 10−9 to 3.0 × 10−7 mol·L−1 (R2 = 0.9906, with a low detection limit of 3.1 × 10−10 mol·L−1. The present study provides a sensitive and selective method and may serve as a foundation of utilizing the DNAzyme MB sensor for identifying traditional Chinese medicines.

Interaction of pyrrolobenzodiazepine (PBD ligands with parallel intermolecular G-quadruplex complex using spectroscopy and ESI-MS.

Directory of Open Access Journals (Sweden)

Gajjela Raju

Full Text Available Studies on ligand interaction with quadruplex DNA, and their role in stabilizing the complex at concentration prevailing under physiological condition, has attained high interest. Electrospray ionization mass spectrometry (ESI-MS and spectroscopic studies in solution were used to evaluate the interaction of PBD and TMPyP4 ligands, stoichiometry and selectivity to G-quadruplex DNA. Two synthetic ligands from PBD family, namely pyrene-linked pyrrolo[2,1-c][1,4]benzodiazepine hybrid (PBD1, mixed imine-amide pyrrolobenzodiazepine dimer (PBD2 and 5,10,15,20-tetrakis(N-methyl-4-pyridylporphyrin (TMPyP4 were studied. G-rich single-stranded oligonucleotide d(5'GGGGTTGGGG3' designated as d(T(2G(8, from the telomeric region of Tetrahymena Glaucoma, was considered for the interaction with ligands. ESI-MS and spectroscopic methods viz., circular dichroism (CD, UV-Visible, and fluorescence were employed to investigate the G-quadruplex structures formed by d(T(2G(8 sequence and its interaction with PBD and TMPyP4 ligands. From ESI-MS spectra, it is evident that the majority of quadruplexes exist as d(T(2G(8(2 and d(T(2G(8(4 forms possessing two to ten cations in the centre, thereby stabilizing the complex. CD band of PBD1 and PBD2 showed hypo and hyperchromicity, on interaction with quadruplex DNA, indicating unfolding and stabilization of quadruplex DNA complex, respectively. UV-Visible and fluorescence experiments suggest that PBD1 bind externally where as PBD2 intercalate moderately and bind externally to G-quadruplex DNA. Further, melting experiments using SYBR Green indicate that PBD1 unfolds and PBD2 stabilizes the G-quadruplex complex. ITC experiments using d(T(2G(8 quadruplex with PBD ligands reveal that PBD1 and PBD2 prefer external/loop binding and external/intercalative binding to quadruplex DNA, respectively. From experimental results it is clear that the interaction of PBD2 and TMPyP4 impart higher stability to the quadruplex complex.

Interaction of Pyrrolobenzodiazepine (PBD) Ligands with Parallel Intermolecular G-Quadruplex Complex Using Spectroscopy and ESI-MS

Science.gov (United States)

Raju, Gajjela; Srinivas, Ragampeta; Santhosh Reddy, Vangala; Idris, Mohammed M.; Kamal, Ahmed; Nagesh, Narayana

2012-01-01

Studies on ligand interaction with quadruplex DNA, and their role in stabilizing the complex at concentration prevailing under physiological condition, has attained high interest. Electrospray ionization mass spectrometry (ESI-MS) and spectroscopic studies in solution were used to evaluate the interaction of PBD and TMPyP4 ligands, stoichiometry and selectivity to G-quadruplex DNA. Two synthetic ligands from PBD family, namely pyrene-linked pyrrolo[2,1-c][1,4]benzodiazepine hybrid (PBD1), mixed imine-amide pyrrolobenzodiazepine dimer (PBD2) and 5,10,15,20-tetrakis(N-methyl-4-pyridyl)porphyrin (TMPyP4) were studied. G-rich single-stranded oligonucleotide d(5′GGGGTTGGGG3′) designated as d(T2G8), from the telomeric region of Tetrahymena Glaucoma, was considered for the interaction with ligands. ESI-MS and spectroscopic methods viz., circular dichroism (CD), UV-Visible, and fluorescence were employed to investigate the G-quadruplex structures formed by d(T2G8) sequence and its interaction with PBD and TMPyP4 ligands. From ESI-MS spectra, it is evident that the majority of quadruplexes exist as d(T2G8)2 and d(T2G8)4 forms possessing two to ten cations in the centre, thereby stabilizing the complex. CD band of PBD1 and PBD2 showed hypo and hyperchromicity, on interaction with quadruplex DNA, indicating unfolding and stabilization of quadruplex DNA complex, respectively. UV-Visible and fluorescence experiments suggest that PBD1 bind externally where as PBD2 intercalate moderately and bind externally to G-quadruplex DNA. Further, melting experiments using SYBR Green indicate that PBD1 unfolds and PBD2 stabilizes the G-quadruplex complex. ITC experiments using d(T2G8) quadruplex with PBD ligands reveal that PBD1 and PBD2 prefer external/loop binding and external/intercalative binding to quadruplex DNA, respectively. From experimental results it is clear that the interaction of PBD2 and TMPyP4 impart higher stability to the quadruplex complex. PMID:22558271

Escherichia coli DNA polymerase I can disrupt G-quadruplex structures during DNA replication.

Science.gov (United States)

Teng, Fang-Yuan; Hou, Xi-Miao; Fan, San-Hong; Rety, Stephane; Dou, Shuo-Xing; Xi, Xu-Guang

2017-12-01

Non-canonical four-stranded G-quadruplex (G4) DNA structures can form in G-rich sequences that are widely distributed throughout the genome. The presence of G4 structures can impair DNA replication by hindering the progress of replicative polymerases (Pols), and failure to resolve these structures can lead to genetic instability. In the present study, we combined different approaches to address the question of whether and how Escherichia coli Pol I resolves G4 obstacles during DNA replication and/or repair. We found that E. coli Pol I-catalyzed DNA synthesis could be arrested by G4 structures at low protein concentrations and the degree of inhibition was strongly dependent on the stability of the G4 structures. Interestingly, at high protein concentrations, E. coli Pol I was able to overcome some kinds of G4 obstacles without the involvement of other molecules and could achieve complete replication of G4 DNA. Mechanistic studies suggested that multiple Pol I proteins might be implicated in G4 unfolding, and the disruption of G4 structures requires energy derived from dNTP hydrolysis. The present work not only reveals an unrealized function of E. coli Pol I, but also presents a possible mechanism by which G4 structures can be resolved during DNA replication and/or repair in E. coli. © 2017 Federation of European Biochemical Societies.

Extended molecular dynamics of a c-kit promoter quadruplex

Czech Academy of Sciences Publication Activity Database

Islam, B.; Stadlbauer, Petr; Krepl, Miroslav; Koča, J.; Neidle, S.; Haider, S.; Šponer, Jiří

2015-01-01

Roč. 43, č. 18 (2015), s. 8673-8693 ISSN 0305-1048 R&D Projects: GA ČR(CZ) GAP208/11/1822 Institutional support: RVO:68081707 Keywords : TELOMERIC G-QUADRUPLEX * INTRAMOLECULAR DNA QUADRUPLEXES * GASTROINTESTINAL STROMAL TUMOR Subject RIV: BO - Biophysics Impact factor: 9.202, year: 2015

Mms1 is an assistant for regulating G-quadruplex DNA structures.

Science.gov (United States)

Schwindt, Eike; Paeschke, Katrin

2017-11-02

The preservation of genome stability is fundamental for every cell. Genomic integrity is constantly challenged. Among those challenges are also non-canonical nucleic acid structures. In recent years, scientists became aware of the impact of G-quadruplex (G4) structures on genome stability. It has been shown that folded G4-DNA structures cause changes in the cell, such as transcriptional up/down-regulation, replication stalling, or enhanced genome instability. Multiple helicases have been identified to regulate G4 structures and by this preserve genome stability. Interestingly, although these helicases are mostly ubiquitous expressed, they show specificity for G4 regulation in certain cellular processes (e.g., DNA replication). To this date, it is not clear how this process and target specificity of helicases are achieved. Recently, Mms1, an ubiquitin ligase complex protein, was identified as a novel G4-DNA-binding protein that supports genome stability by aiding Pif1 helicase binding to these regions. In this perspective review, we discuss the question if G4-DNA interacting proteins are fundamental for helicase function and specificity at G4-DNA structures.

Studies of G-quadruplex DNA structures at the single molecule level

DEFF Research Database (Denmark)

Kragh, Sofie Louise

2015-01-01

Folding of G-quaduplex structures adopted by the human telomeric repeat is here studied by single molecule FRET microscopy. This method allows for the investigation of G-quadruplex structures and their conformational dynamic. Telomeres are located at the ends of our chromosomes and end in a single...... with human telomeric repeat adopt several different G-quadruplex conformations in the presence of K+ ions. G-quadruplexes inhibit telomerase activity and are therefore potential targets for anti-cancer drugs, which can be small molecule ligands capable of stabilizing G-quadruplex structures. Understanding...... range. FRET spectroscopy can be performed on an ensemble of molecules, or on the single molecule level. In single molecule FRET experiments it is possible to follow the behaviour in time for each molecule independently, allowing insight into both dynamically and statistically heterogeneous molecular...

Sugar-modified G-quadruplexes: effects of LNA-, 2′F-RNA– and 2′F-ANA-guanosine chemistries on G-quadruplex structure and stability

Science.gov (United States)

Li, Zhe; Lech, Christopher Jacques; Phan, Anh Tuân

2014-01-01

G-quadruplex-forming oligonucleotides containing modified nucleotide chemistries have demonstrated promising pharmaceutical potential. In this work, we systematically investigate the effects of sugar-modified guanosines on the structure and stability of a (4+0) parallel and a (3+1) hybrid G-quadruplex using over 60 modified sequences containing a single-position substitution of 2′-O-4′-C-methylene-guanosine (LNAG), 2′-deoxy-2′-fluoro-riboguanosine (FG) or 2′-deoxy-2′-fluoro-arabinoguanosine (FANAG). Our results are summarized in two parts: (I) Generally, LNAG substitutions into ‘anti’ position guanines within a guanine-tetrad lead to a more stable G-quadruplex, while substitutions into ‘syn’ positions disrupt the native G-quadruplex conformation. However, some interesting exceptions to this trend are observed. We discover that a LNAG modification upstream of a short propeller loop hinders G-quadruplex formation. (II) A single substitution of either FG or FANAG into a ‘syn’ position is powerful enough to perturb the (3+1) G-quadruplex. Substitution of either FG or FANAG into any ‘anti’ position is well tolerated in the two G-quadruplex scaffolds. FANAG substitutions to ‘anti’ positions are better tolerated than their FG counterparts. In both scaffolds, FANAG substitutions to the central tetrad layer are observed to be the most stabilizing. The observations reported herein on the effects of LNAG, FG and FANAG modifications on G-quadruplex structure and stability will enable the future design of pharmaceutically relevant oligonucleotides. PMID:24371274

Transcriptional control by G-quadruplexes: In vivo roles and perspectives for specific intervention.

Science.gov (United States)

Armas, Pablo; David, Aldana; Calcaterra, Nora B

2017-01-01

G-quadruplexes are non-canonical DNA secondary structures involved in several genomic and molecular processes. Here, we summarize the main G-quadruplex features and evidences proving the in vivo role on the transcriptional regulation of genes required for zebrafish embryonic development. We also discuss alternative strategies for specifically interfering G-quadruplex in vivo.

Cation binding to 15-TBA quadruplex DNA is a multiple-pathway cation-dependent process

Czech Academy of Sciences Publication Activity Database

Reshetnikov, R.V.; Šponer, Jiří; Rassokhina, O.I.; Kopylov, A.M.; Tsvetkov, P.O.; Makarov, A.A.; Golovin, A.V.

2011-01-01

Roč. 39, č. 22 (2011), s. 9789-9802 ISSN 0305-1048 R&D Projects: GA AV ČR(CZ) IAA400040802; GA ČR(CZ) GA203/09/1476; GA ČR(CZ) GAP208/11/1822; GA MŠk(CZ) LC06030 Institutional research plan: CEZ:AV0Z50040507; CEZ:AV0Z50040702 Keywords : QM/MM * quadruplex DNA * molecular dynamics simulation Subject RIV: BO - Biophysics Impact factor: 8.026, year: 2011

Fluorescent Dansyl-Guanosine Conjugates that Bind c-MYC Promoter G-Quadruplex and Downregulate c-MYC Expression.

Science.gov (United States)

Pavan Kumar, Y; Saha, Puja; Saha, Dhurjhoti; Bessi, Irene; Schwalbe, Harald; Chowdhury, Shantanu; Dash, Jyotirmayee

2016-03-02

The four-stranded G-quadruplex present in the c-MYC P1 promoter has been shown to play a pivotal role in the regulation of c-MYC transcription. Small-molecule compounds capable of inhibiting the c-MYC promoter activity by stabilising the c-MYC G-quadruplex could potentially be used as anticancer agents. In this context, here we report the synthesis of dansyl-guanosine conjugates through one-pot modular click reactions. The dansyl-guanosine conjugates can selectively detect c-MYC G-quadruplex over other biologically relevant quadruplexes and duplex DNA and can be useful as staining reagents for selective visualisation of c-MYC G-quadruplex over duplex DNA by gel electrophoresis. NMR spectroscopic titrations revealed the preferential binding sites of these dansyl ligands to the c-MYC G-quadruplex. A dual luciferase assay and qRT-PCR revealed that a dansyl-bisguanosine ligand represses the c-MYC expression, possibly by stabilising the c-MYC G-quadruplex. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Guanine base stacking in G-quadruplex nucleic acids

Science.gov (United States)

Lech, Christopher Jacques; Heddi, Brahim; Phan, Anh Tuân

2013-01-01

G-quadruplexes constitute a class of nucleic acid structures defined by stacked guanine tetrads (or G-tetrads) with guanine bases from neighboring tetrads stacking with one another within the G-tetrad core. Individual G-quadruplexes can also stack with one another at their G-tetrad interface leading to higher-order structures as observed in telomeric repeat-containing DNA and RNA. In this study, we investigate how guanine base stacking influences the stability of G-quadruplexes and their stacked higher-order structures. A structural survey of the Protein Data Bank is conducted to characterize experimentally observed guanine base stacking geometries within the core of G-quadruplexes and at the interface between stacked G-quadruplex structures. We couple this survey with a systematic computational examination of stacked G-tetrad energy landscapes using quantum mechanical computations. Energy calculations of stacked G-tetrads reveal large energy differences of up to 12 kcal/mol between experimentally observed geometries at the interface of stacked G-quadruplexes. Energy landscapes are also computed using an AMBER molecular mechanics description of stacking energy and are shown to agree quite well with quantum mechanical calculated landscapes. Molecular dynamics simulations provide a structural explanation for the experimentally observed preference of parallel G-quadruplexes to stack in a 5′–5′ manner based on different accessible tetrad stacking modes at the stacking interfaces of 5′–5′ and 3′–3′ stacked G-quadruplexes. PMID:23268444

DNA adducts of antitumor cisplatin preclude telomeric sequences from forming G quadruplexes

Czech Academy of Sciences Publication Activity Database

Heringová, Pavla; Kašpárková, Jana; Brabec, Viktor

2009-01-01

Roč. 14, č. 6 (2009), s. 959-968 ISSN 0949-8257 R&D Projects: GA MZd(CZ) NR8562; GA MŠk(CZ) LC06030; GA MŠk(CZ) ME08017; GA MŠk(CZ) OC08003; GA AV ČR(CZ) 1QS500040581; GA AV ČR(CZ) KAN200200651; GA AV ČR(CZ) IAA400040803 Grant - others:GA MŠk(CZ) OC09018 Institutional research plan: CEZ:AV0Z50040507; CEZ:AV0Z50040702 Keywords : cisplatin * DNA quadruplex * telomere Subject RIV: BO - Biophysics Impact factor: 3.415, year: 2009

Determinants for Tight and Selective Binding of a Medicinal Dicarbene Gold(I) Complex to a Telomeric DNA G-Quadruplex: a Joint ESI MS and XRD Investigation.

Science.gov (United States)

Bazzicalupi, Carla; Ferraroni, Marta; Papi, Francesco; Massai, Lara; Bertrand, Benoît; Messori, Luigi; Gratteri, Paola; Casini, Angela

2016-03-18

The dicarbene gold(I) complex [Au(9-methylcaffein-8-ylidene)2 ]BF4 is an exceptional organometallic compound of profound interest as a prospective anticancer agent. This gold(I) complex was previously reported to be highly cytotoxic toward various cancer cell lines in vitro and behaves as a selective G-quadruplex stabilizer. Interactions of the gold complex with various telomeric DNA models have been analyzed by a combined ESI MS and X-ray diffraction (XRD) approach. ESI MS measurements confirmed formation of stable adducts between the intact gold(I) complex and Tel 23 DNA sequence. The crystal structure of the adduct formed between [Au(9-methylcaffein-8-ylidene)2 ](+) and Tel 23 DNA G-quadruplex was solved. Tel 23 maintains a characteristic propeller conformation while binding three gold(I) dicarbene moieties at two distinct sites. Stacking interactions appear to drive noncovalent binding of the gold(I) complex. The structural basis for tight gold(I) complex/G-quadruplex recognition and its selectivity are described. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Targeting G-quadruplex DNA Structures by EMICORON has a strong antitumor efficacy against advanced models of human colon cancer

DEFF Research Database (Denmark)

Porru, Manuela; Artuso, Simona; Salvati, Erica

2015-01-01

We previously identified EMICORON as a novel G-quadruplex (G4) ligand showing high selectivity for G4 structures over the duplex DNA, causing telomere damage and inhibition of cell proliferation in transformed and tumor cells. Here, we evaluated the antitumoral effect of EMICORON on advanced mode...

Allelic Dropout During Polymerase Chain Reaction due to G-Quadruplex Structures and DNA Methylation Is Widespread at Imprinted Human Loci

Directory of Open Access Journals (Sweden)

Aaron J. Stevens

2017-03-01

Full Text Available Loss of one allele during polymerase chain reaction (PCR amplification of DNA, known as allelic dropout, can be caused by a variety of mechanisms. Allelic dropout during PCR may have profound implications for molecular diagnostic and research procedures that depend on PCR and assume biallelic amplification has occurred. Complete allelic dropout due to the combined effects of cytosine methylation and G-quadruplex formation was previously described for a differentially methylated region of the human imprinted gene, MEST. We now demonstrate that this parent-of-origin specific allelic dropout can potentially occur at several other genomic regions that display genomic imprinting and have propensity for G-quadruplex formation, including AIM1, BLCAP, DNMT1, PLAGL1, KCNQ1, and GRB10. These findings demonstrate that systematic allelic dropout during PCR is a general phenomenon for regions of the genome where differential allelic methylation and G-quadruplex motifs coincide, and suggest that great care must be taken to ensure biallelic amplification is occurring in such situations.

Quantification of Chemical and Mechanical Effects on the Formation of the G-Quadruplex and i-Motif in Duplex DNA.

Science.gov (United States)

Selvam, Sangeetha; Mandal, Shankar; Mao, Hanbin

2017-09-05

The formation of biologically significant tetraplex DNA species, such as G-quadruplexes and i-motifs, is affected by chemical (ions and pH) and mechanical [superhelicity (σ) and molecular crowding] factors. Because of the extremely challenging experimental conditions, the relative importance of these factors on tetraplex folding is unknown. In this work, we quantitatively evaluated the chemical and mechanical effects on the population dynamics of DNA tetraplexes in the insulin-linked polymorphic region using magneto-optical tweezers. By mechanically unfolding individual tetraplexes, we found that ions and pH have the largest effects on the formation of the G-quadruplex and i-motif, respectively. Interestingly, superhelicity has the second largest effect followed by molecular crowding conditions. While chemical effects are specific to tetraplex species, mechanical factors have generic influences. The predominant effect of chemical factors can be attributed to the fact that they directly change the stability of a specific tetraplex, whereas the mechanical factors, superhelicity in particular, reduce the stability of the competing species by changing the kinetics of the melting and annealing of the duplex DNA template in a nonspecific manner. The substantial dependence of tetraplexes on superhelicity provides strong support that DNA tetraplexes can serve as topological sensors to modulate fundamental cellular processes such as transcription.

Structural Insights into the Quadruplex-Duplex 3' Interface Formed from a Telomeric Repeat: A Potential Molecular Target.

Science.gov (United States)

Russo Krauss, Irene; Ramaswamy, Sneha; Neidle, Stephen; Haider, Shozeb; Parkinson, Gary N

2016-02-03

We report here on an X-ray crystallographic and molecular modeling investigation into the complex 3' interface formed between putative parallel stranded G-quadruplexes and a duplex DNA sequence constructed from the human telomeric repeat sequence TTAGGG. Our crystallographic approach provides a detailed snapshot of a telomeric 3' quadruplex-duplex junction: a junction that appears to have the potential to form a unique molecular target for small molecule binding and interference with telomere-related functions. This unique target is particularly relevant as current high-affinity compounds that bind putative G-quadruplex forming sequences only rarely have a high degree of selectivity for a particular quadruplex. Here DNA junctions were assembled using different putative quadruplex-forming scaffolds linked at the 3' end to a telomeric duplex sequence and annealed to a complementary strand. We successfully generated a series of G-quadruplex-duplex containing crystals, both alone and in the presence of ligands. The structures demonstrate the formation of a parallel folded G-quadruplex and a B-form duplex DNA stacked coaxially. Most strikingly, structural data reveals the consistent formation of a TAT triad platform between the two motifs. This triad allows for a continuous stack of bases to link the quadruplex motif with the duplex region. For these crystal structures formed in the absence of ligands, the TAT triad interface occludes ligand binding at the 3' quadruplex-duplex interface, in agreement with in silico docking predictions. However, with the rearrangement of a single nucleotide, a stable pocket can be produced, thus providing an opportunity for the binding of selective molecules at the interface.

Mechanism and manipulation of DNA:RNA hybrid G-quadruplex formation in transcription of G-rich DNA.

Science.gov (United States)

Zhang, Jia-yu; Zheng, Ke-wei; Xiao, Shan; Hao, Yu-hua; Tan, Zheng

2014-01-29

We recently reported that a DNA:RNA hybrid G-quadruplex (HQ) forms during transcription of DNA that bears two or more tandem guanine tracts (G-tract) on the nontemplate strand. Putative HQ-forming sequences are enriched in the nearby 1000 nt region right downstream of transcription start sites in the nontemplate strand of warm-blooded animals, and HQ regulates transcription under both in vitro and in vivo conditions. Therefore, knowledge of the mechanism of HQ formation is important for understanding the biological function of HQ as well as for manipulating gene expression by targeting HQ. In this work, we studied the mechanism of HQ formation using an in vitro T7 transcription model. We show that RNA synthesis initially produces an R-loop, a DNA:RNA heteroduplex formed by a nascent RNA transcript and the template DNA strand. In the following round of transcription, the RNA in the R-loop is displaced, releasing the RNA in single-stranded form (ssRNA). Then the G-tracts in the RNA can jointly form HQ with those in the nontemplate DNA strand. We demonstrate that the structural cascade R-loop → ssRNA → HQ offers opportunities to intercept HQ formation, which may provide a potential method to manipulate gene expression.

G-quadruplexes Significantly Stimulate Pif1 Helicase-catalyzed Duplex DNA Unwinding*

Science.gov (United States)

Duan, Xiao-Lei; Liu, Na-Nv; Yang, Yan-Tao; Li, Hai-Hong; Li, Ming; Dou, Shuo-Xing; Xi, Xu-Guang

2015-01-01

The evolutionarily conserved G-quadruplexes (G4s) are faithfully inherited and serve a variety of cellular functions such as telomere maintenance, gene regulation, DNA replication initiation, and epigenetic regulation. Different from the Watson-Crick base-pairing found in duplex DNA, G4s are formed via Hoogsteen base pairing and are very stable and compact DNA structures. Failure of untangling them in the cell impedes DNA-based transactions and leads to genome instability. Cells have evolved highly specific helicases to resolve G4 structures. We used a recombinant nuclear form of Saccharomyces cerevisiae Pif1 to characterize Pif1-mediated DNA unwinding with a substrate mimicking an ongoing lagging strand synthesis stalled by G4s, which resembles a replication origin and a G4-structured flap in Okazaki fragment maturation. We find that the presence of G4 may greatly stimulate the Pif1 helicase to unwind duplex DNA. Further studies reveal that this stimulation results from G4-enhanced Pif1 dimerization, which is required for duplex DNA unwinding. This finding provides new insights into the properties and functions of G4s. We discuss the observed activation phenomenon in relation to the possible regulatory role of G4s in the rapid rescue of the stalled lagging strand synthesis by helping the replicator recognize and activate the replication origin as well as by quickly removing the G4-structured flap during Okazaki fragment maturation. PMID:25627683

G-quadruplexes as novel cis-elements controlling transcription during embryonic development.

Science.gov (United States)

David, Aldana P; Margarit, Ezequiel; Domizi, Pablo; Banchio, Claudia; Armas, Pablo; Calcaterra, Nora B

2016-05-19

G-quadruplexes are dynamic structures folded in G-rich single-stranded DNA regions. These structures have been recognized as a potential nucleic acid based mechanism for regulating multiple cellular processes such as replication, transcription and genomic maintenance. So far, their transcriptional role in vivo during vertebrate embryonic development has not yet been addressed. Here, we performed an in silico search to find conserved putative G-quadruplex sequences (PQSs) within proximal promoter regions of human, mouse and zebrafish developmental genes. Among the PQSs able to fold in vitro as G-quadruplex, those present in nog3, col2a1 and fzd5 promoters were selected for further studies. In cellulo studies revealed that the selected G-quadruplexes affected the transcription of luciferase controlled by the SV40 nonrelated promoter. G-quadruplex disruption in vivo by microinjection in zebrafish embryos of either small ligands or DNA oligonucleotides complementary to the selected PQSs resulted in lower transcription of the targeted genes. Moreover, zebrafish embryos and larvae phenotypes caused by the presence of complementary oligonucleotides fully resembled those ones reported for nog3, col2a1 and fzd5 morphants. To our knowledge, this is the first work revealing in vivo the role of conserved G-quadruplexes in the embryonic development, one of the most regulated processes of the vertebrates biology. © The Author(s) 2016. Published by Oxford University Press on behalf of Nucleic Acids Research.

Utilization of circular dichroism and electrospray ionization mass spectrometry to understand the formation and conversion of G-quadruplex DNA at the human c-myb proto-oncogene.

Science.gov (United States)

Fu, Hengqing; Yang, Pengfei; Hai, Jinhui; Li, Huihui

2018-10-05

G-quadruplex DNAs are involved in a number of key biological processes, including gene expression, transcription, and apoptosis. The c-myb oncogene contains a number of GGA repeats in its promoter which forms G-quadruplex, thus it could be used as a target in cancer therapeutics. Several in-vitro studies have used Circular Dichroism (CD) spectroscopy or electrospray ionization mass spectrometry (ESI-MS) to demonstrate formation and stability of G-quadruplex DNA structure in the promoter region of human c-myb oncogene. The factors affecting the c-myb G-quadruplex structures were investigated, such as cations (i.e. K + , NH 4 + and Na + ) and co-solutes (methanol and polyethylene glycol). The results indicated that the presence of cations and co-solutes could change the G-quadruplex structural population and promote its thermodynamic stabilization as indicated by CD melting curves. It indicated that the co-solutes preferentially stabilize the c-myb G-quadruplex structure containing both homo- and hetero-stacking. In addition, protopine was demonstrated as a binder of c-myb G-quadruplex as screened from a library of natural alkaloids using ESI-MS method. CD spectra showed that it could selectively stabilize the c-myb G-quadruplex structure compared to other six G-quadruplexes from tumor-related G-rich sequences and the duplex DNAs (both long and short-chain ones). The binding of protopine could induce the change in the G-quadruplex structural populations. Therefore, protopine with its high binding specificity could be considered as a precursor for the design of drugs to target and regulate c-myb oncogene transcription. Copyright © 2018 Elsevier B.V. All rights reserved.

Superhelicity Constrains a Localized and R-Loop-Dependent Formation of G-Quadruplexes at the Upstream Region of Transcription.

Science.gov (United States)

Zheng, Ke-Wei; He, Yi-de; Liu, Hong-He; Li, Xin-Min; Hao, Yu-Hua; Tan, Zheng

2017-10-20

Transcription induces formation of intramolecular G-quadruplex structures at the upstream region of a DNA duplex by an upward transmission of negative supercoiling through the DNA. Currently the regulation of such G-quadruplex formation remains unclear. Using plasmid as a model, we demonstrate that while it is the dynamic negative supercoiling generated by a moving RNA polymerase that triggers a formation of a G-quadruplex, the constitutional superhelicity determines the potential and range of the formation of a G-quadruplex by constraining the propagation of the negative supercoiling. G-quadruplex formation is maximal in negatively supercoiled and nearly abolished in relaxed plasmids while being moderate in nicked and linear ones. The formation of a G-quadruplex strongly correlates with the presence of an R-loop. Preventing R-loop formation virtually abolished G-quadruplex formation even in the negatively supercoiled plasmid. Enzymatic action and protein binding that manipulate supercoiling or its propagation all impact the formation of G-quadruplexes. Because chromosomes and plasmids in cells in their natural form are maintained in a supercoiled state, our findings reveal a physical basis that justifies the formation and regulation of G-quadruplexes in vivo. The structural features involved in G-quadruplex formation may all serve as potential targets in clinical and therapeutic applications.

Effect of Urea on G-Quadruplex Stability.

Science.gov (United States)

Aslanyan, Lusine; Ko, Jordan; Kim, Byul G; Vardanyan, Ishkhan; Dalyan, Yeva B; Chalikian, Tigran V

2017-07-13

G-quadruplexes represent a class of noncanonical nucleic acid structures implicated in transcriptional regulation, cellular function, and disease. An understanding of the forces involved in stabilization and destabilization of the G-quadruplex conformation relative to the duplex or single-stranded conformation is a key to elucidating the biological role of G-quadruplex-based genomic switches and the quest for therapeutic means for controlled induction or suppression of a G-quadruplex at selected genomic loci. Solute-solvent interactions provide a ubiquitous and, in many cases, the determining thermodynamic force in maintaining and modulating the stability of nucleic acids. These interactions involve water as well as water-soluble cosolvents that may be present in the solution or in the crowded environment in the cell. We present here the first quantitative investigation of the effect of urea, a destabilizing cosolvent, on the conformational preferences of a G-quadruplex formed by the telomeric d[A(G 3 T 2 A) 3 G 3 ] sequence (Tel22). At 20 mM NaCl and room temperature, Tel22 undergoes a two-state urea-induced unfolding transition. An increase in salt mitigates the deleterious effect of urea on Tel22. The urea m-value of Tel22 normalized per change in solvent-accessible surface area, ΔS A , is similar to those for other DNA and RNA structures while being several-fold larger than that of proteins. Our results suggest that urea can be employed as an analytical tool in thermodynamic characterizations of G-quadruplexes in a manner similar to the use of urea in protein studies. We emphasize the need for further studies involving a larger selection of G-quadruplexes varying in sequence, topology (parallel, antiparallel, hybrid), and molecularity (monomolecular, bimolecular, tetramolecular) to outline the advantages and the limits of the use of urea in G-quadruplex studies. A deeper understanding of the effect of solvent and cosolvents on the differential stability of the

A twice-as-smart synthetic G-quartet: PyroTASQ is both a smart quadruplex ligand and a smart fluorescent probe.

Science.gov (United States)

Laguerre, Aurélien; Stefan, Loic; Larrouy, Manuel; Genest, David; Novotna, Jana; Pirrotta, Marc; Monchaud, David

2014-09-03

Recent and unambiguous evidences of the formation of DNA and RNA G-quadruplexes in cells has provided solid support for these structures to be considered as valuable targets in oncology. Beyond this, they have lent further credence to the anticancer strategies relying on small molecules that selectively target these higher-order DNA/RNA architectures, referred to as G-quadruplex ligands. They have also shed bright light on the necessity of designing multitasking ligands, displaying not only enticing quadruplex interacting properties (affinity, structural selectivity) but also additional features that make them usable for detecting quadruplexes in living cells, notably for determining whether, when, and where these structures fold and unfold during the cell cycle and also for better assessing the consequences of their stabilization by external agents. Herein, we report a brand new design of such multitasking ligands, whose structure experiences a quadruplex-promoted conformational switch that triggers not only its quadruplex affinity (i.e., smart ligands, which display high affinity and selectivity for DNA/RNA quadruplexes) but also its fluorescence (i.e., smart probes, which behave as selective light-up fluorescent reporters on the basis of a fluorogenic electron redistribution). The first prototype of such multifunctional ligands, termed PyroTASQ, represents a brand new generation of quadruplex ligands that can be referred to as "twice-as-smart" quadruplex ligands.

Nucleotide Pool Depletion Induces G-Quadruplex-Dependent Perturbation of Gene Expression

Directory of Open Access Journals (Sweden)

Charikleia Papadopoulou

2015-12-01

Full Text Available Nucleotide pool imbalance has been proposed to drive genetic instability in cancer. Here, we show that slowing replication forks by depleting nucleotide pools with hydroxyurea (HU can also give rise to both transient and permanent epigenetic instability of a reporter locus, BU-1, in DT40 cells. HU induces stochastic formation of Bu-1low variants in dividing cells, which have lost the H3K4me3 present in untreated cells. This instability is potentiated by an intragenic G quadruplex, which also promotes local H2Ax phosphorylation and transient heterochromatinization. Genome-wide, gene expression changes induced by HU significantly overlap with those resulting from loss of the G4-helicases FANCJ, WRN, and BLM. Thus, the effects of global replication stress induced by nucleotide pool depletion can be focused by local replication impediments caused by G quadruplex formation to induce epigenetic instability and changes in gene expression, a mechanism that may contribute to selectable transcriptional changes in cancer.

A Dual-Specific Targeting Approach Based on the Simultaneous Recognition of Duplex and Quadruplex Motifs.

Science.gov (United States)

Nguyen, Thi Quynh Ngoc; Lim, Kah Wai; Phan, Anh Tuân

2017-09-20

Small-molecule ligands targeting nucleic acids have been explored as potential therapeutic agents. Duplex groove-binding ligands have been shown to recognize DNA in a sequence-specific manner. On the other hand, quadruplex-binding ligands exhibit high selectivity between quadruplex and duplex, but show limited discrimination between different quadruplex structures. Here we propose a dual-specific approach through the simultaneous application of duplex- and quadruplex-binders. We demonstrated that a quadruplex-specific ligand and a duplex-specific ligand can simultaneously interact at two separate binding sites of a quadruplex-duplex hybrid harbouring both quadruplex and duplex structural elements. Such a dual-specific targeting strategy would combine the sequence specificity of duplex-binders and the strong binding affinity of quadruplex-binders, potentially allowing the specific targeting of unique quadruplex structures. Future research can be directed towards the development of conjugated compounds targeting specific genomic quadruplex-duplex sites, for which the linker would be highly context-dependent in terms of length and flexibility, as well as the attachment points onto both ligands.

Thermodynamic fingerprints of ligand binding to human telomeric G-quadruplexes.

Science.gov (United States)

Bončina, Matjaž; Podlipnik, Črtomir; Piantanida, Ivo; Eilmes, Julita; Teulade-Fichou, Marie-Paule; Vesnaver, Gorazd; Lah, Jurij

2015-12-02

Thermodynamic studies of ligand binding to human telomere (ht) DNA quadruplexes, as a rule, neglect the involvement of various ht-DNA conformations in the binding process. Therefore, the thermodynamic driving forces and the mechanisms of ht-DNA G-quadruplex-ligand recognition remain poorly understood. In this work we characterize thermodynamically and structurally binding of netropsin (Net), dibenzotetraaza[14]annulene derivatives (DP77, DP78), cationic porphyrin (TMPyP4) and two bisquinolinium ligands (Phen-DC3, 360A-Br) to the ht-DNA fragment (Tel22) AGGG(TTAGGG)3 using isothermal titration calorimetry, CD and fluorescence spectroscopy, gel electrophoresis and molecular modeling. By global thermodynamic analysis of experimental data we show that the driving forces characterized by contributions of specific interactions, changes in solvation and conformation differ significantly for binding of ligands with low quadruplex selectivity over duplexes (Net, DP77, DP78, TMPyP4; KTel22 ≈ KdsDNA). These contributions are in accordance with the observed structural features (changes) and suggest that upon binding Net, DP77, DP78 and TMPyP4 select hybrid-1 and/or hybrid-2 conformation while Phen-DC3 and 360A-Br induce the transition of hybrid-1 and hybrid-2 to the structure with characteristics of antiparallel or hybrid-3 type conformation. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.

Effect of ATRX and G-Quadruplex Formation by the VNTR Sequence on α-Globin Gene Expression.

Science.gov (United States)

Li, Yue; Syed, Junetha; Suzuki, Yuki; Asamitsu, Sefan; Shioda, Norifumi; Wada, Takahito; Sugiyama, Hiroshi

2016-05-17

ATR-X (α-thalassemia/mental retardation X-linked) syndrome is caused by mutations in chromatin remodeler ATRX. ATRX can bind the variable number of tandem repeats (VNTR) sequence in the promoter region of the α-globin gene cluster. The VNTR sequence, which contains the potential G-quadruplex-forming sequence CGC(GGGGCGGGG)n , is involved in the downregulation of α-globin expression. We investigated G-quadruplex and i-motif formation in single-stranded DNA and long double-stranded DNA. The promoter region without the VNTR sequence showed approximately twofold higher luciferase activity than the promoter region harboring the VNTR sequence. G-quadruplex stabilizers hemin and TMPyP4 reduced the luciferase activity, whereas expression of ATRX led to a recovery in reporter activity. Our results demonstrate that stable G-quadruplex formation by the VNTR sequence downregulates the expression of α-globin genes and that ATRX might bind to and resolve the G-quadruplex. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Allelic Dropout During Polymerase Chain Reaction due to G-Quadruplex Structures and DNA Methylation Is Widespread at Imprinted Human Loci.

Science.gov (United States)

Stevens, Aaron J; Taylor, Millie G; Pearce, Frederick Grant; Kennedy, Martin A

2017-03-10

Loss of one allele during polymerase chain reaction (PCR) amplification of DNA, known as allelic dropout, can be caused by a variety of mechanisms. Allelic dropout during PCR may have profound implications for molecular diagnostic and research procedures that depend on PCR and assume biallelic amplification has occurred. Complete allelic dropout due to the combined effects of cytosine methylation and G-quadruplex formation was previously described for a differentially methylated region of the human imprinted gene, MEST We now demonstrate that this parent-of-origin specific allelic dropout can potentially occur at several other genomic regions that display genomic imprinting and have propensity for G-quadruplex formation, including AIM1 , BLCAP , DNMT1 , PLAGL1 , KCNQ1 , and GRB10 These findings demonstrate that systematic allelic dropout during PCR is a general phenomenon for regions of the genome where differential allelic methylation and G-quadruplex motifs coincide, and suggest that great care must be taken to ensure biallelic amplification is occurring in such situations. Copyright © 2017 Stevens et al.

Local epigenetic reprogramming induced by G-quadruplex ligands

Science.gov (United States)

Guilbaud, Guillaume; Murat, Pierre; Recolin, Bénédicte; Campbell, Beth C.; Maiter, Ahmed; Sale, Julian E.; Balasubramanian, Shankar

2017-11-01

DNA and histone modifications regulate transcriptional activity and thus represent valuable targets to reprogram the activity of genes. Current epigenetic therapies target the machinery that regulates these modifications, leading to global transcriptional reprogramming with the potential for extensive undesired effects. Epigenetic information can also be modified as a consequence of disrupting processive DNA replication. Here, we demonstrate that impeding replication by small-molecule-mediated stabilization of G-quadruplex nucleic acid secondary structures triggers local epigenetic plasticity. We report the use of the BU-1 locus of chicken DT40 cells to screen for small molecules able to induce G-quadruplex-dependent transcriptional reprogramming. Further characterization of the top hit compound revealed its ability to induce a dose-dependent inactivation of BU-1 expression in two steps: the loss of H3K4me3 and then subsequent DNA cytosine methylation, changes that were heritable across cell divisions even after the compound was removed. Targeting DNA secondary structures thus represents a potentially new approach for locus-specific epigenetic reprogramming.

Higher-order human telomeric G-quadruplex DNA metalloenzymes enhance enantioselectivity in the Diels-Alder reaction.

Science.gov (United States)

Li, Yinghao; Jia, Guoqing; Wang, Changhao; Cheng, Mingpan; Li, Can

2015-03-02

Short human telomeric (HT) DNA sequences form single G-quadruplex (G4 ) units and exhibit structure-based stereocontrol for a series of reactions. However, for more biologically relevant higher-order HT G4 -DNAs (beyond a single G4 unit), the catalytic performances are unknown. Here, we found that higher-order HT G4 -DNA copper metalloenzymes (two or three G4 units) afford remarkably higher enantioselectivity (>90 % ee) and a five- to sixfold rate increase, compared to a single G4 unit, for the Diels-Alder reaction. Electron paramagnetic resonance (EPR) and enzymatic kinetic studies revealed that the distinct catalytic function between single and higher-order G4 -DNA copper metalloenzymes can be attributed to different Cu(II) coordination environments and substrate specificity. Our finding suggests that, like protein enzymes and ribozymes, higher-order structural organization is crucial for G4 -DNA-based catalysis. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Perturbed soliton excitations in inhomogeneous DNA

International Nuclear Information System (INIS)

Daniel, M.; Vasumathi, V.

2005-05-01

We study nonlinear dynamics of inhomogeneous DNA double helical chain under dynamic plane-base rotator model by considering angular rotation of bases in a plane normal to the helical axis. The DNA dynamics in this case is found to be governed by a perturbed sine-Gordon equation when taking into account the interstrand hydrogen bonding energy and intrastrand inhomogeneous stacking energy and making an analogy with the Heisenberg model of the Hamiltonian for an inhomogeneous anisotropic spin ladder with ferromagnetic legs and antiferromagentic rung coupling. In the homogeneous limit the dynamics is governed by the kink-antikink soliton of the sine-Gordon equation which represents the formation of open state configuration in DNA double helix. The effect of inhomogeneity in stacking energy in the form of localized and periodic variations on the formation of open states in DNA is studied under perturbation. The perturbed soliton is obtained using a multiple scale soliton perturbation theory by solving the associated linear eigen value problem and constructing the complete set of eigen functions. The inhomogeneity in stacking energy is found to modulate the width and speed of the soliton depending on the nature of inhomogeneity. Also it introduces fluctuations in the form of train of pulses or periodic oscillation in the open state configuration (author)

Phenolic promiscuity in the cell nucleus--epigallocatechingallate (EGCG) and theaflavin-3,3'-digallate from green and black tea bind to model cell nuclear structures including histone proteins, double stranded DNA and telomeric quadruplex DNA.

Science.gov (United States)

Mikutis, Gediminas; Karaköse, Hande; Jaiswal, Rakesh; LeGresley, Adam; Islam, Tuhidul; Fernandez-Lahore, Marcelo; Kuhnert, Nikolai

2013-02-01

Flavanols from tea have been reported to accumulate in the cell nucleus in considerable concentrations. The nature of this phenomenon, which could provide novel approaches in understanding the well-known beneficial health effects of tea phenols, is investigated in this contribution. The interaction between epigallocatechin gallate (EGCG) from green tea and a selection of theaflavins from black tea with selected cell nuclear structures such as model histone proteins, double stranded DNA and quadruplex DNA was investigated using mass spectrometry, Circular Dichroism spectroscopy and fluorescent assays. The selected polyphenols were shown to display affinity to all of the selected cell nuclear structures, thereby demonstrating a degree of unexpected molecular promiscuity. Most interestingly theaflavin-digallate was shown to display the highest affinity to quadruplex DNA reported for any naturally occurring molecule reported so far. This finding has immediate implications in rationalising the chemopreventive effect of the tea beverage against cancer and possibly the role of tea phenolics as "life span essentials".

Cation Coordination Alters the Conformation of a Thrombin-Binding G-Quadruplex DNA Aptamer That Affects Inhibition of Thrombin.

Science.gov (United States)

Zavyalova, Elena; Tagiltsev, Grigory; Reshetnikov, Roman; Arutyunyan, Alexander; Kopylov, Alexey

2016-10-01

Thrombin-binding aptamers are promising anticoagulants. HD1 is a monomolecular antiparallel G-quadruplex with two G-quartets linked by three loops. Aptamer-thrombin interactions are mediated with two TT-loops that bind thrombin exosite I. Several cations were shown to be coordinated inside the G-quadruplex, including K + , Na + , NH 4 + , Ba 2+ , and Sr 2+ ; on the contrary, Mn 2+ was coordinated in the grooves, outside the G-quadruplex. K + or Na + coordination provides aptamer functional activity. The effect of other cations on aptamer functional activity has not yet been described, because of a lack of relevant tests. Interactions between aptamer HD1 and a series of cations were studied. A previously developed enzymatic method was applied to evaluate aptamer inhibitory activity. The structure-function correlation was studied using the characterization of G-quadruplex conformation by circular dichroism spectroscopy. K + coordination provided the well-known high inhibitory activity of the aptamer, whereas Na + coordination supported low activity. Although NH 4 + coordination yielded a typical antiparallel G-quadruplex, no inhibitory activity was shown; a similar effect was observed for Ba 2+ and Sr 2+ coordination. Mn 2+ coordination destabilized the G-quadruplex that drastically diminished aptamer inhibitory activity. Therefore, G-quadruplex existence per se is insufficient for aptamer inhibitory activity. To elicit the nature of these effects, we thoroughly analyzed nuclear magnetic resonance (NMR) and X-ray data on the structure of the HD1 G-quadruplex with various cations. The most reasonable explanation is that cation coordination changes the conformation of TT-loops, affecting thrombin binding and inhibition. HD1 counterparts, aptamers 31-TBA and NU172, behaved similarly with some distinctions. In 31-TBA, an additional duplex module stabilized antiparallel G-quadruplex conformation at high concentrations of divalent cations; whereas in NU172, a different

A G-quadruplex-based Label-free Fluorometric Aptasensor for Adenosine Triphosphate Detection.

Science.gov (United States)

Li, Li Juan; Tian, Xue; Kong, Xiang Juan; Chu, Xia

2015-01-01

A G-quadruplex-based, label-free fluorescence assay was demonstrated for the detection of adenosine triphosphate (ATP). A double-stranded DNA (dsDNA), hybridized by ATP-aptamer and its complementary sequence, was employed as a substrate for ATP binding. SYBR Green I (SG I) was a fluorescent probe and exonuclease III (Exo III) was a nuclease to digest the dsDNA. Consequently, in the absence of ATP, the dsDNA was inset with SG I and was digested by Exo III, resulting in a low background signal. In the presence of ATP, the aptamer in dsDNA folded into a G-quadruplex structure that resisted the digestion of Exo III. SG I was inserted into the structure, showing high fluorescence. Owing to a decrease of the background noise, a high signal-to-noise ratio could be obtained. This sensor can detect ATP with a concentration ranging from 50 μM to 5 mM, and possesses a capacity for the sensitive determination of other targets.

Identification of New Natural DNA G-Quadruplex Binders Selected by a Structure-Based Virtual Screening Approach

Directory of Open Access Journals (Sweden)

Stefano Alcaro

2013-09-01

Full Text Available The G-quadruplex DNA structures are mainly present at the terminal portion of telomeres and can be stabilized by ligands able to recognize them in a specific manner. The recognition process is usually related to the inhibition of the enzyme telomerase indirectly involved and over-expressed in a high percentage of human tumors. There are several ligands, characterized by different chemical structures, already reported in the literature for their ability to bind and stabilize the G-quadruplex structures. Using the structural and biological information available on these structures; we performed a high throughput in silico screening of commercially natural compounds databases by means of a structure-based approach followed by docking experiments against the human telomeric sequence d[AG3(T2AG33]. We identified 12 best hits characterized by different chemical scaffolds and conformational and physicochemical properties. All of them were associated to an improved theoretical binding affinity with respect to that of known selective G-binders. Among these hits there is a chalcone derivative; structurally very similar to the polyphenol butein; known to remarkably inhibit the telomerase activity.

Designing a New Class of Bases for Nucleic Acid Quadruplexes and Quadruplex-Active Ligands.

Science.gov (United States)

Bazzi, Sophia; Novotný, Jan; Yurenko, Yevgen P; Marek, Radek

2015-06-22

A new class of quadruplex nucleobases, derived from 3-deazaguanine, has been designed for various applications as smart quadruplex ligands as well as quadruplex-based aptamers, receptors, and sensors. An efficient strategy for modifying the guanine quadruplex core has been developed and tested by using quantum chemistry methods. Several potential guanine derivatives modified at the 3- or 8-position or both are analyzed, and the results compared to reference systems containing natural guanine. Analysis of the formation energies (BLYP-D3(BJ)/def2-TZVPP level of theory, in combination with the COSMO model for water) in model systems consisting of two and three stacked tetrads with Na(+) /K(+) ion(s) inside the internal channel indicates that the formation of structures with 3-halo-3-deazaguanine bases leads to a substantial gain in energy, as compared to the corresponding reference guanine complexes. The results cast light on changes in the noncovalent interactions (hydrogen bonding, stacking, and ion coordination) in a quadruplex stem upon modification of the guanine core. In particular, the enhanced stability of the modified quadruplexes was shown to originate mainly from increased π-π stacking. Our study suggests the 3-halo-3-deazaguanine skeleton as a potential building unit for quadruplex systems and smart G-quadruplex ligands. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Selection of G-quadruplex folding topology with LNA-modified human telomeric sequences in K+ solution

DEFF Research Database (Denmark)

Pradhan, Devranjan; Hansen, Lykke H; Vester, Birte

2011-01-01

G-rich nucleic acid oligomers can form G-quadruplexes built by G-tetrads stacked upon each other. Depending on the nucleotide sequence, G-quadruplexes fold mainly with two topologies: parallel, in which all G-tracts are oriented parallel to each other, or antiparallel, in which one or more G......-tracts are oriented antiparallel to the other G-tracts. In the former topology, all glycosidic bond angles conform to anti conformations, while in the latter topology they adopt both syn and anti conformations. It is of interest to understand the molecular forces that govern G-quadruplex folding. Here, we approach...... this problem by examining the impact of LNA (locked nucleic acid) modifications on the folding topology of the dimeric model system of the human telomere sequence. In solution, this DNA G-quadruplex forms a mixture of G-quadruplexes with antiparallel and parallel topologies. Using CD and NMR spectroscopies, we...

Stabilization of Telomere G-Quadruplexes Interferes with Human Herpesvirus 6A Chromosomal Integration.

Science.gov (United States)

Gilbert-Girard, Shella; Gravel, Annie; Artusi, Sara; Richter, Sara N; Wallaschek, Nina; Kaufer, Benedikt B; Flamand, Louis

2017-07-15

Human herpesviruses 6A and 6B (HHV-6A/B) can integrate their genomes into the telomeres of human chromosomes using a mechanism that remains poorly understood. To achieve a better understanding of the HHV-6A/B integration mechanism, we made use of BRACO-19, a compound that stabilizes G-quadruplex secondary structures and prevents telomere elongation by the telomerase complex. First, we analyzed the folding of telomeric sequences into G-quadruplex structures and their binding to BRACO-19 using G-quadruplex-specific antibodies and surface plasmon resonance. Circular dichroism studies indicate that BRACO-19 modifies the conformation and greatly stabilizes the G-quadruplexes formed in G-rich telomeric DNA. Subsequently we assessed the effects of BRACO-19 on the HHV-6A initial phase of infection. Our results indicate that BRACO-19 does not affect entry of HHV-6A DNA into cells. We next investigated if stabilization of G-quadruplexes by BRACO-19 affected HHV-6A's ability to integrate its genome into host chromosomes. Incubation of telomerase-expressing cells with BRACO-19, such as HeLa and MCF-7, caused a significant reduction in the HHV-6A integration frequency ( P integration frequency in U2OS cells that lack telomerase activity and elongate their telomeres through alternative lengthening mechanisms. Our data suggest that the fluidity of telomeres is important for efficient chromosomal integration of HHV-6A and that interference with telomerase activity negatively affects the generation of cellular clones containing integrated HHV-6A. IMPORTANCE HHV-6A/B can integrate their genomes into the telomeres of infected cells. Telomeres consist of repeated hexanucleotides (TTAGGG) of various lengths (up to several kilobases) and end with a single-stranded 3' extension. To avoid recognition and induce a DNA damage response, the single-stranded overhang folds back on itself and forms a telomeric loop (T-loop) or adopts a tertiary structure, referred to as a G-quadruplex. In the

Quadruplexes in 'Dicty': crystal structure of a four-quartet G-quadruplex formed by G-rich motif found in the Dictyostelium discoideum genome.

Science.gov (United States)

Guédin, Aurore; Lin, Linda Yingqi; Armane, Samir; Lacroix, Laurent; Mergny, Jean-Louis; Thore, Stéphane; Yatsunyk, Liliya A

2018-06-01

Guanine-rich DNA has the potential to fold into non-canonical G-quadruplex (G4) structures. Analysis of the genome of the social amoeba Dictyostelium discoideum indicates a low number of sequences with G4-forming potential (249-1055). Therefore, D. discoideum is a perfect model organism to investigate the relationship between the presence of G4s and their biological functions. As a first step in this investigation, we crystallized the dGGGGGAGGGGTACAGGGGTACAGGGG sequence from the putative promoter region of two divergent genes in D. discoideum. According to the crystal structure, this sequence folds into a four-quartet intramolecular antiparallel G4 with two lateral and one diagonal loops. The G-quadruplex core is further stabilized by a G-C Watson-Crick base pair and a A-T-A triad and displays high thermal stability (Tm > 90°C at 100 mM KCl). Biophysical characterization of the native sequence and loop mutants suggests that the DNA adopts the same structure in solution and in crystalline form, and that loop interactions are important for the G4 stability but not for its folding. Four-tetrad G4 structures are sparse. Thus, our work advances understanding of the structural diversity of G-quadruplexes and yields coordinates for in silico drug screening programs and G4 predictive tools.

Biophysical Characterization of G-Quadruplex Recognition in the PITX1 mRNA by the Specificity Domain of the Helicase RHAU.

Directory of Open Access Journals (Sweden)

Emmanuel O Ariyo

Full Text Available Nucleic acids rich in guanine are able to fold into unique structures known as G-quadruplexes. G-quadruplexes consist of four tracts of guanylates arranged in parallel or antiparallel strands that are aligned in stacked G-quartet planes. The structure is further stabilized by Hoogsteen hydrogen bonds and monovalent cations centered between the planes. RHAU (RNA helicase associated with AU-rich element is a member of the ATP-dependent DExH/D family of RNA helicases and can bind and resolve G-quadruplexes. RHAU contains a core helicase domain with an N-terminal extension that enables recognition and full binding affinity to RNA and DNA G-quadruplexes. PITX1, a member of the bicoid class of homeobox proteins, is a transcriptional activator active during development of vertebrates, chiefly in the anterior pituitary gland and several other organs. We have previously demonstrated that RHAU regulates PITX1 levels through interaction with G-quadruplexes at the 3'-end of the PITX1 mRNA. To understand the structural basis of G-quadruplex recognition by RHAU, we characterize a purified minimal PITX1 G-quadruplex using a variety of biophysical techniques including electrophoretic mobility shift assays, UV-VIS spectroscopy, circular dichroism, dynamic light scattering, small angle X-ray scattering and nuclear magnetic resonance spectroscopy. Our biophysical analysis provides evidence that the RNA G-quadruplex, but not its DNA counterpart, can adopt a parallel orientation, and that only the RNA can interact with N-terminal domain of RHAU via the tetrad face of the G-quadruplex. This work extends our insight into how the N-terminal region of RHAU recognizes parallel G-quadruplexes.

Evaluation of the effect of polymorphism on G-quadruplex-ligand interaction by means of spectroscopic and chromatographic techniques

Science.gov (United States)

Benito, S.; Ferrer, A.; Benabou, S.; Aviñó, A.; Eritja, R.; Gargallo, R.

2018-05-01

Guanine-rich sequences may fold into highly ordered structures known as G-quadruplexes. Apart from the monomeric G-quadruplex, these sequences may form multimeric structures that are not usually considered when studying interaction with ligands. This work studies the interaction of a ligand, crystal violet, with three guanine-rich DNA sequences with the capacity to form multimeric structures. These sequences correspond to short stretches found near the promoter regions of c-kit and SMARCA4 genes. Instrumental techniques (circular dichroism, molecular fluorescence, size-exclusion chromatography and electrospray ionization mass spectrometry) and multivariate data analysis were used for this purpose. The polymorphism of G-quadruplexes was characterized prior to the interaction studies. The ligand was shown to interact preferentially with the monomeric G-quadruplex; the binding stoichiometry was 1:1 and the binding constant was in the order of 105 M-1 for all three sequences. The results highlight the importance of DNA treatment prior to interaction studies.

G-Quadruplex conformational change driven by pH variation with potential application as a nanoswitch.

Science.gov (United States)

Yan, Yi-Yong; Tan, Jia-Heng; Lu, Yu-Jing; Yan, Siu-Cheong; Wong, Kwok-Yin; Li, Ding; Gu, Lian-Quan; Huang, Zhi-Shu

2013-10-01

G-Quadruplex is a highly polymorphic structure, and its behavior in acidic condition has not been well studied. Circular dichroism (CD) spectra were used to study the conformational change of G-quadruplex. The thermal stabilities of the G-quadruplex were measured with CD melting. Interconversion kinetics profiles were investigated by using CD kinetics. The fluorescence of the inserted 2-Aminopurine (Ap) was monitored during pH change and acrylamide quenching, indicating the status of the loop. Proton NMR was adopted to help illustrate the change of the conformation. G-Quadruplex of specific loop was found to be able to transform upon pH variation. The transformation was resulted from the loop rearrangement. After screening of a library of diverse G-quadruplex, a sequence exhibiting the best transformation property was found. A pH-driven nanoswitch with three gears was obtained based on this transition cycle. Certain G-quadruplex was found to go through conformational change at low pH. Loop was the decisive factor controlling the interconversion upon pH variation. G-Quadruplex with TT central loop could be converted in a much milder condition than the one with TTA loop. It can be used to design pH-driven nanodevices such as a nanoswitch. These results provide more insights into G-quadruplex polymorphism, and also contribute to the design of DNA-based nanomachines and logic gates. © 2013.

Ligand binding to telomeric G-quadruplex DNA investigated by funnel-metadynamics simulations.

Science.gov (United States)

Moraca, Federica; Amato, Jussara; Ortuso, Francesco; Artese, Anna; Pagano, Bruno; Novellino, Ettore; Alcaro, Stefano; Parrinello, Michele; Limongelli, Vittorio

2017-03-14

G-quadruplexes (G4s) are higher-order DNA structures typically present at promoter regions of genes and telomeres. Here, the G4 formation decreases the replicative DNA at each cell cycle, finally leading to apoptosis. The ability to control this mitotic clock, particularly in cancer cells, is fascinating and passes through a rational understanding of the ligand/G4 interaction. We demonstrate that an accurate description of the ligand/G4 binding mechanism is possible using an innovative free-energy method called funnel-metadynamics (FM), which we have recently developed to investigate ligand/protein interaction. Using FM simulations, we have elucidated the binding mechanism of the anticancer alkaloid berberine to the human telomeric G4 ( d [AG 3 (T 2 AG 3 ) 3 ]), computing also the binding free-energy landscape. Two ligand binding modes have been identified as the lowest energy states. Furthermore, we have found prebinding sites, which are preparatory to reach the final binding mode. In our simulations, the ions and the water molecules have been explicitly represented and the energetic contribution of the solvent during ligand binding evaluated. Our theoretical results provide an accurate estimate of the absolute ligand/DNA binding free energy ([Formula: see text] = -10.3 ± 0.5 kcal/mol) that we validated through steady-state fluorescence binding assays. The good agreement between the theoretical and experimental value demonstrates that FM is a most powerful method to investigate ligand/DNA interaction and can be a useful tool for the rational design also of G4 ligands.

G-quadruplex and G-rich sequence stimulate Pif1p-catalyzed downstream duplex DNA unwinding through reducing waiting time at ss/dsDNA junction

Science.gov (United States)

Zhang, Bo; Wu, Wen-Qiang; Liu, Na-Nv; Duan, Xiao-Lei; Li, Ming; Dou, Shuo-Xing; Hou, Xi-Miao; Xi, Xu-Guang

2016-01-01

Alternative DNA structures that deviate from B-form double-stranded DNA such as G-quadruplex (G4) DNA can be formed by G-rich sequences that are widely distributed throughout the human genome. We have previously shown that Pif1p not only unfolds G4, but also unwinds the downstream duplex DNA in a G4-stimulated manner. In the present study, we further characterized the G4-stimulated duplex DNA unwinding phenomenon by means of single-molecule fluorescence resonance energy transfer. It was found that Pif1p did not unwind the partial duplex DNA immediately after unfolding the upstream G4 structure, but rather, it would dwell at the ss/dsDNA junction with a ‘waiting time’. Further studies revealed that the waiting time was in fact related to a protein dimerization process that was sensitive to ssDNA sequence and would become rapid if the sequence is G-rich. Furthermore, we identified that the G-rich sequence, as the G4 structure, equally stimulates duplex DNA unwinding. The present work sheds new light on the molecular mechanism by which G4-unwinding helicase Pif1p resolves physiological G4/duplex DNA structures in cells. PMID:27471032

Microwave-Assisted Synthesis of Arene Ru(II Complexes Induce Tumor Cell Apoptosis Through Selectively Binding and Stabilizing bcl-2 G-Quadruplex DNA

Directory of Open Access Journals (Sweden)

Yanhua Chen

2016-05-01

Full Text Available A series of arene Ru(II complexes coordinated with phenanthroimidazole derivatives, [(η6-C6H6Ru(lCl]Cl(1b L = p-ClPIP = 2-(4-Chlorophenylimidazole[4,5f] 1,10-phenanthroline; 2b L = m-ClPIP = 2-(3-Chlorophenylimidazole[4,5f] 1,10-phenanthroline; 3b L = p-NPIP = 2-(4-Nitrophenylimidazole[4,5f] 1,10-phenanthroline; 4b L = m-NPIP = 2-(3-Nitrophenyl imidazole [4,5f] 1,10-phenanthroline were synthesized in yields of 89.9%–92.7% under conditions of microwave irradiation heating for 30 min to liberate four arene Ru(II complexes (1b, 2b, 3b, 4b. The anti-tumor activity of 1b against various tumor cells was evaluated by MTT assay. The results indicated that this complex blocked the growth of human lung adenocarcinoma A549 cells with an IC50 of 16.59 μM. Flow cytometric analysis showed that apoptosis of A549 cells was observed following treatment with 1b. Furthermore, the in vitro DNA-binding behaviors that were confirmed by spectroscopy indicated that 1b could selectively bind and stabilize bcl-2 G-quadruplex DNA to induce apoptosis of A549 cells. Therefore, the synthesized 1b has impressive bcl-2 G-quadruplex DNA-binding and stabilizing activities with potential applications in cancer chemotherapy.

Bis-guanylhydrazone diimidazo[1,2-a:1,2-c]pyrimidine as a novel and specific G-quadruplex binding motif.

Science.gov (United States)

Sparapani, Silvia; Bellini, Stefania; Gunaratnam, Mekala; Haider, Shozeb M; Andreani, Aldo; Rambaldi, Mirella; Locatelli, Alessandra; Morigi, Rita; Granaiola, Massimiliano; Varoli, Lucilla; Burnelli, Silvia; Leoni, Alberto; Neidle, Stephen

2010-08-21

A bis-guanylhydrazone derivative of diimidazo[1,2-a:1,2-c]pyrimidine has unexpectedly been found to be a potent stabiliser of several quadruplex DNAs, whereas there is no significant interaction with duplex DNA. Molecular modeling suggests that the guanylhydrazone groups play an active role in quadruplex binding.

Xanthine and 8-oxoguanine in G-quadruplexes: formation of a G·G·X·O tetrad.

Science.gov (United States)

Cheong, Vee Vee; Heddi, Brahim; Lech, Christopher Jacques; Phan, Anh Tuân

2015-12-02

G-quadruplexes are four-stranded structures built from stacked G-tetrads (G·G·G·G), which are planar cyclical assemblies of four guanine bases interacting through Hoogsteen hydrogen bonds. A G-quadruplex containing a single guanine analog substitution, such as 8-oxoguanine (O) or xanthine (X), would suffer from a loss of a Hoogsteen hydrogen bond within a G-tetrad and/or potential steric hindrance. We show that a proper arrangement of O and X bases can reestablish the hydrogen-bond pattern within a G·G·X·O tetrad. Rational incorporation of G·G·X·O tetrads in a (3+1) G-quadruplex demonstrated a similar folding topology and thermal stability to that of the unmodified G-quadruplex. pH titration conducted on X·O-modified G-quadruplexes indicated a protonation-deprotonation equilibrium of X with a pKa ∼6.7. The solution structure of a G-quadruplex containing a G·G·X·O tetrad was determined, displaying the same folding topology in both the protonated and deprotonated states. A G-quadruplex containing a deprotonated X·O pair was shown to exhibit a more electronegative groove compared to that of the unmodified one. These differences are likely to manifest in the electronic properties of G-quadruplexes and may have important implications for drug targeting and DNA-protein interactions. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.

Integration of G-quadruplex and DNA-templated Ag NCs for nonarithmetic information processing.

Science.gov (United States)

Gao, Ru-Ru; Yao, Tian-Ming; Lv, Xiao-Yan; Zhu, Yan-Yan; Zhang, Yi-Wei; Shi, Shuo

2017-06-01

To create sophisticated molecular logic circuits from scratch, you may not believe how common the building blocks can be and how diverse and powerful such circuits can be when scaled up. Using the two simple building blocks of G-quadruplex and silver nanoclusters (Ag NCs), we experimentally construct a series of multifunctional, label-free, and multi-output logic circuits to perform nonarithmetic functions: a 1-to-2 decoder, a 4-to-2 encoder, an 8-to-3 encoder, dual transfer gates, a 2 : 1 multiplexer, and a 1 : 2 demultiplexer. Moreover, a parity checker which is capable of identifying odd and even numbers from natural numbers is constructed conceptually. Finally, a multi-valued logic gate (ternary inhibit gate) is readily achieved by taking this DNA/Ag NC system as a universal platform. All of the above logic circuits share the same building blocks, indicating the great prospects of the assembly of nanomaterials and DNA for biochemical logic devices. Considering its biocompatibility, the novel prototypes developed here may have potential applications in the fields of biological computers and medical diagnosis and serve as a promising proof of principle in the not-too-distant future.

Quinone methides tethered to naphthalene diimides as selective G-quadruplex alkylating agents.

Science.gov (United States)

Di Antonio, Marco; Doria, Filippo; Richter, Sara N; Bertipaglia, Carolina; Mella, Mariella; Sissi, Claudia; Palumbo, Manlio; Freccero, Mauro

2009-09-16

We have developed novel G-quadruplex (G-4) ligand/alkylating hybrid structures, tethering the naphthalene diimide moiety to quaternary ammonium salts of Mannich bases, as quinone-methide precursors, activatable by mild thermal digestion (40 degrees C). The bis-substituted naphthalene diimides were efficiently synthesized, and their reactivity as activatable bis-alkylating agents was investigated in the presence of thiols and amines in aqueous buffered solutions. The electrophilic intermediate, quinone-methide, involved in the alkylation process was trapped, in the presence of ethyl vinyl ether, in a hetero Diels-Alder [4 + 2] cycloaddition reaction, yielding a substituted 2-ethoxychroman. The DNA recognition and alkylation properties of these new derivatives were investigated by gel electrophoresis, circular dichroism, and enzymatic assays. The alkylation process occurred preferentially on the G-4 structure in comparison to other DNA conformations. By dissecting reversible recognition and alkylation events, we found that the reversible process is a prerequisite to DNA alkylation, which in turn reinforces the G-quadruplex structural rearrangement.

Colorimetric detection of genetically modified organisms based on exonuclease III-assisted target recycling and hemin/G-quadruplex DNAzyme amplification.

Science.gov (United States)

Zhang, Decai; Wang, Weijia; Dong, Qian; Huang, Yunxiu; Wen, Dongmei; Mu, Yuejing; Yuan, Yong

2017-12-21

An isothermal colorimetric method is described for amplified detection of the CaMV 35S promoter sequence in genetically modified organism (GMO). It is based on (a) target DNA-triggered unlabeled molecular beacon (UMB) termini binding, and (b) exonuclease III (Exo III)-assisted target recycling, and (c) hemin/G-quadruplex (DNAzyme) based signal amplification. The specific binding of target to the G-quadruplex sequence-locked UMB triggers the digestion of Exo III. This, in turn, releases an active G-quadruplex segment and target DNA for successive hybridization and cleavage. The Exo III impellent recycling of targets produces numerous G-quadruplex sequences. These further associate with hemin to form DNAzymes and hence will catalyze H 2 O 2 -mediated oxidation of the chromogenic enzyme substrate ABTS 2- causing the formation of a green colored product. This finding enables a sensitive colorimetric determination of GMO DNA (at an analytical wavelength of 420 nm) at concentrations as low as 0.23 nM. By taking advantage of isothermal incubation, this method does not require sophisticated equipment or complicated syntheses. Analyses can be performed within 90 min. The method also discriminates single base mismatches. In our perception, it has a wide scope in that it may be applied to the detection of many other GMOs. Graphical abstract An isothermal and sensitive colorimetric method is described for amplified detection of CaMV 35S promoter sequence in genetically modified organism (GMO). It is based on target DNA-triggered molecular beacon (UMB) termini-binding and exonuclease III assisted target recycling, and on hemin/G-quadruplex (DNAzyme) signal amplification.

GNG Motifs Can Replace a GGG Stretch during G-Quadruplex Formation in a Context Dependent Manner.

Directory of Open Access Journals (Sweden)

Kohal Das

Full Text Available G-quadruplexes are one of the most commonly studied non-B DNA structures. Generally, these structures are formed using a minimum of 4, three guanine tracts, with connecting loops ranging from one to seven. Recent studies have reported deviation from this general convention. One such deviation is the involvement of bulges in the guanine tracts. In this study, guanines along with bulges, also referred to as GNG motifs have been extensively studied using recently reported HOX11 breakpoint fragile region I as a model template. By strategic mutagenesis approach we show that the contribution from continuous G-tracts may be dispensible during G-quadruplex formation when such motifs are flanked by GNGs. Importantly, the positioning and number of GNG/GNGNG can also influence the formation of G-quadruplexes. Further, we assessed three genomic regions from HIF1 alpha, VEGF and SHOX gene for G-quadruplex formation using GNG motifs. We show that HIF1 alpha sequence harbouring GNG motifs can fold into intramolecular G-quadruplex. In contrast, GNG motifs in mutant VEGF sequence could not participate in structure formation, suggesting that the usage of GNG is context dependent. Importantly, we show that when two continuous stretches of guanines are flanked by two independent GNG motifs in a naturally occurring sequence (SHOX, it can fold into an intramolecular G-quadruplex. Finally, we show the specific binding of G-quadruplex binding protein, Nucleolin and G-quadruplex antibody, BG4 to SHOX G-quadruplex. Overall, our study provides novel insights into the role of GNG motifs in G-quadruplex structure formation which may have both physiological and pathological implications.

The Effects of Molecular Crowding on the Structure and Stability of G-Quadruplexes with an Abasic Site

Science.gov (United States)

Fujimoto, Takeshi; Nakano, Shu-ichi; Miyoshi, Daisuke; Sugimoto, Naoki

2011-01-01

Both cellular environmental factors and chemical modifications critically affect the properties of nucleic acids. However, the structure and stability of DNA containing abasic sites under cell-mimicking molecular crowding conditions remain unclear. Here, we investigated the molecular crowding effects on the structure and stability of the G-quadruplexes including a single abasic site. Structural analysis by circular dichroism showed that molecular crowding by PEG200 did not affect the topology of the G-quadruplex structure with or without an abasic site. Thermodynamic analysis further demonstrated that the degree of stabilization of the G-quadruplex by molecular crowding decreased with substitution of an abasic site for a single guanine. Notably, we found that the molecular crowding effects on the enthalpy change for G-quadruplex formation had a linear relationship with the abasic site effects depending on its position. These results are useful for predicting the structure and stability of G-quadruplexes with abasic sites in the cell-mimicking conditions. PMID:21949901

G-quadruplex induced chirality of methylazacalix[6]pyridine via unprecedented binding stoichiometry: en route to multiplex controlled molecular switch

Science.gov (United States)

Guan, Ai-Jiao; Shen, Meng-Jie; Xiang, Jun-Feng; Zhang, En-Xuan; Li, Qian; Sun, Hong-Xia; Wang, Li-Xia; Xu, Guang-Zhi; Tang, Ya-Lin; Xu, Li-Jin; Gong, Han-Yuan

2015-05-01

Nucleic acid based molecular device is a developing research field which attracts great interests in material for building machinelike nanodevices. G-quadruplex, as a new type of DNA secondary structures, can be harnessed to construct molecular device owing to its rich structural polymorphism. Herein, we developed a switching system based on G-quadruplexes and methylazacalix[6]pyridine (MACP6). The induced circular dichroism (CD) signal of MACP6 was used to monitor the switch controlled by temperature or pH value. Furthermore, the CD titration, Job-plot, variable temperature CD and 1H-NMR experiments not only confirmed the binding mode between MACP6 and G-quadruplex, but also explained the difference switching effect of MACP6 and various G-quadruplexes. The established strategy has the potential to be used as the chiral probe for specific G-quadruplex recognition.

Loss of loop adenines alters human telomere d[AG3(TTAG3)3] quadruplex folding

Czech Academy of Sciences Publication Activity Database

Babinský, M.; Fiala, R.; Kejnovská, Iva; Bednářová, Klára; Marek, R.; Sagi, J.; Sklenář, V.; Vorlíčková, Michaela

2014-01-01

Roč. 42, č. 22 (2014), s. 14031-14041 ISSN 0305-1048 R&D Projects: GA ČR(CZ) GAP205/12/0466 Institutional support: RVO:68081707 Keywords : human telomere * DNA quadruplex * cellular DNA Subject RIV: BO - Biophysics Impact factor: 9.112, year: 2014

Label-free detection of kanamycin based on a G-quadruplex DNA aptamer-based fluorescent intercalator displacement assay

Science.gov (United States)

Xing, Yun-Peng; Liu, Chun; Zhou, Xiao-Hong; Shi, Han-Chang

2015-01-01

This work was the first to report that the kanamycin-binding DNA aptamer (5'-TGG GGG TTG AGG CTA AGC CGA-3') can form stable parallel G-quadruplex DNA (G4-DNA) structures by themselves and that this phenomenon can be verified by nondenaturing polyacrylamide gel electrophoresis and circular dichroism spectroscopy. Based on these findings, we developed a novel label-free strategy for kanamycin detection based on the G4-DNA aptamer-based fluorescent intercalator displacement assay with thiazole orange (TO) as the fluorescence probe. In the proposed strategy, TO became strongly fluorescent upon binding to kanamycin-binding G4-DNA. However, the addition of kanamycin caused the displacement of TO from the G4-DNA-TO conjugate, thereby resulting in decreased fluorescent signal, which was inversely related to the kanamycin concentration. The detection limit of the proposed assay decreased to 59 nM with a linear working range of 0.1 μM to 20 μM for kanamycin. The cross-reactivity against six other antibiotics was negligible compared with the response to kanamycin. A satisfactory recovery of kanamycin in milk samples ranged from 80.1% to 98.0%, confirming the potential of this bioassay in the measurement of kanamycin in various applications. Our results also served as a good reference for developing similar fluorescent G4-DNA-based bioassays in the future.

Nonlinear optical and G-Quadruplex DNA stabilization properties of novel mixed ligand copper(II) complexes and coordination polymers: Synthesis, structural characterization and computational studies

Science.gov (United States)

Rajasekhar, Bathula; Bodavarapu, Navya; Sridevi, M.; Thamizhselvi, G.; RizhaNazar, K.; Padmanaban, R.; Swu, Toka

2018-03-01

The present study reports the synthesis and evaluation of nonlinear optical property and G-Quadruplex DNA Stabilization of five novel copper(II) mixed ligand complexes. They were synthesized from copper(II) salt, 2,5- and 2,3- pyridinedicarboxylic acid, diethylenetriamine and amide based ligand (AL). The crystal structure of these complexes were determined through X-ray diffraction and supported by ESI-MAS, NMR, UV-Vis and FT-IR spectroscopic methods. Their nonlinear optical property was studied using Gaussian09 computer program. For structural optimization and nonlinear optical property, density functional theory (DFT) based B3LYP method was used with LANL2DZ basis set for metal ion and 6-31G∗ for C,H,N,O and Cl atoms. The present work reveals that pre-polarized Complex-2 showed higher β value (29.59 × 10-30e.s.u) as compared to that of neutral complex-1 (β = 0.276 × 10-30e.s.u.) which may be due to greater advantage of polarizability. Complex-2 is expected to be a potential material for optoelectronic and photonic technologies. Docking studies using AutodockVina revealed that complex-2 has higher binding energy for both G-Quadruplex DNA (-8.7 kcal/mol) and duplex DNA (-10.1 kcal/mol). It was also observed that structure plays an important role in binding efficiency.

DNA Replication Dynamics of the GGGGCC Repeat of the C9orf72 Gene.

Science.gov (United States)

Thys, Ryan Griffin; Wang, Yuh-Hwa

2015-11-27

DNA has the ability to form a variety of secondary structures in addition to the normal B-form DNA, including hairpins and quadruplexes. These structures are implicated in a number of neurological diseases and cancer. Expansion of a GGGGCC repeat located at C9orf72 is associated with familial amyotrophic lateral sclerosis and frontotemporal dementia. This repeat expands from two to 24 copies in normal individuals to several hundreds or thousands of repeats in individuals with the disease. Biochemical studies have demonstrated that as little as four repeats have the ability to form a stable DNA secondary structure known as a G-quadruplex. Quadruplex structures have the ability to disrupt normal DNA processes such as DNA replication and transcription. Here we examine the role of GGGGCC repeat length and orientation on DNA replication using an SV40 replication system in human cells. Replication through GGGGCC repeats leads to a decrease in overall replication efficiency and an increase in instability in a length-dependent manner. Both repeat expansions and contractions are observed, and replication orientation is found to influence the propensity for expansions or contractions. The presence of replication stress, such as low-dose aphidicolin, diminishes replication efficiency but has no effect on instability. Two-dimensional gel electrophoresis analysis demonstrates a replication stall with as few as 20 GGGGCC repeats. These results suggest that replication of the GGGGCC repeat at C9orf72 is perturbed by the presence of expanded repeats, which has the potential to result in further expansion, leading to disease. © 2015 by The American Society for Biochemistry and Molecular Biology, Inc.

Unexpected Position-Dependent Effects of Ribose G-Quartets in G-Quadruplexes

Czech Academy of Sciences Publication Activity Database

Zhou, J.; Amrane, S.; Rosu, F.; Salgado, G.; Bian, Y.; Tateishi-Karimata, H.; Largy, E.; Korkut, D. N.; Bourdoncle, A.; Miyoshi, D.; Zhang, J.; Ju, H.; Wang, W.; Sugimoto, N.; Gabelica, V.; Mergny, Jean-Louis

2017-01-01

Roč. 139, č. 23 (2017), s. 7768-7779 ISSN 0002-7863 Institutional support: RVO:68081707 Keywords : human telomeric rna * electrospray mass-spectrometry * molecular crowding conditions * dna g-quadruplexes Subject RIV: BO - Biophysics OBOR OECD: Electrochemistry (dry cells, batteries, fuel cells, corrosion metals, electrolysis) Impact factor: 13.858, year: 2016

Sites of instability in the human TCF3 (E2A) gene adopt G-quadruplex DNA structures in vitro

Science.gov (United States)

Williams, Jonathan D.; Fleetwood, Sara; Berroyer, Alexandra; Kim, Nayun; Larson, Erik D.

2015-01-01

The formation of highly stable four-stranded DNA, called G-quadruplex (G4), promotes site-specific genome instability. G4 DNA structures fold from repetitive guanine sequences, and increasing experimental evidence connects G4 sequence motifs with specific gene rearrangements. The human transcription factor 3 (TCF3) gene (also termed E2A) is subject to genetic instability associated with severe disease, most notably a common translocation event t(1;19) associated with acute lymphoblastic leukemia. The sites of instability in TCF3 are not randomly distributed, but focused to certain sequences. We asked if G4 DNA formation could explain why TCF3 is prone to recombination and mutagenesis. Here we demonstrate that sequences surrounding the major t(1;19) break site and a region associated with copy number variations both contain G4 sequence motifs. The motifs identified readily adopt G4 DNA structures that are stable enough to interfere with DNA synthesis in physiological salt conditions in vitro. When introduced into the yeast genome, TCF3 G4 motifs promoted gross chromosomal rearrangements in a transcription-dependent manner. Our results provide a molecular rationale for the site-specific instability of human TCF3, suggesting that G4 DNA structures contribute to oncogenic DNA breaks and recombination. PMID:26029241

pH-Modulated Watson-Crick duplex-quadruplex equilibria of guanine-rich and cytosine-rich DNA sequences 140 base pairs upstream of the c-kit transcription initiation site.

Science.gov (United States)

Bucek, Pavel; Jaumot, Joaquim; Aviñó, Anna; Eritja, Ramon; Gargallo, Raimundo

2009-11-23

Guanine-rich regions of DNA are sequences capable of forming G-quadruplex structures. The formation of a G-quadruplex structure in a region 140 base pairs (bp) upstream of the c-kit transcription initiation site was recently proposed (Fernando et al., Biochemistry, 2006, 45, 7854). In the present study, the acid-base equilibria and the thermally induced unfolding of the structures formed by a guanine-rich region and by its complementary cytosine-rich strand in c-kit were studied by means of circular dichroism and molecular absorption spectroscopies. In addition, competition between the Watson-Crick duplex and the isolated structures was studied as a function of pH value and temperature. Multivariate data analysis methods based on both hard and soft modeling were used to allow accurate quantification of the various acid-base species present in the mixtures. Results showed that the G-quadruplex and i-motif coexist with the Watson-Crick duplex over the pH range from 3.0 to 6.5, approximately, under the experimental conditions tested in this study. At pH 7.0, the duplex is practically the only species present.

RNA synthesis is modulated by G-quadruplex formation in Hepatitis C virus negative RNA strand.

Science.gov (United States)

Chloé, Jaubert; Amina, Bedrat; Laura, Bartolucci; Carmelo, Di Primo; Michel, Ventura; Jean-Louis, Mergny; Samir, Amrane; Marie-Line, Andreola

2018-05-25

DNA and RNA guanine-rich oligonucleotides can form non-canonical structures called G-quadruplexes or "G4" that are based on the stacking of G-quartets. The role of DNA and RNA G4 is documented in eukaryotic cells and in pathogens such as viruses. Yet, G4 have been identified only in a few RNA viruses, including the Flaviviridae family. In this study, we analysed the last 157 nucleotides at the 3'end of the HCV (-) strand. This sequence is known to be the minimal sequence required for an efficient RNA replication. Using bioinformatics and biophysics, we identified a highly conserved G4-prone sequence located in the stem-loop IIy' of the negative strand. We also showed that the formation of this G-quadruplex inhibits the in vitro RNA synthesis by the RdRp. Furthermore, Phen-DC3, a specific G-quadruplex binder, is able to inhibit HCV viral replication in cells in conditions where no cytotoxicity was measured. Considering that this domain of the negative RNA strand is well conserved among HCV genotypes, G4 ligands could be of interest for new antiviral therapies.

Multifunctional energy landscape for a DNA G-quadruplex: An evolved molecular switch

Czech Academy of Sciences Publication Activity Database

Cragnolini, T.; Chakraborty, D.; Šponer, Jiří; Derreumaux, P.; Pasquali, S.; Wales, D.J.

2017-01-01

Roč. 147, č. 15 (2017), č. článku 152715. ISSN 0021-9606 R&D Projects: GA ČR(CZ) GA16-13721S Institutional support: RVO:68081707 Keywords : telomeric g-quadruplex * gb1 hairpin peptide Subject RIV: CF - Physical ; Theoretical Chemistry OBOR OECD: Physical chemistry Impact factor: 2.965, year: 2016

Multimerization rules for G-quadruplexes

Czech Academy of Sciences Publication Activity Database

Kolesnikova, Sofia; Hubálek, Martin; Bednárová, Lucie; Cvačka, Josef; Curtis, Edward A.

2017-01-01

Roč. 45, č. 15 (2017), s. 8684-8696 ISSN 0305-1048 Institutional support: RVO:61388963 Keywords : tetramolecular G-quadruplexes * RNA G-quadruplexes * circular dichroism Subject RIV: CE - Biochemistry OBOR OECD: Biochemistry and molecular biology Impact factor: 10.162, year: 2016 https://academic.oup.com/nar/article/45/15/8684/4002725/Multimerization-rules-for-Gquadruplexes

Expression of Telomere-Associated Proteins is Interdependent to Stabilize Native Telomere Structure and Telomere Dysfunction by G-Quadruplex Ligand Causes TERRA Upregulation.

Science.gov (United States)

Sadhukhan, Ratan; Chowdhury, Priyanka; Ghosh, Sourav; Ghosh, Utpal

2018-06-01

Telomere DNA can form specialized nucleoprotein structure with telomere-associated proteins to hide free DNA ends or G-quadruplex structures under certain conditions especially in presence of G-quadruplex ligand. Telomere DNA is transcribed to form non-coding telomere repeat-containing RNA (TERRA) whose biogenesis and function is poorly understood. Our aim was to find the role of telomere-associated proteins and telomere structures in TERRA transcription. We silenced four [two shelterin (TRF1, TRF2) and two non-shelterin (PARP-1, SLX4)] telomere-associated genes using siRNA and verified depletion in protein level. Knocking down of one gene modulated expression of other telomere-associated genes and increased TERRA from 10q, 15q, XpYp and XqYq chromosomes in A549 cells. Telomere was destabilized or damaged by G-quadruplex ligand pyridostatin (PDS) and bleomycin. Telomere dysfunction-induced foci (TIFs) were observed for each case of depletion of proteins, treatment with PDS or bleomycin. TERRA level was elevated by PDS and bleomycin treatment alone or in combination with depletion of telomere-associated proteins.

Exploring the Dynamics of Propeller Loops in Human Telomeric DNA Quadruplexes Using Atomistic Simulations

Science.gov (United States)

2017-01-01

We have carried out a series of extended unbiased molecular dynamics (MD) simulations (up to 10 μs long, ∼162 μs in total) complemented by replica-exchange with the collective variable tempering (RECT) approach for several human telomeric DNA G-quadruplex (GQ) topologies with TTA propeller loops. We used different AMBER DNA force-field variants and also processed simulations by Markov State Model (MSM) analysis. The slow conformational transitions in the propeller loops took place on a scale of a few μs, emphasizing the need for long simulations in studies of GQ dynamics. The propeller loops sampled similar ensembles for all GQ topologies and for all force-field dihedral-potential variants. The outcomes of standard and RECT simulations were consistent and captured similar spectrum of loop conformations. However, the most common crystallographic loop conformation was very unstable with all force-field versions. Although the loss of canonical γ-trans state of the first propeller loop nucleotide could be related to the indispensable bsc0 α/γ dihedral potential, even supporting this particular dihedral by a bias was insufficient to populate the experimentally dominant loop conformation. In conclusion, while our simulations were capable of providing a reasonable albeit not converged sampling of the TTA propeller loop conformational space, the force-field description still remained far from satisfactory. PMID:28475322

Cockayne syndrome group A and B proteins converge on transcription-linked resolution of non-B DNA

DEFF Research Database (Denmark)

Scheibye-Knudsen, Morten; Tseng, Anne; Jensen, Martin Borch

2016-01-01

of CSA or CSB in a neuroblastoma cell line converges on mitochondrial dysfunction caused by defects in ribosomal DNA transcription and activation of the DNA damage sensor poly-ADP ribose polymerase 1 (PARP1). Indeed, inhibition of ribosomal DNA transcription leads to mitochondrial dysfunction in a number...... to polymerase stalling at non-B DNA in a neuroblastoma cell line, in particular at G-quadruplex structures, and recombinant CSB can melt G-quadruplex structures. Indeed, stabilization of G-quadruplex structures activates PARP1 and leads to accelerated aging in Caenorhabditis elegans. In conclusion, this work...

G Quadruplex in Plants: A Ubiquitous Regulatory Element and Its Biological Relevance.

Science.gov (United States)

Yadav, Vikas; Hemansi; Kim, Nayun; Tuteja, Narendra; Yadav, Puja

2017-01-01

G quadruplexes (G4) are higher-order DNA and RNA secondary structures formed by G-rich sequences that are built around tetrads of hydrogen-bonded guanine bases. Potential G4 quadruplex sequences have been identified in G-rich eukaryotic non-telomeric and telomeric genomic regions. Upon function, G4 formation is known to involve in chromatin remodeling, gene regulation and has been associated with genomic instability, genetic diseases and cancer progression. The natural role and biological validation of G4 structures is starting to be explored, and is of particular interest for the therapeutic interventions for human diseases. However, the existence and physiological role of G4 DNA and G4 RNA in plants species have not been much investigated yet and therefore, is of great interest for the development of improved crop varieties for sustainable agriculture. In this context, several recent studies suggests that these highly diverse G4 structures in plants can be employed to regulate expression of genes involved in several pathophysiological conditions including stress response to biotic and abiotic stresses as well as DNA damage. In the current review, we summarize the recent findings regarding the emerging functional significance of G4 structures in plants and discuss their potential value in the development of improved crop varieties.

G Quadruplex in Plants: A Ubiquitous Regulatory Element and Its Biological Relevance

Directory of Open Access Journals (Sweden)

Vikas Yadav

2017-07-01

Full Text Available G quadruplexes (G4 are higher-order DNA and RNA secondary structures formed by G-rich sequences that are built around tetrads of hydrogen-bonded guanine bases. Potential G4 quadruplex sequences have been identified in G-rich eukaryotic non-telomeric and telomeric genomic regions. Upon function, G4 formation is known to involve in chromatin remodeling, gene regulation and has been associated with genomic instability, genetic diseases and cancer progression. The natural role and biological validation of G4 structures is starting to be explored, and is of particular interest for the therapeutic interventions for human diseases. However, the existence and physiological role of G4 DNA and G4 RNA in plants species have not been much investigated yet and therefore, is of great interest for the development of improved crop varieties for sustainable agriculture. In this context, several recent studies suggests that these highly diverse G4 structures in plants can be employed to regulate expression of genes involved in several pathophysiological conditions including stress response to biotic and abiotic stresses as well as DNA damage. In the current review, we summarize the recent findings regarding the emerging functional significance of G4 structures in plants and discuss their potential value in the development of improved crop varieties.

A label-free ultrasensitive fluorescence detection of viable Salmonella enteritidis using enzyme-induced cascade two-stage toehold strand-displacement-driven assembly of G-quadruplex DNA.

Science.gov (United States)

Zhang, Peng; Liu, Hui; Ma, Suzhen; Men, Shuai; Li, Qingzhou; Yang, Xin; Wang, Hongning; Zhang, Anyun

2016-06-15

The harm of Salmonella enteritidis (S. enteritidis ) to public health mainly by contaminating fresh food and water emphasizes the urgent need for rapid detection techniques to help control the spread of the pathogen. In this assay, an newly designed capture probe complex that contained specific S. enteritidis-aptamer and hybridized signal target sequence was used for viable S. enteritidis recognition directly. In the presence of the target S. enteritidis, single-stranded target sequences were liberated and initiated the replication-cleavage reaction, producing numerous G-quadruplex structures with a linker on the 3'-end. And then, the sensing system took innovative advantage of quadratic linker-induced strand-displacement for the first time to release target sequence in succession, leading to the cyclic reuse of the target sequences and cascade signal amplification, thereby achieving the successive production of G-quadruplex structures. The fluorescent dye, N-Methyl mesoporphyrin IX, binded to these G-quadruplex structures and generated significantly enhanced fluorescent signals to achieve highly sensitive detection of S. enteritidis down to 60 CFU/mL with a linear range from 10(2) to 10(7)CFU/mL. By coupling the cascade two-stage target sequences-recyclable toehold strand-displacement with aptamer-based target recognition successfully, it is the first report on a novel non-label, modification-free and DNA extraction-free ultrasensitive fluorescence biosensor for detecting viable S. enteritidis directly, which can discriminate from dead S. enteritidis. Copyright © 2016 Elsevier B.V. All rights reserved.

Real-Time Study of the Interaction between G-Rich DNA Oligonucleotides and Lead Ion on DNA Tetrahedron-Functionalized Sensing Platform by Dual Polarization Interferometry.

Science.gov (United States)

Wang, Shuang; Lu, Shasha; Zhao, Jiahui; Huang, Jianshe; Yang, Xiurong

2017-11-29

G-quadruplex plays roles in numerous physiological and pathological processes of organisms. Due to the unique properties of G-quadruplex (e.g., forming G4/hemin complexes with catalytic activity and electron acceptability, binding with metal ions, proteins, fluorescent ligands, and so on), it has been widely applied in biosensing. But the formation process of G-quadruplex is not yet fully understood. Here, a DNA tetrahedron platform with higher reproducibility, regenerative ability, and time-saving building process was coupled with dual polarization interferometry technique for the real-time and label-free investigation of the specific interaction process of guanine-rich singled-stranded DNA (G-rich ssDNA) and Pb 2+ . The oriented immobilization of probes greatly decreased the spatial hindrance effect and improved the accessibility of the probes to the Pb 2+ ions. Through real-time monitoring of the whole formation process of the G-quadruplex, we speculated that the probes on the tetrahedron platform initially stood on the sensing surface with a random coil conformation, then the G-rich ssDNA preliminarily formed unstable G-quartets by H-bonding and cation binding, subsequently forming a completely folded and stable quadruplex structure through relatively slow strand rearrangements. On the basis of these studies, we also developed a novel sensing platform for the specific and sensitive determination of Pb 2+ and its chelating agent ethylenediaminetetraacetic acid. This study not only provides a proof-of-concept for conformational dynamics of G-quadruplex-related drugs and pathogenes, but also enriches the biosensor tools by combining nanomaterial with interfaces technique.

Label-free logic modules and two-layer cascade based on stem-loop probes containing a G-quadruplex domain.

Science.gov (United States)

Guo, Yahui; Cheng, Junjie; Wang, Jine; Zhou, Xiaodong; Hu, Jiming; Pei, Renjun

2014-09-01

A simple, versatile, and label-free DNA computing strategy was designed by using toehold-mediated strand displacement and stem-loop probes. A full set of logic gates (YES, NOT, OR, NAND, AND, INHIBIT, NOR, XOR, XNOR) and a two-layer logic cascade were constructed. The probes contain a G-quadruplex domain, which was blocked or unfolded through inputs initiating strand displacement and the obviously distinguishable light-up fluorescent signal of G-quadruplex/NMM complex was used as the output readout. The inputs are the disease-specific nucleotide sequences with potential for clinic diagnosis. The developed versatile computing system based on our label-free and modular strategy might be adapted in multi-target diagnosis through DNA hybridization and aptamer-target interaction. © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Multifunctional energy landscape for a DNA G-quadruplex: An evolved molecular switch

Science.gov (United States)

Cragnolini, Tristan; Chakraborty, Debayan; Šponer, Jiří; Derreumaux, Philippe; Pasquali, Samuela; Wales, David J.

2017-10-01

We explore the energy landscape for a four-fold telomere repeat, obtaining interconversion pathways between six experimentally characterised G-quadruplex topologies. The results reveal a multi-funnel system, with a variety of intermediate configurations and misfolded states. This organisation is identified with the intrinsically multi-functional nature of the system, suggesting a new paradigm for the classification of such biomolecules and clarifying issues regarding apparently conflicting experimental results.

Stwl modifies chromatin compaction and is required to maintain DNA integrity in the presence of perturbed DNA replication

NARCIS (Netherlands)

Yi, X.; Vries, de H.I.; Siudeja, K.; Rana, A.; Lemstra, W.; Brunsting, J.F.; Kok, R.J.M.; Smulders, Y.M.; Schaefer, M.; Dijk, F.; Shang, Y.F.; Eggen, B.J.L.; Kampinga, H.H.; Sibon, O.C.M.

2009-01-01

Hydroxyurea, a well-known DNA replication inhibitor, induces cell cycle arrest and intact checkpoint functions are required to survive DNA replication stress induced by this genotoxic agent. Perturbed DNA synthesis also results in elevated levels of DNA damage. It is unclear how organisms prevent

Stwl Modifies Chromatin Compaction and Is Required to Maintain DNA Integrity in the Presence of Perturbed DNA Replication

NARCIS (Netherlands)

Yi, Xia; Vries, Hilda I. de; Siudeja, Katarzyna; Rana, Anil; Lemstra, Willy; Brunsting, Jeanette F.; Kok, Rob M.; Smulders, Yvo M.; Schaefer, Matthias; Dijk, Freark; Shang, Yongfeng; Eggen, Bart J.L.; Kampinga, Harm H.; Sibon, Ody C.M.

Hydroxyurea, a well-known DNA replication inhibitor, induces cell cycle arrest and intact checkpoint functions are required to survive DNA replication stress induced by this genotoxic agent. Perturbed DNA synthesis also results in elevated levels of DNA damage. It is unclear how organisms prevent

Identification of a New G-Quadruplex Motif in the KRAS Promoter and Design of Pyrene-Modified G4-Decoys with Antiproliferative Activity in Pancreatic Cancer Cells

DEFF Research Database (Denmark)

Cogoi, Susanna; Paramasivam, Manikandan; Filitchev, Vyacheslav Viatcheslav

2009-01-01

A new quadruplex motif located in the promoter of the human KRAS gene, within a nuclease hypersensitive element (NHE), has been characterized. Oligonucleotides mimicking this quadruplex are found to compete with a DNA-protein complex between NHE and a nuclear extract from pancreatic cancer cells........ When modified with (R)-1-O-[4-1-(1-pyrenylethynyl) phenylmethyl]glycerol insertions (TINA), the quadruplex oligonucleotides showed a dramatic increase of the Tm (ΔTm from 22 to 32 °C) and a strong antiproliferative effects in Panc-1 cells....

Investigation of ‘Head-to-Tail’-Connected Oligoaryl N,O-Ligands as Recognition Motifs for Cancer-Relevant G-Quadruplexes

Directory of Open Access Journals (Sweden)

Natalia Rizeq

2017-12-01

Full Text Available Oligomeric compounds, constituted of consecutive N,O-heteroaromatic rings, introduce useful and tunable properties as alternative ligands for biomolecular recognition. In this study, we have explored a synthetic scheme relying on Van Leusen oxazole formation, in conjunction with C–H activation of the formed oxazoles and their subsequent C–C cross-coupling to 2-bromopyridines in order to assemble a library of variable-length, ‘head-to-tail’-connected, pyridyl-oxazole ligands. Through investigation of the interaction of the three longer ligands (5-mer, 6-mer, 7-mer with cancer-relevant G-quadruplex structures (human telomeric/22AG and c-Myc oncogene promoter/Myc2345-Pu22, the asymmetric pyridyl-oxazole motif has been demonstrated to be a prominent recognition element for G-quadruplexes. Fluorescence titrations reveal excellent binding affinities of the 7-mer and 6-mer for a Na+-induced antiparallel 22AG G-quadruplex (KD = 0.6 × 10−7 M−1 and 0.8 × 10−7 M−1, respectively, and satisfactory (albeit lower affinities for the 22AG/K+ and Myc2345-Pu22/K+ G-quadruplexes. All ligands tested exhibit substantial selectivity for G-quadruplex versus duplex (ds26 DNA, as evidenced by competitive Förster resonance energy transfer (FRET melting assays. Additionally, the 7-mer and 6-mer are capable of promoting a sharp morphology transition of 22AG/K+ G-quadruplex.

Fully integrated graphene electronic biosensor for label-free detection of lead (II) ion based on G-quadruplex structure-switching.

Science.gov (United States)

Li, Yijun; Wang, Cheng; Zhu, Yibo; Zhou, Xiaohong; Xiang, Yu; He, Miao; Zeng, Siyu

2017-03-15

This work presents a fully integrated graphene field-effect transistor (GFET) biosensor for the label-free detection of lead ions (Pb 2+ ) in aqueous-media, which first implements the G-quadruplex structure-switching biosensing principle in graphene nanoelectronics. We experimentally illustrate the biomolecular interplay that G-rich DNA single-strands with one-end confined on graphene surface can specifically interact with Pb 2+ ions and switch into G-quadruplex structures. Since the structure-switching of electrically charged DNA strands can disrupt the charge distribution in the vicinity of graphene surface, the carrier equilibrium in graphene sheet might be altered, and manifested by the conductivity variation of GFET. The experimental data and theoretical analysis show that our devices are capable of the label-free and specific quantification of Pb 2+ with a detection limit down to 163.7ng/L. These results first verify the signaling principle competency of G-quadruplex structure-switching in graphene electronic biosensors. Combining with the advantages of the compact device structure and convenient electrical signal, a label-free GFET biosensor for Pb 2+ monitoring is enabled with promising application potential. Copyright © 2016 Elsevier B.V. All rights reserved.

Spectroscopic insights into quadruplexes of five-repeat telomere DNA sequences upon G-block damage

Czech Academy of Sciences Publication Activity Database

Dvořáková, Zuzana; Vorlíčková, Michaela; Renčiuk, Daniel

2017-01-01

Roč. 1861, č. 11 (2017), s. 2750-2757 ISSN 0304-4165 R&D Projects: GA ČR(CZ) GJ17-19170Y Institutional support: RVO:68081707 Keywords : k+ solution * guanine quadruplexes Subject RIV: CE - Biochemistry OBOR OECD: Biochemistry and molecular biology Impact factor: 4.702, year: 2016

Quadruplex-forming sequences occupy discrete regions inside plant LTR retrotransposons

Czech Academy of Sciences Publication Activity Database

Lexa, M.; Kejnovský, Eduard; Šteflová, Pavlína; Konvalinová, H.; Vorlíčková, Michaela; Vyskot, Boris

2014-01-01

Roč. 42, č. 2 (2014), s. 968-978 ISSN 0305-1048 R&D Projects: GA ČR(CZ) GAP205/12/0466; GA ČR(CZ) GAP305/10/0930; GA ČR(CZ) GAP501/10/0102; GA ČR(CZ) GA522/09/0083; GA ČR GPP501/10/P483 Institutional support: RVO:68081707 Keywords : INTRAMOLECULAR DNA QUADRUPLEXES * VIRUS TYPE-1 RNA * CIRCULAR-DICHROISM Subject RIV: BO - Biophysics Impact factor: 9.112, year: 2014

Triplex intermediates in folding of human telomeric quadruplexes probed by microsecond-scale molecular dynamics simulations

Czech Academy of Sciences Publication Activity Database

Stadlbauer, Petr; Trantírek, L.; Cheatham III, T. E.; Koča, J.; Šponer, Jiří

105C, OCT2014 (2014), s. 22-35 ISSN 0300-9084 R&D Projects: GA ČR(CZ) GAP208/12/1822; GA ČR(CZ) GA13-28310S Institutional support: RVO:68081707 Keywords : G-DNA folding * Quadruplex * Triplex Subject RIV: BO - Biophysics Impact factor: 2.963, year: 2014

Hairpins participating in folding of human telomeric sequence quadruplexes studied by standard and T-REMD simulations

Czech Academy of Sciences Publication Activity Database

Stadlbauer, Petr; Kuehrova, P.; Banáš, P.; Koča, J.; Bussi, G.; Trantírek, L.; Otyepka, M.; Šponer, Jiří

2016-01-01

Roč. 43, č. 20 (2016), s. 9626-9644 ISSN 0305-1048 R&D Projects: GA ČR(CZ) GAP208/11/1822 Institutional support: RVO:68081707 Keywords : MOLECULAR-DYNAMICS SIMULATIONS * INTRAMOLECULAR DNA QUADRUPLEXES * PARTICLE MESH EWALD Subject RIV: BO - Biophysics Impact factor: 10.162, year: 2016

G-Quadruplex Forming Oligonucleotides as Anti-HIV Agents.

Science.gov (United States)

Musumeci, Domenica; Riccardi, Claudia; Montesarchio, Daniela

2015-09-22

Though a variety of different non-canonical nucleic acids conformations have been recognized, G-quadruplex structures are probably the structural motifs most commonly found within known oligonucleotide-based aptamers. This could be ascribed to several factors, as their large conformational diversity, marked responsiveness of their folding/unfolding processes to external stimuli, high structural compactness and chemo-enzymatic and thermodynamic stability. A number of G-quadruplex-forming oligonucleotides having relevant in vitro anti-HIV activity have been discovered in the last two decades through either SELEX or rational design approaches. Improved aptamers have been obtained by chemical modifications of natural oligonucleotides, as terminal conjugations with large hydrophobic groups, replacement of phosphodiester linkages with phosphorothioate bonds or other surrogates, insertion of base-modified monomers, etc. In turn, detailed structural studies have elucidated the peculiar architectures adopted by many G-quadruplex-based aptamers and provided insight into their mechanism of action. An overview of the state-of-the-art knowledge of the relevance of putative G-quadruplex forming sequences within the viral genome and of the most studied G-quadruplex-forming aptamers, selectively targeting HIV proteins, is here presented.

A light-up probe targeting for Bcl-2 2345 G-quadruplex DNA with carbazole TO

Science.gov (United States)

Gu, Yingchun; Lin, Dayong; Tang, Yalin; Fei, Xuening; Wang, Cuihong; Zhang, Baolian; Zhou, Jianguo

2018-02-01

As its significant role, the selective recognition of G-quadruplex with specific structures and functions is important in biological and medicinal chemistry. Carbazole derivatives have been reported as a kind of fluorescent probe with many excellent optical properties. In the present study, the fluorescence of the dye (carbazole TO) increased almost 70 fold in the presence of bcl-2 2345 G4 compared to that alone in aqueous buffer condition with almost no fluorescence and 10-30 fold than those in the presence of other DNAs. The binding study results by activity inhibition of G4/Hemin peroxidase experiment, NMR titration and molecular docking simulation showed the high affinity and selectivity to bcl-2 2345 G4 arises from its end-stacking interaction with G-quartet. It is said that a facile approach with excellent sensitive, good selectivity and quick response for bcl-2 2345 G-quadruplex was developed and may be used for antitumor recognition or antitumor agents.

Synthesis of potent G-quadruplex binders of macrocyclic heptaoxazole and evaluation of their activities.

Science.gov (United States)

Tera, Masayuki; Iida, Keisuke; Shin-ya, Kazuo; Nagasawa, Kazuo

2009-01-01

Guanine-rich DNA sequences form unique three-dimensional conformation known as G-quadruplexes (G-q). G-q structures have been found in telomere and in some oncogene promoter. Recently, it was suggested that G-q showed some biological activities including telomere shortening and transcriptional regulation. In this paper, we synthesized selective G-q binders and evaluated of their biological activities.

RecQ-core of BLM unfolds telomeric G-quadruplex in the absence of ATP

Czech Academy of Sciences Publication Activity Database

Budhathoki, J.B.; Ray, S.; Urban, Václav; Janščák, Pavel; Jodh, J.G.; Balci, H.

2014-01-01

Roč. 42, č. 18 (2014), s. 11528-11545 ISSN 0305-1048 R&D Projects: GA ČR GA204/09/0565 Grant - others:U.S. National Science Foundation through the Physics Frontiers Center Program(US) 1430124 Institutional support: RVO:68378050 Keywords : single-stranded DNA * RECQ5 helicase * G-quadruplex structures Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 9.112, year: 2014

Thioflavin T binds dimeric parallel-stranded GA-containing non-G-quadruplex DNAs: a general approach to lighting up double-stranded scaffolds.

Science.gov (United States)

Liu, Shuangna; Peng, Pai; Wang, Huihui; Shi, Lili; Li, Tao

2017-12-01

A molecular rotor thioflavin T (ThT) is usually used as a fluorescent ligand specific for G-quadruplexes. Here, we demonstrate that ThT can tightly bind non-G-quadruplex DNAs with several GA motifs and dimerize them in a parallel double-stranded mode, accompanied by over 100-fold enhancement in the fluorescence emission of ThT. The introduction of reverse Watson-Crick T-A base pairs into these dimeric parallel-stranded DNA systems remarkably favors the binding of ThT into the pocket between G•G and A•A base pairs, where ThT is encapsulated thereby restricting its two rotary aromatic rings in the excited state. A similar mechanism is also demonstrated in antiparallel DNA duplexes where several motifs of two consecutive G•G wobble base pairs are incorporated and serve as the active pockets for ThT binding. The insight into the interactions of ThT with non-G-quadruplex DNAs allows us to introduce a new concept for constructing DNA-based sensors and devices. As proof-of-concept experiments, we design a DNA triplex containing GA motifs in its Hoogsteen hydrogen-bonded two parallel strands as a pH-driven nanoswitch and two GA-containing parallel duplexes as novel metal sensing platforms where C-C and T-T mismatches are included. This work may find further applications in biological systems (e.g. disease gene detection) where parallel duplex or triplex stretches are involved. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.

Tetrahelical structural family adopted by AGCGA-rich regulatory DNA regions

Science.gov (United States)

Kocman, Vojč; Plavec, Janez

2017-05-01

Here we describe AGCGA-quadruplexes, an unexpected addition to the well-known tetrahelical families, G-quadruplexes and i-motifs, that have been a focus of intense research due to their potential biological impact in G- and C-rich DNA regions, respectively. High-resolution structures determined by solution-state nuclear magnetic resonance (NMR) spectroscopy demonstrate that AGCGA-quadruplexes comprise four 5'-AGCGA-3' tracts and are stabilized by G-A and G-C base pairs forming GAGA- and GCGC-quartets, respectively. Residues in the core of the structure are connected with edge-type loops. Sequences of alternating 5'-AGCGA-3' and 5'-GGG-3' repeats could be expected to form G-quadruplexes, but are shown herein to form AGCGA-quadruplexes instead. Unique structural features of AGCGA-quadruplexes together with lower sensitivity to cation and pH variation imply their potential biological relevance in regulatory regions of genes responsible for basic cellular processes that are related to neurological disorders, cancer and abnormalities in bone and cartilage development.

Phenanthroline-2,9-bistriazoles as selective G-quadruplex ligands

DEFF Research Database (Denmark)

Nielsen, Mads Corvinius; Larsen, Anders Foller; Abdikadir, Faisal Hussein

2014-01-01

G-quadruplex (G4) ligands are currently receiving considerable attention as potential anticancer therapeutics. A series of phenanthroline-2,9-bistriazoles carrying tethered positive end groups has been synthesized and evaluated as G4 stabilizers. The compounds were efficiently assembled by copper......(I)-catalyzed azide-alkyne cycloaddition (CuAAC) in CH2Cl2 and water in the presence of a complexing agent. Characterization of the target compounds on telomeric and c-KIT G4 sequences led to the identification of guanidinium-substituted compounds as potent G4 DNA ligands with high selectivity over duplex DNA....... The diisopropylguanidium ligands exhibited high selectivity for the proto-oncogenic sequence c-KIT over the human telomeric sequence in the surface plasmon resonance (SPR) assay, whereas the compounds appeared potent on both G4 structures in the FRET melting temperature assay. The phenanthroline-2,9-bistriazole ligands...

New insights into transcription fidelity: thermal stability of non-canonical structures in template DNA regulates transcriptional arrest, pause, and slippage.

Science.gov (United States)

Tateishi-Karimata, Hisae; Isono, Noburu; Sugimoto, Naoki

2014-01-01

The thermal stability and topology of non-canonical structures of G-quadruplexes and hairpins in template DNA were investigated, and the effect of non-canonical structures on transcription fidelity was evaluated quantitatively. We designed ten template DNAs: A linear sequence that does not have significant higher-order structure, three sequences that form hairpin structures, and six sequences that form G-quadruplex structures with different stabilities. Templates with non-canonical structures induced the production of an arrested, a slipped, and a full-length transcript, whereas the linear sequence produced only a full-length transcript. The efficiency of production for run-off transcripts (full-length and slipped transcripts) from templates that formed the non-canonical structures was lower than that from the linear. G-quadruplex structures were more effective inhibitors of full-length product formation than were hairpin structure even when the stability of the G-quadruplex in an aqueous solution was the same as that of the hairpin. We considered that intra-polymerase conditions may differentially affect the stability of non-canonical structures. The values of transcription efficiencies of run-off or arrest transcripts were correlated with stabilities of non-canonical structures in the intra-polymerase condition mimicked by 20 wt% polyethylene glycol (PEG). Transcriptional arrest was induced when the stability of the G-quadruplex structure (-ΔG°37) in the presence of 20 wt% PEG was more than 8.2 kcal mol(-1). Thus, values of stability in the presence of 20 wt% PEG are an important indicator of transcription perturbation. Our results further our understanding of the impact of template structure on the transcription process and may guide logical design of transcription-regulating drugs.

Exploring the Interactions of the Dietary Plant Flavonoids Fisetin and Naringenin with G-Quadruplex and Duplex DNA, Showing Contrasting Binding Behavior: Spectroscopic and Molecular Modeling Approaches.

Science.gov (United States)

Bhattacharjee, Snehasish; Chakraborty, Sandipan; Sengupta, Pradeep K; Bhowmik, Sudipta

2016-09-01

Guanine-rich sequences have the propensity to fold into a four-stranded DNA structure known as a G-quadruplex (G4). G4 forming sequences are abundant in the promoter region of several oncogenes and become a key target for anticancer drug binding. Here we have studied the interactions of two structurally similar dietary plant flavonoids fisetin and naringenin with G4 as well as double stranded (duplex) DNA by using different spectroscopic and modeling techniques. Our study demonstrates the differential binding ability of the two flavonoids with G4 and duplex DNA. Fisetin more strongly interacts with parallel G4 structure than duplex DNA, whereas naringenin shows stronger binding affinity to duplex rather than G4 DNA. Molecular docking results also corroborate our spectroscopic results, and it was found that both of the ligands are stacked externally in the G4 DNA structure. C-ring planarity of the flavonoid structure appears to be a crucial factor for preferential G4 DNA recognition of flavonoids. The goal of this study is to explore the critical effects of small differences in the structure of closely similar chemical classes of such small molecules (flavonoids) which lead to the contrasting binding properties with the two different forms of DNA. The resulting insights may be expected to facilitate the designing of the highly selective G4 DNA binders based on flavonoid scaffolds.

Altered biochemical specificity of G-quadruplexes with mutated tetrads

Czech Academy of Sciences Publication Activity Database

Švehlová, Kateřina; Lawrence, M. S.; Bednárová, Lucie; Curtis, Edward A.

2016-01-01

Roč. 44, č. 22 (2016), s. 10789-10803 ISSN 0305-1048 Institutional support: RVO:61388963 Keywords : G-quadruplex * G motif GTP aptamer * peroxidase deoxyribozyme Subject RIV: CE - Biochemistry Impact factor: 10.162, year: 2016 https://academic.oup.com/nar/article/44/22/10789/2333933/Altered-biochemical-specificity-of-G-quadruplexes

Yeast Sub1 and human PC4 are G-quadruplex binding proteins that suppress genome instability at co-transcriptionally formed G4 DNA.

Science.gov (United States)

Lopez, Christopher R; Singh, Shivani; Hambarde, Shashank; Griffin, Wezley C; Gao, Jun; Chib, Shubeena; Yu, Yang; Ira, Grzegorz; Raney, Kevin D; Kim, Nayun

2017-06-02

G-quadruplex or G4 DNA is a non-B secondary DNA structure consisting of a stacked array of guanine-quartets that can disrupt critical cellular functions such as replication and transcription. When sequences that can adopt Non-B structures including G4 DNA are located within actively transcribed genes, the reshaping of DNA topology necessary for transcription process stimulates secondary structure-formation thereby amplifying the potential for genome instability. Using a reporter assay designed to study G4-induced recombination in the context of an actively transcribed locus in Saccharomyces cerevisiae, we tested whether co-transcriptional activator Sub1, recently identified as a G4-binding factor, contributes to genome maintenance at G4-forming sequences. Our data indicate that, upon Sub1-disruption, genome instability linked to co-transcriptionally formed G4 DNA in Top1-deficient cells is significantly augmented and that its highly conserved DNA binding domain or the human homolog PC4 is sufficient to suppress G4-associated genome instability. We also show that Sub1 interacts specifically with co-transcriptionally formed G4 DNA in vivo and that yeast cells become highly sensitivity to G4-stabilizing chemical ligands by the loss of Sub1. Finally, we demonstrate the physical and genetic interaction of Sub1 with the G4-resolving helicase Pif1, suggesting a possible mechanism by which Sub1 suppresses instability at G4 DNA. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.

A Molecular Toolbox to Engineer Site-Specific DNA Replication Perturbation.

Science.gov (United States)

Larsen, Nicolai B; Hickson, Ian D; Mankouri, Hocine W

2018-01-01

Site-specific arrest of DNA replication is a useful tool for analyzing cellular responses to DNA replication perturbation. The E. coli Tus-Ter replication barrier can be reconstituted in eukaryotic cells as a system to engineer an unscheduled collision between a replication fork and an "alien" impediment to DNA replication. To further develop this system as a versatile tool, we describe a set of reagents and a detailed protocol that can be used to engineer Tus-Ter barriers into any locus in the budding yeast genome. Because the Tus-Ter complex is a bipartite system with intrinsic DNA replication-blocking activity, the reagents and protocols developed and validated in yeast could also be optimized to engineer site-specific replication fork barriers into other eukaryotic cell types.

A Molecular Toolbox to Engineer Site-Specific DNA Replication Perturbation

DEFF Research Database (Denmark)

Larsen, Nicolai B; Hickson, Ian D; Mankouri, Hocine W

2018-01-01

" impediment to DNA replication. To further develop this system as a versatile tool, we describe a set of reagents and a detailed protocol that can be used to engineer Tus-Ter barriers into any locus in the budding yeast genome. Because the Tus-Ter complex is a bipartite system with intrinsic DNA replication......Site-specific arrest of DNA replication is a useful tool for analyzing cellular responses to DNA replication perturbation. The E. coli Tus-Ter replication barrier can be reconstituted in eukaryotic cells as a system to engineer an unscheduled collision between a replication fork and an "alien......-blocking activity, the reagents and protocols developed and validated in yeast could also be optimized to engineer site-specific replication fork barriers into other eukaryotic cell types....

Voltammetry and Molecular Assembly of G-quadruplex DNAzyme on Single-crystal Au(111)-electrode Surfaces – Hemin as an Electrochemical Intercalator

DEFF Research Database (Denmark)

Zhang, Ling; Ulstrup, Jens; Zhang, Jingdong

2016-01-01

DNA quadruplexes (qs’s) are a class of “non-canonical” oligonucleotides (OGNs) composed of stacked guanine (G) quartets generally stabilized by monovalent cations. Metal porphyrins selectively bind to G-qs complexes to form DNAzyme, which can exhibit peroxidase and other catalytic activity simila...

Identifying the impact of G-quadruplexes on Affymetrix 3' arrays using cloud computing.

Science.gov (United States)

Memon, Farhat N; Owen, Anne M; Sanchez-Graillet, Olivia; Upton, Graham J G; Harrison, Andrew P

2010-01-15

A tetramer quadruplex structure is formed by four parallel strands of DNA/ RNA containing runs of guanine. These quadruplexes are able to form because guanine can Hoogsteen hydrogen bond to other guanines, and a tetrad of guanines can form a stable arrangement. Recently we have discovered that probes on Affymetrix GeneChips that contain runs of guanine do not measure gene expression reliably. We associate this finding with the likelihood that quadruplexes are forming on the surface of GeneChips. In order to cope with the rapidly expanding size of GeneChip array datasets in the public domain, we are exploring the use of cloud computing to replicate our experiments on 3' arrays to look at the effect of the location of G-spots (runs of guanines). Cloud computing is a recently introduced high-performance solution that takes advantage of the computational infrastructure of large organisations such as Amazon and Google. We expect that cloud computing will become widely adopted because it enables bioinformaticians to avoid capital expenditure on expensive computing resources and to only pay a cloud computing provider for what is used. Moreover, as well as financial efficiency, cloud computing is an ecologically-friendly technology, it enables efficient data-sharing and we expect it to be faster for development purposes. Here we propose the advantageous use of cloud computing to perform a large data-mining analysis of public domain 3' arrays.

Amyloid Precursor Protein Translation Is Regulated by a 3'UTR Guanine Quadruplex.

Directory of Open Access Journals (Sweden)

Ezekiel Crenshaw

Full Text Available A central event in Alzheimer's disease is the accumulation of amyloid β (Aβ peptides generated by the proteolytic cleavage of the amyloid precursor protein (APP. APP overexpression leads to increased Aβ generation and Alzheimer's disease in humans and altered neuronal migration and increased long term depression in mice. Conversely, reduction of APP expression results in decreased Aβ levels in mice as well as impaired learning and memory and decreased numbers of dendritic spines. Together these findings indicate that therapeutic interventions that aim to restore APP and Aβ levels must do so within an ideal range. To better understand the effects of modulating APP levels, we explored the mechanisms regulating APP expression focusing on post-transcriptional regulation. Such regulation can be mediated by RNA regulatory elements such as guanine quadruplexes (G-quadruplexes, non-canonical structured RNA motifs that affect RNA stability and translation. Via a bioinformatics approach, we identified a candidate G-quadruplex within the APP mRNA in its 3'UTR (untranslated region at residues 3008-3027 (NM_201414.2. This sequence exhibited characteristics of a parallel G-quadruplex structure as revealed by circular dichroism spectrophotometry. Further, as with other G-quadruplexes, the formation of this structure was dependent on the presence of potassium ions. This G-quadruplex has no apparent role in regulating transcription or mRNA stability as wild type and mutant constructs exhibited equivalent mRNA levels as determined by real time PCR. Instead, we demonstrate that this G-quadruplex negatively regulates APP protein expression using dual luciferase reporter and Western blot analysis. Taken together, our studies reveal post-transcriptional regulation by a 3'UTR G-quadruplex as a novel mechanism regulating APP expression.

Clustered abasic lesions profoundly change the structure and stability of human telomeric G-quadruplexes

Czech Academy of Sciences Publication Activity Database

Kejnovská, Iva; Bednářová, Klára; Renčiuk, Daniel; Dvořáková, Zuzana; Školáková, Petra; Trantírek, L.; Fiala, R.; Vorlíčková, Michaela; Sagi, J.

2017-01-01

Roč. 45, č. 8 (2017), s. 4294-4305 ISSN 0305-1048 R&D Projects: GA MŠk EF15_003/0000477; GA ČR GAP205/12/0466; GA ČR GA13-28310S; GA ČR(CZ) GA15-06785S; GA MŠk(CZ) LQ1601 Institutional support: RVO:68081707 Keywords : dna-damage clusters * k+ solution * guanine quadruplexes Subject RIV: CE - Biochemistry OBOR OECD: Biochemistry and molecular biology Impact factor: 10.162, year: 2016

Macrocyclic G-quadruplex ligands

DEFF Research Database (Denmark)

Nielsen, M C; Ulven, Trond

2010-01-01

are macrocyclic structures which have been modeled after the natural product telomestatin or from porphyrin-based ligands discovered in the late 1990s. These two structural classes of G-quadruplex ligands are reviewed here with special attention to selectivity and structure-activity relationships, and with focus...

Monovalent cation induced structural transitions in telomeric DNAs: G-DNA folding intermediates

International Nuclear Information System (INIS)

Hardin, C.C.; Watson, T.; Henderson, E.; Prosser, J.K.

1991-01-01

Telomeric DNA consists of G- and C-rich strands that are always polarized such that the G-rich strand extends past the 3' end of the duplex to form a 12-16-base overhang. These overhanging strands can self-associate in vitro to form intramolecular structures that have several unusual physical properties and at least one common feature, the presence of non-Watson-Crick G·G base pairs. The term G-DNA was coined for this class of structures. On the basis of gel electrophoresis, imino proton NMR, and circular dichroism (CD) results, the authors find that changing the counterions from sodium to potassium specifically induces conformational transitions in the G-rich telomeric DNA from Tetrahymena, d(T 2 G 4 ) 4 (TET4), which results in a change from the intramolecular species to an apparent multistranded structure, accompanied by an increase in the melting temperature of the base pairs of >25 degree, as monitored by loss of the imino proton NMR signals. They infer that the multistranded structure is a quadruplex. The results indicate that specific differences in ionic interactions can result in a switch in telomeric DNAs between intramolecular hairpin-like or quadruplex-containing species and intermolecular quadruplex structures, all of which involve G·G base pairing interaction. They propose a model in which duplex or hairpin forms of G-DNA are folding intermediates in the formation of either 1-, 2-, or 4-stranded quadruplex structures

Perturbation of DNA replication and cell cycle progression by commonly used [3H]thymidine labeling protocols

International Nuclear Information System (INIS)

Hoy, C.A.; Lewis, E.D.; Schimke, R.T.

1990-01-01

The effect of tritiated thymidine incorporation on DNA replication was studied in Chinese hamster ovary cells. Rapidly eluting (small) DNA from cells labeled with 2 microCi of [ 3 H]thymidine per ml (200 microCi/mmol) for 60 min matured to a large nonelutable size within approximately 2 to 4 h, as measured by the alkaline elution technique. However, DNA from cells exposed to 10 microCi of [ 3 H]thymidine per ml (66 microCi/mmol) was more rapidly eluting initially and did not mature to a nonelutable size during subsequent incubation. Semiconservative DNA replication measured by cesium chloride gradient analysis of bromodeoxyuridine-substituted DNA was also found to be affected by the final specific activity of the [ 3 H]thymidine used in the labeling protocol. Dramatic cell cycle perturbations accompanied these effects on DNA replication, suggesting that labeling protocols commonly used to study DNA metabolism produce aberrant DNA replication and subsequent cell cycle perturbations

Cockayne syndrome group A and B proteins converge on transcription-linked resolution of non-B DNA.

Science.gov (United States)

Scheibye-Knudsen, Morten; Tseng, Anne; Borch Jensen, Martin; Scheibye-Alsing, Karsten; Fang, Evandro Fei; Iyama, Teruaki; Bharti, Sanjay Kumar; Marosi, Krisztina; Froetscher, Lynn; Kassahun, Henok; Eckley, David Mark; Maul, Robert W; Bastian, Paul; De, Supriyo; Ghosh, Soumita; Nilsen, Hilde; Goldberg, Ilya G; Mattson, Mark P; Wilson, David M; Brosh, Robert M; Gorospe, Myriam; Bohr, Vilhelm A

2016-11-01

Cockayne syndrome is a neurodegenerative accelerated aging disorder caused by mutations in the CSA or CSB genes. Although the pathogenesis of Cockayne syndrome has remained elusive, recent work implicates mitochondrial dysfunction in the disease progression. Here, we present evidence that loss of CSA or CSB in a neuroblastoma cell line converges on mitochondrial dysfunction caused by defects in ribosomal DNA transcription and activation of the DNA damage sensor poly-ADP ribose polymerase 1 (PARP1). Indeed, inhibition of ribosomal DNA transcription leads to mitochondrial dysfunction in a number of cell lines. Furthermore, machine-learning algorithms predict that diseases with defects in ribosomal DNA (rDNA) transcription have mitochondrial dysfunction, and, accordingly, this is found when factors involved in rDNA transcription are knocked down. Mechanistically, loss of CSA or CSB leads to polymerase stalling at non-B DNA in a neuroblastoma cell line, in particular at G-quadruplex structures, and recombinant CSB can melt G-quadruplex structures. Indeed, stabilization of G-quadruplex structures activates PARP1 and leads to accelerated aging in Caenorhabditis elegans In conclusion, this work supports a role for impaired ribosomal DNA transcription in Cockayne syndrome and suggests that transcription-coupled resolution of secondary structures may be a mechanism to repress spurious activation of a DNA damage response.

Conformation and stability of intramolecular telomeric G-quadruplexes: sequence effects in the loops.

Directory of Open Access Journals (Sweden)

Giovanna Sattin

Full Text Available Telomeres are guanine-rich sequences that protect the ends of chromosomes. These regions can fold into G-quadruplex structures and their stabilization by G-quadruplex ligands has been employed as an anticancer strategy. Genetic analysis in human telomeres revealed extensive allelic variation restricted to loop bases, indicating that the variant telomeric sequences maintain the ability to fold into G-quadruplex. To assess the effect of mutations in loop bases on G-quadruplex folding and stability, we performed a comprehensive analysis of mutant telomeric sequences by spectroscopic techniques, molecular dynamics simulations and gel electrophoresis. We found that when the first position in the loop was mutated from T to C or A the resulting structure adopted a less stable antiparallel topology; when the second position was mutated to C or A, lower thermal stability and no evident conformational change were observed; in contrast, substitution of the third position from A to C induced a more stable and original hybrid conformation, while mutation to T did not significantly affect G-quadruplex topology and stability. Our results indicate that allelic variations generate G-quadruplex telomeric structures with variable conformation and stability. This aspect needs to be taken into account when designing new potential anticancer molecules.

Charge splitters and charge transport junctions based on guanine quadruplexes

Science.gov (United States)

Sha, Ruojie; Xiang, Limin; Liu, Chaoren; Balaeff, Alexander; Zhang, Yuqi; Zhang, Peng; Li, Yueqi; Beratan, David N.; Tao, Nongjian; Seeman, Nadrian C.

2018-04-01

Self-assembling circuit elements, such as current splitters or combiners at the molecular scale, require the design of building blocks with three or more terminals. A promising material for such building blocks is DNA, wherein multiple strands can self-assemble into multi-ended junctions, and nucleobase stacks can transport charge over long distances. However, nucleobase stacking is often disrupted at junction points, hindering electric charge transport between the two terminals of the junction. Here, we show that a guanine-quadruplex (G4) motif can be used as a connector element for a multi-ended DNA junction. By attaching specific terminal groups to the motif, we demonstrate that charges can enter the structure from one terminal at one end of a three-way G4 motif, and can exit from one of two terminals at the other end with minimal carrier transport attenuation. Moreover, we study four-way G4 junction structures by performing theoretical calculations to assist in the design and optimization of these connectors.

Design, synthesis and evaluation of 4,7-diamino-1,10-phenanthroline G-quadruplex ligands

DEFF Research Database (Denmark)

Nielsen, Mads Corvinius; Borch, Jonas; Ulven, Trond

2009-01-01

the central ionic column. Introduction of positively charged side chains results in compounds with appreciable G-quadruplex stabilizing properties and high aqueous solubility, with the longer side chains giving more potent compounds. Ligands carrying guanidine side chains in general show higher quadruplex...... stabilizing activity and distinctly slower kinetic properties than their amino and dimethylamino analogues, possibly due to specific hydrogen bond interactions with the G-quadruplex loops....

Interdependence of pyrene interactions and tetramolecular G4-DNA assembly.

Science.gov (United States)

Doluca, Osman; Withers, Jamie M; Loo, Trevor S; Edwards, Patrick J B; González, Carlos; Filichev, Vyacheslav V

2015-03-28

Controlling the arrangement of organic chromophores in supramolecular architectures is of primary importance for the development of novel functional molecules. Insertion of a twisted intercalating nucleic acid (TINA) moiety, containing phenylethynylpyren-1-yl derivatives, into a G-rich DNA sequence alters G-quadruplex folding, resulting in supramolecular structures with defined pyrene arrangements. Based on CD, NMR and ESI-mass-spectra, as well as TINA excited dimer (excimer) fluorescence emission we propose that insertion of the TINA monomer in the middle of a dTG4T sequence (i.e. dTGGXGGT, where X is TINA) converts a parallel tetramolecular G-quadruplex into an assembly composed of two identical antiparallel G-quadruplex subunits stacked via TINA-TINA interface. Kinetic analysis showed that TINA-TINA association controls complex formation in the presence of Na(+) but barely competes with guanine-mediated association in K(+) or in the sequence with the longer G-run (dTGGGXGGGT). These results demonstrate new perspectives in the design of molecular entities that can kinetically control G-quadruplex formation and show how tetramolecular G-quadruplexes can be used as a tuneable scaffold to control the arrangement of organic chromophores.

The Escherichia coli Tus-Ter replication fork barrier causes site-specific DNA replication perturbation in yeast

DEFF Research Database (Denmark)

Larsen, Nicolai B; Sass, Ehud; Suski, Catherine

2014-01-01

Replication fork (RF) pausing occurs at both 'programmed' sites and non-physiological barriers (for example, DNA adducts). Programmed RF pausing is required for site-specific DNA replication termination in Escherichia coli, and this process requires the binding of the polar terminator protein, Tus...... as a versatile, site-specific, heterologous DNA replication-perturbing system, with a variety of potential applications....

Hsa-miR-1587 G-quadruplex formation and dimerization induced by NH4+, molecular crowding environment and jatrorrhizine derivatives.

Science.gov (United States)

Tan, Wei; Yi, Long; Zhu, Zhentao; Zhang, Lulu; Zhou, Jiang; Yuan, Gu

2018-03-01

A guanine-rich human mature microRNA, miR-1587, was discovered to form stable intramolecular G-quadruplexes in the presence of K + , Na + and low concentration of NH 4 + (25mM) by electrospray ionization mass spectrometry (ESI-MS) combined with circular dichroism (CD) spectroscopy. Furthermore, under high concentration of NH 4 + (100mM) or molecular crowding environments, miR-1587 formed a dimeric G-quadruplex through 3'-to-3' stacking of two monomeric G-quadruplex subunits with one ammonium ion sandwiched between the interfaces. Specifically, two synthesized jatrorrhizine derivatives with terminal amine groups could also induce the dimerization of miR-1587 G-quadruplex and formed 1:1 and 2:1 complexes with the dimeric G-quadruplex. In contrast, jatrorrhizine could bind with the dimeric miR-1587 G-quadruplex, but could not induce dimerization of miR-1587 G-quadruplex. These results provide a new strategy to regulate the functions of miR-1587 through induction of G-quadruplex formation and dimerization. Copyright © 2017 Elsevier B.V. All rights reserved.

Racemic DNA crystallography.

Science.gov (United States)

Mandal, Pradeep K; Collie, Gavin W; Kauffmann, Brice; Huc, Ivan

2014-12-22

Racemates increase the chances of crystallization by allowing molecular contacts to be formed in a greater number of ways. With the advent of protein synthesis, the production of protein racemates and racemic-protein crystallography are now possible. Curiously, racemic DNA crystallography had not been investigated despite the commercial availability of L- and D-deoxyribo-oligonucleotides. Here, we report a study into racemic DNA crystallography showing the strong propensity of racemic DNA mixtures to form racemic crystals. We describe racemic crystal structures of various DNA sequences and folded conformations, including duplexes, quadruplexes, and a four-way junction, showing that the advantages of racemic crystallography should extend to DNA. © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Use of alternative alkali chlorides in RT and PCR of polynucleotides containing G quadruplex structures.

Science.gov (United States)

Ramos-Alemán, Fabiola; González-Jasso, Eva; Pless, Reynaldo C

2018-02-15

Several alkali chlorides were compared for their use in reverse transcription (RT) and PCR of different types of nucleic acid templates. On a test region of biological DNA incapable of forming G quadruplex (G4) structures, Taq DNA polymerase showed similar PCR performance with 50 mM KCl, CsCl, LiCl, and NaCl. In contrast, on a synthetic model polydeoxyribonucleotide prone to G4 formation, good PCR amplification was obtained with 50 mM CsCl, but little or none with LiCl or KCl. Similarly, in RT of a G4-prone model polyribonucleotide, MMLV reverse transcriptase produced a good yield with 50 mM CsCl, mediocre yields with LiCl or without added alkali chloride, and a poor yield with 50 mM KCl. The full RT-PCR assay starting from the G4-prone polyribonucleotide, showed good results with CsCl in both stages, poor results with LiCl, and no product formation with KCl. The model polynucleotides showed fast G quadruplex formation under PCR or RT conditions with 50 mM KCl, but not with CsCl or LiCl. The results argue for the use of CsCl instead of KCl for RT and PCR of G4-prone sequences. No advantage was observed when using the 7-deaza type nucleotide analog c 7 dGTP in PCR amplification of the G4-prone polydeoxyribonucleotide. Copyright © 2017 Elsevier Inc. All rights reserved.

G-quadruplex recognition activities of E. Coli MutS

Directory of Open Access Journals (Sweden)

Ehrat Edward A

2012-07-01

Full Text Available Abstract Background Guanine quadruplex (G4 DNA is a four-stranded structure that contributes to genome instability and site-specific recombination. G4 DNA folds from sequences containing tandemly repetitive guanines, sequence motifs that are found throughout prokaryote and eukaryote genomes. While some cellular activities have been identified with binding or processing G4 DNA, the factors and pathways governing G4 DNA metabolism are largely undefined. Highly conserved mismatch repair factors have emerged as potential G4-responding complexes because, in addition to initiating heteroduplex correction, the human homologs bind non-B form DNA with high affinity. Moreover, the MutS homologs across species have the capacity to recognize a diverse range of DNA pairing variations and damage, suggesting a conserved ability to bind non-B form DNA. Results Here, we asked if E. coli MutS and a heteroduplex recognition mutant, MutS F36A, were capable of recognizing and responding to G4 DNA structures. We find by mobility shift assay that E. coli MutS binds to G4 DNA with high affinity better than binding to G-T heteroduplexes. In the same assay, MutS F36A failed to recognize G-T mismatched oligonucleotides, as expected, but retained an ability to bind to G4 DNA. Association with G4 DNA by MutS is not likely to activate the mismatch repair pathway because nucleotide binding did not promote release of MutS or MutS F36A from G4 DNA as it does for heteroduplexes. G4 recognition activities occur under physiological conditions, and we find that M13 phage harboring G4-capable DNA poorly infected a MutS deficient strain of E. coli compared to M13mp18, suggesting functional roles for mismatch repair factors in the cellular response to unstable genomic elements. Conclusions Taken together, our findings demonstrate that E. coli MutS has a binding activity specific for non-B form G4 DNA, but such binding appears independent of canonical heteroduplex repair activation.

Molecular recognition of naphthalene diimide ligands by telomeric quadruplex-DNA: the importance of the protonation state and mediated hydrogen bonds.

Science.gov (United States)

Spinello, A; Barone, G; Grunenberg, J

2016-01-28

In depth Monte Carlo conformational scans in combination with molecular dynamics (MD) simulations and electronic structure calculations were applied in order to study the molecular recognition process between tetrasubstituted naphthalene diimide (ND) guests and G-quadruplex (G4) DNA receptors. ND guests are a promising class of telomere stabilizers due to which they are used in novel anticancer therapeutics. Though several ND guests have been studied experimentally in the past, the protonation state under physiological conditions is still unclear. Based on chemical intuition, in the case of N-methyl-piperazine substitution, different protonation states are possible and might play a crucial role in the molecular recognition process by G4-DNA. Depending on the proton concentration, different nitrogen atoms of the N-methyl-piperazine might (or might not) be protonated. This fact was considered in our simulation in terms of a case by case analysis, since the process of molecular recognition is determined by possible donor or acceptor positions. The results of our simulations show that the electrostatic interactions between the ND ligands and the G4 receptor are maximized in the case of the protonation of the terminal nitrogen atoms, forming compact ND G4 complexes inside the grooves. The influence of different protonation states in terms of the ability to form hydrogen bonds with the sugar-phosphate backbone, as well as the importance of mediated vs. direct hydrogen bonding, was analyzed in detail by MD and relaxed force constant (compliance constant) simulations.

Label-Free and Ultrasensitive Biomolecule Detection Based on Aggregation Induced Emission Fluorogen via Target-Triggered Hemin/G-Quadruplex-Catalyzed Oxidation Reaction.

Science.gov (United States)

Li, Haiyin; Chang, Jiafu; Gai, Panpan; Li, Feng

2018-02-07

Fluorescence biosensing strategy has drawn substantial attention due to their advantages of simplicity, convenience, sensitivity, and selectivity, but unsatisfactory structure stability, low fluorescence quantum yield, high cost of labeling, and strict reaction conditions associated with current fluorescence methods severely prohibit their potential application. To address these challenges, we herein propose an ultrasensitive label-free fluorescence biosensor by integrating hemin/G-quadruplex-catalyzed oxidation reaction with aggregation induced emission (AIE) fluorogen-based system. l-Cysteine/TPE-M, which is carefully and elaborately designed and developed, obviously contributes to strong fluorescence emission. In the presence of G-rich DNA along with K + and hemin, efficient destruction of l-cysteine occurs due to hemin/G-quadruplex-catalyzed oxidation reactions. As a result, highly sensitive fluorescence detection of G-rich DNA is readily realized, with a detection limit down to 33 pM. As a validation for the further development of the proposed strategy, we also successfully construct ultrasensitive platforms for microRNA by incorporating the l-cysteine/TPE-M system with target-triggered cyclic amplification reaction. Thus, this proposed strategy is anticipated to find use in basic biochemical research and clinical diagnosis.

Thrombin-Binding Aptamer Quadruplex Formation: AFM and Voltammetric Characterization

Directory of Open Access Journals (Sweden)

Victor Constantin Diculescu

2010-01-01

Full Text Available The adsorption and the redox behaviour of thrombin-binding aptamer (TBA and extended TBA (eTBA were studied using atomic force microscopy and voltammetry at highly oriented pyrolytic graphite and glassy carbon. The different adsorption patterns and degree of surface coverage were correlated with the sequence base composition, presence/absence of K+, and voltammetric behaviour of TBA and eTBA. In the presence of K+, only a few single-stranded sequences present adsorption, while the majority of the molecules forms stable and rigid quadruplexes with no adsorption. Both TBA and eTBA are oxidized and the only anodic peak corresponds to guanine oxidation. Upon addition of K+ ions, TBA and eTBA fold into a quadruplex, causing the decrease of guanine oxidation peak and occurrence of a new peak at a higher potential due to the oxidation of G-quartets. The higher oxidation potential of G-quartets is due to the greater difficulty of electron transfer from the inside of the quadruplex to the electrode surface than electron transfer from the more flexible single strands.

Binding polarity of RPA to telomeric sequences and influence of G-quadruplex stability.

Science.gov (United States)

Safa, Layal; Delagoutte, Emmanuelle; Petruseva, Irina; Alberti, Patrizia; Lavrik, Olga; Riou, Jean-François; Saintomé, Carole

2014-08-01

Replication protein A (RPA) is a single-stranded DNA binding protein that plays an essential role in telomere maintenance. RPA binds to and unfolds G-quadruplex (G4) structures formed in telomeric DNA, thus facilitating lagging strand DNA replication and telomerase activity. To investigate the effect of G4 stability on the interactions with human RPA (hRPA), we used a combination of biochemical and biophysical approaches. Our data revealed an inverse relationship between G4 stability and ability of hRPA to bind to telomeric DNA; notably small G4 ligands that enhance G4 stability strongly impaired G4 unfolding by hRPA. To gain more insight into the mechanism of binding and unfolding of telomeric G4 structures by RPA, we carried out photo-crosslinking experiments to elucidate the spatial arrangement of the RPA subunits along the DNA strands. Our results showed that RPA1 and RPA2 are arranged from 5' to 3' along the unfolded telomeric G4, as already described for unstructured single-stranded DNA, while no contact is possible with RPA3 on this short oligonucleotide. In addition, these data are compatible with a 5' to 3' directionality in G4 unfolding by hRPA. Copyright © 2014 Elsevier Masson SAS. All rights reserved.

Separation of the potential G-quadruplex ligands from the butanol extract of Zanthoxylum ailanthoides Sieb. & Zucc. by countercurrent chromatography and preparative high performance liquid chromatography.

Science.gov (United States)

Han, Tian; Cao, Xueli; Xu, Jing; Pei, Hairun; Zhang, Hong; Tang, Yalin

2017-07-21

G-quadruplex DNA structure is considered to be a very attractive target for antitumor drug design due to its unique role in maintaining telomerase activities. Therefore, discovering ligands with high stability of G-quadruplex structure is of great interest. In this paper, pH-zone refining counter current chromatography (CCC) and preparative high performance liquid chromatography (HPLC) were employed for the separation of potent G-quadruplex ligands from the n-butanol fraction of the crude extract of Zanthoxylum ailanthoides, which is a traditional Chinese medicine recently found to display high inhibitory activity against several human cancer cells. The 75% aqueous ethanol extract of the stem bark of Z. ailanthoides and its fractions with petroleum ether, ethyl acetate and n-butanol displayed almost the same G-quadruplex stabilization ability. Here, pH-zone refining CCC was used for the separation of the alkaloids from the n-butanol fraction by a seldom used solvent system composed of dichloromethane-methanol-water (4:1:2.5) with 10mM TEA in the organic stationary phase as retainer and 10mM HCl in the aqueous mobile phase as eluter. Compounds I, II and III were obtained, with purity greater than 95%, in the quantities of 31.2, 94.0, and 26.4mg respectively from 300mg of lipophilic fraction within 80min, which were identified as three tetrahydroprotoberberines isolated for the first time in this plant. In addition, a phenylpropanoid glycoside compound IV (Syringin), an isoquinoline (Magnoflorine, V), and two lignin isomers (+)-lyoniresiol-3α-O-β-d-glucopyranoside (VI) and (-)-lyoniresinol -3α-O-β-D -glucopyranoside (VII) were isolated by traditional CCC together with preparative HPLC. Compounds IV, V, VI and VII were obtained, with purity greater than 95%, in the quantities of 4.0, 13.2, 6.7, and 6.5mg respectively from 960mg of hydrophilic fraction. Among the seven isolated compounds, tetrahydroprotoberberine I, II and III were found to display remarkable

Effect of Monovalent Ion Parameters on Molecular Dynamics Simulations of G-Quadruplexes

Czech Academy of Sciences Publication Activity Database

Havrila, Marek; Stadlbauer, Petr; Islam, Barira; Otyepka, M.; Šponer, Jiří

2017-01-01

Roč. 13, č. 8 (2017), s. 3911-3926 ISSN 1549-9618 R&D Projects: GA MŠk EF15_003/0000477; GA ČR(CZ) GA16-13721S Institutional support: RVO:68081707 Keywords : telomeric g-quadruplex * amber force-field * nucleic-acid quadruplexes Subject RIV: CF - Physical ; Theoretical Chemistry OBOR OECD: Physical chemistry Impact factor: 5.245, year: 2016

Quadruplexes of human telomere DNA

Czech Academy of Sciences Publication Activity Database

Vorlíčková, Michaela; Chládková, Jana; Kejnovská, Iva; Kypr, Jaroslav

2007-01-01

Roč. 24, č. 6 (2007), s. 710 ISSN 0739-1102. [The 15th Conversation . 19.06.2007-23.06.2007, Albany] R&D Projects: GA ČR(CZ) GA204/07/0057; GA AV ČR(CZ) IAA100040701 Institutional research plan: CEZ:AV0Z50040507; CEZ:AV0Z50040702 Keywords : DNA tetraplex * human telomere * CD spectroscopy Subject RIV: BO - Biophysics

Inverting the G-Tetrad Polarity of a G-Quadruplex by Using Xanthine and 8-Oxoguanine.

Science.gov (United States)

Cheong, Vee Vee; Lech, Christopher Jacques; Heddi, Brahim; Phan, Anh Tuân

2016-01-04

G-quadruplexes are four-stranded nucleic acid structures that are built from consecutively stacked guanine tetrad (G-tetrad) assemblies. The simultaneous incorporation of two guanine base lesions, xanthine (X) and 8-oxoguanine (O), within a single G-tetrad of a G-quadruplex was recently shown to lead to the formation of a stable G⋅G⋅X⋅O tetrad. Herein, a judicious introduction of X and O into a human telomeric G-quadruplex-forming sequence is shown to reverse the hydrogen-bond polarity of the modified G-tetrad while preserving the original folding topology. The control exerted over G-tetrad polarity by joint X⋅O modification will be valuable for the design and programming of G-quadruplex structures and their properties. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Behavior of the guanine base in G-quadruplexes probed by the fluorescent guanine analog, 6-methyl isozanthopterin

Energy Technology Data Exchange (ETDEWEB)

Han, Ji Hoon; Chitrapriya, Nataraj; Lee, Hyun Suk; Lee, Young Ae; Kim, Seog K. [Dept. of Chemistry, Yeungnam University, Gyeongsan (Korea, Republic of); Jung, Maeng Joon [Dept. of Chemistry, Kyungpook National University, Daegu (Korea, Republic of)

2017-02-15

In this study, circular dichroism (CD) spectrum and fluorescence techniques were used to examine the dynamic properties and microenvironment of the guanine base (G) at the central loop and at the middle of the G-stem of the G-quadruplex formed from the G{sub 3}T{sub 2}G{sub 3}TGTG{sub 3}T{sub 2}G{sub 3} sequence (G-quadruplex 1), in which the G base at the 10th and 13th position were replaced with a fluorescent G analog, 6-methyl isoxanthopterin (6MI) (G-quadruplex 2 and 3, respectively). For all G-quadruplexes, the CD spectrum revealed a positive band at 263 nm and a shoulder at 298 nm, and the thermal melting profiles were the sum of at least two sigmoidal curves. These observations indicated the presence of two conformers in the G-quadruplex. The fluorescence intensity of G-quadruplex 2 was greater than 3, as expected from the extent of stacking interaction, which is larger in the G(6MI)G sequence than the T(6MI)T sequence. The efficiency of fluorescence quenching by the polar acrylamide quencher and negatively charged I− quencher were larger for G-quadruplex 3, suggesting that 6MI in the G(6MI)G stem is exposed more to the aqueous environment compared to that in the T(6MI)T central loop. In the latter case, 6MI may direct to the center of the top G-quartet layer. The possibility of hydrogen bond formation between the carbonyl group of 6MI and the acrylamide of the G-quadruplex 3 was proposed.

A single thiazole orange molecule forms an exciplex in a DNA i-motif.

Science.gov (United States)

Xu, Baochang; Wu, Xiangyang; Yeow, Edwin K L; Shao, Fangwei

2014-06-18

A fluorescent exciplex of thiazole orange (TO) is formed in a single-dye conjugated DNA i-motif. The exciplex fluorescence exhibits a large Stokes shift, high quantum yield, robust response to pH oscillation and little structural disturbance to the DNA quadruplex, which can be used to monitor the folding of high-order DNA structures.

Complex DNA structures and structures of DNA complexes

International Nuclear Information System (INIS)

Chazin, W.J.; Carlstroem, G.; Shiow-Meei Chen; Miick, S.; Gomez-Paloma, L.; Smith, J.; Rydzewski, J.

1994-01-01

Complex DNA structures (for example, triplexes, quadruplexes, junctions) and DNA-ligand complexes are more difficult to study by NMR than standard DNA duplexes are because they have high molecular weights, show nonstandard or distorted local conformations, and exhibit large resonance linewidths and severe 1 H spectral overlap. These systems also tend to have limited solubility and may require specialized solution conditions to maintain favorable spectral characteristics, which adds to the spectroscopic difficulties. Furthermore, with more atoms in the system, both assignment and structure calculation become more challenging. In this article, we focus on demonstrating the current status of NMR studies of such systems and the limitations to further progress; we also indicate in what ways isotopic enrichment can be useful

Complex DNA structures and structures of DNA complexes

Energy Technology Data Exchange (ETDEWEB)

Chazin, W.J.; Carlstroem, G.; Shiow-Meei Chen; Miick, S.; Gomez-Paloma, L.; Smith, J.; Rydzewski, J. [Scripps Research Institute, La Jolla, CA (United States)

1994-12-01

Complex DNA structures (for example, triplexes, quadruplexes, junctions) and DNA-ligand complexes are more difficult to study by NMR than standard DNA duplexes are because they have high molecular weights, show nonstandard or distorted local conformations, and exhibit large resonance linewidths and severe {sup 1}H spectral overlap. These systems also tend to have limited solubility and may require specialized solution conditions to maintain favorable spectral characteristics, which adds to the spectroscopic difficulties. Furthermore, with more atoms in the system, both assignment and structure calculation become more challenging. In this article, we focus on demonstrating the current status of NMR studies of such systems and the limitations to further progress; we also indicate in what ways isotopic enrichment can be useful.

Isolation of deletion alleles by G4 DNA-induced mutagenesis

NARCIS (Netherlands)

Pontier, Daphne B; Kruisselbrink, Evelien; Guryev, Victor; Tijsterman, Marcel

Metazoan genomes contain thousands of sequence tracts that match the guanine-quadruplex (G4) DNA signature G(3)N(x)G(3)N(x)G(3)N(x)G(3), a motif that is intrinsically mutagenic, probably because it can form secondary structures during DNA replication. Here we show how and to what extent this feature

A mRNA-Responsive G-Quadruplex-Based Drug Release System

Directory of Open Access Journals (Sweden)

Hidenobu Yaku

2015-04-01

Full Text Available G-quadruplex-based drug delivery carriers (GDDCs were designed to capture and release a telomerase inhibitor in response to a target mRNA. Hybridization between a loop on the GDDC structure and the mRNA should cause the G-quadruplex structure of the GDDC to unfold and release the bound inhibitor, anionic copper(II phthalocyanine (CuAPC. As a proof of concept, GDDCs were designed with a 10-30-mer loop, which can hybridize with a target sequence in epidermal growth factor receptor (EGFR mRNA. Structural analysis using circular dichroism (CD spectroscopy showed that the GDDCs form a (3 + 1 type G-quadruplex structure in 100 mM KCl and 10 mM MgCl2 in the absence of the target RNA. Visible absorbance titration experiments showed that the GDDCs bind to CuAPC with Ka values of 1.5 × 105 to 5.9 × 105 M−1 (Kd values of 6.7 to 1.7 μM at 25 °C, depending on the loop length. Fluorescence titration further showed that the G-quadruplex structure unfolds upon binding to the target RNA with Ka values above 1.0 × 108 M−1 (Kd values below 0.01 μM at 25 °C. These results suggest the carrier can sense and bind to the target RNA, which should result in release of the bound drug. Finally, visible absorbance titration experiments demonstrated that the GDDC release CuAPC in response to the target RNA.

G-quadruplex formation in telomeres enhances POT1/TPP1 protection against RPA binding

Science.gov (United States)

Ray, Sujay; Bandaria, Jigar N.; Qureshi, Mohammad H.; Yildiz, Ahmet; Balci, Hamza

2014-01-01

Human telomeres terminate with a single-stranded 3′ G overhang, which can be recognized as a DNA damage site by replication protein A (RPA). The protection of telomeres (POT1)/POT1-interacting protein 1 (TPP1) heterodimer binds specifically to single-stranded telomeric DNA (ssTEL) and protects G overhangs against RPA binding. The G overhang spontaneously folds into various G-quadruplex (GQ) conformations. It remains unclear whether GQ formation affects the ability of POT1/TPP1 to compete against RPA to access ssTEL. Using single-molecule Förster resonance energy transfer, we showed that POT1 stably loads to a minimal DNA sequence adjacent to a folded GQ. At 150 mM K+, POT1 loading unfolds the antiparallel GQ, as the parallel conformation remains folded. POT1/TPP1 loading blocks RPA’s access to both folded and unfolded telomeres by two orders of magnitude. This protection is not observed at 150 mM Na+, in which ssTEL forms only a less-stable antiparallel GQ. These results suggest that GQ formation of telomeric overhangs may contribute to suppression of DNA damage signals. PMID:24516170

Exonuclease-assisted multicolor aptasensor for visual detection of ochratoxin A based on G-quadruplex-hemin DNAzyme-mediated etching of gold nanorod.

Science.gov (United States)

Yu, Xinhui; Lin, Yaohui; Wang, Xusheng; Xu, Liangjun; Wang, Zongwen; Fu, FengFu

2018-04-21

An exonuclease-assisted multicolor aptasensor was developed for the visual detection of ochratoxin A (OTA). It is based on the etching of gold nanorods (AuNRs) mediated by a G-quadruplex-hemin DNAzyme. A DNA sequence (AG4-OTA) was designed that comprises a hemin aptamer and an OTA aptamer. OTA binds to AG4-OTA to form an antiparallel G-quadruplex, which halts its digestion by exonuclease I (Exo I) from the 3'-end of AG4-OTA. Thus, the retained hemin aptamer can bind to hemin to form a G-quadruplex-hemin DNAzyme. This DNAzyme has peroxidase-like activity that catalyzes the oxidation of 3,3',5,5'-tetramethylbenzidine (TMB) by H 2 O 2 to produce its diimine derivative (TMB 2+ ) in acidic solution. TMB 2+ can etch the AuNRs by oxidizing Au(0) into Au(I). This results in the generation of rainbow-like colors and provides a multicolor platform for the visual detection of OTA. The assay is based on the use of a single isolated aptamer and possesses obvious advantages such as multi-color visual inspection, relatively high sensitivity and accuracy. It can be used to detect as little as 30 nM concentrations of OTA by visual observation and even 10 nM concentrations by spectrophotometry. The method was successfully applied to the determination of OTA in spiked beer where it gave recoveries of 101-108%, with a relative standard deviation (RSD, n = 5) of <5%. Graphical abstract Schematic of an exonuclease-assisted multicolor bioassay based on the G-quadruplex-hemin DNAzyme-mediated etching of gold nanorods (AuNRs). It enables visual detection of ochratoxin A (OTA) with a detection limit of 30 nM.

Expanding the potential of G-quadruplex structures: formation of a heterochiral TBA analogue.

Science.gov (United States)

Virgilio, Antonella; Varra, Michela; Scuotto, Maria; Capuozzo, Antonella; Irace, Carlo; Mayol, Luciano; Esposito, Veronica; Galeone, Aldo

2014-03-21

In order to expand the potential applications of G-quadruplex structures, we explored the ability of heterochiral oligodeoxynucleotides based on the thrombin-binding aptamer (TBA) sequence to fold into similar complexes, with particular focus on their resistance in biological environments. A combination of CD and NMR techniques was used. Similarly to TBA, the ODN ggTTggtgtggTTgg (lower case letters indicate L residues) is able to fold into a chair-like antiparallel G-quadruplex structure, but has a slightly higher thermal stability. The discovery that heterochiral ODNs are able to form stable G-quadruplex structures opens up new possibilities for their development in several fields, as aptamers, sensors and, as recently shown, as catalysts for enantioselective reactions. © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

G-quadruplex-based structural transitions in 15-mer DNA oligonucleotides varying in lengths of internal oligo(dG) stretches detected by voltammetric techniques

Czech Academy of Sciences Publication Activity Database

Vidláková, Pavlína; Pivoňková, Hana; Kejnovská, Iva; Trnková, L.; Vorlíčková, Michaela; Fojta, Miroslav; Havran, Luděk

2015-01-01

Roč. 407, č. 19 (2015), s. 5817-5826 ISSN 1618-2642 R&D Projects: GA ČR GAP206/12/2378 Institutional support: RVO:68081707 Keywords : Oligonucleotides * Electrochemical methods * G-quadruplex Subject RIV: BO - Biophysics Impact factor: 3.125, year: 2015

Internal Light Source-Driven Photoelectrochemical 3D-rGO/Cellulose Device Based on Cascade DNA Amplification Strategy Integrating Target Analog Chain and DNA Mimic Enzyme.

Science.gov (United States)

Lan, Feifei; Liang, Linlin; Zhang, Yan; Li, Li; Ren, Na; Yan, Mei; Ge, Shenguang; Yu, Jinghua

2017-11-01

In this work, a chemiluminescence-driven collapsible greeting card-like photoelectrochemical lab-on-paper device (GPECD) with hollow channel was demonstrated, in which target-triggering cascade DNA amplification strategy was ingeniously introduced. The GPECD had the functions of reagents storage and signal collection, and the change of configuration could control fluidic path, reaction time and alterations in electrical connectivity. In addition, three-dimentional reduced graphene oxide affixed Au flower was in situ grown on paper cellulose fiber for achieving excellent conductivity and biocompatibility. The cascade DNA amplification strategy referred to the cyclic formation of target analog chain and its trigger action to hybridization chain reaction (HCR), leading to the formation of numerous hemin/G-quadruplex DNA mimic enzyme with the presence of hemin. Subjected to the catalysis of hemin/G-quadruplex, the strong chemiluminiscence of luminol-H 2 O 2 system was obtained, which then was used as internal light source to excite photoactive materials realizing the simplification of instrument. In this analyzing process, thrombin served as proof-of-concept, and the concentration of target was converted into the DNA signal output by the specific recognition of aptamer-protein and target analog chain recycling. The target analog chain was produced in quantity with the presence of target, which further triggered abundant HCR and introduced hemin/G-quadruplex into the system. The photocurrent signal was obtained after the nitrogen-doped carbon dots sensitized ZnO was stimulated by chemiluminescence. The proposed GPECD exhibited excellent specificity and sensitivity toward thrombin with a detection limit of 16.7 fM. This judiciously engineered GPECD paved a luciferous way for detecting other protein with trace amounts in bioanalysis and clinical biomedicine.

Tus-Ter as a tool to study site-specific DNA replication perturbation in eukaryotes

DEFF Research Database (Denmark)

Larsen, Nicolai B; Hickson, Ian D; Mankouri, Hocine W

2014-01-01

The high-affinity binding of the Tus protein to specific 21-bp sequences, called Ter, causes site-specific, and polar, DNA replication fork arrest in E coli. The Tus-Ter complex serves to coordinate DNA replication with chromosome segregation in this organism. A number of recent and ongoing studies...... have demonstrated that Tus-Ter can be used as a heterologous tool to generate site-specific perturbation of DNA replication when reconstituted in eukaryotes. Here, we review these recent findings and explore the molecular mechanism by which Tus-Ter mediates replication fork (RF) arrest in the budding...... yeast, S. cerevisiae. We propose that Tus-Ter is a versatile, genetically tractable, and regulatable RF blocking system that can be utilized for disrupting DNA replication in a diverse range of host cells....

Tus-Ter as a tool to study site-specific DNA replication perturbation in eukaryotes.

Science.gov (United States)

Larsen, Nicolai B; Hickson, Ian D; Mankouri, Hocine W

2014-01-01

The high-affinity binding of the Tus protein to specific 21-bp sequences, called Ter, causes site-specific, and polar, DNA replication fork arrest in E coli. The Tus-Ter complex serves to coordinate DNA replication with chromosome segregation in this organism. A number of recent and ongoing studies have demonstrated that Tus-Ter can be used as a heterologous tool to generate site-specific perturbation of DNA replication when reconstituted in eukaryotes. Here, we review these recent findings and explore the molecular mechanism by which Tus-Ter mediates replication fork (RF) arrest in the budding yeast, S. cerevisiae. We propose that Tus-Ter is a versatile, genetically tractable, and regulatable RF blocking system that can be utilized for disrupting DNA replication in a diverse range of host cells.

Ion Binding to Quadruplex DNA Stems. Comparison of MM and QM Descriptions Reveals Sizable Polarization Effects Not Included in Contemporary Simulations

Czech Academy of Sciences Publication Activity Database

Gkionis, K.; Kruse, H.; Platts, J. A.; Mládek, Arnošt; Koča, J.; Šponer, Jiří

2014-01-01

Roč. 10, č. 3 (2014), s. 1326-1340 ISSN 1549-9618 R&D Projects: GA ČR(CZ) GAP208/11/1822; GA MŠk(CZ) ED1.1.00/02.0068 Institutional support: RVO:68081707 Keywords : MOLECULAR-DYNAMICS SIMULATIONS * GAUSSIAN-BASIS SETS * TETRAMOLECULAR G-QUADRUPLEXES Subject RIV: BO - Biophysics Impact factor: 5.498, year: 2014

Formation of a unique cluster of G-quadruplex structures in the HIV-1 Nef coding region: implications for antiviral activity.

Directory of Open Access Journals (Sweden)

Rosalba Perrone

Full Text Available G-quadruplexes are tetraplex structures of nucleic acids that can form in G-rich sequences. Their presence and functional role have been established in telomeres, oncogene promoters and coding regions of the human chromosome. In particular, they have been proposed to be directly involved in gene regulation at the level of transcription. Because the HIV-1 Nef protein is a fundamental factor for efficient viral replication, infectivity and pathogenesis in vitro and in vivo, we investigated G-quadruplex formation in the HIV-1 nef gene to assess the potential for viral inhibition through G-quadruplex stabilization. A comprehensive computational analysis of the nef coding region of available strains showed the presence of three conserved sequences that were uniquely clustered. Biophysical testing proved that G-quadruplex conformations were efficiently stabilized or induced by G-quadruplex ligands in all three sequences. Upon incubation with a G-quadruplex ligand, Nef expression was reduced in a reporter gene assay and Nef-dependent enhancement of HIV-1 infectivity was significantly repressed in an antiviral assay. These data constitute the first evidence of the possibility to regulate HIV-1 gene expression and infectivity through G-quadruplex targeting and therefore open a new avenue for viral treatment.

Tetrasubstituted phenanthrolines as highly potent, water-soluble, and selective g-quadruplex ligands

DEFF Research Database (Denmark)

Larsen, Anders Foller; Nielsen, Mads Corvinius; Ulven, Trond

2012-01-01

Small molecules capable of stabilizing the G-quadruplex (G4) structure are of interest for the development of improved anticancer drugs. Novel 4,7-diamino-substituted 1,10-phenanthroline-2,9-dicarboxamides that represent hybrid structures of known phenanthroline-based ligands have been designed....... An efficient synthetic route to the compounds has been developed and their interactions with various G4 sequences have been evaluated by Förster resonance energy transfer (FRET) melting assays, fluorescent intercalator displacement (FID), electrospray ionization mass spectrometry (ESI-MS), and circular...... dichroism (CD) spectroscopy. The preferred compounds have high aqueous solubility and are strong and potent G4 binders with a high selectivity over duplex DNA; thus, they represent a significant improvement over the lead compounds. Two of the compounds are inhibitors of HeLa and HT1080 cell proliferation....

The role of alkali metal cations in the stabilization of guanine quadruplexes: why K(+) is the best.

Science.gov (United States)

Zaccaria, F; Paragi, G; Fonseca Guerra, C

2016-08-21

The alkali metal ion affinity of guanine quadruplexes has been studied using dispersion-corrected density functional theory (DFT-D). We have done computational investigations in aqueous solution that mimics artificial supramolecular conditions where guanine bases assemble into stacked quartets as well as biological environments in which telomeric quadruplexes are formed. In both cases, an alkali metal cation is needed to assist self-assembly. Our quantum chemical computations on these supramolecular systems are able to reproduce the experimental order of affinity of the guanine quadruplexes for the cations Li(+), Na(+), K(+), Rb(+), and Cs(+). The strongest binding is computed between the potassium cation and the quadruplex as it occurs in nature. The desolvation and the size of alkali metal cations are thought to be responsible for the order of affinity. Until now, the relative importance of these two factors has remained unclear and debated. By assessing the quantum chemical 'size' of the cation, determining the amount of deformation of the quadruplex needed to accommodate the cation and through the energy decomposition analysis (EDA) of the interaction energy between the cation and the guanines, we reveal that the desolvation and size of the alkali metal cation are both almost equally responsible for the order of affinity.

Duplex/quadruplex oligonucleotides: Role of the duplex domain in the stabilization of a new generation of highly effective anti-thrombin aptamers.

Science.gov (United States)

Russo Krauss, Irene; Napolitano, Valeria; Petraccone, Luigi; Troisi, Romualdo; Spiridonova, Vera; Mattia, Carlo Andrea; Sica, Filomena

2018-02-01

Recently, mixed duplex/quadruplex oligonucleotides have attracted great interest for use as biomedical aptamers. In the case of anti-thrombin aptamers, the addition of duplex-forming sequences to a G-quadruplex module identical or very similar to the best-known G-quadruplex of the Thrombin Binding Aptamer (HD1) results in new or improved biological properties, such as higher activity or different recognition properties with respect to HD1. Remarkably, this bimodular fold was hypothesized, based on its sequence, for the only anti-thrombin aptamer in advanced clinical trial, NU172. Whereas cation modulation of G-quadruplex conformation and stability is well characterized, only few data from similar analysis on duplex/quadruplex oligonucleotides exist. Here we have performed a characterization of structure and stability of four different duplex/quadruplex anti-thrombin aptamers, including NU172, in the presence of different cations and in physiological-mimicking conditions in comparison to HD1, by means of spectroscopic techniques (UV and circular dichroism) and differential scanning calorimetry. Our data show a strong reciprocal influence of each domain on the stability of the other and in particular suggest a stabilizing effect of the duplex region in the presence of solutions mimicking the physiological conditions, strengthening the idea that bimodular aptamers present better therapeutic potentialities than those containing a single G-quadruplex domain. Copyright © 2017 Elsevier B.V. All rights reserved.

Giardia telomeric sequence d(TAGGG)4 forms two intramolecular G-quadruplexes in K+ solution: effect of loop length and sequence on the folding topology.

Science.gov (United States)

Hu, Lanying; Lim, Kah Wai; Bouaziz, Serge; Phan, Anh Tuân

2009-11-25

Recently, it has been shown that in K(+) solution the human telomeric sequence d[TAGGG(TTAGGG)(3)] forms a (3 + 1) intramolecular G-quadruplex, while the Bombyx mori telomeric sequence d[TAGG(TTAGG)(3)], which differs from the human counterpart only by one G deletion in each repeat, forms a chair-type intramolecular G-quadruplex, indicating an effect of G-tract length on the folding topology of G-quadruplexes. To explore the effect of loop length and sequence on the folding topology of G-quadruplexes, here we examine the structure of the four-repeat Giardia telomeric sequence d[TAGGG(TAGGG)(3)], which differs from the human counterpart only by one T deletion within the non-G linker in each repeat. We show by NMR that this sequence forms two different intramolecular G-quadruplexes in K(+) solution. The first one is a novel basket-type antiparallel-stranded G-quadruplex containing two G-tetrads, a G x (A-G) triad, and two A x T base pairs; the three loops are consecutively edgewise-diagonal-edgewise. The second one is a propeller-type parallel-stranded G-quadruplex involving three G-tetrads; the three loops are all double-chain-reversal. Recurrence of several structural elements in the observed structures suggests a "cut and paste" principle for the design and prediction of G-quadruplex topologies, for which different elements could be extracted from one G-quadruplex and inserted into another.

Enzyme-free colorimetric detection systems based on the DNA strand displacement competition reaction

Science.gov (United States)

Zhang, Z.; Birkedal, V.; Gothelf, K. V.

2016-05-01

The strand displacement competition assay is based on the dynamic equilibrium of the competitive hybridization of two oligonucleotides (A and B) to a third oligonucleotide (S). In the presence of an analyte that binds to a specific affinity-moiety conjugated to strand B, the equilibrium shifts, which can be detected by a shift in the fluorescence resonance energy transfer signal between dyes attached to the DNA strands. In the present study we have integrated an ATP aptamer in the strand B and demonstrated the optical detection of ATP. Furthermore we explore a new readout method using a split G-quadruplex DNAzyme for colorimetric readout of the detection of streptavidin by the naked eye. Finally, we integrate the whole G-quadruplex DNAzyme system in a single DNA strand and show that it is applicable to colorimetric detection.

Enzyme-free colorimetric detection systems based on the DNA strand displacement competition reaction

DEFF Research Database (Denmark)

Zhang, Zhao; Birkedal, Victoria; Gothelf, Kurt Vesterager

2016-01-01

The strand displacement competition assay is based on the dynamic equilibrium of the competitive hybridization of two oligonucleotides (A and B) to a third oligonucleotide (S). In the presence of an analyte that binds to a specific affinity-moiety conjugated to strand B, the equilibrium shifts, w...... G-quadruplex DNAzyme for colorimetric readout of the detection of streptavidin by the naked eye. Finally, we integrate the whole G-quadruplex DNAzyme system in a single DNA strand and show that it is applicable to colorimetric detection......., which can be detected by a shift in the fluorescence resonance energy transfer signal between dyes attached to the DNA strands. In the present study we have integrated an ATP aptamer in the strand B and demonstrated the optical detection of ATP. Furthermore we explore a new readout method using a split...

Solid-state NMR chemical-shift perturbations indicate domain reorientation of the DnaG primase in the primosome of Helicobacter pylori

Energy Technology Data Exchange (ETDEWEB)

Gardiennet, Carole [Université de Lorraine, CNRS, CRM2, UMR 7036 (France); Wiegand, Thomas [ETH Zurich, Physical Chemistry (Switzerland); Bazin, Alexandre [Université de Lyon 1, Molecular Microbiology and Structural Biochemistry, Labex Ecofect, UMR 5086 CNRS (France); Cadalbert, Riccardo [ETH Zurich, Physical Chemistry (Switzerland); Kunert, Britta; Lacabanne, Denis [Université de Lyon 1, Molecular Microbiology and Structural Biochemistry, Labex Ecofect, UMR 5086 CNRS (France); Gutsche, Irina [Université Grenoble Alpes, Institut de Biologie Structurale (IBS), CNRS, IBS, CEA, IBS (France); Terradot, Laurent, E-mail: l.terradot@ibcp.fr [Université de Lyon 1, Molecular Microbiology and Structural Biochemistry, Labex Ecofect, UMR 5086 CNRS (France); Meier, Beat H., E-mail: beme@ethz.ch [ETH Zurich, Physical Chemistry (Switzerland); Böckmann, Anja, E-mail: a.bockmann@ibcp.fr [Université de Lyon 1, Molecular Microbiology and Structural Biochemistry, Labex Ecofect, UMR 5086 CNRS (France)

2016-03-15

We here investigate the interactions between the DnaB helicase and the C-terminal domain of the corresponding DnaG primase of Helicobacter pylori using solid-state NMR. The difficult crystallization of this 387 kDa complex, where the two proteins interact in a six to three ratio, is circumvented by simple co-sedimentation of the two proteins directly into the MAS-NMR rotor. While the amount of information that can be extracted from such a large protein is still limited, we can assign a number of amino-acid residues experiencing significant chemical-shift perturbations upon helicase-primase complex formation. The location of these residues is used as a guide to model the interaction interface between the two proteins in the complex. Chemical-shift perturbations also reveal changes at the interaction interfaces of the hexameric HpDnaB assembly on HpDnaG binding. A structural model of the complex that explains the experimental findings is obtained.

Folding of guanine quadruplex molecules-funnel-like mechanism or kinetic partitioning? An overview from MD simulation studies

Czech Academy of Sciences Publication Activity Database

Šponer, Jiří; Bussi, G.; Stadlbauer, Petr; Kührová, P.; Banáš, P.; Islam, Barira; Haider, S.; Neidle, S.; Otyepka, M.

2017-01-01

Roč. 1861, č. 5 (2017), s. 1246-1263 ISSN 0304-4165 R&D Projects: GA ČR(CZ) GA16-13721S Institutional support: RVO:68081707 Keywords : telomeric g-quadruplex * parallel g-quadruplex Subject RIV: CE - Biochemistry OBOR OECD: Biochemistry and molecular biology Impact factor: 4.702, year: 2016

Structure and possible function of a G-quadruplex in the long terminal repeat of the proviral HIV-1 genome.

Science.gov (United States)

De Nicola, Beatrice; Lech, Christopher J; Heddi, Brahim; Regmi, Sagar; Frasson, Ilaria; Perrone, Rosalba; Richter, Sara N; Phan, Anh Tuân

2016-07-27

The long terminal repeat (LTR) of the proviral human immunodeficiency virus (HIV)-1 genome is integral to virus transcription and host cell infection. The guanine-rich U3 region within the LTR promoter, previously shown to form G-quadruplex structures, represents an attractive target to inhibit HIV transcription and replication. In this work, we report the structure of a biologically relevant G-quadruplex within the LTR promoter region of HIV-1. The guanine-rich sequence designated LTR-IV forms a well-defined structure in physiological cationic solution. The nuclear magnetic resonance (NMR) structure of this sequence reveals a parallel-stranded G-quadruplex containing a single-nucleotide thymine bulge, which participates in a conserved stacking interaction with a neighboring single-nucleotide adenine loop. Transcription analysis in a HIV-1 replication competent cell indicates that the LTR-IV region may act as a modulator of G-quadruplex formation in the LTR promoter. Consequently, the LTR-IV G-quadruplex structure presented within this work could represent a valuable target for the design of HIV therapeutics. © The Author(s) 2016. Published by Oxford University Press on behalf of Nucleic Acids Research.

Fragile X mental retardation protein recognizes a G quadruplex structure within the survival motor neuron domain containing 1 mRNA 5'-UTR.

Science.gov (United States)

McAninch, Damian S; Heinaman, Ashley M; Lang, Cara N; Moss, Kathryn R; Bassell, Gary J; Rita Mihailescu, Mihaela; Evans, Timothy L

2017-07-25

G quadruplex structures have been predicted by bioinformatics to form in the 5'- and 3'-untranslated regions (UTRs) of several thousand mature mRNAs and are believed to play a role in translation regulation. Elucidation of these roles has primarily been focused on the 3'-UTR, with limited focus on characterizing the G quadruplex structures and functions in the 5'-UTR. Investigation of the affinity and specificity of RNA binding proteins for 5'-UTR G quadruplexes and the resulting regulatory effects have also been limited. Among the mRNAs predicted to form a G quadruplex structure within the 5'-UTR is the survival motor neuron domain containing 1 (SMNDC1) mRNA, encoding a protein that is critical to the spliceosome. Additionally, this mRNA has been identified as a potential target of the fragile X mental retardation protein (FMRP), whose loss of expression leads to fragile X syndrome. FMRP is an RNA binding protein involved in translation regulation that has been shown to bind mRNA targets that form G quadruplex structures. In this study we have used biophysical methods to investigate G quadruplex formation in the 5'-UTR of SMNDC1 mRNA and analyzed its interactions with FMRP. Our results show that SMNDC1 mRNA 5'-UTR forms an intramolecular, parallel G quadruplex structure comprised of three G quartet planes, which is bound specifically by FMRP both in vitro and in mouse brain lysates. These findings suggest a model by which FMRP might regulate the translation of a subset of its mRNA targets by recognizing the G quadruplex structure present in their 5'-UTR, and affecting their accessibility by the protein synthesis machinery.

Tyramine Hydrochloride Based Label-Free System for Operating Various DNA Logic Gates and a DNA Caliper for Base Number Measurements.

Science.gov (United States)

Fan, Daoqing; Zhu, Xiaoqing; Dong, Shaojun; Wang, Erkang

2017-07-05

DNA is believed to be a promising candidate for molecular logic computation, and the fluorogenic/colorimetric substrates of G-quadruplex DNAzyme (G4zyme) are broadly used as label-free output reporters of DNA logic circuits. Herein, for the first time, tyramine-HCl (a fluorogenic substrate of G4zyme) is applied to DNA logic computation and a series of label-free DNA-input logic gates, including elementary AND, OR, and INHIBIT logic gates, as well as a two to one encoder, are constructed. Furthermore, a DNA caliper that can measure the base number of target DNA as low as three bases is also fabricated. This DNA caliper can also perform concatenated AND-AND logic computation to fulfil the requirements of sophisticated logic computing. © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

Detection of perturbation phases and developmental stages in organisms from DNA microarray time series data.

Directory of Open Access Journals (Sweden)

Marianne Rooman

Full Text Available Available DNA microarray time series that record gene expression along the developmental stages of multicellular eukaryotes, or in unicellular organisms subject to external perturbations such as stress and diauxie, are analyzed. By pairwise comparison of the gene expression profiles on the basis of a translation-invariant and scale-invariant distance measure corresponding to least-rectangle regression, it is shown that peaks in the average distance values are noticeable and are localized around specific time points. These points systematically coincide with the transition points between developmental phases or just follow the external perturbations. This approach can thus be used to identify automatically, from microarray time series alone, the presence of external perturbations or the succession of developmental stages in arbitrary cell systems. Moreover, our results show that there is a striking similarity between the gene expression responses to these a priori very different phenomena. In contrast, the cell cycle does not involve a perturbation-like phase, but rather continuous gene expression remodeling. Similar analyses were conducted using three other standard distance measures, showing that the one we introduced was superior. Based on these findings, we set up an adapted clustering method that uses this distance measure and classifies the genes on the basis of their expression profiles within each developmental stage or between perturbation phases.

Computational Analysis of G-Quadruplex Forming Sequences across Chromosomes Reveals High Density Patterns Near the Terminal Ends.

Directory of Open Access Journals (Sweden)

Julia H Chariker

Full Text Available G-quadruplex structures (G4 are found throughout the human genome and are known to play a regulatory role in a variety of molecular processes. Structurally, they have many configurations and can form from one or more DNA strands. At the gene level, they regulate gene expression and protein synthesis. In this paper, chromosomal-level patterns of distribution are analyzed on the human genome to identify high-level distribution patterns potentially related to global functional processes. Here we show unique high density banding patterns on individual chromosomes that are highly correlated, appearing in a mirror pattern, across forward and reverse DNA strands. The highest density of G4 sequences occurs within four megabases of one end of most chromosomes and contains G4 motifs that bind with zinc finger proteins. These findings suggest that G4 may play a role in global chromosomal processes such as those found in meiosis.

A new signal-on method for the detection of protein based on binding-induced strategy and photoinduced electron transfer between Ag nanoclusters and split G-quadruplex-hemin complexes

Energy Technology Data Exchange (ETDEWEB)

Zhang, Kai, E-mail: zhangkai@jsinm.org; Wang, Ke; Zhu, Xue; Xie, Minhao

2015-08-05

Proteins play important roles in biological and cellular processes. The levels of proteins can be useful biomarkers for cellular events or disease diagnosis, thus the method for sensitive and selective detection of proteins is imperative to proteins express, study, and clinical diagnosis. Herein, we report a “signal-on” platform for the assay of protein based on binding-induced strategy and photoinduced electron transfer between Ag nanoclusters and split G-quadruplex-hemin complexes. By using biotin as the affinity ligand, this simple protocol could sensitively detect streptavidin with a detection limit down to 10 pM. With the use of an antibody as the affinity ligand, a method for homogeneous fluorescence detection of Prostate Specific Antigen (PSA) was also proposed with a detection limit of 10 pM. The one-step and wash-free assay showed good selectivity. Its high sensitivity, acceptable accuracy, and satisfactory versatility of analytes led to various applications in bioanalysis. - Highlights: • AgNCs have great potential for application in biomedicine. • Binding of two affinity ligands can result in binding-induced DNA assemblies. • PET can be happened between DNA/AgNCs and G-quadruplex/hemin complexes. • A platform for the detection of proteins was proposed by using PET and binding-induced strategy.

Nanomechanical DNA origami pH sensors.

Science.gov (United States)

Kuzuya, Akinori; Watanabe, Ryosuke; Yamanaka, Yusei; Tamaki, Takuya; Kaino, Masafumi; Ohya, Yuichi

2014-10-16

Single-molecule pH sensors have been developed by utilizing molecular imaging of pH-responsive shape transition of nanomechanical DNA origami devices with atomic force microscopy (AFM). Short DNA fragments that can form i-motifs were introduced to nanomechanical DNA origami devices with pliers-like shape (DNA Origami Pliers), which consist of two levers of 170-nm long and 20-nm wide connected at a Holliday-junction fulcrum. DNA Origami Pliers can be observed as in three distinct forms; cross, antiparallel and parallel forms, and cross form is the dominant species when no additional interaction is introduced to DNA Origami Pliers. Introduction of nine pairs of 12-mer sequence (5'-AACCCCAACCCC-3'), which dimerize into i-motif quadruplexes upon protonation of cytosine, drives transition of DNA Origami Pliers from open cross form into closed parallel form under acidic conditions. Such pH-dependent transition was clearly imaged on mica in molecular resolution by AFM, showing potential application of the system to single-molecular pH sensors.

Identification and characterisation of a G-quadruplex forming sequence in the promoter region of nuclear factor (erythroid-derived 2)-like 2 (Nrf2)

Energy Technology Data Exchange (ETDEWEB)

Waller, Zoë A.E., E-mail: z.waller@uea.ac.uk; Howell, Lesley A.; MacDonald, Colin J.; O’Connell, Maria A.; Searcey, Mark, E-mail: m.searcey@uea.ac.uk

2014-04-25

Highlights: • Discovery of a G-quadruplex forming sequence in the promoter sequence of Nrf2. • Characterisation of the G-quadruplex by UV, CD and NMR. • Conformational switching of G-quadruplex induced by 9-aminoacridine. - Abstract: The transcription factor nuclear factor (erythroid-derived 2)-like 2 (Nrf2) regulates multiple antioxidants, Phase II detoxification enzymes and other cytoprotective enzymes in cells. Activation of Nrf2 is recognised as being of potential therapeutic benefit in inflammatory-diseases whereas more recently, it has become clear that the inhibition of Nrf2 may have benefit in the alleviation of resistance in some tumour types. A potential G-quadruplex forming sequence was identified in the promoter region of Nrf2, close to a number of putative transcription factor binding sites. Characterisation of the sequence 5’-d[GGGAAGGGAGCAAGGGCGGGAGGG]-3’ using CD spectroscopy, imino proton NMR resonances and UV melting experiments demonstrated the formation of a parallel intramolecular G-quadruplex in the presence of K{sup +} ions. Incubation with 9-aminoacridine ligands induced a switch from antiparallel to parallel forms. The presence of a G-quadruplex forming sequence in the promoter region of Nrf2 suggests an approach to targeting the production of the protein through stabilisation of the structure, thereby avoiding resistance to antitumour drugs.

Characterizing and controlling intrinsic biases of lambda exonuclease in nascent strand sequencing reveals phasing between nucleosomes and G-quadruplex motifs around a subset of human replication origins

DEFF Research Database (Denmark)

Foulk, M. S.; Urban, J. M.; Casella, Cinzia

2015-01-01

Nascent strand sequencing (NS-seq) is used to discover DNA replication origins genome-wide, allowing identification of features for their specification. NS-seq depends on the ability of lambda exonuclease (lambda-exo) to efficiently digest parental DNA while leaving RNA-primer protected nascent...... strands intact. We used genomics and biochemical approaches to determine if lambda-exo digests all parental DNA sequences equally. We report that lambda-exo does not efficiently digest G-quadruplex (G4) structures in a plasmid. Moreover, lambda-exo digestion of nonreplicating genomic DNA (LexoG0) enriches...... GC-rich DNA and G4 motifs genome-wide. We used LexoG0 data to control for nascent strand-independent lambda-exo biases in NSseq and validated this approach at the rDNA locus. The lambda-exo-controlled NS-seq peaks are not GC-rich, and only 35.5% overlap with 6.8% of all G4s, suggesting that G4s...

G-Quadruplex Identification in the Genome of Protozoan Parasites Points to Naphthalene Diimide Ligands as New Antiparasitic Agents.

Science.gov (United States)

Belmonte-Reche, Efres; Martínez-García, Marta; Guédin, Aurore; Zuffo, Michela; Arévalo-Ruiz, Matilde; Doria, Filippo; Campos-Salinas, Jenny; Maynadier, Marjorie; López-Rubio, José Juan; Freccero, Mauro; Mergny, Jean-Louis; Pérez-Victoria, José María; Morales, Juan Carlos

2018-02-08

G-quadruplexes (G4) are DNA secondary structures that take part in the regulation of gene expression. Putative G4 forming sequences (PQS) have been reported in mammals, yeast, bacteria, and viruses. Here, we present PQS searches on the genomes of T. brucei, L. major, and P. falciparum. We found telomeric sequences and new PQS motifs. Biophysical experiments showed that EBR1, a 29 nucleotide long highly repeated PQS in T. brucei, forms a stable G4 structure. G4 ligands based on carbohydrate conjugated naphthalene diimides (carb-NDIs) that bind G4's including hTel could bind EBR1 with selectivity versus dsDNA. These ligands showed important antiparasitic activity. IC 50 values were in the nanomolar range against T. brucei with high selectivity against MRC-5 human cells. Confocal microscopy confirmed these ligands localize in the nucleus and kinetoplast of T. brucei suggesting they can reach their potential G4 targets. Cytotoxicity and zebrafish toxicity studies revealed sugar conjugation reduces intrinsic toxicity of NDIs.

The Escherichia coli Tus-Ter replication fork barrier causes site-specific DNA replication perturbation in yeast.

Science.gov (United States)

Larsen, Nicolai B; Sass, Ehud; Suski, Catherine; Mankouri, Hocine W; Hickson, Ian D

2014-04-07

Replication fork (RF) pausing occurs at both 'programmed' sites and non-physiological barriers (for example, DNA adducts). Programmed RF pausing is required for site-specific DNA replication termination in Escherichia coli, and this process requires the binding of the polar terminator protein, Tus, to specific DNA sequences called Ter. Here, we demonstrate that Tus-Ter modules also induce polar RF pausing when engineered into the Saccharomyces cerevisiae genome. This heterologous RF barrier is distinct from a number of previously characterized, protein-mediated, RF pause sites in yeast, as it is neither Tof1-dependent nor counteracted by the Rrm3 helicase. Although the yeast replisome can overcome RF pausing at Tus-Ter modules, this event triggers site-specific homologous recombination that requires the RecQ helicase, Sgs1, for its timely resolution. We propose that Tus-Ter can be utilized as a versatile, site-specific, heterologous DNA replication-perturbing system, with a variety of potential applications.

Reference simulations of noncanonical nucleic acids with different chí variants of the AMBER force field: Quadruplex DNA, quadruplex RNA, and Z-DNA

Czech Academy of Sciences Publication Activity Database

Krepl, Miroslav; Zgarbová, M.; Stadlbauer, Petr; Otyepka, M.; Banáš, P.; Koča, J.; Cheatham III, T.E.; Jurečka, P.; Šponer, Jiří

2012-01-01

Roč. 8, č. 7 (2012), s. 2506-2520 ISSN 1549-9618 R&D Projects: GA ČR(CZ) GD203/09/H046; GA ČR(CZ) GA203/09/1476; GA ČR(CZ) GAP208/11/1822; GA ČR(CZ) GBP305/12/G034 Institutional research plan: CEZ:AV0Z50040702 Keywords : refinement of empirical force fields * DNA * Z-DNA backbone Subject RIV: BO - Biophysics Impact factor: 5.389, year: 2012

Derivation of Reliable Geometries in QM Calculations of DNA Structures: Explicit Solvent QM/MM and Restrained Implicit Solvent QM Optimizations of G-Quadruplexes.

Science.gov (United States)

Gkionis, Konstantinos; Kruse, Holger; Šponer, Jiří

2016-04-12

Modern dispersion-corrected DFT methods have made it possible to perform reliable QM studies on complete nucleic acid (NA) building blocks having hundreds of atoms. Such calculations, although still limited to investigations of potential energy surfaces, enhance the portfolio of computational methods applicable to NAs and offer considerably more accurate intrinsic descriptions of NAs than standard MM. However, in practice such calculations are hampered by the use of implicit solvent environments and truncation of the systems. Conventional QM optimizations are spoiled by spurious intramolecular interactions and severe structural deformations. Here we compare two approaches designed to suppress such artifacts: partially restrained continuum solvent QM and explicit solvent QM/MM optimizations. We report geometry relaxations of a set of diverse double-quartet guanine quadruplex (GQ) DNA stems. Both methods provide neat structures without major artifacts. However, each one also has distinct weaknesses. In restrained optimizations, all errors in the target geometries (i.e., low-resolution X-ray and NMR structures) are transferred to the optimized geometries. In QM/MM, the initial solvent configuration causes some heterogeneity in the geometries. Nevertheless, both approaches represent a decisive step forward compared to conventional optimizations. We refine earlier computations that revealed sizable differences in the relative energies of GQ stems computed with AMBER MM and QM. We also explore the dependence of the QM/MM results on the applied computational protocol.

Integration of G-quadruplex and DNA-templated Ag NCs for nonarithmetic information processing† †Electronic supplementary information (ESI) available. See DOI: 10.1039/c7sc00361g Click here for additional data file.

Science.gov (United States)

Gao, Ru-Ru; Lv, Xiao-Yan; Zhu, Yan-Yan; Zhang, Yi-Wei

2017-01-01

To create sophisticated molecular logic circuits from scratch, you may not believe how common the building blocks can be and how diverse and powerful such circuits can be when scaled up. Using the two simple building blocks of G-quadruplex and silver nanoclusters (Ag NCs), we experimentally construct a series of multifunctional, label-free, and multi-output logic circuits to perform nonarithmetic functions: a 1-to-2 decoder, a 4-to-2 encoder, an 8-to-3 encoder, dual transfer gates, a 2 : 1 multiplexer, and a 1 : 2 demultiplexer. Moreover, a parity checker which is capable of identifying odd and even numbers from natural numbers is constructed conceptually. Finally, a multi-valued logic gate (ternary inhibit gate) is readily achieved by taking this DNA/Ag NC system as a universal platform. All of the above logic circuits share the same building blocks, indicating the great prospects of the assembly of nanomaterials and DNA for biochemical logic devices. Considering its biocompatibility, the novel prototypes developed here may have potential applications in the fields of biological computers and medical diagnosis and serve as a promising proof of principle in the not-too-distant future. PMID:28626564

Modular Assembly of Cell-targeting Devices Based on an Uncommon G-quadruplex Aptamer

Directory of Open Access Journals (Sweden)

Felipe Opazo

2015-01-01

Full Text Available Aptamers are valuable tools that provide great potential to develop cost-effective diagnostics and therapies in the biomedical field. Here, we report a novel DNA aptamer that folds into an unconventional G-quadruplex structure able to recognize and enter specifically into human Burkitt's lymphoma cells. We further optimized this aptamer to a highly versatile and stable minimized version. The minimized aptamer can be easily equipped with different functionalities like quantum dots, organic dyes, or even a second different aptamer domain yielding a bi-paratopic aptamer. Although the target molecule of the aptamer remains unknown, our microscopy and pharmacological studies revealed that the aptamer hijacks the clathrin-mediated endocytosis pathway for its cellular internalization. We conclude that this novel class of aptamers can be used as a modular tool to specifically deliver different cargoes into malignant cells. This work provides a thorough characterization of the aptamer and we expect that our strategy will pave the path for future therapeutic applications.

The G-quadruplex augments translation in the 5' untranslated region of transforming growth factor β2.

Science.gov (United States)

Agarwala, Prachi; Pandey, Satyaprakash; Mapa, Koyeli; Maiti, Souvik

2013-03-05

Transforming growth factor β2 (TGFβ2) is a versatile cytokine with a prominent role in cell migration, invasion, cellular development, and immunomodulation. TGFβ2 promotes the malignancy of tumors by inducing epithelial-mesenchymal transition, angiogenesis, and immunosuppression. As it is well-documented that nucleic acid secondary structure can regulate gene expression, we assessed whether any secondary motif regulates its expression at the post-transcriptional level. Bioinformatics analysis predicts an existence of a 23-nucleotide putative G-quadruplex sequence (PG4) in the 5' untranslated region (UTR) of TGFβ2 mRNA. The ability of this stretch of sequence to form a highly stable, intramolecular parallel quadruplex was demonstrated using ultraviolet and circular dichroism spectroscopy. Footprinting studies further validated its existence in the presence of a neighboring nucleotide sequence. Following structural characterization, we evaluated the biological relevance of this secondary motif using a dual luciferase assay. Although PG4 inhibits the expression of the reporter gene, its presence in the context of the entire 5' UTR sequence interestingly enhances gene expression. Mutation or removal of the G-quadruplex sequence from the 5' UTR of the gene diminished the level of expression of this gene at the translational level. Thus, here we highlight an activating role of the G-quadruplex in modulating gene expression of TGFβ2 at the translational level and its potential to be used as a target for the development of therapeutics against cancer.

Structure variations of TBA G-quadruplex induced by 2'-O-methyl nucleotide in K+ and Ca2+ environments.

Science.gov (United States)

Zhao, Xiaoyang; Liu, Bo; Yan, Jing; Yuan, Ying; An, Liwen; Guan, Yifu

2014-10-01

Thrombin binding aptamer (TBA), a 15-mer oligonucleotide of d(GGTTGGTGTGGTTGG) sequence, folds into a chair-type antiparallel G-quadruplex in the K(+) environment, and each of two G-tetrads is characterized by a syn-anti-syn-anti glycosidic conformation arrangement. To explore its folding topology and structural stability, 2'-O-methyl nucleotide (OMe) with the C3'-endo sugar pucker conformation and anti glycosidic angle was used to selectively substitute for the guanine residues of G-tetrads of TBA, and these substituted TBAs were characterized using a circular dichroism spectrum, thermally differential spectrum, ultraviolet stability analysis, electrophoresis mobility shift assay, and thermodynamic analysis in K(+) and Ca(2+) environments. Results showed that single substitutions for syn-dG residues destabilized the G-quadruplex structure, while single substitutions for anti-dG residues could preserve the G-quadruplex in the K(+) environment. When one or two G-tetrads were modified with OMe, TBA became unstructured. In contrast, in Ca(2+) environment, the native TBA appeared to be unstructured. When two G-tetrads were substituted with OMe, TBA seemed to become a more stable parallel G-4 structure. Further thermodynamic data suggested that OMe-substitutions were an enthalpy-driven event. The results in this study enrich our understanding about the effects of nucleotide derivatives on the G-quadruplex structure stability in different ionic environments, which will help to design G-quadruplex for biological and medical applications. © The Author 2014. Published by ABBS Editorial Office in association with Oxford University Press on behalf of the Institute of Biochemistry and Cell Biology, Shanghai Institutes for Biological Sciences, Chinese Academy of Sciences.

Phylo-typing of clinical Escherichia coli isolates originating from bovine mastitis and canine pyometra and urinary tract infection by means of quadruplex PCR.

Science.gov (United States)

Müştak, Hamit Kaan; Günaydin, Elçin; Kaya, İnci Başak; Salar, Merve Özdal; Babacan, Orkun; Önat, Kaan; Ata, Zafer; Diker, Kadir Serdar

2015-01-01

Escherichia coli is one of the major causative agents of bovine mastitis worldwide, and is typically associated with acute, clinical mastitis. Besides this, E. coli strains which belong to the extra-intestinal pathogenic group are also the major cause of urinary tract infections and pyometra in dogs. In this study, it was aimed to investigate phylo-groups/subgroups in 155 E. coli isolates obtained from acute bovine mastitis, 43 from urinary tract infections of dogs and 20 from canine pyometra by a formerly described triplex PCR and recently described new quadruplex polymerase chain reaction (PCR) method. Group A1 (n = 118; 76%) and B1 (n = 71; 46%) were found to be the most prevalent groups by triplex and quadruplex PCR assays in mastitis isolates, respectively. Phylo-typing of 43 urinary tract isolates also revealed that most of the isolates belonged to A1 (n = 23; 54%) by triplex and B2 (n = 36; 84%) by quadruplex PCR assays. The isolates assigned as group A1 (n = 17; 85%) by triplex PCR could not be classified by quadruplex PCR in pyometra isolates. The results support the hypothesis that E. coli strains isolated from bovine mastitis cases are environmental. Also, groups C, E and F were identified as new phylo-groups for the first time in acute bovine mastitis cases. The comparison of triplex PCR with quadruplex PCR results revealed that most of the groups assigned in triplex PCR were altered by quadruplex PCR assay.

Equilibrious Strand Exchange Promoted by DNA Conformational Switching

Science.gov (United States)

Wu, Zhiguo; Xie, Xiao; Li, Puzhen; Zhao, Jiayi; Huang, Lili; Zhou, Xiang

2013-01-01

Most of DNA strand exchange reactions in vitro are based on toehold strategy which is generally nonequilibrium, and intracellular strand exchange mediated by proteins shows little sequence specificity. Herein, a new strand exchange promoted by equilibrious DNA conformational switching is verified. Duplexes containing c-myc sequence which is potentially converted into G-quadruplex are designed in this strategy. The dynamic equilibrium between duplex and G4-DNA is response to the specific exchange of homologous single-stranded DNA (ssDNA). The SER is enzyme free and sequence specific. No ATP is needed and the displaced ssDNAs are identical to the homologous ssDNAs. The SER products and exchange kenetics are analyzed by PAGE and the RecA mediated SER is performed as the contrast. This SER is a new feature of G4-DNAs and a novel strategy to utilize the dynamic equilibrium of DNA conformations.

QuadBase2: web server for multiplexed guanine quadruplex mining and visualization

Science.gov (United States)

Dhapola, Parashar; Chowdhury, Shantanu

2016-01-01

DNA guanine quadruplexes or G4s are non-canonical DNA secondary structures which affect genomic processes like replication, transcription and recombination. G4s are computationally identified by specific nucleotide motifs which are also called putative G4 (PG4) motifs. Despite the general relevance of these structures, there is currently no tool available that can allow batch queries and genome-wide analysis of these motifs in a user-friendly interface. QuadBase2 (quadbase.igib.res.in) presents a completely reinvented web server version of previously published QuadBase database. QuadBase2 enables users to mine PG4 motifs in up to 178 eukaryotes through the EuQuad module. This module interfaces with Ensembl Compara database, to allow users mine PG4 motifs in the orthologues of genes of interest across eukaryotes. PG4 motifs can be mined across genes and their promoter sequences in 1719 prokaryotes through ProQuad module. This module includes a feature that allows genome-wide mining of PG4 motifs and their visualization as circular histograms. TetraplexFinder, the module for mining PG4 motifs in user-provided sequences is now capable of handling up to 20 MB of data. QuadBase2 is a comprehensive PG4 motif mining tool that further expands the configurations and algorithms for mining PG4 motifs in a user-friendly way. PMID:27185890

Nanomechanical DNA Origami pH Sensors

Directory of Open Access Journals (Sweden)

Akinori Kuzuya

2014-10-01

Full Text Available Single-molecule pH sensors have been developed by utilizing molecular imaging of pH-responsive shape transition of nanomechanical DNA origami devices with atomic force microscopy (AFM. Short DNA fragments that can form i-motifs were introduced to nanomechanical DNA origami devices with pliers-like shape (DNA Origami Pliers, which consist of two levers of 170-nm long and 20-nm wide connected at a Holliday-junction fulcrum. DNA Origami Pliers can be observed as in three distinct forms; cross, antiparallel and parallel forms, and cross form is the dominant species when no additional interaction is introduced to DNA Origami Pliers. Introduction of nine pairs of 12-mer sequence (5'-AACCCCAACCCC-3', which dimerize into i-motif quadruplexes upon protonation of cytosine, drives transition of DNA Origami Pliers from open cross form into closed parallel form under acidic conditions. Such pH-dependent transition was clearly imaged on mica in molecular resolution by AFM, showing potential application of the system to single-molecular pH sensors.

TMPyP4 porphyrin distorts RNA G-quadruplex structures of the disease-associated r(GGGGCC)n repeat of the C9orf72 gene and blocks interaction of RNA-binding proteins.

Science.gov (United States)

Zamiri, Bita; Reddy, Kaalak; Macgregor, Robert B; Pearson, Christopher E

2014-02-21

Certain DNA and RNA sequences can form G-quadruplexes, which can affect genetic instability, promoter activity, RNA splicing, RNA stability, and neurite mRNA localization. Amyotrophic lateral sclerosis and frontotemporal dementia can be caused by expansion of a (GGGGCC)n repeat in the C9orf72 gene. Mutant r(GGGGCC)n- and r(GGCCCC)n-containing transcripts aggregate in nuclear foci, possibly sequestering repeat-binding proteins such as ASF/SF2 and hnRNPA1, suggesting a toxic RNA pathogenesis, as occurs in myotonic dystrophy. Furthermore, the C9orf72 repeat RNA was recently demonstrated to undergo the noncanonical repeat-associated non-AUG translation (RAN translation) into pathologic dipeptide repeats in patient brains, a process that is thought to depend upon RNA structure. We previously demonstrated that the r(GGGGCC)n RNA forms repeat tract length-dependent G-quadruplex structures that bind the ASF/SF2 protein. Here we show that the cationic porphyrin (5,10,15,20-tetra(N-methyl-4-pyridyl) porphyrin (TMPyP4)), which can bind some G-quadruplex-forming sequences, can bind and distort the G-quadruplex formed by r(GGGGCC)8, and this ablates the interaction of either hnRNPA1 or ASF/SF2 with the repeat. These findings provide proof of concept that nucleic acid binding small molecules, such as TMPyP4, can distort the secondary structure of the C9orf72 repeat, which may beneficially disrupt protein interactions, which may ablate either protein sequestration and/or RAN translation into potentially toxic dipeptides. Disruption of secondary structure formation of the C9orf72 RNA repeats may be a viable therapeutic avenue, as well as a means to test the role of RNA structure upon RAN translation.

A G-quadruplex-containing RNA activates fluorescence in a GFP-like fluorophore

Energy Technology Data Exchange (ETDEWEB)

Huang, Hao; Suslov, Nikolai B.; Li, Nan-Sheng; Shelke, Sandip A.; Evans, Molly E.; Koldobskaya, Yelena; Rice, Phoebe A.; Piccirilli, Joseph A. [UC

2014-08-21

Spinach is an in vitro–selected RNA aptamer that binds a GFP-like ligand and activates its green fluorescence. Spinach is thus an RNA analog of GFP and has potentially widespread applications for in vivo labeling and imaging. We used antibody-assisted crystallography to determine the structures of Spinach both with and without bound fluorophore at 2.2-Å and 2.4-Å resolution, respectively. Spinach RNA has an elongated structure containing two helical domains separated by an internal bulge that folds into a G-quadruplex motif of unusual topology. The G-quadruplex motif and adjacent nucleotides comprise a partially preformed binding site for the fluorophore. The fluorophore binds in a planar conformation and makes extensive aromatic stacking and hydrogen bond interactions with the RNA. Our findings provide a foundation for structure-based engineering of new fluorophore-binding RNA aptamers.

Porous platinum nanotubes labeled with hemin/G-quadruplex based electrochemical aptasensor for sensitive thrombin analysis via the cascade signal amplification.

Science.gov (United States)

Sun, Aili; Qi, Qingan; Wang, Xuannian; Bie, Ping

2014-07-15

For the first time, a sensitive electrochemical aptasensor for thrombin (TB) was developed by using porous platinum nanotubes (PtNTs) labeled with hemin/G-quadruplex and glucose dehydrogenase (GDH) as labels. Porous PtNTs with large surface area exhibited the peroxidase-like activity. Coupling with GDH and hemin/G-quadruplex as NADH oxidase and HRP-mimicking DNAzyme, the cascade signal amplification was achieved by the following ways: in the presence of glucose and NAD(+) in the working buffer, GDH electrocatalyzed the oxidation of glucose with the production of NADH. Then, hemin/G-quadruplex as NADH oxidase catalyzed the oxidation of NADH to in situ generate H2O2. Based on the corporate electrocatalysis of PtNTs and hemin/G-quadruplex toward H2O2, the electrochemical signal was significantly amplified, allowing the detection limit of TB down to 0.15 pM level. Moreover, the proposed strategy was simple because the intercalated hemin offered the readout signal, avoiding the adding of additional redox mediator as signal donator. Such an electrochemical aptasensor is highly promising for sensitive detection of other proteins in clinical diagnostics. Copyright © 2014 Elsevier B.V. All rights reserved.

Enhanced anti-HIV-1 activity of G-quadruplexes comprising locked nucleic acids and intercalating nucleic acids

DEFF Research Database (Denmark)

Pedersen, Erik Bjerregaard; Nielsen, Jakob Toudahl; Nielsen, Claus

2011-01-01

Two G-quadruplex forming sequences, 50-TGGGAG and the 17-mer sequence T30177, which exhibit anti-HIV-1 activity on cell lines, were modified using either locked nucleic acids (LNA) or via insertions of (R)-1-O-(pyren-1-ylmethyl)glycerol (intercalating nucleic acid, INA) or (R)-1-O-[4-(1......-pyrenylethynyl)phenylmethyl]glycerol (twisted intercalating nucleic acid, TINA). Incorporation of LNA or INA/TINA monomers provide as much as 8-fold improvement of anti-HIV-1 activity. We demonstrate for the first time a detailed analysis of the effect the incorporation of INA/TINA monomers in quadruplex forming...

The binding efficiency of RPA to telomeric G-strands folded into contiguous G-quadruplexes is independent of the number of G4 units.

Science.gov (United States)

Lancrey, Astrid; Safa, Layal; Chatain, Jean; Delagoutte, Emmanuelle; Riou, Jean-François; Alberti, Patrizia; Saintomé, Carole

2018-03-01

Replication protein A (RPA) is a single-stranded DNA binding protein involved in replication and in telomere maintenance. During telomere replication, G-quadruplexes (G4) can accumulate on the lagging strand template and need to be resolved. It has been shown that human RPA is able to unfold a single G4. Nevertheless, the G-strand of human telomeres is prone to fold into higher-order structures formed by contiguous G-quadruplexes. To understand how RPA deals with these structures, we studied its interaction with telomeric G-strands folding into an increasing number of contiguous G4s. The aim of this study was to determine whether the efficiency of binding/unfolding of hRPA to telomeric G-strands depends on the number of G4 units. Our data show that the number n of contiguous G4 units (n ≥ 2) does not affect the efficiency of hRPA to coat transiently exposed single-stranded telomeric G-strands. This feature may be essential in preventing instability due to G4 structures during telomere replication. Copyright © 2017 Elsevier B.V. and Société Française de Biochimie et Biologie Moléculaire (SFBBM). All rights reserved.

Mutant p53 perturbs DNA replication checkpoint control through TopBP1 and Treslin.

Science.gov (United States)

Liu, Kang; Lin, Fang-Tsyr; Graves, Joshua D; Lee, Yu-Ju; Lin, Weei-Chin

2017-05-09

Accumulating evidence supports the gain-of-function of mutant forms of p53 (mutp53s). However, whether mutp53 directly perturbs the DNA replication checkpoint remains unclear. Previously, we have demonstrated that TopBP1 forms a complex with mutp53s and mediates their gain-of-function through NF-Y and p63/p73. Akt phosphorylates TopBP1 and induces its oligomerization, which inhibits its ATR-activating function. Here we show that various contact and conformational mutp53s bypass Akt to induce TopBP1 oligomerization and attenuate ATR checkpoint response during replication stress. The effect on ATR response caused by mutp53 can be exploited in a synthetic lethality strategy, as depletion of another ATR activator, DNA2, in mutp53-R273H-expressing cancer cells renders cells hypersensitive to cisplatin. Expression of mutp53-R273H also makes cancer cells more sensitive to DNA2 depletion or DNA2 inhibitors. In addition to ATR-activating function during replication stress, TopBP1 interacts with Treslin in a Cdk-dependent manner to initiate DNA replication during normal growth. We find that mutp53 also interferes with TopBP1 replication function. Several contact, but not conformational, mutp53s enhance the interaction between TopBP1 and Treslin and promote DNA replication despite the presence of a Cdk2 inhibitor. Together, these data uncover two distinct mechanisms by which mutp53 enhances DNA replication: ( i ) Both contact and conformational mutp53s can bind TopBP1 and attenuate the checkpoint response to replication stress, and ( ii ) during normal growth, contact (but not conformational) mutp53s can override the Cdk2 requirement to promote replication by facilitating the TopBP1/Treslin interaction.

Evaluation of the Stability of DNA i-Motifs in the Nuclei of Living Mammalian Cells

Czech Academy of Sciences Publication Activity Database

Dzatko, S.; Krafčíková, M.; Haensel-Hertsch, R.; Fessl, T.; Fiala, R.; Loja, T.; Krafčík, D.; Mergny, Jean-Louis; Foldynova-Trantirkova, Silvie; Trantírek, L.

2018-01-01

Roč. 57, č. 8 (2018), s. 2165-2169 ISSN 1433-7851 R&D Projects: GA MŠk EF15_003/0000477 Institutional support: RVO:68081707 Keywords : g-quadruplex * telomeric dna * base-pairs * molecular switch Subject RIV: CG - Electrochemistry OBOR OECD: Electrochemistry (dry cells, batteries, fuel cells, corrosion metals, electrolysis) Impact factor: 11.994, year: 2016

RPA-mediated unfolding of systematically varying G-quadruplex structures.

Science.gov (United States)

Ray, Sujay; Qureshi, Mohammad H; Malcolm, Dominic W; Budhathoki, Jagat B; Celik, Uğur; Balci, Hamza

2013-05-21

G-quadruplex (GQ) is a noncanonical nucleic acid structure that is formed by guanine rich sequences. Unless it is destabilized by proteins such as replication protein A (RPA), GQ could interfere with DNA metabolic functions, such as replication or repair. We studied RPA-mediated GQ unfolding using single-molecule FRET on two groups of GQ structures that have different loop lengths and different numbers of G-tetrad layers. We observed a linear increase in the steady-state stability of the GQ against RPA-mediated unfolding with increasing number of layers or decreasing loop length. The stability demonstrated by different GQ structures varied by at least three orders of magnitude. Those with shorter loops (less than three nucleotides long) or a greater number of layers (more than three layers) maintained a significant folded population even at physiological RPA concentration (≈1 μM), raising the possibility of physiological viability of such GQ structures. Finally, we measured the transition time between the start and end of the RPA-mediated GQ unfolding process to be 0.35 ± 0.10 s for all GQ constructs we studied, despite significant differences in their steady-state stabilities. We propose a two-step RPA-mediated GQ unfolding mechanism that is consistent with our observations. Copyright © 2013 Biophysical Society. Published by Elsevier Inc. All rights reserved.

Electrochemical single-molecule conductivity of duplex and quadruplex DNA

DEFF Research Database (Denmark)

Zhang, Ling; Zhang, Jingdong; Ulstrup, Jens

2017-01-01

Photoinduced and electrochemical charge transport in DNA (oligonucleotides, OGNs) and the notions “hopping”, superexchange, polaron, and vibrationally gated charge transport have been in focus over more than two decades. In recent years mapping of electrochemical charge transport of pure and redo...

i-Motif of cytosine-rich human telomere DNA fragments containing natural base lesions

Czech Academy of Sciences Publication Activity Database

Dvořáková, Zuzana; Renčiuk, Daniel; Kejnovská, Iva; Školáková, Petra; Bednářová, Klára; Sagi, J.; Vorlíčková, Michaela

2018-01-01

Roč. 46, č. 4 (2018), s. 1624-1634 ISSN 1362-4962 R&D Projects: GA ČR(CZ) GA15-06785S; GA ČR GA17-12075S; GA ČR(CZ) GJ17-19170Y; GA MŠk EF15_003/0000477 Institutional support: RVO:68081707 Keywords : pair opening kinetics * g-quadruplex dna Subject RIV: CE - Biochemistry OBOR OECD: Biochemistry and molecular biology

Quadruplex-forming properties of FRAXA (CGG) repeats interrupted by (AGG) triplets

Czech Academy of Sciences Publication Activity Database

Renčiuk, Daniel; Zemánek, Michal; Kejnovská, Iva; Vorlíčková, Michaela

2009-01-01

Roč. 91, č. 3 (2009), s. 416-422 ISSN 0300-9084 R&D Projects: GA ČR(CZ) GA204/07/0057; GA AV ČR(CZ) IAA100040701 Institutional research plan: CEZ:AV0Z50040507; CEZ:AV0Z50040702 Keywords : fragile X-chromosome * quadruplex * CD spectroscopy Subject RIV: BO - Biophysics Impact factor: 3.897, year: 2009

A label-free luminescent switch-on assay for ATP using a G-quadruplex-selective iridium(III) complex.

Science.gov (United States)

Leung, Ka-Ho; Lu, Lihua; Wang, Modi; Mak, Tsun-Yin; Chan, Daniel Shiu-Hin; Tang, Fung-Kit; Leung, Chung-Hang; Kwan, Hiu-Yee; Yu, Zhiling; Ma, Dik-Lung

2013-01-01

We report herein the G-quadruplex-selective property of a luminescent cyclometallated iridium(III) complex for the detection of adenosine-5'-triphosphate (ATP) in aqueous solution. The ATP-binding aptamer was employed as the ATP recognition unit, while the iridium(III) complex was used to monitor the formation of the G-quadruplex structure induced by ATP. The sensitivity and fold enhancement of the assay were higher than those of the previously reported assay using the organic dye crystal violet as a fluorescent probe. This label-free luminescent switch-on assay exhibits high sensitivity and selectivity towards ATP with a limit of detection of 2.5 µM.

A label-free luminescent switch-on assay for ATP using a G-quadruplex-selective iridium(III complex.

Directory of Open Access Journals (Sweden)

Ka-Ho Leung

Full Text Available We report herein the G-quadruplex-selective property of a luminescent cyclometallated iridium(III complex for the detection of adenosine-5'-triphosphate (ATP in aqueous solution. The ATP-binding aptamer was employed as the ATP recognition unit, while the iridium(III complex was used to monitor the formation of the G-quadruplex structure induced by ATP. The sensitivity and fold enhancement of the assay were higher than those of the previously reported assay using the organic dye crystal violet as a fluorescent probe. This label-free luminescent switch-on assay exhibits high sensitivity and selectivity towards ATP with a limit of detection of 2.5 µM.

Transcription arrest by a G quadruplex forming-trinucleotide repeat sequence from the human c-myb gene.

Science.gov (United States)

Broxson, Christopher; Beckett, Joshua; Tornaletti, Silvia

2011-05-17

Non canonical DNA structures correspond to genomic regions particularly susceptible to genetic instability. The transcription process facilitates formation of these structures and plays a major role in generating the instability associated with these genomic sites. However, little is known about how non canonical structures are processed when encountered by an elongating RNA polymerase. Here we have studied the behavior of T7 RNA polymerase (T7RNAP) when encountering a G quadruplex forming-(GGA)(4) repeat located in the human c-myb proto-oncogene. To make direct correlations between formation of the structure and effects on transcription, we have taken advantage of the ability of the T7 polymerase to transcribe single-stranded substrates and of G4 DNA to form in single-stranded G-rich sequences in the presence of potassium ions. Under physiological KCl concentrations, we found that T7 RNAP transcription was arrested at two sites that mapped to the c-myb (GGA)(4) repeat sequence. The extent of arrest did not change with time, indicating that the c-myb repeat represented an absolute block and not a transient pause to T7 RNAP. Consistent with G4 DNA formation, arrest was not observed in the absence of KCl or in the presence of LiCl. Furthermore, mutations in the c-myb (GGA)(4) repeat, expected to prevent transition to G4, also eliminated the transcription block. We show T7 RNAP arrest at the c-myb repeat in double-stranded DNA under conditions mimicking the cellular concentration of biomolecules and potassium ions, suggesting that the G4 structure formed in the c-myb repeat may represent a transcription roadblock in vivo. Our results support a mechanism of transcription-coupled DNA repair initiated by arrest of transcription at G4 structures.

A bouquet of DNA structures: Emerging diversity

Directory of Open Access Journals (Sweden)

Mahima Kaushik

2016-03-01

Full Text Available Structural polymorphism of DNA has constantly been evolving from the time of illustration of the double helical model of DNA by Watson and Crick. A variety of non-canonical DNA structures have constantly been documented across the globe. DNA attracted worldwide attention as a carrier of genetic information. In addition to the classical Watson–Crick duplex, DNA can actually adopt diverse structures during its active participation in cellular processes like replication, transcription, recombination and repair. Structures like hairpin, cruciform, triplex, G-triplex, quadruplex, i-motif and other alternative non-canonical DNA structures have been studied at length and have also shown their in vivo occurrence. This review mainly focuses on non-canonical structures adopted by DNA oligonucleotides which have certain prerequisites for their formation in terms of sequence, its length, number and orientation of strands along with varied solution conditions. This conformational polymorphism of DNA might be the basis of different functional properties of a specific set of DNA sequences, further giving some insights for various extremely complicated biological phenomena. Many of these structures have already shown their linkages with diseases like cancer and genetic disorders, hence making them an extremely striking target for structure-specific drug designing and therapeutic applications.

A bouquet of DNA structures: Emerging diversity.

Science.gov (United States)

Kaushik, Mahima; Kaushik, Shikha; Roy, Kapil; Singh, Anju; Mahendru, Swati; Kumar, Mohan; Chaudhary, Swati; Ahmed, Saami; Kukreti, Shrikant

2016-03-01

Structural polymorphism of DNA has constantly been evolving from the time of illustration of the double helical model of DNA by Watson and Crick. A variety of non-canonical DNA structures have constantly been documented across the globe. DNA attracted worldwide attention as a carrier of genetic information. In addition to the classical Watson-Crick duplex, DNA can actually adopt diverse structures during its active participation in cellular processes like replication, transcription, recombination and repair. Structures like hairpin, cruciform, triplex, G-triplex, quadruplex, i-motif and other alternative non-canonical DNA structures have been studied at length and have also shown their in vivo occurrence. This review mainly focuses on non-canonical structures adopted by DNA oligonucleotides which have certain prerequisites for their formation in terms of sequence, its length, number and orientation of strands along with varied solution conditions. This conformational polymorphism of DNA might be the basis of different functional properties of a specific set of DNA sequences, further giving some insights for various extremely complicated biological phenomena. Many of these structures have already shown their linkages with diseases like cancer and genetic disorders, hence making them an extremely striking target for structure-specific drug designing and therapeutic applications.

Molecular dynamics simulations of guanine quadruplex loops: Advances and force field limitations

Czech Academy of Sciences Publication Activity Database

Fadrná, E.; Špačková, Naďa; Štefl, R.; Koča, J.; Cheatham III, T. E.; Šponer, Jiří

2004-01-01

Roč. 87, č. 1 (2004), s. 227-242 ISSN 0006-3495 R&D Projects: GA MŠk LN00A016 Grant - others:Wellcome Trust(GB) GR067507MF Institutional research plan: CEZ:AV0Z5004920 Keywords : quanine quadruplex * four-thymidine loop * locally enhanced sampling Subject RIV: BO - Biophysics Impact factor: 4.585, year: 2004

DNA origami nanorobot fiber optic genosensor to TMV.

Science.gov (United States)

Torelli, Emanuela; Manzano, Marisa; Srivastava, Sachin K; Marks, Robert S

2018-01-15

In the quest of greater sensitivity and specificity of diagnostic systems, one continually searches for alternative DNA hybridization methods, enabling greater versatility and where possible field-enabled detection of target analytes. We present, herein, a hybrid molecular self-assembled scaffolded DNA origami entity, intimately immobilized via capture probes linked to aminopropyltriethoxysilane, onto a glass optical fiber end-face transducer, thus producing a novel biosensor. Immobilized DNA nanorobots with a switchable flap can then be actuated by a specific target DNA present in a sample, by exposing a hemin/G-quadruplex DNAzyme, which then catalyzes the generation of chemiluminescence, once the specific fiber probes are immersed in a luminol-based solution. Integrating organic nanorobots to inorganic fiber optics creates a hybrid system that we demonstrate as a proof-of-principle can be utilized in specific DNA sequence detection. This system has potential applications in a wide range of fields, including point-of-care diagnostics or cellular in vivo biosensing when using ultrathin fiber optic probes for research purposes. Copyright © 2017 Elsevier B.V. All rights reserved.

Small Molecule Microarrays Enable the Identification of a Selective, Quadruplex-Binding Inhibitor of MYC Expression.

Science.gov (United States)

Felsenstein, Kenneth M; Saunders, Lindsey B; Simmons, John K; Leon, Elena; Calabrese, David R; Zhang, Shuling; Michalowski, Aleksandra; Gareiss, Peter; Mock, Beverly A; Schneekloth, John S

2016-01-15

The transcription factor MYC plays a pivotal role in cancer initiation, progression, and maintenance. However, it has proven difficult to develop small molecule inhibitors of MYC. One attractive route to pharmacological inhibition of MYC has been the prevention of its expression through small molecule-mediated stabilization of the G-quadruplex (G4) present in its promoter. Although molecules that bind globally to quadruplex DNA and influence gene expression are well-known, the identification of new chemical scaffolds that selectively modulate G4-driven genes remains a challenge. Here, we report an approach for the identification of G4-binding small molecules using small molecule microarrays (SMMs). We use the SMM screening platform to identify a novel G4-binding small molecule that inhibits MYC expression in cell models, with minimal impact on the expression of other G4-associated genes. Surface plasmon resonance (SPR) and thermal melt assays demonstrated that this molecule binds reversibly to the MYC G4 with single digit micromolar affinity, and with weaker or no measurable binding to other G4s. Biochemical and cell-based assays demonstrated that the compound effectively silenced MYC transcription and translation via a G4-dependent mechanism of action. The compound induced G1 arrest and was selectively toxic to MYC-driven cancer cell lines containing the G4 in the promoter but had minimal effects in peripheral blood mononucleocytes or a cell line lacking the G4 in its MYC promoter. As a measure of selectivity, gene expression analysis and qPCR experiments demonstrated that MYC and several MYC target genes were downregulated upon treatment with this compound, while the expression of several other G4-driven genes was not affected. In addition to providing a novel chemical scaffold that modulates MYC expression through G4 binding, this work suggests that the SMM screening approach may be broadly useful as an approach for the identification of new G4-binding small

Label-free and sensitive detection of T4 polynucleotide kinase activity via coupling DNA strand displacement reaction with enzymatic-aided amplification.

Science.gov (United States)

Cheng, Rui; Tao, Mangjuan; Shi, Zhilu; Zhang, Xiafei; Jin, Yan; Li, Baoxin

2015-11-15

Several fluorescence signal amplification strategies have been developed for sensitive detection of T4 polynucleotide kinase (T4 PNK) activity, but they need fluorescence dye labeled DNA probe. We have addressed the limitation and report here a label-free strategy for sensitive detection of PNK activity by coupling DNA strand displacement reaction with enzymatic-aided amplification. A hairpin oligonucleotide (hpDNA) with blunt ends was used as the substrate for T4 PNK phosphorylation. In the presence of T4 PNK, the stem of hpDNA was phosphorylated and further degraded by lambda exonuclease (λ exo) from 5' to 3' direction to release a single-stranded DNA as a trigger of DNA strand displacement reaction (SDR). The trigger DNA can continuously displace DNA P2 from P1/P2 hybrid with the help of specific cleavage of nicking endonuclease (Nt.BbvCI). Then, DNA P2 can form G-quadruplex in the presence of potassium ions and quadruplex-selective fluorphore, N-methyl mesoporphyrin IX (NMM), resulting in a significant increase in fluorescence intensity of NMM. Thus, the accumulative release of DNA P2 led to fluorescence signal amplification for determining T4 PNK activity with a detection limit of 6.6×10(-4) U/mL, which is superior or comparative with established approaches. By ingeniously utilizing T4 PNK-triggered DNA SDR, T4 PNK activity can be specifically and facilely studied in homogeneous solution containing complex matrix without any external fluorescence labeling. Moreover, the influence of different inhibitors on the T4 PNK activity revealed that it also can be explored to screen T4 PNK inhibitors. Therefore, this label-free amplification strategy presents a facile and cost-effective approach for nucleic acid phosphorylation related research. Copyright © 2015 Elsevier B.V. All rights reserved.

Development of a Novel Fluorescence Assay Based on the Use of the Thrombin-Binding Aptamer for the Detection of O6-Alkylguanine-DNA Alkyltransferase Activity

Directory of Open Access Journals (Sweden)

Maria Tintoré

2010-01-01

Full Text Available Human O6-alkylguanine-DNA alkyltransferase (hAGT is a DNA repair protein that reverses the effects of alkylating agents by removing DNA adducts from the O6 position of guanine. Here, we developed a real-time fluorescence hAGT activity assay that is based on the detection of conformational changes of the thrombin-binding aptamer (TBA. The quadruplex structure of TBA is disrupted when a central guanine is replaced by an O6-methyl-guanine. The sequence also contains a fluorophore (fluorescein and a quencher (dabsyl attached to the opposite ends. In the unfolded structure, the fluorophore and the quencher are separated. When hAGT removes the methyl group from the central guanine of TBA, it folds back immediately into its quadruplex structure. Consequently, the fluorophore and the quencher come into close proximity, thereby resulting in decreased fluorescence intensity. Here, we developed a new method to quantify the hAGT without using radioactivity. This new fluorescence resonance energy transfer assay has been designed to detect the conformational change of TBA that is induced by the removal of the O6-methyl group.

Investigation of hyperfine interactions in DNA nitrogenous bases using perturbed angular correlation spectroscopy

International Nuclear Information System (INIS)

Silva, Andreia dos Santos; Carbonari, Artur Wilson; Lapolli, Andre Luis; Saxena, Rajendra Narain; Saitovitch, Henrique

2013-01-01

Perturbed γγ angular correlations (PAC) spectroscopy has been used to study the DNA nitrogenous bases (adenine, cytosine, guanine, thymine), using 111 In→ 111 Cd and 111m Cd→ 111 Cd probe nuclei. One of the advantages of applying PAC technique to biological molecules is that the experiments can be carried out on molecules in aqueous solution [1], approaching the function of molecules under conditions that are close to in vivo conditions. The measurements were carried out for DNA nitrogenous bases molecules at 295 K and 77 K in order to investigate dynamic and static hyperfine interactions, respectively. The interpretation of the results was based on the measurements of dynamic interaction characterized by the decay constant from which valuable information on the macroscopic behavior of the molecules was obtained [2; 3]. On the other hand, PAC measurements at low temperature showed interaction frequency (ν Q ), asymmetry parameter (η) and the distribution of the quadrupole frequency (δ). These parameters provide a local microscopic description of the chemical environment in the neighborhood of the probe nuclei. Results showed differences in the hyperfine interactions of probe nuclei bound to the studied biomolecules. Such differences were observed by variations in the hyperfine parameters, which depended on the type of biomolecule and the results also showed that the probe nuclei bounded at the molecules in some cases and at others did not. (author)

Profiling DNA damage response following mitotic perturbations

DEFF Research Database (Denmark)

Pedersen, Ronni Sølvhøi; Karemore, Gopal; Gudjonsson, Thorkell

2016-01-01

that a broad spectrum of mitotic errors correlates with increased DNA breakage in daughter cells. Unexpectedly, we find that only a subset of these correlations are functionally linked. We identify the genuine mitosis-born DNA damage events and sub-classify them according to penetrance of the observed...

Ultrasensitive photoelectrochemical aptasensor for lead ion detection based on sensitization effect of CdTe QDs on MoS2-CdS:Mn nanocomposites by the formation of G-quadruplex structure.

Science.gov (United States)

Shi, Jian-Jun; Zhu, Jing-Chun; Zhao, Ming; Wang, Yan; Yang, Ping; He, Jie

2018-06-01

An ultrasensitive photoelectrochemical (PEC) aptasensor for lead ion (Pb 2+ ) detection was fabricated based on MoS 2 -CdS:Mn nanocomposites and sensitization effect of CdTe quantum dots (QDs). MoS 2 -CdS:Mn modified electrode was used as the PEC matrix for the immobilization of probe DNA (pDNA) labeled with CdTe QDs. Target DNA (tDNA) were hybridized with pDNA to made the QDs locate away from the electrode surface by the rod-like double helix. The detection of Pb 2+ was based on the conformational change of the pDNA to G-quadruplex structure in the presence of Pb 2+ , which made the labeled QDs move close to the electrode surface, leading to the generation of sensitization effect and evident increase of the photocurrent intensity. The linear range was 50 fM to 100 nM with a detection limit of 16.7 fM. The recoveries of the determination of Pb 2+ in real samples were in the range of 102.5-108.0%. This proposed PEC aptasensor provides a new sensing strategy for various heavy metal ions at ultralow levels. Copyright © 2018 Elsevier B.V. All rights reserved.

Label-Free Ag+ Detection by Enhancing DNA Sensitized Tb3+ Luminescence

Directory of Open Access Journals (Sweden)

Kimberly Kleinke

2016-08-01

Full Text Available In this work, the effect of Ag+ on DNA sensitized Tb3+ luminescence was studied initially using the Ag+-specific RNA-cleaving DNAzyme, Ag10c. While we expected to observe luminescence quenching by Ag+, a significant enhancement was produced. Based on this observation, simple DNA oligonucleotide homopolymers were used with systematically varied sequence and length. We discovered that both poly-G and poly-T DNA have a significant emission enhancement by Ag+, while the absolute intensity is stronger with the poly-G DNA, indicating that a G-quadruplex DNA is not required for this enhancement. Using the optimized length of the G7 DNA (an oligo constituted with seven guanines, Ag+ was measured with a detection limit of 57.6 nM. The signaling kinetics, G7 DNA conformation, and the binding affinity of Tb3+ to the DNA in the presence or absence of Ag+ are also studied to reveal the mechanism of emission enhancement. This observation is useful not only for label-free detection of Ag+, but also interesting for the rational design of new biosensors using Tb3+ luminescence.

G-quadruplex formation in the Oct4 promoter positively regulates Oct4 expression

Czech Academy of Sciences Publication Activity Database

Renčiuk, Daniel; Ryneš, J.; Kejnovská, Iva; Foldynova-Trantirkova, S.; Andaeng, M.; Trantírek, L.; Vorlíčková, Michaela

2017-01-01

Roč. 1860, č. 2 (2017), s. 175-183 ISSN 1874-9399 R&D Projects: GA ČR(CZ) GP14-33947P; GA ČR GAP205/12/0466; GA ČR(CZ) GA15-06785S Institutional support: RVO:68081707 Keywords : linked polymorphic region * guanine quadruplexes * transcription factor Subject RIV: CE - Biochemistry OBOR OECD: Biochemistry and molecular biology Impact factor: 5.018, year: 2016

Sulforaphane enhances irradiation effects in terms of perturbed cell cycle progression and increased DNA damage in pancreatic cancer cells.

Directory of Open Access Journals (Sweden)

Patrick Naumann

Full Text Available Sulforaphane (SFN, an herbal isothiocyanate enriched in cruciferous vegetables like broccoli and cauliflower, has gained popularity for its antitumor effects in cell lines such as pancreatic cancer. Antiproliferative as well as radiosensitizing properties were reported for head and neck cancer but little is known about its effects in pancreatic cancer cells in combination with irradiation (RT.In four established pancreatic cancer cell lines we investigated clonogenic survival, analyzed cell cycle distribution and compared DNA damage via flow cytometry and western blot after treatment with SFN and RT.Both SFN and RT show a strong and dose dependent survival reduction in clonogenic assays, an induction of a G2/M cell cycle arrest and an increase in γH2AX protein level indicating DNA damage. Effects were more pronounced in combined treatment and both cell cycle perturbation and DNA damage persisted for a longer period than after SFN or RT alone. Moreover, SFN induced a loss of DNA repair proteins Ku 70, Ku 80 and XRCC4.Our results suggest that combination of SFN and RT exerts a more distinct DNA damage and growth inhibition than each treatment alone. SFN seems to be a viable option to improve treatment efficacy of chemoradiation with hopefully higher rates of secondary resectability after neoadjuvant treatment for pancreatic cancer.

Low-Energy Electron-Induced Strand Breaks in Telomere-Derived DNA Sequences-Influence of DNA Sequence and Topology.

Science.gov (United States)

Rackwitz, Jenny; Bald, Ilko

2018-03-26

During cancer radiation therapy high-energy radiation is used to reduce tumour tissue. The irradiation produces a shower of secondary low-energy (DNA very efficiently by dissociative electron attachment. Recently, it was suggested that low-energy electron-induced DNA strand breaks strongly depend on the specific DNA sequence with a high sensitivity of G-rich sequences. Here, we use DNA origami platforms to expose G-rich telomere sequences to low-energy (8.8 eV) electrons to determine absolute cross sections for strand breakage and to study the influence of sequence modifications and topology of telomeric DNA on the strand breakage. We find that the telomeric DNA 5'-(TTA GGG) 2 is more sensitive to low-energy electrons than an intermixed sequence 5'-(TGT GTG A) 2 confirming the unique electronic properties resulting from G-stacking. With increasing length of the oligonucleotide (i.e., going from 5'-(GGG ATT) 2 to 5'-(GGG ATT) 4 ), both the variety of topology and the electron-induced strand break cross sections increase. Addition of K + ions decreases the strand break cross section for all sequences that are able to fold G-quadruplexes or G-intermediates, whereas the strand break cross section for the intermixed sequence remains unchanged. These results indicate that telomeric DNA is rather sensitive towards low-energy electron-induced strand breakage suggesting significant telomere shortening that can also occur during cancer radiation therapy. © 2018 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

Delineation of G-Quadruplex Alkylation Sites Mediated by 3,6-Bis(1-methyl-4-vinylpyridinium iodide)carbazole-Aniline Mustard Conjugates.

Science.gov (United States)

Chen, Chien-Han; Hu, Tsung-Hao; Huang, Tzu-Chiao; Chen, Ying-Lan; Chen, Yet-Ran; Cheng, Chien-Chung; Chen, Chao-Tsen

2015-11-23

A new G-quadruplex (G-4)-directing alkylating agent BMVC-C3M was designed and synthesized to integrate 3,6-bis(1-methyl-4-vinylpyridinium iodide)carbazole (BMVC) with aniline mustard. Various telomeric G-4 structures (hybrid-2 type and antiparallel) and an oncogene promoter, c-MYC (parallel), were constructed to react with BMVC-C3M, yielding 35 % alkylation yield toward G-4 DNA over other DNA categories (alkylation adducts by electrospray ionization mass spectroscopy (ESI-MS) revealed the stepwise DNA alkylation mechanism of aniline mustard for the first time. Furthermore, the monoalkylation sites and intrastrand cross-linking sites were determined and found to be dependent on G-4 topology based on the results of footprinting analysis in combination with mass spectroscopic techniques and in silico modeling. The results indicated that BMVC-C3M preferentially alkylated at A15 (H26), G12 (H24), and G2 (c-MYC), respectively, as monoalkylated adducts and formed A15-C3M-A21 (H26), G12-C3M-G4 (H24), and G2-C3M-G4/G17 (c-MYC), respectively, as cross-linked dialkylated adducts. Collectively, the stability and site-selective cross-linking capacity of BMVC-C3M provides a credible tool for the structural and functional characterization of G-4 DNAs in biological systems. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Development of an Efficient G-Quadruplex-Stabilised Thrombin-Binding Aptamer Containing a Three-Carbon Spacer Molecule

DEFF Research Database (Denmark)

Aaldering, Lukas J.; Poongavanam, Vasanthanathan; Langkjær, Niels

2017-01-01

The thrombin-binding aptamer (TBA), which shows anticoagulant properties, is one of the most studied G-quadruplex-forming aptamers. In this study, we investigated the impact of different chemical modifications such as a three-carbon spacer (spacer-C3), unlocked nucleic acid (UNA) and 3′-amino-mod...

Triple Quenching of a Novel Self-Enhanced Ru(II) Complex by Hemin/G-Quadruplex DNAzymes and Its Potential Application to Quantitative Protein Detection.

Science.gov (United States)

Zhao, Min; Liao, Ni; Zhuo, Ying; Chai, Ya-Qin; Wang, Ji-Peng; Yuan, Ruo

2015-08-04

Herein, a novel "on-off" electrochemiluminescence (ECL) aptasensor for highly sensitive determination of thrombin has been constructed based on the triple quenching of the effect of hemin/G-quadruplex DNAzymes upon the Ru(II) complex-based ECL system. First, a strong initial ECL signal was achieved by the dual amplification strategies of (i) intramolecular coreaction of a self-enhanced Ru(II)-based molecule (PTCA-PEI-Ru(II)) and (ii) intermolecular coreaction between PTCA-PEI-Ru(II) and nicotinamide adenine dinucleotide (NADH), which was named the signal-on state. Then, a novel triple quenching of the effect of multifunctional hemin/G-quadruplex DNAzymes upon the Ru(II) complex-based ECL system was designed to realize the desirable signal-off state, which was outlined as follows: (i) the hemin/G-quadruplex DNAzymes mimicked NADH oxidase to oxidize NADH and in situ generate the H2O2, consuming the coreactant of NADH; (ii) its active center of hemin could oxidize the excited state PTCA-PEI-Ru(II)* to PTCA-PEI-Ru(III), making the energy and electron transfer quench; (iii) it also acted as horseradish peroxidase (HRP) to catalyze the H2O2 for in situ producing the quencher of O2. Based on triple quenching of the effect of hemin/G-quadruplex DNAzymes, the highly sensitive "on-off" thrombin aptasensor was developed with a wide linear detection range of 1.0 × 10(-14) M to 1.0 × 10(-10) M and a detection limit down to the femtomolar level.

Amplified biosensing using the horseradish peroxidase-mimicking DNAzyme as an electrocatalyst.

Science.gov (United States)

Pelossof, Gilad; Tel-Vered, Ran; Elbaz, Johann; Willner, Itamar

2010-06-01

The hemin/G-quadruplex horseradish peroxidase-mimicking DNAzyme is assembled on Au electrodes. It reveals bioelectrocatalytic properties and electrocatalyzes the reduction of H(2)O(2). The bioelectrocatalytic functions of the hemin/G-quadruplex DNAzyme are used to develop electrochemical sensors that follow the activity of glucose oxidase and biosensors for the detection of DNA or low-molecular-weight substrates (adenosine monophosphate, AMP). Hairpin nucleic structures that include the G-quadruplex sequence in a caged configuration and the nucleic acid sequence complementary to the analyte DNA, or the aptamer sequence for AMP, are immobilized on Au-electrode surfaces. In the presence of the DNA analyte, or AMP, the hairpin structures are opened, and the hemin/G-quadruplex horseradish peroxidase-mimicking DNAzyme structures are generated on the electrode surfaces. The bioelectrocatalytic cathodic currents generated by the functionalized electrodes, upon the electrochemical reduction of H(2)O(2), provide a quantitative measure for the detection of the target analytes. The DNA target was analyzed with a detection limit of 1 x 10(-12) M, while the detection limit for analyzing AMP was 1 x 10(-6) M. Methods to regenerate the sensing surfaces are presented.

Can We Execute Reliable MM-PBSA Free Energy Computations of Relative Stabilities of Different Guanine Quadruplex Folds?

Czech Academy of Sciences Publication Activity Database

Islam, B.; Stadlbauer, Petr; Neidle, S.; Haider, S.; Šponer, Jiří

2016-01-01

Roč. 120, č. 11 (2016), s. 2899-2912 ISSN 1520-6106 R&D Projects: GA ČR(CZ) GA16-13721S Institutional support: RVO:68081707 Keywords : MOLECULAR-DYNAMICS SIMULATIONS * TELOMERIC G-QUADRUPLEX * AMBER FORCE-FIELD Subject RIV: BO - Biophysics Impact factor: 3.177, year: 2016

Characterizing and controlling intrinsic biases of lambda exonuclease in nascent strand sequencing reveals phasing between nucleosomes and G-quadruplex motifs around a subset of human replication origins.

Science.gov (United States)

Foulk, Michael S; Urban, John M; Casella, Cinzia; Gerbi, Susan A

2015-05-01

Nascent strand sequencing (NS-seq) is used to discover DNA replication origins genome-wide, allowing identification of features for their specification. NS-seq depends on the ability of lambda exonuclease (λ-exo) to efficiently digest parental DNA while leaving RNA-primer protected nascent strands intact. We used genomics and biochemical approaches to determine if λ-exo digests all parental DNA sequences equally. We report that λ-exo does not efficiently digest G-quadruplex (G4) structures in a plasmid. Moreover, λ-exo digestion of nonreplicating genomic DNA (LexoG0) enriches GC-rich DNA and G4 motifs genome-wide. We used LexoG0 data to control for nascent strand-independent λ-exo biases in NS-seq and validated this approach at the rDNA locus. The λ-exo-controlled NS-seq peaks are not GC-rich, and only 35.5% overlap with 6.8% of all G4s, suggesting that G4s are not general determinants for origin specification but may play a role for a subset. Interestingly, we observed a periodic spacing of G4 motifs and nucleosomes around the peak summits, suggesting that G4s may position nucleosomes at this subset of origins. Finally, we demonstrate that use of Na(+) instead of K(+) in the λ-exo digestion buffer reduced the effect of G4s on λ-exo digestion and discuss ways to increase both the sensitivity and specificity of NS-seq. © 2015 Foulk et al.; Published by Cold Spring Harbor Laboratory Press.

DNA-Mediated Electrochemistry

Science.gov (United States)

Gorodetsky, Alon A.; Buzzeo, Marisa C.

2009-01-01

The base pair stack of DNA has been demonstrated as a medium for long range charge transport chemistry both in solution and at DNA-modified surfaces. This chemistry is exquisitely sensitive to structural perturbations in the base pair stack as occur with lesions, single base mismatches, and protein binding. We have exploited this sensitivity for the development of reliable electrochemical assays based on DNA charge transport at self-assembled DNA monolayers. Here we discuss the characteristic features, applications, and advantages of DNA-mediated electrochemistry. PMID:18980370

Improved Inhibition of Telomerase by Short Twisted Intercalating Nucleic Acids under Molecular Crowding Conditions

DEFF Research Database (Denmark)

Agarwal, Tani; Pradhan, Devranjan; Géci, Imrich

2012-01-01

Human telomeric DNA has the ability to fold into a 4-stranded G-quadruplex structure. Several G-quadruplex ligands are known to stabilize the structure and thereby inhibit telomerase activity. Such ligands have demonstrated efficient telomerase inhibition in dilute conditions, but under molecular...

MTBP, the partner of Treslin, contains a novel DNA-binding domain that is essential for proper initiation of DNA replication.

Science.gov (United States)

Kumagai, Akiko; Dunphy, William G

2017-11-01

Treslin, which is essential for incorporation of Cdc45 into the replicative helicase, possesses a partner called MTBP (Mdm2-binding protein). We have analyzed Xenopus and human MTBP to assess its role in DNA replication. Depletion of MTBP from Xenopus egg extracts, which also removes Treslin, abolishes DNA replication. These extracts be can rescued with recombinant Treslin-MTBP but not Treslin or MTBP alone. Thus, Treslin-MTBP is collectively necessary for replication. We have identified a C-terminal region of MTBP (the CTM domain) that binds efficiently to both double-stranded DNA and G-quadruplex (G4) DNA. This domain also exhibits homology with budding yeast Sld7. Mutants of MTBP without a functional CTM domain are defective for DNA replication in Xenopus egg extracts. These mutants display an impaired localization to chromatin and the inability to support loading of Cdc45. Human cells harboring such a mutant also display severe S-phase defects. Thus, the CTM domain of MTBP plays a critical role in localizing Treslin-MTBP to the replication apparatus for initiation. © 2017 Kumagai and Dunphy. This article is distributed by The American Society for Cell Biology under license from the author(s). Two months after publication it is available to the public under an Attribution–Noncommercial–Share Alike 3.0 Unported Creative Commons License (http://creativecommons.org/licenses/by-nc-sa/3.0).

Oligomer formation and G-quadruplex binding by purified murine Rif1 protein, a key organizer of higher-order chromatin architecture.

Science.gov (United States)

Moriyama, Kenji; Yoshizawa-Sugata, Naoko; Masai, Hisao

2018-03-09

Rap1-interacting protein 1 (Rif1) regulates telomere length in budding yeast. We previously reported that, in metazoans and fission yeast, Rif1 also plays pivotal roles in controlling genome-wide DNA replication timing. We proposed that Rif1 may assemble chromatin compartments that contain specific replication-timing domains by promoting chromatin loop formation. Rif1 also is involved in DNA lesion repair, restart after replication fork collapse, anti-apoptosis activities, replicative senescence, and transcriptional regulation. Although multiple physiological functions of Rif1 have been characterized, biochemical and structural information on mammalian Rif1 is limited, mainly because of difficulties in purifying the full-length protein. Here, we expressed and purified the 2418-amino-acid-long, full-length murine Rif1 as well as its partially truncated variants in human 293T cells. Hydrodynamic analyses indicated that Rif1 forms elongated or extended homo-oligomers in solution, consistent with the presence of a HEAT-type helical repeat segment known to adopt an elongated shape. We also observed that the purified murine Rif1 bound G-quadruplex (G4) DNA with high specificity and affinity, as was previously shown for Rif1 from fission yeast. Both the N-terminal (HEAT-repeat) and C-terminal segments were involved in oligomer formation and specifically bound G4 DNA, and the central intrinsically disordered polypeptide segment increased the affinity for G4. Of note, pulldown assays revealed that Rif1 simultaneously binds multiple G4 molecules. Our findings support a model in which Rif1 modulates chromatin loop structures through binding to multiple G4 assemblies and by holding chromatin fibers together. © 2018 by The American Society for Biochemistry and Molecular Biology, Inc.

RTEL1 dismantles T loops and counteracts telomeric G4-DNA to maintain telomere integrity.

Science.gov (United States)

Vannier, Jean-Baptiste; Pavicic-Kaltenbrunner, Visnja; Petalcorin, Mark I R; Ding, Hao; Boulton, Simon J

2012-05-11

T loops and telomeric G-quadruplex (G4) DNA structures pose a potential threat to genome stability and must be dismantled to permit efficient telomere replication. Here we implicate the helicase RTEL1 in the removal of telomeric DNA secondary structures, which is essential for preventing telomere fragility and loss. In the absence of RTEL1, T loops are inappropriately resolved by the SLX4 nuclease complex, resulting in loss of the telomere as a circle. Depleting SLX4 or blocking DNA replication abolished telomere circles (TCs) and rescued telomere loss in RTEL1(-/-) cells but failed to suppress telomere fragility. Conversely, stabilization of telomeric G4-DNA or loss of BLM dramatically enhanced telomere fragility in RTEL1-deficient cells but had no impact on TC formation or telomere loss. We propose that RTEL1 performs two distinct functions at telomeres: it disassembles T loops and also counteracts telomeric G4-DNA structures, which together ensure the dynamics and stability of the telomere. Copyright © 2012 Elsevier Inc. All rights reserved.

G-Quadruplexes influence pri-microRNA processing.

Science.gov (United States)

Rouleau, Samuel G; Garant, Jean-Michel; Bolduc, François; Bisaillon, Martin; Perreault, Jean-Pierre

2018-02-01

RNA G-Quadruplexes (G4) have been shown to possess many biological functions, including the regulation of microRNA (miRNA) biogenesis and function. However, their impact on pri-miRNA processing remains unknown. We identified G4 located near the Drosha cleavage site in three distinct pri-miRNAs: pri-mir200c, pri-mir451a, and pri-mir497. The folding of the potential G4 motifs was determined in solution. Subsequently, mutations disrupting G4 folding led to important changes in the mature miRNAs levels in cells. Moreover, using small antisense oligonucleotides binding to the pri-miRNA, it was possible to modulate, either positively or negatively, the mature miRNA levels. Together, these data demonstrate that G4 motifs could contribute to the regulation of pri-mRNA processing, a novel role for G4. Considering that bio-informatics screening indicates that between 9% and 50% of all pri-miRNAs contain a putative G4, these structures possess interesting potential as future therapeutic targets.

Ultrasensitive electrochemical detection of avian influenza A (H7N9) virus DNA based on isothermal exponential amplification coupled with hybridization chain reaction of DNAzyme nanowires.

Science.gov (United States)

Yu, Yanyan; Chen, Zuanguang; Jian, Wensi; Sun, Duanping; Zhang, Beibei; Li, Xinchun; Yao, Meicun

2015-02-15

In this work, a simple and label-free electrochemical biosensor with duel amplification strategy was developed for DNA detection based on isothermal exponential amplification (EXPAR) coupled with hybridization chain reaction (HCR) of DNAzymes nanowires. Through rational design, neither the primer nor the DNAzymes containing molecular beacons (MBs) could react with the duplex probe which were fixed on the electrode surface. Once challenged with target, the duplex probe cleaved and triggered the EXPAR mediated target recycle and regeneration circles as well as the HCR process. As a result, a greater amount of targets were generated to cleave the duplex probes. Subsequently, the nanowires consisting of the G-quadruplex units were self-assembled through hybridization with the strand fixed on the electrode surface. In the presence of hemin, the resulting catalytic G-quadruplex-hemin HRP-mimicking DNAzymes were formed. Electrochemical signals can be obtained by measuring the increase in reduction current of oxidized 3.3',5.5'-tetramethylbenzidine sulfate (TMB), which was generated by DNAzyme in the presence of H2O2. This method exhibited ultrahigh sensitivity towards avian influenza A (H7N9) virus DNA sequence with detection limits of 9.4 fM and a detection range of 4 orders of magnitude. The biosensor was also capable of discriminating single-nucleotide difference among concomitant DNA sequences and performed well in spiked cell lysates. Copyright © 2014 Elsevier B.V. All rights reserved.

RPA prevents G-rich structure formation at lagging-strand telomeres to allow maintenance of chromosome ends.

Science.gov (United States)

Audry, Julien; Maestroni, Laetitia; Delagoutte, Emmanuelle; Gauthier, Tiphaine; Nakamura, Toru M; Gachet, Yannick; Saintomé, Carole; Géli, Vincent; Coulon, Stéphane

2015-07-14

Replication protein A (RPA) is a highly conserved heterotrimeric single-stranded DNA-binding protein involved in DNA replication, recombination, and repair. In fission yeast, the Rpa1-D223Y mutation provokes telomere shortening. Here, we show that this mutation impairs lagging-strand telomere replication and leads to the accumulation of secondary structures and recruitment of the homologous recombination factor Rad52. The presence of these secondary DNA structures correlates with reduced association of shelterin subunits Pot1 and Ccq1 at telomeres. Strikingly, heterologous expression of the budding yeast Pif1 known to efficiently unwind G-quadruplex rescues all the telomeric defects of the D223Y cells. Furthermore, in vitro data show that the identical D to Y mutation in human RPA specifically affects its ability to bind G-quadruplex. We propose that RPA prevents the formation of G-quadruplex structures at lagging-strand telomeres to promote shelterin association and facilitate telomerase action at telomeres. © 2015 The Authors.

G4-DNA formation in the HRAS promoter and rational design of decoy oligonucleotides for cancer therapy.

Directory of Open Access Journals (Sweden)

Alexandro Membrino

Full Text Available HRAS is a proto-oncogene involved in the tumorigenesis of urinary bladder cancer. In the HRAS promoter we identified two G-rich elements, hras-1 and hras-2, that fold, respectively, into an antiparallel and a parallel quadruplex (qhras-1, qhras-2. When we introduced in sequence hras-1 or hras-2 two point mutations that block quadruplex formation, transcription increased 5-fold, but when we stabilized the G-quadruplexes by guanidinium phthalocyanines, transcription decreased to 20% of control. By ChIP we found that sequence hras-1 is bound only by MAZ, while hras-2 is bound by MAZ and Sp1: two transcription factors recognizing guanine boxes. We also discovered by EMSA that recombinant MAZ-GST binds to both HRAS quadruplexes, while Sp1-GST only binds to qhras-1. The over-expression of MAZ and Sp1 synergistically activates HRAS transcription, while silencing each gene by RNAi results in a strong down-regulation of transcription. All these data indicate that the HRAS G-quadruplexes behave as transcription repressors. Finally, we designed decoy oligonucleotides mimicking the HRAS quadruplexes, bearing (R-1-O-[4-(1-Pyrenylethynyl phenylmethyl] glycerol and LNA modifications to increase their stability and nuclease resistance (G4-decoys. The G4-decoys repressed HRAS transcription and caused a strong antiproliferative effect, mediated by apoptosis, in T24 bladder cancer cells where HRAS is mutated.

Reversible Modulation of DNA-Based Hydrogel Shapes by Internal Stress Interactions.

Science.gov (United States)

Hu, Yuwei; Kahn, Jason S; Guo, Weiwei; Huang, Fujian; Fadeev, Michael; Harries, Daniel; Willner, Itamar

2016-12-14

We present the assembly of asymmetric two-layer hybrid DNA-based hydrogels revealing stimuli-triggered reversibly modulated shape transitions. Asymmetric, linear hydrogels that include layer-selective switchable stimuli-responsive elements that control the hydrogel stiffness are designed. Trigger-induced stress in one of the layers results in the bending of the linear hybrid structure, thereby minimizing the elastic free energy of the systems. The removal of the stress by a counter-trigger restores the original linear bilayer hydrogel. The stiffness of the DNA hydrogel layers is controlled by thermal, pH (i-motif), K + ion/crown ether (G-quadruplexes), chemical (pH-doped polyaniline), or biocatalytic (glucose oxidase/urease) triggers. A theoretical model relating the experimental bending radius of curvatures of the hydrogels with the Young's moduli and geometrical parameters of the hydrogels is provided. Promising applications of shape-regulated stimuli-responsive asymmetric hydrogels include their use as valves, actuators, sensors, and drug delivery devices.

Chemosensitivity of human small cell carcinoma of the lung detected by flow cytometric DNA analysis of drug-induced cell cycle perturbations in vitro

DEFF Research Database (Denmark)

Engelholm, S A; Spang-Thomsen, M; Vindeløv, L L

1986-01-01

A method based on detection of drug-induced cell cycle perturbation by flow cytometric DNA analysis has previously been described in Ehrlich ascites tumors as a way to estimate chemosensitivity. The method is extended to test human small-cell carcinoma of the lung. Three tumors with different...... sensitivities to melphalan in nude mice were used. Tumors were disaggregated by a combined mechanical and enzymatic method and thereafter have incubated with different doses of melphalan. After incubation the cells were plated in vitro on agar, and drug induced cell cycle changes were monitored by flow...

The dynamic interplay between DNA topoisomerases and DNA topology.

Science.gov (United States)

Seol, Yeonee; Neuman, Keir C

2016-11-01

Topological properties of DNA influence its structure and biochemical interactions. Within the cell, DNA topology is constantly in flux. Transcription and other essential processes, including DNA replication and repair, not only alter the topology of the genome but also introduce additional complications associated with DNA knotting and catenation. These topological perturbations are counteracted by the action of topoisomerases, a specialized class of highly conserved and essential enzymes that actively regulate the topological state of the genome. This dynamic interplay among DNA topology, DNA processing enzymes, and DNA topoisomerases is a pervasive factor that influences DNA metabolism in vivo. Building on the extensive structural and biochemical characterization over the past four decades that has established the fundamental mechanistic basis of topoisomerase activity, scientists have begun to explore the unique roles played by DNA topology in modulating and influencing the activity of topoisomerases. In this review we survey established and emerging DNA topology-dependent protein-DNA interactions with a focus on in vitro measurements of the dynamic interplay between DNA topology and topoisomerase activity.

DNA breaks and repair in interstitial telomere sequences: Influence of chromatin structure

International Nuclear Information System (INIS)

Revaud, D.

2009-06-01

Interstitial Telomeric Sequences (ITS) are over-involved in spontaneous and radiationinduced chromosome aberrations in chinese hamster cells. We have performed a study to investigate the origin of their instability, spontaneously or after low doses irradiation. Our results demonstrate that ITS have a particular chromatin structure: short nucleotide repeat length, less compaction of the 30 nm chromatin fiber, presence of G-quadruplex structures. These features would modulate breaks production and would favour the recruitment of alternative DNA repair mechanisms, which are prone to produce chromosome aberrations. These pathways could be at the origin of chromosome aberrations in ITS whereas NHEJ and HR Double Strand Break repair pathways are rather required for a correct repair in these regions. (author)

Label-free and enzyme-free detection of transcription factors with graphene oxide fluorescence switch-based multifunctional G-quadruplex-hairpin probe.

Science.gov (United States)

Zhu, Desong; Wang, Lei; Xu, Xiaowen; Jiang, Wei

2016-01-15

Transcription factors (TFs) play pivotal roles in the regulation of a variety of essential cellular processes and some of them have been recognized as potential diagnostic markers and therapeutic targets of some diseases. Sensitive and accurate detection of TFs is of great importance to better understanding their roles in gene regulation and evaluation of disease state. Here, we developed a simple, label-free and enzyme-free new fluorescent strategy for the detection of TFs by graphene oxide (GO) fluorescence switch-based multifunctional G-quadruplex-hairpin probe (MGHP). The MGHP possessed of three functions simultaneously, adsorbing onto GO with the loop part, binding to target with the stem part and serving as signal carrier with the terminal G-quadruplex. First, the MGHP was adsorbed quickly to GO. Next, the TF bound to the stem part of MGHP to form a huge target-MGHP complex, which led to desorption of the complex from GO. Finally, NMM was inserted into G-quadruplex in the complex to yield an enhanced fluorescence response. The GO used here, as a fluorescence switch, could quickly and efficiently quench the fluorescence of NMM inserted into the MGHP absorbed on the GO, guaranteeing a high signal-to-noise ratio. Sensitive detection of purified NF-κB p50 and HeLa cell nuclear extracts were achieved with detection limits of 0.2nM and 7.8ng/µL, respectively. Moreover, this proposed strategy could be used to screen inhibitors of NF-κB p50 activity. The strategy proposed here might offer a new potential approach for reliable quantification of TFs in clinical diagnostics and treatment research of some diseases. Copyright © 2015 Elsevier B.V. All rights reserved.

Modular Nuclease-Responsive DNA Three-Way Junction-Based Dynamic Assembly of a DNA Device and Its Sensing Application.

Science.gov (United States)

Zhu, Jing; Wang, Lei; Xu, Xiaowen; Wei, Haiping; Jiang, Wei

2016-04-05

Here, we explored a modular strategy for rational design of nuclease-responsive three-way junctions (TWJs) and fabricated a dynamic DNA device in a "plug-and-play" fashion. First, inactivated TWJs were designed, which contained three functional domains: the inaccessible toehold and branch migration domains, the specific sites of nucleases, and the auxiliary complementary sequence. The actions of different nucleases on their specific sites in TWJs caused the close proximity of the same toehold and branch migration domains, resulting in the activation of the TWJs and the formation of a universal trigger for the subsequent dynamic assembly. Second, two hairpins (H1 and H2) were introduced, which could coexist in a metastable state, initially to act as the components for the dynamic assembly. Once the trigger initiated the opening of H1 via TWJs-driven strand displacement, the cascade hybridization of hairpins immediately switched on, resulting in the formation of the concatemers of H1/H2 complex appending numerous integrated G-quadruplexes, which were used to obtain label-free signal readout. The inherent modularity of this design allowed us to fabricate a flexible DNA dynamic device and detect multiple nucleases through altering the recognition pattern slightly. Taking uracil-DNA glycosylase and CpG methyltransferase M.SssI as models, we successfully realized the butt joint between the uracil-DNA glycosylase and M.SssI recognition events and the dynamic assembly process. Furthermore, we achieved ultrasensitive assay of nuclease activity and the inhibitor screening. The DNA device proposed here will offer an adaptive and flexible tool for clinical diagnosis and anticancer drug discovery.

Learning gene networks under SNP perturbations using eQTL datasets.

Directory of Open Access Journals (Sweden)

Lingxue Zhang

2014-02-01

identified computationally by our method under SNP perturbations is well supported by the results from experimental perturbation studies related to DNA replication stress response.

High-Resolution Profiling of Drosophila Replication Start Sites Reveals a DNA Shape and Chromatin Signature of Metazoan Origins

Directory of Open Access Journals (Sweden)

Federico Comoglio

2015-05-01

Full Text Available At every cell cycle, faithful inheritance of metazoan genomes requires the concerted activation of thousands of DNA replication origins. However, the genetic and chromatin features defining metazoan replication start sites remain largely unknown. Here, we delineate the origin repertoire of the Drosophila genome at high resolution. We address the role of origin-proximal G-quadruplexes and suggest that they transiently stall replication forks in vivo. We dissect the chromatin configuration of replication origins and identify a rich spatial organization of chromatin features at initiation sites. DNA shape and chromatin configurations, not strict sequence motifs, mark and predict origins in higher eukaryotes. We further examine the link between transcription and origin firing and reveal that modulation of origin activity across cell types is intimately linked to cell-type-specific transcriptional programs. Our study unravels conserved origin features and provides unique insights into the relationship among DNA topology, chromatin, transcription, and replication initiation across metazoa.

Highly sensitive and selective detection of Pb2+ using a turn-on fluorescent aptamer DNA silver nanoclusters sensor.

Science.gov (United States)

Zhang, Baozhu; Wei, Chunying

2018-05-15

A novel turn-on fluorescent biosensor has been constructed using C-PS2.M-DNA-templated silver nanoclusters (Ag NCs) with an average diameter of about 1 nm. The proposed approach presents a low-toxic, simple, sensitive, and selective detection for Pb 2+ . The fluorescence intensity of C-PS2.M-DNA-Ag NCs enhances significantly in the presence of Pb 2+ , which is attributed to the special interaction between Pb 2+ and its aptamer DNA PS2.M. Pb 2+ induces the aptamer to form G-quadruplex and makes two darkish DNA/Ag NCs located at the 3' and 5' terminus close, resulting in the fluorescence light-up. Moreover, Pb 2+ can be detected as low as 3.0 nM within a good linear range from 5 to 50 nM (R = 0.9862). Furthermore, the application for detection of Pb 2+ in real water samples further demonstrates the reliability of the sensor. Thus, this sensor system shows a potential application for monitoring Pb 2+ in environmental samples. Copyright © 2018 Elsevier B.V. All rights reserved.

DNA methylation

DEFF Research Database (Denmark)

Williams, Kristine; Christensen, Jesper; Helin, Kristian

2012-01-01

DNA methylation is involved in key cellular processes, including X-chromosome inactivation, imprinting and transcriptional silencing of specific genes and repetitive elements. DNA methylation patterns are frequently perturbed in human diseases such as imprinting disorders and cancer. The recent...... discovery that the three members of the TET protein family can convert 5-methylcytosine (5mC) into 5-hydroxymethylcytosine (5hmC) has provided a potential mechanism leading to DNA demethylation. Moreover, the demonstration that TET2 is frequently mutated in haematopoietic tumours suggests that the TET...... proteins are important regulators of cellular identity. Here, we review the current knowledge regarding the function of the TET proteins, and discuss various mechanisms by which they contribute to transcriptional control. We propose that the TET proteins have an important role in regulating DNA methylation...

DNA nanotechnology: On-command molecular Trojans

Science.gov (United States)

Niemeyer, Christof M.

2017-12-01

Lipid-motif-decorated DNA nanocapsules filled with photoresponsive polymers are capable of delivering signalling molecules into target organisms for biological perturbations at high spatiotemporal resolution.

R-ChIP Using Inactive RNase H Reveals Dynamic Coupling of R-loops with Transcriptional Pausing at Gene Promoters.

Science.gov (United States)

Chen, Liang; Chen, Jia-Yu; Zhang, Xuan; Gu, Ying; Xiao, Rui; Shao, Changwei; Tang, Peng; Qian, Hao; Luo, Daji; Li, Hairi; Zhou, Yu; Zhang, Dong-Er; Fu, Xiang-Dong

2017-11-16

R-loop, a three-stranded RNA/DNA structure, has been linked to induced genome instability and regulated gene expression. To enable precision analysis of R-loops in vivo, we develop an RNase-H-based approach; this reveals predominant R-loop formation near gene promoters with strong G/C skew and propensity to form G-quadruplex in non-template DNA, corroborating with all biochemically established properties of R-loops. Transcription perturbation experiments further indicate that R-loop induction correlates to transcriptional pausing. Interestingly, we note that most mapped R-loops are each linked to a nearby free RNA end; by using a ribozyme to co-transcriptionally cleave nascent RNA, we demonstrate that such a free RNA end coupled with a G/C-skewed sequence is necessary and sufficient to induce R-loop. These findings provide a topological solution for RNA invasion into duplex DNA and suggest an order for R-loop initiation and elongation in an opposite direction to that previously proposed. Copyright © 2017 Elsevier Inc. All rights reserved.

R-loops and initiation of DNA replication in human cells: a missing link?

Directory of Open Access Journals (Sweden)

Rodrigo eLombraña

2015-04-01

Full Text Available The unanticipated widespread occurrence of stable hybrid DNA/RNA structures (R-loops in human cells and the increasing evidence of their involvement in several human malignancies have invigorated the research on R-loop biology in recent years. Here we propose that physiological R-loop formation at CpG island promoters can contribute to DNA replication origin specification at these regions, the most efficient replication initiation sites in mammalian cells. Quite likely, this occurs by the strand-displacement reaction activating the formation of G-quadruplex structures that target the Origin Recognition Complex (ORC in the single-stranded conformation. In agreement with this, we found that R-loops co-localize with the ORC within the same CpG island region in a significant fraction of these efficient replication origins, precisely at the position displaying the highest density of G4 motifs. This scenario builds on the connection between transcription and replication in human cells and suggests that R-loop dysregulation at CpG island promoter-origins might contribute to the phenotype of DNA replication abnormalities and loss of genome integrity detected in cancer cells.

Fluorescence enhancement upon G-quadruplex folding: synthesis, structure, and biophysical characterization of a dansyl/cyclodextrin-tagged thrombin binding aptamer.

Science.gov (United States)

De Tito, Stefano; Morvan, François; Meyer, Albert; Vasseur, Jean-Jacques; Cummaro, Annunziata; Petraccone, Luigi; Pagano, Bruno; Novellino, Ettore; Randazzo, Antonio; Giancola, Concetta; Montesarchio, Daniela

2013-11-20

A novel fluorescent thrombin binding aptamer (TBA), conjugated with the environmentally sensitive dansyl probe at the 3'-end and a β-cyclodextrin residue at the 5'-end, has been efficiently synthesized exploiting Cu(I)-catalyzed azide-alkyne cycloaddition procedures. Its conformation and stability in solution have been studied by an integrated approach, combining in-depth NMR, CD, fluorescence, and DSC studies. ITC measurements have allowed us to analyze in detail its interaction with human thrombin. All the collected data show that this bis-conjugated aptamer fully retains its G-quadruplex formation ability and thrombin recognition properties, with the terminal appendages only marginally interfering with the conformational behavior of TBA. Folding of this modified aptamer into the chairlike, antiparallel G-quadruplex structure, promoted by K(+) and/or thrombin binding, typical of TBA, is associated with a net fluorescence enhancement, due to encapsulation of dansyl, attached at the 3'-end, into the apolar cavity of the β-cyclodextrin at the 5'-end. Overall, the structural characterization of this novel, bis-conjugated TBA fully demonstrates its potential as a diagnostic tool for thrombin recognition, also providing a useful basis for the design of suitable aptamer-based devices for theranostic applications, allowing simultaneously both detection and inhibition or modulation of the thrombin activity.

Poly-ADP-ribosylation of proteins responds to cellular perturbations

International Nuclear Information System (INIS)

Schneeweiss, F.H.A.; Sharan, R.N.

1999-01-01

From the results presented above it is quite obvious that poly-ADP-ribosylation reaction is a sensitive parameter to monitor cellular responses to a wide variety of perturbations. Having developed a monolayer assay system using 32 P-NAD + as a marker, it has become possible to measure levels of cellular ADP-ribosylation more precisely. It has been demonstrated that the trigger of poly-ADP-ribosylation reaction may involve different cellular components for different perturbations. In this, membrane has been found to be important. The study has been particularly informative in the realm of DNA damage and repair following qualitatively different radiation assaults. As poly-ADP-ribosylation in eukaryotic cells primarily affects chromosomal proteins, notably histones, the reaction is strongly triggered in response to single and double strand breaks in DNA. Therefore, level of cellular poly-ADP-ribosylation can potentially be used as a biosensor of radiation induced strand breaks and can be specially useful in clinical monitoring of progress of radiotherapy. The assay of poly-ADP-ribosylation, however, requires use of radiolabelled tracer, e.g. 32 P-NAD + . Due to this, study of poly-ADP-ribosylation can not be extended to monitor effects of incorporated radionuclides. In order to overcome this shortcoming and to make the assay more sensitive and quick, a Western blot immunoassay has been developed. The preliminary indications are that the immunoassay of poly-ADP-ribosylation will fulfil the requirements to use poly-ADP-ribosylation as a sensitive, convenient and clinically applicable biosensor of cell response not only to radiations but also to different perturbations. (orig.)

Conformational dynamics of the human propeller telomeric DNA quadruplex on a microsecond time scale

Czech Academy of Sciences Publication Activity Database

Islam, B.; Sgobba, M.; Laughton, C.; Orozco, M.; Šponer, Jiří; Neidle, S.; Haider, S.

2013-01-01

Roč. 41, č. 4 (2013), s. 2723-2735 ISSN 0305-1048 R&D Projects: GA ČR(CZ) GAP208/11/1822 Grant - others:GA ČR(CZ) ED1.1.00/02.0068 Program:ED Institutional support: RVO:68081707 Keywords : MOLECULAR-DYNAMICS * CRYSTAL-STRUCTURE * B-DNA Subject RIV: BO - Biophysics Impact factor: 8.808, year: 2013

Large-scale symmetry-adapted perturbation theory computations via density fitting and Laplace transformation techniques: investigating the fundamental forces of DNA-intercalator interactions.

Science.gov (United States)

Hohenstein, Edward G; Parrish, Robert M; Sherrill, C David; Turney, Justin M; Schaefer, Henry F

2011-11-07

Symmetry-adapted perturbation theory (SAPT) provides a means of probing the fundamental nature of intermolecular interactions. Low-orders of SAPT (here, SAPT0) are especially attractive since they provide qualitative (sometimes quantitative) results while remaining tractable for large systems. The application of density fitting and Laplace transformation techniques to SAPT0 can significantly reduce the expense associated with these computations and make even larger systems accessible. We present new factorizations of the SAPT0 equations with density-fitted two-electron integrals and the first application of Laplace transformations of energy denominators to SAPT. The improved scalability of the DF-SAPT0 implementation allows it to be applied to systems with more than 200 atoms and 2800 basis functions. The Laplace-transformed energy denominators are compared to analogous partial Cholesky decompositions of the energy denominator tensor. Application of our new DF-SAPT0 program to the intercalation of DNA by proflavine has allowed us to determine the nature of the proflavine-DNA interaction. Overall, the proflavine-DNA interaction contains important contributions from both electrostatics and dispersion. The energetics of the intercalator interaction are are dominated by the stacking interactions (two-thirds of the total), but contain important contributions from the intercalator-backbone interactions. It is hypothesized that the geometry of the complex will be determined by the interactions of the intercalator with the backbone, because by shifting toward one side of the backbone, the intercalator can form two long hydrogen-bonding type interactions. The long-range interactions between the intercalator and the next-nearest base pairs appear to be negligible, justifying the use of truncated DNA models in computational studies of intercalation interaction energies.

Senescent intervertebral disc cells exhibit perturbed matrix homeostasis phenotype.

Science.gov (United States)

Ngo, Kevin; Patil, Prashanti; McGowan, Sara J; Niedernhofer, Laura J; Robbins, Paul D; Kang, James; Sowa, Gwendolyn; Vo, Nam

2017-09-01

Aging greatly increases the risk for intervertebral disc degeneration (IDD) as a result of proteoglycan loss due to reduced synthesis and enhanced degradation of the disc matrix proteoglycan (PG). How disc matrix PG homeostasis becomes perturbed with age is not known. The goal of this study is to determine whether cellular senescence is a source of this perturbation. We demonstrated that disc cellular senescence is dramatically increased in the DNA repair-deficient Ercc1 -/Δ mouse model of human progeria. In these accelerated aging mice, increased disc cellular senescence is closely associated with the rapid loss of disc PG. We also directly examine PG homeostasis in oxidative damage-induced senescent human cells using an in vitro cell culture model system. Senescence of human disc cells treated with hydrogen peroxide was confirmed by growth arrest, senescence-associated β-galactosidase activity, γH2AX foci, and acquisition of senescence-associated secretory phenotype. Senescent human disc cells also exhibited perturbed matrix PG homeostasis as evidenced by their decreased capacity to synthesize new matrix PG and enhanced degradation of aggrecan, a major matrix PG. of the disc. Our in vivo and in vitro findings altogether suggest that disc cellular senescence is an important driver of PG matrix homeostatic perturbation and PG loss. Published by Elsevier B.V.

FANCJ couples replication past natural fork barriers with maintenance of chromatin structure.

Science.gov (United States)

Schwab, Rebekka A; Nieminuszczy, Jadwiga; Shin-ya, Kazuo; Niedzwiedz, Wojciech

2013-04-01

Defective DNA repair causes Fanconi anemia (FA), a rare childhood cancer-predisposing syndrome. At least 15 genes are known to be mutated in FA; however, their role in DNA repair remains unclear. Here, we show that the FANCJ helicase promotes DNA replication in trans by counteracting fork stalling on replication barriers, such as G4 quadruplex structures. Accordingly, stabilization of G4 quadruplexes in ΔFANCJ cells restricts fork movements, uncouples leading- and lagging-strand synthesis and generates small single-stranded DNA gaps behind the fork. Unexpectedly, we also discovered that FANCJ suppresses heterochromatin spreading by coupling fork movement through replication barriers with maintenance of chromatin structure. We propose that FANCJ plays an essential role in counteracting chromatin compaction associated with unscheduled replication fork stalling and restart, and suppresses tumorigenesis, at least partially, in this replication-specific manner.

Thermodynamic properties of water molecules in the presence of cosolute depend on DNA structure: a study using grid inhomogeneous solvation theory

Science.gov (United States)

Nakano, Miki; Tateishi-Karimata, Hisae; Tanaka, Shigenori; Tama, Florence; Miyashita, Osamu; Nakano, Shu-ichi; Sugimoto, Naoki

2015-01-01

In conditions that mimic those of the living cell, where various biomolecules and other components are present, DNA strands can adopt many structures in addition to the canonical B-form duplex. Previous studies in the presence of cosolutes that induce molecular crowding showed that thermal stabilities of DNA structures are associated with the properties of the water molecules around the DNAs. To understand how cosolutes, such as ethylene glycol, affect the thermal stability of DNA structures, we investigated the thermodynamic properties of water molecules around a hairpin duplex and a G-quadruplex using grid inhomogeneous solvation theory (GIST) with or without cosolutes. Our analysis indicated that (i) cosolutes increased the free energy of water molecules around DNA by disrupting water–water interactions, (ii) ethylene glycol more effectively disrupted water–water interactions around Watson–Crick base pairs than those around G-quartets or non-paired bases, (iii) due to the negative electrostatic potential there was a thicker hydration shell around G-quartets than around Watson–Crick-paired bases. Our findings suggest that the thermal stability of the hydration shell around DNAs is one factor that affects the thermal stabilities of DNA structures under the crowding conditions. PMID:26538600

Probing of miniPEGγ-PNA-DNA Hybrid Duplex Stability with AFM Force Spectroscopy.

Science.gov (United States)

Dutta, Samrat; Armitage, Bruce A; Lyubchenko, Yuri L

2016-03-15

Peptide nucleic acids (PNA) are synthetic polymers, the neutral peptide backbone of which provides elevated stability to PNA-PNA and PNA-DNA hybrid duplexes. It was demonstrated that incorporation of diethylene glycol (miniPEG) at the γ position of the peptide backbone increased the thermal stability of the hybrid duplexes (Sahu, B. et al. J. Org. Chem. 2011, 76, 5614-5627). Here, we applied atomic force microscopy (AFM) based single molecule force spectroscopy and dynamic force spectroscopy (DFS) to test the strength and stability of the hybrid 10 bp duplex. This hybrid duplex consisted of miniPEGγ-PNA and DNA of the same length (γ(MP)PNA-DNA), which we compared to a DNA duplex with a homologous sequence. AFM force spectroscopy data obtained at the same conditions showed that the γ(MP)PNA-DNA hybrid is more stable than the DNA counterpart, 65 ± 15 pN vs 47 ± 15 pN, respectively. The DFS measurements performed in a range of pulling speeds analyzed in the framework of the Bell-Evans approach yielded a dissociation constant, koff ≈ 0.030 ± 0.01 s⁻¹ for γ(MP)PNA-DNA hybrid duplex vs 0.375 ± 0.18 s⁻¹ for the DNA-DNA duplex suggesting that the hybrid duplex is much more stable. Correlating the high affinity of γ(MP)PNA-DNA to slow dissociation kinetics is consistent with prior bulk characterization by surface plasmon resonance. Given the growing interest in γ(MP)PNA as well as other synthetic DNA analogues, the use of single molecule experiments along with computational analysis of force spectroscopy data will provide direct characterization of various modifications as well as higher order structures such as triplexes and quadruplexes.

Escherichia coli and Neisseria gonorrhoeae UvrD helicase unwinds G4 DNA structures.

Science.gov (United States)

Shukla, Kaustubh; Thakur, Roshan Singh; Ganguli, Debayan; Rao, Desirazu Narasimha; Nagaraju, Ganesh

2017-10-18

G-quadruplex (G4) secondary structures have been implicated in various biological processes, including gene expression, DNA replication and telomere maintenance. However, unresolved G4 structures impede replication progression which can lead to the generation of DNA double-strand breaks and genome instability. Helicases have been shown to resolve G4 structures to facilitate faithful duplication of the genome. Escherichia coli UvrD (EcUvrD) helicase plays a crucial role in nucleotide excision repair, mismatch repair and in the regulation of homologous recombination. Here, we demonstrate a novel role of E. coli and Neisseria gonorrhoeae UvrD in resolving G4 tetraplexes. EcUvrD and N gonorrhoeae UvrD were proficient in unwinding previously characterized tetramolecular G4 structures. Notably, EcUvrD was equally efficient in resolving tetramolecular and bimolecular G4 DNA that were derived from the potential G4-forming sequences from the genome of E. coli Interestingly, in addition to resolving intermolecular G4 structures, EcUvrD was robust in unwinding intramolecular G4 structures. These data for the first time provide evidence for the role of UvrD in the resolution of G4 structures, which has implications for the in vivo role of UvrD helicase in G4 DNA resolution and genome maintenance. © 2017 The Author(s). Published by Portland Press Limited on behalf of the Biochemical Society.

Supersingular quantum perturbations

International Nuclear Information System (INIS)

Detwiler, L.C.; Klauder, J.R.

1975-01-01

A perturbation potential is called supersingular whenever generally every matrix element of the perturbation in the unperturbed eigenstates is infinite. It follows that supersingular perturbations do not have conventional perturbation expansions, say for energy eigenvalues. By invoking variational arguments, we determine the asymptotic behavior of the energy eigenvalues for asymptotically small values of the coupling constant of the supersingular perturbation

Local stability perturbation in DNA structure induced by chain discontinuities

International Nuclear Information System (INIS)

Jorcano, J.L.; Mingot, F.; Davila, C.A.

1976-01-01

The thermal dependence of parameter ''h'' (number of base pairs broken near to internucleotide breaks) is studied. At 25degC, 0,2 M Na + and pH 7, the ''h'' value is about 12. Far from DNA melting temperature, ''h'' is not dependent upon ionic strength and it depends very little on temperature. This behavior suggests a non cooperative, entropically driven chain unzipping from terminals. Near melting temperature, ''h'' shows a thermal dependence asymptotic to Tm, and correlated with DNA composition. It seems to correspond to the cooperative denaturation. ''h'' values have been calculated from double and single break probabilities evaluated from hydrodynamically determined molecular weight distributions. (author)

Detection of G-Quadruplex Structures Formed by G-Rich Sequences from Rice Genome and Transcriptome Using Combined Probes.

Science.gov (United States)

Chang, Tianjun; Li, Weiguo; Ding, Zhan; Cheng, Shaofei; Liang, Kun; Liu, Xiangjun; Bing, Tao; Shangguan, Dihua

2017-08-01

Putative G-quadruplex (G4) forming sequences (PQS) are highly prevalent in the genome and transcriptome of various organisms and are considered as potential regulation elements in many biological processes by forming G4 structures. The formation of G4 structures highly depends on the sequences and the environment. In most cases, it is difficult to predict G4 formation by PQS, especially PQS containing G2 tracts. Therefore, the experimental identification of G4 formation is essential in the study of G4-related biological functions. Herein, we report a rapid and simple method for the detection of G4 structures by using a pair of complementary reporters, hemin and BMSP. This method was applied to detect G4 structures formed by PQS (DNA and RNA) searched in the genome and transcriptome of Oryza sativa. Unlike most of the reported G4 probes that only recognize part of G4 structures, the proposed method based on combined probes positively responded to almost all G4 conformations, including parallel, antiparallel, and mixed/hybrid G4, but did not respond to non-G4 sequences. This method shows potential for high-throughput identification of G4 structures in genome and transcriptome. Furthermore, BMSP was observed to drive some PQS to form more stable G4 structures or induce the G4 formation of some PQS that cannot form G4 in normal physiological conditions, which may provide a powerful molecular tool for gene regulation.

A novel microfluidic mixer based on dual-hydrodynamic focusing for interrogating the kinetics of DNA-protein interaction.

Science.gov (United States)

Li, Ying; Xu, Fei; Liu, Chao; Xu, Youzhi; Feng, Xiaojun; Liu, Bi-Feng

2013-08-21

Kinetic measurement of biomacromolecular interaction plays a significant role in revealing the underlying mechanisms of cellular activities. Due to the small diffusion coefficient of biomacromolecules, it is difficult to resolve the rapid kinetic process with traditional analytical methods such as stopped-flow or laminar mixers. Here, we demonstrated a unique continuous-flow laminar mixer based on microfluidic dual-hydrodynamic focusing to characterize the kinetics of DNA-protein interactions. The time window of this mixer for kinetics observation could cover from sub-milliseconds to seconds, which made it possible to capture the folding process with a wide dynamic range. Moreover, the sample consumption was remarkably reduced to <0.55 μL min⁻¹, over 1000-fold saving in comparison to those reported previously. We further interrogated the interaction kinetics of G-quadruplex and the single-stranded DNA binding protein, indicating that this novel micromixer would be a useful approach for analyzing the interaction kinetics of biomacromolecules.

A pre-protective strategy for precise tumor targeting and efficient photodynamic therapy with a switchable DNA/upconversion nanocomposite.

Science.gov (United States)

Yu, Zhengze; Ge, Yegang; Sun, Qiaoqiao; Pan, Wei; Wan, Xiuyan; Li, Na; Tang, Bo

2018-04-14

Tumor-specific targeting based on folic acid (FA) is one of the most common and significant approaches in cancer therapy. However, the expression of folate receptors (FRs) in normal tissues will lead to unexpected targeting and unsatisfactory therapeutic effect. To address this issue, we develop a pre-protective strategy for precise tumor targeting and efficient photodynamic therapy (PDT) using a switchable DNA/upconversion nanocomposite, which can be triggered in the acidic tumor microenvironment. The DNA/upconversion nanocomposite is composed of polyacrylic acid (PAA) coated upconversion nanoparticles (UCNPs), the surface of which is modified using FA and chlorin e6 (Ce6) functionalized DNA sequences with different lengths. Initially, FA on the shorter DNA was protected by a longer DNA to prevent the bonding to FRs on normal cells. Once reaching the acidic tumor microenvironment, C base-rich longer DNA forms a C-quadruplex, resulting in the exposure of the FA groups and the bonding of FA and FRs on cancer cell membranes to achieve precise targeting. Simultaneously, the photosensitizer chlorin e6 (Ce6) gets close to the surface of UCNPs, enabling the excitation of Ce6 to generate singlet oxygen ( 1 O 2 ) under near infrared light via Förster resonance energy transfer (FRET). In vivo experiments indicated that higher tumor targeting efficiency was achieved and the tumor growth was greatly inhibited through the pre-protective strategy.

DNA based identification of medicinal materials in Chinese patent medicines

Science.gov (United States)

Chen, Rong; Dong, Juan; Cui, Xin; Wang, Wei; Yasmeen, Afshan; Deng, Yun; Zeng, Xiaomao; Tang, Zhuo

2012-12-01

Chinese patent medicines (CPM) are highly processed and easy to use Traditional Chinese Medicine (TCM). The market for CPM in China alone is tens of billions US dollars annually and some of the CPM are also used as dietary supplements for health augmentation in the western countries. But concerns continue to be raised about the legality, safety and efficacy of many popular CPM. Here we report a pioneer work of applying molecular biotechnology to the identification of CPM, particularly well refined oral liquids and injections. What's more, this PCR based method can also be developed to an easy to use and cost-effective visual chip by taking advantage of G-quadruplex based Hybridization Chain Reaction. This study demonstrates that DNA identification of specific Medicinal materials is an efficient and cost-effective way to audit highly processed CPM and will assist in monitoring their quality and legality.

Non-perturbative versus perturbative renormalization of lattice operators

International Nuclear Information System (INIS)

Goeckeler, M.; Technische Hochschule Aachen; Horsley, R.; Ilgenfritz, E.M.; Oelrich, H.; Forschungszentrum Juelich GmbH; Schierholz, G.; Forschungszentrum Juelich GmbH; Perlt, H.; Schiller, A.; Rakow, P.

1995-09-01

Our objective is to compute the moments of the deep-inelastic structure functions of the nucleon on the lattice. A major source of uncertainty is the renormalization of the lattice operators that enter the calculation. In this talk we compare the renormalization constants of the most relevant twist-two bilinear quark operators which we have computed non-perturbatively and perturbatively to one loop order. Furthermore, we discuss the use of tadpole improved perturbation theory. (orig.)

A sensitive electrochemical aptasensor based on the co-catalysis of hemin/G-quadruplex, platinum nanoparticles and flower-like MnO2 nanosphere functionalized multi-walled carbon nanotubes.

Science.gov (United States)

Xu, Wenju; Xue, Shuyan; Yi, Huayu; Jing, Pei; Chai, Yaqin; Yuan, Ruo

2015-01-28

In this work, a sensitive electrochemical aptasensor for the detection of thrombin (TB) is developed and demonstrated based on the co-catalysis of hemin/G-quadruplex, platinum nanoparticles (PtNPs) and flower-like MnO2 nanosphere functionalized multi-walled carbon nanotubes (MWCNT-MnO2).

Investigation of a Quadruplex-Forming Repeat Sequence Highly Enriched in Xanthomonas and Nostoc sp.

Directory of Open Access Journals (Sweden)

Charlotte Rehm

Full Text Available In prokaryotes simple sequence repeats (SSRs with unit sizes of 1-5 nucleotides (nt are causative for phase and antigenic variation. Although an increased abundance of heptameric repeats was noticed in bacteria, reports about SSRs of 6-9 nt are rare. In particular G-rich repeat sequences with the propensity to fold into G-quadruplex (G4 structures have received little attention. In silico analysis of prokaryotic genomes show putative G4 forming sequences to be abundant. This report focuses on a surprisingly enriched G-rich repeat of the type GGGNATC in Xanthomonas and cyanobacteria such as Nostoc. We studied in detail the genomes of Xanthomonas campestris pv. campestris ATCC 33913 (Xcc, Xanthomonas axonopodis pv. citri str. 306 (Xac, and Nostoc sp. strain PCC7120 (Ana. In all three organisms repeats are spread all over the genome with an over-representation in non-coding regions. Extensive variation of the number of repetitive units was observed with repeat numbers ranging from two up to 26 units. However a clear preference for four units was detected. The strong bias for four units coincides with the requirement of four consecutive G-tracts for G4 formation. Evidence for G4 formation of the consensus repeat sequences was found in biophysical studies utilizing CD spectroscopy. The G-rich repeats are preferably located between aligned open reading frames (ORFs and are under-represented in coding regions or between divergent ORFs. The G-rich repeats are preferentially located within a distance of 50 bp upstream of an ORF on the anti-sense strand or within 50 bp from the stop codon on the sense strand. Analysis of whole transcriptome sequence data showed that the majority of repeat sequences are transcribed. The genetic loci in the vicinity of repeat regions show increased genomic stability. In conclusion, we introduce and characterize a special class of highly abundant and wide-spread quadruplex-forming repeat sequences in bacteria.

Investigation of a Quadruplex-Forming Repeat Sequence Highly Enriched in Xanthomonas and Nostoc sp.

Science.gov (United States)

Rehm, Charlotte; Wurmthaler, Lena A; Li, Yuanhao; Frickey, Tancred; Hartig, Jörg S

2015-01-01

In prokaryotes simple sequence repeats (SSRs) with unit sizes of 1-5 nucleotides (nt) are causative for phase and antigenic variation. Although an increased abundance of heptameric repeats was noticed in bacteria, reports about SSRs of 6-9 nt are rare. In particular G-rich repeat sequences with the propensity to fold into G-quadruplex (G4) structures have received little attention. In silico analysis of prokaryotic genomes show putative G4 forming sequences to be abundant. This report focuses on a surprisingly enriched G-rich repeat of the type GGGNATC in Xanthomonas and cyanobacteria such as Nostoc. We studied in detail the genomes of Xanthomonas campestris pv. campestris ATCC 33913 (Xcc), Xanthomonas axonopodis pv. citri str. 306 (Xac), and Nostoc sp. strain PCC7120 (Ana). In all three organisms repeats are spread all over the genome with an over-representation in non-coding regions. Extensive variation of the number of repetitive units was observed with repeat numbers ranging from two up to 26 units. However a clear preference for four units was detected. The strong bias for four units coincides with the requirement of four consecutive G-tracts for G4 formation. Evidence for G4 formation of the consensus repeat sequences was found in biophysical studies utilizing CD spectroscopy. The G-rich repeats are preferably located between aligned open reading frames (ORFs) and are under-represented in coding regions or between divergent ORFs. The G-rich repeats are preferentially located within a distance of 50 bp upstream of an ORF on the anti-sense strand or within 50 bp from the stop codon on the sense strand. Analysis of whole transcriptome sequence data showed that the majority of repeat sequences are transcribed. The genetic loci in the vicinity of repeat regions show increased genomic stability. In conclusion, we introduce and characterize a special class of highly abundant and wide-spread quadruplex-forming repeat sequences in bacteria.

Toehold-mediated strand displacement reaction-dependent fluorescent strategy for sensitive detection of uracil-DNA glycosylase activity.

Science.gov (United States)

Wu, Yushu; Wang, Lei; Jiang, Wei

2017-03-15

Sensitive detection of uracil-DNA glycosylase (UDG) activity is beneficial for evaluating the repairing process of DNA lesions. Here, toehold-mediated strand displacement reaction (TSDR)-dependent fluorescent strategy was constructed for sensitive detection of UDG activity. A single-stranded DNA (ssDNA) probe with two uracil bases and a trigger sequence were designed. A hairpin probe with toehold domain was designed, and a reporter probe was also designed. Under the action of UDG, two uracil bases were removed from ssDNA probe, generating apurinic/apyrimidinic (AP) sites. Then, the AP sites could inhibit the TSDR between ssDNA probe and hairpin probe, leaving the trigger sequence in ssDNA probe still free. Subsequently, the trigger sequence was annealed with the reporter probe, initiating the polymerization and nicking amplification reaction. As a result, numerous G-quadruplex (G4) structures were formed, which could bind with N-methyl-mesoporphyrin IX (NMM) to generate enhanced fluorescent signal. In the absence of UDG, the ssDNA probe could hybridize with the toehold domain of the hairpin probe to initiate TSDR, blocking the trigger sequence, and then the subsequent amplification reaction would not occur. The proposed strategy was successfully implemented for detecting UDG activity with a detection limit of 2.7×10 -5 U/mL. Moreover, the strategy could distinguish UDG well from other interference enzymes. Furthermore, the strategy was also applied for detecting UDG activity in HeLa cells lysate with low effect of cellular components. These results indicated that the proposed strategy offered a promising tool for sensitive quantification of UDG activity in UDG-related function study and disease prognosis. Copyright © 2016 Elsevier B.V. All rights reserved.

Genome-wide identification and characterisation of human DNA replication origins by initiation site sequencing (ini-seq).

Science.gov (United States)

Langley, Alexander R; Gräf, Stefan; Smith, James C; Krude, Torsten

2016-12-01

Next-generation sequencing has enabled the genome-wide identification of human DNA replication origins. However, different approaches to mapping replication origins, namely (i) sequencing isolated small nascent DNA strands (SNS-seq); (ii) sequencing replication bubbles (bubble-seq) and (iii) sequencing Okazaki fragments (OK-seq), show only limited concordance. To address this controversy, we describe here an independent high-resolution origin mapping technique that we call initiation site sequencing (ini-seq). In this approach, newly replicated DNA is directly labelled with digoxigenin-dUTP near the sites of its initiation in a cell-free system. The labelled DNA is then immunoprecipitated and genomic locations are determined by DNA sequencing. Using this technique we identify >25,000 discrete origin sites at sub-kilobase resolution on the human genome, with high concordance between biological replicates. Most activated origins identified by ini-seq are found at transcriptional start sites and contain G-quadruplex (G4) motifs. They tend to cluster in early-replicating domains, providing a correlation between early replication timing and local density of activated origins. Origins identified by ini-seq show highest concordance with sites identified by SNS-seq, followed by OK-seq and bubble-seq. Furthermore, germline origins identified by positive nucleotide distribution skew jumps overlap with origins identified by ini-seq and OK-seq more frequently and more specifically than do sites identified by either SNS-seq or bubble-seq. © The Author(s) 2016. Published by Oxford University Press on behalf of Nucleic Acids Research.

Molecular Mechanisms of DNA Replication Checkpoint Activation

Directory of Open Access Journals (Sweden)

Bénédicte Recolin

2014-03-01

Full Text Available The major challenge of the cell cycle is to deliver an intact, and fully duplicated, genetic material to the daughter cells. To this end, progression of DNA synthesis is monitored by a feedback mechanism known as replication checkpoint that is untimely linked to DNA replication. This signaling pathway ensures coordination of DNA synthesis with cell cycle progression. Failure to activate this checkpoint in response to perturbation of DNA synthesis (replication stress results in forced cell division leading to chromosome fragmentation, aneuploidy, and genomic instability. In this review, we will describe current knowledge of the molecular determinants of the DNA replication checkpoint in eukaryotic cells and discuss a model of activation of this signaling pathway crucial for maintenance of genomic stability.

Mycobacterium tuberculosis DinG is a structure-specific helicase that unwinds G4 DNA: implications for targeting G4 DNA as a novel therapeutic approach.

Science.gov (United States)

Thakur, Roshan Singh; Desingu, Ambika; Basavaraju, Shivakumar; Subramanya, Shreelakshmi; Rao, Desirazu N; Nagaraju, Ganesh

2014-09-05

The significance of G-quadruplexes and the helicases that resolve G4 structures in prokaryotes is poorly understood. The Mycobacterium tuberculosis genome is GC-rich and contains >10,000 sequences that have the potential to form G4 structures. In Escherichia coli, RecQ helicase unwinds G4 structures. However, RecQ is absent in M. tuberculosis, and the helicase that participates in G4 resolution in M. tuberculosis is obscure. Here, we show that M. tuberculosis DinG (MtDinG) exhibits high affinity for ssDNA and ssDNA translocation with a 5' → 3' polarity. Interestingly, MtDinG unwinds overhangs, flap structures, and forked duplexes but fails to unwind linear duplex DNA. Our data with DNase I footprinting provide mechanistic insights and suggest that MtDinG is a 5' → 3' polarity helicase. Notably, in contrast to E. coli DinG, MtDinG catalyzes unwinding of replication fork and Holliday junction structures. Strikingly, we find that MtDinG resolves intermolecular G4 structures. These data suggest that MtDinG is a multifunctional structure-specific helicase that unwinds model structures of DNA replication, repair, and recombination as well as G4 structures. We finally demonstrate that promoter sequences of M. tuberculosis PE_PGRS2, mce1R, and moeB1 genes contain G4 structures, implying that G4 structures may regulate gene expression in M. tuberculosis. We discuss these data and implicate targeting G4 structures and DinG helicase in M. tuberculosis could be a novel therapeutic strategy for culminating the infection with this pathogen. © 2014 by The American Society for Biochemistry and Molecular Biology, Inc.

Inhibition of RecBCD enzyme by antineoplastic DNA alkylating agents.

Science.gov (United States)

Dziegielewska, Barbara; Beerman, Terry A; Bianco, Piero R

2006-09-01

To understand how bulky adducts might perturb DNA helicase function, three distinct DNA-binding agents were used to determine the effects of DNA alkylation on a DNA helicase. Adozelesin, ecteinascidin 743 (Et743) and hedamycin each possess unique structures and sequence selectivity. They bind to double-stranded DNA and alkylate one strand of the duplex in cis, adding adducts that alter the structure of DNA significantly. The results show that Et743 was the most potent inhibitor of DNA unwinding, followed by adozelesin and hedamycin. Et743 significantly inhibited unwinding, enhanced degradation of DNA, and completely eliminated the ability of the translocating RecBCD enzyme to recognize and respond to the recombination hotspot chi. Unwinding of adozelesin-modified DNA was accompanied by the appearance of unwinding intermediates, consistent with enzyme entrapment or stalling. Further, adozelesin also induced "apparent" chi fragment formation. The combination of enzyme sequestering and pseudo-chi modification of RecBCD, results in biphasic time-courses of DNA unwinding. Hedamycin also reduced RecBCD activity, albeit at increased concentrations of drug relative to either adozelesin or Et743. Remarkably, the hedamycin modification resulted in constitutive activation of the bottom-strand nuclease activity of the enzyme, while leaving the ability of the translocating enzyme to recognize and respond to chi largely intact. Finally, the results show that DNA alkylation does not significantly perturb the allosteric interaction that activates the enzyme for ATP hydrolysis, as the efficiency of ATP utilization for DNA unwinding is affected only marginally. These results taken together present a unique response of RecBCD enzyme to bulky DNA adducts. We correlate these effects with the recently determined crystal structure of the RecBCD holoenzyme bound to DNA.

Acute inactivation of the replicative helicase in human cells triggers MCM8-9-dependent DNA synthesis

DEFF Research Database (Denmark)

Natsume, Toyoaki; Nishimura, Kohei; Minocherhomji, Sheroy

2017-01-01

stemming from replisome dissociation during DNA replication perturbation, we used a degron-based system for inducible proteolysis of a subunit of the replicative helicase. We show that MCM2-depleted cells activate a DNA damage response pathway and generate replication-associated DNA double-strand breaks...

Perturbed effects at radiation physics

International Nuclear Information System (INIS)

Külahcı, Fatih; Şen, Zekâi

2013-01-01

Perturbation methodology is applied in order to assess the linear attenuation coefficient, mass attenuation coefficient and cross-section behavior with random components in the basic variables such as the radiation amounts frequently used in the radiation physics and chemistry. Additionally, layer attenuation coefficient (LAC) and perturbed LAC (PLAC) are proposed for different contact materials. Perturbation methodology provides opportunity to obtain results with random deviations from the average behavior of each variable that enters the whole mathematical expression. The basic photon intensity variation expression as the inverse exponential power law (as Beer–Lambert's law) is adopted for perturbation method exposition. Perturbed results are presented not only in terms of the mean but additionally the standard deviation and the correlation coefficients. Such perturbation expressions provide one to assess small random variability in basic variables. - Highlights: • Perturbation methodology is applied to Radiation Physics. • Layer attenuation coefficient (LAC) and perturbed LAC are proposed for contact materials. • Perturbed linear attenuation coefficient is proposed. • Perturbed mass attenuation coefficient (PMAC) is proposed. • Perturbed cross-section is proposed

Structural Insight into the interaction of Flavonoids with Human Telomeric Sequence

Science.gov (United States)

Tawani, Arpita; Kumar, Amit

2015-01-01

Flavonoids are a group of naturally available compounds that are an attractive source for drug discovery. Their potential to act as anti-tumourigenic and anti-proliferative agents has been reported previously but is not yet fully understood. Targeting human telomeric G-quadruplex DNA could be one of the mechanisms by which these flavonoids exert anticancer activity. We have performed detailed biophysical studies for the interaction of four representative flavonoids, Luteolin, Quercetin, Rutin and Genistein, with the human telomeric G-quadruplex sequence tetramolecular d-(T2AG3T) (Tel7). In addition, we used NMR spectroscopy to derive the first model for the complex formed between Quercetin and G-quadruplex sequence. The model showed that Quercetin stabilises the G-quadruplex structure and does not open the G-tetrad. It interacts with the telomeric sequence through π-stacking at two sites: between T1pT2 and between G6pT7. Based on our findings, we suggest that Quercetin could be a potent candidate for targeting the telomere and thus, act as a potent anti-cancer agent. PMID:26627543

Shedding lights on the flexible-armed porphyrins: Human telomeric G4 DNA interaction and cell photocytotoxicity research.

Science.gov (United States)

Sun, Xiang-Yu; Zhao, Ping; Jin, Shu-Fang; Liu, Min-Chao; Wang, Xia-Hong; Huang, Yu-Min; Cheng, Zhen-Feng; Yan, Si-Qi; Li, Yan-Yu; Chen, Ya-Qing; Zhong, Yan-Mei

2017-08-01

DNA polymorphism exerts a fascination on a large scientific community. Without crystallographic structural data, clarification of the binding modes between G-quadruplex (G4) and ligand (complex) is a challenging job. In the present work, three porphyrin compounds with different flexible carbon chains (arms) were designed, synthesized and characterized. Their binding, folding and stabilizing abilities to human telomeric G4 DNA structures were comparatively researched. Positive charges at the end of the flexible carbon chains seem to be favorable for the DNA-porphyrin interactions, which were evidenced by the spectral results and further confirmed by the molecular docking calculations. Biological function analysis demonstrated that these porphyrins show no substantial inhibition to Hela, A549 and BEL 7402 cancer cell lines under dark while exhibit broad inhibition under visible light. This significantly enhanced photocytotoxicity relative to the dark control is an essential property of photochemotherapeutic agents. The feature of the flexible arms emerges as critical influencing factors in the cell photocytotoxicity. Moreover, an ROS-mediated mitochondrial dysfunction pathway was suggested for the cell apoptosis induced by these flexible-armed porphyrins. It is found that the porphyrins with positive charges located at the end of the flexible arms represent an exciting opportunity for photochemotherapeutic anti-cancer drug design. Copyright © 2017. Published by Elsevier B.V.

Target recycling amplification for label-free and sensitive colorimetric detection of adenosine triphosphate based on un-modified aptamers and DNAzymes.

Science.gov (United States)

Gong, Xue; Li, Jinfu; Zhou, Wenjiao; Xiang, Yun; Yuan, Ruo; Chai, Yaqin

2014-05-30

Based on target recycling amplification, the development of a new label-free, simple and sensitive colorimetric detection method for ATP by using un-modified aptamers and DNAzymes is described. The association of the model target molecules (ATP) with the corresponding aptamers of the dsDNA probes leads to the release of the G-quadruplex sequences. The ATP-bound aptamers can be further degraded by Exonuclease III to release ATP, which can again bind the aptamers of the dsDNA probes to initiate the target recycling amplification process. Due to this target recycling amplification, the amount of the released G-quadruplex sequences is significantly enhanced. Subsequently, these G-quadruplex sequences bind hemin to form numerous peroxidase mimicking DNAzymes, which cause substantially intensified color change of the probe solution for highly sensitive colorimetric detection of ATP down to the sub-nanomolar (0.33nM) level. Our method is highly selective toward ATP against other control molecules and can be performed in one single homogeneous solution, which makes our sensing approach hold great potential for sensitive colorimetric detection of other small molecules and proteins. Copyright © 2014 Elsevier B.V. All rights reserved.

Perturbative anyon gas

International Nuclear Information System (INIS)

Dasnieres de Veigy, A.; Ouvry, S.; Paris-6 Univ., 75

1992-06-01

The problem of the statistical mechanics of an anyon gas is addressed. A perturbative analysis in the anyonic coupling constant α is reviewed, and the thermodynamical potential is computed at first and second order. An adequate second quantized formalism (field theory at finite temperature) is proposed. At first order in perturbation theory, the results are strikingly simple: only the second virial coefficient close to bosonic statistics is corrected. At second order, however, the complexity of the anyon model appears. One can compute exactly the perturbative correction to each cluster coefficient. However, and contrary to first order, a closed expression for the equation of state seems out of reach. As an illustration, the perturbative expressions of a 3 , a 4 , a 5 and a 6 are given at second order. Finally, using the same formalism, the equation of state of an anyon gas in a constant magnetic field is analyzed at first order in perturbation theory. (K.A.) 16 refs.; 3 figs.; 7 tabs

Perturbation theory

International Nuclear Information System (INIS)

Bartlett, R.; Kirtman, B.; Davidson, E.R.

1978-01-01

After noting some advantages of using perturbation theory some of the various types are related on a chart and described, including many-body nonlinear summations, quartic force-field fit for geometry, fourth-order correlation approximations, and a survey of some recent work. Alternative initial approximations in perturbation theory are also discussed. 25 references

TERRA mimicking ssRNAs prevail over the DNA substrate for telomerase in vitro due to interactions with the alternative binding site.

Science.gov (United States)

Azhibek, Dulat; Skvortsov, Dmitry; Andreeva, Anna; Zatsepin, Timofei; Arutyunyan, Alexandr; Zvereva, Maria; Dontsova, Olga

2016-06-01

Telomerase is a key component of the telomere length maintenance system in the majority of eukaryotes. Telomerase displays maximal activity in stem and cancer cells with high proliferative potential. In humans, telomerase activity is regulated by various mechanisms, including the interaction with telomere ssDNA overhangs that contain a repetitive G-rich sequence, and with noncoding RNA, Telomeric repeat-containing RNA (TERRA), that contains the same sequence. So these nucleic acids can compete for telomerase RNA templates in the cell. In this study, we have investigated the ability of different model substrates mimicking telomere DNA overhangs and TERRA RNA to compete for telomerase in vitro through a previously developed telomerase inhibitor assay. We have shown in this study that RNA oligonucleotides are better competitors for telomerase that DNA ones as RNA also use an alternative binding site on telomerase, and the presence of 2'-OH groups is significant in these interactions. In contrast to DNA, the possibility of forming intramolecular G-quadruplex structures has a minor effect for RNA binding to telomerase. Taking together our data, we propose that TERRA RNA binds better to telomerase compared with its native substrate - the 3'-end of telomere DNA overhang. As a result, some specific factor may exist that participates in switching telomerase from TERRA to the 3'-end of DNA for telomere elongation at the distinct period of a cell cycle in vivo. Copyright © 2015 John Wiley & Sons, Ltd. Copyright © 2015 John Wiley & Sons, Ltd.

C9orf72 nucleotide repeat structures initiate molecular cascades of disease.

Science.gov (United States)

Haeusler, Aaron R; Donnelly, Christopher J; Periz, Goran; Simko, Eric A J; Shaw, Patrick G; Kim, Min-Sik; Maragakis, Nicholas J; Troncoso, Juan C; Pandey, Akhilesh; Sattler, Rita; Rothstein, Jeffrey D; Wang, Jiou

2014-03-13

A hexanucleotide repeat expansion (HRE), (GGGGCC)n, in C9orf72 is the most common genetic cause of the neurodegenerative diseases amyotrophic lateral sclerosis (ALS) and frontotemporal dementia (FTD). Here we identify a molecular mechanism by which structural polymorphism of the HRE leads to ALS/FTD pathology and defects. The HRE forms DNA and RNA G-quadruplexes with distinct structures and promotes RNA•DNA hybrids (R-loops). The structural polymorphism causes a repeat-length-dependent accumulation of transcripts aborted in the HRE region. These transcribed repeats bind to ribonucleoproteins in a conformation-dependent manner. Specifically, nucleolin, an essential nucleolar protein, preferentially binds the HRE G-quadruplex, and patient cells show evidence of nucleolar stress. Our results demonstrate that distinct C9orf72 HRE structural polymorphism at both DNA and RNA levels initiates molecular cascades leading to ALS/FTD pathologies, and provide the basis for a mechanistic model for repeat-associated neurodegenerative diseases.

Perturbations in DNA structure upon interaction with porphyrins revealed by chemical probes, DNA footprinting and molecular modelling.

Science.gov (United States)

Ford, K G; Neidle, S

1995-06-01

The interactions of several porphyrins with a 74 base-pair DNA sequence have been examined by footprinting and chemical protection methods. Tetra-(4-N-methyl-(pyridyl)) porphyrin (TMPy), two of its metal complexes and tetra-(4-trimethylanilinium) porphyrin (TMAP) bind to closely similar AT-rich sequences. The three TMPy ligands produce modest changes in DNA structure and base accessibility on binding, in contrast to the large-scale conformational changes observed with TMAP. Molecular modelling studies have been performed on TMPy and TMAP bound in the AT-rich minor groove of an oligonucleotide. These have shown that significant structural change is needed to accommodate the bulky trimethyl substituent groups of TMAP, in contrast to the facile minor groove fit of TMPy.

Developments in perturbation theory

International Nuclear Information System (INIS)

Greenspan, E.

1976-01-01

Included are sections dealing with perturbation expressions for reactivity, methods for the calculation of perturbed fluxes, integral transport theory formulations for reactivity, generalized perturbation theory, sensitivity and optimization studies, multigroup calculations of bilinear functionals, and solution of inhomogeneous Boltzmann equations with singular operators

PerturbationAnalyzer: a tool for investigating the effects of concentration perturbation on protein interaction networks.

Science.gov (United States)

Li, Fei; Li, Peng; Xu, Wenjian; Peng, Yuxing; Bo, Xiaochen; Wang, Shengqi

2010-01-15

The propagation of perturbations in protein concentration through a protein interaction network (PIN) can shed light on network dynamics and function. In order to facilitate this type of study, PerturbationAnalyzer, which is an open source plugin for Cytoscape, has been developed. PerturbationAnalyzer can be used in manual mode for simulating user-defined perturbations, as well as in batch mode for evaluating network robustness and identifying significant proteins that cause large propagation effects in the PINs when their concentrations are perturbed. Results from PerturbationAnalyzer can be represented in an intuitive and customizable way and can also be exported for further exploration. PerturbationAnalyzer has great potential in mining the design principles of protein networks, and may be a useful tool for identifying drug targets. PerturbationAnalyzer can be accessed from the Cytoscape web site http://www.cytoscape.org/plugins/index.php or http://biotech.bmi.ac.cn/PerturbationAnalyzer. Supplementary data are available at Bioinformatics online.

Difference scheme for a singularly perturbed parabolic convection-diffusion equation in the presence of perturbations

Science.gov (United States)

Shishkin, G. I.

2015-11-01

An initial-boundary value problem is considered for a singularly perturbed parabolic convection-diffusion equation with a perturbation parameter ɛ (ɛ ∈ (0, 1]) multiplying the highest order derivative. The stability of a standard difference scheme based on monotone approximations of the problem on a uniform mesh is analyzed, and the behavior of discrete solutions in the presence of perturbations is examined. The scheme does not converge ɛ-uniformly in the maximum norm as the number of its grid nodes is increased. When the solution of the difference scheme converges, which occurs if N -1 ≪ ɛ and N -1 0 ≪ 1, where N and N 0 are the numbers of grid intervals in x and t, respectively, the scheme is not ɛ-uniformly well conditioned or stable to data perturbations in the grid problem and to computer perturbations. For the standard difference scheme in the presence of data perturbations in the grid problem and/or computer perturbations, conditions on the "parameters" of the difference scheme and of the computer (namely, on ɛ, N, N 0, admissible data perturbations in the grid problem, and admissible computer perturbations) are obtained that ensure the convergence of the perturbed solutions. Additionally, the conditions are obtained under which the perturbed numerical solution has the same order of convergence as the solution of the unperturbed standard difference scheme.

Non-Perturbative Asymptotic Improvement of Perturbation Theory and Mellin-Barnes Representation

Directory of Open Access Journals (Sweden)

Samuel Friot

2010-10-01

Full Text Available Using a method mixing Mellin-Barnes representation and Borel resummation we show how to obtain hyperasymptotic expansions from the (divergent formal power series which follow from the perturbative evaluation of arbitrary ''N-point'' functions for the simple case of zero-dimensional φ4 field theory. This hyperasymptotic improvement appears from an iterative procedure, based on inverse factorial expansions, and gives birth to interwoven non-perturbative partial sums whose coefficients are related to the perturbative ones by an interesting resurgence phenomenon. It is a non-perturbative improvement in the sense that, for some optimal truncations of the partial sums, the remainder at a given hyperasymptotic level is exponentially suppressed compared to the remainder at the preceding hyperasymptotic level. The Mellin-Barnes representation allows our results to be automatically valid for a wide range of the phase of the complex coupling constant, including Stokes lines. A numerical analysis is performed to emphasize the improved accuracy that this method allows to reach compared to the usual perturbative approach, and the importance of hyperasymptotic optimal truncation schemes.

A Role for the Fifth G-Track in G-Quadruplex Forming Oncogene Promoter Sequences during Oxidative Stress: Do These "Spare Tires" Have an Evolved Function?

Science.gov (United States)

Fleming, Aaron M; Zhou, Jia; Wallace, Susan S; Burrows, Cynthia J

2015-08-26

Uncontrolled inflammation or oxidative stress generates electron-deficient species that oxidize the genome increasing its instability in cancer. The G-quadruplex (G4) sequences regulating the c-MYC , KRAS , VEGF , BCL-2 , HIF-1α , and RET oncogenes, as examples, are targets for oxidation at loop and 5'-core guanines (G) as showcased in this study by CO 3 •- oxidation of the VEGF G4. Products observed include 8-oxo-7,8-dihydroguanine (OG), spiroiminodihydantoin (Sp), and 5-guanidinohydantoin (Gh). Our previous studies found that OG and Gh, when present in the four G-tracks of the solved structure for VEGF and c-MY C, were not substrates for the base excision repair (BER) DNA glycosylases in biologically relevant KCl solutions. We now hypothesize that a fifth G-track found a few nucleotides distant from the G4 tracks involved in folding can act as a "spare tire," facilitating extrusion of a damaged G-run into a large loop that then becomes a substrate for BER. Thermodynamic, spectroscopic, and DMS footprinting studies verified the fifth domain replacing a damaged G-track with OG or Gh at a loop or core position in the VEGF G4. These new "spare tire"-containing strands with Gh in loops are now found to be substrates for initiation of BER with the NEIL1, NEIL2, and NEIL3 DNA glycosylases. The results support a hypothesis in which regulatory G4s carry a "spare-tire" fifth G-track for aiding in the repair process when these sequences are damaged by radical oxygen species, a feature observed in a large number of these sequences. Furthermore, formation and repair of oxidized bases in promoter regions may constitute an additional example of epigenetic modification, in this case of guanine bases, to regulate gene expression in which the G4 sequences act as sensors of oxidative stress.

Dynamic DNA binding, junction recognition and G4 melting activity underlie the telomeric and genome-wide roles of human CST.

Science.gov (United States)

Bhattacharjee, Anukana; Wang, Yongyao; Diao, Jiajie; Price, Carolyn M

2017-12-01

Human CST (CTC1-STN1-TEN1) is a ssDNA-binding complex that helps resolve replication problems both at telomeres and genome-wide. CST resembles Replication Protein A (RPA) in that the two complexes harbor comparable arrays of OB-folds and have structurally similar small subunits. However, the overall architecture and functions of CST and RPA are distinct. Currently, the mechanism underlying CST action at diverse replication issues remains unclear. To clarify CST mechanism, we examined the capacity of CST to bind and resolve DNA structures found at sites of CST activity. We show that CST binds preferentially to ss-dsDNA junctions, an activity that can explain the incremental nature of telomeric C-strand synthesis following telomerase action. We also show that CST unfolds G-quadruplex structures, thus providing a mechanism for CST to facilitate replication through telomeres and other GC-rich regions. Finally, smFRET analysis indicates that CST binding to ssDNA is dynamic with CST complexes undergoing concentration-dependent self-displacement. These findings support an RPA-based model where dissociation and re-association of individual OB-folds allow CST to mediate loading and unloading of partner proteins to facilitate various aspects of telomere replication and genome-wide resolution of replication stress. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.

Nonlinear microrheology and molecular imaging to map microscale deformations of entangled DNA networks

Science.gov (United States)

Wu, Tsai-Chin; Anderson, Rae

We use active microrheology coupled to single-molecule fluorescence imaging to elucidate the microscale dynamics of entangled DNA. DNA naturally exists in a wide range of lengths and topologies, and is often confined in cell nucleui, forming highly concentrated and entangled biopolymer networks. Thus, DNA is the model polymer for understanding entangled polymer dynamics as well as the crowded environment of cells. These networks display complex viscoelastic properties that are not well understood, especially at the molecular-level and in response to nonlinear perturbations. Specifically, how microscopic stresses and strains propagate through entangled networks, and what molecular deformations lead to the network stress responses are unknown. To answer these important questions, we optically drive a microsphere through entangled DNA, perturbing the system far from equilibrium, while measuring the resistive force the DNA exerts on the bead during and after bead motion. We simultaneously image single fluorescent-labeled DNA molecules throughout the network to directly link the microscale stress response to molecular deformations. We characterize the deformation of the network from the molecular-level to the mesoscale, and map the stress propagation throughout the network. We further study the impact of DNA length (11 - 115 kbp) and topology (linear vs ring DNA) on deformation and propagation dynamics, exploring key nonlinear features such as tube dilation and power-law relaxation.

Epigenetic reprogramming of pericentromeric satellite DNA in premalignant and malignant lesions

DEFF Research Database (Denmark)

Brückmann, Nadine Heidi; Pedersen, Christina Bøg; Ditzel, Henrik Jørn

2018-01-01

on pericentromeric satellites in primary melanocytes. This suggests that polycomb bodies form in cancer cells with global DNA demethylation to control the stability of pericentromeric satellite DNA. These results reveal a novel epigenetic perturbation specific to premalignant and malignant cells thatmaybe used...... as an early diagnostic marker for detection of precancerous changes and a new therapeutic entry point. Implications: Pericentromeric satellite DNA is epigenetically reprogrammed into polycomb bodies as a premalignant event with implications for transcriptional activity and genomic stability. Mol Cancer Res...

Label-free colorimetric detection of Hg²⁺ based on Hg²⁺-triggered exonuclease III-assisted target recycling and DNAzyme amplification.

Science.gov (United States)

Ren, Wang; Zhang, Ying; Huang, Wei Tao; Li, Nian Bing; Luo, Hong Qun

2015-06-15

This work reported a label-free colorimetric assay for sensitive detection of Hg(2+) based on Hg(2+)-triggered hairpin DNA probe (H-DNA) termini-binding and exonuclease Ш (Exo Ш)-assisted target recycling, as well as hemin/G-quadruplex (DNAzyme) signal amplification. The specific binding of free Hg(2+) with the thymine-thymine (T-T) mismatches termini of H-DNA could immediately trigger the Exo Ш digestion, and then set free G-quadruplex segments and Hg(2+). The Exo Ш impellent recycling of ultratrace Hg(2+) produced numerous G-quadruplexes. The corresponding DNAzymes catalyzed efficiently the H2O2-mediated oxidation of the ABTS(2-) to the colored product in the presence of hemin. Using the color change as the output signal, and the Exo Ш-aided Hg(2+) recycling and DNAzyme as the signal amplifier, the ultrasensitive assay system successfully achieved visual detection of Hg(2+) as low as 1.0 nM by the naked eye, and was suitable for field monitoring. The calibration curve was linear in the range of 50.0 pM to 20.0 nM for Hg(2+) (R=0.9962) with a detection limit of 10.0 pM. Moreover, this proposed strategy showed excellent selectivity, portability and low-cost, and was successfully applied to colorimetric detection of Hg(2+) in laboratory tap water and Jialing river water samples. Copyright © 2015 Elsevier B.V. All rights reserved.

Stationary axially symmetric perturbations of a rotating black hole. [Space-time perturbation, Newman-Penrose formalism

Energy Technology Data Exchange (ETDEWEB)

Demianski, M [California Inst. of Tech., Pasadena (USA)

1976-07-01

A stationary axially symmetric perturbation of a rotating black hole due to a distribution of test matter is investigated. The Newman-Penrose spin coefficient formalism is used to derive a general set of equations describing the perturbed space-time. In a linear approximation it is shown that the mass and angular momentum of a rotating black hole is not affected by the perturbation. The metric perturbations near the horizon are given. It is concluded that given a perturbing test fluid distribution, one can always find a corresponding metric perturbation such that the mass and angular momentum of the black hole are not changed. It was also noticed that when a tends to M, those perturbed spin coefficients and components of the Weyl tensor which determine the intrinsic properties of the incoming null cone near the horizon grow indefinitely.

Quadruplex gold immunochromatogaraphic assay for four families of antibiotic residues in milk.

Science.gov (United States)

Zhou, Jinyu; Nie, Wei; Chen, Yiqiang; Yang, Chunjiang; Gong, Lu; Zhang, Chi; Chen, Qian; He, Lidong; Feng, Xiaoyu

2018-08-01

In this study, we developed a quadruplex gold immunochromatogaraphic assay (GICA) for the simultaneous determination of four families of antibiotics including β-lactams, tetracyclines, streptomycin and chloramphenicol in milk. For qualitative analysis, the visual cut-off values were measured to be 2-100 ng/mL, 16-32 ng/mL, 50 ng/mL and 2.4 ng/mL for β-lactams, tetracyclines, streptomycin and chloramphenicol, respectively. For quantitative analysis, the detection ranges were 0.13-1 ng/mL for penicillin G, 0.13-8 ng/mL for tetracycline, 0.78-25 ng/mL for streptomycin, 0.019-1.2 ng/mL for chloramphenicol in milk respectively, with linear correlation coefficients higher than 0.97. The spiked experiment indicated that the mean recoveries ranged from 84.5% to 107.6% with coefficient of variations less than 16.2%, and real sample analysis revealed that the GICA can produce consistent results with instrumental analysis. These results demonstrated that this novel immunoassay is a promising approach for rapidly screening common antibiotic residues in milk. Copyright © 2018 Elsevier Ltd. All rights reserved.

Surface Plasmon Resonance kinetic analysis of the interaction between G-quadruplex nucleic acids and an anti-G-quadruplex monoclonal antibody.

Science.gov (United States)

Lago, Sara; Nadai, Matteo; Rossetto, Monica; Richter, Sara N

2018-06-01

G-quadruplexes (G4s) are nucleic acids secondary structures formed in guanine-rich sequences. Anti-G4 antibodies represent a tool for the direct investigation of G4s in cells. Surface Plasmon Resonance (SPR) is a highly sensitive technology, suitable for assessing the affinity between biomolecules. We here aimed at improving the orientation of an anti-G4 antibody on the SPR sensor chip to optimize detection of binding antigens. SPR was employed to characterize the anti-G4 antibody interaction with G4 and non-G4 oligonucleotides. Dextran-functionalized sensor chips were used both in covalent coupling and capturing procedures. The use of two leading molecule for orienting the antibody of interest allowed to improve its activity from completely non-functional to 65% active. The specificity of the anti-G4 antobody for G4 structures could thus be assessed with high sensitivity and reliability. Optimization of the immobilization protocol for SPR biosensing, allowed us to determine the anti-G4 antibody affinity and specificity for G4 antigens with higher sensitivity with respect to other in vitro assays such as ELISA. Anti-G4 antibody specificity is a fundamental assumption for the future utilization of this kind of antibodies for monitoring G4s directly in cells. The heterogeneous orientation of amine-coupling immobilized ligands is a general problem that often leads to partial or complete inactivation of the molecules. Here we describe a new strategy for improving ligand orientation: driving it from two sides. This principle can be virtually applied to every molecule that loses its activity or is poorly immobilized after standard coupling to the SPR chip surface. Copyright © 2018 The Authors. Published by Elsevier B.V. All rights reserved.

The Effect of INA [(R)-1-O-(1-Pyrenylmethyl)Glycerol] Insertions on the Structure and Biological Activity of a G-Quadruplex from a Critical Kras G-Rich Sequence

DEFF Research Database (Denmark)

Cogoi, Susanna; Paramasivan, Manikandan; Xodo, Luigi E.

2007-01-01

Quadruplex-forming oligonucleotides containing INA [(R)-1-O-(1-pyrenylmethyl)glycerol] insertions have been designed and studied for their capacity to inhibit the expression of the KRAS oncogene in pancreatic adenocarcinoma cells. It is found that INA can influence the folding topology of the G-q...

Orthogonal Operation of Constitutional Dynamic Networks Consisting of DNA-Tweezer Machines.

Science.gov (United States)

Yue, Liang; Wang, Shan; Cecconello, Alessandro; Lehn, Jean-Marie; Willner, Itamar

2017-12-26

Overexpression or down-regulation of cellular processes are often controlled by dynamic chemical networks. Bioinspired by nature, we introduce constitutional dynamic networks (CDNs) as systems that emulate the principle of the nature processes. The CDNs comprise dynamically interconvertible equilibrated constituents that respond to external triggers by adapting the composition of the dynamic mixture to the energetic stabilization of the constituents. We introduce a nucleic acid-based CDN that includes four interconvertible and mechanically triggered tweezers, AA', BB', AB' and BA', existing in closed, closed, open, and open configurations, respectively. By subjecting the CDN to auxiliary triggers, the guided stabilization of one of the network constituents dictates the dynamic reconfiguration of the structures of the tweezers constituents. The orthogonal and reversible operations of the CDN DNA tweezers are demonstrated, using T-A·T triplex or K + -stabilized G-quadruplex as structural motifs that control the stabilities of the constituents. The implications of the study rest on the possible applications of input-guided CDN assemblies for sensing, logic gate operations, and programmed activation of molecular machines.

Structure of a Stable G-Hairpin

Czech Academy of Sciences Publication Activity Database

Gajarský, M.; Zivkovic, M.L.; Stadlbauer, Petr; Pagano, B.; Fiala, R.; Amato, J.; Tomáška, L´.; Šponer, Jiří; Plavec, J.; Trantírek, L.

2017-01-01

Roč. 139, č. 10 (2017), s. 3591-3594 ISSN 0002-7863 R&D Projects: GA ČR GA13-28310S; GA ČR(CZ) GA16-13721S Institutional support: RVO:68081707 Keywords : g-quadruplex structures * human telomeric dna * single-stranded-dna * g-triplex Subject RIV: CE - Biochemistry OBOR OECD: Biochemistry and molecular biology Impact factor: 13.858, year: 2016

DNA adducts in senescent cells

International Nuclear Information System (INIS)

Gaubatz, J.W.

1987-01-01

Perturbations in DNA repair and other metabolic processes during development and aging might affect the steady-state level of genomic damage. The persistence or accumulation of DNA lesions in postmitotic cells could have a significant impact on proper cellular function, interfering with gene regulation for example. To test the notion that DNA damage increases as a function of age in non-dividing cells, DNA was purified from heart tissue of C57BL/6Nia mice at different ages and analyzed by post labeling techniques to detect DNA adducts. In the present experiments, four-dimensional, thin-layer chromatography was used to isolate aromatic adducts that were labeled with carrier-free (γ- 32 P) ATP under DNA-P excess conditions. The complexity and frequency of aromatic adducts varied between DNA samples. Several adducts were present in all preparations and were clearly more abundant in nucleotide maps of mature and old heart DNA. However, a direct correlation with age was not observed. In contrast, experiments in which aromatic adducts were first isolated by phase-transfer to 1-butanol, then labeled with excess (γ- 32 P)ATP indicated that there was an age-related increase in these adducts. The results are consistent with their earlier studies that showed alkyl adducts increased during aging of mouse myocardium and suggest that a common repair pathway might be involved

DNA replication stress and cancer chemotherapy.

Science.gov (United States)

Kitao, Hiroyuki; Iimori, Makoto; Kataoka, Yuki; Wakasa, Takeshi; Tokunaga, Eriko; Saeki, Hiroshi; Oki, Eiji; Maehara, Yoshihiko

2018-02-01

DNA replication is one of the fundamental biological processes in which dysregulation can cause genome instability. This instability is one of the hallmarks of cancer and confers genetic diversity during tumorigenesis. Numerous experimental and clinical studies have indicated that most tumors have experienced and overcome the stresses caused by the perturbation of DNA replication, which is also referred to as DNA replication stress (DRS). When we consider therapeutic approaches for tumors, it is important to exploit the differences in DRS between tumor and normal cells. In this review, we introduce the current understanding of DRS in tumors and discuss the underlying mechanism of cancer therapy from the aspect of DRS. © 2017 The Authors. Cancer Science published by John Wiley & Sons Australia, Ltd on behalf of Japanese Cancer Association.

Following DNA chain extension and protein conformational changes in crystals of a Y-family DNA polymerase via Raman crystallography.

Science.gov (United States)

Espinoza-Herrera, Shirly J; Gaur, Vineet; Suo, Zucai; Carey, Paul R

2013-07-23

Y-Family DNA polymerases are known to bypass DNA lesions in vitro and in vivo. Sulfolobus solfataricus DNA polymerase (Dpo4) was chosen as a model Y-family enzyme for investigating the mechanism of DNA synthesis in single crystals. Crystals of Dpo4 in complexes with DNA (the binary complex) in the presence or absence of an incoming nucleotide were analyzed by Raman microscopy. (13)C- and (15)N-labeled d*CTP, or unlabeled dCTP, were soaked into the binary crystals with G as the templating base. In the presence of the catalytic metal ions, Mg(2+) and Mn(2+), nucleotide incorporation was detected by the disappearance of the triphosphate band of dCTP and the retention of *C modes in the crystal following soaking out of noncovalently bound C(or *C)TP. The addition of the second coded base, thymine, was observed by adding cognate dTTP to the crystal following a single d*CTP addition. Adding these two bases caused visible damage to the crystal that was possibly caused by protein and/or DNA conformational change within the crystal. When d*CTP is soaked into the Dpo4 crystal in the absence of Mn(2+) or Mg(2+), the primer extension reaction did not occur; instead, a ternary protein·template·d*CTP complex was formed. In the Raman difference spectra of both binary and ternary complexes, in addition to the modes of d(*C)CTP, features caused by ring modes from the template/primer bases being perturbed and from the DNA backbone appear, as well as features from perturbed peptide and amino acid side chain modes. These effects are more pronounced in the ternary complex than in the binary complex. Using standardized Raman intensities followed as a function of time, the C(*C)TP population in the crystal was maximal at ∼20 min. These remained unchanged in the ternary complex but declined in the binary complexes as chain incorporation occurred.

Perturbative and constructive renormalization

International Nuclear Information System (INIS)

Veiga, P.A. Faria da

2000-01-01

These notes are a survey of the material treated in a series of lectures delivered at the X Summer School Jorge Andre Swieca. They are concerned with renormalization in Quantum Field Theories. At the level of perturbation series, we review classical results as Feynman graphs, ultraviolet and infrared divergences of Feynman integrals. Weinberg's theorem and Hepp's theorem, the renormalization group and the Callan-Symanzik equation, the large order behavior and the divergence of most perturbation series. Out of the perturbative regime, as an example of a constructive method, we review Borel summability and point out how it is possible to circumvent the perturbation diseases. These lectures are a preparation for the joint course given by professor V. Rivasseau at the same school, where more sophisticated non-perturbative analytical methods based on rigorous renormalization group techniques are presented, aiming at furthering our understanding about the subject and bringing field theoretical models to a satisfactory mathematical level. (author)

Study on Electrochemical Insulin Sensing Utilizing a DNA Aptamer-Immobilized Gold Electrode

Directory of Open Access Journals (Sweden)

Izumi Kubo

2015-07-01

Full Text Available We investigated an insulin-sensing method by utilizing an insulin-binding aptamer IGA3, which forms an anti-parallel G-quadruplex with folded single strands. Spectroscopic observation indicates that some anti-parallel G-quadruplex bind hemin and show peroxidase activity. In this study, the peroxidase activity of IGA3 with hemin was confirmed by spectrophotometric measurements, i.e., the activity was three-times higher than hemin itself. IGA3 was then immobilized onto a gold electrode to determine its electrochemical activity. The peroxidase activity of the immobilized IGA3-hemin complex was determined by cyclic voltammetry, and a cathodic peak current of the electrode showed a dependence on the concentration of H2O2. The cathodic peak current of the IGA3-hemin complex decreased by binding it to insulin, and this decrease depended on the concentration of insulin.

New Methods in Non-Perturbative QCD

Energy Technology Data Exchange (ETDEWEB)

Unsal, Mithat [North Carolina State Univ., Raleigh, NC (United States)

2017-01-31

In this work, we investigate the properties of quantum chromodynamics (QCD), by using newly developing mathematics and physics formalisms. Almost all of the mass in the visible universe emerges from a quantum chromodynamics (QCD), which has a completely negligible microscopic mass content. An intimately related issue in QCD is the quark confinement problem. Answers to non-perturbative questions in QCD remained largely elusive despite much effort over the years. It is also believed that the usual perturbation theory is inadequate to address these kinds of problems. Perturbation theory gives a divergent asymptotic series (even when the theory is properly renormalized), and there are non-perturbative phenomena which never appear at any order in perturbation theory. Recently, a fascinating bridge between perturbation theory and non-perturbative effects has been found: a formalism called resurgence theory in mathematics tells us that perturbative data and non-perturbative data are intimately related. Translating this to the language of quantum field theory, it turns out that non-perturbative information is present in a coded form in perturbation theory and it can be decoded. We take advantage of this feature, which is particularly useful to understand some unresolved mysteries of QCD from first principles. In particular, we use: a) Circle compactifications which provide a semi-classical window to study confinement and mass gap problems, and calculable prototypes of the deconfinement phase transition; b) Resurgence theory and transseries which provide a unified framework for perturbative and non-perturbative expansion; c) Analytic continuation of path integrals and Lefschetz thimbles which may be useful to address sign problem in QCD at finite density.

Cosmological perturbation theory and quantum gravity

Energy Technology Data Exchange (ETDEWEB)

Brunetti, Romeo [Dipartimento di Matematica, Università di Trento,Via Sommarive 14, 38123 Povo TN (Italy); Fredenhagen, Klaus [II Institute für Theoretische Physik, Universität Hamburg,Luruper Chaussee 149, 22761 Hamburg (Germany); Hack, Thomas-Paul [Institute für Theoretische Physik, Universität Leipzig,Brüderstr. 16, 04103 Leipzig (Germany); Pinamonti, Nicola [Dipartimento di Matematica, Università di Genova,Via Dodecaneso 35, 16146 Genova (Italy); INFN, Sezione di Genova,Via Dodecaneso 33, 16146 Genova (Italy); Rejzner, Katarzyna [Department of Mathematics, University of York,Heslington, York YO10 5DD (United Kingdom)

2016-08-04

It is shown how cosmological perturbation theory arises from a fully quantized perturbative theory of quantum gravity. Central for the derivation is a non-perturbative concept of gauge-invariant local observables by means of which perturbative invariant expressions of arbitrary order are generated. In particular, in the linearised theory, first order gauge-invariant observables familiar from cosmological perturbation theory are recovered. Explicit expressions of second order quantities are presented as well.

Perturbations i have Known and Loved

Science.gov (United States)

Field, Robert W.

2011-06-01

A spectroscopic perturbation is a disruption of a ^1Σ-^1Σ-like regular pattern that can embody level-shifts, extra lines, and intensity anomalies. Once upon a time, when a band was labeled ``perturbed,'' it was considered worthless because it could at best yield molecular constants unsuited for archival tables. Nevertheless, a few brave spectroscopists, notably Albin Lagerqvist and Richard Barrow, collected perturbations because they knew that the pattern of multiple perturbations formed an intricate puzzle that would eventually reveal the presence and electronic symmetry of otherwise unobservable electronic states. There are many kinds of patterns of broken patterns. In my PhD thesis I showed how to determine absolute vibrational assignments for the perturber from patterns among the observed values of perturbation matrix elements. When a ^3Π state is perturbed, its six (Ω, parity) components capture a pattern of level shifts and intensity anomalies that reveals more about the nature of the perturber than a simple perturbation of the single component of a ^1Σ state. In perturbation-facilitated OODR, a perturbed singlet level acts as a spectroscopic doorway through which the entire triplet manifold may be systematically explored. For polyatomic molecule vibrations, a vibrational polyad (a group of mutually perturbing vibrational levels, among which the perturbation matrix elements are expected to follow harmonic oscillator scaling rules) can contain more components than a ^3Π state and intrapolyad patterns can be exquisitely sensitive not merely to the nature of an interloper within the polyad but also to the eigenvector character of the vibronic state from which the polyad is viewed. Variation of scaled polyad interaction parameters from one polyad to the next, a pattern of patterns, can signal proximity to an isomerization barrier. Everything in Rydberg-land seems to scale as N⋆-3, yet a trespassing valence state causes all scaling and propensity rules go

A sensitive electrochemical aptasensor for ATP detection based on exonuclease III-assisted signal amplification strategy.

Science.gov (United States)

Bao, Ting; Shu, Huawei; Wen, Wei; Zhang, Xiuhua; Wang, Shengfu

2015-03-03

A target-induced structure-switching electrochemical aptasensor for sensitive detection of ATP was successfully constructed which was based on exonuclease III-catalyzed target recycling for signal amplification. With the existence of ATP, methylene blue (MB) labeled hairpin DNA formed G-quadruplex with ATP, which led to conformational changes of the hairpin DNA and created catalytic cleavage sites for exonuclease III (Exo III). Then the structure-switching DNA hybridized with capture DNA which made MB close to electrode surface. Meanwhile, Exo III selectively digested aptamer from its 3'-end, thus G-quadruplex structure was destroyed and ATP was released for target recycling. The Exo III-assisted target recycling amplified electrochemical signal significantly. Fluorescence experiment was performed to confirm the structure-switching process of the hairpin DNA. In fluorescence experiment, AuNPs-aptamer conjugates were synthesized, AuNPs quenched fluorescence of MB, the target-induced structure-switching made Exo III digested aptamer, which restored fluorescence. Under optimized conditions, the proposed aptasensor showed a linear range of 0.1-20 nM with a detection limit of 34 pM. In addition, the proposed aptasensor had good stability and selectivity, offered promising choice for the detection of other small molecules. Copyright © 2014 Elsevier B.V. All rights reserved.

Logic gates and antisense DNA devices operating on a translator nucleic Acid scaffold.

Science.gov (United States)

Shlyahovsky, Bella; Li, Yang; Lioubashevski, Oleg; Elbaz, Johann; Willner, Itamar

2009-07-28

A series of logic gates, "AND", "OR", and "XOR", are designed using a DNA scaffold that includes four "footholds" on which the logic operations are activated. Two of the footholds represent input-recognition strands, and these are blocked by complementary nucleic acids, whereas the other two footholds are blocked by nucleic acids that include the horseradish peroxidase (HRP)-mimicking DNAzyme sequence. The logic gates are activated by either nucleic acid inputs that hybridize to the respective "footholds", or by low-molecular-weight inputs (adenosine monophosphate or cocaine) that yield the respective aptamer-substrate complexes. This results in the respective translocation of the blocking nucleic acids to the footholds carrying the HRP-mimicking DNAzyme sequence, and the concomitant release of the respective DNAzyme. The released product-strands then self-assemble into the hemin/G-quadruplex-HRP-mimicking DNAzyme that biocatalyzes the formation of a colored product and provides an output signal for the different logic gates. The principle of the logic operation is, then, implemented as a possible paradigm for future nanomedicine. The nucleic acid inputs that bind to the blocked footholds result in the translocation of the blocking nucleic acids to the respective footholds carrying the antithrombin aptamer. The released aptamer inhibits, then, the hydrolytic activity of thrombin. The system demonstrates the regulation of a biocatalytic reaction by a translator system activated on a DNA scaffold.

NM23-H2 may play an indirect role in transcriptional activation of c-myc gene expression but does not cleave the nuclease hypersensitive element III1

International Nuclear Information System (INIS)

Dexheimer, Thomas S.; Carey, Steven S.; Zuohe, Song; Gokhale, Vijay M.; Hu, Xiaohui; Murata, Lauren B.; Maes, Estelle M.; Weichsel, Andrzej; Sun, Daekyu; Meuillet, Emmanuelle J.; Montfort, William R.; Hurley, Laurence H.

2009-01-01

The formation of G-quadruplex structures within the nuclease hypersensitive element (NHE) III 1 region of the c-myc promoter and the ability of these structures to repress c-myc transcription have been well established. However, just how these extremely stable DNA secondary structures are transformed to activate c-myc transcription is still unknown. NM23-H2/nucleoside diphosphate kinase B has been recognized as an activator of c-myc transcription via interactions with the NHE III 1 region of the c-myc gene promoter. Through the use of RNA interference, we confirmed the transcriptional regulatory role of NM23-H2. In addition, we find that further purification of NM23-H2 results in loss of the previously identified DNA strand cleavage activity, but retention of its DNA binding activity. NM23-H2 binds to both single-stranded guanine- and cytosine-rich strands of the c-myc NHE III 1 and, to a lesser extent, to a random single-stranded DNA template. However, it does not bind to or cleave the NHE III 1 in duplex form. Significantly, potassium ions and compounds that stabilize the G-quadruplex and i-motif structures have an inhibitory effect on NM23-H2 DNA-binding activity. Mutation of Arg 88 to Ala 88 (R88A) reduced both DNA and nucleotide binding but had minimal effect on the NM23-H2 crystal structure. On the basis of these data and molecular modeling studies, we have proposed a stepwise trapping-out of the NHE III 1 region in a single-stranded form, thus allowing single-stranded transcription factors to bind and activate c-myc transcription. Furthermore, this model provides a rationale for how the stabilization of the G-quadruplex or i-motif structures formed within the c-myc gene promoter region can inhibit NM23-H2 from activating c-myc gene expression.

Optimal random perturbations for stochastic approximation using a simultaneous perturbation gradient approximation

DEFF Research Database (Denmark)

Sadegh, Payman; Spall, J. C.

1998-01-01

simultaneous perturbation approximation to the gradient based on loss function measurements. SPSA is based on picking a simultaneous perturbation (random) vector in a Monte Carlo fashion as part of generating the approximation to the gradient. This paper derives the optimal distribution for the Monte Carlo...

Disformal transformation of cosmological perturbations

Directory of Open Access Journals (Sweden)

Masato Minamitsuji

2014-10-01

Full Text Available We investigate the gauge-invariant cosmological perturbations in the gravity and matter frames in the general scalar–tensor theory where two frames are related by the disformal transformation. The gravity and matter frames are the extensions of the Einstein and Jordan frames in the scalar–tensor theory where two frames are related by the conformal transformation, respectively. First, it is shown that the curvature perturbation in the comoving gauge to the scalar field is disformally invariant as well as conformally invariant, which gives the predictions from the cosmological model where the scalar field is responsible both for inflation and cosmological perturbations. Second, in case that the disformally coupled matter sector also contributes to curvature perturbations, we derive the evolution equations of the curvature perturbation in the uniform matter energy density gauge from the energy (nonconservation in the matter sector, which are independent of the choice of the gravity sector. While in the matter frame the curvature perturbation in the uniform matter energy density gauge is conserved on superhorizon scales for the vanishing nonadiabatic pressure, in the gravity frame it is not conserved even if the nonadiabatic pressure vanishes. The formula relating two frames gives the amplitude of the curvature perturbation in the matter frame, once it is evaluated in the gravity frame.

Disformal transformation of cosmological perturbations

International Nuclear Information System (INIS)

Minamitsuji, Masato

2014-01-01

We investigate the gauge-invariant cosmological perturbations in the gravity and matter frames in the general scalar–tensor theory where two frames are related by the disformal transformation. The gravity and matter frames are the extensions of the Einstein and Jordan frames in the scalar–tensor theory where two frames are related by the conformal transformation, respectively. First, it is shown that the curvature perturbation in the comoving gauge to the scalar field is disformally invariant as well as conformally invariant, which gives the predictions from the cosmological model where the scalar field is responsible both for inflation and cosmological perturbations. Second, in case that the disformally coupled matter sector also contributes to curvature perturbations, we derive the evolution equations of the curvature perturbation in the uniform matter energy density gauge from the energy (non)conservation in the matter sector, which are independent of the choice of the gravity sector. While in the matter frame the curvature perturbation in the uniform matter energy density gauge is conserved on superhorizon scales for the vanishing nonadiabatic pressure, in the gravity frame it is not conserved even if the nonadiabatic pressure vanishes. The formula relating two frames gives the amplitude of the curvature perturbation in the matter frame, once it is evaluated in the gravity frame

The SARS-unique domain (SUD of SARS coronavirus contains two macrodomains that bind G-quadruplexes.

Directory of Open Access Journals (Sweden)

Jinzhi Tan

2009-05-01

Full Text Available Since the outbreak of severe acute respiratory syndrome (SARS in 2003, the three-dimensional structures of several of the replicase/transcriptase components of SARS coronavirus (SARS-CoV, the non-structural proteins (Nsps, have been determined. However, within the large Nsp3 (1922 amino-acid residues, the structure and function of the so-called SARS-unique domain (SUD have remained elusive. SUD occurs only in SARS-CoV and the highly related viruses found in certain bats, but is absent from all other coronaviruses. Therefore, it has been speculated that it may be involved in the extreme pathogenicity of SARS-CoV, compared to other coronaviruses, most of which cause only mild infections in humans. In order to help elucidate the function of the SUD, we have determined crystal structures of fragment 389-652 ("SUD(core" of Nsp3, which comprises 264 of the 338 residues of the domain. Both the monoclinic and triclinic crystal forms (2.2 and 2.8 A resolution, respectively revealed that SUD(core forms a homodimer. Each monomer consists of two subdomains, SUD-N and SUD-M, with a macrodomain fold similar to the SARS-CoV X-domain. However, in contrast to the latter, SUD fails to bind ADP-ribose, as determined by zone-interference gel electrophoresis. Instead, the entire SUD(core as well as its individual subdomains interact with oligonucleotides known to form G-quadruplexes. This includes oligodeoxy- as well as oligoribonucleotides. Mutations of selected lysine residues on the surface of the SUD-N subdomain lead to reduction of G-quadruplex binding, whereas mutations in the SUD-M subdomain abolish it. As there is no evidence for Nsp3 entering the nucleus of the host cell, the SARS-CoV genomic RNA or host-cell mRNA containing long G-stretches may be targets of SUD. The SARS-CoV genome is devoid of G-stretches longer than 5-6 nucleotides, but more extended G-stretches are found in the 3'-nontranslated regions of mRNAs coding for certain host-cell proteins

Preheating curvaton perturbations

International Nuclear Information System (INIS)

Bastero-Gil, M.; Di Clemente, V.; King, S.F.

2005-01-01

We discuss the potentially important role played by preheating in certain variants of the curvaton mechanism in which isocurvature perturbations of a D-flat (and F-flat) direction become converted to curvature perturbations during reheating. We discover that parametric resonance of the isocurvature components amplifies the superhorizon fluctuations by a significant amount. As an example of these effects we develop a particle physics motivated model which involves hybrid inflation with the waterfall field N being responsible for generating the μ term, the right-handed neutrino mass scale, and the Peccei-Quinn symmetry breaking scale. The role of the curvaton field can be played either by usual Higgs field, or the lightest right-handed sneutrino. Our new results show that it is possible to achieve the correct curvature perturbations for initial values of the curvaton fields of order the weak scale. In this model we show that the prediction for the spectral index of the final curvature perturbation only depends on the mass of the curvaton during inflation, where consistency with current observational data requires the ratio of this mass to the Hubble constant to be 0.3

Structure and mechanism of human DNA polymerase [eta

Energy Technology Data Exchange (ETDEWEB)

Biertümpfel, Christian; Zhao, Ye; Kondo, Yuji; Ramón-Maiques, Santiago; Gregory, Mark; Lee, Jae Young; Masutani, Chikahide; Lehmann, Alan R.; Hanaoka, Fumio; Yang, Wei (Sussex); (NIH); (Gakushuin); (Osaka)

2010-11-03

The variant form of the human syndrome xeroderma pigmentosum (XPV) is caused by a deficiency in DNA polymerase {eta} (Pol{eta}), a DNA polymerase that enables replication through ultraviolet-induced pyrimidine dimers. Here we report high-resolution crystal structures of human Pol{eta} at four consecutive steps during DNA synthesis through cis-syn cyclobutane thymine dimers. Pol{eta} acts like a 'molecular splint' to stabilize damaged DNA in a normal B-form conformation. An enlarged active site accommodates the thymine dimer with excellent stereochemistry for two-metal ion catalysis. Two residues conserved among Pol{eta} orthologues form specific hydrogen bonds with the lesion and the incoming nucleotide to assist translesion synthesis. On the basis of the structures, eight Pol{eta} missense mutations causing XPV can be rationalized as undermining the molecular splint or perturbing the active-site alignment. The structures also provide an insight into the role of Pol{eta} in replicating through D loop and DNA fragile sites.

Mechanistic Studies of Oligonucleotide Aptamers With Potent Antiproliferative and Pro-Apoptotic Activity Against Prostate Cancer Cells

Science.gov (United States)

2007-05-01

Quadruplex structures in nucleic acids. Biopolymers , 2000. 56(3): p. 123-46. 16. Mills, M., et al., Unusual DNA conformations: implications for telomeres...scanning autoradiographic films and using UN-SCAN-IT gel software ( Silk Scientific Corporation, UT, USA). Band intensities were normalized as indicated in

Optofluidics-based DNA structure-competitive aptasensor for rapid on-site detection of lead(II) in an aquatic environment.

Science.gov (United States)

Long, Feng; Zhu, Anna; Wang, Hongchen

2014-11-07

Lead ions (Pb(2+)), ubiquitous and one of the most toxic metallic pollutants, have attracted increasing attentions because of their various neurotoxic effects. Pb(2+) has been proven to induce a conformational change in G-quadruplex (G4) aptamers to form a stabilizing G4/Pb(2+) complex. Based on this principle, an innovative optofluidics-based DNA structure-competitive aptasensor was developed for Pb(2+) detection in an actual aquatic environment. The proposed sensing system has good characteristics, such as high sensitivity and selectivity, reusability, easy operation, rapidity, robustness, portability, use of a small sample volume, and cost effectiveness. A fluorescence-labeled G4 aptamer was utilized as a molecular probe. A DNA probe, a complementary strand of G4 aptamer, was immobilized onto the sensor surface. When the mixture of Pb(2+) solution and G4 aptamer was introduced into the optofluidic cell, Pb(2+) and the DNA probe bound competitively with the G4 aptamer. A high Pb(2+) concentration reduced the binding of the aptamer and the DNA probe; thus, a low-fluorescence signal was detected. A sensitive sensing response to Pb(2+) in the range of 1.0-300.0 nM with a low detection limit of 0.22 nM was exhibited under optimal conditions. The potential interference of the environmental sample matrix was assessed with spiked samples, and the recovery of Pb(2+) ranged from 80 to 105% with a relative standard deviation value of monitoring of other trace analytes. Copyright © 2014 Elsevier B.V. All rights reserved.

Close encounters for the first time: Helicase interactions with DNA damage.

Science.gov (United States)

Khan, Irfan; Sommers, Joshua A; Brosh, Robert M

2015-09-01

DNA helicases are molecular motors that harness the energy of nucleoside triphosphate hydrolysis to unwinding structured DNA molecules that must be resolved during cellular replication, DNA repair, recombination, and transcription. In vivo, DNA helicases are expected to encounter a wide spectrum of covalent DNA modifications to the sugar phosphate backbone or the nitrogenous bases; these modifications can be induced by endogenous biochemical processes or exposure to environmental agents. The frequency of lesion abundance can vary depending on the lesion type. Certain adducts such as oxidative base modifications can be quite numerous, and their effects can be helix-distorting or subtle perturbations to DNA structure. Helicase encounters with specific DNA lesions and more novel forms of DNA damage will be discussed. We will also review the battery of assays that have been used to characterize helicase-catalyzed unwinding of damaged DNA substrates. Characterization of the effects of specific DNA adducts on unwinding by various DNA repair and replication helicases has proven to be insightful for understanding mechanistic and biological aspects of helicase function in cellular DNA metabolism. Published by Elsevier B.V.

Singular perturbation of simple eigenvalues

International Nuclear Information System (INIS)

Greenlee, W.M.

1976-01-01

Two operator theoretic theorems which generalize those of asymptotic regular perturbation theory and which apply to singular perturbation problems are proved. Application of these theorems to concrete problems is involved, but the perturbation expansions for eigenvalues and eigenvectors are developed in terms of solutions of linear operator equations. The method of correctors, as well as traditional boundary layer techniques, can be used to apply these theorems. The current formulation should be applicable to highly singular ''hard core'' potential perturbations of the radial equation of quantum mechanics. The theorems are applied to a comparatively simple model problem whose analysis is basic to that of the quantum mechanical problem

Base case and perturbation scenarios

Energy Technology Data Exchange (ETDEWEB)

Edmunds, T

1998-10-01

This report describes fourteen energy factors that could affect electricity markets in the future (demand, process, source mix, etc.). These fourteen factors are believed to have the most influence on the State's energy environment. A base case, or most probable, characterization is given for each of these fourteen factors over a twenty year time horizon. The base case characterization is derived from quantitative and qualitative information provided by State of California government agencies, where possible. Federal government databases are nsed where needed to supplement the California data. It is envisioned that a initial selection of issue areas will be based upon an evaluation of them under base case conditions. For most of the fourteen factors, the report identities possible perturbations from base case values or assumptions that may be used to construct additional scenarios. Only those perturbations that are plausible and would have a significant effect on energy markets are included in the table. The fourteen factors and potential perturbations of the factors are listed in Table 1.1. These perturbations can be combined to generate internally consist.ent. combinations of perturbations relative to the base case. For example, a low natural gas price perturbation should be combined with a high natural gas demand perturbation. The factor perturbations are based upon alternative quantitative forecasts provided by other institutions (the Department of Energy - Energy Information Administration in some cases), changes in assumptions that drive the quantitative forecasts, or changes in assumptions about the structure of the California energy markets. The perturbations are intended to be used for a qualitative reexamination of issue areas after an initial evaluation under the base case. The perturbation information would be used as a "tiebreaker;" to make decisions regarding those issue areas that were marginally accepted or rejected under the base case. Hf a

Scalar cosmological perturbations

International Nuclear Information System (INIS)

Uggla, Claes; Wainwright, John

2012-01-01

Scalar perturbations of Friedmann-Lemaitre cosmologies can be analyzed in a variety of ways using Einstein's field equations, the Ricci and Bianchi identities, or the conservation equations for the stress-energy tensor, and possibly introducing a timelike reference congruence. The common ground is the use of gauge invariants derived from the metric tensor, the stress-energy tensor, or from vectors associated with a reference congruence, as basic variables. Although there is a complication in that there is no unique choice of gauge invariants, we will show that this can be used to advantage. With this in mind our first goal is to present an efficient way of constructing dimensionless gauge invariants associated with the tensors that are involved, and of determining their inter-relationships. Our second goal is to give a unified treatment of the various ways of writing the governing equations in dimensionless form using gauge-invariant variables, showing how simplicity can be achieved by a suitable choice of variables and normalization factors. Our third goal is to elucidate the connection between the metric-based approach and the so-called 1 + 3 gauge-invariant approach to cosmological perturbations. We restrict our considerations to linear perturbations, but our intent is to set the stage for the extension to second-order perturbations. (paper)

Divergent Perturbation Series

International Nuclear Information System (INIS)

Suslov, I.M.

2005-01-01

Various perturbation series are factorially divergent. The behavior of their high-order terms can be determined by Lipatov's method, which involves the use of instanton configurations of appropriate functional integrals. When the Lipatov asymptotic form is known and several lowest order terms of the perturbation series are found by direct calculation of diagrams, one can gain insight into the behavior of the remaining terms of the series, which can be resummed to solve various strong-coupling problems in a certain approximation. This approach is demonstrated by determining the Gell-Mann-Low functions in φ 4 theory, QED, and QCD with arbitrary coupling constants. An overview of the mathematical theory of divergent series is presented, and interpretation of perturbation series is discussed. Explicit derivations of the Lipatov asymptotic form are presented for some basic problems in theoretical physics. A solution is proposed to the problem of renormalon contributions, which hampered progress in this field in the late 1970s. Practical perturbation-series summation schemes are described both for a coupling constant of order unity and in the strong-coupling limit. An interpretation of the Borel integral is given for 'non-Borel-summable' series. Higher order corrections to the Lipatov asymptotic form are discussed

DNA breaks and repair in interstitial telomere sequences: Influence of chromatin structure; Etude des cassures de l'ADN et des mecanismes de reparation dans les sequences telomeriques interstitielles: Influence de la structure chromatinienne

Energy Technology Data Exchange (ETDEWEB)

Revaud, D.

2009-06-15

Interstitial Telomeric Sequences (ITS) are over-involved in spontaneous and radiationinduced chromosome aberrations in chinese hamster cells. We have performed a study to investigate the origin of their instability, spontaneously or after low doses irradiation. Our results demonstrate that ITS have a particular chromatin structure: short nucleotide repeat length, less compaction of the 30 nm chromatin fiber, presence of G-quadruplex structures. These features would modulate breaks production and would favour the recruitment of alternative DNA repair mechanisms, which are prone to produce chromosome aberrations. These pathways could be at the origin of chromosome aberrations in ITS whereas NHEJ and HR Double Strand Break repair pathways are rather required for a correct repair in these regions. (author)

Transposable elements and G-quadruplexes

Czech Academy of Sciences Publication Activity Database

Kejnovský, Eduard; Tokan, Viktor; Lexa, M.

2015-01-01

Roč. 23, č. 3 (2015), s. 615-623 ISSN 0967-3849 R&D Projects: GA ČR(CZ) GA15-02891S Institutional support: RVO:68081707 Keywords : TRINUCLEOTIDE REPEAT DNA * LTR RETROTRANSPOSONS * BINDING PROTEIN Subject RIV: BO - Biophysics Impact factor: 2.590, year: 2015

Maintaining epigenetic inheritance during DNA replication in plants

Directory of Open Access Journals (Sweden)

Francisco eIglesias

2016-02-01

Full Text Available Biotic and abiotic stresses alter the pattern of gene expression in plants. Depending on the frequency and duration of stress events, the effects on the transcriptional state of genes are remembered temporally or transmitted to daughter cells and, in some instances, even to offspring (transgenerational epigenetic inheritance. This memory effect, which can be found even in the absence of the original stress, has an epigenetic basis, through molecular mechanisms that take place at the chromatin and DNA level but do not imply changes in the DNA sequence. Many epigenetic mechanisms have been described and involve covalent modifications on the DNA and histones, such as DNA methylation, histone acetylation and methylation, and RNAi dependent silencing mechanisms. Some of these chromatin modifications need to be stable through cell division in order to be truly epigenetic. During DNA replication, histones are recycled during the formation of the new nucleosomes and this process is tightly regulated. Perturbations to the DNA replication process and/or the recycling of histones lead to epigenetic changes. In this mini-review, we discuss recent evidence aimed at linking DNA replication process to epigenetic inheritance in plants.

Large-order perturbation theory

International Nuclear Information System (INIS)

Wu, T.T.

1982-01-01

The original motivation for studying the asymptotic behavior of the coefficients of perturbation series came from quantum field theory. An overview is given of some of the attempts to understand quantum field theory beyond finite-order perturbation series. At least is the case of the Thirring model and probably in general, the full content of a relativistic quantum field theory cannot be recovered from its perturbation series. This difficulty, however, does not occur in quantum mechanics, and the anharmonic oscillator is used to illustrate the methods used in large-order perturbation theory. Two completely different methods are discussed, the first one using the WKB approximation, and a second one involving the statistical analysis of Feynman diagrams. The first one is well developed and gives detailed information about the desired asymptotic behavior, while the second one is still in its infancy and gives instead information about the distribution of vertices of the Feynman diagrams

Lentivector Integration Sites in Ependymal Cells From a Model of Metachromatic Leukodystrophy: Non-B DNA as a New Factor Influencing Integration

Science.gov (United States)

McAllister, Robert G; Liu, Jiahui; Woods, Matthew W; Tom, Sean K; Rupar, C Anthony; Barr, Stephen D

2014-01-01

The blood–brain barrier controls the passage of molecules from the blood into the central nervous system (CNS) and is a major challenge for treatment of neurological diseases. Metachromatic leukodystrophy is a neurodegenerative lysosomal storage disease caused by loss of arylsulfatase A (ARSA) activity. Gene therapy via intraventricular injection of a lentiviral vector is a potential approach to rapidly and permanently deliver therapeutic levels of ARSA to the CNS. We present the distribution of integration sites of a lentiviral vector encoding human ARSA (LV-ARSA) in murine brain choroid plexus and ependymal cells, administered via a single intracranial injection into the CNS. LV-ARSA did not exhibit a strong preference for integration in or near actively transcribed genes, but exhibited a strong preference for integration in or near satellite DNA. We identified several genomic hotspots for LV-ARSA integration and identified a consensus target site sequence characterized by two G-quadruplex-forming motifs flanking the integration site. In addition, our analysis identified several other non-B DNA motifs as new factors that potentially influence lentivirus integration, including human immunodeficiency virus type-1 in human cells. Together, our data demonstrate a clinically favorable integration site profile in the murine brain and identify non-B DNA as a potential new host factor that influences lentiviral integration in murine and human cells. PMID:25158091

Perturbation theory in light-cone gauge

International Nuclear Information System (INIS)

Vianello, Eliana

2000-01-01

Perturbation calculations are presented for the light-cone gauge Schwinger model. Eigenstates can be calculated perturbatively but the perturbation theory is nonstandard. We hope to extend the work to QCD 2 to resolve some outstanding issues in those theories

Targeting DNA Replication Stress for Cancer Therapy

Directory of Open Access Journals (Sweden)

Jun Zhang

2016-08-01

Full Text Available The human cellular genome is under constant stress from extrinsic and intrinsic factors, which can lead to DNA damage and defective replication. In normal cells, DNA damage response (DDR mediated by various checkpoints will either activate the DNA repair system or induce cellular apoptosis/senescence, therefore maintaining overall genomic integrity. Cancer cells, however, due to constitutive growth signaling and defective DDR, may exhibit “replication stress” —a phenomenon unique to cancer cells that is described as the perturbation of error-free DNA replication and slow-down of DNA synthesis. Although replication stress has been proven to induce genomic instability and tumorigenesis, recent studies have counterintuitively shown that enhancing replicative stress through further loosening of the remaining checkpoints in cancer cells to induce their catastrophic failure of proliferation may provide an alternative therapeutic approach. In this review, we discuss the rationale to enhance replicative stress in cancer cells, past approaches using traditional radiation and chemotherapy, and emerging approaches targeting the signaling cascades induced by DNA damage. We also summarize current clinical trials exploring these strategies and propose future research directions including the use of combination therapies, and the identification of potential new targets and biomarkers to track and predict treatment responses to targeting DNA replication stress.

On dark energy isocurvature perturbation

International Nuclear Information System (INIS)

Liu, Jie; Zhang, Xinmin; Li, Mingzhe

2011-01-01

Determining the equation of state of dark energy with astronomical observations is crucially important to understand the nature of dark energy. In performing a likelihood analysis of the data, especially of the cosmic microwave background and large scale structure data the dark energy perturbations have to be taken into account both for theoretical consistency and for numerical accuracy. Usually, one assumes in the global fitting analysis that the dark energy perturbations are adiabatic. In this paper, we study the dark energy isocurvature perturbation analytically and discuss its implications for the cosmic microwave background radiation and large scale structure. Furthermore, with the current astronomical observational data and by employing Markov Chain Monte Carlo method, we perform a global analysis of cosmological parameters assuming general initial conditions for the dark energy perturbations. The results show that the dark energy isocurvature perturbations are very weakly constrained and that purely adiabatic initial conditions are consistent with the data

Complete-active-space second-order perturbation theory (CASPT2//CASSCF) study of the dissociative electron attachment in canonical DNA nucleobases caused by low-energy electrons (0-3 eV)

Energy Technology Data Exchange (ETDEWEB)

Francés-Monerris, Antonio; Segarra-Martí, Javier; Merchán, Manuela; Roca-Sanjuán, Daniel, E-mail: Daniel.Roca@uv.es [Instituto de Ciencia Molecular, Universitat de València, P.O. Box 22085, 46071 València (Spain)

2015-12-07

Low-energy (0-3 eV) ballistic electrons originated during the irradiation of biological material can interact with DNA/RNA nucleobases yielding transient-anion species which undergo decompositions. Since the discovery that these reactions can eventually lead to strand breaking of the DNA chains, great efforts have been dedicated to their study. The main fragmentation at the 0-3 eV energy range is the ejection of a hydrogen atom from the specific nitrogen positions. In the present study, the methodological approach introduced in a previous work on uracil [I. González-Ramírez et al., J. Chem. Theory Comput. 8, 2769-2776 (2012)] is employed to study the DNA canonical nucleobases fragmentations of N–H bonds induced by low-energy electrons. The approach is based on minimum energy path and linear interpolation of internal coordinates computations along the N–H dissociation channels carried out at the complete-active-space self-consistent field//complete-active-space second-order perturbation theory level. On the basis of the calculated theoretical quantities, new assignations for the adenine and cytosine anion yield curves are provided. In addition, the π{sub 1}{sup −} and π{sub 2}{sup −} states of the pyrimidine nucleobases are expected to produce the temporary anions at electron energies close to 1 and 2 eV, respectively. Finally, the present theoretical results do not allow to discard neither the dipole-bound nor the valence-bound mechanisms in the range of energies explored, suggesting that both possibilities may coexist in the experiments carried out with the isolated nucleobases.

High-resolution AFM structure of DNA G-wires in aqueous solution.

Science.gov (United States)

Bose, Krishnashish; Lech, Christopher J; Heddi, Brahim; Phan, Anh Tuân

2018-05-17

We investigate the self-assembly of short pieces of the Tetrahymena telomeric DNA sequence d[G 4 T 2 G 4 ] in physiologically relevant aqueous solution using atomic force microscopy (AFM). Wire-like structures (G-wires) of 3.0 nm height with well-defined surface periodic features were observed. Analysis of high-resolution AFM images allowed their classification based on the periodicity of these features. A major species is identified with periodic features of 4.3 nm displaying left-handed ridges or zigzag features on the molecular surface. A minor species shows primarily left-handed periodic features of 2.2 nm. In addition to 4.3 and 2.2 nm ridges, background features with periodicity of 0.9 nm are also observed. Using molecular modeling and simulation, we identify a molecular structure that can explain both the periodicity and handedness of the major G-wire species. Our results demonstrate the potential structural diversity of G-wire formation and provide valuable insight into the structure of higher-order intermolecular G-quadruplexes. Our results also demonstrate how AFM can be combined with simulation to gain insight into biomolecular structure.

Perturbation Theory of Embedded Eigenvalues

DEFF Research Database (Denmark)

Engelmann, Matthias

project gives a general and systematic approach to analytic perturbation theory of embedded eigenvalues. The spectral deformation technique originally developed in the theory of dilation analytic potentials in the context of Schrödinger operators is systematized by the use of Mourre theory. The group...... of dilations is thereby replaced by the unitary group generated y the conjugate operator. This then allows to treat the perturbation problem with the usual Kato theory.......We study problems connected to perturbation theory of embedded eigenvalues in two different setups. The first part deals with second order perturbation theory of mass shells in massive translation invariant Nelson type models. To this end an expansion of the eigenvalues w.r.t. fiber parameter up...

Examination of the effect of the annealing cation on higher order structures containing guanine or isoguanine repeats

Science.gov (United States)

Pierce, Sarah E.; Wang, Junmei; Jayawickramarajah, Janarthanan; Hamilton, Andrew D.; Brodbelt, Jennifer S.

2010-01-01

Isoguanine (2-oxo-6-amino-guanine), a natural but non-standard base, exhibits unique self-association properties compared to its isomer, guanine, and results in formation of different higher order DNA structures. In this work, the higher order structures formed by oligonucleotides containing guanine repeats or isoguanine repeats after annealing in solutions containing various cations are evaluated by electrospray ionization mass spectrometry (ESI-MS) and circular dichroism (CD) spectroscopy. The guanine-containing strand (G9) consistently formed quadruplexes upon annealing, whereas the isoguanine strand (Ig9) formed both pentaplexes and quadruplexes depending on the annealing cation. Quadruplex formation with G9 showed some dependence on the identity of the cation present during annealing with high relative quadruplex formation detected with six of ten cations. Analogous annealing experiments with Ig9 resulted in complex formation with all ten cations, and the majority of the resulting complexes were pentaplexes. CD results indicated most of the original complexes survived the desalting process necessary for ESI-MS analysis. In addition, several complexes, especially the pentaplexes, were found to be capable of cation exchange with ammonium ions. Ab initio calculations were conducted for isoguanine tetrads and pentads coordinated with all ten cations to predict the most energetically stable structures of the complexes in the gas phase. The observed preference of forming quadruplexes versus pentaplexes as a function of the coordinated cation can be interpreted by the calculated reaction energies of both the tetrads and pentads in combination with the distortion energies of tetrads. PMID:19746468

Chiral perturbation theory

International Nuclear Information System (INIS)

Ecker, G.

1996-06-01

After a general introduction to the structure of effective field theories, the main ingredients of chiral perturbation theory are reviewed. Applications include the light quark mass ratios and pion-pion scattering to two-loop accuracy. In the pion-nucleon system, the linear σ model is contrasted with chiral perturbation theory. The heavy-nucleon expansion is used to construct the effective pion-nucleon Lagrangian to third order in the low-energy expansion, with applications to nucleon Compton scattering. (author)

Concatenated logic circuits based on a three-way DNA junction: a keypad-lock security system with visible readout and an automatic reset function.

Science.gov (United States)

Chen, Junhua; Zhou, Shungui; Wen, Junlin

2015-01-07

Concatenated logic circuits operating as a biocomputing keypad-lock security system with an automatic reset function have been successfully constructed on the basis of toehold-mediated strand displacement and three-way-DNA-junction architecture. In comparison with previously reported keypad locks, the distinctive advantage of the proposed security system is that it can be reset and cycled spontaneously a large number of times without an external stimulus, thus making practical applications possible. By the use of a split-G-quadruplex DNAzyme as the signal reporter, the output of the keypad lock can be recognized readily by the naked eye. The "lock" is opened only when the inputs are introduced in an exact order. This requirement provides defense against illegal invasion to protect information at the molecular scale. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Dynamics of a single ion in a perturbed Penning trap: Octupolar perturbation

International Nuclear Information System (INIS)

Lara, Martin; Salas, J. Pablo

2004-01-01

Imperfections in the design or implementation of Penning traps may give rise to electrostatic perturbations that introduce nonlinearities in the dynamics. In this paper we investigate, from the point of view of classical mechanics, the dynamics of a single ion trapped in a Penning trap perturbed by an octupolar perturbation. Because of the axial symmetry of the problem, the system has two degrees of freedom. Hence, this model is ideal to be managed by numerical techniques like continuation of families of periodic orbits and Poincare surfaces of section. We find that, through the variation of the two parameters controlling the dynamics, several periodic orbits emanate from two fundamental periodic orbits. This process produces important changes (bifurcations) in the phase space structure leading to chaotic behavior

A DNA origami nanorobot controlled by nucleic acid hybridization.

Science.gov (United States)

Torelli, Emanuela; Marini, Monica; Palmano, Sabrina; Piantanida, Luca; Polano, Cesare; Scarpellini, Alice; Lazzarino, Marco; Firrao, Giuseppe

2014-07-23

A prototype for a DNA origami nanorobot is designed, produced, and tested. The cylindrical nanorobot (diameter of 14 nm and length of 48 nm) with a switchable flap, is able to respond to an external stimulus and reacts by a physical switch from a disarmed to an armed configuration able to deliver a cellular compatible message. In the tested design the robot weapon is a nucleic acid fully contained in the inner of the tube and linked to a single point of the internal face of the flap. Upon actuation the nanorobot moves the flap extracting the nucleic acid that assembles into a hemin/G-quadruplex horseradish peroxidase mimicking DNAzyme catalyzing a colorimetric reaction or chemiluminescence generation. The actuation switch is triggered by an external nucleic acid (target) that interacts with a complementary nucleic acid that is beard externally by the nanorobot (probe). Hybridization of probe and target produces a localized structural change that results in flap opening. The flap movement is studied on a two-dimensional prototype origami using Förster resonance energy transfer and is shown to be triggered by a variety of targets, including natural RNAs. The nanorobot has potential for in vivo biosensing and intelligent delivery of biological activators. © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

A DNA origami nanorobot controlled by nucleic acid hybridization

KAUST Repository

Torelli, Emanuela

2014-03-20

A prototype for a DNA origami nanorobot is designed, produced, and tested. The cylindrical nanorobot (diameter of 14 nm and length of 48 nm) with a switchable flap, is able to respond to an external stimulus and reacts by a physical switch from a disarmed to an armed configuration able to deliver a cellular compatible message. In the tested design the robot weapon is a nucleic acid fully contained in the inner of the tube and linked to a single point of the internal face of the flap. Upon actuation the nanorobot moves the flap extracting the nucleic acid that assembles into a hemin/G-quadruplex horseradish peroxidase mimicking DNAzyme catalyzing a colorimetric reaction or chemiluminescence generation. The actuation switch is triggered by an external nucleic acid (target) that interacts with a complementary nucleic acid that is beard externally by the nanorobot (probe). Hybridization of probe and target produces a localized structural change that results in flap opening. The flap movement is studied on a two-dimensional prototype origami using Förster resonance energy transfer and is shown to be triggered by a variety of targets, including natural RNAs. The nanorobot has potential for in vivo biosensing and intelligent delivery of biological activators. © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Status of perturbative QCD

International Nuclear Information System (INIS)

Collins, J.C.

1985-01-01

Progress in quantum chromodynamics in the past year is reviewed in these specific areas: proof of factorization for hadron-hadron collisions, fast calculation of higher order graphs, perturbative Monte Carlo calculations for hadron-hadron scattering, applicability of perturbative methods to heavy quark production, and understanding of the small-x problem. 22 refs

FRW Cosmological Perturbations in Massive Bigravity

CERN Document Server

Comelli, D; Pilo, L

2014-01-01

Cosmological perturbations of FRW solutions in ghost free massive bigravity, including also a second matter sector, are studied in detail. At early time, we find that sub horizon exponential instabilities are unavoidable and they lead to a premature departure from the perturbative regime of cosmological perturbations.

A quantum theoretical study of reactions of methyldiazonium ion with DNA base pairs

International Nuclear Information System (INIS)

Shukla, P.K.; Ganapathy, Vinay; Mishra, P.C.

2011-01-01

Graphical abstract: Reactions of methyldiazonium ion at the different sites of the DNA bases in the Watson-Crick GC and AT base pairs were investigated employing density functional and second order Moller-Plesset (MP2) perturbation theories. Display Omitted Highlights: → Methylation of the DNA bases is important as it can cause mutation and cancer. → Methylation reactions of the GC and AT base pairs with CH 3 N 2 + were not studied earlier theoretically. → Experimental observations have been explained using theoretical methods. - Abstract: Methylation of the DNA bases in the Watson-Crick GC and AT base pairs by the methyldiazonium ion was investigated employing density functional and second order Moller-Plesset (MP2) perturbation theories. Methylation at the N3, N7 and O6 sites of guanine, N1, N3 and N7 sites of adenine, O2 and N3 sites of cytosine and the O2 and O4 sites of thymine were considered. The computed reactivities for methylation follow the order N7(guanine) > N3(adenine) > O6(guanine) which is in agreement with experiment. The base pairing in DNA is found to play a significant role with regard to reactivities of the different sites.

Toehold-mediated strand displacement reaction triggered isothermal DNA amplification for highly sensitive and selective fluorescent detection of single-base mutation.

Science.gov (United States)

Zhu, Jing; Ding, Yongshun; Liu, Xingti; Wang, Lei; Jiang, Wei

2014-09-15

Highly sensitive and selective detection strategy for single-base mutations is essential for risk assessment of malignancy and disease prognosis. In this work, a fluorescent detection method for single-base mutation was proposed based on high selectivity of toehold-mediated strand displacement reaction (TSDR) and powerful signal amplification capability of isothermal DNA amplification. A discrimination probe was specially designed with a stem-loop structure and an overhanging toehold domain. Hybridization between the toehold domain and the perfect matched target initiated the TSDR along with the unfolding of the discrimination probe. Subsequently, the target sequence acted as a primer to initiate the polymerization and nicking reactions, which released a great abundant of short sequences. Finally, the released strands were annealed with the reporter probe, launching another polymerization and nicking reaction to produce lots of G-quadruplex DNA, which could bind the N-methyl mesoporphyrin IX to yield an enhanced fluorescence response. However, when there was even a single base mismatch in the target DNA, the TSDR was suppressed and so subsequent isothermal DNA amplification and fluorescence response process could not occur. The proposed approach has been successfully implemented for the identification of the single-base mutant sequences in the human KRAS gene with a detection limit of 1.8 pM. Furthermore, a recovery of 90% was obtained when detecting the target sequence in spiked HeLa cells lysate, demonstrating the feasibility of this detection strategy for single-base mutations in biological samples. Copyright © 2014 Elsevier B.V. All rights reserved.

Chaotic inflation with metric and matter perturbations

International Nuclear Information System (INIS)

Feldman, H.A.; Brandenberger, R.H.

1989-01-01

A perturbative scheme to analyze the evolution of both metric and scalar field perturbations in an expanding universe is developed. The scheme is applied to study chaotic inflation with initial metric and scalar field perturbations present. It is shown that initial gravitational perturbations with wavelength smaller than the Hubble radius rapidly decay. The metric simultaneously picks up small perturbations determined by the matter inhomogeneities. Both are frozen in once the wavelength exceeds the Hubble radius. (orig.)

Thermodynamic and biological evaluation of a thrombin binding aptamer modified with several unlocked nucleic acid (UNA) monomers and a 2′-C-piperazino-UNA monomer

DEFF Research Database (Denmark)

Jensen, Troels B.; Henriksen, Jonas Rosager; Rasmussen, Bjarne E.

2011-01-01

Thrombin binding aptamer is a DNA 15-mer which forms a G-quadruplex structure and possess promising anticoagulant properties due to specific interactions with thrombin. Herein we present the influence of a single 2′-C-piperazino-UNA residue and UNA residues incorporated in several positions on th...

Investigation of hyperfine interactions in DNA and antibody of different lineages of mice infected by T. cruzi by perturbed gamma-gamma angular correlation spectroscopy

International Nuclear Information System (INIS)

Silva, Andreia dos Santos

2012-01-01

In the present work perturbed angular correlation (PAC) spectroscopy was used to measured electric quadrupole interactions in DNA biomolecules of different mice lineages (A/J, C57BL/6, B6AF1, BXA1 e BXA2), samples of different isotypes of immunoglobulin G (IgG1, IgG2a e IgG2b) and active portions of complete and fragmented immunoglobulin responsible by the immune response. Electric quadrupole interactions were also measured in DNA nitrogenous bases (adenine, cytosine, guanine, thymine). PAC measurements were performed using 111 In → 111C d; 111mC d → 111 Cd; 111 Ag → 111 Cd; e 181 Hf → 181 Ta as probe nuclei, and carried out at room temperature and liquid nitrogen temperature, in order to investigate dynamic and static hyperfine interactions, respectively. The biomolecule samples were directly marked with the radioactive parent nuclei, whose atom link to a certain site in the biomolecules. The biological materials as well as the probe nuclei were chosen to investigate the possibility to use PAC spectroscopy to measure hyperfine parameters at nuclei from metallic elements bound to biomolecules (including the use of different probe nuclei produced in the decay of parent nuclei of four different metals) and also to study the behavior of different biomolecules by means of the measured hyperfine parameters. Results show differences in the hyperfine interactions of probe nuclei bound to the studied biomolecules. Such differences were observed by variations in the hyperfine parameters, which depend on the type of biomolecule and the results also show that the probe nuclei atom bound to the molecule in some cases and in others do not. (author)

A Role for the Fifth G-Track in G-Quadruplex Forming Oncogene Promoter Sequences during Oxidative Stress: Do These “Spare Tires” Have an Evolved Function?

Science.gov (United States)

2015-01-01

Uncontrolled inflammation or oxidative stress generates electron-deficient species that oxidize the genome increasing its instability in cancer. The G-quadruplex (G4) sequences regulating the c-MYC, KRAS, VEGF, BCL-2, HIF-1α, and RET oncogenes, as examples, are targets for oxidation at loop and 5′-core guanines (G) as showcased in this study by CO3•– oxidation of the VEGF G4. Products observed include 8-oxo-7,8-dihydroguanine (OG), spiroiminodihydantoin (Sp), and 5-guanidinohydantoin (Gh). Our previous studies found that OG and Gh, when present in the four G-tracks of the solved structure for VEGF and c-MYC, were not substrates for the base excision repair (BER) DNA glycosylases in biologically relevant KCl solutions. We now hypothesize that a fifth G-track found a few nucleotides distant from the G4 tracks involved in folding can act as a “spare tire,” facilitating extrusion of a damaged G-run into a large loop that then becomes a substrate for BER. Thermodynamic, spectroscopic, and DMS footprinting studies verified the fifth domain replacing a damaged G-track with OG or Gh at a loop or core position in the VEGF G4. These new “spare tire”-containing strands with Gh in loops are now found to be substrates for initiation of BER with the NEIL1, NEIL2, and NEIL3 DNA glycosylases. The results support a hypothesis in which regulatory G4s carry a “spare-tire” fifth G-track for aiding in the repair process when these sequences are damaged by radical oxygen species, a feature observed in a large number of these sequences. Furthermore, formation and repair of oxidized bases in promoter regions may constitute an additional example of epigenetic modification, in this case of guanine bases, to regulate gene expression in which the G4 sequences act as sensors of oxidative stress. PMID:26405692

Cosmological perturbations in antigravity

Science.gov (United States)

Oltean, Marius; Brandenberger, Robert

2014-10-01

We compute the evolution of cosmological perturbations in a recently proposed Weyl-symmetric theory of two scalar fields with oppositely signed conformal couplings to Einstein gravity. It is motivated from the minimal conformal extension of the standard model, such that one of these scalar fields is the Higgs while the other is a new particle, the dilaton, introduced to make the Higgs mass conformally symmetric. At the background level, the theory admits novel geodesically complete cyclic cosmological solutions characterized by a brief period of repulsive gravity, or "antigravity," during each successive transition from a big crunch to a big bang. For simplicity, we consider scalar perturbations in the absence of anisotropies, with potential set to zero and without any radiation. We show that despite the necessarily wrong-signed kinetic term of the dilaton in the full action, these perturbations are neither ghostlike nor tachyonic in the limit of strongly repulsive gravity. On this basis, we argue—pending a future analysis of vector and tensor perturbations—that, with respect to perturbative stability, the cosmological solutions of this theory are viable.

Gauge-invariant cosmological density perturbations

International Nuclear Information System (INIS)

Sasaki, Misao.

1986-06-01

Gauge-invariant formulation of cosmological density perturbation theory is reviewed with special emphasis on its geometrical aspects. Then the gauge-invariant measure of the magnitude of a given perturbation is presented. (author)

Twisting perturbed parafermions

Directory of Open Access Journals (Sweden)

A.V. Belitsky

2017-07-01

Full Text Available The near-collinear expansion of scattering amplitudes in maximally supersymmetric Yang–Mills theory at strong coupling is governed by the dynamics of stings propagating on the five sphere. The pentagon transitions in the operator product expansion which systematize the series get reformulated in terms of matrix elements of branch-point twist operators in the two-dimensional O(6 nonlinear sigma model. The facts that the latter is an asymptotically free field theory and that there exists no local realization of twist fields prevents one from explicit calculation of their scaling dimensions and operator product expansion coefficients. This complication is bypassed making use of the equivalence of the sigma model to the infinite-level limit of WZNW models perturbed by current–current interactions, such that one can use conformal symmetry and conformal perturbation theory for systematic calculations. Presently, to set up the formalism, we consider the O(3 sigma model which is reformulated as perturbed parafermions.

Effect of Hydrotherapy on Static and Dynamic Balance in Older Adults: Comparison of Perturbed and Non-Perturbed Programs

Directory of Open Access Journals (Sweden)

Elham Azimzadeh

2013-01-01

Full Text Available Objectives: Falling is a main cause of mortality in elderly. Balance training exercises can help to prevent falls in older adults. According to the principle of specificity of training, the perturbation-based trainings are more similar to the real world. So these training programs can improve balance in elderly. Furthermore, exercising in an aquatic environment can reduce the limitations for balance training rather than a non-aquatic on. The aim of this study is comparing the effectiveness of perturbed and non-perturbed balance training programs in water on static and dynamic balance in aforementioned population group. Methods & Materials: 37 old women (age 80-65, were randomized to the following groups: perturbation-based training (n=12, non-perturbation-based training (n=12 and control (n=13 groups. Static and dynamic balance had been tested before and after the eight weeks of training by the postural stability test of the Biodex balance system using dynamic (level 4 and static platform. The data were analyzed by one sample paired t-test, Independent t-test and ANOVA. Results: There was a significant improvement for all indexes of static and dynamic balance in perturbation-based training (P<0.05. However, in non-perturbed group, all indexes were improved except ML (P<0.05. ANOVA showed that perturbed training was more effective than non-perturbed training on both static and dynamic balances. Conclusion: The findings confirmed the specificity principle of training. Although balance training can improve balance abilities, these kinds of trainings are not such specific for improving balance neuromuscular activities.The perturbation-based trainings can activate postural compensatory responses and reduce falling risk. According to results, we can conclude that hydrotherapy especially with perturbation-based programs will be useful for rehabilitation interventions in elderly .

Multiplicative perturbations of local C-semigroups

Indian Academy of Sciences (India)

In this paper, we establish some left and right multiplicative perturbation theorems concerning local -semigroups when the generator of a perturbed local -semigroup S ( ⋅ ) may not be densely defined and the perturbation operator is a bounded linear operator from D ( A ) ¯ into () such that = on D ( A ) ¯ ...

Multiplicative perturbations of local C-semigroups

Indian Academy of Sciences (India)

2016-08-26

Aug 26, 2016 ... In this paper, we establish some left and right multiplicative perturbation theorems concerning local -semigroups when the generator of a perturbed local -semigroup S(⋅) may not be densely defined and the perturbation operator is a bounded linear operator from ¯D(A) into () such that = ...

Strong preference of BRCA1 protein to topologically constrained non-B DNA structures

Czech Academy of Sciences Publication Activity Database

Brázda, Václav; Haroniková, Lucia; Liao, J.C.C.; Fridrichova, Helena; Jagelská, Eva

2016-01-01

Roč. 17, JAN2016 (2016), č. článku 14. ISSN 1471-2199 R&D Projects: GA ČR GA15-21855S Institutional support: RVO:68081707 Keywords : double-strand breaks * g-quadruplexes * c-myc Subject RIV: BO - Biophysics Impact factor: 1.939, year: 2016

Perturbative QCD (1/3)

CERN Multimedia

CERN. Geneva

2013-01-01

Perturbative QCD is the general theoretical framework for describing hard scattering processes yielding multiparticle production at hadron colliders. In these lectures, we shall introduce fundamental features of perturbative QCD and describe its application to several high energy collider processes, including jet production in electron-positron annihilation, deep inelastic scattering, Higgs boson and gauge boson production at the LHC.

Geometric Hamiltonian structures and perturbation theory

International Nuclear Information System (INIS)

Omohundro, S.

1984-08-01

We have been engaged in a program of investigating the Hamiltonian structure of the various perturbation theories used in practice. We describe the geometry of a Hamiltonian structure for non-singular perturbation theory applied to Hamiltonian systems on symplectic manifolds and the connection with singular perturbation techniques based on the method of averaging

Structural basis for IL-1α recognition by a modified DNA aptamer that specifically inhibits IL-1α signaling

Energy Technology Data Exchange (ETDEWEB)

Ren, Xiaoming; Gelinas, Amy D.; von Carlowitz, Ira; Janjic, Nebojsa; Pyle, Anna Marie (Yale); (SomaLogic)

2017-10-09

IL-1α is an essential cytokine that contributes to inflammatory responses and is implicated in various forms of pathogenesis and cancer. Here we report a naphthyl modified DNA aptamer that specifically binds IL-1α and inhibits its signaling pathway. By solving the crystal structure of the IL-1α/aptamer, we provide a high-resolution structure of this critical cytokine and we reveal its functional interaction interface with high-affinity ligands. The non-helical aptamer, which represents a highly compact nucleic acid structure, contains a wealth of new conformational features, including an unknown form of G-quadruplex. The IL-1α/aptamer interface is composed of unusual polar and hydrophobic elements, along with an elaborate hydrogen bonding network that is mediated by sodium ion. IL-1α uses the same interface to interact with both the aptamer and its cognate receptor IL-1RI, thereby suggesting a novel route to immunomodulatory therapeutics.

A multiplex degenerate PCR analytical approach targeting to eight genes for screening GMOs.

Science.gov (United States)

Guo, Jinchao; Chen, Lili; Liu, Xin; Gao, Ying; Zhang, Dabing; Yang, Litao

2012-06-01

Currently, the detection methods with lower cost and higher throughput are the major trend in screening genetically modified (GM) food or feed before specific identification. In this study, we developed a quadruplex degenerate PCR screening approach for more than 90 approved GMO events. This assay is consisted of four PCR systems targeting on nine DNA sequences from eight trait genes widely introduced into GMOs, such as CP4-EPSPS derived from Acetobacterium tumefaciens sp. strain CP4, phosphinothricin acetyltransferase gene derived from Streptomyceshygroscopicus (bar) and Streptomyces viridochromogenes (pat), and Cry1Ab, Cry1Ac, Cry1A(b/c), mCry3A, and Cry3Bb1 derived from Bacillus thuringiensis. The quadruplex degenerate PCR assay offers high specificity and sensitivity with the absolute limit of detection (LOD) of approximate 80targetcopies. Furthermore, the applicability of the quadruplex PCR assay was confirmed by screening either several artificially prepared samples or samples of Grain Inspection, Packers and Stockyards Administration (GIPSA) proficiency program. Copyright © 2011 Elsevier Ltd. All rights reserved.

Non-perturbative effects in supersymmetry

International Nuclear Information System (INIS)

Veneziano, G.

1987-01-01

Some non perturbative aspects of globally supersymmetric (SUSY) gauge theories are discussed. These share with their non-supersymmetric analogues interesting non perturbative features, such as the spontaneous breaking of chiral symmetries via condensates. What is peculiar about supersymmetric theories, however, is that one is able to say a lot about non-perturbative effects even without resorting to elaborate numerical calculations: general arguments, supersymmetric and chiral Ward identities and analytic, dynamical calculations will turn out to effectively determine most of the supersymmetric vacuum properties. 28 references, 5 figures

The theory of singular perturbations

CERN Document Server

De Jager, E M

1996-01-01

The subject of this textbook is the mathematical theory of singular perturbations, which despite its respectable history is still in a state of vigorous development. Singular perturbations of cumulative and of boundary layer type are presented. Attention has been given to composite expansions of solutions of initial and boundary value problems for ordinary and partial differential equations, linear as well as quasilinear; also turning points are discussed. The main emphasis lies on several methods of approximation for solutions of singularly perturbed differential equations and on the mathemat

Local perturbations perturb—exponentially–locally

International Nuclear Information System (INIS)

De Roeck, W.; Schütz, M.

2015-01-01

We elaborate on the principle that for gapped quantum spin systems with local interaction, “local perturbations [in the Hamiltonian] perturb locally [the groundstate].” This principle was established by Bachmann et al. [Commun. Math. Phys. 309, 835–871 (2012)], relying on the “spectral flow technique” or “quasi-adiabatic continuation” [M. B. Hastings, Phys. Rev. B 69, 104431 (2004)] to obtain locality estimates with sub-exponential decay in the distance to the spatial support of the perturbation. We use ideas of Hamza et al. [J. Math. Phys. 50, 095213 (2009)] to obtain similarly a transformation between gapped eigenvectors and their perturbations that is local with exponential decay. This allows to improve locality bounds on the effect of perturbations on the low lying states in certain gapped models with a unique “bulk ground state” or “topological quantum order.” We also give some estimate on the exponential decay of correlations in models with impurities where some relevant correlations decay faster than one would naively infer from the global gap of the system, as one also expects in disordered systems with a localized groundstate

Perturbation theory in large order

International Nuclear Information System (INIS)

Bender, C.M.

1978-01-01

For many quantum mechanical models, the behavior of perturbation theory in large order is strikingly simple. For example, in the quantum anharmonic oscillator, which is defined by -y'' + (x 2 /4 + ex 4 /4 - E) y = 0, y ( +- infinity) = 0, the perturbation coefficients, A/sub n/, in the expansion for the ground-state energy, E(ground state) approx. EPSILON/sub n = 0//sup infinity/ A/sub n/epsilon/sup n/, simplify dramatically as n → infinity: A/sub n/ approx. (6/π 3 )/sup 1/2/(-3)/sup n/GAMMA(n + 1/2). Methods of applied mathematics are used to investigate the nature of perturbation theory in quantum mechanics and show that its large-order behavior is determined by the semiclassical content of the theory. In quantum field theory the perturbation coefficients are computed by summing Feynman graphs. A statistical procedure in a simple lambda phi 4 model for summing the set of all graphs as the number of vertices → infinity is presented. Finally, the connection between the large-order behavior of perturbation theory in quantum electrodynamics and the value of α, the charge on the electron, is discussed. 7 figures

Some remarks on perturbation in flame photometry; Quelques remarques sur les perturbations dans la photometrie de flamme

Energy Technology Data Exchange (ETDEWEB)

Malinowski, J [Commissariat a l' Energie Atomique, Saclay (France).Centre d' Etudes Nucleaires

1960-07-01

After classifying the various types of perturbations, the author attempts to explain their causes. He then gives examples of possibilities of suppressing them. (author) [French] Ayant classe les divers types de perturbations en categories, l'auteur essaie d'expliquer les causes de ces perturbations. Il donne ensuite des exemples de possibilites de les supprimer. (auteur)

Perturbation theory of effective Hamiltonians

International Nuclear Information System (INIS)

Brandow, B.H.

1975-01-01

This paper constitutes a review of the many papers which have used perturbation theory to derive ''effective'' or ''model'' Hamiltonians. It begins with a brief review of nondegenerate and non-many-body perturbation theory, and then considers the degenerate but non-many-body problem in some detail. It turns out that the degenerate perturbation problem is not uniquely defined, but there are some practical criteria for choosing among the various possibilities. Finally, the literature dealing with the linked-cluster aspects of open-shell many-body systems is reviewed. (U.S.)

On the non-perturbative effects

International Nuclear Information System (INIS)

Manjavidze, J.; Voronyuk, V.

2004-01-01

The quantum correspondence principle based on the time reversibility is adopted to take into account the non-Abelian symmetry constrains. The main properties of the new strong-coupling perturbation theory which take into account non-perturbative effects are described. (author)

Raman spectroscopy of DNA-metal complexes. I. Interactions and conformational effects of the divalent cations: Mg, Ca, Sr, Ba, Mn, Co, Ni, Cu, Pd, and Cd.

Science.gov (United States)

Duguid, J; Bloomfield, V A; Benevides, J; Thomas, G J

1993-11-01

Interactions of divalent metal cations (Mg2+, Ca2+, Ba2+, Sr2+, Mn2+, Co2+, Ni2+, Cu2+, Pd2+, and Cd2+) with DNA have been investigated by laser Raman spectroscopy. Both genomic calf-thymus DNA (> 23 kilobase pairs) and mononucleosomal fragments (160 base pairs) were employed as targets of metal interaction in solutions containing 5 weight-% DNA and metal:phosphate molar ratios of 0.6:1. Raman difference spectra reveal that transition metal cations (Mn2+, Co2+, Ni2+, Cu2+, Pd2+, and Cd2+) induce the greatest structural changes in B-DNA. The Raman (vibrational) band differences are extensive and indicate partial disordering of the B-form backbone, reduction in base stacking, reduction in base pairing, and specific metal interaction with acceptor sites on the purine (N7) and pyrimidine (N3) rings. Many of the observed spectral changes parallel those accompanying thermal denaturation of B-DNA and suggest that the metals link the bases of denatured DNA. While exocyclic carbonyls of dT, dG, and dC may stabilize metal ligation, correlation plots show that perturbations of the carbonyls are mainly a consequence of metal-induced denaturation of the double helix. Transition metal interactions with the DNA phosphates are weak in comparison to interactions with the bases, except in the case of Cu2+, which strongly perturbs both base and phosphate group vibrations. On the other hand, the Raman signature of B-DNA is largely unperturbed by Mg2+, Ca2+, Sr2+, and Ba2+, suggesting much weaker interactions of the alkaline earth metals with both base and phosphate sites. A notable exception is a moderate perturbation by alkaline earths of purine N7 sites in 160-base pair DNA, with Ca2+ causing the greatest effect. Correlation plots demonstrate a strong interrelationship between perturbations of Raman bands assigned to ring vibrations of the bases and those of bands assigned to exocyclic carbonyls and backbone phosphodiester groups. However, strong correlations do not occur between

Evolution of the curvature perturbations during warm inflation

International Nuclear Information System (INIS)

Matsuda, Tomohiro

2009-01-01

This paper considers warm inflation as an interesting application of multi-field inflation. Delta-N formalism is used for the calculation of the evolution of the curvature perturbations during warm inflation. Although the perturbations considered in this paper are decaying after the horizon exit, the corrections to the curvature perturbations sourced by these perturbations can remain and dominate the curvature perturbations at large scales. In addition to the typical evolution of the curvature perturbations, inhomogeneous diffusion rate is considered for warm inflation, which may lead to significant non-Gaussianity of the spectrum

Perturbative spacetimes from Yang-Mills theory

Energy Technology Data Exchange (ETDEWEB)

Luna, Andrés [School of Physics and Astronomy, University of Glasgow,Glasgow G12 8QQ, Scotland (United Kingdom); Monteiro, Ricardo [Theoretical Physics Department, CERN,Geneva (Switzerland); Nicholson, Isobel; Ochirov, Alexander; O’Connell, Donal [Higgs Centre for Theoretical Physics,School of Physics and Astronomy, The University of Edinburgh,Edinburgh EH9 3JZ, Scotland (United Kingdom); Westerberg, Niclas [Institute of Photonics and Quantum Sciences,School of Engineering and Physical Sciences, Heriot-Watt University,Edinburgh (United Kingdom); Higgs Centre for Theoretical Physics,School of Physics and Astronomy, The University of Edinburgh,Edinburgh EH9 3JZ, Scotland (United Kingdom); White, Chris D. [Centre for Research in String Theory,School of Physics and Astronomy, Queen Mary University of London,327 Mile End Road, London E1 4NS (United Kingdom)

2017-04-12

The double copy relates scattering amplitudes in gauge and gravity theories. In this paper, we expand the scope of the double copy to construct spacetime metrics through a systematic perturbative expansion. The perturbative procedure is based on direct calculation in Yang-Mills theory, followed by squaring the numerator of certain perturbative diagrams as specified by the double-copy algorithm. The simplest spherically symmetric, stationary spacetime from the point of view of this procedure is a particular member of the Janis-Newman-Winicour family of naked singularities. Our work paves the way for applications of the double copy to physically interesting problems such as perturbative black-hole scattering.

Nonperturbative perturbation theory

International Nuclear Information System (INIS)

Bender, C.M.

1989-01-01

In this talk we describe a recently proposed graphical perturbative calculational scheme for quantum field theory. The basic idea is to expand in the power of the interaction term. For example, to solve a λφ 4 theory in d-dimensional space-time, we introduce a small parameter δ and consider a λ(φ 2 ) 1+δ field theory. We show how to expand such a theory as a series in powers of δ. The resulting perturbation series appears to have a finite radius of convergence and numerical results for low-dimensional models are good. We have computed the two-point and four-point Green's functions to second order in powers of δ and the 2n-point Green's functions (n>2) to order δ. We explain how to renormalize the theory and show that, to first order in powers of δ, when δ>0 and d≥4 the theory is free. This conclusion remains valid to second order in powers of δ, and we believe that it remains valid to all orders in powers of δ. The new perturbative scheme is consistent with global supersymmetry invariance. We examine a two-dimensional supersymmetric quantum field theory in which we do not know of any other means for doing analytical calculations. We illustrate the power of this new technique by computing the ground-state energy density E to second order in this new perturbation theory. We show that there is a beautiful and delicate cancellation between infinite classes of graphs which leads to the result that E=0. (orig.)

Epigenetic perturbations in the pathogenesis of mustard toxicity; hypothesis and preliminary results

International Nuclear Information System (INIS)

Korkmaz, A.; Yaren, H.; Kunak, I.; Uysal, B.; Kurt, B.; Topal, T.

2009-01-01

The pathogenesis of sulfur mustard (SM) toxicity is not fully understood, although it is related to reactive oxygen and nitrogen species, oxidative stress, DNA damage, poly (ADP-ribose) polymerase activation within the affected cell. We, therefore, made an attempt whether epigenetic aberrations may contribute to pathogenesis of SM poisoning in rats' lung. A total of 40 male SD rats were divided into 4 groups. Group 1 served as control and given 2 ml saline, three groups received single dose of mechlorethamine (MEC) (3.5 mg/kg subcutaneously) with the same time intervals. Group 2 received MEC only; group 3 received histone deacetylase (HDAC) inhibitor (Trichostatine A) (1 mg/kg) and group 4 received DNA methyl transferase (DNMT) inhibitor (5-Azacytidine) (0.02 mg/kg), intraperitoneally. MEC injection resulted in severe lung toxicity with strong interstitial and alveolar edema, hemorrhage, emphysematous changes as well as mild inflammatory cell infiltration and septal thickening. In group 3, the HDAC inhibitor significantly reduced interstitial and alveolar edema, hemorrhage and inflammatory cell infiltration. On the other hand, we have observed severe lung damage by using DNMT inhibitor (group 4). In HDAC inhibitor group, the results were close to sham group. In DNMT inhibitor group, however, lungs were worse than MEC group results. These preliminary results revealed that, SM itself and/or its intracellular metabolites may perturb the epigenetic environment of the affected cell in lung tissue. Hypothetically, MEC may cause HDAC induction leading to a variety of gene silencing. Trichostatine A can reduce the active enzyme level and can reactivate the already silenced genes. Further studies are needed to clarify the involvement of epigenetic perturbations in the pathogenesis of mustard toxicity.(author)

Kerr-CFT and gravitational perturbations

International Nuclear Information System (INIS)

Dias, Oscar J.C.; Reall, Harvey S.; Santos, Jorge E.

2009-01-01

Motivated by the Kerr-CFT conjecture, we investigate perturbations of the near-horizon extreme Kerr spacetime. The Teukolsky equation for a massless field of arbitrary spin is solved. Solutions fall into two classes: normal modes and traveling waves. Imposing suitable (outgoing) boundary conditions, we find that there are no unstable modes. The explicit form of metric perturbations is obtained using the Hertz potential formalism, and compared with the Kerr-CFT boundary conditions. The energy and angular momentum associated with scalar field and gravitational normal modes are calculated. The energy is positive in all cases. The behaviour of second order perturbations is discussed.

The power of perturbation theory

Energy Technology Data Exchange (ETDEWEB)

Serone, Marco [SISSA International School for Advanced Studies and INFN Trieste, Via Bonomea 265, 34136, Trieste (Italy); Abdus Salam International Centre for Theoretical Physics, Strada Costiera 11, 34151, Trieste (Italy); Spada, Gabriele [SISSA International School for Advanced Studies and INFN Trieste, Via Bonomea 265, 34136, Trieste (Italy); Villadoro, Giovanni [Abdus Salam International Centre for Theoretical Physics, Strada Costiera 11, 34151, Trieste (Italy)

2017-05-10

We study quantum mechanical systems with a discrete spectrum. We show that the asymptotic series associated to certain paths of steepest-descent (Lefschetz thimbles) are Borel resummable to the full result. Using a geometrical approach based on the Picard-Lefschetz theory we characterize the conditions under which perturbative expansions lead to exact results. Even when such conditions are not met, we explain how to define a different perturbative expansion that reproduces the full answer without the need of transseries, i.e. non-perturbative effects, such as real (or complex) instantons. Applications to several quantum mechanical systems are presented.

A Biofunctional Molecular Beacon for Detecting Single Base Mutations in Cancer Cells

Directory of Open Access Journals (Sweden)

Haiyan Dong

2016-01-01

Full Text Available The development of a convenient and sensitive biosensing system to detect specific DNA sequences is an important issue in the field of genetic disease therapy. As a classic DNA detection technique, molecular beacon (MB is often used in the biosensing system. However, it has intrinsic drawbacks, including high assay cost, complicated chemical modification, and operational complexity. In this study, we developed a simple and cost-effective label-free multifunctional MB (LMMB by integrating elements of polymerization primer, template, target recognition, and G-quadruplex into one entity to detect target DNA. The core technique was accomplished by introducing a G-hairpin that features fragments of both G-quadruplex and target DNA recognition in the G-hairpin stem. Hybridization between LMMB and target DNA triggered conformational change between the G-hairpin and the common C-hairpin, resulting in significant SYBR-green signal amplification. The hybridization continues to the isothermal circular strand-displacement polymerization and accumulation of the double-stranded fragments, causing the uninterrupted extension of the LMMB without a need of chemical modification and other assistant DNA sequences. The novel and programmable LMMB could detect target DNA with sensitivity at 250 pmol/l with a linear range from 2 to 100 nmol/l and the relative standard deviation of 7.98%. The LMMB could sense a single base mutation from the normal DNA, and polymerase chain reaction (PCR amplicons of the mutant-type cell line from the wild-type one. The total time required for preparation and assaying was only 25 minutes. Apparently, the LMMB shows great potential for detecting DNA and its mutations in biosamples, and therefore it opens up a new prospect for genetic disease therapy.

Non-adiabatic perturbations in multi-component perfect fluids

Energy Technology Data Exchange (ETDEWEB)

Koshelev, N.A., E-mail: koshna71@inbox.ru [Ulyanovsk State University, Leo Tolstoy str 42, 432970 (Russian Federation)

2011-04-01

The evolution of non-adiabatic perturbations in models with multiple coupled perfect fluids with non-adiabatic sound speed is considered. Instead of splitting the entropy perturbation into relative and intrinsic parts, we introduce a set of symmetric quantities, which also govern the non-adiabatic pressure perturbation in models with energy transfer. We write the gauge invariant equations for the variables that determine on a large scale the non-adiabatic pressure perturbation and the rate of changes of the comoving curvature perturbation. The analysis of evolution of the non-adiabatic pressure perturbation has been made for several particular models.

Non-adiabatic perturbations in multi-component perfect fluids

International Nuclear Information System (INIS)

Koshelev, N.A.

2011-01-01

The evolution of non-adiabatic perturbations in models with multiple coupled perfect fluids with non-adiabatic sound speed is considered. Instead of splitting the entropy perturbation into relative and intrinsic parts, we introduce a set of symmetric quantities, which also govern the non-adiabatic pressure perturbation in models with energy transfer. We write the gauge invariant equations for the variables that determine on a large scale the non-adiabatic pressure perturbation and the rate of changes of the comoving curvature perturbation. The analysis of evolution of the non-adiabatic pressure perturbation has been made for several particular models

Closed form bound-state perturbation theory

Directory of Open Access Journals (Sweden)

Ollie J. Rose

1980-01-01

Full Text Available The perturbed Schrödinger eigenvalue problem for bound states is cast into integral form using Green's Functions. A systematic algorithm is developed and applied to the resulting equation giving rise to approximate solutions expressed as functions of the given perturbation parameter. As a by-product, convergence radii for the traditional Rayleigh-Schrödinger and Brillouin-Wigner perturbation theories emerge in a natural way.

On summation of perturbation expansions

International Nuclear Information System (INIS)

Horzela, A.

1985-04-01

The problem of the restoration of physical quantities defined by divergent perturbation expansions is analysed. The Pad'e and Borel summability is proved for alternating perturbation expansions with factorially growing coefficients. The proof is based on the methods of the classical moments theory. 17 refs. (author)

Perturbation theory and collision probability formalism. Vol. 2

Energy Technology Data Exchange (ETDEWEB)

Nasr, M [National Center for Nuclear Safety and Radiation Control, Atomic Energy Authority, Cairo (Egypt)

1996-03-01

Perturbation theory is commonly used in evaluating the activity effects, particularly those resulting from small and localized perturbation in multiplying media., e.g. in small sample reactivity measurements. The Boltzmann integral transport equation is generally used for evaluating the direct and adjoint fluxes in the heterogenous lattice cells to be used in the perturbation equations. When applying perturbation theory in this formalism, a term involving the perturbation effects on the special transfer kernel arises. This term is difficult to evaluate correctly, since it involves an integration all over the entire system. The main advantage of the perturbation theory which is the limitation of the integration procedure on the perturbation region is found to be of no practical use in such cases. In the present work, the perturbation equation in the collision probability formalism is analyzed. A mathematical treatment of the term in question is performed. A new mathematical expression for this term is derived. The new expression which can be estimated easily is derived.

Anticipation of direction and time of perturbation modulates the onset latency of trunk muscle responses during sitting perturbations.

Science.gov (United States)

Milosevic, Matija; Shinya, Masahiro; Masani, Kei; Patel, Kramay; McConville, Kristiina M V; Nakazawa, Kimitaka; Popovic, Milos R

2016-02-01

Trunk muscles are responsible for maintaining trunk stability during sitting. However, the effects of anticipation of perturbation on trunk muscle responses are not well understood. The objectives of this study were to identify the responses of trunk muscles to sudden support surface translations and quantify the effects of anticipation of direction and time of perturbation on the trunk neuromuscular responses. Twelve able-bodied individuals participated in the study. Participants were seated on a kneeling chair and support surface translations were applied in the forward and backward directions with and without direction and time of perturbation cues. The trunk started moving on average approximately 40ms after the perturbation. During unanticipated perturbations, average latencies of the trunk muscle contractions were in the range between 103.4 and 117.4ms. When participants anticipated the perturbations, trunk muscle latencies were reduced by 16.8±10.0ms and the time it took the trunk to reach maximum velocity was also reduced, suggesting a biomechanical advantage caused by faster muscle responses. These results suggested that trunk muscles have medium latency responses and use reflexive mechanisms. Moreover, anticipation of perturbation decreased trunk muscles latencies, suggesting that the central nervous system modulated readiness of the trunk based on anticipatory information. Copyright © 2015 Elsevier Ltd. All rights reserved.

Secondary isocurvature perturbations from acoustic reheating

Science.gov (United States)

Ota, Atsuhisa; Yamaguchi, Masahide

2018-06-01

The superhorizon (iso)curvature perturbations are conserved if the following conditions are satisfied: (i) (each) non adiabatic pressure perturbation is zero, (ii) the gradient terms are ignored, that is, at the leading order of the gradient expansion (iii) (each) total energy momentum tensor is conserved. We consider the case with the violation of the last two requirements and discuss the generation of secondary isocurvature perturbations during the late time universe. Second order gradient terms are not necessarily ignored even if we are interested in the long wavelength modes because of the convolutions which may pick products of short wavelength perturbations up. We then introduce second order conserved quantities on superhorizon scales under the conditions (i) and (iii) even in the presence of the gradient terms by employing the full second order cosmological perturbation theory. We also discuss the violation of the condition (iii), that is, the energy momentum tensor is conserved for the total system but not for each component fluid. As an example, we explicitly evaluate second order heat conduction between baryons and photons due to the weak Compton scattering, which dominates during the period just before recombination. We show that such secondary effects can be recast into the isocurvature perturbations on superhorizon scales if the local type primordial non Gaussianity exists a priori.

Generalized chiral perturbation theory

International Nuclear Information System (INIS)

Knecht, M.; Stern, J.

1994-01-01

The Generalized Chiral Perturbation Theory enlarges the framework of the standard χPT (Chiral Perturbation Theory), relaxing certain assumptions which do not necessarily follow from QCD or from experiment, and which are crucial for the usual formulation of the low energy expansion. In this way, experimental tests of the foundations of the standard χPT become possible. Emphasis is put on physical aspects rather than on formal developments of GχPT. (author). 31 refs

Effects of ionizing radiations on DNA-protein complexes

International Nuclear Information System (INIS)

Gillard, N.

2005-11-01

The radio-induced destruction of DNA-protein complexes may have serious consequences for systems implicated in important cellular functions. The first system which has been studied is the lactose operon system, that regulates gene expression in Escherichia coli. First of all, the repressor-operator complex is destroyed after irradiation of the complex or of the protein alone. The damaging of the domain of repressor binding to DNA (headpiece) has been demonstrated and studied from the point of view of peptide chain integrity, conformation and amino acids damages. Secondly, dysfunctions of the in vitro induction of an irradiated repressor-unirradiated DNA complex have been observed. These perturbations, due to a decrease of the number of inducer binding sites, are correlated to the damaging of tryptophan residues. Moreover, the inducer protects the repressor when they are irradiated together, both by acting as a scavenger in the bulk, and by the masking of its binding site on the protein. The second studied system is formed by Fpg (for Formamido pyrimidine glycosylase), a DNA repair protein and a DNA with an oxidative lesion. The results show that irradiation disturbs the repair both by decreasing its efficiency of DNA lesion recognition and binding, and by altering its enzymatic activity. (author)

Stepping stability: effects of sensory perturbation

Directory of Open Access Journals (Sweden)

Krebs David E

2005-05-01

Full Text Available Abstract Background Few tools exist for quantifying locomotor stability in balance impaired populations. The objective of this study was to develop and evaluate a technique for quantifying stability of stepping in healthy people and people with peripheral (vestibular hypofunction, VH and central (cerebellar pathology, CB balance dysfunction by means a sensory (auditory perturbation test. Methods Balance impaired and healthy subjects performed a repeated bench stepping task. The perturbation was applied by suddenly changing the cadence of the metronome (100 beat/min to 80 beat/min at a predetermined time (but unpredictable by the subject during the trial. Perturbation response was quantified by computing the Euclidian distance, expressed as a fractional error, between the anterior-posterior center of gravity attractor trajectory before and after the perturbation was applied. The error immediately after the perturbation (Emax, error after recovery (Emin and the recovery response (Edif were documented for each participant, and groups were compared with ANOVA. Results Both balance impaired groups exhibited significantly higher Emax (p = .019 and Emin (p = .028 fractional errors compared to the healthy (HE subjects, but there were no significant differences between CB and VH groups. Although response recovery was slower for CB and VH groups compared to the HE group, the difference was not significant (p = .051. Conclusion The findings suggest that individuals with balance impairment have reduced ability to stabilize locomotor patterns following perturbation, revealing the fragility of their impairment adaptations and compensations. These data suggest that auditory perturbations applied during a challenging stepping task may be useful for measuring rehabilitation outcomes.

Menadione-induced DNA fragmentation without 8-oxo-2'-deoxyguanosine formation in isolated rat hepatocytes

DEFF Research Database (Denmark)

Fischer-Nielsen, A; Corcoran, G B; Poulsen, H E

1995-01-01

Menadione (2-methyl-1,4-naphthoquinone) induces oxidative stress in cells causing perturbations in the cytoplasm as well as nicking of DNA. The mechanisms by which DNA damage occurs are still unclear, but a widely discussed issue is whether menadione-generated reactive oxygen species (ROS) directly...... damage DNA. In the present study, we measured the effect of menadione on formation of 7,8-dihydro-8-oxo-2'-deoxyguanosine (8-oxodG), an index of oxidative DNA base modifications, and on DNA fragmentation. Isolated hepatocytes from phenobarbital-pretreated rats were exposed to menadione, 25-400 micro......M, for 15, 90 or 180 min with or without prior depletion of reduced glutathione (GSH) by diethyl maleate. Menadione caused profound GSH depletion and internucleosomal DNA fragmentation, which was demonstrated by a prominent fragmentation ladder on agarose gel electrophoresis. We found no oxidative...

Cosmological perturbations beyond linear order

CERN Multimedia

CERN. Geneva

2013-01-01

Cosmological perturbation theory is the standard tool to understand the formation of the large scale structure in the Universe. However, its degree of applicability is limited by the growth of the amplitude of the matter perturbations with time. This problem can be tackled with by using N-body simulations or analytical techniques that go beyond the linear calculation. In my talk, I'll summarise some recent efforts in the latter that ameliorate the bad convergence of the standard perturbative expansion. The new techniques allow better analytical control on observables (as the matter power spectrum) over scales very relevant to understand the expansion history and formation of structure in the Universe.

Instabilities in mimetic matter perturbations

Energy Technology Data Exchange (ETDEWEB)

Firouzjahi, Hassan; Gorji, Mohammad Ali [School of Astronomy, Institute for Research in Fundamental Sciences (IPM), P.O. Box 19395-5531, Tehran (Iran, Islamic Republic of); Mansoori, Seyed Ali Hosseini, E-mail: firouz@ipm.ir, E-mail: gorji@ipm.ir, E-mail: shosseini@shahroodut.ac.ir, E-mail: shossein@ipm.ir [Physics Department, Shahrood University of Technology, P.O. Box 3619995161 Shahrood (Iran, Islamic Republic of)

2017-07-01

We study cosmological perturbations in mimetic matter scenario with a general higher derivative function. We calculate the quadratic action and show that both the kinetic term and the gradient term have the wrong sings. We perform the analysis in both comoving and Newtonian gauges and confirm that the Hamiltonians and the associated instabilities are consistent with each other in both gauges. The existence of instabilities is independent of the specific form of higher derivative function which generates gradients for mimetic field perturbations. It is verified that the ghost instability in mimetic perturbations is not associated with the higher derivative instabilities such as the Ostrogradsky ghost.

Gauge-invariant perturbations in a spatially flat anisotropic universe

International Nuclear Information System (INIS)

Den, Mitsue.

1986-12-01

The gauge-invariant perturbations in a spatially flat anisotropic universe with an arbitrary dimension (= N) are studied. In a previous paper the equations for the perturbations with a wave vector k a in one of the axial directions were derived and their solutions were shown. In this paper the perturbations with k a in arbitrary directions are treated. The remarkable properties are that all three types (scalar, vector, and tensor) of perturbations are generally coupled, so that a density perturbation can be produced also by vector or tensor perturbations. The formulation is quite general, but the behavior of the perturbations is discussed in a simple case such that N = 4 and k a is orthogonal to one of the axial directions. In this case, the perturbations are divided into two groups which are dynamically decoupled from each other. The asymptotic behavior of the perturbations in the group containing the density perturbation is discussed. (author)

Lattice regularized chiral perturbation theory

International Nuclear Information System (INIS)

Borasoy, Bugra; Lewis, Randy; Ouimet, Pierre-Philippe A.

2004-01-01

Chiral perturbation theory can be defined and regularized on a spacetime lattice. A few motivations are discussed here, and an explicit lattice Lagrangian is reviewed. A particular aspect of the connection between lattice chiral perturbation theory and lattice QCD is explored through a study of the Wess-Zumino-Witten term

Output synchronization of chaotic systems under nonvanishing perturbations

Energy Technology Data Exchange (ETDEWEB)

Lopez-Mancilla, Didier [Departamento de Ciencias Exactas y Tecnologicas, Centro Universitario de los Lagos, Universidad de Guadalajara (CULagos-UdeG), Enrique Diaz de Leon s/n, 47460 Lagos de Moreno, Jal. (Mexico)], E-mail: didier@uabc.mx; Cruz-Hernandez, Cesar [Electronics and Telecommunications Department, Scientific Research and Advanced Studies of Ensenada (CICESE), Km. 107, Carretera Tijuana-Ensenada, 22860 Ensenada, B.C. (Mexico)], E-mail: ccruz@cicese.mx

2008-08-15

In this paper, an analysis for chaos synchronization under nonvanishing perturbations is presented. In particular, we use model-matching approach from nonlinear control theory for output synchronization of identical and nonidentical chaotic systems under nonvanishing perturbations in a master-slave configuration. We show that the proposed approach is indeed suitable to synchronize a class of perturbed slaves with a chaotic master system; that is the synchronization error trajectories remain bounded if the perturbations satisfy some conditions. In order to illustrate this robustness synchronization property, we present two cases of study: (i) for identical systems, a pair of coupled Roessler systems, the first like a master and the other like a perturbed slave, and (ii) for nonidentical systems, a Chua's circuit driving a Roessler/slave system with a perturbed control law, in both cases a quantitative analysis on the perturbation is included.

Output synchronization of chaotic systems under nonvanishing perturbations

International Nuclear Information System (INIS)

Lopez-Mancilla, Didier; Cruz-Hernandez, Cesar

2008-01-01

In this paper, an analysis for chaos synchronization under nonvanishing perturbations is presented. In particular, we use model-matching approach from nonlinear control theory for output synchronization of identical and nonidentical chaotic systems under nonvanishing perturbations in a master-slave configuration. We show that the proposed approach is indeed suitable to synchronize a class of perturbed slaves with a chaotic master system; that is the synchronization error trajectories remain bounded if the perturbations satisfy some conditions. In order to illustrate this robustness synchronization property, we present two cases of study: (i) for identical systems, a pair of coupled Roessler systems, the first like a master and the other like a perturbed slave, and (ii) for nonidentical systems, a Chua's circuit driving a Roessler/slave system with a perturbed control law, in both cases a quantitative analysis on the perturbation is included

Two-body perturbation theory versus first order perturbation theory: A comparison based on the square-well fluid.

Science.gov (United States)

Mercier Franco, Luís Fernando; Castier, Marcelo; Economou, Ioannis G

2017-12-07

We show that the Zwanzig first-order perturbation theory can be obtained directly from a truncated Taylor series expansion of a two-body perturbation theory and that such truncation provides a more accurate prediction of thermodynamic properties than the full two-body perturbation theory. This unexpected result is explained by the quality of the resulting approximation for the fluid radial distribution function. We prove that the first-order and the two-body perturbation theories are based on different approximations for the fluid radial distribution function. To illustrate the calculations, the square-well fluid is adopted. We develop an analytical expression for the two-body perturbed Helmholtz free energy for the square-well fluid. The equation of state obtained using such an expression is compared to the equation of state obtained from the first-order approximation. The vapor-liquid coexistence curve and the supercritical compressibility factor of a square-well fluid are calculated using both equations of state and compared to Monte Carlo simulation data. Finally, we show that the approximation for the fluid radial distribution function given by the first-order perturbation theory provides closer values to the ones calculated via Monte Carlo simulations. This explains why such theory gives a better description of the fluid thermodynamic behavior.

Isocurvature perturbations in the Ekpyrotic Universe

International Nuclear Information System (INIS)

Notari, A.; Riotto, A.

2002-01-01

The Ekpyrotic scenario assumes that our visible Universe is a boundary brane in a five-dimensional bulk and that the hot Big Bang occurs when a nearly supersymmetric five-brane travelling along the fifth dimension collides with our visible brane. We show that the generation of isocurvature perturbations is a generic prediction of the Ekpyrotic Universe. This is due to the interactions in the kinetic terms between the brane modulus parameterizing the position of the five-brane in the bulk and the dilaton and volume moduli. We show how to separate explicitly the adiabatic and isocurvature modes by performing a rotation in field space. Our results indicate that adiabatic and isocurvature perturbations might be cross-correlated and that curvature perturbations might be entirely seeded by isocurvature perturbations

Thermodynamic and spectroscopic investigations of TMPyP4 association with guanine- and cytosine-rich DNA and RNA repeats of C9orf72.

Science.gov (United States)

Alniss, Hasan; Zamiri, Bita; Khalaj, Melisa; Pearson, Christopher E; Macgregor, Robert B

2018-01-22

An expansion of the hexanucleotide repeat (GGGGCC)n·(GGCCCC)n in the C9orf72 promoter has been shown to be the cause of Amyotrophic lateral sclerosis and frontotemporal dementia (ALS-FTD). The C9orf72 repeat can form four-stranded structures; the cationic porphyrin (TMPyP4) binds and distorts these structures. Isothermal titration calorimetry (ITC), and circular dichroism (CD) were used to study the binding of TMPyP4 to the C-rich and G-rich DNA and RNA oligos containing the hexanucleotide repeat at pH 7.5 and 0.1 M K + . The CD spectra of G-rich DNA and RNA TMPyP4 complexes showed features of antiparallel and parallel G-quadruplexes, respectively. The shoulder at 260 nm in the CD spectrum becomes more intense upon formation of complexes between TMPyP4 and the C-rich DNA. The peak at 290 nm becomes more intense in the c-rich RNA molecules, suggesting induction of an i-motif structure. The ITC data showed that TMPyP4 binds at two independent sites for all DNA and RNA molecules. For DNA, the data are consistent with TMPyP4 stacking on the terminal tetrads and intercalation. For RNA, the thermodynamics of the two binding modes are consistent with groove binding and intercalation. In both cases, intercalation is the weaker binding mode. These findings are considered with respect to the structural differences of the folded DNA and RNA molecules and the energetics of the processes that drive site-specific recognition by TMPyP4; these data will be helpful in efforts to optimize the specificity and affinity of the binding of porphyrin-like molecules. Copyright © 2018 Elsevier Inc. All rights reserved.

Continual integral in perturbation theory

International Nuclear Information System (INIS)

Slavnov, A.A.

1975-01-01

It is shown that all results obtained by means of continual integration within the framework of perturbation theory are completely equivalent to those obtained by the usual diagram technique and are therfore just as rigorous. A rigorous justification is given for the rules for operating with continual integrals in perturbation theory. (author)

Thermodynamic, Anticoagulant, and Antiproliferative Properties of Thrombin Binding Aptamer Containing Novel UNA Derivative

DEFF Research Database (Denmark)

Kotkowiak, Weronika; Lisowiec-Wachnicka, Jolanta; Grynda, Jakub

2018-01-01

Thrombin is a serine protease that plays a crucial role in hemostasis, fibrinolysis, cell proliferation, and migration. Thrombin binding aptamer (TBA) is able to inhibit the activity of thrombin molecule via binding to its exosite I. This 15-nt DNA oligonucleotide forms an intramolecular, antipar......Thrombin is a serine protease that plays a crucial role in hemostasis, fibrinolysis, cell proliferation, and migration. Thrombin binding aptamer (TBA) is able to inhibit the activity of thrombin molecule via binding to its exosite I. This 15-nt DNA oligonucleotide forms an intramolecular......, antiparallel G-quadruplex structure with a chair-like conformation. In this paper, we report on our investigations on the influence of certain modified nucleotide residues on thermodynamic stability, folding topology, and biological properties of TBA variants. In particular, the effect of single incorporation......-quadruplex thermodynamic and biological stability, and that the effect is strongly position dependent. Interestingly, TBA variants containing the modified nucleotide residues are characterized by unchanged folding topology. Thrombin time assay revealed that incorporation of certain UNA residues may improve G...

Kato expansion in quantum canonical perturbation theory

International Nuclear Information System (INIS)

Nikolaev, Andrey

2016-01-01

This work establishes a connection between canonical perturbation series in quantum mechanics and a Kato expansion for the resolvent of the Liouville superoperator. Our approach leads to an explicit expression for a generator of a block-diagonalizing Dyson’s ordered exponential in arbitrary perturbation order. Unitary intertwining of perturbed and unperturbed averaging superprojectors allows for a description of ambiguities in the generator and block-diagonalized Hamiltonian. We compare the efficiency of the corresponding computational algorithm with the efficiencies of the Van Vleck and Magnus methods for high perturbative orders.

Kato expansion in quantum canonical perturbation theory

Energy Technology Data Exchange (ETDEWEB)

Nikolaev, Andrey, E-mail: Andrey.Nikolaev@rdtex.ru [Institute of Computing for Physics and Technology, Protvino, Moscow Region, Russia and RDTeX LTD, Moscow (Russian Federation)

2016-06-15

This work establishes a connection between canonical perturbation series in quantum mechanics and a Kato expansion for the resolvent of the Liouville superoperator. Our approach leads to an explicit expression for a generator of a block-diagonalizing Dyson’s ordered exponential in arbitrary perturbation order. Unitary intertwining of perturbed and unperturbed averaging superprojectors allows for a description of ambiguities in the generator and block-diagonalized Hamiltonian. We compare the efficiency of the corresponding computational algorithm with the efficiencies of the Van Vleck and Magnus methods for high perturbative orders.

Invariant exchange perturbation theory for multicenter systems: Time-dependent perturbations

International Nuclear Information System (INIS)

Orlenko, E. V.; Evstafev, A. V.; Orlenko, F. E.

2015-01-01

A formalism of exchange perturbation theory (EPT) is developed for the case of interactions that explicitly depend on time. Corrections to the wave function obtained in any order of perturbation theory and represented in an invariant form include exchange contributions due to intercenter electron permutations in complex multicenter systems. For collisions of atomic systems with an arbitrary type of interaction, general expressions are obtained for the transfer (T) and scattering (S) matrices in which intercenter electron permutations between overlapping nonorthogonal states belonging to different centers (atoms) are consistently taken into account. The problem of collision of alpha particles with lithium atoms accompanied by the redistribution of electrons between centers is considered. The differential and total charge-exchange cross sections of lithium are calculated

Strings as perturbations of evolving spin networks

International Nuclear Information System (INIS)

Smolin, Lee

2000-01-01

One step in the construction of a background independent formulation of string theory is detailed, in which it is shown how perturbative strings may arise as small fluctuations around histories in a formulation of non-perturbative dynamics of spin networks due to Markopoulou. In this formulation the dynamics of spin network states and their generalizations is described in terms of histories which have discrete analogues of the causal structure and many fingered time of Lorentzian spacetimes. Perturbations of these histories turn out to be described in terms of spin systems defined on 2-dimensional timelike surfaces embedded in the discrete spacetime. When the history has a classical limit which is Minkowski spacetime, the action of the perturbation theory is given to leading order by the spacetime area of the surface, as in bosonic string theory. This map between a non-perturbative formulation of quantum gravity and a 1+1 dimensional theory generalizes to a large class of theories in which the group SU(2) i s extended to any quantum group or supergroup. It is argued that a necessary condition for the non-perturbative theory to have a good classical limit is that the resulting 1+1 dimensional theory defines a consistent and stable perturbative string theory

Acoustic anisotropic wavefields through perturbation theory

KAUST Repository

Alkhalifah, Tariq Ali

2013-09-01

Solving the anisotropic acoustic wave equation numerically using finite-difference methods introduces many problems and media restriction requirements, and it rarely contributes to the ability to resolve the anisotropy parameters. Among these restrictions are the inability to handle media with η<0 and the presence of shear-wave artifacts in the solution. Both limitations do not exist in the solution of the elliptical anisotropic acoustic wave equation. Using perturbation theory in developing the solution of the anisotropic acoustic wave equation allows direct access to the desired limitation-free solutions, that is, solutions perturbed from the elliptical anisotropic background medium. It also provides a platform for parameter estimation because of the ability to isolate the wavefield dependency on the perturbed anisotropy parameters. As a result, I derive partial differential equations that relate changes in the wavefield to perturbations in the anisotropy parameters. The solutions of the perturbation equations represented the coefficients of a Taylor-series-type expansion of the wavefield as a function of the perturbed parameter, which is in this case η or the tilt of the symmetry axis. The expansion with respect to the symmetry axis allows use of an acoustic transversely isotropic media with a vertical symmetry axis (VTI) kernel to estimate the background wavefield and the corresponding perturbation coefficients. The VTI extrapolation kernel is about one-fourth the cost of the transversely isotropic model with a tilt in the symmetry axis kernel. Thus, for a small symmetry axis tilt, the cost of migration using a first-order expansion can be reduced. The effectiveness of the approach was demonstrated on the Marmousi model.

Perturbations of higher-dimensional spacetimes

Energy Technology Data Exchange (ETDEWEB)

Durkee, Mark; Reall, Harvey S, E-mail: M.N.Durkee@damtp.cam.ac.uk, E-mail: H.S.Reall@damtp.cam.ac.uk [DAMTP, Centre for Mathematical Sciences, University of Cambridge, Wilberforce Road, Cambridge, CB3 0WA (United Kingdom)

2011-02-07

We discuss linearized gravitational perturbations of higher-dimensional spacetimes. For algebraically special spacetimes (e.g. Myers-Perry black holes), we show that there exist local gauge invariant quantities linear in the metric perturbation. These are the higher-dimensional generalizations of the 4D Newman-Penrose scalars that (in an algebraically special vacuum spacetime) satisfy decoupled equations of motion. We show that decoupling occurs in more than four dimensions if, and only if, the spacetime admits a null geodesic congruence with vanishing expansion, rotation and shear. Decoupling of electromagnetic perturbations occurs under the same conditions. Although these conditions are not satisfied in black hole spacetimes, they are satisfied in the near-horizon geometry of an extreme black hole.

Application of linear and higher perturbation theory in reactor physics

International Nuclear Information System (INIS)

Woerner, D.

1978-01-01

For small perturbations in the material composition of a reactor according to the first approximation of perturbation theory the eigenvalue perturbation is proportional to the perturbation of the system. This assumption is true for the neutron flux not influenced by the perturbance. The two-dimensional code LINESTO developed for such problems in this paper on the basis of diffusion theory determines the relative change of the multiplication constant. For perturbations varying the neutron flux in the space of energy and position the eigenvalue perturbation is also influenced by this changed neutron flux. In such cases linear perturbation theory yields larger errors. Starting from the methods of calculus of variations there is additionally developed in this paper a perturbation method of calculation permitting in a quick and simple manner to assess the influence of flux perturbation on the eigenvalue perturbation. While the source of perturbations is evaluated in isotropic approximation of diffusion theory the associated inhomogeneous equation may be used to determine the flux perturbation by means of diffusion or transport theory. Possibilities of application and limitations of this method are studied in further systematic investigations on local perturbations. It is shown that with the integrated code system developed in this paper a number of local perturbations may be checked requiring little computing time. With it flux perturbations in first approximation and perturbations of the multiplication constant in second approximation can be evaluated. (orig./RW) [de

't Hooft loops and perturbation theory

CERN Document Server

De Forcrand, Philippe; Noth, D; Forcrand, Philippe de; Lucini, Biagio; Noth, David

2005-01-01

We show that high-temperature perturbation theory describes extremely well the area law of SU(N) spatial 't Hooft loops, or equivalently the tension of the interface between different Z_N vacua in the deconfined phase. For SU(2), the disagreement between Monte Carlo data and lattice perturbation theory for sigma(T)/T^2 is less than 2%, down to temperatures O(10) T_c. For SU(N), N>3, the ratios of interface tensions, (sigma_k/sigma_1)(T), agree with perturbation theory, which predicts tiny deviations from the ratio of Casimirs, down to nearly T_c. In contrast, individual tensions differ markedly from the perturbative expression. In all cases, the required precision Monte Carlo measurements are made possible by a simple but powerful modification of the 'snake' algorithm.

Propagation of Ion Acoustic Perturbations

DEFF Research Database (Denmark)

Pécseli, Hans

1975-01-01

Equations describing the propagation of ion acoustic perturbations are considered, using the assumption that the electrons are Boltzman distributed and isothermal at all times. Quasi-neutrality is also considered.......Equations describing the propagation of ion acoustic perturbations are considered, using the assumption that the electrons are Boltzman distributed and isothermal at all times. Quasi-neutrality is also considered....

Aphidicolin synchronization of mouse L cells perturbs the relationship between cell killing and DNA double-strand breakage after X-irradiation

International Nuclear Information System (INIS)

Radford, I.R.; Broadhurst, S.

1988-01-01

The relationship between X-ray-induced cell killing and DNA double-strand breakage was examined for synchronized mouse L cells that had entered S-phase, G2-phase, mitosis, and G1-phase following release from aphidicolin and compared to asynchronous culture response. Aphidicolin-synchronized cells showed cycle phase-dependent changes in dose-responses for both killing and DNA dsb. However, on the basis of DNA dsb per unit length of DNA required to produce a lethal lesion, aphidicolin-synchronized cells were more sensitive to X-rays than asynchronous cultures. This sensitivity peaked 2 h after release from aphidicolin treatment, and then progressively declined towards the asynchronous culture value. It is argued that results are due to deregulation of the temporal order of DNA replication following aphidicolin treatment, and can be incorporated into the critical DNA target size model by postulating that the targets for radiation action in mammalian cells are DNA-associated with potentially transcriptionally active proto-oncogenes or constitutive fragile sites. (author)

Perturbation of host-cell membrane is a primary mechanism of HIV cytopathology.

Science.gov (United States)

Cloyd, M W; Lynn, W S

1991-04-01

Cytopathic viruses injure cells by a number of different mechanisms. The mechanism by which HIV-1 injures T cells was studied by temporally examining host-cell macromolecular syntheses, stages of the cell cycle, and membrane permeability following acute infection. T cells cytopathically infected at an m.o.i. of 1-5 grew normally for 24-72 hr, depending on the cell line, followed by the first manifestation of cell injury, slowing of cell division. At that time significant amounts of unintegrated HIV DNA and p24 core protein became detectable, and acridine orange flow cytometric cell cycle studies demonstrated the presence of fewer cells in the G2/M stage of the cell cycle. There was no change in the frequency of cells in the S-stage, and metabolic pulsing with radioactive precursors demonstrated that host-cell DNA, RNA, and protein syntheses were normal at that time and normal up to the time cells started to die (approximately 24 hr later), when all three decreased. Cellular lipid synthesis, however, was perturbed when cell multiplication slowed, with phospholipid synthesis reduced and neutral lipid synthesis enhanced. Permeability of the host-cell membrane to small molecules, such as Ca2+ and sucrose, was slightly enhanced early postinfection, and by the time of slowing of cell division, host membrane permeability was greatly increased to both Ca2+ and sucrose (Stokes radius 5.2 A) but not to inulin (Stokes radium 20 A). These changes in host-cell membrane permeability and phospholipid synthesis were not observed in acutely infected H9 cells, which are not susceptible to HIV cytopathology. Thus, HIV-1 appeared to predominantly injure T cells by perturbing host-cell membrane permeability and lipid synthesis, which is similar to the cytopathic mechanisms of paramyxoviruses.

EDITORIAL: Non-linear and non-Gaussian cosmological perturbations Non-linear and non-Gaussian cosmological perturbations

Science.gov (United States)

Sasaki, Misao; Wands, David

2010-06-01

In recent years there has been a resurgence of interest in the study of non-linear perturbations of cosmological models. This has been the result of both theoretical developments and observational advances. New theoretical challenges arise at second and higher order due to mode coupling and the need to develop new gauge-invariant variables beyond first order. In particular, non-linear interactions lead to deviations from a Gaussian distribution of primordial perturbations even if initial vacuum fluctuations are exactly Gaussian. These non-Gaussianities provide an important probe of models for the origin of structure in the very early universe. We now have a detailed picture of the primordial distribution of matter from surveys of the cosmic microwave background, notably NASA's WMAP satellite. The situation will continue to improve with future data from the ESA Planck satellite launched in 2009. To fully exploit these data cosmologists need to extend non-linear cosmological perturbation theory beyond the linear theory that has previously been sufficient on cosmological scales. Another recent development has been the realization that large-scale structure, revealed in high-redshift galaxy surveys, could also be sensitive to non-linearities in the primordial curvature perturbation. This focus section brings together a collection of invited papers which explore several topical issues in this subject. We hope it will be of interest to theoretical physicists and astrophysicists alike interested in understanding and interpreting recent developments in cosmological perturbation theory and models of the early universe. Of course it is only an incomplete snapshot of a rapidly developing field and we hope the reader will be inspired to read further work on the subject and, perhaps, fill in some of the missing pieces. This focus section is dedicated to the memory of Lev Kofman (1957-2009), an enthusiastic pioneer of inflationary cosmology and non-Gaussian perturbations.

Perturbation methods for power and reactivity reconstruction

International Nuclear Information System (INIS)

Palmiotti, G.; Salvatores, M.; Estiot, J.C.; Broccoli, U.; Bruna, G.; Gomit, J.M.

1987-01-01

This paper deals with recent developments and applications in perturbation methods. Two types of methods are used. The first one is an explicit method, which allows the explicit reconstruction of a perturbed flux using a linear combination of a library of functions. In our application, these functions are the harmonics (i.e. the high order eigenfunctions of the system). The second type is based on the Generalized Perturbation Theory GPT and needs the calculation of an importance function for each integral parameter of interest. Recent developments of a particularly useful high order formulation allows to obtain satisfactory results also for very large perturbations

On adiabatic perturbations in the ekpyrotic scenario

International Nuclear Information System (INIS)