Two-wire Interface for Digital Microphones

NARCIS (Netherlands)

Groothedde, Wouter; Klumperink, Eric A.M.; Nauta, Bram; Eschauzier, Rudolphe Gustave Hubertus; van Rijn, Nico

2003-01-01

A two-wire interface for a digital microphone circuit includes a power line and a ground line. The interface utilizes the ground line as a "voltage active line" to transmit both clock and data signals between the digital microphone circuit and a receiving circuit. The digital microphone circuit

Two-Wire interface for digital microphones

NARCIS (Netherlands)

Groothedde, Wouter; Klumperink, Eric A.M.; Nauta, Bram; Eschauzier, Rudolphe Gustave Hubertus; van Rijn, Nico

2005-01-01

A two-wire interface for a digital microphone circuit includes a power line and a ground line. The interface utilizes the ground line as a "voltage active line" to transmit both clock and data signals between the digital microphone circuit and a receiving circuit. The digital microphone circuit

External wire-frame fixation of digital skin grafts: a non-invasive alternative to the K-wire insertion method.

Science.gov (United States)

Huang, Chenyu; Ogawa, Rei; Hyakusoku, Hiko

2014-08-01

The current skin graft fixation methods for digits, including the Kirschner wire insertion technique, can be limited by inadequate or excessive fixation and complications such as infection or secondary injuries. Therefore, the external wire-frame fixation method was invented and used for skin grafting of digits. This study aimed to investigate external wire-frame fixation of digital skin grafts as a non-invasive alternative to the K-wire insertion method. In 2005-2012, 15 patients with burn scar contractures on the hand digits received a skin graft that was then fixed with an external wire frame. The intra-operative time needed to make the wire frame, the postoperative time to frame and suture removal, the graft survival rate, the effect of contracture release and the complications were recorded. In all cases, the contracture release was 100%. The complete graft survival rate was 98.6%. Four patients had epithelial necrosis in wire-frame fixation is simple, minimally invasive and a custom-made technique for skin grafting of the fingers. It was designed for its potential benefits and the decreased risk it poses to patients with scar contractures on their fingers. It can be implemented in three phases of grafting, does not affect the epiphyseal line or subsequent finger growth and is suitable for children with multi-digit involvement. Copyright © 2013 Elsevier Ltd and ISBI. All rights reserved.

Dual Recognition of Human Telomeric G-quadruplex by Neomycin-anthraquinone Conjugate

Science.gov (United States)

Ranjan, Nihar; Davis, Erik; Xue, Liang

2013-01-01

The authors report the recognition of a G-quadruplex formed by four repeat human telomeric DNA with aminosugar intercalator conjugates. The recognition of G-quadruplex through dual binding mode ligands significantly increased the affinity of ligands for G-quadruplex. One such example is a neomycin-anthraquinone 2 which exhibited nanomolar affinity for the quadruplex, and the affinity of 2 is nearly 1000 fold higher for human telomeric G-quadruplex DNA than its constituent units, neomycin and anthraquinone. PMID:23698792

Simultaneous G-Quadruplex DNA Logic.

Science.gov (United States)

Bader, Antoine; Cockroft, Scott L

2018-04-03

A fundamental principle of digital computer operation is Boolean logic, where inputs and outputs are described by binary integer voltages. Similarly, inputs and outputs may be processed on the molecular level as exemplified by synthetic circuits that exploit the programmability of DNA base-pairing. Unlike modern computers, which execute large numbers of logic gates in parallel, most implementations of molecular logic have been limited to single computing tasks, or sensing applications. This work reports three G-quadruplex-based logic gates that operate simultaneously in a single reaction vessel. The gates respond to unique Boolean DNA inputs by undergoing topological conversion from duplex to G-quadruplex states that were resolved using a thioflavin T dye and gel electrophoresis. The modular, addressable, and label-free approach could be incorporated into DNA-based sensors, or used for resolving and debugging parallel processes in DNA computing applications. © 2018 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

Flying wire beam profile monitor at the J-PARC MR

International Nuclear Information System (INIS)

Igarashi, Susumu; Arakawa, Dai; Hashimoto, Yoshinori; Teshima, Masaki; Toyama, Takeshi; Hanamura, Kotoku

2008-01-01

A flying wire beam profile monitor has been assembled and installed at the main ring of the Japan Proton Accelerator Research Complex. The monitor is to measure the horizontal beam profile using a carbon fiber of 7 μmφ. The fiber crosses the beam with the speed of 10 m/s. Secondary particles from the beam-wire scattering is detected using a scintillation counter. The scintillator signal as a function of the wire position is to be reconstructed as a beam profile. The high scanning speed and the minimum material are necessary for the accurate beam profile measurement. The monitor has been operated in the beam commissioning run of the main ring. The beam profile data have been successfully acquired after the reduction of the beam background. (author)

Stability region of closed-loop pilot-vehicle system for fly-by-wire aircraft with limited actuator rate

OpenAIRE

Ying-hui, Li; Liang, Qu; Hao-jun, Xu; Qi-meng, Cao

2017-01-01

The category-II PIO (Pilot Induced Oscillations) caused by actuator rate limitation of fly-by-wire airplanes will badly threaten the flight safety. The stability regions of closed-loop pilot-vehicle (CLPV) system with rate limited actuator were studied in this paper to assess stability of such CLPV system. The augmented state  variables were introduced to segregate the rate limited element from the primary  system in order to build the saturation nonlinear model of CLPV system. To get the max...

Amyloid Precursor Protein Translation Is Regulated by a 3'UTR Guanine Quadruplex.

Directory of Open Access Journals (Sweden)

Ezekiel Crenshaw

Full Text Available A central event in Alzheimer's disease is the accumulation of amyloid β (Aβ peptides generated by the proteolytic cleavage of the amyloid precursor protein (APP. APP overexpression leads to increased Aβ generation and Alzheimer's disease in humans and altered neuronal migration and increased long term depression in mice. Conversely, reduction of APP expression results in decreased Aβ levels in mice as well as impaired learning and memory and decreased numbers of dendritic spines. Together these findings indicate that therapeutic interventions that aim to restore APP and Aβ levels must do so within an ideal range. To better understand the effects of modulating APP levels, we explored the mechanisms regulating APP expression focusing on post-transcriptional regulation. Such regulation can be mediated by RNA regulatory elements such as guanine quadruplexes (G-quadruplexes, non-canonical structured RNA motifs that affect RNA stability and translation. Via a bioinformatics approach, we identified a candidate G-quadruplex within the APP mRNA in its 3'UTR (untranslated region at residues 3008-3027 (NM_201414.2. This sequence exhibited characteristics of a parallel G-quadruplex structure as revealed by circular dichroism spectrophotometry. Further, as with other G-quadruplexes, the formation of this structure was dependent on the presence of potassium ions. This G-quadruplex has no apparent role in regulating transcription or mRNA stability as wild type and mutant constructs exhibited equivalent mRNA levels as determined by real time PCR. Instead, we demonstrate that this G-quadruplex negatively regulates APP protein expression using dual luciferase reporter and Western blot analysis. Taken together, our studies reveal post-transcriptional regulation by a 3'UTR G-quadruplex as a novel mechanism regulating APP expression.

Designing a New Class of Bases for Nucleic Acid Quadruplexes and Quadruplex-Active Ligands.

Science.gov (United States)

Bazzi, Sophia; Novotný, Jan; Yurenko, Yevgen P; Marek, Radek

2015-06-22

A new class of quadruplex nucleobases, derived from 3-deazaguanine, has been designed for various applications as smart quadruplex ligands as well as quadruplex-based aptamers, receptors, and sensors. An efficient strategy for modifying the guanine quadruplex core has been developed and tested by using quantum chemistry methods. Several potential guanine derivatives modified at the 3- or 8-position or both are analyzed, and the results compared to reference systems containing natural guanine. Analysis of the formation energies (BLYP-D3(BJ)/def2-TZVPP level of theory, in combination with the COSMO model for water) in model systems consisting of two and three stacked tetrads with Na(+) /K(+) ion(s) inside the internal channel indicates that the formation of structures with 3-halo-3-deazaguanine bases leads to a substantial gain in energy, as compared to the corresponding reference guanine complexes. The results cast light on changes in the noncovalent interactions (hydrogen bonding, stacking, and ion coordination) in a quadruplex stem upon modification of the guanine core. In particular, the enhanced stability of the modified quadruplexes was shown to originate mainly from increased π-π stacking. Our study suggests the 3-halo-3-deazaguanine skeleton as a potential building unit for quadruplex systems and smart G-quadruplex ligands. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Thermal stability of DNA quadruplex-duplex hybrids.

Science.gov (United States)

Lim, Kah Wai; Khong, Zi Jian; Phan, Anh Tuân

2014-01-14

DNA has the capacity to adopt several distinct structural forms, such as duplex and quadruplex helices, which have been implicated in cellular processes and shown to exhibit important functional properties. Quadruplex-duplex hybrids, generated from the juxtaposition of these two structural elements, could find applications in therapeutics and nanotechnology. Here we used NMR and CD spectroscopy to investigate the thermal stability of two classes of quadruplex-duplex hybrids comprising fundamentally distinct modes of duplex and quadruplex connectivity: Construct I involves the coaxial orientation of the duplex and quadruplex helices with continual base stacking across the two components; Construct II involves the orthogonal orientation of the duplex and quadruplex helices with no base stacking between the two components. We have found that for both constructs, the stability of the quadruplex generally increases with the length of the stem-loop incorporated, with respect to quadruplexes comprising nonstructured loops of the same length, which showed a continuous drop in stability with increasing loop length. The stability of these complexes, particularly Construct I, can be substantially influenced by the base-pair steps proximal to the quadruplex-duplex junction. Bulges at the junction are largely detrimental to the adoption of the desired G-quadruplex topology for Construct I but not for Construct II. These findings should facilitate future design and prediction of quadruplex-duplex hybrids.

Status and test report on the LANL-Boeing APLE/HPO flying-wire beam-profile monitor. Status report

Energy Technology Data Exchange (ETDEWEB)

Wilke, M.; Barlow, D.; Fortgang, C.; Gilpatrick, J.; Meyer, R.; Rendon, A.; Warren, D. [Los Alamos National Lab., NM (United States); Greegor, R. [Boeing Co., Seattle, WA (United States)

1994-07-01

The High-Power Oscillator (HPO) demonstration of the Average Power Laser Experiment (APLE) is a collaboration by Los Alamos National Laboratory and Boeing to demonstrate a 10 kW average power, 10 {mu}m free electron laser (FEL). As part of the collaboration, Los Alamos National Laboratory (LANL) is responsible for many of the electron beam diagnostics in the linac, transport, and laser sections. Because of the high duty factor and power of the electron beam, special diagnostics are required. This report describes the flying wire diagnostic required to monitor the beam profile during high-power, high-duty operation. The authors describe the diagnostic and prototype tests on the Los Alamos APLE Prototype Experiment (APEX) FEL. They also describe the current status of the flying wires being built for APLE.

G-Quadruplex conformational change driven by pH variation with potential application as a nanoswitch.

Science.gov (United States)

Yan, Yi-Yong; Tan, Jia-Heng; Lu, Yu-Jing; Yan, Siu-Cheong; Wong, Kwok-Yin; Li, Ding; Gu, Lian-Quan; Huang, Zhi-Shu

2013-10-01

G-Quadruplex is a highly polymorphic structure, and its behavior in acidic condition has not been well studied. Circular dichroism (CD) spectra were used to study the conformational change of G-quadruplex. The thermal stabilities of the G-quadruplex were measured with CD melting. Interconversion kinetics profiles were investigated by using CD kinetics. The fluorescence of the inserted 2-Aminopurine (Ap) was monitored during pH change and acrylamide quenching, indicating the status of the loop. Proton NMR was adopted to help illustrate the change of the conformation. G-Quadruplex of specific loop was found to be able to transform upon pH variation. The transformation was resulted from the loop rearrangement. After screening of a library of diverse G-quadruplex, a sequence exhibiting the best transformation property was found. A pH-driven nanoswitch with three gears was obtained based on this transition cycle. Certain G-quadruplex was found to go through conformational change at low pH. Loop was the decisive factor controlling the interconversion upon pH variation. G-Quadruplex with TT central loop could be converted in a much milder condition than the one with TTA loop. It can be used to design pH-driven nanodevices such as a nanoswitch. These results provide more insights into G-quadruplex polymorphism, and also contribute to the design of DNA-based nanomachines and logic gates. © 2013.

Measurement of residual stress by using focused ion beam and digital image correlation method in thin-sized wires used for steel cords

International Nuclear Information System (INIS)

Yang, Y S; Park, C G; Bae, J G

2008-01-01

Residual stress in the axial direction of the steel wires has been measured by using a method based on the combination of the focused ion beam (FIB) milling and digital image correlation software. That is, the residual stress was calculated from the measured displacement field before and after the introduction of a slot along the steel wires. The displacement was obtained by the digital correlation analysis of high-resolution scanning electron micrographs, while the slot was introduced by FIB milling with low energy beam. The fitting of the experimental results to an analytical model with the independent Young's modulus determined allows us to find the residual stress. The complete experimental procedures are described and its feasibilities are also evaluated for the thin-sized steel wires

Transcriptional control by G-quadruplexes: In vivo roles and perspectives for specific intervention.

Science.gov (United States)

Armas, Pablo; David, Aldana; Calcaterra, Nora B

2017-01-01

G-quadruplexes are non-canonical DNA secondary structures involved in several genomic and molecular processes. Here, we summarize the main G-quadruplex features and evidences proving the in vivo role on the transcriptional regulation of genes required for zebrafish embryonic development. We also discuss alternative strategies for specifically interfering G-quadruplex in vivo.

To develop a flying fish egg inspection system by a digital imaging base system

Science.gov (United States)

Chen, Chun-Jen; Jywe, Wenyuh; Hsieh, Tung-Hsien; Chen, Chien Hung

2015-07-01

This paper develops an automatic optical inspection system for flying fish egg quality inspection. The automatic optical inspection system consists of a 2-axes stage, a digital camera, a lens, a LED light source, a vacuum generator, a tube and a tray. This system can automatically find the particle on the flying egg tray and used stage to driver the tube onto the particle. Then use straw and vacuum generator to pick up the particle. The system pick rate is about 30 particles per minute.

Seven essential questions on G-quadruplexes.

Science.gov (United States)

König, Sebastian L B; Evans, Amanda C; Huppert, Julian L

2010-08-01

The helical duplex architecture of DNA was discovered by Francis Crick and James Watson in 1951 and is well known and understood. However, nucleic acids can also adopt alternative structural conformations that are less familiar, although no less biologically relevant, such as the G-quadruplex. G-quadruplexes continue to be the subject of a rapidly expanding area of research, owing to their significant potential as therapeutic targets and their unique biophysical properties. This review begins by focusing on G-quadruplex structure, elucidating the intermolecular and intramolecular interactions underlying its formation and highlighting several substructural variants. A variety of methods used to characterize these structures are also outlined. The current state of G-quadruplex research is then addressed by proffering seven pertinent questions for discussion. This review concludes with an overview of possible directions for future research trajectories in this exciting and relevant field.

Selectivity in ligand recognition of G-quadruplex loops.

Science.gov (United States)

Campbell, Nancy H; Patel, Manisha; Tofa, Amina B; Ghosh, Ragina; Parkinson, Gary N; Neidle, Stephen

2009-03-03

A series of disubstituted acridine ligands have been cocrystallized with a bimolecular DNA G-quadruplex. The ligands have a range of cyclic amino end groups of varying size. The crystal structures show that the diagonal loop in this quadruplex results in a large cavity for these groups, in contrast to the steric constraints imposed by propeller loops in human telomeric quadruplexes. We conclude that the nature of the loop has a significant influence on ligand selectivity for particular quadruplex folds.

Effect of ATRX and G-Quadruplex Formation by the VNTR Sequence on α-Globin Gene Expression.

Science.gov (United States)

Li, Yue; Syed, Junetha; Suzuki, Yuki; Asamitsu, Sefan; Shioda, Norifumi; Wada, Takahito; Sugiyama, Hiroshi

2016-05-17

ATR-X (α-thalassemia/mental retardation X-linked) syndrome is caused by mutations in chromatin remodeler ATRX. ATRX can bind the variable number of tandem repeats (VNTR) sequence in the promoter region of the α-globin gene cluster. The VNTR sequence, which contains the potential G-quadruplex-forming sequence CGC(GGGGCGGGG)n , is involved in the downregulation of α-globin expression. We investigated G-quadruplex and i-motif formation in single-stranded DNA and long double-stranded DNA. The promoter region without the VNTR sequence showed approximately twofold higher luciferase activity than the promoter region harboring the VNTR sequence. G-quadruplex stabilizers hemin and TMPyP4 reduced the luciferase activity, whereas expression of ATRX led to a recovery in reporter activity. Our results demonstrate that stable G-quadruplex formation by the VNTR sequence downregulates the expression of α-globin genes and that ATRX might bind to and resolve the G-quadruplex. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Effect of Urea on G-Quadruplex Stability.

Science.gov (United States)

Aslanyan, Lusine; Ko, Jordan; Kim, Byul G; Vardanyan, Ishkhan; Dalyan, Yeva B; Chalikian, Tigran V

2017-07-13

G-quadruplexes represent a class of noncanonical nucleic acid structures implicated in transcriptional regulation, cellular function, and disease. An understanding of the forces involved in stabilization and destabilization of the G-quadruplex conformation relative to the duplex or single-stranded conformation is a key to elucidating the biological role of G-quadruplex-based genomic switches and the quest for therapeutic means for controlled induction or suppression of a G-quadruplex at selected genomic loci. Solute-solvent interactions provide a ubiquitous and, in many cases, the determining thermodynamic force in maintaining and modulating the stability of nucleic acids. These interactions involve water as well as water-soluble cosolvents that may be present in the solution or in the crowded environment in the cell. We present here the first quantitative investigation of the effect of urea, a destabilizing cosolvent, on the conformational preferences of a G-quadruplex formed by the telomeric d[A(G 3 T 2 A) 3 G 3 ] sequence (Tel22). At 20 mM NaCl and room temperature, Tel22 undergoes a two-state urea-induced unfolding transition. An increase in salt mitigates the deleterious effect of urea on Tel22. The urea m-value of Tel22 normalized per change in solvent-accessible surface area, ΔS A , is similar to those for other DNA and RNA structures while being several-fold larger than that of proteins. Our results suggest that urea can be employed as an analytical tool in thermodynamic characterizations of G-quadruplexes in a manner similar to the use of urea in protein studies. We emphasize the need for further studies involving a larger selection of G-quadruplexes varying in sequence, topology (parallel, antiparallel, hybrid), and molecularity (monomolecular, bimolecular, tetramolecular) to outline the advantages and the limits of the use of urea in G-quadruplex studies. A deeper understanding of the effect of solvent and cosolvents on the differential stability of the

Hsa-miR-1587 G-quadruplex formation and dimerization induced by NH4+, molecular crowding environment and jatrorrhizine derivatives.

Science.gov (United States)

Tan, Wei; Yi, Long; Zhu, Zhentao; Zhang, Lulu; Zhou, Jiang; Yuan, Gu

2018-03-01

A guanine-rich human mature microRNA, miR-1587, was discovered to form stable intramolecular G-quadruplexes in the presence of K + , Na + and low concentration of NH 4 + (25mM) by electrospray ionization mass spectrometry (ESI-MS) combined with circular dichroism (CD) spectroscopy. Furthermore, under high concentration of NH 4 + (100mM) or molecular crowding environments, miR-1587 formed a dimeric G-quadruplex through 3'-to-3' stacking of two monomeric G-quadruplex subunits with one ammonium ion sandwiched between the interfaces. Specifically, two synthesized jatrorrhizine derivatives with terminal amine groups could also induce the dimerization of miR-1587 G-quadruplex and formed 1:1 and 2:1 complexes with the dimeric G-quadruplex. In contrast, jatrorrhizine could bind with the dimeric miR-1587 G-quadruplex, but could not induce dimerization of miR-1587 G-quadruplex. These results provide a new strategy to regulate the functions of miR-1587 through induction of G-quadruplex formation and dimerization. Copyright © 2017 Elsevier B.V. All rights reserved.

Inverting the G-Tetrad Polarity of a G-Quadruplex by Using Xanthine and 8-Oxoguanine.

Science.gov (United States)

Cheong, Vee Vee; Lech, Christopher Jacques; Heddi, Brahim; Phan, Anh Tuân

2016-01-04

G-quadruplexes are four-stranded nucleic acid structures that are built from consecutively stacked guanine tetrad (G-tetrad) assemblies. The simultaneous incorporation of two guanine base lesions, xanthine (X) and 8-oxoguanine (O), within a single G-tetrad of a G-quadruplex was recently shown to lead to the formation of a stable G⋅G⋅X⋅O tetrad. Herein, a judicious introduction of X and O into a human telomeric G-quadruplex-forming sequence is shown to reverse the hydrogen-bond polarity of the modified G-tetrad while preserving the original folding topology. The control exerted over G-tetrad polarity by joint X⋅O modification will be valuable for the design and programming of G-quadruplex structures and their properties. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Guanine base stacking in G-quadruplex nucleic acids

Science.gov (United States)

Lech, Christopher Jacques; Heddi, Brahim; Phan, Anh Tuân

2013-01-01

G-quadruplexes constitute a class of nucleic acid structures defined by stacked guanine tetrads (or G-tetrads) with guanine bases from neighboring tetrads stacking with one another within the G-tetrad core. Individual G-quadruplexes can also stack with one another at their G-tetrad interface leading to higher-order structures as observed in telomeric repeat-containing DNA and RNA. In this study, we investigate how guanine base stacking influences the stability of G-quadruplexes and their stacked higher-order structures. A structural survey of the Protein Data Bank is conducted to characterize experimentally observed guanine base stacking geometries within the core of G-quadruplexes and at the interface between stacked G-quadruplex structures. We couple this survey with a systematic computational examination of stacked G-tetrad energy landscapes using quantum mechanical computations. Energy calculations of stacked G-tetrads reveal large energy differences of up to 12 kcal/mol between experimentally observed geometries at the interface of stacked G-quadruplexes. Energy landscapes are also computed using an AMBER molecular mechanics description of stacking energy and are shown to agree quite well with quantum mechanical calculated landscapes. Molecular dynamics simulations provide a structural explanation for the experimentally observed preference of parallel G-quadruplexes to stack in a 5′–5′ manner based on different accessible tetrad stacking modes at the stacking interfaces of 5′–5′ and 3′–3′ stacked G-quadruplexes. PMID:23268444

Aminoglycosylation can enhance the G-quadruplex binding activity of epigallocatechin.

Directory of Open Access Journals (Sweden)

Li-Ping Bai

Full Text Available With the aim of enhancing G-quadruplex binding activity, two new glucosaminosides (16, 18 of penta-methylated epigallocatechin were synthesized by chemical glycosylation. Subsequent ESI-TOF-MS analysis demonstrated that these two glucosaminoside derivatives exhibit much stronger binding activity to human telomeric DNA and RNA G-quadruplexes than their parent structure (i.e., methylated EGC (14 as well as natural epigallocatechin (EGC, 6. The DNA G-quadruplex binding activity of 16 and 18 is even more potent than strong G-quadruplex binder quercetin, which has a more planar structure. These two synthetic compounds also showed a higher binding strength to human telomeric RNA G-quadruplex than its DNA counterpart. Analysis of the structure-activity relationship revealed that the more basic compound, 16, has a higher binding capacity with DNA and RNA G-quadruplexes than its N-acetyl derivative, 18, suggesting the importance of the basicity of the aminoglycoside for G-quadruplex binding activity. Molecular docking simulation predicted that the aromatic ring of 16 π-stacks with the aromatic ring of guanine nucleotides, with the glucosamine moiety residing in the groove of G-quadruplex. This research indicates that glycosylation of natural products with aminosugar can significantly enhance their G-quadruplex binding activities, thus is an effective way to generate small molecules targeting G-quadruplexes in nucleic acids. In addition, this is the first report that green tea catechin can bind to nucleic acid G-quadruplex structures.

Controlling the stoichiometry and strand polarity of a tetramolecular G-quadruplex structure by using a DNA origami frame

Science.gov (United States)

Rajendran, Arivazhagan; Endo, Masayuki; Hidaka, Kumi; Lan Thao Tran, Phong; Mergny, Jean-Louis; Sugiyama, Hiroshi

2013-01-01

Guanine-rich oligonucleotides often show a strong tendency to form supramolecular architecture, the so-called G-quadruplex structure. Because of the biological significance, it is now considered to be one of the most important conformations of DNA. Here, we describe the direct visualization and single-molecule analysis of the formation of a tetramolecular G-quadruplex in KCl solution. The conformational changes were carried out by incorporating two duplex DNAs, with G–G mismatch repeats in the middle, inside a DNA origami frame and monitoring the topology change of the strands. In the absence of KCl, incorporated duplexes had no interaction and laid parallel to each other. Addition of KCl induced the formation of a G-quadruplex structure by stably binding the duplexes to each other in the middle. Such a quadruplex formation allowed the DNA synapsis without disturbing the duplex regions of the participating sequences, and resulted in an X-shaped structure that was monitored by atomic force microscopy. Further, the G-quadruplex formation in KCl solution and its disruption in KCl-free buffer were analyzed in real-time. The orientation of the G-quadruplex is often difficult to control and investigate using traditional biochemical methods. However, our method using DNA origami could successfully control the strand orientations, topology and stoichiometry of the G-quadruplex. PMID:23863846

A multi-functional guanine derivative for studying the DNA G-quadruplex structure.

Science.gov (United States)

Ishizuka, Takumi; Zhao, Pei-Yan; Bao, Hong-Liang; Xu, Yan

2017-10-23

In the present study, we developed a multi-functional guanine derivative, 8F G, as a G-quadruplex stabilizer, a fluorescent probe for the detection of G-quadruplex formation, and a 19 F sensor for the observation of the G-quadruplex. We demonstrate that the functional nucleoside bearing a 3,5-bis(trifluoromethyl)benzene group at the 8-position of guanine stabilizes the DNA G-quadruplex structure and fluoresces following the G-quadruplex formation. Furthermore, we show that the functional sensor can be used to directly observe DNA G-quadruplexes by 19 F-NMR in living cells. To our knowledge, this is the first study showing that the nucleoside derivative simultaneously allows for three kinds of functions at a single G-quadruplex DNA. Our results suggest that the multi-functional nucleoside derivative can be broadly used for studying the G-quadruplex structure and serves as a powerful tool for examining the molecular basis of G-quadruplex formation in vitro and in living cells.

Distance-dependent duplex DNA destabilization proximal to G-quadruplex/i-motif sequences

Science.gov (United States)

König, Sebastian L. B.; Huppert, Julian L.; Sigel, Roland K. O.; Evans, Amanda C.

2013-01-01

G-quadruplexes and i-motifs are complementary examples of non-canonical nucleic acid substructure conformations. G-quadruplex thermodynamic stability has been extensively studied for a variety of base sequences, but the degree of duplex destabilization that adjacent quadruplex structure formation can cause has yet to be fully addressed. Stable in vivo formation of these alternative nucleic acid structures is likely to be highly dependent on whether sufficient spacing exists between neighbouring duplex- and quadruplex-/i-motif-forming regions to accommodate quadruplexes or i-motifs without disrupting duplex stability. Prediction of putative G-quadruplex-forming regions is likely to be assisted by further understanding of what distance (number of base pairs) is required for duplexes to remain stable as quadruplexes or i-motifs form. Using oligonucleotide constructs derived from precedented G-quadruplexes and i-motif-forming bcl-2 P1 promoter region, initial biophysical stability studies indicate that the formation of G-quadruplex and i-motif conformations do destabilize proximal duplex regions. The undermining effect that quadruplex formation can have on duplex stability is mitigated with increased distance from the duplex region: a spacing of five base pairs or more is sufficient to maintain duplex stability proximal to predicted quadruplex/i-motif-forming regions. PMID:23771141

Behavior of the guanine base in G-quadruplexes probed by the fluorescent guanine analog, 6-methyl isozanthopterin

Energy Technology Data Exchange (ETDEWEB)

Han, Ji Hoon; Chitrapriya, Nataraj; Lee, Hyun Suk; Lee, Young Ae; Kim, Seog K. [Dept. of Chemistry, Yeungnam University, Gyeongsan (Korea, Republic of); Jung, Maeng Joon [Dept. of Chemistry, Kyungpook National University, Daegu (Korea, Republic of)

2017-02-15

In this study, circular dichroism (CD) spectrum and fluorescence techniques were used to examine the dynamic properties and microenvironment of the guanine base (G) at the central loop and at the middle of the G-stem of the G-quadruplex formed from the G{sub 3}T{sub 2}G{sub 3}TGTG{sub 3}T{sub 2}G{sub 3} sequence (G-quadruplex 1), in which the G base at the 10th and 13th position were replaced with a fluorescent G analog, 6-methyl isoxanthopterin (6MI) (G-quadruplex 2 and 3, respectively). For all G-quadruplexes, the CD spectrum revealed a positive band at 263 nm and a shoulder at 298 nm, and the thermal melting profiles were the sum of at least two sigmoidal curves. These observations indicated the presence of two conformers in the G-quadruplex. The fluorescence intensity of G-quadruplex 2 was greater than 3, as expected from the extent of stacking interaction, which is larger in the G(6MI)G sequence than the T(6MI)T sequence. The efficiency of fluorescence quenching by the polar acrylamide quencher and negatively charged I− quencher were larger for G-quadruplex 3, suggesting that 6MI in the G(6MI)G stem is exposed more to the aqueous environment compared to that in the T(6MI)T central loop. In the latter case, 6MI may direct to the center of the top G-quartet layer. The possibility of hydrogen bond formation between the carbonyl group of 6MI and the acrylamide of the G-quadruplex 3 was proposed.

Biophysical Characterization of G-Quadruplex Recognition in the PITX1 mRNA by the Specificity Domain of the Helicase RHAU.

Directory of Open Access Journals (Sweden)

Emmanuel O Ariyo

Full Text Available Nucleic acids rich in guanine are able to fold into unique structures known as G-quadruplexes. G-quadruplexes consist of four tracts of guanylates arranged in parallel or antiparallel strands that are aligned in stacked G-quartet planes. The structure is further stabilized by Hoogsteen hydrogen bonds and monovalent cations centered between the planes. RHAU (RNA helicase associated with AU-rich element is a member of the ATP-dependent DExH/D family of RNA helicases and can bind and resolve G-quadruplexes. RHAU contains a core helicase domain with an N-terminal extension that enables recognition and full binding affinity to RNA and DNA G-quadruplexes. PITX1, a member of the bicoid class of homeobox proteins, is a transcriptional activator active during development of vertebrates, chiefly in the anterior pituitary gland and several other organs. We have previously demonstrated that RHAU regulates PITX1 levels through interaction with G-quadruplexes at the 3'-end of the PITX1 mRNA. To understand the structural basis of G-quadruplex recognition by RHAU, we characterize a purified minimal PITX1 G-quadruplex using a variety of biophysical techniques including electrophoretic mobility shift assays, UV-VIS spectroscopy, circular dichroism, dynamic light scattering, small angle X-ray scattering and nuclear magnetic resonance spectroscopy. Our biophysical analysis provides evidence that the RNA G-quadruplex, but not its DNA counterpart, can adopt a parallel orientation, and that only the RNA can interact with N-terminal domain of RHAU via the tetrad face of the G-quadruplex. This work extends our insight into how the N-terminal region of RHAU recognizes parallel G-quadruplexes.

Electrochemical and AFM Characterization of G-Quadruplex Electrochemical Biosensors and Applications

Science.gov (United States)

2018-01-01

Guanine-rich DNA sequences are able to form G-quadruplexes, being involved in important biological processes and representing smart self-assembling nanomaterials that are increasingly used in DNA nanotechnology and biosensor technology. G-quadruplex electrochemical biosensors have received particular attention, since the electrochemical response is particularly sensitive to the DNA structural changes from single-stranded, double-stranded, or hairpin into a G-quadruplex configuration. Furthermore, the development of an increased number of G-quadruplex aptamers that combine the G-quadruplex stiffness and self-assembling versatility with the aptamer high specificity of binding to a variety of molecular targets allowed the construction of biosensors with increased selectivity and sensitivity. This review discusses the recent advances on the electrochemical characterization, design, and applications of G-quadruplex electrochemical biosensors in the evaluation of metal ions, G-quadruplex ligands, and other small organic molecules, proteins, and cells. The electrochemical and atomic force microscopy characterization of G-quadruplexes is presented. The incubation time and cations concentration dependence in controlling the G-quadruplex folding, stability, and nanostructures formation at carbon electrodes are discussed. Different G-quadruplex electrochemical biosensors design strategies, based on the DNA folding into a G-quadruplex, the use of G-quadruplex aptamers, or the use of hemin/G-quadruplex DNAzymes, are revisited. PMID:29666699

G-Quadruplex Forming Oligonucleotides as Anti-HIV Agents.

Science.gov (United States)

Musumeci, Domenica; Riccardi, Claudia; Montesarchio, Daniela

2015-09-22

Though a variety of different non-canonical nucleic acids conformations have been recognized, G-quadruplex structures are probably the structural motifs most commonly found within known oligonucleotide-based aptamers. This could be ascribed to several factors, as their large conformational diversity, marked responsiveness of their folding/unfolding processes to external stimuli, high structural compactness and chemo-enzymatic and thermodynamic stability. A number of G-quadruplex-forming oligonucleotides having relevant in vitro anti-HIV activity have been discovered in the last two decades through either SELEX or rational design approaches. Improved aptamers have been obtained by chemical modifications of natural oligonucleotides, as terminal conjugations with large hydrophobic groups, replacement of phosphodiester linkages with phosphorothioate bonds or other surrogates, insertion of base-modified monomers, etc. In turn, detailed structural studies have elucidated the peculiar architectures adopted by many G-quadruplex-based aptamers and provided insight into their mechanism of action. An overview of the state-of-the-art knowledge of the relevance of putative G-quadruplex forming sequences within the viral genome and of the most studied G-quadruplex-forming aptamers, selectively targeting HIV proteins, is here presented.

Local epigenetic reprogramming induced by G-quadruplex ligands

Science.gov (United States)

Guilbaud, Guillaume; Murat, Pierre; Recolin, Bénédicte; Campbell, Beth C.; Maiter, Ahmed; Sale, Julian E.; Balasubramanian, Shankar

2017-11-01

DNA and histone modifications regulate transcriptional activity and thus represent valuable targets to reprogram the activity of genes. Current epigenetic therapies target the machinery that regulates these modifications, leading to global transcriptional reprogramming with the potential for extensive undesired effects. Epigenetic information can also be modified as a consequence of disrupting processive DNA replication. Here, we demonstrate that impeding replication by small-molecule-mediated stabilization of G-quadruplex nucleic acid secondary structures triggers local epigenetic plasticity. We report the use of the BU-1 locus of chicken DT40 cells to screen for small molecules able to induce G-quadruplex-dependent transcriptional reprogramming. Further characterization of the top hit compound revealed its ability to induce a dose-dependent inactivation of BU-1 expression in two steps: the loss of H3K4me3 and then subsequent DNA cytosine methylation, changes that were heritable across cell divisions even after the compound was removed. Targeting DNA secondary structures thus represents a potentially new approach for locus-specific epigenetic reprogramming.

Multimerization rules for G-quadruplexes

Czech Academy of Sciences Publication Activity Database

Kolesnikova, Sofia; Hubálek, Martin; Bednárová, Lucie; Cvačka, Josef; Curtis, Edward A.

2017-01-01

Roč. 45, č. 15 (2017), s. 8684-8696 ISSN 0305-1048 Institutional support: RVO:61388963 Keywords : tetramolecular G-quadruplexes * RNA G-quadruplexes * circular dichroism Subject RIV: CE - Biochemistry OBOR OECD: Biochemistry and molecular biology Impact factor: 10.162, year: 2016 https://academic.oup.com/nar/article/45/15/8684/4002725/Multimerization-rules-for-Gquadruplexes

Studies of G-quadruplexes formed within self-assembled DNA mini-circles.

Science.gov (United States)

Klejevskaja, Beata; Pyne, Alice L B; Reynolds, Matthew; Shivalingam, Arun; Thorogate, Richard; Hoogenboom, Bart W; Ying, Liming; Vilar, Ramon

2016-10-13

We have developed self-assembled DNA mini-circles that contain a G-quadruplex-forming sequence from the c-Myc oncogene promoter and demonstrate by FRET that the G-quadruplex unfolding kinetics are 10-fold slower than for the simpler 24-mer G-quadruplex that is commonly used for FRET experiments.

DNA and RNA Quadruplex-Binding Proteins

Czech Academy of Sciences Publication Activity Database

Brázda, Václav; Haroniková, Lucia; Liao, J.C.C.; Fojta, Miroslav

2014-01-01

Roč. 15, č. 10 (2014), s. 17493-17517 E-ISSN 1422-0067 R&D Projects: GA ČR(CZ) GBP206/12/G151 Institutional support: RVO:68081707 Keywords : DNA quadruplex * RNA quadruplex * telomere Subject RIV: BO - Biophysics Impact factor: 2.862, year: 2014

Fluorescence detection of DNA, adenosine-5'-triphosphate (ATP), and telomerase activity by zinc(II)-protoporphyrin IX/G-quadruplex labels.

Science.gov (United States)

Zhang, Zhanxia; Sharon, Etery; Freeman, Ronit; Liu, Xiaoqing; Willner, Itamar

2012-06-05

The zinc(II)-protoporphyrin IX (ZnPPIX) fluorophore binds to G-quadruplexes, and this results in the enhanced fluorescence of the fluorophore. This property enabled the development of DNA sensors, aptasensors, and a sensor following telomerase activity. The DNA sensor is based on the design of a hairpin structure that includes a "caged" inactive G-quadruplex sequence. Upon opening the hairpin by the analyte DNA, the resulting fluorescence of the ZnPPIX/G-quadruplex provides the readout signal for the sensing event (detection limit 5 nM). Addition of Exonuclease III to the system allows the recycling of the analyte and its amplified analysis (detection limit, 200 pM). The association of the ZnPPIX to G-quadruplex aptamer-substrate complexes allowed the detection of adenosine-5'-triphosphate (ATP, detection limit 10 μM). Finally, the association of ZnPPIX to the G-quadruplex repeat units of telomers allowed the detection of telomerase activity originating from 380 ± 20 cancer 293T cell extract.

The analysis of track chamber photographs using flying spot digitizers

CERN Multimedia

Powell, Brian W

1966-01-01

A vast quantity of data pours from the experiments on particle accelerators throughout the world. For example, over 300 000 photographs per week came from the three bubble chambers operating on the CERN PS at the end of 1965. The conventional method of processing these bubble chamber photographs is for each one of them to be examined ('scanned') to see whether it records an interesting particle interaction. The interesting photographs are then passed to hand operated measuring machines to obtain precise measurements of the particle trajectories recorded on the film. Similar measurements are carried out on photographs taken in film spark chamber experiments. This article on the Flying Spot Digitizers at CERN describes one of the most fruitful attempts to speed and make more accurate the process of analysis of bubble and spark chamber photographs. There are two types of Flying Spot Digitizer at CERN — the HPD or Hough Powell Device (named after Professor Hough and the author who, together, initiated the devel...

Quadruplexes in 'Dicty': crystal structure of a four-quartet G-quadruplex formed by G-rich motif found in the Dictyostelium discoideum genome.

Science.gov (United States)

Guédin, Aurore; Lin, Linda Yingqi; Armane, Samir; Lacroix, Laurent; Mergny, Jean-Louis; Thore, Stéphane; Yatsunyk, Liliya A

2018-06-01

Guanine-rich DNA has the potential to fold into non-canonical G-quadruplex (G4) structures. Analysis of the genome of the social amoeba Dictyostelium discoideum indicates a low number of sequences with G4-forming potential (249-1055). Therefore, D. discoideum is a perfect model organism to investigate the relationship between the presence of G4s and their biological functions. As a first step in this investigation, we crystallized the dGGGGGAGGGGTACAGGGGTACAGGGG sequence from the putative promoter region of two divergent genes in D. discoideum. According to the crystal structure, this sequence folds into a four-quartet intramolecular antiparallel G4 with two lateral and one diagonal loops. The G-quadruplex core is further stabilized by a G-C Watson-Crick base pair and a A-T-A triad and displays high thermal stability (Tm > 90°C at 100 mM KCl). Biophysical characterization of the native sequence and loop mutants suggests that the DNA adopts the same structure in solution and in crystalline form, and that loop interactions are important for the G4 stability but not for its folding. Four-tetrad G4 structures are sparse. Thus, our work advances understanding of the structural diversity of G-quadruplexes and yields coordinates for in silico drug screening programs and G4 predictive tools.

Heterocyclic Dications as a New Class of Telomeric G-Quadruplex Targeting Agents

Science.gov (United States)

Nanjunda, Rupesh; Musetti, Caterina; Kumar, Arvind; Ismail, Mohamed A.; Farahat, Abdelbasset A.; Wang, Siming; Sissi, Claudia; Palumbo, Manlio; Boykin, David W.; Wilson, W. David

2013-01-01

Small molecules that can induce and stabilize G-quadruplex DNA structures represent a novel approach for anti-cancer and anti-parasitic therapy and extensive efforts have been directed towards discovering lead compounds that are capable of stabilizing quadruplexes. The purpose of this study is to explore conformational modifications in a series of heterocyclic dications to discover structural motifs that can selectively bind and stabilize specific G-quadruplexes, such as those present in the human telomere. The G-quadruplex has various potential recognition sites for small molecules; however, the primary interaction site of most of these ligands is the terminal tetrads. Similar to duplex-DNA groove recognition, quadruplex groove recognition by small molecules offers the potential for enhanced selectivity that can be developed into a viable therapeutic strategy. The compounds investigated were selected based on preliminary studies with DB832, a bifuryl-phenyl diamidine with a unique telomere interaction. This compound provides a paradigm that can help in understanding the optimum compound-DNA interactions that lead to quadruplex groove recognition. DNA recognition by the DB832 derivatives was investigated by biophysical experiments such as thermal melting, circular dichroism, mass spectrometry and NMR. Biological studies were also performed to complement the biophysical data. The results suggest a complex binding mechanism which involves the recognition of grooves for some ligands as well as stacking at the terminal tetrads of the human telomeric G-quadruplex for most of the ligands. These molecules represent an excellent starting point for further SAR analysis for diverse modes of quadruplex recognition and subsequent structure optimization for drug development. PMID:22380518

Xanthene and Xanthone Derivatives as G-Quadruplex Stabilizing Ligands

Directory of Open Access Journals (Sweden)

Alessandro Altieri

2013-10-01

Full Text Available Following previous studies on anthraquinone and acridine-based G-quadruplex ligands, here we present a study of similar aromatic cores, with the specific aim of increasing G-quadruplex binding and selectivity with respect to duplex DNA. Synthesized compounds include two and three-side chain xanthone and xanthene derivatives, as well as a dimeric “bridged” form. ESI and FRET measurements suggest that all the studied molecules are good G-quadruplex ligands, both at telomeres and on G-quadruplex forming sequences of oncogene promoters. The dimeric compound and the three-side chain xanthone derivative have been shown to represent the best compounds emerging from the different series of ligands presented here, having also high selectivity for G-quadruplex structures with respect to duplex DNA. Molecular modeling simulations are in broad agreement with the experimental data.

Efficient Long-Range Hole Transport Through G-Quadruplexes.

Science.gov (United States)

Wu, Jingyuan; Meng, Zhenyu; Lu, Yunpeng; Shao, Fangwei

2017-10-09

DNA offers a means of long-range charge transport for biology and electric nanodevices. Here, a series of tetra-stranded G-quadruplexes were assembled within a dendritic DNA architecture to explore oxidative charge transport (hole transport) through the G-quadruplex. Efficient charge transport was achieved over 28 Å upon UV irradiation. Over a longer G-quadruplex bridge, hole transport was escalated to a higher efficiency, which resulted in a higher yield than that of the optimal duplex DNA for charge transport, that is, the adenine tract. Efficient long-range hole transport suggests tetra-stranded G-quadruplexes, instead of an oxidation hotspot, hold better potential as an electron conduit than duplex DNA. © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

Repair of O6-methylguanine adducts in human telomeric G-quadruplex DNA by O6-alkylguanine-DNA alkyltransferase

Science.gov (United States)

Hellman, Lance M.; Spear, Tyler J.; Koontz, Colton J.; Melikishvili, Manana; Fried, Michael G.

2014-01-01

O6-alkylguanine-DNA alkyltransferase (AGT) is a single-cycle DNA repair enzyme that removes pro-mutagenic O6-alkylguanine adducts from DNA. Its functions with short single-stranded and duplex substrates have been characterized, but its ability to act on other DNA structures remains poorly understood. Here, we examine the functions of this enzyme on O6-methylguanine (6mG) adducts in the four-stranded structure of the human telomeric G-quadruplex. On a folded 22-nt G-quadruplex substrate, binding saturated at 2 AGT:DNA, significantly less than the ∼5 AGT:DNA found with linear single-stranded DNAs of similar length, and less than the value found with the telomere sequence under conditions that inhibit quadruplex formation (4 AGT:DNA). Despite these differences, AGT repaired 6mG adducts located within folded G-quadruplexes, at rates that were comparable to those found for a duplex DNA substrate under analogous conditions. Repair was kinetically biphasic with the amplitudes of rapid and slow phases dependent on the position of the adduct within the G-quadruplex: in general, adducts located in the top or bottom tetrads of a quadruplex stack exhibited more rapid-phase repair than did adducts located in the inner tetrad. This distinction may reflect differences in the conformational dynamics of 6mG residues in G-quadruplex DNAs. PMID:25080506

Sugar-modified G-quadruplexes: effects of LNA-, 2′F-RNA– and 2′F-ANA-guanosine chemistries on G-quadruplex structure and stability

Science.gov (United States)

Li, Zhe; Lech, Christopher Jacques; Phan, Anh Tuân

2014-01-01

G-quadruplex-forming oligonucleotides containing modified nucleotide chemistries have demonstrated promising pharmaceutical potential. In this work, we systematically investigate the effects of sugar-modified guanosines on the structure and stability of a (4+0) parallel and a (3+1) hybrid G-quadruplex using over 60 modified sequences containing a single-position substitution of 2′-O-4′-C-methylene-guanosine (LNAG), 2′-deoxy-2′-fluoro-riboguanosine (FG) or 2′-deoxy-2′-fluoro-arabinoguanosine (FANAG). Our results are summarized in two parts: (I) Generally, LNAG substitutions into ‘anti’ position guanines within a guanine-tetrad lead to a more stable G-quadruplex, while substitutions into ‘syn’ positions disrupt the native G-quadruplex conformation. However, some interesting exceptions to this trend are observed. We discover that a LNAG modification upstream of a short propeller loop hinders G-quadruplex formation. (II) A single substitution of either FG or FANAG into a ‘syn’ position is powerful enough to perturb the (3+1) G-quadruplex. Substitution of either FG or FANAG into any ‘anti’ position is well tolerated in the two G-quadruplex scaffolds. FANAG substitutions to ‘anti’ positions are better tolerated than their FG counterparts. In both scaffolds, FANAG substitutions to the central tetrad layer are observed to be the most stabilizing. The observations reported herein on the effects of LNAG, FG and FANAG modifications on G-quadruplex structure and stability will enable the future design of pharmaceutically relevant oligonucleotides. PMID:24371274

Intramolecular telomeric G-quadruplexes dramatically inhibit DNA synthesis by replicative and translesion polymerases, revealing their potential to lead to genetic change.

Directory of Open Access Journals (Sweden)

Deanna N Edwards

Full Text Available Recent research indicates that hundreds of thousands of G-rich sequences within the human genome have the potential to form secondary structures known as G-quadruplexes. Telomeric regions, consisting of long arrays of TTAGGG/AATCCC repeats, are among the most likely areas in which these structures might form. Since G-quadruplexes assemble from certain G-rich single-stranded sequences, they might arise when duplex DNA is unwound such as during replication. Coincidentally, these bulky structures when present in the DNA template might also hinder the action of DNA polymerases. In this study, single-stranded telomeric templates with the potential to form G-quadruplexes were examined for their effects on a variety of replicative and translesion DNA polymerases from humans and lower organisms. Our results demonstrate that single-stranded templates containing four telomeric GGG runs fold into intramolecular G-quadruplex structures. These intramolecular G quadruplexes are somewhat dynamic in nature and stabilized by increasing KCl concentrations and decreasing temperatures. Furthermore, the presence of these intramolecular G-quadruplexes in the template dramatically inhibits DNA synthesis by various DNA polymerases, including the human polymerase δ employed during lagging strand replication of G-rich telomeric strands and several human translesion DNA polymerases potentially recruited to sites of replication blockage. Notably, misincorporation of nucleotides is observed when certain translesion polymerases are employed on substrates containing intramolecular G-quadruplexes, as is extension of the resulting mismatched base pairs upon dynamic unfolding of this secondary structure. These findings reveal the potential for blockage of DNA replication and genetic changes related to sequences capable of forming intramolecular G-quadruplexes.

c-MYC G-quadruplex binding by the RNA polymerase I inhibitor BMH-21 and analogues revealed by a combined NMR and biochemical Approach.

Science.gov (United States)

Musso, Loana; Mazzini, Stefania; Rossini, Anna; Castagnoli, Lorenzo; Scaglioni, Leonardo; Artali, Roberto; Di Nicola, Massimo; Zunino, Franco; Dallavalle, Sabrina

2018-03-01

Pyridoquinazolinecarboxamides have been reported as RNA polymerase I inhibitors and represent a novel class of potential antitumor agents. BMH-21, was reported to intercalate with GC-rich rDNA, resulting in nucleolar stress as a primary mechanism of cytotoxicity. The interaction of BMH-21 and analogues with DNA G-quadruplex structures was studied by NMR and molecular modelling. The cellular response was investigated in a panel of human tumor cell lines and protein expression was examined by Western Blot analysis. We explored the ability of BMH-21 and its analogue 2 to bind to G-quadruplex present in the c-MYC promoter, by NMR and molecular modelling studies. We provide evidence that both compounds are not typical DNA intercalators but are effective binders of the tested G-quadruplex. The interaction with c-MYC G-quadruplex was reflected in down-regulation of c-Myc expression in human tumor cells. The inhibitory effect was almost complete in lymphoma cells SUDHL4 characterized by overexpression of c-Myc protein. This downregulation reflected an early and persistent modulation of cMyc mRNA. Given the relevance of c-MYC in regulation of ribosome biogenesis, it is conceivable that the inhibition of c-MYC contributes to the perturbation of nuclear functions and RNA polymerase I activity. Similar experiments with CX-5461, another RNA polymerase I transcription inhibitor, indicate the same behaviour in G-quadruplex stabilization. Our results support the hypothesis that BMH-21 and analogue compounds share the same mechanism, i.e. G-quadruplex binding as a primary event of a cascade leading to inhibition of RNA polymerase I and apoptosis. Copyright © 2017 Elsevier B.V. All rights reserved.

Experimental approaches to identify cellular G-quadruplex structures and functions.

Science.gov (United States)

Di Antonio, Marco; Rodriguez, Raphaël; Balasubramanian, Shankar

2012-05-01

Guanine-rich nucleic acids can fold into non-canonical DNA secondary structures called G-quadruplexes. The formation of these structures can interfere with the biology that is crucial to sustain cellular homeostases and metabolism via mechanisms that include transcription, translation, splicing, telomere maintenance and DNA recombination. Thus, due to their implication in several biological processes and possible role promoting genomic instability, G-quadruplex forming sequences have emerged as potential therapeutic targets. There has been a growing interest in the development of synthetic molecules and biomolecules for sensing G-quadruplex structures in cellular DNA. In this review, we summarise and discuss recent methods developed for cellular imaging of G-quadruplexes, and the application of experimental genomic approaches to detect G-quadruplexes throughout genomic DNA. In particular, we will discuss the use of engineered small molecules and natural proteins to enable pull-down, ChIP-Seq, ChIP-chip and fluorescence imaging of G-quadruplex structures in cellular DNA. Copyright © 2012 Elsevier Inc. All rights reserved.

Studies of G-quadruplex DNA structures at the single molecule level

DEFF Research Database (Denmark)

Kragh, Sofie Louise

2015-01-01

Folding of G-quaduplex structures adopted by the human telomeric repeat is here studied by single molecule FRET microscopy. This method allows for the investigation of G-quadruplex structures and their conformational dynamic. Telomeres are located at the ends of our chromosomes and end in a single...... with human telomeric repeat adopt several different G-quadruplex conformations in the presence of K+ ions. G-quadruplexes inhibit telomerase activity and are therefore potential targets for anti-cancer drugs, which can be small molecule ligands capable of stabilizing G-quadruplex structures. Understanding...... range. FRET spectroscopy can be performed on an ensemble of molecules, or on the single molecule level. In single molecule FRET experiments it is possible to follow the behaviour in time for each molecule independently, allowing insight into both dynamically and statistically heterogeneous molecular...

Optimization of arc-start performance by wire-feeding control for GMA welding

Energy Technology Data Exchange (ETDEWEB)

Kang, Jong Gu; Ryu, Gyeong Su; Rhee, Se Hun [Hanyang University, Seoul (Korea, Republic of); Kim, Dong Cheol; Kang, Mun Jin [Korea Institute of Industrial Technology, Incheon (Korea, Republic of); Park, Young Whan [Pukyong National University, Busan (Korea, Republic of)

2013-02-15

The wire feeding system for gas metal arc welding usually consists of a wire feeder and a torch. In many industries, the distance between the wire feeder and the torch is generally 3 m to 5 m. In a conventional wire feeder, a direct current (DC) motor is used for wire feeding. However, a significant problem with this system is the impossibility of feedback control because of inner or outer impedance. In this paper, a digital wire feeder was developed by using a DC encoder motor and a push-pull torch. An optimized wire-feeding system was also developed by experiment. The welding process was observed using a high-speed camera. The resulting wire-feeding system exhibits low spatter generation and arc stability.

Agreement in the determination of preformed wire shape templates on plaster models and customized digital arch form diagrams on digital models.

Science.gov (United States)

Camardella, Leonardo Tavares; Sá, Maiara da Silva Bezerra; Guimarães, Luciana Campos; Vilella, Beatriz de Souza; Vilella, Oswaldo de Vasconcellos

2018-03-01

The aim of this study was to verify the accuracy of preformed wire shape templates on plaster models and those of customized digital arch form diagrams on digital models. Twenty pairs of dental plaster models were randomly selected from the archives of the Department of Orthodontics of Federal Fluminense University, Niterói, Rio de Janeiro, Brazil. All plaster model samples were scanned in a plaster model scanner to create the respective digital models. Three examiners defined the arch form on the mandibular arch of these models by selecting the ideal preformed wire shape template on each plaster model or by making a customized digital arch form on the digital models using a digital arch form customization tool. These 2 arch forms were superimposed by the best-fit method. The greatest differences in the 6 regions on the superimposed arches were evaluated. Each examiner presented a descriptive analysis with the means, standard deviation, and minimum and maximum intervals of the differences on the superimpositions. Intraclass correlation coefficient and paired t tests were used to evaluate the accuracy of the superimpositions. Among the 6 regions analyzed in the superimpositions, the largest differences in the anterior and premolar regions were considered clinically insignificant, whereas the largest differences in the right molar region, especially the second molar area, were considered clinically significant by all 3 examiners. The intraclass correlation coefficients showed a weak correlation in the premolar region and moderate correlations in the anterior and molar regions. The paired t test showed statistically significant differences in the left anterior and premolar regions. The superimpositions between the arch forms on plaster and digital models were considered accurate, and the differences were not clinically significant, with the exception of the second molar area. Despite the favorable results, the requirement of correcting some software problems may

G-quadruplexes as novel cis-elements controlling transcription during embryonic development.

Science.gov (United States)

David, Aldana P; Margarit, Ezequiel; Domizi, Pablo; Banchio, Claudia; Armas, Pablo; Calcaterra, Nora B

2016-05-19

G-quadruplexes are dynamic structures folded in G-rich single-stranded DNA regions. These structures have been recognized as a potential nucleic acid based mechanism for regulating multiple cellular processes such as replication, transcription and genomic maintenance. So far, their transcriptional role in vivo during vertebrate embryonic development has not yet been addressed. Here, we performed an in silico search to find conserved putative G-quadruplex sequences (PQSs) within proximal promoter regions of human, mouse and zebrafish developmental genes. Among the PQSs able to fold in vitro as G-quadruplex, those present in nog3, col2a1 and fzd5 promoters were selected for further studies. In cellulo studies revealed that the selected G-quadruplexes affected the transcription of luciferase controlled by the SV40 nonrelated promoter. G-quadruplex disruption in vivo by microinjection in zebrafish embryos of either small ligands or DNA oligonucleotides complementary to the selected PQSs resulted in lower transcription of the targeted genes. Moreover, zebrafish embryos and larvae phenotypes caused by the presence of complementary oligonucleotides fully resembled those ones reported for nog3, col2a1 and fzd5 morphants. To our knowledge, this is the first work revealing in vivo the role of conserved G-quadruplexes in the embryonic development, one of the most regulated processes of the vertebrates biology. © The Author(s) 2016. Published by Oxford University Press on behalf of Nucleic Acids Research.

Disordering of human telomeric G-quadruplex with novel antiproliferative anthrathiophenedione.

Directory of Open Access Journals (Sweden)

Dmitry Kaluzhny

Full Text Available Linear heteroareneanthracenediones have been shown to interfere with DNA functions, thereby causing death of human tumor cells and their drug resistant counterparts. Here we report the interaction of our novel antiproliferative agent 4,11-bis[(2-{[acetimido]amino}ethylamino]anthra[2,3-b]thiophene-5,10-dione with telomeric DNA structures studied by isothermal titration calorimetry, circular dichroism and UV absorption spectroscopy. New compound demonstrated a high affinity (K(ass∼10⁶ M⁻¹ for human telomeric antiparallel quadruplex d(TTAGGG₄ and duplex d(TTAGGG₄∶d(CCCTAA₄. Importantly, a ∼100-fold higher affinity was determined for the ligand binding to an unordered oligonucleotide d(TTAGGG TTAGAG TTAGGG TTAGGG unable to form quadruplex structures. Moreover, in the presence of Na+ the compound caused dramatic conformational perturbation of the telomeric G-quadruplex, namely, almost complete disordering of G-quartets. Disorganization of a portion of G-quartets in the presence of K+ was also detected. Molecular dynamics simulations were performed to illustrate how the binding of one molecule of the ligand might disrupt the G-quartet adjacent to the diagonal loop of telomeric G-quadruplex. Our results provide evidence for a non-trivial mode of alteration of G-quadruplex structure by tentative antiproliferative drugs.

Fluorescent Dansyl-Guanosine Conjugates that Bind c-MYC Promoter G-Quadruplex and Downregulate c-MYC Expression.

Science.gov (United States)

Pavan Kumar, Y; Saha, Puja; Saha, Dhurjhoti; Bessi, Irene; Schwalbe, Harald; Chowdhury, Shantanu; Dash, Jyotirmayee

2016-03-02

The four-stranded G-quadruplex present in the c-MYC P1 promoter has been shown to play a pivotal role in the regulation of c-MYC transcription. Small-molecule compounds capable of inhibiting the c-MYC promoter activity by stabilising the c-MYC G-quadruplex could potentially be used as anticancer agents. In this context, here we report the synthesis of dansyl-guanosine conjugates through one-pot modular click reactions. The dansyl-guanosine conjugates can selectively detect c-MYC G-quadruplex over other biologically relevant quadruplexes and duplex DNA and can be useful as staining reagents for selective visualisation of c-MYC G-quadruplex over duplex DNA by gel electrophoresis. NMR spectroscopic titrations revealed the preferential binding sites of these dansyl ligands to the c-MYC G-quadruplex. A dual luciferase assay and qRT-PCR revealed that a dansyl-bisguanosine ligand represses the c-MYC expression, possibly by stabilising the c-MYC G-quadruplex. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Superhelicity Constrains a Localized and R-Loop-Dependent Formation of G-Quadruplexes at the Upstream Region of Transcription.

Science.gov (United States)

Zheng, Ke-Wei; He, Yi-de; Liu, Hong-He; Li, Xin-Min; Hao, Yu-Hua; Tan, Zheng

2017-10-20

Transcription induces formation of intramolecular G-quadruplex structures at the upstream region of a DNA duplex by an upward transmission of negative supercoiling through the DNA. Currently the regulation of such G-quadruplex formation remains unclear. Using plasmid as a model, we demonstrate that while it is the dynamic negative supercoiling generated by a moving RNA polymerase that triggers a formation of a G-quadruplex, the constitutional superhelicity determines the potential and range of the formation of a G-quadruplex by constraining the propagation of the negative supercoiling. G-quadruplex formation is maximal in negatively supercoiled and nearly abolished in relaxed plasmids while being moderate in nicked and linear ones. The formation of a G-quadruplex strongly correlates with the presence of an R-loop. Preventing R-loop formation virtually abolished G-quadruplex formation even in the negatively supercoiled plasmid. Enzymatic action and protein binding that manipulate supercoiling or its propagation all impact the formation of G-quadruplexes. Because chromosomes and plasmids in cells in their natural form are maintained in a supercoiled state, our findings reveal a physical basis that justifies the formation and regulation of G-quadruplexes in vivo. The structural features involved in G-quadruplex formation may all serve as potential targets in clinical and therapeutic applications.

Phylo-typing of clinical Escherichia coli isolates originating from bovine mastitis and canine pyometra and urinary tract infection by means of quadruplex PCR.

Science.gov (United States)

Müştak, Hamit Kaan; Günaydin, Elçin; Kaya, İnci Başak; Salar, Merve Özdal; Babacan, Orkun; Önat, Kaan; Ata, Zafer; Diker, Kadir Serdar

2015-01-01

Escherichia coli is one of the major causative agents of bovine mastitis worldwide, and is typically associated with acute, clinical mastitis. Besides this, E. coli strains which belong to the extra-intestinal pathogenic group are also the major cause of urinary tract infections and pyometra in dogs. In this study, it was aimed to investigate phylo-groups/subgroups in 155 E. coli isolates obtained from acute bovine mastitis, 43 from urinary tract infections of dogs and 20 from canine pyometra by a formerly described triplex PCR and recently described new quadruplex polymerase chain reaction (PCR) method. Group A1 (n = 118; 76%) and B1 (n = 71; 46%) were found to be the most prevalent groups by triplex and quadruplex PCR assays in mastitis isolates, respectively. Phylo-typing of 43 urinary tract isolates also revealed that most of the isolates belonged to A1 (n = 23; 54%) by triplex and B2 (n = 36; 84%) by quadruplex PCR assays. The isolates assigned as group A1 (n = 17; 85%) by triplex PCR could not be classified by quadruplex PCR in pyometra isolates. The results support the hypothesis that E. coli strains isolated from bovine mastitis cases are environmental. Also, groups C, E and F were identified as new phylo-groups for the first time in acute bovine mastitis cases. The comparison of triplex PCR with quadruplex PCR results revealed that most of the groups assigned in triplex PCR were altered by quadruplex PCR assay.

GNG Motifs Can Replace a GGG Stretch during G-Quadruplex Formation in a Context Dependent Manner.

Directory of Open Access Journals (Sweden)

Kohal Das

Full Text Available G-quadruplexes are one of the most commonly studied non-B DNA structures. Generally, these structures are formed using a minimum of 4, three guanine tracts, with connecting loops ranging from one to seven. Recent studies have reported deviation from this general convention. One such deviation is the involvement of bulges in the guanine tracts. In this study, guanines along with bulges, also referred to as GNG motifs have been extensively studied using recently reported HOX11 breakpoint fragile region I as a model template. By strategic mutagenesis approach we show that the contribution from continuous G-tracts may be dispensible during G-quadruplex formation when such motifs are flanked by GNGs. Importantly, the positioning and number of GNG/GNGNG can also influence the formation of G-quadruplexes. Further, we assessed three genomic regions from HIF1 alpha, VEGF and SHOX gene for G-quadruplex formation using GNG motifs. We show that HIF1 alpha sequence harbouring GNG motifs can fold into intramolecular G-quadruplex. In contrast, GNG motifs in mutant VEGF sequence could not participate in structure formation, suggesting that the usage of GNG is context dependent. Importantly, we show that when two continuous stretches of guanines are flanked by two independent GNG motifs in a naturally occurring sequence (SHOX, it can fold into an intramolecular G-quadruplex. Finally, we show the specific binding of G-quadruplex binding protein, Nucleolin and G-quadruplex antibody, BG4 to SHOX G-quadruplex. Overall, our study provides novel insights into the role of GNG motifs in G-quadruplex structure formation which may have both physiological and pathological implications.

A Dual-Specific Targeting Approach Based on the Simultaneous Recognition of Duplex and Quadruplex Motifs.

Science.gov (United States)

Nguyen, Thi Quynh Ngoc; Lim, Kah Wai; Phan, Anh Tuân

2017-09-20

Small-molecule ligands targeting nucleic acids have been explored as potential therapeutic agents. Duplex groove-binding ligands have been shown to recognize DNA in a sequence-specific manner. On the other hand, quadruplex-binding ligands exhibit high selectivity between quadruplex and duplex, but show limited discrimination between different quadruplex structures. Here we propose a dual-specific approach through the simultaneous application of duplex- and quadruplex-binders. We demonstrated that a quadruplex-specific ligand and a duplex-specific ligand can simultaneously interact at two separate binding sites of a quadruplex-duplex hybrid harbouring both quadruplex and duplex structural elements. Such a dual-specific targeting strategy would combine the sequence specificity of duplex-binders and the strong binding affinity of quadruplex-binders, potentially allowing the specific targeting of unique quadruplex structures. Future research can be directed towards the development of conjugated compounds targeting specific genomic quadruplex-duplex sites, for which the linker would be highly context-dependent in terms of length and flexibility, as well as the attachment points onto both ligands.

Conformation and stability of intramolecular telomeric G-quadruplexes: sequence effects in the loops.

Directory of Open Access Journals (Sweden)

Giovanna Sattin

Full Text Available Telomeres are guanine-rich sequences that protect the ends of chromosomes. These regions can fold into G-quadruplex structures and their stabilization by G-quadruplex ligands has been employed as an anticancer strategy. Genetic analysis in human telomeres revealed extensive allelic variation restricted to loop bases, indicating that the variant telomeric sequences maintain the ability to fold into G-quadruplex. To assess the effect of mutations in loop bases on G-quadruplex folding and stability, we performed a comprehensive analysis of mutant telomeric sequences by spectroscopic techniques, molecular dynamics simulations and gel electrophoresis. We found that when the first position in the loop was mutated from T to C or A the resulting structure adopted a less stable antiparallel topology; when the second position was mutated to C or A, lower thermal stability and no evident conformational change were observed; in contrast, substitution of the third position from A to C induced a more stable and original hybrid conformation, while mutation to T did not significantly affect G-quadruplex topology and stability. Our results indicate that allelic variations generate G-quadruplex telomeric structures with variable conformation and stability. This aspect needs to be taken into account when designing new potential anticancer molecules.

Structure variations of TBA G-quadruplex induced by 2'-O-methyl nucleotide in K+ and Ca2+ environments.

Science.gov (United States)

Zhao, Xiaoyang; Liu, Bo; Yan, Jing; Yuan, Ying; An, Liwen; Guan, Yifu

2014-10-01

Thrombin binding aptamer (TBA), a 15-mer oligonucleotide of d(GGTTGGTGTGGTTGG) sequence, folds into a chair-type antiparallel G-quadruplex in the K(+) environment, and each of two G-tetrads is characterized by a syn-anti-syn-anti glycosidic conformation arrangement. To explore its folding topology and structural stability, 2'-O-methyl nucleotide (OMe) with the C3'-endo sugar pucker conformation and anti glycosidic angle was used to selectively substitute for the guanine residues of G-tetrads of TBA, and these substituted TBAs were characterized using a circular dichroism spectrum, thermally differential spectrum, ultraviolet stability analysis, electrophoresis mobility shift assay, and thermodynamic analysis in K(+) and Ca(2+) environments. Results showed that single substitutions for syn-dG residues destabilized the G-quadruplex structure, while single substitutions for anti-dG residues could preserve the G-quadruplex in the K(+) environment. When one or two G-tetrads were modified with OMe, TBA became unstructured. In contrast, in Ca(2+) environment, the native TBA appeared to be unstructured. When two G-tetrads were substituted with OMe, TBA seemed to become a more stable parallel G-4 structure. Further thermodynamic data suggested that OMe-substitutions were an enthalpy-driven event. The results in this study enrich our understanding about the effects of nucleotide derivatives on the G-quadruplex structure stability in different ionic environments, which will help to design G-quadruplex for biological and medical applications. © The Author 2014. Published by ABBS Editorial Office in association with Oxford University Press on behalf of the Institute of Biochemistry and Cell Biology, Shanghai Institutes for Biological Sciences, Chinese Academy of Sciences.

Using Fly-By-Wire Technology in Future Models of the UH-60 and Other Rotary Wing Aircraft

Science.gov (United States)

Solem, Courtney K.

2011-01-01

Several fixed-winged airplanes have successfully used fly-by-wire (FBW) technology for the last 40 years. This technology is now beginning to be incorporated into rotary wing aircraft. By using FBW technology, manufacturers are expecting to improve upon the weight, maintenance time and costs, handling and reliability of the aircraft. Before mass production of this new system begins in new models such as the UH-60MU, testing must be conducted to insure the safety of this technology as well as to reassure others it will be worth the time and money to make such a dramatic change to a perfectly functional machine. The RASCAL JUH-60A has been modified for these purposes. This Black Hawk helicopter has already been equipped with the FBW technology and can be configured as a near perfect representation of the UH-60MU. Because both machines have very similar qualities, the data collected from the RASCAL can be used to make future decisions about the UH-60MU. The U.S. Army AFDD Flight Project Office oversees all the design modifications for every hardware system used in the RASCAL aircraft. This project deals with specific designs and analyses of unique RASCAL aircraft subsystems and their modifications to conduct flight mechanics research.

The G-quadruplex DNA stabilizing drug pyridostatin promotes DNA damage and downregulates transcription of Brca1 in neurons.

Science.gov (United States)

Moruno-Manchon, Jose F; Koellhoffer, Edward C; Gopakumar, Jayakrishnan; Hambarde, Shashank; Kim, Nayun; McCullough, Louise D; Tsvetkov, Andrey S

2017-09-12

The G-quadruplex is a non-canonical DNA secondary structure formed by four DNA strands containing multiple runs of guanines. G-quadruplexes play important roles in DNA recombination, replication, telomere maintenance, and regulation of transcription. Small molecules that stabilize the G-quadruplexes alter gene expression in cancer cells. Here, we hypothesized that the G-quadruplexes regulate transcription in neurons. We discovered that pyridostatin, a small molecule that specifically stabilizes G-quadruplex DNA complexes, induced neurotoxicity and promoted the formation of DNA double-strand breaks (DSBs) in cultured neurons. We also found that pyridostatin downregulated transcription of the Brca1 gene, a gene that is critical for DSB repair. Importantly, in an in vitro gel shift assay, we discovered that an antibody specific to the G-quadruplex structure binds to a synthetic oligonucleotide, which corresponds to the first putative G-quadruplex in the Brca1 gene promoter. Our results suggest that the G-quadruplex complexes regulate transcription in neurons. Studying the G-quadruplexes could represent a new avenue for neurodegeneration and brain aging research.

RNA synthesis is modulated by G-quadruplex formation in Hepatitis C virus negative RNA strand.

Science.gov (United States)

Chloé, Jaubert; Amina, Bedrat; Laura, Bartolucci; Carmelo, Di Primo; Michel, Ventura; Jean-Louis, Mergny; Samir, Amrane; Marie-Line, Andreola

2018-05-25

DNA and RNA guanine-rich oligonucleotides can form non-canonical structures called G-quadruplexes or "G4" that are based on the stacking of G-quartets. The role of DNA and RNA G4 is documented in eukaryotic cells and in pathogens such as viruses. Yet, G4 have been identified only in a few RNA viruses, including the Flaviviridae family. In this study, we analysed the last 157 nucleotides at the 3'end of the HCV (-) strand. This sequence is known to be the minimal sequence required for an efficient RNA replication. Using bioinformatics and biophysics, we identified a highly conserved G4-prone sequence located in the stem-loop IIy' of the negative strand. We also showed that the formation of this G-quadruplex inhibits the in vitro RNA synthesis by the RdRp. Furthermore, Phen-DC3, a specific G-quadruplex binder, is able to inhibit HCV viral replication in cells in conditions where no cytotoxicity was measured. Considering that this domain of the negative RNA strand is well conserved among HCV genotypes, G4 ligands could be of interest for new antiviral therapies.

Extended molecular dynamics of a c-kit promoter quadruplex

Czech Academy of Sciences Publication Activity Database

Islam, B.; Stadlbauer, Petr; Krepl, Miroslav; Koča, J.; Neidle, S.; Haider, S.; Šponer, Jiří

2015-01-01

Roč. 43, č. 18 (2015), s. 8673-8693 ISSN 0305-1048 R&D Projects: GA ČR(CZ) GAP208/11/1822 Institutional support: RVO:68081707 Keywords : TELOMERIC G-QUADRUPLEX * INTRAMOLECULAR DNA QUADRUPLEXES * GASTROINTESTINAL STROMAL TUMOR Subject RIV: BO - Biophysics Impact factor: 9.202, year: 2015

Evaluation of the effect of polymorphism on G-quadruplex-ligand interaction by means of spectroscopic and chromatographic techniques

Science.gov (United States)

Benito, S.; Ferrer, A.; Benabou, S.; Aviñó, A.; Eritja, R.; Gargallo, R.

2018-05-01

Guanine-rich sequences may fold into highly ordered structures known as G-quadruplexes. Apart from the monomeric G-quadruplex, these sequences may form multimeric structures that are not usually considered when studying interaction with ligands. This work studies the interaction of a ligand, crystal violet, with three guanine-rich DNA sequences with the capacity to form multimeric structures. These sequences correspond to short stretches found near the promoter regions of c-kit and SMARCA4 genes. Instrumental techniques (circular dichroism, molecular fluorescence, size-exclusion chromatography and electrospray ionization mass spectrometry) and multivariate data analysis were used for this purpose. The polymorphism of G-quadruplexes was characterized prior to the interaction studies. The ligand was shown to interact preferentially with the monomeric G-quadruplex; the binding stoichiometry was 1:1 and the binding constant was in the order of 105 M-1 for all three sequences. The results highlight the importance of DNA treatment prior to interaction studies.

Volumetric contributions of loop regions of G-quadruplex DNA to the formation of the tertiary structure.

Science.gov (United States)

Takahashi, Shuntaro; Sugimoto, Naoki

2017-12-01

DNA guanine-quadruplexes (G-quadruplexes) are unique DNA structures formed by guanine-rich sequences. The loop regions of G-quadruplexes play key roles in stability and topology of G-quadruplexes. Here, we investigated volumetric changes induced by pressure in the folding of the G-quadruplex formed by the thrombin binding aptamer (TBA) with mutations within the loop regions. The change of partial molar volume in the transition from coil to G-quadruplex, ∆V tr , of TBA with a mutation from T to A in the 5' most loop (TBA T3A) was 75.5cm 3 mol -1 , which was larger than that of TBA (54.6cm 3 mol -1 ). TBA with a G to T mutation in the central loop (TBA G8T) had thermal stability similar to TBA T3A but a smaller ∆V tr of 41.1cm 3 mol -1 . In the presence of poly(ethylene)glycol 200 (PEG200), ∆V tr values were 14.7cm 3 mol -1 for TBA T3A and 13.2cm 3 mol -1 for TBA G8T. These results suggest that the two mutations destabilize the G-quadruplex structure differently. Thus, volumetric data obtained using pressure-based thermodynamic analyses provides information about the dynamics of the loop regions and the roles of loops in the stabilities and folding of G-quadruplex structures. Copyright © 2017 Elsevier B.V. All rights reserved.

A new cationic porphyrin derivative (TMPipEOPP with large side arm substituents: a highly selective G-quadruplex optical probe.

Directory of Open Access Journals (Sweden)

Li-Na Zhu

Full Text Available The discovery of uncommon DNA structures and speculation about their potential functions in genes has brought attention to specific DNA structure recognition. G-quadruplexes are four-stranded nucleic acid structures formed by G-rich DNA (or RNA sequences. G-rich sequences with a high potential to form G-quadruplexes have been found in many important genomic regions. Porphyrin derivatives with cationic side arm substituents are important G-quadruplex-binding ligands. For example, 5,10,15,20-Tetrakis(N-methylpyridinium-4-yl-21H,23H-porphyrin (TMPyP4, interacts strongly with G-quadruplexes, but has poor selectivity for G-quadruplex versus duplex DNA. To increase the G-quadruplex recognition specificity, a new cationic porphyrin derivative, 5,10,15,20-tetra-{4-[2-(1-methyl-1-piperidinylethoxy]phenyl} porphyrin (TMPipEOPP, with large side arm substituents was synthesized, and the interactions between TMPipEOPP and different DNA structures were compared. The results show that G-quadruplexes cause large changes in the UV-Vis absorption and fluorescence spectra of TMPipEOPP, but duplex and single-stranded DNAs do not, indicating that TMPipEOPP can be developed as a highly specific optical probe for discriminating G-quadruplex from duplex and single-stranded DNA. Visual discrimination is also possible. Job plot and Scatchard analysis suggest that a complicated binding interaction occurs between TMPipEOPP and G-quadruplexes. At a low [G-quadruplex]/[TMPipEOPP] ratio, one G-quadruplex binds two TMPipEOPP molecules by end-stacking and outside binding modes. At a high [G-quadruplex]/[TMPipEOPP] ratio, two G-quadruplexes bind to one TMPipEOPP molecule in a sandwich-like end-stacking mode.

A new cationic porphyrin derivative (TMPipEOPP) with large side arm substituents: a highly selective G-quadruplex optical probe.

Science.gov (United States)

Zhu, Li-Na; Zhao, Shu-Juan; Wu, Bin; Li, Xiao-Zeng; Kong, De-Ming

2012-01-01

The discovery of uncommon DNA structures and speculation about their potential functions in genes has brought attention to specific DNA structure recognition. G-quadruplexes are four-stranded nucleic acid structures formed by G-rich DNA (or RNA) sequences. G-rich sequences with a high potential to form G-quadruplexes have been found in many important genomic regions. Porphyrin derivatives with cationic side arm substituents are important G-quadruplex-binding ligands. For example, 5,10,15,20-Tetrakis(N-methylpyridinium-4-yl)-21H,23H-porphyrin (TMPyP4), interacts strongly with G-quadruplexes, but has poor selectivity for G-quadruplex versus duplex DNA. To increase the G-quadruplex recognition specificity, a new cationic porphyrin derivative, 5,10,15,20-tetra-{4-[2-(1-methyl-1-piperidinyl)ethoxy]phenyl} porphyrin (TMPipEOPP), with large side arm substituents was synthesized, and the interactions between TMPipEOPP and different DNA structures were compared. The results show that G-quadruplexes cause large changes in the UV-Vis absorption and fluorescence spectra of TMPipEOPP, but duplex and single-stranded DNAs do not, indicating that TMPipEOPP can be developed as a highly specific optical probe for discriminating G-quadruplex from duplex and single-stranded DNA. Visual discrimination is also possible. Job plot and Scatchard analysis suggest that a complicated binding interaction occurs between TMPipEOPP and G-quadruplexes. At a low [G-quadruplex]/[TMPipEOPP] ratio, one G-quadruplex binds two TMPipEOPP molecules by end-stacking and outside binding modes. At a high [G-quadruplex]/[TMPipEOPP] ratio, two G-quadruplexes bind to one TMPipEOPP molecule in a sandwich-like end-stacking mode.

Pyrrolobenzodiazepines (PBDs do not bind to DNA G-quadruplexes.

Directory of Open Access Journals (Sweden)

Khondaker M Rahman

Full Text Available The pyrrolo[2,1-c][1,4] benzodiazepines (PBDs are a family of sequence-selective, minor-groove binding DNA-interactive agents that covalently attach to guanine residues. A recent publication in this journal (Raju et al, PloS One, 2012, 7, 4, e35920 reported that two PBD molecules were observed to bind with high affinity to the telomeric quadruplex of Tetrahymena glaucoma based on Electrospray Ionisation Mass Spectrometry (ESI-MS, Circular Dichroism, UV-Visible and Fluorescence spectroscopy data. This was a surprising result given the close 3-dimensional shape match between the structure of all PBD molecules and the minor groove of duplex DNA, and the completely different 3-dimensional structure of quadruplex DNA. Therefore, we evaluated the interaction of eight PBD molecules of diverse structure with a range of parallel, antiparallel and mixed DNA quadruplexes using DNA Thermal Denaturation, Circular Dichroism and Molecular Dynamics Simulations. Those PBD molecules without large C8-substitutents had an insignificant affinity for the eight quadruplex types, although those with large π-system-containing C8-substituents (as with the compounds evaluated by Raju and co-workers were found to interact to some extent. Our molecular dynamics simulations support the likelihood that molecules of this type, including those examined by Raju and co-workers, interact with quadruplex DNA through their C8-substituents rather than the PBD moiety itself. It is important for the literature to be clear on this matter, as the mechanism of action of these agents will be under close scrutiny in the near future due to the growing number of PBD-based agents entering the clinic as both single-agents and as components of antibody-drug conjugates (ADCs.

Selection of G-quadruplex folding topology with LNA-modified human telomeric sequences in K+ solution

DEFF Research Database (Denmark)

Pradhan, Devranjan; Hansen, Lykke H; Vester, Birte

2011-01-01

G-rich nucleic acid oligomers can form G-quadruplexes built by G-tetrads stacked upon each other. Depending on the nucleotide sequence, G-quadruplexes fold mainly with two topologies: parallel, in which all G-tracts are oriented parallel to each other, or antiparallel, in which one or more G......-tracts are oriented antiparallel to the other G-tracts. In the former topology, all glycosidic bond angles conform to anti conformations, while in the latter topology they adopt both syn and anti conformations. It is of interest to understand the molecular forces that govern G-quadruplex folding. Here, we approach...... this problem by examining the impact of LNA (locked nucleic acid) modifications on the folding topology of the dimeric model system of the human telomere sequence. In solution, this DNA G-quadruplex forms a mixture of G-quadruplexes with antiparallel and parallel topologies. Using CD and NMR spectroscopies, we...

Simultaneous Binding of Hybrid Molecules Constructed with Dual DNA-Binding Components to a G-Quadruplex and Its Proximal Duplex.

Science.gov (United States)

Asamitsu, Sefan; Obata, Shunsuke; Phan, Anh Tuân; Hashiya, Kaori; Bando, Toshikazu; Sugiyama, Hiroshi

2018-03-20

A G-quadruplex (quadruplex) is a nucleic acid secondary structure adopted by guanine-rich sequences and is considered to be relevant to various pharmacological and biological contexts. Although a number of researchers have endeavored to discover and develop quadruplex-interactive molecules, poor ligand designability originating from topological similarity of the skeleton of diverse quadruplexes has remained a bottleneck for gaining specificity for individual quadruplexes. This work reports on hybrid molecules that were constructed with dual DNA-binding components, a cyclic imidazole/lysine polyamide (cIKP), and a hairpin pyrrole/imidazole polyamide (hPIP), with the aim toward specific quadruplex targeting by reading out the local duplex DNA sequence adjacent to designated quadruplexes in the genome. By means of circular dichroism (CD), fluorescence resonance energy transfer (FRET), surface plasmon resonance (SPR), and NMR techniques, we showed the dual and simultaneous recognition of the respective segment via hybrid molecules, and the synergistic and mutual effect of each binding component that was appropriately linked on higher binding affinity and modest sequence specificity. Monitoring quadruplex and duplex imino protons of the quadruplex/duplex motif titrated with hybrid molecules clearly revealed distinct features of the binding of hybrid molecules to the respective segments upon their simultaneous recognition. A series of the systematic and detailed binding assays described here showed that the concept of simultaneous recognition of quadruplex and its proximal duplex by hybrid molecules constructed with the dual DNA-binding components may provide a new strategy for ligand design, enabling targeting of a large variety of designated quadruplexes at specific genome locations. © 2018 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

Altered biochemical specificity of G-quadruplexes with mutated tetrads

Czech Academy of Sciences Publication Activity Database

Švehlová, Kateřina; Lawrence, M. S.; Bednárová, Lucie; Curtis, Edward A.

2016-01-01

Roč. 44, č. 22 (2016), s. 10789-10803 ISSN 0305-1048 Institutional support: RVO:61388963 Keywords : G-quadruplex * G motif GTP aptamer * peroxidase deoxyribozyme Subject RIV: CE - Biochemistry Impact factor: 10.162, year: 2016 https://academic.oup.com/nar/article/44/22/10789/2333933/Altered-biochemical-specificity-of-G-quadruplexes

Xanthine and 8-oxoguanine in G-quadruplexes: formation of a G·G·X·O tetrad.

Science.gov (United States)

Cheong, Vee Vee; Heddi, Brahim; Lech, Christopher Jacques; Phan, Anh Tuân

2015-12-02

G-quadruplexes are four-stranded structures built from stacked G-tetrads (G·G·G·G), which are planar cyclical assemblies of four guanine bases interacting through Hoogsteen hydrogen bonds. A G-quadruplex containing a single guanine analog substitution, such as 8-oxoguanine (O) or xanthine (X), would suffer from a loss of a Hoogsteen hydrogen bond within a G-tetrad and/or potential steric hindrance. We show that a proper arrangement of O and X bases can reestablish the hydrogen-bond pattern within a G·G·X·O tetrad. Rational incorporation of G·G·X·O tetrads in a (3+1) G-quadruplex demonstrated a similar folding topology and thermal stability to that of the unmodified G-quadruplex. pH titration conducted on X·O-modified G-quadruplexes indicated a protonation-deprotonation equilibrium of X with a pKa ∼6.7. The solution structure of a G-quadruplex containing a G·G·X·O tetrad was determined, displaying the same folding topology in both the protonated and deprotonated states. A G-quadruplex containing a deprotonated X·O pair was shown to exhibit a more electronegative groove compared to that of the unmodified one. These differences are likely to manifest in the electronic properties of G-quadruplexes and may have important implications for drug targeting and DNA-protein interactions. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.

Accuracy of four different digital intraoral scanners: effects of the presence of orthodontic brackets and wire.

Science.gov (United States)

Jung, Yoo-Ran; Park, Ji-Man; Chun, Youn-Sic; Lee, Kkot-Nim; Kim, Minji

The objective of this study was to compare the accuracy of four different digital intraoral scanners and the effects of buccal brackets and orthodontic wire. For this study, three sets of models (Control model, BKT model with buccal bracket, and WBKT model with buccal bracket and orthodontic wire) were scanned using four different types of intraoral scanners: E4D dentist, iTero, Trios, and Zfx IntraScan. The mesiodistal width of the teeth, intercanine width, and intermolar width measured by four scanners were compared. Three-dimensional (3D) images of the brackets were taken using the four scanners. Data were analyzed with one-way ANOVA, independent t test, and post-hoc Tukey test at a significance level of P brackets and orthodontic wire. Comparison of 3D bracket images scanned by the four scanners showed differences in image distortion among the scanners. Bracket characteristics did not affect the 3D bracket images. The four intraoral scanners used in this study differed in accuracy. However, the results acquired by iTero and Trios were more reliable. Effects of buccal brackets and orthodontic wire on the 3D images taken by intraoral scanners were not clinically significant.

Cation Coordination Alters the Conformation of a Thrombin-Binding G-Quadruplex DNA Aptamer That Affects Inhibition of Thrombin.

Science.gov (United States)

Zavyalova, Elena; Tagiltsev, Grigory; Reshetnikov, Roman; Arutyunyan, Alexander; Kopylov, Alexey

2016-10-01

Thrombin-binding aptamers are promising anticoagulants. HD1 is a monomolecular antiparallel G-quadruplex with two G-quartets linked by three loops. Aptamer-thrombin interactions are mediated with two TT-loops that bind thrombin exosite I. Several cations were shown to be coordinated inside the G-quadruplex, including K + , Na + , NH 4 + , Ba 2+ , and Sr 2+ ; on the contrary, Mn 2+ was coordinated in the grooves, outside the G-quadruplex. K + or Na + coordination provides aptamer functional activity. The effect of other cations on aptamer functional activity has not yet been described, because of a lack of relevant tests. Interactions between aptamer HD1 and a series of cations were studied. A previously developed enzymatic method was applied to evaluate aptamer inhibitory activity. The structure-function correlation was studied using the characterization of G-quadruplex conformation by circular dichroism spectroscopy. K + coordination provided the well-known high inhibitory activity of the aptamer, whereas Na + coordination supported low activity. Although NH 4 + coordination yielded a typical antiparallel G-quadruplex, no inhibitory activity was shown; a similar effect was observed for Ba 2+ and Sr 2+ coordination. Mn 2+ coordination destabilized the G-quadruplex that drastically diminished aptamer inhibitory activity. Therefore, G-quadruplex existence per se is insufficient for aptamer inhibitory activity. To elicit the nature of these effects, we thoroughly analyzed nuclear magnetic resonance (NMR) and X-ray data on the structure of the HD1 G-quadruplex with various cations. The most reasonable explanation is that cation coordination changes the conformation of TT-loops, affecting thrombin binding and inhibition. HD1 counterparts, aptamers 31-TBA and NU172, behaved similarly with some distinctions. In 31-TBA, an additional duplex module stabilized antiparallel G-quadruplex conformation at high concentrations of divalent cations; whereas in NU172, a different

Interaction of pyrrolobenzodiazepine (PBD ligands with parallel intermolecular G-quadruplex complex using spectroscopy and ESI-MS.

Directory of Open Access Journals (Sweden)

Gajjela Raju

Full Text Available Studies on ligand interaction with quadruplex DNA, and their role in stabilizing the complex at concentration prevailing under physiological condition, has attained high interest. Electrospray ionization mass spectrometry (ESI-MS and spectroscopic studies in solution were used to evaluate the interaction of PBD and TMPyP4 ligands, stoichiometry and selectivity to G-quadruplex DNA. Two synthetic ligands from PBD family, namely pyrene-linked pyrrolo[2,1-c][1,4]benzodiazepine hybrid (PBD1, mixed imine-amide pyrrolobenzodiazepine dimer (PBD2 and 5,10,15,20-tetrakis(N-methyl-4-pyridylporphyrin (TMPyP4 were studied. G-rich single-stranded oligonucleotide d(5'GGGGTTGGGG3' designated as d(T(2G(8, from the telomeric region of Tetrahymena Glaucoma, was considered for the interaction with ligands. ESI-MS and spectroscopic methods viz., circular dichroism (CD, UV-Visible, and fluorescence were employed to investigate the G-quadruplex structures formed by d(T(2G(8 sequence and its interaction with PBD and TMPyP4 ligands. From ESI-MS spectra, it is evident that the majority of quadruplexes exist as d(T(2G(8(2 and d(T(2G(8(4 forms possessing two to ten cations in the centre, thereby stabilizing the complex. CD band of PBD1 and PBD2 showed hypo and hyperchromicity, on interaction with quadruplex DNA, indicating unfolding and stabilization of quadruplex DNA complex, respectively. UV-Visible and fluorescence experiments suggest that PBD1 bind externally where as PBD2 intercalate moderately and bind externally to G-quadruplex DNA. Further, melting experiments using SYBR Green indicate that PBD1 unfolds and PBD2 stabilizes the G-quadruplex complex. ITC experiments using d(T(2G(8 quadruplex with PBD ligands reveal that PBD1 and PBD2 prefer external/loop binding and external/intercalative binding to quadruplex DNA, respectively. From experimental results it is clear that the interaction of PBD2 and TMPyP4 impart higher stability to the quadruplex complex.

Interaction of Pyrrolobenzodiazepine (PBD) Ligands with Parallel Intermolecular G-Quadruplex Complex Using Spectroscopy and ESI-MS

Science.gov (United States)

Raju, Gajjela; Srinivas, Ragampeta; Santhosh Reddy, Vangala; Idris, Mohammed M.; Kamal, Ahmed; Nagesh, Narayana

2012-01-01

Studies on ligand interaction with quadruplex DNA, and their role in stabilizing the complex at concentration prevailing under physiological condition, has attained high interest. Electrospray ionization mass spectrometry (ESI-MS) and spectroscopic studies in solution were used to evaluate the interaction of PBD and TMPyP4 ligands, stoichiometry and selectivity to G-quadruplex DNA. Two synthetic ligands from PBD family, namely pyrene-linked pyrrolo[2,1-c][1,4]benzodiazepine hybrid (PBD1), mixed imine-amide pyrrolobenzodiazepine dimer (PBD2) and 5,10,15,20-tetrakis(N-methyl-4-pyridyl)porphyrin (TMPyP4) were studied. G-rich single-stranded oligonucleotide d(5′GGGGTTGGGG3′) designated as d(T2G8), from the telomeric region of Tetrahymena Glaucoma, was considered for the interaction with ligands. ESI-MS and spectroscopic methods viz., circular dichroism (CD), UV-Visible, and fluorescence were employed to investigate the G-quadruplex structures formed by d(T2G8) sequence and its interaction with PBD and TMPyP4 ligands. From ESI-MS spectra, it is evident that the majority of quadruplexes exist as d(T2G8)2 and d(T2G8)4 forms possessing two to ten cations in the centre, thereby stabilizing the complex. CD band of PBD1 and PBD2 showed hypo and hyperchromicity, on interaction with quadruplex DNA, indicating unfolding and stabilization of quadruplex DNA complex, respectively. UV-Visible and fluorescence experiments suggest that PBD1 bind externally where as PBD2 intercalate moderately and bind externally to G-quadruplex DNA. Further, melting experiments using SYBR Green indicate that PBD1 unfolds and PBD2 stabilizes the G-quadruplex complex. ITC experiments using d(T2G8) quadruplex with PBD ligands reveal that PBD1 and PBD2 prefer external/loop binding and external/intercalative binding to quadruplex DNA, respectively. From experimental results it is clear that the interaction of PBD2 and TMPyP4 impart higher stability to the quadruplex complex. PMID:22558271

Binding modes and pathway of RHPS4 to human telomeric G-quadruplex and duplex DNA probed by all-atom molecular dynamics simulations with explicit solvent.

Science.gov (United States)

Mulholland, Kelly; Siddiquei, Farzana; Wu, Chun

2017-07-19

RHPS4, a potent binder to human telomeric DNA G-quadruplex, shows high efficacy in tumor cell growth inhibition. However, it's preferential binding to DNA G-quadruplex over DNA duplex (about 10 fold) remains to be improved toward its clinical application. A high resolution structure of the single-stranded telomeric DNA G-quadruplexes, or B-DNA duplex, in complex with RHPS4 is not available yet, and the binding nature of this ligand to these DNA forms remains to be elusive. In this study, we carried out 40 μs molecular dynamics binding simulations with a free ligand to decipher the binding pathway of RHPS4 to a DNA duplex and three G-quadruplex folders (parallel, antiparallel and hybrid) of the human telomeric DNA sequence. The most stable binding mode identified for the duplex, parallel, antiparallel and hybrid G-quadruplexes is an intercalation, bottom stacking, top intercalation and bottom intercalation mode, respectively. The intercalation mode with similar binding strength to both the duplex and the G-quadruplexes, explains the lack of binding selectivity of RHPS4 to the G-quadruplex form. Therefore, a ligand modification that destabilizes the duplex intercalation mode but stabilizes the G-quadruplex intercalation mode will improve the binding selectivity toward G-quadruplex. The intercalation mode of RHPS4 to both the duplex and the antiparallel and the hybrid G-quadruplex follows a base flipping-insertion mechanism rather than an open-insertion mechanism. The groove binding, the side binding and the intercalation with flipping out of base were observed to be intermediate states before the full intercalation state with paired bases.

Macrocyclic G-quadruplex ligands

DEFF Research Database (Denmark)

Nielsen, M C; Ulven, Trond

2010-01-01

are macrocyclic structures which have been modeled after the natural product telomestatin or from porphyrin-based ligands discovered in the late 1990s. These two structural classes of G-quadruplex ligands are reviewed here with special attention to selectivity and structure-activity relationships, and with focus...

Putative DNA G-quadruplex formation within the promoters of Plasmodium falciparum var genes

Directory of Open Access Journals (Sweden)

Rowe J

2009-08-01

Full Text Available Abstract Background Guanine-rich nucleic acid sequences are capable of folding into an intramolecular four-stranded structure called a G-quadruplex. When found in gene promoter regions, G-quadruplexes can downregulate gene expression, possibly by blocking the transcriptional machinery. Here we have used a genome-wide bioinformatic approach to identify Putative G-Quadruplex Sequences (PQS in the Plasmodium falciparum genome, along with biophysical techniques to examine the physiological stability of P. falciparum PQS in vitro. Results We identified 63 PQS in the non-telomeric regions of the P. falciparum clone 3D7. Interestingly, 16 of these PQS occurred in the upstream region of a subset of the P. falciparum var genes (group B var genes. The var gene family encodes PfEMP1, the parasite's major variant antigen and adhesin expressed at the surface of infected erythrocytes, that plays a key role in malaria pathogenesis and immune evasion. The ability of the PQS found in the upstream regions of group B var genes (UpsB-Q to form stable G-quadruplex structures in vitro was confirmed using 1H NMR, circular dichroism, UV spectroscopy, and thermal denaturation experiments. Moreover, the synthetic compound BOQ1 that shows a higher affinity for DNA forming quadruplex rather than duplex structures was found to bind with high affinity to the UpsB-Q. Conclusion This is the first demonstration of non-telomeric PQS in the genome of P. falciparum that form stable G-quadruplexes under physiological conditions in vitro. These results allow the generation of a novel hypothesis that the G-quadruplex sequences in the upstream regions of var genes have the potential to play a role in the transcriptional control of this major virulence-associated multi-gene family.

The Effects of Molecular Crowding on the Structure and Stability of G-Quadruplexes with an Abasic Site

Science.gov (United States)

Fujimoto, Takeshi; Nakano, Shu-ichi; Miyoshi, Daisuke; Sugimoto, Naoki

2011-01-01

Both cellular environmental factors and chemical modifications critically affect the properties of nucleic acids. However, the structure and stability of DNA containing abasic sites under cell-mimicking molecular crowding conditions remain unclear. Here, we investigated the molecular crowding effects on the structure and stability of the G-quadruplexes including a single abasic site. Structural analysis by circular dichroism showed that molecular crowding by PEG200 did not affect the topology of the G-quadruplex structure with or without an abasic site. Thermodynamic analysis further demonstrated that the degree of stabilization of the G-quadruplex by molecular crowding decreased with substitution of an abasic site for a single guanine. Notably, we found that the molecular crowding effects on the enthalpy change for G-quadruplex formation had a linear relationship with the abasic site effects depending on its position. These results are useful for predicting the structure and stability of G-quadruplexes with abasic sites in the cell-mimicking conditions. PMID:21949901

Human telomere sequence DNA in water-free and high-viscosity solvents: G-quadruplex folding governed by Kramers rate theory.

Science.gov (United States)

Lannan, Ford M; Mamajanov, Irena; Hud, Nicholas V

2012-09-19

Structures formed by human telomere sequence (HTS) DNA are of interest due to the implication of telomeres in the aging process and cancer. We present studies of HTS DNA folding in an anhydrous, high viscosity deep eutectic solvent (DES) comprised of choline choride and urea. In this solvent, the HTS DNA forms a G-quadruplex with the parallel-stranded ("propeller") fold, consistent with observations that reduced water activity favors the parallel fold, whereas alternative folds are favored at high water activity. Surprisingly, adoption of the parallel structure by HTS DNA in the DES, after thermal denaturation and quick cooling to room temperature, requires several months, as opposed to less than 2 min in an aqueous solution. This extended folding time in the DES is, in part, due to HTS DNA becoming kinetically trapped in a folded state that is apparently not accessed in lower viscosity solvents. A comparison of times required for the G-quadruplex to convert from its aqueous-preferred folded state to its parallel fold also reveals a dependence on solvent viscosity that is consistent with Kramers rate theory, which predicts that diffusion-controlled transitions will slow proportionally with solvent friction. These results provide an enhanced view of a G-quadruplex folding funnel and highlight the necessity to consider solvent viscosity in studies of G-quadruplex formation in vitro and in vivo. Additionally, the solvents and analyses presented here should prove valuable for understanding the folding of many other nucleic acids and potentially have applications in DNA-based nanotechnology where time-dependent structures are desired.

High-resolution AFM structure of DNA G-wires in aqueous solution.

Science.gov (United States)

Bose, Krishnashish; Lech, Christopher J; Heddi, Brahim; Phan, Anh Tuân

2018-05-17

We investigate the self-assembly of short pieces of the Tetrahymena telomeric DNA sequence d[G 4 T 2 G 4 ] in physiologically relevant aqueous solution using atomic force microscopy (AFM). Wire-like structures (G-wires) of 3.0 nm height with well-defined surface periodic features were observed. Analysis of high-resolution AFM images allowed their classification based on the periodicity of these features. A major species is identified with periodic features of 4.3 nm displaying left-handed ridges or zigzag features on the molecular surface. A minor species shows primarily left-handed periodic features of 2.2 nm. In addition to 4.3 and 2.2 nm ridges, background features with periodicity of 0.9 nm are also observed. Using molecular modeling and simulation, we identify a molecular structure that can explain both the periodicity and handedness of the major G-wire species. Our results demonstrate the potential structural diversity of G-wire formation and provide valuable insight into the structure of higher-order intermolecular G-quadruplexes. Our results also demonstrate how AFM can be combined with simulation to gain insight into biomolecular structure.

Quadruplex-forming properties of FRAXA (CGG) repeats interrupted by (AGG) triplets

Czech Academy of Sciences Publication Activity Database

Renčiuk, Daniel; Zemánek, Michal; Kejnovská, Iva; Vorlíčková, Michaela

2009-01-01

Roč. 91, č. 3 (2009), s. 416-422 ISSN 0300-9084 R&D Projects: GA ČR(CZ) GA204/07/0057; GA AV ČR(CZ) IAA100040701 Institutional research plan: CEZ:AV0Z50040507; CEZ:AV0Z50040702 Keywords : fragile X-chromosome * quadruplex * CD spectroscopy Subject RIV: BO - Biophysics Impact factor: 3.897, year: 2009

Stabilization of Telomere G-Quadruplexes Interferes with Human Herpesvirus 6A Chromosomal Integration.

Science.gov (United States)

Gilbert-Girard, Shella; Gravel, Annie; Artusi, Sara; Richter, Sara N; Wallaschek, Nina; Kaufer, Benedikt B; Flamand, Louis

2017-07-15

Human herpesviruses 6A and 6B (HHV-6A/B) can integrate their genomes into the telomeres of human chromosomes using a mechanism that remains poorly understood. To achieve a better understanding of the HHV-6A/B integration mechanism, we made use of BRACO-19, a compound that stabilizes G-quadruplex secondary structures and prevents telomere elongation by the telomerase complex. First, we analyzed the folding of telomeric sequences into G-quadruplex structures and their binding to BRACO-19 using G-quadruplex-specific antibodies and surface plasmon resonance. Circular dichroism studies indicate that BRACO-19 modifies the conformation and greatly stabilizes the G-quadruplexes formed in G-rich telomeric DNA. Subsequently we assessed the effects of BRACO-19 on the HHV-6A initial phase of infection. Our results indicate that BRACO-19 does not affect entry of HHV-6A DNA into cells. We next investigated if stabilization of G-quadruplexes by BRACO-19 affected HHV-6A's ability to integrate its genome into host chromosomes. Incubation of telomerase-expressing cells with BRACO-19, such as HeLa and MCF-7, caused a significant reduction in the HHV-6A integration frequency ( P integration frequency in U2OS cells that lack telomerase activity and elongate their telomeres through alternative lengthening mechanisms. Our data suggest that the fluidity of telomeres is important for efficient chromosomal integration of HHV-6A and that interference with telomerase activity negatively affects the generation of cellular clones containing integrated HHV-6A. IMPORTANCE HHV-6A/B can integrate their genomes into the telomeres of infected cells. Telomeres consist of repeated hexanucleotides (TTAGGG) of various lengths (up to several kilobases) and end with a single-stranded 3' extension. To avoid recognition and induce a DNA damage response, the single-stranded overhang folds back on itself and forms a telomeric loop (T-loop) or adopts a tertiary structure, referred to as a G-quadruplex. In the

Design, synthesis and evaluation of 4,7-diamino-1,10-phenanthroline G-quadruplex ligands

DEFF Research Database (Denmark)

Nielsen, Mads Corvinius; Borch, Jonas; Ulven, Trond

2009-01-01

the central ionic column. Introduction of positively charged side chains results in compounds with appreciable G-quadruplex stabilizing properties and high aqueous solubility, with the longer side chains giving more potent compounds. Ligands carrying guanidine side chains in general show higher quadruplex...... stabilizing activity and distinctly slower kinetic properties than their amino and dimethylamino analogues, possibly due to specific hydrogen bond interactions with the G-quadruplex loops....

A twice-as-smart synthetic G-quartet: PyroTASQ is both a smart quadruplex ligand and a smart fluorescent probe.

Science.gov (United States)

Laguerre, Aurélien; Stefan, Loic; Larrouy, Manuel; Genest, David; Novotna, Jana; Pirrotta, Marc; Monchaud, David

2014-09-03

Recent and unambiguous evidences of the formation of DNA and RNA G-quadruplexes in cells has provided solid support for these structures to be considered as valuable targets in oncology. Beyond this, they have lent further credence to the anticancer strategies relying on small molecules that selectively target these higher-order DNA/RNA architectures, referred to as G-quadruplex ligands. They have also shed bright light on the necessity of designing multitasking ligands, displaying not only enticing quadruplex interacting properties (affinity, structural selectivity) but also additional features that make them usable for detecting quadruplexes in living cells, notably for determining whether, when, and where these structures fold and unfold during the cell cycle and also for better assessing the consequences of their stabilization by external agents. Herein, we report a brand new design of such multitasking ligands, whose structure experiences a quadruplex-promoted conformational switch that triggers not only its quadruplex affinity (i.e., smart ligands, which display high affinity and selectivity for DNA/RNA quadruplexes) but also its fluorescence (i.e., smart probes, which behave as selective light-up fluorescent reporters on the basis of a fluorogenic electron redistribution). The first prototype of such multifunctional ligands, termed PyroTASQ, represents a brand new generation of quadruplex ligands that can be referred to as "twice-as-smart" quadruplex ligands.

UvrD in Deinococcus radiodurans is optimized for processing G-quadruplex DNA

International Nuclear Information System (INIS)

Das, Anubrata; Misra, H.S.

2015-01-01

Deinococcus radiodurans R1 is a radiation resistant Gram-positive bacterium capable of tolerating very high doses of DNA-damaging agents such as gamma radiation (D10 ∼ 12kGy) desiccation (∼ 5% relative humidity), UVC radiation (D10 ∼ 800J/m 2 ) and hydrogen peroxide (40 mM). It achieves this by using a complex regulatory mechanism and novel proteins. Recently bioinformatic analysis showed several stretches of guanine runs in D.radiodurans genome, which could form G-quartets. The role of G-quartets in regulatory processes is well documented in various organisms. The presence of G -quartets in D. radiodurans means that there are regulatory or structural proteins which would bind to these elements. Several proteins are known to bind G-quartets. Finding the proteins which would bind to G4 DNA is difficult as no specific motifs are available for binding these elements. Also most of the known proteins that are shown to bind to G-quadruplex DNA are of eukaryotic nature. To overcome these challenges we defined a set of known G-quadruplex binding proteins and used a smith-waterman algorithm with our own scoring matrix to homologs of G-quadruplex binding proteins in D.radiodurans. Using bioinformatics analysis, we showed that UvrD (DR 1775) of D. radiodurans has ability to bind/translocate along G-quadruplex DNA, a novel feature in prokaryotes. The translocase activity of DR1775 is ATP specific and this ATPase activity is attenuated by ssDNA. Data supporting UvrD of D. radiodurans as a G-quadruplex DNA metabolizing proteins would be presented. (author)

G-Quadruplex DNAzyme Molecular Beacon for Amplified Colorimetric Biosensing of Pseudostellaria heterophylla

Directory of Open Access Journals (Sweden)

Juan Hu

2013-01-01

Full Text Available With an internal transcribed spacer of 18 S, 5.8 S and 26 S nuclear ribosomal DNA (nrDNA ITS as DNA marker, we report a colorimetric approach for authentication of Pseudostellaria heterophylla (PH and its counterfeit species based on the differentiation of the nrDNA ITS sequence. The assay possesses an unlabelled G-quadruplex DNAzyme molecular beacon (MB probe, employing complementary sequence as biorecognition element and 1:1:1:1 split G-quadruplex halves as reporter. In the absence of target DNA (T-DNA, the probe can shape intermolecular G-quadruplex structures capable of binding hemin to form G-quadruplex-hemin DNAzyme and catalyze the oxidation of ABTS2− to blue-green ABTS•− by H2O2. In the presence of T-DNA, T-DNA can hybridize with the complementary sequence to form a duplex structure, hindering the formation of the G-quadruplex structure and resulting in the loss of the catalytic activity. Consequently, a UV-Vis absorption signal decrease is observed in the ABTS2−-H2O2 system. The “turn-off” assay allows the detection of T-DNA from 1.0 × 10−9 to 3.0 × 10−7 mol·L−1 (R2 = 0.9906, with a low detection limit of 3.1 × 10−10 mol·L−1. The present study provides a sensitive and selective method and may serve as a foundation of utilizing the DNAzyme MB sensor for identifying traditional Chinese medicines.

Human telomeric DNA: G-quadruplex, i-motif and Watson–Crick double helix

Science.gov (United States)

Phan, Anh Tuân; Mergny, Jean-Louis

2002-01-01

Human telomeric DNA composed of (TTAGGG/CCCTAA)n repeats may form a classical Watson–Crick double helix. Each individual strand is also prone to quadruplex formation: the G-rich strand may adopt a G-quadruplex conformation involving G-quartets whereas the C-rich strand may fold into an i-motif based on intercalated C·C+ base pairs. Using an equimolar mixture of the telomeric oligonucleotides d[AGGG(TTAGGG)3] and d[(CCCTAA)3CCCT], we defined which structures existed and which would be the predominant species under a variety of experimental conditions. Under near-physiological conditions of pH, temperature and salt concentration, telomeric DNA was predominantly in a double-helix form. However, at lower pH values or higher temperatures, the G-quadruplex and/or the i-motif efficiently competed with the duplex. We also present kinetic and thermodynamic data for duplex association and for G-quadruplex/i-motif unfolding. PMID:12409451

Separation of the potential G-quadruplex ligands from the butanol extract of Zanthoxylum ailanthoides Sieb. & Zucc. by countercurrent chromatography and preparative high performance liquid chromatography.

Science.gov (United States)

Han, Tian; Cao, Xueli; Xu, Jing; Pei, Hairun; Zhang, Hong; Tang, Yalin

2017-07-21

G-quadruplex DNA structure is considered to be a very attractive target for antitumor drug design due to its unique role in maintaining telomerase activities. Therefore, discovering ligands with high stability of G-quadruplex structure is of great interest. In this paper, pH-zone refining counter current chromatography (CCC) and preparative high performance liquid chromatography (HPLC) were employed for the separation of potent G-quadruplex ligands from the n-butanol fraction of the crude extract of Zanthoxylum ailanthoides, which is a traditional Chinese medicine recently found to display high inhibitory activity against several human cancer cells. The 75% aqueous ethanol extract of the stem bark of Z. ailanthoides and its fractions with petroleum ether, ethyl acetate and n-butanol displayed almost the same G-quadruplex stabilization ability. Here, pH-zone refining CCC was used for the separation of the alkaloids from the n-butanol fraction by a seldom used solvent system composed of dichloromethane-methanol-water (4:1:2.5) with 10mM TEA in the organic stationary phase as retainer and 10mM HCl in the aqueous mobile phase as eluter. Compounds I, II and III were obtained, with purity greater than 95%, in the quantities of 31.2, 94.0, and 26.4mg respectively from 300mg of lipophilic fraction within 80min, which were identified as three tetrahydroprotoberberines isolated for the first time in this plant. In addition, a phenylpropanoid glycoside compound IV (Syringin), an isoquinoline (Magnoflorine, V), and two lignin isomers (+)-lyoniresiol-3α-O-β-d-glucopyranoside (VI) and (-)-lyoniresinol -3α-O-β-D -glucopyranoside (VII) were isolated by traditional CCC together with preparative HPLC. Compounds IV, V, VI and VII were obtained, with purity greater than 95%, in the quantities of 4.0, 13.2, 6.7, and 6.5mg respectively from 960mg of hydrophilic fraction. Among the seven isolated compounds, tetrahydroprotoberberine I, II and III were found to display remarkable

Development of a carbazole-based fluorescence probe for G-quadruplex DNA: The importance of side-group effect on binding specificity

Science.gov (United States)

Wang, Ming-Qi; Ren, Gui-Ying; Zhao, Shuang; Lian, Guang-Chang; Chen, Ting-Ting; Ci, Yang; Li, Hong-Yao

2018-06-01

G-quadruplex DNAs are highly prevalent in the human genome and involved in many important biological processes. However, many aspects of their biological mechanism and significance still need to be elucidated. Therefore, the development of fluorescent probes for G-quadruplex detection is important for the basic research. We report here on the development of small molecular dyes designed on the basis of carbazole scaffold by introducing styrene-like substituents at its 9-position, for the purpose of G-quadruplex recognition. Results revealed that the side group on the carbazole scaffold was very important for their ability to selectively recognize G-quadruplex DNA structures. 1a with the pyridine side group displayed excellent fluorescence signal turn-on property for the specific discrimination of G-quadruplex DNAs against other nucleic acids. The characteristics of 1a were further investigated with UV-vis spectrophotometry, fluorescence, circular dichroism, FID assay and molecular docking to validate the selectivity, sensitivity and detailed binding mode toward G-quadruplex DNAs.

Biochemical techniques for the characterization of G-quadruplex structures: EMSA, DMS footprinting, and DNA polymerase stop assay.

Science.gov (United States)

Sun, Daekyu; Hurley, Laurence H

2010-01-01

The proximal promoter region of many human growth-related genes contains a polypurine/polypyrimidine tract that serves as multiple binding sites for Sp1 or other transcription factors. These tracts often contain a guanine-rich sequence consisting of four runs of three or more contiguous guanines separated by one or more bases, corresponding to a general motif known for the formation of an intramolecular G-quadruplex. Recent results provide strong evidence that specific G-quadruplex structures form naturally within these polypurine/polypyrimidine tracts in many human promoter regions, raising the possibility that the transcriptional control of these genes can be modulated by G-quadruplex-interactive agents. In this chapter, we describe three general biochemical methodologies, electrophoretic mobility shift assay (EMSA), dimethylsulfate (DMS) footprinting, and the DNA polymerase stop assay, which can be useful for initial characterization of G-quadruplex structures formed by G-rich sequences.

Structural Insights into the Quadruplex-Duplex 3' Interface Formed from a Telomeric Repeat: A Potential Molecular Target.

Science.gov (United States)

Russo Krauss, Irene; Ramaswamy, Sneha; Neidle, Stephen; Haider, Shozeb; Parkinson, Gary N

2016-02-03

We report here on an X-ray crystallographic and molecular modeling investigation into the complex 3' interface formed between putative parallel stranded G-quadruplexes and a duplex DNA sequence constructed from the human telomeric repeat sequence TTAGGG. Our crystallographic approach provides a detailed snapshot of a telomeric 3' quadruplex-duplex junction: a junction that appears to have the potential to form a unique molecular target for small molecule binding and interference with telomere-related functions. This unique target is particularly relevant as current high-affinity compounds that bind putative G-quadruplex forming sequences only rarely have a high degree of selectivity for a particular quadruplex. Here DNA junctions were assembled using different putative quadruplex-forming scaffolds linked at the 3' end to a telomeric duplex sequence and annealed to a complementary strand. We successfully generated a series of G-quadruplex-duplex containing crystals, both alone and in the presence of ligands. The structures demonstrate the formation of a parallel folded G-quadruplex and a B-form duplex DNA stacked coaxially. Most strikingly, structural data reveals the consistent formation of a TAT triad platform between the two motifs. This triad allows for a continuous stack of bases to link the quadruplex motif with the duplex region. For these crystal structures formed in the absence of ligands, the TAT triad interface occludes ligand binding at the 3' quadruplex-duplex interface, in agreement with in silico docking predictions. However, with the rearrangement of a single nucleotide, a stable pocket can be produced, thus providing an opportunity for the binding of selective molecules at the interface.

Thermodynamic fingerprints of ligand binding to human telomeric G-quadruplexes

OpenAIRE

Bon?ina, Matja?; Podlipnik, ?rtomir; Piantanida, Ivo; Eilmes, Julita; Teulade-Fichou, Marie-Paule; Vesnaver, Gorazd; Lah, Jurij

2015-01-01

Thermodynamic studies of ligand binding to human telomere (ht) DNA quadruplexes, as a rule, neglect the involvement of various ht-DNA conformations in the binding process. Therefore, the thermodynamic driving forces and the mechanisms of ht-DNA G-quadruplex-ligand recognition remain poorly understood. In this work we characterize thermodynamically and structurally binding of netropsin (Net), dibenzotetraaza[14]annulene derivatives (DP77, DP78), cationic porphyrin (TMPyP4) and two bisquinolini...

G-quadruplex induced chirality of methylazacalix[6]pyridine via unprecedented binding stoichiometry: en route to multiplex controlled molecular switch

Science.gov (United States)

Guan, Ai-Jiao; Shen, Meng-Jie; Xiang, Jun-Feng; Zhang, En-Xuan; Li, Qian; Sun, Hong-Xia; Wang, Li-Xia; Xu, Guang-Zhi; Tang, Ya-Lin; Xu, Li-Jin; Gong, Han-Yuan

2015-05-01

Nucleic acid based molecular device is a developing research field which attracts great interests in material for building machinelike nanodevices. G-quadruplex, as a new type of DNA secondary structures, can be harnessed to construct molecular device owing to its rich structural polymorphism. Herein, we developed a switching system based on G-quadruplexes and methylazacalix[6]pyridine (MACP6). The induced circular dichroism (CD) signal of MACP6 was used to monitor the switch controlled by temperature or pH value. Furthermore, the CD titration, Job-plot, variable temperature CD and 1H-NMR experiments not only confirmed the binding mode between MACP6 and G-quadruplex, but also explained the difference switching effect of MACP6 and various G-quadruplexes. The established strategy has the potential to be used as the chiral probe for specific G-quadruplex recognition.

Synthesis and Molecular Modeling of Thermally Stable DNA G-Quadruplexes with Anthraquinone Insertions

DEFF Research Database (Denmark)

Gouda, Alaa S.; Amine, Mahasen S.; Pedersen, Erik Bjerregaard

2017-01-01

Two new phosphoramidite building blocks for DNA synthesis were synthesized from 1,5- and 2,6-dihydroxyanthraquinones through alkylation with 3-bromo-1-propanol followed by DMT-protection. The novel synthesized 1,5- and 2,6-disubstituted anthraquinone monomers H15 and H26 are incorporated into a G...... anthraquinone-modified quadruplexes revealed no change of the antiparallel structure when compared with the wild type under potassium buffer conditions. The significantly increased thermostabilities were interpreted by molecular modeling of anthraquinone-modified G-quadruplexes....

Formation of a unique cluster of G-quadruplex structures in the HIV-1 Nef coding region: implications for antiviral activity.

Directory of Open Access Journals (Sweden)

Rosalba Perrone

Full Text Available G-quadruplexes are tetraplex structures of nucleic acids that can form in G-rich sequences. Their presence and functional role have been established in telomeres, oncogene promoters and coding regions of the human chromosome. In particular, they have been proposed to be directly involved in gene regulation at the level of transcription. Because the HIV-1 Nef protein is a fundamental factor for efficient viral replication, infectivity and pathogenesis in vitro and in vivo, we investigated G-quadruplex formation in the HIV-1 nef gene to assess the potential for viral inhibition through G-quadruplex stabilization. A comprehensive computational analysis of the nef coding region of available strains showed the presence of three conserved sequences that were uniquely clustered. Biophysical testing proved that G-quadruplex conformations were efficiently stabilized or induced by G-quadruplex ligands in all three sequences. Upon incubation with a G-quadruplex ligand, Nef expression was reduced in a reporter gene assay and Nef-dependent enhancement of HIV-1 infectivity was significantly repressed in an antiviral assay. These data constitute the first evidence of the possibility to regulate HIV-1 gene expression and infectivity through G-quadruplex targeting and therefore open a new avenue for viral treatment.

Thrombin-Binding Aptamer Quadruplex Formation: AFM and Voltammetric Characterization

Directory of Open Access Journals (Sweden)

Victor Constantin Diculescu

2010-01-01

Full Text Available The adsorption and the redox behaviour of thrombin-binding aptamer (TBA and extended TBA (eTBA were studied using atomic force microscopy and voltammetry at highly oriented pyrolytic graphite and glassy carbon. The different adsorption patterns and degree of surface coverage were correlated with the sequence base composition, presence/absence of K+, and voltammetric behaviour of TBA and eTBA. In the presence of K+, only a few single-stranded sequences present adsorption, while the majority of the molecules forms stable and rigid quadruplexes with no adsorption. Both TBA and eTBA are oxidized and the only anodic peak corresponds to guanine oxidation. Upon addition of K+ ions, TBA and eTBA fold into a quadruplex, causing the decrease of guanine oxidation peak and occurrence of a new peak at a higher potential due to the oxidation of G-quartets. The higher oxidation potential of G-quartets is due to the greater difficulty of electron transfer from the inside of the quadruplex to the electrode surface than electron transfer from the more flexible single strands.

Giardia telomeric sequence d(TAGGG)4 forms two intramolecular G-quadruplexes in K+ solution: effect of loop length and sequence on the folding topology.

Science.gov (United States)

Hu, Lanying; Lim, Kah Wai; Bouaziz, Serge; Phan, Anh Tuân

2009-11-25

Recently, it has been shown that in K(+) solution the human telomeric sequence d[TAGGG(TTAGGG)(3)] forms a (3 + 1) intramolecular G-quadruplex, while the Bombyx mori telomeric sequence d[TAGG(TTAGG)(3)], which differs from the human counterpart only by one G deletion in each repeat, forms a chair-type intramolecular G-quadruplex, indicating an effect of G-tract length on the folding topology of G-quadruplexes. To explore the effect of loop length and sequence on the folding topology of G-quadruplexes, here we examine the structure of the four-repeat Giardia telomeric sequence d[TAGGG(TAGGG)(3)], which differs from the human counterpart only by one T deletion within the non-G linker in each repeat. We show by NMR that this sequence forms two different intramolecular G-quadruplexes in K(+) solution. The first one is a novel basket-type antiparallel-stranded G-quadruplex containing two G-tetrads, a G x (A-G) triad, and two A x T base pairs; the three loops are consecutively edgewise-diagonal-edgewise. The second one is a propeller-type parallel-stranded G-quadruplex involving three G-tetrads; the three loops are all double-chain-reversal. Recurrence of several structural elements in the observed structures suggests a "cut and paste" principle for the design and prediction of G-quadruplex topologies, for which different elements could be extracted from one G-quadruplex and inserted into another.

Expression of Telomere-Associated Proteins is Interdependent to Stabilize Native Telomere Structure and Telomere Dysfunction by G-Quadruplex Ligand Causes TERRA Upregulation.

Science.gov (United States)

Sadhukhan, Ratan; Chowdhury, Priyanka; Ghosh, Sourav; Ghosh, Utpal

2018-06-01

Telomere DNA can form specialized nucleoprotein structure with telomere-associated proteins to hide free DNA ends or G-quadruplex structures under certain conditions especially in presence of G-quadruplex ligand. Telomere DNA is transcribed to form non-coding telomere repeat-containing RNA (TERRA) whose biogenesis and function is poorly understood. Our aim was to find the role of telomere-associated proteins and telomere structures in TERRA transcription. We silenced four [two shelterin (TRF1, TRF2) and two non-shelterin (PARP-1, SLX4)] telomere-associated genes using siRNA and verified depletion in protein level. Knocking down of one gene modulated expression of other telomere-associated genes and increased TERRA from 10q, 15q, XpYp and XqYq chromosomes in A549 cells. Telomere was destabilized or damaged by G-quadruplex ligand pyridostatin (PDS) and bleomycin. Telomere dysfunction-induced foci (TIFs) were observed for each case of depletion of proteins, treatment with PDS or bleomycin. TERRA level was elevated by PDS and bleomycin treatment alone or in combination with depletion of telomere-associated proteins.

Thermodynamic fingerprints of ligand binding to human telomeric G-quadruplexes.

Science.gov (United States)

Bončina, Matjaž; Podlipnik, Črtomir; Piantanida, Ivo; Eilmes, Julita; Teulade-Fichou, Marie-Paule; Vesnaver, Gorazd; Lah, Jurij

2015-12-02

Thermodynamic studies of ligand binding to human telomere (ht) DNA quadruplexes, as a rule, neglect the involvement of various ht-DNA conformations in the binding process. Therefore, the thermodynamic driving forces and the mechanisms of ht-DNA G-quadruplex-ligand recognition remain poorly understood. In this work we characterize thermodynamically and structurally binding of netropsin (Net), dibenzotetraaza[14]annulene derivatives (DP77, DP78), cationic porphyrin (TMPyP4) and two bisquinolinium ligands (Phen-DC3, 360A-Br) to the ht-DNA fragment (Tel22) AGGG(TTAGGG)3 using isothermal titration calorimetry, CD and fluorescence spectroscopy, gel electrophoresis and molecular modeling. By global thermodynamic analysis of experimental data we show that the driving forces characterized by contributions of specific interactions, changes in solvation and conformation differ significantly for binding of ligands with low quadruplex selectivity over duplexes (Net, DP77, DP78, TMPyP4; KTel22 ≈ KdsDNA). These contributions are in accordance with the observed structural features (changes) and suggest that upon binding Net, DP77, DP78 and TMPyP4 select hybrid-1 and/or hybrid-2 conformation while Phen-DC3 and 360A-Br induce the transition of hybrid-1 and hybrid-2 to the structure with characteristics of antiparallel or hybrid-3 type conformation. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.

Fragile X mental retardation protein recognizes a G quadruplex structure within the survival motor neuron domain containing 1 mRNA 5'-UTR.

Science.gov (United States)

McAninch, Damian S; Heinaman, Ashley M; Lang, Cara N; Moss, Kathryn R; Bassell, Gary J; Rita Mihailescu, Mihaela; Evans, Timothy L

2017-07-25

G quadruplex structures have been predicted by bioinformatics to form in the 5'- and 3'-untranslated regions (UTRs) of several thousand mature mRNAs and are believed to play a role in translation regulation. Elucidation of these roles has primarily been focused on the 3'-UTR, with limited focus on characterizing the G quadruplex structures and functions in the 5'-UTR. Investigation of the affinity and specificity of RNA binding proteins for 5'-UTR G quadruplexes and the resulting regulatory effects have also been limited. Among the mRNAs predicted to form a G quadruplex structure within the 5'-UTR is the survival motor neuron domain containing 1 (SMNDC1) mRNA, encoding a protein that is critical to the spliceosome. Additionally, this mRNA has been identified as a potential target of the fragile X mental retardation protein (FMRP), whose loss of expression leads to fragile X syndrome. FMRP is an RNA binding protein involved in translation regulation that has been shown to bind mRNA targets that form G quadruplex structures. In this study we have used biophysical methods to investigate G quadruplex formation in the 5'-UTR of SMNDC1 mRNA and analyzed its interactions with FMRP. Our results show that SMNDC1 mRNA 5'-UTR forms an intramolecular, parallel G quadruplex structure comprised of three G quartet planes, which is bound specifically by FMRP both in vitro and in mouse brain lysates. These findings suggest a model by which FMRP might regulate the translation of a subset of its mRNA targets by recognizing the G quadruplex structure present in their 5'-UTR, and affecting their accessibility by the protein synthesis machinery.

Effect of Monovalent Ion Parameters on Molecular Dynamics Simulations of G-Quadruplexes

Czech Academy of Sciences Publication Activity Database

Havrila, Marek; Stadlbauer, Petr; Islam, Barira; Otyepka, M.; Šponer, Jiří

2017-01-01

Roč. 13, č. 8 (2017), s. 3911-3926 ISSN 1549-9618 R&D Projects: GA MŠk EF15_003/0000477; GA ČR(CZ) GA16-13721S Institutional support: RVO:68081707 Keywords : telomeric g-quadruplex * amber force-field * nucleic-acid quadruplexes Subject RIV: CF - Physical ; Theoretical Chemistry OBOR OECD: Physical chemistry Impact factor: 5.245, year: 2016

G-Quadruplexes Involving Both Strands of Genomic DNA Are Highly Abundant and Colocalize with Functional Sites in the Human Genome.

Directory of Open Access Journals (Sweden)

Andrzej S Kudlicki

Full Text Available The G-quadruplex is a non-canonical DNA structure biologically significant in DNA replication, transcription and telomere stability. To date, only G4s with all guanines originating from the same strand of DNA have been considered in the context of the human nuclear genome. Here, I discuss interstrand topological configurations of G-quadruplex DNA, consisting of guanines from both strands of genomic DNA; an algorithm is presented for predicting such structures. I have identified over 550,000 non-overlapping interstrand G-quadruplex forming sequences in the human genome--significantly more than intrastrand configurations. Functional analysis of interstrand G-quadruplex sites shows strong association with transcription initiation, the results are consistent with the XPB and XPD transcriptional helicases binding only to G-quadruplex DNA with interstrand topology. Interstrand quadruplexes are also enriched in origin of replication sites. Several topology classes of interstrand quadruplex-forming sequences are possible, and different topologies are enriched in different types of structural elements. The list of interstrand quadruplex forming sequences, and the computer program used for their prediction are available at the web address http://moment.utmb.edu/allquads.

Identification of New Natural DNA G-Quadruplex Binders Selected by a Structure-Based Virtual Screening Approach

Directory of Open Access Journals (Sweden)

Stefano Alcaro

2013-09-01

Full Text Available The G-quadruplex DNA structures are mainly present at the terminal portion of telomeres and can be stabilized by ligands able to recognize them in a specific manner. The recognition process is usually related to the inhibition of the enzyme telomerase indirectly involved and over-expressed in a high percentage of human tumors. There are several ligands, characterized by different chemical structures, already reported in the literature for their ability to bind and stabilize the G-quadruplex structures. Using the structural and biological information available on these structures; we performed a high throughput in silico screening of commercially natural compounds databases by means of a structure-based approach followed by docking experiments against the human telomeric sequence d[AG3(T2AG33]. We identified 12 best hits characterized by different chemical scaffolds and conformational and physicochemical properties. All of them were associated to an improved theoretical binding affinity with respect to that of known selective G-binders. Among these hits there is a chalcone derivative; structurally very similar to the polyphenol butein; known to remarkably inhibit the telomerase activity.

Flying spin-qubit gates implemented through Dresselhaus and Rashba spin-orbit couplings

International Nuclear Information System (INIS)

Gong, S.J.; Yang, Z.Q.

2007-01-01

A theoretical scheme is proposed to implement flying spin-qubit gates based on two semiconductor wires with Dresselhaus and Rashba spin-orbit couplings (SOCs), respectively. It is found that under the manipulation of the Dresselhaus/Rashba SOC, spin rotates around x/y axis in the three-dimensional spin space. By combining the two kinds of manipulations, i.e. connecting the two kinds of semiconductor wires in series, we obtain a universal set of losses flying single-qubit gates including Hadamard, phase, and π/8 gates. A ballistic switching effect of electronic flow is also found in the investigation. Our results may be useful in future spin or nanoscale electronics

The role of alkali metal cations in the stabilization of guanine quadruplexes: why K(+) is the best.

Science.gov (United States)

Zaccaria, F; Paragi, G; Fonseca Guerra, C

2016-08-21

The alkali metal ion affinity of guanine quadruplexes has been studied using dispersion-corrected density functional theory (DFT-D). We have done computational investigations in aqueous solution that mimics artificial supramolecular conditions where guanine bases assemble into stacked quartets as well as biological environments in which telomeric quadruplexes are formed. In both cases, an alkali metal cation is needed to assist self-assembly. Our quantum chemical computations on these supramolecular systems are able to reproduce the experimental order of affinity of the guanine quadruplexes for the cations Li(+), Na(+), K(+), Rb(+), and Cs(+). The strongest binding is computed between the potassium cation and the quadruplex as it occurs in nature. The desolvation and the size of alkali metal cations are thought to be responsible for the order of affinity. Until now, the relative importance of these two factors has remained unclear and debated. By assessing the quantum chemical 'size' of the cation, determining the amount of deformation of the quadruplex needed to accommodate the cation and through the energy decomposition analysis (EDA) of the interaction energy between the cation and the guanines, we reveal that the desolvation and size of the alkali metal cation are both almost equally responsible for the order of affinity.

A Selective G-Quadruplex DNA-Stabilizing Ligand Based on a Cyclic Naphthalene Diimide Derivative

Directory of Open Access Journals (Sweden)

Md. Monirul Islam

2015-06-01

Full Text Available A cyclic naphthalene diimide (cyclic NDI, 1, carrying a benzene moiety as linker chain, was synthesized and its interaction with G-quadruplex DNAs of a-core and a-coreTT as a human telomeric DNA, c-kit and c-myc as DNA sequence at promoter region, or thrombin-binding aptamer (TBA studied based on UV-VIS and circular dichroism (CD spectroscopic techniques, thermal melting temperature measurement, and FRET-melting assay. The circular dichroism spectra showed that 1 induced the formation of different types of G-quadruplex DNA structure. Compound 1 bound to these G-quadruplexes with affinities in the range of 106–107 M−1 order and a 2:1 stoichiometry. Compound 1 showed 270-fold higher selectivity for a-core than dsDNA with a preferable a-core binding than a-coreTT, c-kit, c-myc and TBA in the presence of K+, which is supported by thermal melting studies. The FRET-melting assay also showed that 1 bound preferentially to human telomeric DNA. Compound 1 showed potent inhibition against telomerase activity with an IC50 value of 0.9 μM and preferable binding to G-quadruplexes DNA than our previously published cyclic NDI derivative 3 carrying a benzene moiety as longer linker chain.

Identification of the DNA-Binding Domains of Human Replication Protein A That Recognize G-Quadruplex DNA

Directory of Open Access Journals (Sweden)

Aishwarya Prakash

2011-01-01

Full Text Available Replication protein A (RPA, a key player in DNA metabolism, has 6 single-stranded DNA-(ssDNA- binding domains (DBDs A-F. SELEX experiments with the DBDs-C, -D, and -E retrieve a 20-nt G-quadruplex forming sequence. Binding studies show that RPA-DE binds preferentially to the G-quadruplex DNA, a unique preference not observed with other RPA constructs. Circular dichroism experiments show that RPA-CDE-core can unfold the G-quadruplex while RPA-DE stabilizes it. Binding studies show that RPA-C binds pyrimidine- and purine-rich sequences similarly. This difference between RPA-C and RPA-DE binding was also indicated by the inability of RPA-CDE-core to unfold an oligonucleotide containing a TC-region 5′ to the G-quadruplex. Molecular modeling studies of RPA-DE and telomere-binding proteins Pot1 and Stn1 reveal structural similarities between the proteins and illuminate potential DNA-binding sites for RPA-DE and Stn1. These data indicate that DBDs of RPA have different ssDNA recognition properties.

Co-transcriptional formation of DNA:RNA hybrid G-quadruplex and potential function as constitutional cis element for transcription control.

Science.gov (United States)

Zheng, Ke-wei; Xiao, Shan; Liu, Jia-quan; Zhang, Jia-yu; Hao, Yu-hua; Tan, Zheng

2013-05-01

G-quadruplex formation in genomic DNA is considered to regulate transcription. Previous investigations almost exclusively focused on intramolecular G-quadruplexes formed by DNA carrying four or more G-tracts, and structure formation has rarely been studied in physiologically relevant processes. Here, we report an almost entirely neglected, but actually much more prevalent form of G-quadruplexes, DNA:RNA hybrid G-quadruplexes (HQ) that forms in transcription. HQ formation requires as few as two G-tracts instead of four on a non-template DNA strand. Potential HQ sequences (PHQS) are present in >97% of human genes, with an average of 73 PHQSs per gene. HQ modulates transcription under both in vitro and in vivo conditions. Transcriptomal analysis of human tissues implies that maximal gene expression may be limited by the number of PHQS in genes. These features suggest that HQs may play fundamental roles in transcription regulation and other transcription-mediated processes.

Duplex/quadruplex oligonucleotides: Role of the duplex domain in the stabilization of a new generation of highly effective anti-thrombin aptamers.

Science.gov (United States)

Russo Krauss, Irene; Napolitano, Valeria; Petraccone, Luigi; Troisi, Romualdo; Spiridonova, Vera; Mattia, Carlo Andrea; Sica, Filomena

2018-02-01

Recently, mixed duplex/quadruplex oligonucleotides have attracted great interest for use as biomedical aptamers. In the case of anti-thrombin aptamers, the addition of duplex-forming sequences to a G-quadruplex module identical or very similar to the best-known G-quadruplex of the Thrombin Binding Aptamer (HD1) results in new or improved biological properties, such as higher activity or different recognition properties with respect to HD1. Remarkably, this bimodular fold was hypothesized, based on its sequence, for the only anti-thrombin aptamer in advanced clinical trial, NU172. Whereas cation modulation of G-quadruplex conformation and stability is well characterized, only few data from similar analysis on duplex/quadruplex oligonucleotides exist. Here we have performed a characterization of structure and stability of four different duplex/quadruplex anti-thrombin aptamers, including NU172, in the presence of different cations and in physiological-mimicking conditions in comparison to HD1, by means of spectroscopic techniques (UV and circular dichroism) and differential scanning calorimetry. Our data show a strong reciprocal influence of each domain on the stability of the other and in particular suggest a stabilizing effect of the duplex region in the presence of solutions mimicking the physiological conditions, strengthening the idea that bimodular aptamers present better therapeutic potentialities than those containing a single G-quadruplex domain. Copyright © 2017 Elsevier B.V. All rights reserved.

A mRNA-Responsive G-Quadruplex-Based Drug Release System

Directory of Open Access Journals (Sweden)

Hidenobu Yaku

2015-04-01

Full Text Available G-quadruplex-based drug delivery carriers (GDDCs were designed to capture and release a telomerase inhibitor in response to a target mRNA. Hybridization between a loop on the GDDC structure and the mRNA should cause the G-quadruplex structure of the GDDC to unfold and release the bound inhibitor, anionic copper(II phthalocyanine (CuAPC. As a proof of concept, GDDCs were designed with a 10-30-mer loop, which can hybridize with a target sequence in epidermal growth factor receptor (EGFR mRNA. Structural analysis using circular dichroism (CD spectroscopy showed that the GDDCs form a (3 + 1 type G-quadruplex structure in 100 mM KCl and 10 mM MgCl2 in the absence of the target RNA. Visible absorbance titration experiments showed that the GDDCs bind to CuAPC with Ka values of 1.5 × 105 to 5.9 × 105 M−1 (Kd values of 6.7 to 1.7 μM at 25 °C, depending on the loop length. Fluorescence titration further showed that the G-quadruplex structure unfolds upon binding to the target RNA with Ka values above 1.0 × 108 M−1 (Kd values below 0.01 μM at 25 °C. These results suggest the carrier can sense and bind to the target RNA, which should result in release of the bound drug. Finally, visible absorbance titration experiments demonstrated that the GDDC release CuAPC in response to the target RNA.

A battery-free multichannel digital neural/EMG telemetry system for flying insects.

Science.gov (United States)

Thomas, Stewart J; Harrison, Reid R; Leonardo, Anthony; Reynolds, Matthew S

2012-10-01

This paper presents a digital neural/EMG telemetry system small enough and lightweight enough to permit recording from insects in flight. It has a measured flight package mass of only 38 mg. This system includes a single-chip telemetry integrated circuit (IC) employing RF power harvesting for battery-free operation, with communication via modulated backscatter in the UHF (902-928 MHz) band. An on-chip 11-bit ADC digitizes 10 neural channels with a sampling rate of 26.1 kSps and 4 EMG channels at 1.63 kSps, and telemeters this data wirelessly to a base station. The companion base station transceiver includes an RF transmitter of +36 dBm (4 W) output power to wirelessly power the telemetry IC, and a digital receiver with a sensitivity of -70 dBm for 10⁻⁵ BER at 5.0 Mbps to receive the data stream from the telemetry IC. The telemetry chip was fabricated in a commercial 0.35 μ m 4M1P (4 metal, 1 poly) CMOS process. The die measures 2.36 × 1.88 mm, is 250 μm thick, and is wire bonded into a flex circuit assembly measuring 4.6 × 6.8 mm.

Structure and possible function of a G-quadruplex in the long terminal repeat of the proviral HIV-1 genome.

Science.gov (United States)

De Nicola, Beatrice; Lech, Christopher J; Heddi, Brahim; Regmi, Sagar; Frasson, Ilaria; Perrone, Rosalba; Richter, Sara N; Phan, Anh Tuân

2016-07-27

The long terminal repeat (LTR) of the proviral human immunodeficiency virus (HIV)-1 genome is integral to virus transcription and host cell infection. The guanine-rich U3 region within the LTR promoter, previously shown to form G-quadruplex structures, represents an attractive target to inhibit HIV transcription and replication. In this work, we report the structure of a biologically relevant G-quadruplex within the LTR promoter region of HIV-1. The guanine-rich sequence designated LTR-IV forms a well-defined structure in physiological cationic solution. The nuclear magnetic resonance (NMR) structure of this sequence reveals a parallel-stranded G-quadruplex containing a single-nucleotide thymine bulge, which participates in a conserved stacking interaction with a neighboring single-nucleotide adenine loop. Transcription analysis in a HIV-1 replication competent cell indicates that the LTR-IV region may act as a modulator of G-quadruplex formation in the LTR promoter. Consequently, the LTR-IV G-quadruplex structure presented within this work could represent a valuable target for the design of HIV therapeutics. © The Author(s) 2016. Published by Oxford University Press on behalf of Nucleic Acids Research.

“One Ring to Bind Them All”—Part I: The Efficiency of the Macrocyclic Scaffold for G-Quadruplex DNA Recognition

Directory of Open Access Journals (Sweden)

David Monchaud

2010-01-01

Full Text Available Macrocyclic scaffolds are particularly attractive for designing selective G-quadruplex ligands essentially because, on one hand, they show a poor affinity for the “standard” B-DNA conformation and, on the other hand, they fit nicely with the external G-quartets of quadruplexes. Stimulated by the pioneering studies on the cationic porphyrin TMPyP4 and the natural product telomestatin, follow-up studies have developed, rapidly leading to a large diversity of macrocyclic structures with remarkable-quadruplex binding properties and biological activities. In this review we summarize the current state of the art in detailing the three main categories of quadruplex-binding macrocycles described so far (telomestatin-like polyheteroarenes, porphyrins and derivatives, polyammonium cyclophanes, and in addressing both synthetic issues and biological aspects.

Expanding the potential of G-quadruplex structures: formation of a heterochiral TBA analogue.

Science.gov (United States)

Virgilio, Antonella; Varra, Michela; Scuotto, Maria; Capuozzo, Antonella; Irace, Carlo; Mayol, Luciano; Esposito, Veronica; Galeone, Aldo

2014-03-21

In order to expand the potential applications of G-quadruplex structures, we explored the ability of heterochiral oligodeoxynucleotides based on the thrombin-binding aptamer (TBA) sequence to fold into similar complexes, with particular focus on their resistance in biological environments. A combination of CD and NMR techniques was used. Similarly to TBA, the ODN ggTTggtgtggTTgg (lower case letters indicate L residues) is able to fold into a chair-like antiparallel G-quadruplex structure, but has a slightly higher thermal stability. The discovery that heterochiral ODNs are able to form stable G-quadruplex structures opens up new possibilities for their development in several fields, as aptamers, sensors and, as recently shown, as catalysts for enantioselective reactions. © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Investigation of ‘Head-to-Tail’-Connected Oligoaryl N,O-Ligands as Recognition Motifs for Cancer-Relevant G-Quadruplexes

Directory of Open Access Journals (Sweden)

Natalia Rizeq

2017-12-01

Full Text Available Oligomeric compounds, constituted of consecutive N,O-heteroaromatic rings, introduce useful and tunable properties as alternative ligands for biomolecular recognition. In this study, we have explored a synthetic scheme relying on Van Leusen oxazole formation, in conjunction with C–H activation of the formed oxazoles and their subsequent C–C cross-coupling to 2-bromopyridines in order to assemble a library of variable-length, ‘head-to-tail’-connected, pyridyl-oxazole ligands. Through investigation of the interaction of the three longer ligands (5-mer, 6-mer, 7-mer with cancer-relevant G-quadruplex structures (human telomeric/22AG and c-Myc oncogene promoter/Myc2345-Pu22, the asymmetric pyridyl-oxazole motif has been demonstrated to be a prominent recognition element for G-quadruplexes. Fluorescence titrations reveal excellent binding affinities of the 7-mer and 6-mer for a Na+-induced antiparallel 22AG G-quadruplex (KD = 0.6 × 10−7 M−1 and 0.8 × 10−7 M−1, respectively, and satisfactory (albeit lower affinities for the 22AG/K+ and Myc2345-Pu22/K+ G-quadruplexes. All ligands tested exhibit substantial selectivity for G-quadruplex versus duplex (ds26 DNA, as evidenced by competitive Förster resonance energy transfer (FRET melting assays. Additionally, the 7-mer and 6-mer are capable of promoting a sharp morphology transition of 22AG/K+ G-quadruplex.

Triplex intermediates in folding of human telomeric quadruplexes probed by microsecond-scale molecular dynamics simulations

Czech Academy of Sciences Publication Activity Database

Stadlbauer, Petr; Trantírek, L.; Cheatham III, T. E.; Koča, J.; Šponer, Jiří

105C, OCT2014 (2014), s. 22-35 ISSN 0300-9084 R&D Projects: GA ČR(CZ) GAP208/12/1822; GA ČR(CZ) GA13-28310S Institutional support: RVO:68081707 Keywords : G-DNA folding * Quadruplex * Triplex Subject RIV: BO - Biophysics Impact factor: 2.963, year: 2014

Image processing by use of the digital cross-correlator

International Nuclear Information System (INIS)

Katou, Yoshinori

1982-01-01

We manufactured for trial an instrument which achieved the image processing using digital correlators. A digital correlator perform 64-bit parallel correlation at 20 MH. The output of a digital correlator is a 7-bit word representing. An A-D converter is used to quantize it a precision of six bits. The resulting 6-bit word is fed to six correlators, wired in parallel. The image processing achieved in 12 bits, whose digital outputs converted an analog signal by a D-A converter. This instrument is named the digital cross-correlator. The method which was used in the image processing system calculated the convolution with the digital correlator. It makes various digital filters. In the experiment with the image processing video signals from TV camera were used. The digital image processing time was approximately 5 μs. The contrast was enhanced and smoothed. The digital cross-correlator has the image processing of 16 sorts, and was produced inexpensively. (author)

Identification and characterisation of a G-quadruplex forming sequence in the promoter region of nuclear factor (erythroid-derived 2)-like 2 (Nrf2)

Energy Technology Data Exchange (ETDEWEB)

Waller, Zoë A.E., E-mail: z.waller@uea.ac.uk; Howell, Lesley A.; MacDonald, Colin J.; O’Connell, Maria A.; Searcey, Mark, E-mail: m.searcey@uea.ac.uk

2014-04-25

Highlights: • Discovery of a G-quadruplex forming sequence in the promoter sequence of Nrf2. • Characterisation of the G-quadruplex by UV, CD and NMR. • Conformational switching of G-quadruplex induced by 9-aminoacridine. - Abstract: The transcription factor nuclear factor (erythroid-derived 2)-like 2 (Nrf2) regulates multiple antioxidants, Phase II detoxification enzymes and other cytoprotective enzymes in cells. Activation of Nrf2 is recognised as being of potential therapeutic benefit in inflammatory-diseases whereas more recently, it has become clear that the inhibition of Nrf2 may have benefit in the alleviation of resistance in some tumour types. A potential G-quadruplex forming sequence was identified in the promoter region of Nrf2, close to a number of putative transcription factor binding sites. Characterisation of the sequence 5’-d[GGGAAGGGAGCAAGGGCGGGAGGG]-3’ using CD spectroscopy, imino proton NMR resonances and UV melting experiments demonstrated the formation of a parallel intramolecular G-quadruplex in the presence of K{sup +} ions. Incubation with 9-aminoacridine ligands induced a switch from antiparallel to parallel forms. The presence of a G-quadruplex forming sequence in the promoter region of Nrf2 suggests an approach to targeting the production of the protein through stabilisation of the structure, thereby avoiding resistance to antitumour drugs.

Triple Quenching of a Novel Self-Enhanced Ru(II) Complex by Hemin/G-Quadruplex DNAzymes and Its Potential Application to Quantitative Protein Detection.

Science.gov (United States)

Zhao, Min; Liao, Ni; Zhuo, Ying; Chai, Ya-Qin; Wang, Ji-Peng; Yuan, Ruo

2015-08-04

Herein, a novel "on-off" electrochemiluminescence (ECL) aptasensor for highly sensitive determination of thrombin has been constructed based on the triple quenching of the effect of hemin/G-quadruplex DNAzymes upon the Ru(II) complex-based ECL system. First, a strong initial ECL signal was achieved by the dual amplification strategies of (i) intramolecular coreaction of a self-enhanced Ru(II)-based molecule (PTCA-PEI-Ru(II)) and (ii) intermolecular coreaction between PTCA-PEI-Ru(II) and nicotinamide adenine dinucleotide (NADH), which was named the signal-on state. Then, a novel triple quenching of the effect of multifunctional hemin/G-quadruplex DNAzymes upon the Ru(II) complex-based ECL system was designed to realize the desirable signal-off state, which was outlined as follows: (i) the hemin/G-quadruplex DNAzymes mimicked NADH oxidase to oxidize NADH and in situ generate the H2O2, consuming the coreactant of NADH; (ii) its active center of hemin could oxidize the excited state PTCA-PEI-Ru(II)* to PTCA-PEI-Ru(III), making the energy and electron transfer quench; (iii) it also acted as horseradish peroxidase (HRP) to catalyze the H2O2 for in situ producing the quencher of O2. Based on triple quenching of the effect of hemin/G-quadruplex DNAzymes, the highly sensitive "on-off" thrombin aptasensor was developed with a wide linear detection range of 1.0 × 10(-14) M to 1.0 × 10(-10) M and a detection limit down to the femtomolar level.

Utilization of circular dichroism and electrospray ionization mass spectrometry to understand the formation and conversion of G-quadruplex DNA at the human c-myb proto-oncogene.

Science.gov (United States)

Fu, Hengqing; Yang, Pengfei; Hai, Jinhui; Li, Huihui

2018-10-05

G-quadruplex DNAs are involved in a number of key biological processes, including gene expression, transcription, and apoptosis. The c-myb oncogene contains a number of GGA repeats in its promoter which forms G-quadruplex, thus it could be used as a target in cancer therapeutics. Several in-vitro studies have used Circular Dichroism (CD) spectroscopy or electrospray ionization mass spectrometry (ESI-MS) to demonstrate formation and stability of G-quadruplex DNA structure in the promoter region of human c-myb oncogene. The factors affecting the c-myb G-quadruplex structures were investigated, such as cations (i.e. K + , NH 4 + and Na + ) and co-solutes (methanol and polyethylene glycol). The results indicated that the presence of cations and co-solutes could change the G-quadruplex structural population and promote its thermodynamic stabilization as indicated by CD melting curves. It indicated that the co-solutes preferentially stabilize the c-myb G-quadruplex structure containing both homo- and hetero-stacking. In addition, protopine was demonstrated as a binder of c-myb G-quadruplex as screened from a library of natural alkaloids using ESI-MS method. CD spectra showed that it could selectively stabilize the c-myb G-quadruplex structure compared to other six G-quadruplexes from tumor-related G-rich sequences and the duplex DNAs (both long and short-chain ones). The binding of protopine could induce the change in the G-quadruplex structural populations. Therefore, protopine with its high binding specificity could be considered as a precursor for the design of drugs to target and regulate c-myb oncogene transcription. Copyright © 2018 Elsevier B.V. All rights reserved.

Hairpins participating in folding of human telomeric sequence quadruplexes studied by standard and T-REMD simulations

Czech Academy of Sciences Publication Activity Database

Stadlbauer, Petr; Kuehrova, P.; Banáš, P.; Koča, J.; Bussi, G.; Trantírek, L.; Otyepka, M.; Šponer, Jiří

2016-01-01

Roč. 43, č. 20 (2016), s. 9626-9644 ISSN 0305-1048 R&D Projects: GA ČR(CZ) GAP208/11/1822 Institutional support: RVO:68081707 Keywords : MOLECULAR-DYNAMICS SIMULATIONS * INTRAMOLECULAR DNA QUADRUPLEXES * PARTICLE MESH EWALD Subject RIV: BO - Biophysics Impact factor: 10.162, year: 2016

Cation binding to 15-TBA quadruplex DNA is a multiple-pathway cation-dependent process

Science.gov (United States)

Reshetnikov, Roman V.; Sponer, Jiri; Rassokhina, Olga I.; Kopylov, Alexei M.; Tsvetkov, Philipp O.; Makarov, Alexander A.; Golovin, Andrey V.

2011-01-01

A combination of explicit solvent molecular dynamics simulation (30 simulations reaching 4 µs in total), hybrid quantum mechanics/molecular mechanics approach and isothermal titration calorimetry was used to investigate the atomistic picture of ion binding to 15-mer thrombin-binding quadruplex DNA (G-DNA) aptamer. Binding of ions to G-DNA is complex multiple pathway process, which is strongly affected by the type of the cation. The individual ion-binding events are substantially modulated by the connecting loops of the aptamer, which play several roles. They stabilize the molecule during time periods when the bound ions are not present, they modulate the route of the ion into the stem and they also stabilize the internal ions by closing the gates through which the ions enter the quadruplex. Using our extensive simulations, we for the first time observed full spontaneous exchange of internal cation between quadruplex molecule and bulk solvent at atomistic resolution. The simulation suggests that expulsion of the internally bound ion is correlated with initial binding of the incoming ion. The incoming ion then readily replaces the bound ion while minimizing any destabilization of the solute molecule during the exchange. PMID:21893589

Nucleotide Pool Depletion Induces G-Quadruplex-Dependent Perturbation of Gene Expression

Directory of Open Access Journals (Sweden)

Charikleia Papadopoulou

2015-12-01

Full Text Available Nucleotide pool imbalance has been proposed to drive genetic instability in cancer. Here, we show that slowing replication forks by depleting nucleotide pools with hydroxyurea (HU can also give rise to both transient and permanent epigenetic instability of a reporter locus, BU-1, in DT40 cells. HU induces stochastic formation of Bu-1low variants in dividing cells, which have lost the H3K4me3 present in untreated cells. This instability is potentiated by an intragenic G quadruplex, which also promotes local H2Ax phosphorylation and transient heterochromatinization. Genome-wide, gene expression changes induced by HU significantly overlap with those resulting from loss of the G4-helicases FANCJ, WRN, and BLM. Thus, the effects of global replication stress induced by nucleotide pool depletion can be focused by local replication impediments caused by G quadruplex formation to induce epigenetic instability and changes in gene expression, a mechanism that may contribute to selectable transcriptional changes in cancer.

Scintillation counter and wire chamber front end modules for high energy physics experiments

International Nuclear Information System (INIS)

Baldin, Boris; DalMonte, Lou

2011-01-01

This document describes two front-end modules developed for the proposed MIPP upgrade (P-960) experiment at Fermilab. The scintillation counter module was developed for the Plastic Ball detector time and charge measurements. The module has eight LEMO 00 input connectors terminated with 50 ohms and accepts negative photomultiplier signals in the range 0.25...1000 pC with the maximum input voltage of 4.0 V. Each input has a passive splitter with integration and differentiation times of ∼20 ns. The integrated portion of the signal is digitized at 26.55 MHz by Analog Devices AD9229 12-bit pipelined 4-channel ADC. The differentiated signal is discriminated for time measurement and sent to one of the four TMC304 inputs. The 4-channel TMC304 chip allows high precision time measurement of rising and falling edges with ∼100 ps resolution and has internal digital pipeline. The ADC data is also pipelined which allows deadtime-less operation with trigger decision times of ∼4 (micro)s. The wire chamber module was developed for MIPP EMCal detector charge measurements. The 32-channel digitizer accepts differential analog signals from four 8-channel integrating wire amplifiers. The connection between wire amplifier and digitizer is provided via 26-wire twist-n-flat cable. The wire amplifier integrates input wire current and has sensitivity of 275 mV/pC and the noise level of ∼0.013 pC. The digitizer uses the same 12-bit AD9229 ADC chip as the scintillator counter module. The wire amplifier has a built-in test pulser with a mask register to provide testing of the individual channels. Both modules are implemented as a 6Ux220 mm VME size board with 48-pin power connector. A custom europack (VME) 21-slot crate is developed for housing these front-end modules.

Cation binding to 15-TBA quadruplex DNA is a multiple-pathway cation-dependent process.

Science.gov (United States)

Reshetnikov, Roman V; Sponer, Jiri; Rassokhina, Olga I; Kopylov, Alexei M; Tsvetkov, Philipp O; Makarov, Alexander A; Golovin, Andrey V

2011-12-01

A combination of explicit solvent molecular dynamics simulation (30 simulations reaching 4 µs in total), hybrid quantum mechanics/molecular mechanics approach and isothermal titration calorimetry was used to investigate the atomistic picture of ion binding to 15-mer thrombin-binding quadruplex DNA (G-DNA) aptamer. Binding of ions to G-DNA is complex multiple pathway process, which is strongly affected by the type of the cation. The individual ion-binding events are substantially modulated by the connecting loops of the aptamer, which play several roles. They stabilize the molecule during time periods when the bound ions are not present, they modulate the route of the ion into the stem and they also stabilize the internal ions by closing the gates through which the ions enter the quadruplex. Using our extensive simulations, we for the first time observed full spontaneous exchange of internal cation between quadruplex molecule and bulk solvent at atomistic resolution. The simulation suggests that expulsion of the internally bound ion is correlated with initial binding of the incoming ion. The incoming ion then readily replaces the bound ion while minimizing any destabilization of the solute molecule during the exchange. © The Author(s) 2011. Published by Oxford University Press.

Intermolecular G-quadruplex structure-based fluorescent DNA detection system.

Science.gov (United States)

Zhou, Hui; Wu, Zai-Sheng; Shen, Guo-Li; Yu, Ru-Qin

2013-03-15

Adopting multi-donors to pair with one acceptor could improve the performance of fluorogenic detection probes. However, common dyes (e.g., fluorescein) in close proximity to each other would self-quench the fluorescence, and the fluorescence is difficult to restore. In this contribution, we constructed a novel "multi-donors-to-one acceptor" fluorescent DNA detection system by means of the intermolecular G-quadruplex (IGQ) structure-based fluorescence signal enhancement combined with the hairpin oligonucleotide. The novel IGQ-hairpin system was characterized using the p53 gene as the model target DNA. The proposed system showed an improved assay performance due to the introduction of IGQ-structure into fluorescent signaling probes, which could inhibit the background fluorescence and increase fluorescence restoration amplitude of fluoresceins upon target DNA hybridization. The proof-of-concept scheme is expected to provide new insight into the potential of G-quadruplex structure and promote the application of fluorescent oligonucleotide probes in fundamental research, diagnosis, and treatment of genetic diseases. Copyright © 2012 Elsevier B.V. All rights reserved.

Insect Wing Displacement Measurement Using Digital Holography

International Nuclear Information System (INIS)

Aguayo, Daniel D.; Mendoza Santoyo, Fernando; Torre I, Manuel H. de la; Caloca Mendez, Cristian I.

2008-01-01

Insects in flight have been studied with optical non destructive techniques with the purpose of using meaningful results in aerodynamics. With the availability of high resolution and large dynamic range CCD sensors the so called interferometric digital holographic technique was used to measure the surface displacement of in flight insect wings, such as butterflies. The wings were illuminated with a continuous wave Verdi laser at 532 nm, and observed with a CCD Pixelfly camera that acquire images at a rate of 11.5 frames per second at a resolution of 1392x1024 pixels and 12 Bit dynamic range. At this frame rate digital holograms of the wings were captured and processed in the usual manner, namely, each individual hologram is Fourier processed in order to find the amplitude and phase corresponding to the digital hologram. The wings displacement is obtained when subtraction between two digital holograms is performed for two different wings position, a feature applied to all consecutive frames recorded. The result of subtracting is seen as a wrapped phase fringe pattern directly related to the wing displacement. The experimental data for different butterfly flying conditions and exposure times are shown as wire mesh plots in a movie of the wings displacement

Folding of guanine quadruplex molecules-funnel-like mechanism or kinetic partitioning? An overview from MD simulation studies

Czech Academy of Sciences Publication Activity Database

Šponer, Jiří; Bussi, G.; Stadlbauer, Petr; Kührová, P.; Banáš, P.; Islam, Barira; Haider, S.; Neidle, S.; Otyepka, M.

2017-01-01

Roč. 1861, č. 5 (2017), s. 1246-1263 ISSN 0304-4165 R&D Projects: GA ČR(CZ) GA16-13721S Institutional support: RVO:68081707 Keywords : telomeric g-quadruplex * parallel g-quadruplex Subject RIV: CE - Biochemistry OBOR OECD: Biochemistry and molecular biology Impact factor: 4.702, year: 2016

Stability of Human Telomere Quadruplexes at High DNA Concentrations

Czech Academy of Sciences Publication Activity Database

Kejnovská, Iva; Vorlíčková, Michaela; Brázdová, Marie; Sagi, J.

2014-01-01

Roč. 101, č. 4 (2014), s. 428-438 ISSN 0006-3525 R&D Projects: GA ČR(CZ) GAP205/12/0466 Institutional support: RVO:68081707 Keywords : quadruplex * DNA concentration * folding topology Subject RIV: BO - Biophysics Impact factor: 2.385, year: 2014

Porous platinum nanotubes labeled with hemin/G-quadruplex based electrochemical aptasensor for sensitive thrombin analysis via the cascade signal amplification.

Science.gov (United States)

Sun, Aili; Qi, Qingan; Wang, Xuannian; Bie, Ping

2014-07-15

For the first time, a sensitive electrochemical aptasensor for thrombin (TB) was developed by using porous platinum nanotubes (PtNTs) labeled with hemin/G-quadruplex and glucose dehydrogenase (GDH) as labels. Porous PtNTs with large surface area exhibited the peroxidase-like activity. Coupling with GDH and hemin/G-quadruplex as NADH oxidase and HRP-mimicking DNAzyme, the cascade signal amplification was achieved by the following ways: in the presence of glucose and NAD(+) in the working buffer, GDH electrocatalyzed the oxidation of glucose with the production of NADH. Then, hemin/G-quadruplex as NADH oxidase catalyzed the oxidation of NADH to in situ generate H2O2. Based on the corporate electrocatalysis of PtNTs and hemin/G-quadruplex toward H2O2, the electrochemical signal was significantly amplified, allowing the detection limit of TB down to 0.15 pM level. Moreover, the proposed strategy was simple because the intercalated hemin offered the readout signal, avoiding the adding of additional redox mediator as signal donator. Such an electrochemical aptasensor is highly promising for sensitive detection of other proteins in clinical diagnostics. Copyright © 2014 Elsevier B.V. All rights reserved.

Toward the design of new DNA G-quadruplex ligands through rational analysis of polymorphism and binding data.

Science.gov (United States)

Artese, Anna; Costa, Giosuè; Distinto, Simona; Moraca, Federica; Ortuso, Francesco; Parrotta, Lucia; Alcaro, Stefano

2013-10-01

Human telomeres play a key role in protecting chromosomal ends from fusion events; they are composed of d(TTAGGG) repeats, ranging in size from 3 to 15 kb. They form G-quadruplex DNA structures, stabilized by G-quartets in the presence of cations, and are involved in several biological processes. In particular, a telomere maintenance mechanism is provided by a specialized enzyme called telomerase, a reverse transcriptase able to add multiple copies of the 5'-GGTTAG-3' motif to the end of the G-strand of the telomere and which is over-expressed in the majority of cancer cells. The central cation has a crucial role in maintaining the stability of the structure. Based on its nature, it can be associated with different topological telomeric quadruplexes, which depend also on the orientation of the DNA strands and the syn/anti conformation of the guanines. Such a polymorphism, confirmed by the different structures deposited in the Protein Data Bank (PDB), prompted us to apply a computational protocol in order to investigate the conformational properties of a set of known G-quadruplex ligands and their molecular recognition against six different experimental models of the human telomeric sequence d[AG3(T2AG3)3]. The average AutoDock correlation between theoretical and experimental data yielded an r2 value equal to 0.882 among all the studied models. Such a result was always improved with respect to those of the single folds, with the exception of the parallel structure (r2 equal to 0.886), thus suggesting a key role of this G4 conformation in the stacking interaction network. Among the studied binders, a trisubstituted acridine and a dibenzophenanthroline derivative were well recognized by the parallel and the mixed G-quadruplex structures, allowing the identification of specific key contacts with DNA and the further design of more potent or target specific G-quadruplex ligands. Copyright © 2013 Elsevier Masson SAS. All rights reserved.

Quinone methides tethered to naphthalene diimides as selective G-quadruplex alkylating agents.

Science.gov (United States)

Di Antonio, Marco; Doria, Filippo; Richter, Sara N; Bertipaglia, Carolina; Mella, Mariella; Sissi, Claudia; Palumbo, Manlio; Freccero, Mauro

2009-09-16

We have developed novel G-quadruplex (G-4) ligand/alkylating hybrid structures, tethering the naphthalene diimide moiety to quaternary ammonium salts of Mannich bases, as quinone-methide precursors, activatable by mild thermal digestion (40 degrees C). The bis-substituted naphthalene diimides were efficiently synthesized, and their reactivity as activatable bis-alkylating agents was investigated in the presence of thiols and amines in aqueous buffered solutions. The electrophilic intermediate, quinone-methide, involved in the alkylation process was trapped, in the presence of ethyl vinyl ether, in a hetero Diels-Alder [4 + 2] cycloaddition reaction, yielding a substituted 2-ethoxychroman. The DNA recognition and alkylation properties of these new derivatives were investigated by gel electrophoresis, circular dichroism, and enzymatic assays. The alkylation process occurred preferentially on the G-4 structure in comparison to other DNA conformations. By dissecting reversible recognition and alkylation events, we found that the reversible process is a prerequisite to DNA alkylation, which in turn reinforces the G-quadruplex structural rearrangement.

Digital Communication and Modulation

DEFF Research Database (Denmark)

Sørensen, John Aasted

2010-01-01

Fundamental principles in modern digital communication system like modems and wire- and wireless transmission over physical channels. Class room sessions and projects. Semester: Spring 2010 Extent: 7.5 ects Class size: 9......Fundamental principles in modern digital communication system like modems and wire- and wireless transmission over physical channels. Class room sessions and projects. Semester: Spring 2010 Extent: 7.5 ects Class size: 9...

Digital Communication and Modulation

DEFF Research Database (Denmark)

Sørensen, John Aasted

2010-01-01

Fundamental principles in modern digital communication system like modems and wire- and wireless transmission over physical channels. Class room sessions and projects. Semester: Autumn 2010 Extent: 7.5 ects Class size: 18......Fundamental principles in modern digital communication system like modems and wire- and wireless transmission over physical channels. Class room sessions and projects. Semester: Autumn 2010 Extent: 7.5 ects Class size: 18...

A G-quadruplex-containing RNA activates fluorescence in a GFP-like fluorophore

Energy Technology Data Exchange (ETDEWEB)

Huang, Hao; Suslov, Nikolai B.; Li, Nan-Sheng; Shelke, Sandip A.; Evans, Molly E.; Koldobskaya, Yelena; Rice, Phoebe A.; Piccirilli, Joseph A. [UC

2014-08-21

Spinach is an in vitro–selected RNA aptamer that binds a GFP-like ligand and activates its green fluorescence. Spinach is thus an RNA analog of GFP and has potentially widespread applications for in vivo labeling and imaging. We used antibody-assisted crystallography to determine the structures of Spinach both with and without bound fluorophore at 2.2-Å and 2.4-Å resolution, respectively. Spinach RNA has an elongated structure containing two helical domains separated by an internal bulge that folds into a G-quadruplex motif of unusual topology. The G-quadruplex motif and adjacent nucleotides comprise a partially preformed binding site for the fluorophore. The fluorophore binds in a planar conformation and makes extensive aromatic stacking and hydrogen bond interactions with the RNA. Our findings provide a foundation for structure-based engineering of new fluorophore-binding RNA aptamers.

A powerful, low-cost histogramming memory for digital radiography with multi-wire proportional counters

International Nuclear Information System (INIS)

Bateman, J.E.; Locke, C.E.R.; Ferrari, C.A.

1986-01-01

A powerful, low-cost histogramming memory for digital radiograph with multi-wire proportional counter is described. The memory is based on a commercial video display device coupled to an Apple II microcomputer which, at a total cost of around 2500 pounds gives a system with 512 x 512 pixel resolution and a counting range of 4095 counts per pixel. The system can take data at rates of up to 5000 Hz while providing a live-time display. No hardware modifications are necessary, the comprehensive storage and display facilities being implemented in a combined package of BASIC and ASSEMBLER software. An ACCELERATOR coprocessor card is used to enhance the performance of the system. (author)

The G-quadruplex augments translation in the 5' untranslated region of transforming growth factor β2.

Science.gov (United States)

Agarwala, Prachi; Pandey, Satyaprakash; Mapa, Koyeli; Maiti, Souvik

2013-03-05

Transforming growth factor β2 (TGFβ2) is a versatile cytokine with a prominent role in cell migration, invasion, cellular development, and immunomodulation. TGFβ2 promotes the malignancy of tumors by inducing epithelial-mesenchymal transition, angiogenesis, and immunosuppression. As it is well-documented that nucleic acid secondary structure can regulate gene expression, we assessed whether any secondary motif regulates its expression at the post-transcriptional level. Bioinformatics analysis predicts an existence of a 23-nucleotide putative G-quadruplex sequence (PG4) in the 5' untranslated region (UTR) of TGFβ2 mRNA. The ability of this stretch of sequence to form a highly stable, intramolecular parallel quadruplex was demonstrated using ultraviolet and circular dichroism spectroscopy. Footprinting studies further validated its existence in the presence of a neighboring nucleotide sequence. Following structural characterization, we evaluated the biological relevance of this secondary motif using a dual luciferase assay. Although PG4 inhibits the expression of the reporter gene, its presence in the context of the entire 5' UTR sequence interestingly enhances gene expression. Mutation or removal of the G-quadruplex sequence from the 5' UTR of the gene diminished the level of expression of this gene at the translational level. Thus, here we highlight an activating role of the G-quadruplex in modulating gene expression of TGFβ2 at the translational level and its potential to be used as a target for the development of therapeutics against cancer.

Space shuttle pilot-induced-oscillation research testing

Science.gov (United States)

Powers, B. G.

1984-01-01

The simulation requirements for investigation of pilot-induced-oscillation (PIO) characteristics during the landing phase are discussed. Orbiters simulations and F-8 digital fly-by-wire aircraft tests are addressed.

DNA sensors and aptasensors based on the hemin/G-quadruplex-controlled aggregation of Au NPs in the presence of L-cysteine.

Science.gov (United States)

Niazov-Elkan, Angelica; Golub, Eyal; Sharon, Etery; Balogh, Dora; Willner, Itamar

2014-07-23

L-cysteine induces the aggregation of Au nanoparticles (NPs), resulting in a color transition from red to blue due to interparticle plasmonic coupling in the aggregated structure. The hemin/G-quadruplex horseradish peroxidase-mimicking DNAzyme catalyzes the aerobic oxidation of L-cysteine to cystine, a process that inhibits the aggregation of the NPs. The degree of inhibition of the aggregation process is controlled by the concentration of the DNAzyme in the system. These functions are implemented to develop sensing platforms for the detection of a target DNA, for the analysis of aptamer-substrate complexes, and for the analysis of L-cysteine in human urine samples. A hairpin DNA structure that includes a recognition site for the DNA analyte and a caged G-quadruplex sequence, is opened in the presence of the target DNA. The resulting self-assembled hemin/G-quadruplex acts as catalyst that controls the aggregation of the Au NPs. Also, the thrombin-binding aptamer folds into a G-quadruplex nanostructure upon binding to thrombin. The association of hemin to the resulting G-quadruplex aptamer-thrombin complex leads to a catalytic label that controls the L-cysteine-mediated aggregation of the Au NPs. The hemin/G-qaudruplex-controlled aggregation of Au NPs process is further implemented for visual and spectroscopic detection of L-cysteine concentration in urine samples. © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

A G-quadruplex-based Label-free Fluorometric Aptasensor for Adenosine Triphosphate Detection.

Science.gov (United States)

Li, Li Juan; Tian, Xue; Kong, Xiang Juan; Chu, Xia

2015-01-01

A G-quadruplex-based, label-free fluorescence assay was demonstrated for the detection of adenosine triphosphate (ATP). A double-stranded DNA (dsDNA), hybridized by ATP-aptamer and its complementary sequence, was employed as a substrate for ATP binding. SYBR Green I (SG I) was a fluorescent probe and exonuclease III (Exo III) was a nuclease to digest the dsDNA. Consequently, in the absence of ATP, the dsDNA was inset with SG I and was digested by Exo III, resulting in a low background signal. In the presence of ATP, the aptamer in dsDNA folded into a G-quadruplex structure that resisted the digestion of Exo III. SG I was inserted into the structure, showing high fluorescence. Owing to a decrease of the background noise, a high signal-to-noise ratio could be obtained. This sensor can detect ATP with a concentration ranging from 50 μM to 5 mM, and possesses a capacity for the sensitive determination of other targets.

Toehold strand displacement-driven assembly of G-quadruplex DNA for enzyme-free and non-label sensitive fluorescent detection of thrombin.

Science.gov (United States)

Xu, Yunying; Zhou, Wenjiao; Zhou, Ming; Xiang, Yun; Yuan, Ruo; Chai, Yaqin

2015-02-15

Based on a new signal amplification strategy by the toehold strand displacement-driven cyclic assembly of G-quadruplex DNA, the development of an enzyme-free and non-label aptamer sensing approach for sensitive fluorescent detection of thrombin is described. The target thrombin associates with the corresponding aptamer of the partial dsDNA probes and liberates single stranded initiation sequences, which trigger the toehold strand displacement assembly of two G-quadruplex containing hairpin DNAs. This toehold strand displacement reaction leads to the cyclic reuse of the initiation sequences and the production of DNA assemblies with numerous G-quadruplex structures. The fluorescent dye, N-Methyl mesoporphyrin IX, binds to these G-quadruplex structures and generates significantly amplified fluorescent signals to achieve highly sensitive detection of thrombin down to 5 pM. Besides, this method shows high selectivity towards the target thrombin against other control proteins. The developed thrombin sensing method herein avoids the modification of the probes and the involvement of any enzyme or nanomaterial labels for signal amplification. With the successful demonstration for thrombin detection, our approach can be easily adopted to monitor other target molecules in a simple, low-cost, sensitive and selective way by choosing appropriate aptamer/ligand pairs. Copyright © 2014 Elsevier B.V. All rights reserved.

Steer-by-wire innovations and demonstrator

NARCIS (Netherlands)

Lupker, H.A.; Zuurbier, J.; Verschuren, R.M.A.F.; Jansen, S.T.H.; Willemsen, D.M.C.

2002-01-01

Arguments for 'by-wire' systems include production costs, packaging and traffic safety. Innovations concern both product and development process e.g. combined virtual engineering and Hardware-in-the-loop testing. Three Steer-by-wire systems are discussed: a steering system simulator used as a

Bis-guanylhydrazone diimidazo[1,2-a:1,2-c]pyrimidine as a novel and specific G-quadruplex binding motif.

Science.gov (United States)

Sparapani, Silvia; Bellini, Stefania; Gunaratnam, Mekala; Haider, Shozeb M; Andreani, Aldo; Rambaldi, Mirella; Locatelli, Alessandra; Morigi, Rita; Granaiola, Massimiliano; Varoli, Lucilla; Burnelli, Silvia; Leoni, Alberto; Neidle, Stephen

2010-08-21

A bis-guanylhydrazone derivative of diimidazo[1,2-a:1,2-c]pyrimidine has unexpectedly been found to be a potent stabiliser of several quadruplex DNAs, whereas there is no significant interaction with duplex DNA. Molecular modeling suggests that the guanylhydrazone groups play an active role in quadruplex binding.

A time-domain digitally controlled oscillator composed of a free running ring oscillator and flying-adder

International Nuclear Information System (INIS)

Liu Wei; Zhang Shengdong; Wang Yangyuan; Li Wei; Ren Peng; Lin Qinglong

2009-01-01

A time-domain digitally controlled oscillator (DCO) is proposed. The DCO is composed of a free-running ring oscillator (FRO) and a two lap-selectors integrated flying-adder (FA). With a coiled cell array which allows uniform loading capacitances of the delay cells, the FRO produces 32 outputs with consistent tap spacing for the FA as reference clocks. The FA uses the outputs from the FRO to generate the output of the DCO according to the control number, resulting in a linear dependence of the output period, instead of the frequency on the digital controlling word input. Thus the proposed DCO ensures a good conversion linearity in a time-domain, and is suitable for time-domain all-digital phase locked loop applications. The DCO was implemented in a standard 0.13 μm digital logic CMOS process. The measurement results show that the DCO has a linear and monotonic tuning curve with gain variation of less than 10%, and a very low root mean square period jitter of 9.3 ps in the output clocks. The DCO works well at supply voltages ranging from 0.6 to 1.2 V, and consumes 4 mW of power with 500 MHz frequency output at 1.2 V supply voltage.

Atomistic picture for the folding pathway of a hybrid-1 type human telomeric DNA G-quadruplex.

Directory of Open Access Journals (Sweden)

Yunqiang Bian

2014-04-01

Full Text Available In this work we studied the folding process of the hybrid-1 type human telomeric DNA G-quadruplex with solvent and K(+ ions explicitly modeled. Enabled by the powerful bias-exchange metadynamics and large-scale conventional molecular dynamic simulations, the free energy landscape of this G-DNA was obtained for the first time and four folding intermediates were identified, including a triplex and a basically formed quadruplex. The simulations also provided atomistic pictures for the structures and cation binding patterns of the intermediates. The results showed that the structure formation and cation binding are cooperative and mutually supporting each other. The syn/anti reorientation dynamics of the intermediates was also investigated. It was found that the nucleotides usually take correct syn/anti configurations when they form native and stable hydrogen bonds with the others, while fluctuating between two configurations when they do not. Misfolded intermediates with wrong syn/anti configurations were observed in the early intermediates but not in the later ones. Based on the simulations, we also discussed the roles of the non-native interactions. Besides, the formation process of the parallel conformation in the first two G-repeats and the associated reversal loop were studied. Based on the above results, we proposed a folding pathway for the hybrid-1 type G-quadruplex with atomistic details, which is new and more complete compared with previous ones. The knowledge gained for this type of G-DNA may provide a general insight for the folding of the other G-quadruplexes.

An automatic tension measurement system of MWPC wires

International Nuclear Information System (INIS)

D'Antone, I.; Lolli, M.; Torromeo, G.

1992-01-01

An electronic system is presented for automatic mechanical tension measurement to test wire chambers. The developed system works in the tension range from 50 g to 300 g; this large working range is obtained by using a microcontroller that performs a digital control on the bridge of an oscillator containing the wire of which the tension has to be measured. The microcontroller automatically brings the system towards the oscillation condition and subsequently, measuring the frequency, it evaluates, displays and sends to a host computer the value of the mechanical tension of the wires. The system is precise and allows fast measurements. A description of the hardware and software design is given. (orig.)

Colorimetric detection of genetically modified organisms based on exonuclease III-assisted target recycling and hemin/G-quadruplex DNAzyme amplification.

Science.gov (United States)

Zhang, Decai; Wang, Weijia; Dong, Qian; Huang, Yunxiu; Wen, Dongmei; Mu, Yuejing; Yuan, Yong

2017-12-21

An isothermal colorimetric method is described for amplified detection of the CaMV 35S promoter sequence in genetically modified organism (GMO). It is based on (a) target DNA-triggered unlabeled molecular beacon (UMB) termini binding, and (b) exonuclease III (Exo III)-assisted target recycling, and (c) hemin/G-quadruplex (DNAzyme) based signal amplification. The specific binding of target to the G-quadruplex sequence-locked UMB triggers the digestion of Exo III. This, in turn, releases an active G-quadruplex segment and target DNA for successive hybridization and cleavage. The Exo III impellent recycling of targets produces numerous G-quadruplex sequences. These further associate with hemin to form DNAzymes and hence will catalyze H 2 O 2 -mediated oxidation of the chromogenic enzyme substrate ABTS 2- causing the formation of a green colored product. This finding enables a sensitive colorimetric determination of GMO DNA (at an analytical wavelength of 420 nm) at concentrations as low as 0.23 nM. By taking advantage of isothermal incubation, this method does not require sophisticated equipment or complicated syntheses. Analyses can be performed within 90 min. The method also discriminates single base mismatches. In our perception, it has a wide scope in that it may be applied to the detection of many other GMOs. Graphical abstract An isothermal and sensitive colorimetric method is described for amplified detection of CaMV 35S promoter sequence in genetically modified organism (GMO). It is based on target DNA-triggered molecular beacon (UMB) termini-binding and exonuclease III assisted target recycling, and on hemin/G-quadruplex (DNAzyme) signal amplification.

Ball with hair: modular functionalization of highly stable G-quadruplex DNA nano-scaffolds through N2-guanine modification.

Science.gov (United States)

Lech, Christopher Jacques; Phan, Anh Tuân

2017-06-20

Functionalized nanoparticles have seen valuable applications, particularly in the delivery of therapeutic and diagnostic agents in biological systems. However, the manufacturing of such nano-scale systems with the consistency required for biological application can be challenging, as variation in size and shape have large influences in nanoparticle behavior in vivo. We report on the development of a versatile nano-scaffold based on the modular functionalization of a DNA G-quadruplex. DNA sequences are functionalized in a modular fashion using well-established phosphoramidite chemical synthesis with nucleotides containing modification of the amino (N2) position of the guanine base. In physiological conditions, these sequences fold into well-defined G-quadruplex structures. The resulting DNA nano-scaffolds are thermally stable, consistent in size, and functionalized in a manner that allows for control over the density and relative orientation of functional chemistries on the nano-scaffold surface. Various chemistries including small modifications (N2-methyl-guanine), bulky aromatic modifications (N2-benzyl-guanine), and long chain-like modifications (N2-6-amino-hexyl-guanine) are tested and are found to be generally compatible with G-quadruplex formation. Furthermore, these modifications stabilize the G-quadruplex scaffold by 2.0-13.3 °C per modification in the melting temperature, with concurrent modifications producing extremely stable nano-scaffolds. We demonstrate the potential of this approach by functionalizing nano-scaffolds for use within the biotin-avidin conjugation approach. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.

DNA Sequences Proximal to Human Mitochondrial DNA Deletion Breakpoints Prevalent in Human Disease Form G-quadruplexes, a Class of DNA Structures Inefficiently Unwound by the Mitochondrial Replicative Twinkle Helicase*

Science.gov (United States)

Bharti, Sanjay Kumar; Sommers, Joshua A.; Zhou, Jun; Kaplan, Daniel L.; Spelbrink, Johannes N.; Mergny, Jean-Louis; Brosh, Robert M.

2014-01-01

Mitochondrial DNA deletions are prominent in human genetic disorders, cancer, and aging. It is thought that stalling of the mitochondrial replication machinery during DNA synthesis is a prominent source of mitochondrial genome instability; however, the precise molecular determinants of defective mitochondrial replication are not well understood. In this work, we performed a computational analysis of the human mitochondrial genome using the “Pattern Finder” G-quadruplex (G4) predictor algorithm to assess whether G4-forming sequences reside in close proximity (within 20 base pairs) to known mitochondrial DNA deletion breakpoints. We then used this information to map G4P sequences with deletions characteristic of representative mitochondrial genetic disorders and also those identified in various cancers and aging. Circular dichroism and UV spectral analysis demonstrated that mitochondrial G-rich sequences near deletion breakpoints prevalent in human disease form G-quadruplex DNA structures. A biochemical analysis of purified recombinant human Twinkle protein (gene product of c10orf2) showed that the mitochondrial replicative helicase inefficiently unwinds well characterized intermolecular and intramolecular G-quadruplex DNA substrates, as well as a unimolecular G4 substrate derived from a mitochondrial sequence that nests a deletion breakpoint described in human renal cell carcinoma. Although G4 has been implicated in the initiation of mitochondrial DNA replication, our current findings suggest that mitochondrial G-quadruplexes are also likely to be a source of instability for the mitochondrial genome by perturbing the normal progression of the mitochondrial replication machinery, including DNA unwinding by Twinkle helicase. PMID:25193669

Targeting G-quadruplex DNA Structures by EMICORON has a strong antitumor efficacy against advanced models of human colon cancer

DEFF Research Database (Denmark)

Porru, Manuela; Artuso, Simona; Salvati, Erica

2015-01-01

We previously identified EMICORON as a novel G-quadruplex (G4) ligand showing high selectivity for G4 structures over the duplex DNA, causing telomere damage and inhibition of cell proliferation in transformed and tumor cells. Here, we evaluated the antitumoral effect of EMICORON on advanced mode...

Nano-powder production by electrical explosion of wires

International Nuclear Information System (INIS)

Mao Zhiguo; Zou Xiaobing; Wang Xinxin; Jiang Weihua

2010-01-01

A device for nano-powder production by electrical explosion of wires was designed and built. Eight wires housed in the discharge chamber are exploded one by one before opening the chamber for the collection of the produced nano-powder. To increase the rate of energy deposition into a wire, the electrical behavior of the discharge circuit including the exploding wire was simulated. The results showed that both reducing the circuit inductance and reducing the capacitance of the energy-storage capacitor (keeping the storage energy constant) can increase the energy deposition rate. To better understand the physical processes of the nano-powder formation by the wire vapor, a Mach-Zehnder interferometer was used to record the time evolution of the wire vapor as well as the plasma. A thermal expansion lag of the dense vapor core as well as more than one times of the vapor burst was observed for the first time. Finally, nano-powders of titanium nitride, titanium dioxide, copper oxides and zinc oxide were produced by electrical explosion of wires. (authors)

Identifying the impact of G-quadruplexes on Affymetrix 3' arrays using cloud computing.

Science.gov (United States)

Memon, Farhat N; Owen, Anne M; Sanchez-Graillet, Olivia; Upton, Graham J G; Harrison, Andrew P

2010-01-15

A tetramer quadruplex structure is formed by four parallel strands of DNA/ RNA containing runs of guanine. These quadruplexes are able to form because guanine can Hoogsteen hydrogen bond to other guanines, and a tetrad of guanines can form a stable arrangement. Recently we have discovered that probes on Affymetrix GeneChips that contain runs of guanine do not measure gene expression reliably. We associate this finding with the likelihood that quadruplexes are forming on the surface of GeneChips. In order to cope with the rapidly expanding size of GeneChip array datasets in the public domain, we are exploring the use of cloud computing to replicate our experiments on 3' arrays to look at the effect of the location of G-spots (runs of guanines). Cloud computing is a recently introduced high-performance solution that takes advantage of the computational infrastructure of large organisations such as Amazon and Google. We expect that cloud computing will become widely adopted because it enables bioinformaticians to avoid capital expenditure on expensive computing resources and to only pay a cloud computing provider for what is used. Moreover, as well as financial efficiency, cloud computing is an ecologically-friendly technology, it enables efficient data-sharing and we expect it to be faster for development purposes. Here we propose the advantageous use of cloud computing to perform a large data-mining analysis of public domain 3' arrays.

Analog and digital appliance technology for the control and monitoring of space HVAC systems

Energy Technology Data Exchange (ETDEWEB)

Gyoeri, M

1987-01-01

Both analog and digital devices are expected to meet the required control functions. The analog control device meets this function by way of a complicated circuitry and wiring technology of varying sophistication. In the digital control by a preprogrammed microprocessor. Digital technology allows to use the copied programme in different devices. Any change in the control of a system can be implemented and met by a programme change in digital technology. In analog technology, this change involves a change in wiring. (orig./HW).

SpaceWire Driver Software for Special DSPs

Science.gov (United States)

Clark, Douglas; Lux, James; Nishimoto, Kouji; Lang, Minh

2003-01-01

A computer program provides a high-level C-language interface to electronics circuitry that controls a SpaceWire interface in a system based on a space qualified version of the ADSP-21020 digital signal processor (DSP). SpaceWire is a spacecraft-oriented standard for packet-switching data-communication networks that comprise nodes connected through bidirectional digital serial links that utilize low-voltage differential signaling (LVDS). The software is tailored to the SMCS-332 application-specific integrated circuit (ASIC) (also available as the TSS901E), which provides three highspeed (150 Mbps) serial point-to-point links compliant with the proposed Institute of Electrical and Electronics Engineers (IEEE) Standard 1355.2 and equivalent European Space Agency (ESA) Standard ECSS-E-50-12. In the specific application of this software, the SpaceWire ASIC was combined with the DSP processor, memory, and control logic in a Multi-Chip Module DSP (MCM-DSP). The software is a collection of low-level driver routines that provide a simple message-passing application programming interface (API) for software running on the DSP. Routines are provided for interrupt-driven access to the two styles of interface provided by the SMCS: (1) the "word at a time" conventional host interface (HOCI); and (2) a higher performance "dual port memory" style interface (COMI).

A label-free luminescent switch-on assay for ATP using a G-quadruplex-selective iridium(III) complex.

Science.gov (United States)

Leung, Ka-Ho; Lu, Lihua; Wang, Modi; Mak, Tsun-Yin; Chan, Daniel Shiu-Hin; Tang, Fung-Kit; Leung, Chung-Hang; Kwan, Hiu-Yee; Yu, Zhiling; Ma, Dik-Lung

2013-01-01

We report herein the G-quadruplex-selective property of a luminescent cyclometallated iridium(III) complex for the detection of adenosine-5'-triphosphate (ATP) in aqueous solution. The ATP-binding aptamer was employed as the ATP recognition unit, while the iridium(III) complex was used to monitor the formation of the G-quadruplex structure induced by ATP. The sensitivity and fold enhancement of the assay were higher than those of the previously reported assay using the organic dye crystal violet as a fluorescent probe. This label-free luminescent switch-on assay exhibits high sensitivity and selectivity towards ATP with a limit of detection of 2.5 µM.

A label-free luminescent switch-on assay for ATP using a G-quadruplex-selective iridium(III complex.

Directory of Open Access Journals (Sweden)

Ka-Ho Leung

Full Text Available We report herein the G-quadruplex-selective property of a luminescent cyclometallated iridium(III complex for the detection of adenosine-5'-triphosphate (ATP in aqueous solution. The ATP-binding aptamer was employed as the ATP recognition unit, while the iridium(III complex was used to monitor the formation of the G-quadruplex structure induced by ATP. The sensitivity and fold enhancement of the assay were higher than those of the previously reported assay using the organic dye crystal violet as a fluorescent probe. This label-free luminescent switch-on assay exhibits high sensitivity and selectivity towards ATP with a limit of detection of 2.5 µM.

A Prototype Wire Position Monitoring System

International Nuclear Information System (INIS)

Wang, Wei

2010-01-01

The Wire Position Monitoring System (WPM) will track changes in the transverse position of LCLS Beam Position Monitors (BPMs) to 1(micro)m over several weeks. This position information will be used between applications of beam based alignment to correct for changes in component alignment. The WPM system has several requirements. The sensor range must be large enough so that precision sensor positioning is not required. The resolution needs to be small enough so that the signal can be used to monitor motion to 1(micro)m. The system must be stable enough so that system drift does not mimic motion of the component being monitored. The WPM sensor assembly consists of two parts, the magnetic sensor and an integrated lock-in amplifier. The magnetic sensor picks up a signal from the alternating current in a stretched wire. The voltage v induced in the sensor is proportional to the wire displacement from the center of the sensor. The integrated lock-in amplifier provides a DC output whose magnitude is proportional to the AC signal from the magnetic sensor. The DC output is either read on a digital voltmeter or digitized locally and communicated over a computer interface.

Experimental investigation of industrial copper deformed by wire ...

African Journals Online (AJOL)

drawing on microstructure and physical properties of industrial copper wires. Copper wires were provided by E.N.I.CA.Biskra (Algeria). We investigated some wires with different strain levels (as received, 1.20, 2.10, and ε = 3.35).

A high resolution wire scanner beam profile monitor with a microprocessor data acquisition system

International Nuclear Information System (INIS)

Cutler, R.I.; Mohr, D.L.; Whittaker, J.K.; Yoder, N.R.

1983-01-01

A beam profile monitor has been constructed for the NBS-LANL Racetrack Microtron. The monitor consists of two perpendicular 30 μm diameter carbon wires that are driven through an electron beam by a pneumatic actuator. A long-lifetime, electroformed nickel bellows is used for the linear-motion vacuum feedthrough. Secondary emission current from the wires and a signal from a transducer measuring the position of the wires are simultaneously digitized by a microprocessor to yield beam current density profiles in two dimensions. The wire scanner is designed for use with both pulsed and cw beams

MIDAS, prototype Multivariate Interactive Digital Analysis System, phase 1. Volume 3: Wiring diagrams

Science.gov (United States)

Kriegler, F. J.; Christenson, D.; Gordon, M.; Kistler, R.; Lampert, S.; Marshall, R.; Mclaughlin, R.

1974-01-01

The Midas System is a third-generation, fast, multispectral recognition system able to keep pace with the large quantity and high rates of data acquisition from present and projected sensors. A principal objective of the MIDAS Program is to provide a system well interfaced with the human operator and thus to obtain large overall reductions in turn-around time and significant gains in throughput. The hardware and software generated in Phase I of the overall program are described. The system contains a mini-computer to control the various high-speed processing elements in the data path and a classifier which implements an all-digital prototype multivariate-Gaussian maximum likelihood decision algorithm operating at 2 x 100,000 pixels/sec. Sufficient hardware was developed to perform signature extraction from computer-compatible tapes, compute classifier coefficients, control the classifier operation, and diagnose operation. The MIDAS construction and wiring diagrams are given.

Sensitive and simple method for measuring wire tensions

International Nuclear Information System (INIS)

Atac, M.; Mishina, M.

1982-08-01

Measuring tension of wires in drift chambers and multiwire proportional chambers after construction is an important process because sometimes wires get loose after soldering, crimping or glueing. One needs to sort out wires which have tensions below a required minimum value to prevent electrostatic instabilities. There have been several methods reported on this subject in which the wires were excited either with sinusoidal current under magnetic field or with sinusoidal voltage electrostatically coupled to the wire, searching for a resonating frequency with which the wires vibrate mechanically. Then the vibration is detected either visually, optically or with magnetic pick-up directly touching the wires. Any of these is only applicable to the usual multiwire chamber which has open access to the wire plane. They also need fairly large excitation currents to induce a detectable vibration to the wires. Here we report a very simple method that can be used for any type of wire chamber or proportional tube system for measuring wire tension. Only a very small current is required for the wire excitation to obtain a large enough signal because it detects the induced emf voltage across a wire. A sine-wave oscillator and a digital voltmeter are sufficient devices aside from a permanent magnet to provide the magnetic field around the wire. A useful application of this method to a large system is suggested

Effect of wire shape on wire array discharge

International Nuclear Information System (INIS)

Shimomura, N.; Tanaka, Y.; Yushita, Y.; Nagata, M.; Teramoto, Y.; Katsuki, S.; Akiyama, H.

2001-01-01

Although considerable investigations have been reported on z-pinches to achieve nuclear fusion, little attention has been given from the point of view of how a wire array consisting of many parallel wires explodes. Instability existing in the wire array discharge has been shown. In this paper, the effect of wire shape in the wire array on unstable behavior of the wire array discharge is represented by numerical analysis. The claws on the wire formed in installation of wire may cause uniform current distribution on wire array. The effect of error of wire diameter in production is computed by Monte Carlo Method. (author)

Effect of wire shape on wire array discharge

Energy Technology Data Exchange (ETDEWEB)

Shimomura, N.; Tanaka, Y.; Yushita, Y.; Nagata, M. [University of Tokushima, Department of Electrical and Electronic Engineering, Tokushima (Japan); Teramoto, Y.; Katsuki, S.; Akiyama, H. [Kumamoto University, Department of Electrical and Computer Engineering, Kumamoto (Japan)

2001-09-01

Although considerable investigations have been reported on z-pinches to achieve nuclear fusion, little attention has been given from the point of view of how a wire array consisting of many parallel wires explodes. Instability existing in the wire array discharge has been shown. In this paper, the effect of wire shape in the wire array on unstable behavior of the wire array discharge is represented by numerical analysis. The claws on the wire formed in installation of wire may cause uniform current distribution on wire array. The effect of error of wire diameter in production is computed by Monte Carlo Method. (author)

Allelic Dropout During Polymerase Chain Reaction due to G-Quadruplex Structures and DNA Methylation Is Widespread at Imprinted Human Loci

Directory of Open Access Journals (Sweden)

Aaron J. Stevens

2017-03-01

Full Text Available Loss of one allele during polymerase chain reaction (PCR amplification of DNA, known as allelic dropout, can be caused by a variety of mechanisms. Allelic dropout during PCR may have profound implications for molecular diagnostic and research procedures that depend on PCR and assume biallelic amplification has occurred. Complete allelic dropout due to the combined effects of cytosine methylation and G-quadruplex formation was previously described for a differentially methylated region of the human imprinted gene, MEST. We now demonstrate that this parent-of-origin specific allelic dropout can potentially occur at several other genomic regions that display genomic imprinting and have propensity for G-quadruplex formation, including AIM1, BLCAP, DNMT1, PLAGL1, KCNQ1, and GRB10. These findings demonstrate that systematic allelic dropout during PCR is a general phenomenon for regions of the genome where differential allelic methylation and G-quadruplex motifs coincide, and suggest that great care must be taken to ensure biallelic amplification is occurring in such situations.

Effects of trimethylamine N-oxide and urea on DNA duplex and G-quadruplex.

Science.gov (United States)

Ueda, Yu-Mi; Zouzumi, Yu-Ki; Maruyama, Atsushi; Nakano, Shu-Ichi; Sugimoto, Naoki; Miyoshi, Daisuke

2016-01-01

We systematically investigated effects of molecular crowding with trimethylamine N -oxide (TMAO) as a zwitterionic and protective osmolyte and urea as a nonionic denaturing osmolyte on conformation and thermodynamics of the canonical DNA duplex and the non-canonical DNA G-quadruplex. It was found that TMAO and urea stabilized and destabilized, respectively, the G-quadruplex. On the other hand, these osmolytes generally destabilize the duplex; however, it was observed that osmolytes having the trimethylamine group stabilized the duplex at the lower concentrations because of a direct binding to a groove of the duplex. These results are useful not only to predict DNA structures and their thermodynamics under physiological environments in living cells, but also design of polymers and materials to regulate structure and stability of DNA sequences.

Digital thermal anemometry

International Nuclear Information System (INIS)

Stock, D.E.; Shook, M.

1983-01-01

Calibration and data reduction techniques relying completely on digital systems are described for standard hot-wire, cross-wires, and split-film probes. These techniques allow the probe to be calibrated in the actual orientation which will be used. Success of the method depends on initially balancing a dual element probe such that both sensors respond identically to velocity changes

Structural dynamics of thrombin-binding DNA aptamer d(GGTTGGTGTGGTTGG) quadruplex DNA studied by large-scale explicit solvent simulations

Czech Academy of Sciences Publication Activity Database

Reshetnikov, R.; Golovin, A.; Spiridonova, V.; Kopylov, A.; Šponer, Jiří

2010-01-01

Roč. 6, č. 10 (2010), s. 3003-3014 ISSN 1549-9618 R&D Projects: GA AV ČR(CZ) IAA400040802; GA ČR(CZ) GA203/09/1476; GA MŠk(CZ) LC06030 Institutional research plan: CEZ:AV0Z50040507; CEZ:AV0Z50040702 Keywords : molecular dynamics * quadruplex DNA * thrombin Subject RIV: BO - Biophysics Impact factor: 5.138, year: 2010

New crosslinked polyvinyl chloride insulated wire by electron beam irradiation

International Nuclear Information System (INIS)

Takahata, Norio; Shingyouchi, Kazuo; Sato, Masakatsu; Sasaki, Hidemi; Terunuma, Haruji

1978-01-01

The polyvinyl chloride-coated wires crosslinked by electron beam irradiation have made rapid progress as electric and electronic wiring material and grown to hold a firm position in this field. In response to the requirements for wires with the advance of electronic equipments, Hitachi Cable Ltd. developed a peculiar graft polymer consisting of chlorinated polyethylene and polyvinyl chloride. To this polymer, the characteristics of a very wide range from toughness to flexibility can be given, and the crosslinked polyvinyl chloride wires utilizing these characteristics were put in practical use. Many kinds of the wires were developed as follows; 105 deg. C rating crosslinked vinyl-coated wires authorized by UL and CSA standards, crosslinked vinyl-coated wires with excellent flexibility, high strength crosslinked vinyl-coated wires with thin coating and crosslinked vinyl-coated wires for automobiles. They are expected to be developed into other new fields and applications. (Kobatake, H.)

Enhanced anti-HIV-1 activity of G-quadruplexes comprising locked nucleic acids and intercalating nucleic acids

DEFF Research Database (Denmark)

Pedersen, Erik Bjerregaard; Nielsen, Jakob Toudahl; Nielsen, Claus

2011-01-01

Two G-quadruplex forming sequences, 50-TGGGAG and the 17-mer sequence T30177, which exhibit anti-HIV-1 activity on cell lines, were modified using either locked nucleic acids (LNA) or via insertions of (R)-1-O-(pyren-1-ylmethyl)glycerol (intercalating nucleic acid, INA) or (R)-1-O-[4-(1......-pyrenylethynyl)phenylmethyl]glycerol (twisted intercalating nucleic acid, TINA). Incorporation of LNA or INA/TINA monomers provide as much as 8-fold improvement of anti-HIV-1 activity. We demonstrate for the first time a detailed analysis of the effect the incorporation of INA/TINA monomers in quadruplex forming...

Unexpected Position-Dependent Effects of Ribose G-Quartets in G-Quadruplexes

Czech Academy of Sciences Publication Activity Database

Zhou, J.; Amrane, S.; Rosu, F.; Salgado, G.; Bian, Y.; Tateishi-Karimata, H.; Largy, E.; Korkut, D. N.; Bourdoncle, A.; Miyoshi, D.; Zhang, J.; Ju, H.; Wang, W.; Sugimoto, N.; Gabelica, V.; Mergny, Jean-Louis

2017-01-01

Roč. 139, č. 23 (2017), s. 7768-7779 ISSN 0002-7863 Institutional support: RVO:68081707 Keywords : human telomeric rna * electrospray mass-spectrometry * molecular crowding conditions * dna g-quadruplexes Subject RIV: BO - Biophysics OBOR OECD: Electrochemistry (dry cells, batteries, fuel cells, corrosion metals, electrolysis) Impact factor: 13.858, year: 2016

Allelic Dropout During Polymerase Chain Reaction due to G-Quadruplex Structures and DNA Methylation Is Widespread at Imprinted Human Loci.

Science.gov (United States)

Stevens, Aaron J; Taylor, Millie G; Pearce, Frederick Grant; Kennedy, Martin A

2017-03-10

Loss of one allele during polymerase chain reaction (PCR) amplification of DNA, known as allelic dropout, can be caused by a variety of mechanisms. Allelic dropout during PCR may have profound implications for molecular diagnostic and research procedures that depend on PCR and assume biallelic amplification has occurred. Complete allelic dropout due to the combined effects of cytosine methylation and G-quadruplex formation was previously described for a differentially methylated region of the human imprinted gene, MEST We now demonstrate that this parent-of-origin specific allelic dropout can potentially occur at several other genomic regions that display genomic imprinting and have propensity for G-quadruplex formation, including AIM1 , BLCAP , DNMT1 , PLAGL1 , KCNQ1 , and GRB10 These findings demonstrate that systematic allelic dropout during PCR is a general phenomenon for regions of the genome where differential allelic methylation and G-quadruplex motifs coincide, and suggest that great care must be taken to ensure biallelic amplification is occurring in such situations. Copyright © 2017 Stevens et al.

Enantioselective light switch effect of Δ- and Λ-[Ru(phenanthroline)2 dipyrido[3,2-a:2', 3'-c]phenazine]2+ bound to G-quadruplex DNA.

Science.gov (United States)

Park, Jin Ha; Lee, Hyun Suk; Jang, Myung Duk; Han, Sung Wook; Kim, Seog K; Lee, Young-Ae

2018-06-01

The interaction of Δ- and Λ-[Ru(phen) 2 DPPZ] 2+ (DPPZ = dipyrido[3,2-a:2', 3'-c]phenazine, phen = phenanthroline) with a G-quadruplex formed from 5'-G 2 T 2 G 2 TGTG 2 T 2 G 2-3 '(15-mer) was investigated. The well-known enhancement of luminescence intensity (the 'light-switch' effect) was observed for the [Ru(phen) 2 DPPZ] 2+ complexes upon formation of an adduct with the G-quadruplex. The emission intensity of the G-quadruplex-bound Λ-isomer was 3-fold larger than that of the Δ-isomer when bound to the G-quadruplex, which is opposite of the result observed in the case of double stranded DNA (dsDNA); the light switch effect is larger for the dsDNA-bound Δ-isomer. In the job plot of the G-quadruplex with Δ- and Λ-[Ru(phen) 2 DPPZ] 2+ , a major inflection point for the two isomers was observed at x ≈ .65, which suggests a binding stoichiometry of 2:1 for both enantiomers. When the G base at the 8th position was replaced with 6-methyl isoxanthopterin (6MI), a fluorescent guanine analog, the excited energy of 6-MI transferred to bound Δ- or Λ-[Ru(phen) 2 DPPZ] 2+ , which suggests that at least a part of both Ru(II) enantiomers is close to or in contact with the diagonal loop of the G-quadruplex. A luminescence quenching experiment using [Fe(CN) 6 ] 4- for the G-quadruplex-bound Ru(II) complex revealed downward bending curves for both enantiomers in the Stern-Volmer plot, which suggests the presence of Ru(II) complexes that are both accessible and inaccessible to the quencher and may be related to the 2:1 binding stoichiometry.

Fully integrated graphene electronic biosensor for label-free detection of lead (II) ion based on G-quadruplex structure-switching.

Science.gov (United States)

Li, Yijun; Wang, Cheng; Zhu, Yibo; Zhou, Xiaohong; Xiang, Yu; He, Miao; Zeng, Siyu

2017-03-15

This work presents a fully integrated graphene field-effect transistor (GFET) biosensor for the label-free detection of lead ions (Pb 2+ ) in aqueous-media, which first implements the G-quadruplex structure-switching biosensing principle in graphene nanoelectronics. We experimentally illustrate the biomolecular interplay that G-rich DNA single-strands with one-end confined on graphene surface can specifically interact with Pb 2+ ions and switch into G-quadruplex structures. Since the structure-switching of electrically charged DNA strands can disrupt the charge distribution in the vicinity of graphene surface, the carrier equilibrium in graphene sheet might be altered, and manifested by the conductivity variation of GFET. The experimental data and theoretical analysis show that our devices are capable of the label-free and specific quantification of Pb 2+ with a detection limit down to 163.7ng/L. These results first verify the signaling principle competency of G-quadruplex structure-switching in graphene electronic biosensors. Combining with the advantages of the compact device structure and convenient electrical signal, a label-free GFET biosensor for Pb 2+ monitoring is enabled with promising application potential. Copyright © 2016 Elsevier B.V. All rights reserved.

Cutting techniques of reinforced concrete by wire sawing

International Nuclear Information System (INIS)

Miyao, Hidehiko; Komatsu, Junji; Kamiyama, Yoshinori; Yasoshima, Harunori; Kukino, Yoshinori; Yamamoto, Yuichi; Miyazaki, Takashi; Aritomi, Masanori

1995-01-01

The Research Association for Nuclear Facility Decommissioning (RANDEC) has been carrying out demonstration tests to improve current technologies for decommissioning. The conceptual dismantling system has been studied and basic cutting tests have been carried out by wire sawing. In terms of waste management and dismantling efficiency, the diamond wire saw cutting method has advantages for cutting radioactive concrete in large blocks. A conceptual design for a dismantling system for various concrete shieldings of nuclear facilities has been developed and diamond wire sawing has been designed and manufactured. The basic cutting tests by wire sawing have been carried out to obtain quantitative data, in addition to the conceptual design of a dismantling system for biological shielding of various power reactors (PWR, BWR, GCR) and cell walls of nuclear fuel cycle facilities. On the basis of the conceptual dismantling system and quantitative cutting performance data, wire sawing equipment has been manufactured for use in nuclear facilities. This study was performed on consignment for the Science and Technology Agency of Japan. (author)

Exonuclease-assisted multicolor aptasensor for visual detection of ochratoxin A based on G-quadruplex-hemin DNAzyme-mediated etching of gold nanorod.

Science.gov (United States)

Yu, Xinhui; Lin, Yaohui; Wang, Xusheng; Xu, Liangjun; Wang, Zongwen; Fu, FengFu

2018-04-21

An exonuclease-assisted multicolor aptasensor was developed for the visual detection of ochratoxin A (OTA). It is based on the etching of gold nanorods (AuNRs) mediated by a G-quadruplex-hemin DNAzyme. A DNA sequence (AG4-OTA) was designed that comprises a hemin aptamer and an OTA aptamer. OTA binds to AG4-OTA to form an antiparallel G-quadruplex, which halts its digestion by exonuclease I (Exo I) from the 3'-end of AG4-OTA. Thus, the retained hemin aptamer can bind to hemin to form a G-quadruplex-hemin DNAzyme. This DNAzyme has peroxidase-like activity that catalyzes the oxidation of 3,3',5,5'-tetramethylbenzidine (TMB) by H 2 O 2 to produce its diimine derivative (TMB 2+ ) in acidic solution. TMB 2+ can etch the AuNRs by oxidizing Au(0) into Au(I). This results in the generation of rainbow-like colors and provides a multicolor platform for the visual detection of OTA. The assay is based on the use of a single isolated aptamer and possesses obvious advantages such as multi-color visual inspection, relatively high sensitivity and accuracy. It can be used to detect as little as 30 nM concentrations of OTA by visual observation and even 10 nM concentrations by spectrophotometry. The method was successfully applied to the determination of OTA in spiked beer where it gave recoveries of 101-108%, with a relative standard deviation (RSD, n = 5) of <5%. Graphical abstract Schematic of an exonuclease-assisted multicolor bioassay based on the G-quadruplex-hemin DNAzyme-mediated etching of gold nanorods (AuNRs). It enables visual detection of ochratoxin A (OTA) with a detection limit of 30 nM.

G-quadruplex-based structural transitions in 15-mer DNA oligonucleotides varying in lengths of internal oligo(dG) stretches detected by voltammetric techniques

Czech Academy of Sciences Publication Activity Database

Vidláková, Pavlína; Pivoňková, Hana; Kejnovská, Iva; Trnková, L.; Vorlíčková, Michaela; Fojta, Miroslav; Havran, Luděk

2015-01-01

Roč. 407, č. 19 (2015), s. 5817-5826 ISSN 1618-2642 R&D Projects: GA ČR GAP206/12/2378 Institutional support: RVO:68081707 Keywords : Oligonucleotides * Electrochemical methods * G-quadruplex Subject RIV: BO - Biophysics Impact factor: 3.125, year: 2015

6-Thioguanine alters the structure and stability of duplex DNA and inhibits quadruplex DNA formation.

Science.gov (United States)

Marathias, V M; Sawicki, M J; Bolton, P H

1999-07-15

The ability to chemically synthesize biomolecules has opened up the opportunity to observe changes in structure and activity that occur upon single atom substitution. In favorable cases this can provide information about the roles of individual atoms. The substitution of 6-thioguanine (6SG) for guanine is a potentially very useful single atom substitution as 6SG has optical, photocrosslinking, metal ion binding and other properties of potential utility. In addition, 6-mercaptopurine is a clinically important pro-drug that is activated by conversion into 6SG by cells. The results presented here indicate that the presence of 6SG blocks the formation of quadruplex DNA. The presence of 6SG alters the structure and lowers the thermal stability of duplex DNA, but duplex DNA can be formed in the presence of 6SG. These results indicate that some of the cytotoxic activity of 6SG may be due to disruption of the quadruplex structures formed by telomere and other DNAs. This additional mode of action is consistent with the delayed onset of cytotoxicity.

Surface cleaning of metal wire by atmospheric pressure plasma

International Nuclear Information System (INIS)

Nakamura, T.; Buttapeng, C.; Furuya, S.; Harada, N.

2009-01-01

In this study, the possible application of atmospheric pressure dielectric barrier discharge plasma for the annealing of metallic wire is examined and presented. The main purpose of the current study is to examine the surface cleaning effect for a cylindrical object by atmospheric pressure plasma. The experimental setup consists of a gas tank, plasma reactor, and power supply with control panel. The gas assists in the generation of plasma. Copper wire was used as an experimental cylindrical object. This copper wire was irradiated with the plasma, and the cleaning effect was confirmed. The result showed that it is possible to remove the tarnish which exists on the copper wire surface. The experiment reveals that atmospheric pressure plasma is usable for the surface cleaning of metal wire. However, it is necessary to examine the method for preventing oxidization of the copper wire.

Fabrication of mesoscopic floating Si wires by introducing dislocations

International Nuclear Information System (INIS)

Motohashi, Mitsuya; Shimizu, Kazuya; Niwa, Masaaki; Suzuki, Toshiaki

2014-01-01

We fabricated a mesoscopic Si wire by introducing dislocations in a silicon wafer before HF anodization. The dislocations formed along the (111) crystal plane. The outline of the dislocation line was an inverted triangle. The resulting wire floated on a bridge girder and had a hybrid structure consisting of a porous layer and crystalline Si. The cross section of the wire had an inverted triangle shape. The wire formation mechanism is discussed in terms of carrier transport, crystal structure, and dislocation formation during anodization. (paper)

Fabrication of mesoscopic floating Si wires by introducing dislocations

Science.gov (United States)

Motohashi, Mitsuya; Shimizu, Kazuya; Suzuki, Toshiaki; Niwa, Masaaki

2014-12-01

We fabricated a mesoscopic Si wire by introducing dislocations in a silicon wafer before HF anodization. The dislocations formed along the (111) crystal plane. The outline of the dislocation line was an inverted triangle. The resulting wire floated on a bridge girder and had a hybrid structure consisting of a porous layer and crystalline Si. The cross section of the wire had an inverted triangle shape. The wire formation mechanism is discussed in terms of carrier transport, crystal structure, and dislocation formation during anodization.

A light-up probe targeting for Bcl-2 2345 G-quadruplex DNA with carbazole TO

Science.gov (United States)

Gu, Yingchun; Lin, Dayong; Tang, Yalin; Fei, Xuening; Wang, Cuihong; Zhang, Baolian; Zhou, Jianguo

2018-02-01

As its significant role, the selective recognition of G-quadruplex with specific structures and functions is important in biological and medicinal chemistry. Carbazole derivatives have been reported as a kind of fluorescent probe with many excellent optical properties. In the present study, the fluorescence of the dye (carbazole TO) increased almost 70 fold in the presence of bcl-2 2345 G4 compared to that alone in aqueous buffer condition with almost no fluorescence and 10-30 fold than those in the presence of other DNAs. The binding study results by activity inhibition of G4/Hemin peroxidase experiment, NMR titration and molecular docking simulation showed the high affinity and selectivity to bcl-2 2345 G4 arises from its end-stacking interaction with G-quartet. It is said that a facile approach with excellent sensitive, good selectivity and quick response for bcl-2 2345 G-quadruplex was developed and may be used for antitumor recognition or antitumor agents.

Experience of precision measuring distances by invar wires at accelerators

International Nuclear Information System (INIS)

Porubaj, N.I.

1977-01-01

With a view to determining the deformations and displacements of the ring foundation of the ITEP accelerator, the method of very accurate distance measurements by means of invar wires and strips is described. Measurement errors are analyzed. This method has allowed to measure distances up to 40 m with a mean-square error of less than 40 μm. The calibration accuracy of 3 and 25-m measuring wires has been determined to be +- 27 μm. Time instability of the wires is +- 16 μm. It is shown that strips are more stable in time than wires. Elongation of 6, 19, 25 and 38 m invar wires has been measured as function of the tension time. The error due to tension of a 38-m wire may be tangible. Data on thermal coefficient variation in time has been obtained for invar wires and strips. The multiannual measurements of the ring foundation deformations show that variations of the mean radius are caused by increases of concrete temperature. Temperature increase by only 1 deg caused mean radius increase of 0.3 mm

Studies on the control of the Mediterranean fruit fly, Ceratitis capitata Wiedemann, using gamma radiation. Part of a coordinated programme on fruit fly eradication or control by the sterile-male technique

International Nuclear Information System (INIS)

Wakid, A.M.

1975-01-01

Wheat bran and molasses were used in larval medium of the Mediterranean fruit fly, Ceratitis capitata instead of the dried carrot previously used in Egypt. The new larval medium consists of wheat bran, molasses, yeast, sodium benzoate, hydrochloric acid and tap water. This substitution reduced the production costs of pupae in our laboratories. The adults produced from this medium showed almost similar emergence, fecundity, fertility and longevity as those produced from carrot medium. New large larval breeding cabinet was constructed which improved the larval production and can help in mass production purposes. Large oviposition cage was also used instead of the small ones previously used in Egypt. Six field cages made of wire screen, glass and wood were constructed to conduct semi field experiments on the competitiveness of the irradiated males. Competitiveness decreased with increased dose, doses of 5-9 krad led to almost similar reduction in egg hatch. Ratios of 13:13:1:1 and 2:2:1:1 (treated males : treated females : untreated males : untreated females) were tested in the field cages. There was no clear indication of whether male competitiveness of a particular dose was affected by the ratio of irradiated males to untreated males and females. Generally competitiveness of the irradiated males decreased by time. Flight range of the irradiated (9 krad) tagged flies was found to be 700 m within an orchard. Flies released in an orchard did not reach another orchard 700 m far from the release point

Removal mechanism of phosphate from aqueous solution by fly ash.

Science.gov (United States)

Lu, S G; Bai, S Q; Zhu, L; Shan, H D

2009-01-15

This work studied the effectiveness of fly ash in removing phosphate from aqueous solution and its related removal mechanism. The adsorption and precipitation of phosphate by fly ash were investigated separately in order to evaluate their role in the removal of phosphate. Results showed that the removal of phosphate by fly ash was rapid. The removal percentage of phosphate in the first 5min reached 68-96% of the maximum removal of phosphate by fly ash. The removal processes of phosphate by fly ash included a fast and large removal representing precipitation, then a slower and longer removal due to adsorption. The adsorption of phosphate on fly ash could be described well by Freundlich isotherm equation. The pH and Ca2+ concentration of fly ash suspension were decreased with the addition of phosphate, which suggests that calcium phosphate precipitation is a major mechanism of the phosphate removal. Comparison of the relative contribution of the adsorption and precipitation to the total removal of phosphate by fly ash showed that the adsorption accounted for 30-34% of the total removal of phosphate, depending on the content of CaO in fly ash. XRD patterns of the fly ash before and after phosphate adsorption revealed that phosphate salt (CaHPO4 x 2H2O) was formed in the adsorption process. Therefore, the removal of phosphate by fly ash can be attributed to the formation of phosphate precipitation as a brushite and the adsorption on hydroxylated oxides. The results suggested that the use of fly ash could be a promising solution to the removal of phosphate in the wastewater treatment and pollution control.

Development of linear flow rate control system for eccentric butter-fly valve

International Nuclear Information System (INIS)

Kwak, K. K.; Cho, S. W.; Park, J. S.; Cho, J. H.; Song, I. T.; Kim, J. G.; Kwon, S. J.; Kim, I. J.; Park, W. K.

1999-12-01

Butter-fly valves are advantageous over gate, globe, plug, and ball valves in a variety of installations, particularly in the large sizes. The purpose of this project development of linear flow rate control system for eccentric butter-fly valve (intelligent butter-fly valve system). The intelligent butter-fly valve system consist of a valve body, micro controller. The micro controller consist of torque control system, pressure censor, worm and worm gear and communication line etc. The characteristics of intelligent butter-fly valve system as follows: Linear flow rate control function. Digital remote control function. guard function. Self-checking function. (author)

Spectroscopic studies on the interactions of 5-ethyl-6-phenyl-3,8-bis((3-aminoalkyl)propanamido)phenanthridin-5-ium derivatives with G-quadruplex DNA

Science.gov (United States)

Yalçın, Ergin; Duyar, Halil; Ihmels, Heiko; Seferoğlu, Zeynel

2018-05-01

An improved microwave-induced synthesis of five ethidium derivatives (Ethidium derivatives, 2a-d) is presented. As the derivatives 2a-d have been proposed previously to be telomerase inhibitors, the binding interactions of these ethidium derivatives with G-quadruplex DNA were evaluated by means of photometric and fluorimetric titration, thermal DNA denaturation, CD and 1H NMR spectroscopy. In particular, the compound bearing 3,8-bis(pyrrolidin-1-yl)propanamido substituent 2a exhibits high selectivity for G-quadruplex DNA relative to duplex DNA.

Acidolysis of coal fly ash by Aspergillus niger

Energy Technology Data Exchange (ETDEWEB)

Torma, A.E.; Singh, A.K. (EG and G Idaho Inc., Idaho Falls, ID (United States). Center for Biological Processing Technology)

1993-12-01

The kinetics of aluminium extraction were investigated, using as-received and calcined fly ash samples and a pure culture of [ital Aspergillus niger]. This fungus metabolized sucrose to citric and oxalic acids, which were involved in the acidolysis of fly ash. Aluminium extraction from as-received fly ash was only 5-8%, whereas from calcined fly ash it was up to 93.5%. The order of reaction and the overall reaction rate constant were determined by the van't Hoff technique with respect to the concentration of calcined fly ash. A linearized form of a modified Monod expression was applied to the experimental data to assess the kinetic constants for the acidolysis process. Statistically designed experiments were carried out with calcined fly ash and synthetic solutions containing citric and oxalic acids to determine the optimum leaching conditions. The acidolysis reaction mechanism is discussed. 28 refs., 6 figs., 3 tabs.

Temperature Diffusion Distribution of Electric Wire Deteriorated by Overcurrent

Science.gov (United States)

Choi, Chung-Seog; Kim, Hyang-Kon; Kim, Dong-Woo; Lee, Ki-Yeon

This study presents thermal diffusion distribution of the electric wires when overcurrent is supplied to copper wires. And then, this study intends to provide a basis of knowledge for analyzing the causes of electric accidents through hybrid technology. In the thermal image distribution analysis of the electric wire to which fusing current was supplied, it was found that less heat was accumulated in the thin wires because of easier heat dispersion, while more heat was accumulated in the thicker wires. The 3-dimensional thermal image analysis showed that heat distribution was concentrated at the center of the wire and the inclination of heat distribution was steep in the thicker wires. When 81A was supplied to 1.6mm copper wire for 500 seconds, the surface temperature of wire was maximum 46.68°C and minimum 30.87°C. It revealed the initial characteristics of insulation deterioration that generates white smoke without external deformation. In the analysis with stereoscopic microscope, the surface turned dark brown and rough with the increase of fusing current. Also, it was known that exfoliation occurred when wire melted down with 2 times the fusing current. With the increase of current, we found the number of primary arms of the dendrite structure to be increased and those of the secondary and tertiary arms to be decreased. Also, when the overcurrent reached twice the fusing current, it was found that columnar composition, observed in the cross sectional structure of molten wire, appeared and formed regular directivity. As described above, we could present the burning pattern and change in characteristics of insulation and conductor quantitatively. And we could not only minimize the analysis error by combining the information but also present the scientific basis in the analysis of causes of electric accidents, mediation of disputes on product liability concerning the electric products.

Label-free logic modules and two-layer cascade based on stem-loop probes containing a G-quadruplex domain.

Science.gov (United States)

Guo, Yahui; Cheng, Junjie; Wang, Jine; Zhou, Xiaodong; Hu, Jiming; Pei, Renjun

2014-09-01

A simple, versatile, and label-free DNA computing strategy was designed by using toehold-mediated strand displacement and stem-loop probes. A full set of logic gates (YES, NOT, OR, NAND, AND, INHIBIT, NOR, XOR, XNOR) and a two-layer logic cascade were constructed. The probes contain a G-quadruplex domain, which was blocked or unfolded through inputs initiating strand displacement and the obviously distinguishable light-up fluorescent signal of G-quadruplex/NMM complex was used as the output readout. The inputs are the disease-specific nucleotide sequences with potential for clinic diagnosis. The developed versatile computing system based on our label-free and modular strategy might be adapted in multi-target diagnosis through DNA hybridization and aptamer-target interaction. © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

KINETICS OF FLY ASH BENEFICIATION BY CARBON BURNOUT

Energy Technology Data Exchange (ETDEWEB)

Dr. Joseph N.D. Dodoo; Dr. Joseph M. Okoh

2000-11-01

Surface area analyses performed on fly ash samples reveal that the surface area is controlled by carbon content. The higher surface areas found in large particles are due to the presence of highly porous carbonaceous particles. Adsorption-desorption isotherms and t-plots of fly ash samples indicate that fly ash is porous. BJH Adsorption/Desorption pore size analysis reveal that pore diameters are independent of sieve size. They appear to be dependent only on the nature of the material which confers porosity. Based on the results of Brown and Dykstra (41) it is reasonable to assume that calculations of reaction rates at temperatures above 550 C were confounded by weight losses from processes other than carbon oxidation and, therefore, are not useful in determination of the temperature dependence of carbon oxidation in fly ash. The results of the present study indicate that temperatures below 550 C should be used for future studies in order to satisfactorily assess the temperature dependence of carbon oxidation in fly ash. Furthermore, it is also advisable that percent carbon determinations be performed on fly ash samples after the oxidation reactions to determine whether all carbon present in fly ash is oxidized. This will ensure that reaction rates are representative of the complete oxidation of carbon. An inverse relationship was determined between reaction rates and oxygen concentration for this study. As discussed, this may be due to volatilization of volatiles from fly ash and ease of transport of products away from the reaction sites by the action of the vacuum applied to the samples. A more accurate determination of oxygen dependence of carbon oxidation can be accomplished by the use of specialty gases containing different concentrations of oxygen which could eliminate the need to apply vacuum to the samples.

G Quadruplex in Plants: A Ubiquitous Regulatory Element and Its Biological Relevance.

Science.gov (United States)

Yadav, Vikas; Hemansi; Kim, Nayun; Tuteja, Narendra; Yadav, Puja

2017-01-01

G quadruplexes (G4) are higher-order DNA and RNA secondary structures formed by G-rich sequences that are built around tetrads of hydrogen-bonded guanine bases. Potential G4 quadruplex sequences have been identified in G-rich eukaryotic non-telomeric and telomeric genomic regions. Upon function, G4 formation is known to involve in chromatin remodeling, gene regulation and has been associated with genomic instability, genetic diseases and cancer progression. The natural role and biological validation of G4 structures is starting to be explored, and is of particular interest for the therapeutic interventions for human diseases. However, the existence and physiological role of G4 DNA and G4 RNA in plants species have not been much investigated yet and therefore, is of great interest for the development of improved crop varieties for sustainable agriculture. In this context, several recent studies suggests that these highly diverse G4 structures in plants can be employed to regulate expression of genes involved in several pathophysiological conditions including stress response to biotic and abiotic stresses as well as DNA damage. In the current review, we summarize the recent findings regarding the emerging functional significance of G4 structures in plants and discuss their potential value in the development of improved crop varieties.

G Quadruplex in Plants: A Ubiquitous Regulatory Element and Its Biological Relevance

Directory of Open Access Journals (Sweden)

Vikas Yadav

2017-07-01

Full Text Available G quadruplexes (G4 are higher-order DNA and RNA secondary structures formed by G-rich sequences that are built around tetrads of hydrogen-bonded guanine bases. Potential G4 quadruplex sequences have been identified in G-rich eukaryotic non-telomeric and telomeric genomic regions. Upon function, G4 formation is known to involve in chromatin remodeling, gene regulation and has been associated with genomic instability, genetic diseases and cancer progression. The natural role and biological validation of G4 structures is starting to be explored, and is of particular interest for the therapeutic interventions for human diseases. However, the existence and physiological role of G4 DNA and G4 RNA in plants species have not been much investigated yet and therefore, is of great interest for the development of improved crop varieties for sustainable agriculture. In this context, several recent studies suggests that these highly diverse G4 structures in plants can be employed to regulate expression of genes involved in several pathophysiological conditions including stress response to biotic and abiotic stresses as well as DNA damage. In the current review, we summarize the recent findings regarding the emerging functional significance of G4 structures in plants and discuss their potential value in the development of improved crop varieties.

Identification of a New G-Quadruplex Motif in the KRAS Promoter and Design of Pyrene-Modified G4-Decoys with Antiproliferative Activity in Pancreatic Cancer Cells

DEFF Research Database (Denmark)

Cogoi, Susanna; Paramasivam, Manikandan; Filitchev, Vyacheslav Viatcheslav

2009-01-01

A new quadruplex motif located in the promoter of the human KRAS gene, within a nuclease hypersensitive element (NHE), has been characterized. Oligonucleotides mimicking this quadruplex are found to compete with a DNA-protein complex between NHE and a nuclear extract from pancreatic cancer cells........ When modified with (R)-1-O-[4-1-(1-pyrenylethynyl) phenylmethyl]glycerol insertions (TINA), the quadruplex oligonucleotides showed a dramatic increase of the Tm (ΔTm from 22 to 32 °C) and a strong antiproliferative effects in Panc-1 cells....

G-Quadruplexes in DNA Replication: A Problem or a Necessity?

Science.gov (United States)

Valton, Anne-Laure; Prioleau, Marie-Noëlle

2016-11-01

DNA replication is a highly regulated process that ensures the correct duplication of the genome at each cell cycle. A precise cell type-specific temporal program controls the duplication of complex vertebrate genomes in an orderly manner. This program is based on the regulation of both replication origin firing and replication fork progression. G-quadruplexes (G4s), DNA secondary structures displaying noncanonical Watson-Crick base pairing, have recently emerged as key controllers of genome duplication. Here we discuss the various means by which G4s affect this fundamental cellular process. Copyright © 2016 Elsevier Ltd. All rights reserved.

Multifunctional energy landscape for a DNA G-quadruplex: An evolved molecular switch

Czech Academy of Sciences Publication Activity Database

Cragnolini, T.; Chakraborty, D.; Šponer, Jiří; Derreumaux, P.; Pasquali, S.; Wales, D.J.

2017-01-01

Roč. 147, č. 15 (2017), č. článku 152715. ISSN 0021-9606 R&D Projects: GA ČR(CZ) GA16-13721S Institutional support: RVO:68081707 Keywords : telomeric g-quadruplex * gb1 hairpin peptide Subject RIV: CF - Physical ; Theoretical Chemistry OBOR OECD: Physical chemistry Impact factor: 2.965, year: 2016

Avaliação da transmissão de dados de temperatura no sistema 1-wireTM Evaluation of the temperature data transmission in the 1-wireTM system

Directory of Open Access Journals (Sweden)

Antonio J. Steidle Neto

2005-04-01

Full Text Available A necessidade de sistemas de monitoramento automático versáteis e de baixo custo que possam auxiliar o produtor agrícola na otimização dos processos produtivos, é evidente. Este trabalho foi realizado com o objetivo de pesquisar as limitações e as potencialidades de aplicação do sistema 1-wireTM na transmissão de dados de temperatura em instalações agrícolas. O sistema 1-wireTM é uma rede de transmissão de dados que possibilita a comunicação digital entre um computador e dispositivos da série 1-wireTM, tais como os sensores de temperatura DS1820. A transmissão de dados de temperatura nesse sistema foi avaliada em função do tipo dos condutores e do número de sensores DS1820. Com base nos resultados, concluiu-se que o aumento do número de sensores de temperatura DS1820 no sistema 1-wireTM incrementa a carga capacitiva de maneira distinta para cada um dos tipos de condutores estudados, podendo causar interrupções na transmissão de dados.The need of versatile and low cost automatic monitoring systems for the optimization of the agricultural productive processes is evident. This work was carried out to evaluate the limitations and potentialities of the 1-wireTM system for temperature data transmission in agricultural buildings. The 1-wireTM system is a data transmission network, which makes possible the digital communication between a computer and devices of the 1-wireTM series, such as the temperature DS1820 sensors. The temperature data transmission in this system was evaluated as a function of types of conductors and the number of DS1820 sensors. Based on the results, it was concluded that, by increasing the number of the DS1820 temperature sensors in the 1-wireTM system, the capacitive load increases in a different way for each conductor and can cause interruptions during temperature data transmission.

Small Molecule Microarrays Enable the Identification of a Selective, Quadruplex-Binding Inhibitor of MYC Expression.

Science.gov (United States)

Felsenstein, Kenneth M; Saunders, Lindsey B; Simmons, John K; Leon, Elena; Calabrese, David R; Zhang, Shuling; Michalowski, Aleksandra; Gareiss, Peter; Mock, Beverly A; Schneekloth, John S

2016-01-15

The transcription factor MYC plays a pivotal role in cancer initiation, progression, and maintenance. However, it has proven difficult to develop small molecule inhibitors of MYC. One attractive route to pharmacological inhibition of MYC has been the prevention of its expression through small molecule-mediated stabilization of the G-quadruplex (G4) present in its promoter. Although molecules that bind globally to quadruplex DNA and influence gene expression are well-known, the identification of new chemical scaffolds that selectively modulate G4-driven genes remains a challenge. Here, we report an approach for the identification of G4-binding small molecules using small molecule microarrays (SMMs). We use the SMM screening platform to identify a novel G4-binding small molecule that inhibits MYC expression in cell models, with minimal impact on the expression of other G4-associated genes. Surface plasmon resonance (SPR) and thermal melt assays demonstrated that this molecule binds reversibly to the MYC G4 with single digit micromolar affinity, and with weaker or no measurable binding to other G4s. Biochemical and cell-based assays demonstrated that the compound effectively silenced MYC transcription and translation via a G4-dependent mechanism of action. The compound induced G1 arrest and was selectively toxic to MYC-driven cancer cell lines containing the G4 in the promoter but had minimal effects in peripheral blood mononucleocytes or a cell line lacking the G4 in its MYC promoter. As a measure of selectivity, gene expression analysis and qPCR experiments demonstrated that MYC and several MYC target genes were downregulated upon treatment with this compound, while the expression of several other G4-driven genes was not affected. In addition to providing a novel chemical scaffold that modulates MYC expression through G4 binding, this work suggests that the SMM screening approach may be broadly useful as an approach for the identification of new G4-binding small

Chip-by-chip configurable interconnection using digital printing techniques

International Nuclear Information System (INIS)

Mashayekhi, Mohammad; Carrabina, Jordi; Winchester, Lee; Laurila, Mika-Matti; Mäntysalo, Matti; Ogier, Simon; Terés, Lluís

2017-01-01

Printed electronics technologies add new fabrication concepts to the classical set of microelectronic processes. Among these, the use of digital printing techniques such as inkjet permits the deposition of materials on top of preexisting substrates without any mask. This allows individual personalization of electronic circuits. Different proposals have been made to make use of such a property: (1) wiring new metallic layers on top of circuits to build programmable logic array-like circuits, (2) programming OTP ROM like memories, and (3) building inkjet-configurable gate arrays. The capability of building an individual circuit with technological steps simpler than photolithographic ones opens a concept similar to the successful field programmable gate array. Although nowadays the process resolution is still low, it can quickly evolve to higher wiring densities and therefore permit a greater level of transistor integration. In this paper, we propose a new structure to realize the connections only by deposition of conductive dots oriented to optimize the area needed to implement the drop-on-demand (DoD) wiring at circuit level. One important feature of this structure is that it minimizes the amount of printed material required for the connection thereby reducing failures often seen with DoD printing techniques for conductive lines. These structures have been validated by two different DoD technologies: inkjet and superfine jet, and have been compared to mask-based photolithography technology with promising results. (paper)

A learning flight control system for the F8-DFBW aircraft. [Digital Fly-By-Wire

Science.gov (United States)

Montgomery, R. C.; Mekel, R.; Nachmias, S.

1978-01-01

This report contains a complete description of a learning control system designed for the F8-DFBW aircraft. The system is parameter-adaptive with the additional feature that it 'learns' the variation of the control system gains needed over the flight envelope. It, thus, generates and modifies its gain schedule when suitable data are available. The report emphasizes the novel learning features of the system: the forms of representation of the flight envelope and the process by which identified parameters are used to modify the gain schedule. It contains data taken during piloted real-time 6 degree-of-freedom simulations that were used to develop and evaluate the system.

Molecular dynamics simulations of guanine quadruplex loops: Advances and force field limitations

Czech Academy of Sciences Publication Activity Database

Fadrná, E.; Špačková, Naďa; Štefl, R.; Koča, J.; Cheatham III, T. E.; Šponer, Jiří

2004-01-01

Roč. 87, č. 1 (2004), s. 227-242 ISSN 0006-3495 R&D Projects: GA MŠk LN00A016 Grant - others:Wellcome Trust(GB) GR067507MF Institutional research plan: CEZ:AV0Z5004920 Keywords : quanine quadruplex * four-thymidine loop * locally enhanced sampling Subject RIV: BO - Biophysics Impact factor: 4.585, year: 2004

Electronic brakes. From ABS to brake-by-wire. 2. ed.; Elektronische Bremssysteme. Vom ABS zum Brake-by-Wire

Energy Technology Data Exchange (ETDEWEB)

Reichel, H.R.

2003-07-01

The book reports trends in vehicle brakes from 1968 to 1998. This was the age of the electronic revolution. The book presents conventional brakes, antiblocking systems (ABS), antislip systems (ASS), brake assistants (BAS), dynamic control systems, and brake-by-wire systems. [German] Das Buch berichtet ueber Entwicklungen an Fahrzeugbremsanlagen in der Zeitspanne von 1968 bis etwa 1998. Diese Zeit war gepraegt vom Vordringen der Elektronik in die Bremsen, was fuer Hersteller und Kunden eine Revolution bedeutete. Behandelt sind: (a) Konventionelle Bremsanlagen, (b) Antiblockiersysteme (ABS), (c) Anti-Schlupf-regelungen (ASR), (d) Bremsassistenten (BAS), (e) Fahrdynamikregelungen (FDR, ESP), (f) Brake-by-Wire (orig.)

Social attraction mediated by fruit flies' microbiome.

Science.gov (United States)

Venu, Isvarya; Durisko, Zachary; Xu, Jianping; Dukas, Reuven

2014-04-15

Larval and adult fruit flies are attracted to volatiles emanating from food substrates that have been occupied by larvae. We tested whether such volatiles are emitted by the larval gut bacteria by conducting tests under bacteria-free (axenic) conditions. We also tested attraction to two bacteria species, Lactobacillus brevis, which we cultured from larvae in our lab, and L. plantarum, a common constituent of fruit flies' microbiome in other laboratory populations and in wild fruit flies. Neither larvae nor adults showed attraction to axenic food that had been occupied by axenic larvae, but both showed the previously reported attraction to standard food that had been occupied by larvae with an intact microbiome. Larvae also showed significant attraction to volatiles from axenic food and larvae to which we added only either L. brevis or L. plantarum, and volatiles from L. brevis reared on its optimal growth medium. Controlled learning experiments indicated that larvae experienced with both standard and axenic used food do not perceive either as superior, while focal larvae experienced with simulated used food, which contains burrows, perceive it as superior to unused food. Our results suggest that flies rely on microbiome-derived volatiles for long-distance attraction to suitable food patches. Under natural settings, fruits often contain harmful fungi and bacteria, and both L. brevis and L. plantarum produce compounds that suppress the growth of some antagonistic fungi and bacteria. The larval microbiome volatiles may therefore lead prospective fruit flies towards substrates with a hospitable microbial environment.

wire chamber

CERN Multimedia

Proportional multi-wire chamber. Multi-wire detectors contain layers of positively and negatively charged wires enclosed in a chamber full of gas. A charged particle passing through the chamber knocks negatively charged electrons out of atoms in the gas, leaving behind positive ions. The electrons are pulled towards the positively charged wires. They collide with other atoms on the way, producing an avalanche of electrons and ions. The movement of these electrons and ions induces an electric pulse in the wires which is collected by fast electronics. The size of the pulse is proportional to the energy loss of the original particle. Proportional wire chambers allow a much quicker reading than the optical or magnetoscriptive readout wire chambers.

Thermosonic wire bonding of IC devices using palladium wire

International Nuclear Information System (INIS)

Shze, J.H.; Poh, M.T.; Tan, R.M.

1996-01-01

The feasibility of replacing gold wire by palladium wire in thermosonic wire bonding of CMOS and bipolar devices are studied in terms of the manufacturability, physical, electrical and assembly performance. The results that palladium wire is a viable option for bonding the bipolar devices but not the CMOS devices

Quadruplex-forming sequences occupy discrete regions inside plant LTR retrotransposons

Czech Academy of Sciences Publication Activity Database

Lexa, M.; Kejnovský, Eduard; Šteflová, Pavlína; Konvalinová, H.; Vorlíčková, Michaela; Vyskot, Boris

2014-01-01

Roč. 42, č. 2 (2014), s. 968-978 ISSN 0305-1048 R&D Projects: GA ČR(CZ) GAP205/12/0466; GA ČR(CZ) GAP305/10/0930; GA ČR(CZ) GAP501/10/0102; GA ČR(CZ) GA522/09/0083; GA ČR GPP501/10/P483 Institutional support: RVO:68081707 Keywords : INTRAMOLECULAR DNA QUADRUPLEXES * VIRUS TYPE-1 RNA * CIRCULAR-DICHROISM Subject RIV: BO - Biophysics Impact factor: 9.112, year: 2014

Feedback - closing the loop digitally

International Nuclear Information System (INIS)

Zagel, J.; Chase, B.

1992-01-01

Many feedback and feedforward systems are now using microprocessors within the loop. We describe the wide range of possibilities and problems that arise. We also propose some ideas for analysis and testing, including examples of motion control in the Flying Wire systems in Main Ring and Tevatron and Low Level RF control now being built for the Fermilab Linac upgrade. (author)

Synthesise of Zn O nano wires by direct oxidation method

International Nuclear Information System (INIS)

Farbod, M.; Ahangarpour, A.

2007-01-01

Zn O is a semiconductor which has a direct and wide energy band which is about 3.37 eV at room temperature. It has various applications from UV lasers, sensitive sensors, solar cells to photo catalysis applications. Zn O has different nano structures such as nanoparticles, nano wires, nano rods, nano tubes and nano belts. The one dimensional Zn O nano structures such as nano wires are very important because of their applications in nano electronics and nano photonics so different methods have been proposed to synthesize them. In this work large scale of Zn O nano wires are produced by direct oxidation a Zn substrate (which was cleaned by chemical methods) in air or oxygen atmosphere at 400 d eg C . Nano wires were investigated by scanning electron microscopy and energy dispersive x-ray measurements. Their diameter is about 30-150 nanometer and their length is about several micrometer. This method which acts without any catalyst is a convenient method to synthesis semiconductor nano wires.

Modeling of the First Layers in the Fly's Eye

Science.gov (United States)

Moya, J. A.; Wilcox, M. J.; Donohoe, G. W.

1997-01-01

Increased autonomy of robots would yield significant advantages in the exploration of space. The shortfalls of computer vision can, however, pose significant limitations on a robot's potential. At the same time, simple insects which are largely hard-wired have effective visual systems. The understanding of insect vision systems thus may lead to improved approaches to visual tasks. A good starting point for the study of a vision system is its eye. In this paper, a model of the sensory portion of the fly's eye is presented. The effectiveness of the model is briefly addressed by a comparison of its performance to experimental data.

Aerosols produced by evaporation of a uranium wire

International Nuclear Information System (INIS)

Morel, C.

1968-03-01

This work is devoted to the study of the aerosols formed when an uranium wire is evaporated in a normal or rarefied atmosphere, either with or without a drying agent. The heating of the wire can be either fast or slow. The first part is a study of aerosol production apparatus and of methods of measuring the aerosol. The second part presents the results obtained with various aerosols: the particles produced by the wire are less than one micron; during rapid heating, the granulometric distribution of the aerosol obeys a log-normal law; during slow heating, the distribution has two modes: one near 0.05 micron, the other close to 0.01 micron. (author) [fr

Spectroscopic insights into quadruplexes of five-repeat telomere DNA sequences upon G-block damage

Czech Academy of Sciences Publication Activity Database

Dvořáková, Zuzana; Vorlíčková, Michaela; Renčiuk, Daniel

2017-01-01

Roč. 1861, č. 11 (2017), s. 2750-2757 ISSN 0304-4165 R&D Projects: GA ČR(CZ) GJ17-19170Y Institutional support: RVO:68081707 Keywords : k+ solution * guanine quadruplexes Subject RIV: CE - Biochemistry OBOR OECD: Biochemistry and molecular biology Impact factor: 4.702, year: 2016

DETECTORS: Vienna - beyond the wire

International Nuclear Information System (INIS)

Krammer, Manfred; Regler, Meinhard

1995-01-01

In 1986, at the fourth Vienna Wire Chamber Conference, Georges Charpak, the inventor of the multiwire proportional chamber, had confidently announced ''Les funérailles des chambres à fils''. Was this the writing on the wall for the conference series as well as this type of detector technology? The demand for detector innovation, coupled with imaginative thinking on the part of the organizers, have kept the Vienna venue at the forefront of the physics calendar. An additional boost to the success of the series was certainly the Nobel Prize awarded to Georges Charpak in 1992. While the major topic naturally is still wire chambers, alternative technologies are also covered. However in fields like calorimetry or ring imaging Cherenkovs, a sample of only a few prominent detectors were presented, giving some participants the impression of a biased selection. The fact that silicon detectors, electronics and track reconstruction strategies were, with the exception of the invited talks, restricted to poster presentations led to the same conclusion. As a result the organizing committee saw that it will have to revise its brief for the next conference. The conference opened with philosophical thoughts by Nobel Prizewinner Georges Charpak. The first day at Vienna is traditionally devoted to applications of gaseous detectors outside high energy physics. L. Shektman gave an overview of wire chambers for medical imaging. Further applications in medicine and in other fields like biology and space science were described by subsequent speakers. The exciting idea of flying a spectrometer on a balloon to study the fraction of electrons and positrons in cosmic rays attracted a lot of attention. The next day covered wire chambers in general. V. Polychronakos presented applications of cathode strip chambers in muon spectrometers for experiments at CERN's LHC proton-proton detector. Certainly the challenges of LHC for detector development dominated many

Preparation of nanosize carbon powders by pulsed wire discharge

Energy Technology Data Exchange (ETDEWEB)

Minami, C.; Kinemuchi, Y.; Suzuki, T.; Suematsu, H.; Jiang, W.; Yatsui, K. [Nagaoka Univ. of Technology, Extreme Energy-Density Research Inst., Nagaoka, Niigata (Japan); Hirata, T.; Hatakeyama, R. [Tohoku Univ., Graduate School of Engineering, Sendai, Miyagi (Japan)

2002-06-01

Nanosize powders of carbons were tried to be synthesized by pulsed discharge of graphite wires in several kinds of ambient gases. When the wire was discharged in N{sub 2} gas, nanosize powders have been successfully produced. The result of X-ray diffraction analysis indicated that nanosize powders produced in N{sub 2} gas at 750 Torr were amorphous carbon containing glassy carbons, while mass-spectrum analysis demonstrated the production of fullerenes at 600 Torr. If the wire is discharged in Ar gas, dielectric breakdown takes place between electrodes, producing no carbon powders. (author)

Absorption of short-pulse electromagnetic energy by a resistively loaded straight wire

International Nuclear Information System (INIS)

Miller, E.K.; Deadrick, F.J.; Landt, J.A.

1975-01-01

Absorption of short-pulse electromagnetic energy by a resistively loaded straight wire is examined. Energy collected by the wire, load energy, peak load currents, and peak load voltages are found for a wide range of parameters, with particular emphasis on nuclear electromagnetic pulse (EMP) phenomena. A series of time-sequenced plots is used to illustrate pulse propagation on wires when loads and wire ends are encountered

Towards functional safety in drive-by-wire vehicles

CERN Document Server

Bergmiller, Peter Johannes

2015-01-01

This book presents approaches to address key challenges based on a vehicle level view and with a special emphasis on Drive-by-Wire systems. The design and testing of modern vehicle electronics are becoming more and more demanding due to increasing interdependencies among components and the safety criticality of tasks. The development towards Drive-by-Wire functionalities in vehicles with multiple actuators for vehicle control further increases the challenge. The book explicitly takes into account the interactions between components  and aims at bridging the gap between the need to generate additional customer benefits and the effort to achieve functional safety. The book follows a twofold approach: on the one side, it presents a toolchain to support efficient further development of novel functionalities for Drive-by-Wire vehicles. The toolchain comprises appropriate software tools and scaled and full-scale experimental vehicles. On the other side, development towards functionally safe and flexible Drive-by-W...

Wire Chamber

CERN Multimedia

Magnetoscriptive readout wire chamber. Multi-wire detectors contain layers of positively and negatively charged wires enclosed in a chamber full of gas. A charged particle passing through the chamber knocks negatively charged electrons out of atoms in the gas, leaving behind positive ions. The electrons are pulled towards the positively charged wires. They collide with other atoms on the way, producing an avalanche of electrons and ions. The movement of these electrons and ions induces an electric pulse in the wires which is collected by fast electronics. The size of the pulse is proportional to the energy loss of the original particle.

Wire chamber

CERN Multimedia

1967-01-01

Magnetoscriptive readout wire chamber.Multi-wire detectors contain layers of positively and negatively charged wires enclosed in a chamber full of gas. A charged particle passing through the chamber knocks negatively charged electrons out of atoms in the gas, leaving behind positive ions. The electrons are pulled towards the positively charged wires. They collide with other atoms on the way, producing an avalanche of electrons and ions. The movement of these electrons and ions induces an electric pulse in the wires which is collected by fast electronics. The size of the pulse is proportional to the energy loss of the original particle.

Loss of loop adenines alters human telomere d[AG3(TTAG3)3] quadruplex folding

Czech Academy of Sciences Publication Activity Database

Babinský, M.; Fiala, R.; Kejnovská, Iva; Bednářová, Klára; Marek, R.; Sagi, J.; Sklenář, V.; Vorlíčková, Michaela

2014-01-01

Roč. 42, č. 22 (2014), s. 14031-14041 ISSN 0305-1048 R&D Projects: GA ČR(CZ) GAP205/12/0466 Institutional support: RVO:68081707 Keywords : human telomere * DNA quadruplex * cellular DNA Subject RIV: BO - Biophysics Impact factor: 9.112, year: 2014

Formation of plasma around wire fragments created by electrically exploded copper wire

International Nuclear Information System (INIS)

Taylor, Michael J.

2002-01-01

The physical processes occurring during the electrical explosion of metallic conductors has attracted interest for many years. Applications include circuit breakers, segmented lightning divertor strips for aircraft radomes, disruption of metallic shaped charge jets, plasma armatures for electromagnetic railguns and plasma generators for electrothermal-chemical guns. Recent work has cited the phenomenology of the fragmentation processes, particularly the development of a plasma around the lower resistance condensed fragments. An understanding of both the fragmentation process and the development of the accompanying formation of plasma is essential for the optimization of devices that utilize either of these phenomena. With the use of x-radiography and fast photography, this paper explores the wire explosion process, in particular the relationship between the fragmentation, plasma development and resistance rise that occurs during this period. A hypothesis is put forward to account for the development of plasma around the condensed wire fragments. Experimental parameters used in this study are defined. Wires studied were typically copper, with a diameter of 1 mm and length in excess of 150 mm. Circuit inductance used were from 26 to 800 μH. This relatively high circuit inductance gave circuit rise times less than 180 MA s -1 , slow with respect to many other exploding wire studies. Discharge duration ranged from 0.8 to 10 ms. (author)

Current Controller for Multi-level Front-end Converter and Its Digital Implementation Considerations on Three-level Flying Capacitor Topology

Science.gov (United States)

Tekwani, P. N.; Shah, M. T.

2017-10-01

This paper presents behaviour analysis and digital implementation of current error space phasor based hysteresis controller applied to three-phase three-level flying capacitor converter as front-end topology. The controller is self-adaptive in nature, and takes the converter from three-level to two-level mode of operation and vice versa, following various trajectories of sector change with the change in reference dc-link voltage demanded by the load. It keeps current error space phasor within the prescribed hexagonal boundary. During the contingencies, the proposed controller takes the converter in over modulation mode to meet the load demand, and once the need is satisfied, controller brings back the converter in normal operating range. Simulation results are presented to validate behaviour of controller to meet the said contingencies. Unity power factor is assured by proposed controller with low current harmonic distortion satisfying limits prescribed in IEEE 519-2014. Proposed controller is implemented using TMS320LF2407 16-bit fixed-point digital signal processor. Detailed analysis of numerical format to avoid overflow of sensed variables in processor, and per-unit model implementation in software are discussed and hardware results are presented at various stages of signal conditioning to validate the experimental setup. Control logic for the generation of reference currents is implemented in TMS320LF2407A using assembly language and experimental results are also presented for the same.

QuantiFly: Robust Trainable Software for Automated Drosophila Egg Counting.

Directory of Open Access Journals (Sweden)

Dominic Waithe

Full Text Available We report the development and testing of software called QuantiFly: an automated tool to quantify Drosophila egg laying. Many laboratories count Drosophila eggs as a marker of fitness. The existing method requires laboratory researchers to count eggs manually while looking down a microscope. This technique is both time-consuming and tedious, especially when experiments require daily counts of hundreds of vials. The basis of the QuantiFly software is an algorithm which applies and improves upon an existing advanced pattern recognition and machine-learning routine. The accuracy of the baseline algorithm is additionally increased in this study through correction of bias observed in the algorithm output. The QuantiFly software, which includes the refined algorithm, has been designed to be immediately accessible to scientists through an intuitive and responsive user-friendly graphical interface. The software is also open-source, self-contained, has no dependencies and is easily installed (https://github.com/dwaithe/quantifly. Compared to manual egg counts made from digital images, QuantiFly achieved average accuracies of 94% and 85% for eggs laid on transparent (defined and opaque (yeast-based fly media. Thus, the software is capable of detecting experimental differences in most experimental situations. Significantly, the advanced feature recognition capabilities of the software proved to be robust to food surface artefacts like bubbles and crevices. The user experience involves image acquisition, algorithm training by labelling a subset of eggs in images of some of the vials, followed by a batch analysis mode in which new images are automatically assessed for egg numbers. Initial training typically requires approximately 10 minutes, while subsequent image evaluation by the software is performed in just a few seconds. Given the average time per vial for manual counting is approximately 40 seconds, our software introduces a timesaving advantage for

Branched ZnO wire structures for water collection inspired by cacti.

Science.gov (United States)

Heng, Xin; Xiang, Mingming; Lu, Zhihui; Luo, Cheng

2014-06-11

In this work, motivated by an approach used in a cactus to collect fog, we have developed an artificial water-collection structure. This structure includes a large ZnO wire and an array of small ZnO wires that are branched on the large wire. All these wires have conical shapes, whose diameters gradually increase from the tip to the root of a wire. Accordingly, a water drop that is condensed on the tip of each wire is driven to the root by a capillary force induced by this diameter gradient. The lengths of stem and branched wires in the synthesized structures are in the orders of 1 mm and 100 μm, respectively. These dimensions are, respectively, comparable to and larger than their counterparts in the case of a cactus. Two groups of tests were conducted at relative humidity of 100% to compare the amounts of water collected by artificial and cactus structures within specific time durations of 2 and 35 s, respectively. The amount of water collected by either type of structures was in the order of 0.01 μL. However, on average, what has been collected by the artificial structures was 1.4-5.0 times more than that harvested by the cactus ones. We further examined the mechanism that a cactus used to absorb a collected water drop into its stem. On the basis of the gained understanding, we developed a setup to successfully collect about 6 μL of water within 30 min.

Transient Analysis of Lumped Circuit Networks Loaded Thin Wires By DGTD Method

KAUST Repository

Li, Ping

2016-03-31

With the purpose of avoiding very fine mesh cells in the proximity of a thin wire, the modified telegrapher’s equations (MTEs) are employed to describe the thin wire voltage and current distributions, which consequently results in reduced number of unknowns and augmented Courant-Friedrichs-Lewy (CFL) number. As hyperbolic systems, both the MTEs and the Maxwell’s equations are solved by the discontinuous Galerkin time-domain (DGTD) method. In realistic situations, the thin wires could be either driven or loaded by circuit networks. The thin wire-circuit interface performs as a boundary condition for the thin wire solver, where the thin wire voltage and current used for the incoming flux evaluation involved in the DGTD analyzed MTEs are not available. To obtain this voltage and current, an auxiliary current flowing through the thin wire-circuit interface is introduced at each interface. Corresponding auxiliary equations derived from the invariable property of characteristic variable for hyperbolic systems are developed and solved together with the circuit equations established by the modified nodal analysis (MNA) modality. Furthermore, in order to characterize the field and thin wire interactions, a weighted electric field and a volume current density are added into the MTEs and Maxwell-Ampere’s law equation, respectively. To validate the proposed algorithm, three representative examples are presented.

Mechanical properties and aesthetics of FRP orthodontic wire fabricated by hot drawing.

Science.gov (United States)

Imai, T; Watari, F; Yamagata, S; Kobayashi, M; Nagayama, K; Toyoizumi, Y; Nakamura, S

1998-12-01

The FRP wires 0.5 mm in diameter with a multiple fiber structure were fabricated by drawing the fiber polymer complex at 250 degrees C for an esthetic, transparent orthodontic wire. Biocompatible CaO-P2O5-SiO2-Al2O3 (CPSA) glass fibers of 8-20 microm in diameter were oriented unidirectionally in the longitudinal direction in PMMA matrix. The mechanical properties were investigated by 3-point flexural test. The FRP wire showed sufficient strength and a very good elastic recovery after deformation. Young's modulus and the flexural load at deflection 1 mm were nearly independent of the fiber diameter and linearly increased with the fiber fraction. The dependence on fiber fraction obeys well the rule of mixture. This FRP wire could cover the range of strength corresponding to the conventional metal orthodontic wires from Ni-Ti used in the initial stage of orthodontic treatments to Co-Cr used in the final stage by changing the volume ratio of glass fibers with the same external diameter. The estheticity in external appearance was excellent. Thus the new FRP wire can satisfy both mechanical properties necessary for an orthodontic wire and enough estheticity, which was not possible for the conventional metal wire.

Transient Analysis of Lumped Circuit Networks Loaded Thin Wires By DGTD Method

KAUST Repository

Li, Ping; Shi, Yifei; Jiang, Li Jun; Bagci, Hakan

2016-01-01

With the purpose of avoiding very fine mesh cells in the proximity of a thin wire, the modified telegrapher’s equations (MTEs) are employed to describe the thin wire voltage and current distributions, which consequently results in reduced number of unknowns and augmented Courant-Friedrichs-Lewy (CFL) number. As hyperbolic systems, both the MTEs and the Maxwell’s equations are solved by the discontinuous Galerkin time-domain (DGTD) method. In realistic situations, the thin wires could be either driven or loaded by circuit networks. The thin wire-circuit interface performs as a boundary condition for the thin wire solver, where the thin wire voltage and current used for the incoming flux evaluation involved in the DGTD analyzed MTEs are not available. To obtain this voltage and current, an auxiliary current flowing through the thin wire-circuit interface is introduced at each interface. Corresponding auxiliary equations derived from the invariable property of characteristic variable for hyperbolic systems are developed and solved together with the circuit equations established by the modified nodal analysis (MNA) modality. Furthermore, in order to characterize the field and thin wire interactions, a weighted electric field and a volume current density are added into the MTEs and Maxwell-Ampere’s law equation, respectively. To validate the proposed algorithm, three representative examples are presented.

Phase change heat transfer and bubble behavior observed on twisted wire heater geometries in microgravity

International Nuclear Information System (INIS)

Munro, Troy R.; Koeln, Justin P.; Fassmann, Andrew W.; Barnett, Robert J.; Ban, Heng

2014-01-01

Highlights: • Subcooled water boiled in microgravity on twists of thin wires. • Wire twisting creates heat transfer enhancements because of high local temperatures. • A preliminary version of a new bubble dynamics method is discussed. • A critical distance that fluid must be superheated for boiling onset is presented. - Abstract: Phase change is an effective method of transferring heat, yet its application in microgravity thermal management systems requires greater understanding of bubble behavior. To further this knowledge base, a microgravity boiling experiment was performed (floating) onboard an aircraft flying in a parabolic trajectory to study the effect of surface geometry and heat flux on phase change heat transfer in a pool of subcooled water. A special emphasis was the investigation of heat transfer enhancement caused by modifying the surface geometry through the use of a twist of three wires and a twist of four wires. A new method for bubble behavior analysis was developed to quantify bubble growth characteristics, which allows a quantitative comparison of bubble dynamics between different data sets. It was found that the surface geometry of the three-wire twist enhanced heat transfer by reducing the heat flux needed for bubble incipience and the average wire temperature in microgravity. Simulation results indicated that increased local superheating in wire crevices may be responsible for the change of bubble behavior seen as the wire geometry configuration was varied. The convective heat transfer rate, in comparison to ground experiments, was lower for microgravity at low heating rates, and higher at high heating rates. This study provides insights into the role of surface geometry on superheating behavior and presents an initial version of a new bubble behavior analysis method. Further research on these topics could lead to new designs of heater surface geometries using phase change heat transfer in microgravity applications

Multifunctional energy landscape for a DNA G-quadruplex: An evolved molecular switch

Science.gov (United States)

Cragnolini, Tristan; Chakraborty, Debayan; Šponer, Jiří; Derreumaux, Philippe; Pasquali, Samuela; Wales, David J.

2017-10-01

We explore the energy landscape for a four-fold telomere repeat, obtaining interconversion pathways between six experimentally characterised G-quadruplex topologies. The results reveal a multi-funnel system, with a variety of intermediate configurations and misfolded states. This organisation is identified with the intrinsically multi-functional nature of the system, suggesting a new paradigm for the classification of such biomolecules and clarifying issues regarding apparently conflicting experimental results.

Wire communication engineering

International Nuclear Information System (INIS)

Son, Byeong Tae

1997-02-01

This book describes wire telecommunication engineering/ It is divided into eleven chapter, which deal with Introduction with development of telecommunication, voice and sound wave and communication network, Telegraphy with summary of telegraphy, code of telegraphy, communication speed, morse and telex, Telephone on structure, circuit and image telephone, Traffic on telecommunication traffic, transmission of line about theory, cable line and loaded cable, carrier communication with carrier telegraphy and carrier telephone, optical communication with types, structure, specialty, laser and equipment, DATA, Mobile telecommunication on summary, mobile telephone, radio paging and digital mobile telecommunication, ISDN with channel of ISDN, and service of ISDN, and design of telecommunication.

Feasibility study of an active soft catheter actuated by SMA wires

Science.gov (United States)

Konh, Bardia; Karimi, Saeed; Miller, Scott

2018-03-01

This study aims to assess the feasibility of using a combination of thin elastomer tubes and SMA wires to develop an active catheter. Cardiac catheters have been widely used in investigational and interventional procedures such as angiography, angioplasty, electro- physiology, and endocardial ablation. The commercial models manually steer inside the patient's body via internally installed pull wires. Active catheters, on the other hand, have the potential to revolutionize surgical procedures because of their computer-controlled and enhanced motion. Shape memory alloys have been used for almost a decade as a trustworthy actuator for biomedical applications. In this work, SMA wires were attached to a small pressurized elastomer tube to realize deflection. The tube was pressurized to maintain a constant stress on the SMA wires. The tip motion via actuation of SMA wires was then measured and reported. The results of this study showed that by adopting an appropriate training process for the SMA wires prior to performing the experiments and adopting an appropriate internal pressure for the elastomer tube, less external loads on SMA wires would be needed for a consistent actuation.

Development of cutting techniques of steel pipe by wire sawing

International Nuclear Information System (INIS)

Kamiyama, Yoshinori; Inai, Shinsuke

2004-01-01

A cutting method has a high cutting efficiency and enable cutting in safe. A wire saw cutting method is used for dismantling of massive concrete structures such as nuclear power plants with an effective and safe mean. In the case of dismantling of structures with multiple pipes installed at these facilities, an effective method is also demanded. If a wire saw method to remotely cut target objects in a large block in bulk is applicable, it will be expected an effective dismantling work under severe conditions with radioactivity. Although the wire saw method has adaptability for any shapes of cutting target objects and is widely adopted in dismantling of concrete constructs, it has few actual achievements in dismantling of steel structures such as steel pipe bundle. This study aims to verify its cutting characteristics and adaptability as a cutting method by conducting a cutting basic test to develop a diamond wire saw method to efficiently cut constructs with multiple pipes in a bundle. The test proved that a wire saw cutting method apply to dismantle structures with steel pipe bundle. A wire saw for metal cutting is adaptable in dismantling of bundle of thick carbon steel and stainless steel pipes. And also a wire saw for concrete cutting is adaptable in dismantling of pipe bundle structure with a mortar. (author)

Determinants for Tight and Selective Binding of a Medicinal Dicarbene Gold(I) Complex to a Telomeric DNA G-Quadruplex: a Joint ESI MS and XRD Investigation.

Science.gov (United States)

Bazzicalupi, Carla; Ferraroni, Marta; Papi, Francesco; Massai, Lara; Bertrand, Benoît; Messori, Luigi; Gratteri, Paola; Casini, Angela

2016-03-18

The dicarbene gold(I) complex [Au(9-methylcaffein-8-ylidene)2 ]BF4 is an exceptional organometallic compound of profound interest as a prospective anticancer agent. This gold(I) complex was previously reported to be highly cytotoxic toward various cancer cell lines in vitro and behaves as a selective G-quadruplex stabilizer. Interactions of the gold complex with various telomeric DNA models have been analyzed by a combined ESI MS and X-ray diffraction (XRD) approach. ESI MS measurements confirmed formation of stable adducts between the intact gold(I) complex and Tel 23 DNA sequence. The crystal structure of the adduct formed between [Au(9-methylcaffein-8-ylidene)2 ](+) and Tel 23 DNA G-quadruplex was solved. Tel 23 maintains a characteristic propeller conformation while binding three gold(I) dicarbene moieties at two distinct sites. Stacking interactions appear to drive noncovalent binding of the gold(I) complex. The structural basis for tight gold(I) complex/G-quadruplex recognition and its selectivity are described. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Self-organization of mesoscopic silver wires by electrochemical deposition

Directory of Open Access Journals (Sweden)

Sheng Zhong

2014-08-01

Full Text Available Long, straight mesoscale silver wires have been fabricated from AgNO3 electrolyte via electrodeposition without the help of templates, additives, and surfactants. Although the wire growth speed is very fast due to growth under non-equilibrium conditions, the wire morphology is regular and uniform in diameter. Structural studies reveal that the wires are single-crystalline, with the [112] direction as the growth direction. A possible growth mechanism is suggested. Auger depth profile measurements show that the wires are stable against oxidation under ambient conditions. This unique system provides a convenient way for the study of self-organization in electrochemical environments as well as for the fabrication of highly-ordered, single-crystalline metal nanowires.

Predicting AEA dosage by Foam Index and adsorption on Fly Ash

OpenAIRE

Jacobsen, Stefan; Ollendorff, Margrethe; Geiker, Mette Rica; Tunstall, Lori; Scherer, George W.

2012-01-01

Abstract: The unpredictable air entrainment in fly ash concrete caused by carbon in fly ash was studied by measuring adsorption of Air Entraining Agents (AEA) on the fly ash and by Foam Index (FI) testing. The FI test measures the mass ratio of AEA/binder required to obtain stable foam when shaking a mixture of water, binder powder and AEA, while increasing AEA-dosage stepwise. A review of concrete air entrainment and new studies combining adsorption (TGA, NMR) of AEA on fly ash with various ...

Multi-wire chamber system for heavy ion beam monitoring at the Bevalac

International Nuclear Information System (INIS)

Cuperus, J.; Morgado, R.

1975-03-01

Horizontal and vertical integrated beam-current profiles are generated by a system of multi-wire chambers (32 wires/profile) operating in either the ionization or proportional mode. Sixteen distinct displays (1024 words) are digitally stored and any four may be simultaneously displayed. A new display can be generated at 64 ms intervals. A central control unit selects the mode of operation, the amount of delay after an appropriate trigger, the chamber integration time, and the particular chambers to be displayed. Operating in the proportional mode, the system can detect relativistic heavy-ion beam intensities as low as 10 4 charges cm -2 sec -1 . (U.S.)

Detection of a buried wire with two resistively loaded wire antennas

NARCIS (Netherlands)

Vossen, S.H.J.A.; Tijhuis, A.G.; Lepelaars, E.S.A.M.; Zwamborn, A.P.M.

2002-01-01

The use of two identical straight thin-wire antennas for the detection of a buried wire is analyzed with the aid of numerical calculations. The buried wire is located below an interface between two homogeneous half-spaces. The detection setup, which is formed by a transmitting and a receiving wire,

pH-Modulated Watson-Crick duplex-quadruplex equilibria of guanine-rich and cytosine-rich DNA sequences 140 base pairs upstream of the c-kit transcription initiation site.

Science.gov (United States)

Bucek, Pavel; Jaumot, Joaquim; Aviñó, Anna; Eritja, Ramon; Gargallo, Raimundo

2009-11-23

Guanine-rich regions of DNA are sequences capable of forming G-quadruplex structures. The formation of a G-quadruplex structure in a region 140 base pairs (bp) upstream of the c-kit transcription initiation site was recently proposed (Fernando et al., Biochemistry, 2006, 45, 7854). In the present study, the acid-base equilibria and the thermally induced unfolding of the structures formed by a guanine-rich region and by its complementary cytosine-rich strand in c-kit were studied by means of circular dichroism and molecular absorption spectroscopies. In addition, competition between the Watson-Crick duplex and the isolated structures was studied as a function of pH value and temperature. Multivariate data analysis methods based on both hard and soft modeling were used to allow accurate quantification of the various acid-base species present in the mixtures. Results showed that the G-quadruplex and i-motif coexist with the Watson-Crick duplex over the pH range from 3.0 to 6.5, approximately, under the experimental conditions tested in this study. At pH 7.0, the duplex is practically the only species present.

Wire Position Monitoring with FPGA based Electronics

International Nuclear Information System (INIS)

Eddy, N.; Lysenko, O.

2009-01-01

This fall the first Tesla-style cryomodule cooldown test is being performed at Fermilab. Instrumentation department is preparing the electronics to handle the data from a set of wire position monitors (WPMs). For simulation purposes a prototype pipe with a WMP has been developed and built. The system is based on the measurement of signals induced in pickups by 320 MHz signal carried by a wire through the WPM. The wire is stretched along the pipe with a tensioning load of 9.07 kg. The WPM consists of four 50 (Omega) striplines spaced 90 o apart. FPGA based digitizer scans the WPM and transmits the data to a PC via VME interface. The data acquisition is based on the PC running LabView. In order to increase the accuracy and convenience of the measurements some modifications were required. The first is implementation of an average and decimation filter algorithm in the integrator operation in the FPGA. The second is the development of alternative tool for WPM measurements in the PC. The paper describes how these modifications were performed and test results of a new design. The last cryomodule generation has a single chain of seven WPMs (placed in critical positions: at each end, at the three posts and between the posts) to monitor a cold mass displacement during cooldown. The system was developed in Italy in collaboration with DESY. Similar developments have taken place at Fermilab in the frame of cryomodules construction for SCRF research. This fall preliminary cryomodule cooldown test is being performed. In order to prepare an appropriate electronic system for the test a prototype pipe with a WMP has been developed and built, figure 1. The system is based on the measurement of signals induced in pickups by 320 MHz signal carried by a wire through the WPM. The 0.5 mm diameter Cu wire is stretched along the pipe with a tensioning load of 9.07 kg and has a length of 1.1 m. The WPM consists of four 50 (Omega) striplines spaced 90 o apart. An FPGA based digitizer

Error-tolerant pedal for a brake-by-wire system; Fehlertolerante Pedaleinheit fuer ein elektromechanisches Bremssystem (Brake-by-Wire)

Energy Technology Data Exchange (ETDEWEB)

Stoelzl, S.

2000-07-01

The author describes the development of an error-tolerant brake-by-wire system with pedal consolidation, including the development of a monitoring and safety concept. [German] Die zunehmende Entwicklung aktiver Fahrerassistenzsysteme im Automobilbereich (z.B. ABS, ESP) zur Erhoehung der Fahrsicherheit erfordert ein staendig wachsendes Funktionspotential. Die Bremsanlagen werden dadurch immer komplexer. Parallel steigen die Anforderungen an den Bremspedalkomfort. Einen Ausweg aus dieser Problematik verspricht die Elektromechanische Bremsanlage (EMB) mit rueckwirkungsfreier Entkopplung des Fahrers von den Radbremsen (Brake-by-Wire). Das Bremskommando des Fahrers wird bei Betaetigung des Bremspedals rein sensorisch erfasst. Da es keine mechanische Rueckfallebene mehr gibt, muessen Fehler der Pedaleinheit erkannt und toleriert werden. Neu an dieser Arbeit ist die Entwicklung der fehlertoleranten elektromechanischen Pedaleinheit der EMB mit Pedalsensorkonsolidierung und Erstellung des dazu notwendigen Sicherheits- und Ueberwachungskonzepts. (orig.)

[Osteosynthesis by tension band wiring of displaced fractures of the olecranon].

Science.gov (United States)

Doursounian, L; Prevot, O; Touzard, R C

1994-01-01

Fifty-two displaced olecranon fractures in adults were treated over a 5-year period. Minimum follow-up was 6 months. Forty-eight fractures were operated and 38 were treated by tension band wiring technique. This technique, applied for all types of fractures, gave good functional results in 33 cases (87%) and fair functional results in 5 cases. Complications include 1 pseudarthrosis, 2 loss of reduction, 2 transient tourniquet palsy and 13 skin problems due to wire protrusion. Tension band wiring is a simple safe and effective technique for displaced olecranon fractures but often requires K-wire removal.

G-quadruplex formation in the Oct4 promoter positively regulates Oct4 expression

Czech Academy of Sciences Publication Activity Database

Renčiuk, Daniel; Ryneš, J.; Kejnovská, Iva; Foldynova-Trantirkova, S.; Andaeng, M.; Trantírek, L.; Vorlíčková, Michaela

2017-01-01

Roč. 1860, č. 2 (2017), s. 175-183 ISSN 1874-9399 R&D Projects: GA ČR(CZ) GP14-33947P; GA ČR GAP205/12/0466; GA ČR(CZ) GA15-06785S Institutional support: RVO:68081707 Keywords : linked polymorphic region * guanine quadruplexes * transcription factor Subject RIV: CE - Biochemistry OBOR OECD: Biochemistry and molecular biology Impact factor: 5.018, year: 2016

Cold atoms near surfaces: designing potentials by sculpturing wires

International Nuclear Information System (INIS)

Della Pietra, Leonardo; Aigner, Simon; Hagen, Christoph vom; Lezec, Henri J; Schmiedmayer, Joerg

2005-01-01

The magnetic trapping potentials for atoms on atom chips are determined by the current flow pattern in the chip wires. By modifying the wire shape using focused ion beam nano-machining we can design specialized current flow patterns and therefore micro-design the magnetic trapping potentials. We give designs for a barrier, a quantum dot, and a double well or double barrier and show preliminary experiments with ultra cold atoms in these designed potentials

Fast and High Accuracy Wire Scanner

CERN Document Server

Koujili, M; Koopman, J; Ramos, D; Sapinski, M; De Freitas, J; Ait Amira, Y; Djerdir, A

2009-01-01

Scanning of a high intensity particle beam imposes challenging requirements on a Wire Scanner system. It is expected to reach a scanning speed of 20 m.s-1 with a position accuracy of the order of 1 μm. In addition a timing accuracy better than 1 millisecond is needed. The adopted solution consists of a fork holding a wire rotating by a maximum of 200°. Fork, rotor and angular position sensor are mounted on the same axis and located in a chamber connected to the beam vacuum. The requirements imply the design of a system with extremely low vibration, vacuum compatibility, radiation and temperature tolerance. The adopted solution consists of a rotary brushless synchronous motor with the permanent magnet rotor installed inside of the vacuum chamber and the stator installed outside. The accurate position sensor will be mounted on the rotary shaft inside of the vacuum chamber, has to resist a bake-out temperature of 200°C and ionizing radiation up to a dozen of kGy/year. A digital feedback controller allows maxi...

Inter-progenitor pool wiring: An evolutionarily conserved strategy that expands neural circuit diversity.

Science.gov (United States)

Suzuki, Takumi; Sato, Makoto

2017-11-15

Diversification of neuronal types is key to establishing functional variations in neural circuits. The first critical step to generate neuronal diversity is to organize the compartmental domains of developing brains into spatially distinct neural progenitor pools. Neural progenitors in each pool then generate a unique set of diverse neurons through specific spatiotemporal specification processes. In this review article, we focus on an additional mechanism, 'inter-progenitor pool wiring', that further expands the diversity of neural circuits. After diverse types of neurons are generated in one progenitor pool, a fraction of these neurons start migrating toward a remote brain region containing neurons that originate from another progenitor pool. Finally, neurons of different origins are intermingled and eventually form complex but precise neural circuits. The developing cerebral cortex of mammalian brains is one of the best examples of inter-progenitor pool wiring. However, Drosophila visual system development has revealed similar mechanisms in invertebrate brains, suggesting that inter-progenitor pool wiring is an evolutionarily conserved strategy that expands neural circuit diversity. Here, we will discuss how inter-progenitor pool wiring is accomplished in mammalian and fly brain systems. Copyright © 2017 Elsevier Inc. All rights reserved.

Voltammetry and Molecular Assembly of G-quadruplex DNAzyme on Single-crystal Au(111)-electrode Surfaces – Hemin as an Electrochemical Intercalator

DEFF Research Database (Denmark)

Zhang, Ling; Ulstrup, Jens; Zhang, Jingdong

2016-01-01

DNA quadruplexes (qs’s) are a class of “non-canonical” oligonucleotides (OGNs) composed of stacked guanine (G) quartets generally stabilized by monovalent cations. Metal porphyrins selectively bind to G-qs complexes to form DNAzyme, which can exhibit peroxidase and other catalytic activity simila...

Wire Array Photovoltaics

Science.gov (United States)

Turner-Evans, Dan

Over the past five years, the cost of solar panels has dropped drastically and, in concert, the number of installed modules has risen exponentially. However, solar electricity is still more than twice as expensive as electricity from a natural gas plant. Fortunately, wire array solar cells have emerged as a promising technology for further lowering the cost of solar. Si wire array solar cells are formed with a unique, low cost growth method and use 100 times less material than conventional Si cells. The wires can be embedded in a transparent, flexible polymer to create a free-standing array that can be rolled up for easy installation in a variety of form factors. Furthermore, by incorporating multijunctions into the wire morphology, higher efficiencies can be achieved while taking advantage of the unique defect relaxation pathways afforded by the 3D wire geometry. The work in this thesis shepherded Si wires from undoped arrays to flexible, functional large area devices and laid the groundwork for multijunction wire array cells. Fabrication techniques were developed to turn intrinsic Si wires into full p-n junctions and the wires were passivated with a-Si:H and a-SiNx:H. Single wire devices yielded open circuit voltages of 600 mV and efficiencies of 9%. The arrays were then embedded in a polymer and contacted with a transparent, flexible, Ni nanoparticle and Ag nanowire top contact. The contact connected >99% of the wires in parallel and yielded flexible, substrate free solar cells featuring hundreds of thousands of wires. Building on the success of the Si wire arrays, GaP was epitaxially grown on the material to create heterostructures for photoelectrochemistry. These cells were limited by low absorption in the GaP due to its indirect bandgap, and poor current collection due to a diffusion length of only 80 nm. However, GaAsP on SiGe offers a superior combination of materials, and wire architectures based on these semiconductors were investigated for multijunction

wire chamber

CERN Multimedia

1985-01-01

Multi-wire detectors contain layers of positively and negatively charged wires enclosed in a chamber full of gas. A charged particle passing through the chamber knocks negatively charged electrons out of atoms in the gas, leaving behind positive ions. The electrons are pulled towards the positively charged wires. They collide with other atoms on the way, producing an avalanche of electrons and ions. The movement of these electrons and ions induces an electric pulse in the wires which is collected by fast electronics. The size of the pulse is proportional to the energy loss of the original particle.

Wire chamber

CERN Multimedia

Multi-wire detectors contain layers of positively and negatively charged wires enclosed in a chamber full of gas. A charged particle passing through the chamber knocks negatively charged electrons out of atoms in the gas, leaving behind positive ions. The electrons are pulled towards the positively charged wires. They collide with other atoms on the way, producing an avalanche of electrons and ions. The movement of these electrons and ions induces an electric pulse in the wires which is collected by fast electronics. The size of the pulse is proportional to the energy loss of the original particle.

wire chamber

CERN Multimedia

Multi-wire detectors contain layers of positively and negatively charged wires enclosed in a chamber full of gas. A charged particle passing through the chamber knocks negatively charged electrons out of atoms in the gas, leaving behind positive ions. The electrons are pulled towards the positively charged wires. They collide with other atoms on the way, producing an avalanche of electrons and ions. The movement of these electrons and ions induces an electric pulse in the wires which is collected by fast electronics. The size of the pulse is proportional to the energy loss of the original particle.

Analytical prediction of digital signal crosstalk of FCC

Science.gov (United States)

Belleisle, A. P.

1972-01-01

The results are presented of study effort whose aim was the development of accurate means of analyzing and predicting signal cross-talk in multi-wire digital data cables. A complete analytical model is developed n + 1 wire systems of uniform transmission lines with arbitrary linear boundary conditions. In addition, a minimum set of parameter measurements required for the application of the model are presented. Comparisons between cross-talk predicted by this model and actual measured cross-talk are shown for a six conductor ribbon cable.

Multisensory integration for odor tracking by flying Drosophila: Behavior, circuits and speculation.

Science.gov (United States)

Duistermars, Brian J; Frye, Mark A

2010-01-01

Many see fruit flies as an annoyance, invading our homes with a nagging persistence and efficiency. Yet from a scientific perspective, these tiny animals are a wonder of multisensory integration, capable of tracking fragmented odor plumes amidst turbulent winds and constantly varying visual conditions. The peripheral olfactory, mechanosensory, and visual systems of the fruit fly, Drosophila melanogaster, have been studied in great detail;1-4 however, the mechanisms by which fly brains integrate information from multiple sensory modalities to facilitate robust odor tracking remain elusive. Our studies on olfactory orientation by flying flies reveal that these animals do not simply follow their "nose"; rather, fruit flies require mechanosensory and visual input to track odors in flight.5,6 Collectively, these results shed light on the neural circuits involved in odor localization by fruit flies in the wild and illuminate the elegant complexity underlying a behavior to which the annoyed and amazed are familiar.

Tungsten wire and tubing joined by nickel brazing

Science.gov (United States)

1965-01-01

Thin tungsten wire and tungsten tubing are brazed together using a contacting coil of nickel wire heated to its melting point in an inert-gas atmosphere. This method is also effective for brazing tungsten to tungsten-rhenium parts.

Synthesis of potent G-quadruplex binders of macrocyclic heptaoxazole and evaluation of their activities.

Science.gov (United States)

Tera, Masayuki; Iida, Keisuke; Shin-ya, Kazuo; Nagasawa, Kazuo

2009-01-01

Guanine-rich DNA sequences form unique three-dimensional conformation known as G-quadruplexes (G-q). G-q structures have been found in telomere and in some oncogene promoter. Recently, it was suggested that G-q showed some biological activities including telomere shortening and transcriptional regulation. In this paper, we synthesized selective G-q binders and evaluated of their biological activities.

RecQ-core of BLM unfolds telomeric G-quadruplex in the absence of ATP

Czech Academy of Sciences Publication Activity Database

Budhathoki, J.B.; Ray, S.; Urban, Václav; Janščák, Pavel; Jodh, J.G.; Balci, H.

2014-01-01

Roč. 42, č. 18 (2014), s. 11528-11545 ISSN 0305-1048 R&D Projects: GA ČR GA204/09/0565 Grant - others:U.S. National Science Foundation through the Physics Frontiers Center Program(US) 1430124 Institutional support: RVO:68378050 Keywords : single-stranded DNA * RECQ5 helicase * G-quadruplex structures Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 9.112, year: 2014

Phenanthroline-2,9-bistriazoles as selective G-quadruplex ligands

DEFF Research Database (Denmark)

Nielsen, Mads Corvinius; Larsen, Anders Foller; Abdikadir, Faisal Hussein

2014-01-01

G-quadruplex (G4) ligands are currently receiving considerable attention as potential anticancer therapeutics. A series of phenanthroline-2,9-bistriazoles carrying tethered positive end groups has been synthesized and evaluated as G4 stabilizers. The compounds were efficiently assembled by copper......(I)-catalyzed azide-alkyne cycloaddition (CuAAC) in CH2Cl2 and water in the presence of a complexing agent. Characterization of the target compounds on telomeric and c-KIT G4 sequences led to the identification of guanidinium-substituted compounds as potent G4 DNA ligands with high selectivity over duplex DNA....... The diisopropylguanidium ligands exhibited high selectivity for the proto-oncogenic sequence c-KIT over the human telomeric sequence in the surface plasmon resonance (SPR) assay, whereas the compounds appeared potent on both G4 structures in the FRET melting temperature assay. The phenanthroline-2,9-bistriazole ligands...

New Structure Design and Simulation of Brake by Wire System Based on Giant-magnetostrictive Material

Directory of Open Access Journals (Sweden)

Changbao CHU

2014-04-01

Full Text Available Existing electronic mechanical brake by wire system has several disadvantages. For instance, system actuators are complex, response speed slower, larger vibration noise, etc. This paper discusses a new type brake by wire system based on giant-magnetostrictive material. The new type brake by wire system model was set up under Matlab/Simulink software environment. PID control method was used to control the brake by wire system. Simulation results shows that the new type brake by wire system achieves better braking performance compared with hydraulic braking system. This work provides a new idea for researching automobile brake by wire system.

Investigation of gliding flight by flying fish

Science.gov (United States)

Park, Hyungmin; Jeon, Woo-Pyung; Choi, Haecheon

2006-11-01

The most successful flight capability of fish is observed in the flying fish. Furthermore, despite the difference between two medium (air and water), the flying fish is well evolved to have an excellent gliding performance as well as fast swimming capability. In this study, flying fish's morphological adaptation to gliding flight is experimentally investigated using dry-mounted darkedged-wing flying fish, Cypselurus Hiraii. Specifically, we examine the effects of the pectoral and pelvic fins on the aerodynamic performance considering (i) both pectoral and pelvic fins, (ii) pectoral fins only, and (iii) body only with both fins folded. Varying the attack angle, we measure the lift, drag and pitching moment at the free-stream velocity of 12m/s for each case. Case (i) has higher lift-to-drag ratio (i.e. longer gliding distance) and more enhanced longitudinal static stability than case (ii). However, the lift coefficient is smaller for case (i) than for case (ii), indicating that the pelvic fins are not so beneficial for wing loading. The gliding performance of flying fish is compared with those of other fliers and is found to be similar to those of insects such as the butterfly and fruitfly.

Development of an Efficient G-Quadruplex-Stabilised Thrombin-Binding Aptamer Containing a Three-Carbon Spacer Molecule

DEFF Research Database (Denmark)

Aaldering, Lukas J.; Poongavanam, Vasanthanathan; Langkjær, Niels

2017-01-01

The thrombin-binding aptamer (TBA), which shows anticoagulant properties, is one of the most studied G-quadruplex-forming aptamers. In this study, we investigated the impact of different chemical modifications such as a three-carbon spacer (spacer-C3), unlocked nucleic acid (UNA) and 3′-amino-mod...

Thioflavin T binds dimeric parallel-stranded GA-containing non-G-quadruplex DNAs: a general approach to lighting up double-stranded scaffolds.

Science.gov (United States)

Liu, Shuangna; Peng, Pai; Wang, Huihui; Shi, Lili; Li, Tao

2017-12-01

A molecular rotor thioflavin T (ThT) is usually used as a fluorescent ligand specific for G-quadruplexes. Here, we demonstrate that ThT can tightly bind non-G-quadruplex DNAs with several GA motifs and dimerize them in a parallel double-stranded mode, accompanied by over 100-fold enhancement in the fluorescence emission of ThT. The introduction of reverse Watson-Crick T-A base pairs into these dimeric parallel-stranded DNA systems remarkably favors the binding of ThT into the pocket between G•G and A•A base pairs, where ThT is encapsulated thereby restricting its two rotary aromatic rings in the excited state. A similar mechanism is also demonstrated in antiparallel DNA duplexes where several motifs of two consecutive G•G wobble base pairs are incorporated and serve as the active pockets for ThT binding. The insight into the interactions of ThT with non-G-quadruplex DNAs allows us to introduce a new concept for constructing DNA-based sensors and devices. As proof-of-concept experiments, we design a DNA triplex containing GA motifs in its Hoogsteen hydrogen-bonded two parallel strands as a pH-driven nanoswitch and two GA-containing parallel duplexes as novel metal sensing platforms where C-C and T-T mismatches are included. This work may find further applications in biological systems (e.g. disease gene detection) where parallel duplex or triplex stretches are involved. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.

Wired and wireless convergent extended-reach optical access network using direct-detection of all-optical OFDM super-channel signal.

Science.gov (United States)

Chow, C W; Yeh, C H; Sung, J Y; Hsu, C W

2014-12-15

We propose and demonstrate the feasibility of using all-optical orthogonal frequency division multiplexing (AO-OFDM) for the convergent optical wired and wireless access networks. AO-OFDM relies on all-optically generated orthogonal subcarriers; hence, high data rate (> 100 Gb/s) can be easily achieved without hitting the speed limit of electronic digital-to-analog and analog-to-digital converters (DAC/ADC). A proof-of-concept convergent access network using AO-OFDM super-channel (SC) is demonstrated supporting 40 - 100 Gb/s wired and gigabit/s 100 GHz millimeter-wave (MMW) ROF transmissions.

wire chamber

CERN Multimedia

Was used in ISR (Intersecting Storage Ring) split field magnet experiment. Multi-wire detectors contain layers of positively and negatively charged wires enclosed in a chamber full of gas. A charged particle passing through the chamber knocks negatively charged electrons out of atoms in the gas, leaving behind positive ions. The electrons are pulled towards the positively charged wires. They collide with other atoms on the way, producing an avalanche of electrons and ions. The movement of these electrons and ions induces an electric pulse in the wires which is collected by fast electronics. The size of the pulse is proportional to the energy loss of the original particle.

Digital communication system

Science.gov (United States)

Monford, L. G., Jr. (Inventor)

1974-01-01

A digital communication system is reported for parallel operation of 16 or more transceiver units with the use of only four interconnecting wires. A remote synchronization circuit produces unit address control words sequentially in data frames of 16 words. Means are provided in each transceiver unit to decode calling signals and to transmit calling and data signals. The transceivers communicate with each other over one data line. The synchronization unit communicates the address control information to the transceiver units over an address line and further provides the timing information over a clock line. A reference voltage level or ground line completes the interconnecting four wire hookup.

Preparation and dispersive properties of Ag colloid by electrical explosion of wire

International Nuclear Information System (INIS)

Yun, G.S.; Bac, L.H.; Kim, J.S.; Kwon, Y.S.; Choi, H.S.; Kim, J.C.

2011-01-01

Research highlights: → Wire diameter and synthetic temperature affect on properties of Ag colloid by EEW. → The lower temperature and smaller diameter make smaller size and narrower size distribution. → Ag colloid are more stable at lower synthetic temperature and smaller size. - Abstract: In this work, Ag colloid was prepared by electrical explosion of wire in deionized water with 0.2 mm and 0.3 mm wire diameter. The temperature of water used for medium of explosion process was change from 20 deg. C to 80 deg. C. Morphology and particle size of nanoparticles was observed by transmission electron microscope. The particle size and size distribution of nanoparticles was found to shift to a smaller size with a decrease of temperature and smaller wire diameter. Surface plasmon resonance of the silver colloids was studied by UV-vis spectroscopy. Stability of silver colloids was investigated by zeta-potential and Turbiscan techniques. The results indicated that temperature of medium during explosion affects much on the stability of Ag colloid. The silver colloidal stability prepared at lower temperature and smaller wire diameter was more stable.

The importance of carbon nanotube wire density, structural uniformity, and purity for fabricating homogeneous carbon nanotube-copper wire composites by copper electrodeposition

Science.gov (United States)

Sundaram, Rajyashree; Yamada, Takeo; Hata, Kenji; Sekiguchi, Atsuko

2018-04-01

We present the influence of density, structural regularity, and purity of carbon nanotube wires (CNTWs) used as Cu electrodeposition templates on fabricating homogeneous high-electrical performance CNT-Cu wires lighter than Cu. We show that low-density CNTWs (wires) with regular macro- and microstructures and high CNT content (>90 wt %) are essential for making homogeneous CNT-Cu wires. These homogeneous CNT-Cu wires show a continuous Cu matrix with evenly mixed nanotubes of high volume fractions (˜45 vol %) throughout the wire-length. Consequently, the composite wires show densities ˜5.1 g/cm3 (33% lower than Cu) and electrical conductivities ˜6.1 × 104 S/cm (>100 × CNTW conductivity). However, composite wires from templates with higher densities or structural inconsistencies are non-uniform with discontinuous Cu matrices and poor CNT/Cu mixing. These non-uniform CNT-Cu wires show conductivities 2-6 times lower than the homogeneous composite wires.

Wiring of heme enzymes by methylene-blue labeled dendrimers

DEFF Research Database (Denmark)

Álvarez-Martos, Isabel; Shahdost-fard, Faezeh; Ferapontova, Elena

2017-01-01

Redox-modified branched 3D dendrimeric nanostructures may be considered as perspective wires for electrical connection between redox enzymes and electrodes. Here, we studied electron transfer (ET) reactions and bioelectrocatalysis of heme-containing horseradish peroxidase (HRP) and heme- and moli......Redox-modified branched 3D dendrimeric nanostructures may be considered as perspective wires for electrical connection between redox enzymes and electrodes. Here, we studied electron transfer (ET) reactions and bioelectrocatalysis of heme-containing horseradish peroxidase (HRP) and heme......- and molibdopterin-containing sulfite oxidase (SOx), wired to gold by the methylene blue (MB)-labeled polyamidoamine (PAMAM) dendrimers. The enzymes’ electrochemical transformation and bioelectrocatalytic function could be followed at both unlabeled and MB-labeled dendrimer-modified electrodes with the formal redox......, optimization of bioelectrocatalysis of complex intermembrane and, possibly, membrane enzymes....

Computer-generated video fly-through: an aid to visual impact assessment for windfarms

International Nuclear Information System (INIS)

Neilson, G.; Leeming, T.; Hall, S.

1998-01-01

Computer generated video fly-through provides a new method of assessing the visual impact of wind farms. With a PC, software and digital terrain model of the wind farm it is possible to produce videos ranging from wireframe to realistically shaded models. Using computer generated video fly-through visually sensitive corridors can be explored fully, wind turbine rotors can be seen in motion, critical viewpoints can be identified for photomontages and the context of the wind farm appreciated better. This paper describes the techniques of computer generated video fly through and examines its various applications in visual impact assessment of wind farms. (Author)

A new wire chamber front-end system, based on the ASD-8 B chip

International Nuclear Information System (INIS)

Kruesemann, B.A.M.; Bassini, R.; Ellinghaus, F.; Frekers, D.; Hagemann, M.; Hannen, V.M.; Heynitz, H. von; Heyse, J.; Rakers, S.; Sohlbach, H.; Woertche, H.J.

1999-01-01

The Focal-Plane Polarimeter (FPP) for the Big-Bite Spectrometer van den Berg (Nucl. Instr. and Meth. B 99 (1995) 637ff) at the KVI requires the read-out of four large-area MWPCs and two VDCs with 3872 wires in total. The EUROSUPERNOVA collaboration (SNOVA) developed a digital 16 channel preamplifier front-end board, housing two amplifier-shaper-discriminatorchips ASD-8 B. The main features of this board are a fast single-wire readout, a high integration density, a low power consumption and compatibility to common instrumentation standards. The board represents the first successfully running application of the ASD-8 for wire chamber readout. (author)

Influence of tensile stress and frequency on the longitudinal magnetic hysteresis of amorphous wires

International Nuclear Information System (INIS)

Torres, Carlos; Maria Munoz, Jose; Hernandez-Gomez, Pablo; Francisco, Carlos de

2010-01-01

This work studies the longitudinal magnetic hysteresis of amorphous wires with different Fe or Co compositions through an external magnetic field in the axial direction. Measurements have been carried out with the help of a digitally processed system in the 50 Hz-1 kHz frequency range. In addition, the influence of different tensile stresses has been also analyzed. The results show that both parameters change considerably the magnetic hysteresis of the wires but in a different way depending on their composition. This behaviour has been interpreted in terms of the different domain distribution associated with the opposite sign of the magnetostriction for Fe and Co-based wires, respectively.

PS wire chamber

CERN Multimedia

1970-01-01

A wire chamber used at CERN's Proton Synchrotron accelerator in the 1970s. Multi-wire detectors contain layers of positively and negatively charged wires enclosed in a chamber full of gas. A charged particle passing through the chamber knocks negatively charged electrons out of atoms in the gas, leaving behind positive ions. The electrons are pulled towards the positively charged wires. They collide with other atoms on the way, producing an avalanche of electrons and ions. The movement of these electrons and ions induces an electric pulse in the wires which is collected by fast electronics. The size of the pulse is proportional to the energy loss of the original particle.

"Crows on the Wire": Intermediality in Applied Drama and Conflict Transformation--"Humanising" the Police in Northern Ireland

Science.gov (United States)

Jennings, Matt

2016-01-01

"Crows on the Wire" (COTW) is an intermedial project deploying applied theatre, educational drama and digital performance [Dixon, S. (2007). "Digital Performance: A History of New Media in Theatre, Dance, Performance Art and Installation." Cambridge, MA: MIT Press] to explore the recent history of the peace process in Northern…

Wire breakage in SLC wire profile monitors

International Nuclear Information System (INIS)

Field, C.; McCormick, D.; Raimondi, P.; Ross, M.

1998-05-01

Wire scanning beam profile monitors are used at the Stanford Linear Collider (SLC) for emittance preservation control and beam optics optimization. Twenty such scanners have proven most useful for this purpose and have performed a total of 1.5 million scans in the 4 to 6 years since their installation. Most of the essential scanners are equipped with 20 to 40 microm tungsten wires. SLC bunch intensities and sizes often exceed 2 x 10 7 particles/microm 2 (3C/m 2 ). The authors believe that this has caused a number of tungsten wire failures that appear at the ends of the wire, near the wire support points, after a few hundred scans are accumulated. Carbon fibers, also widely used at SLAC, have been substituted in several scanners and have performed well. In this paper, the authors present theories for the wire failure mechanism and techniques learned in reducing the failures

Theory of wire number scaling in wire-array Z pinches

International Nuclear Information System (INIS)

Desjarlais, M.P.; Marder, B.M.

1999-01-01

Pulsed-power-driven Z pinches, produced by imploding cylindrical arrays of many wires, have generated very high x-ray radiation powers (>200 TW) and energies (2 MJ). Experiments have revealed a steady improvement in Z-pinch performance with increasing wire number at fixed total mass and array radius. The dominant mechanism acting to limit the performance of these devices is believed to be the Rayleigh-Taylor instability which broadens the radially imploding plasma sheath and consequently reduces the peak radiation power. A model is presented which describes an amplification over the two-dimensional Rayleigh-Taylor growth rate brought about by kink-like forces on the individual wires. This amplification factor goes to zero as the number of wires approaches infinity. This model gives results which are in good agreement with the experimental data and provides a scaling for wire-array Z pinches. copyright 1999 American Institute of Physics

Can We Execute Reliable MM-PBSA Free Energy Computations of Relative Stabilities of Different Guanine Quadruplex Folds?

Czech Academy of Sciences Publication Activity Database

Islam, B.; Stadlbauer, Petr; Neidle, S.; Haider, S.; Šponer, Jiří

2016-01-01

Roč. 120, č. 11 (2016), s. 2899-2912 ISSN 1520-6106 R&D Projects: GA ČR(CZ) GA16-13721S Institutional support: RVO:68081707 Keywords : MOLECULAR-DYNAMICS SIMULATIONS * TELOMERIC G-QUADRUPLEX * AMBER FORCE-FIELD Subject RIV: BO - Biophysics Impact factor: 3.177, year: 2016

Seasonal use of red-cockaded woodpecker cavities by southern flying squirrels.

Energy Technology Data Exchange (ETDEWEB)

Loeb, Susan C; Ruth, Deanna L

2004-12-31

Loeb, Susan C., and Deanna L. Ruth. 2004. Seasonal use of red-cockaded woodpecker cavities by southern flying squirrels. In: Red-cockaded woodpecker; Road to Recovery. Proceedings of the 4th Red-cockaded woodpecker Symposium. Ralph Costa and Susan J. Daniels, eds. Savannah, Georgia. January, 2003. Chapter 8. Cavities, Cavity Trees, and Cavity Communities. Pp 501-502. Abstract: Southern flying squirrels can significantly impact red-cockaded woodpecker reproductive success (Laves and Loeb 1999). Thus exclusion or removal of flying squirrels from red-cockaded woodpecker cavities and clusters may be warranted in small woodpecker populations (U.S. Fish and Wildlife Service 2003). However, development of effective and efficient protocols for southern flying squirrel control requires an understanding of the seasonal dynamics of southern flying squirrel cavity use. Most studies of southern flying squirrel use of red-cockaded woodpecker cavities have been conducted during spring (e.g., Harlow and Lennartz 1983, Rudolph et al. 1990a, Loeb 1993) and no studies have examined the effects of long term flying squirrel control on subsequent cavity use. The objectives of this study were to determine: (1) whether flying squirrel use of red-cockaded woodpecker cavities varies with season or cavity type, and (2) the long term effect of continuous squirrel removal.

THERMO-MECHANICALLY PROCESSED ROLLED WIRE FOR HIGH-STRENGTH ON-BOARD WIRE

Directory of Open Access Journals (Sweden)

V. A. Lutsenko

2011-01-01

Full Text Available It is shown that at twisting of wire of diameter 1,83 mm, produced by direct wire drawing of thermomechanically processed rolled wire of diameter 5,5 mm of steel 90, metal stratification is completely eliminated at decrease of carbon, manganese and an additional alloying of chrome.

Rosetta performs ESA's closest-ever Earth fly-by

Science.gov (United States)

2005-03-01

The passage through the Earth-Moon system allowed ground controllers to test Rosetta's 'asteroid fly-by mode' (AFM) using the Moon as a 'fake' asteroid, rehearsing the fly-bys of asteroids Steins and Lutetia due in 2008 and 2010 respectively. The AFM test started at 23:01 GMT and ran for nine minutes during which the two onboard navigation cameras successfully tracked the Moon, allowing Rosetta's attitude to be automatically adjusted. Before and after closest approach, the navigation cameras also acquired a series of images of the Moon and Earth; these data will be downloaded early today for ground processing and are expected to be available by 8 March. In addition, other onboard instruments were switched on, including ALICE (ultraviolet imaging spectrometer), VIRTIS (visible and infrared mapping spectrometer) and MIRO (microwave instrument for the Rosetta orbiter), for calibration and general testing using the Earth and Moon as targets. The fly-by manoeuvre swung the three-tonne spacecraft around our planet and out towards Mars, where it will make a fly-by on 26 February 2007. Rosetta will return to Earth again in a series of four planet fly-bys (three times with Earth, once with Mars) before reaching Comet 67P/Churyumov-Gerasimenko in 2014, when it will enter orbit and deliver a lander, Philae, onto the surface. The fly-bys are necessary to accelerate the spacecraft so as to eventually match the velocity of the target comet. They are a fuel-saving way to boost speed using planetary gravity. Yesterday's fly-by came one year and two days after launch and highlights the valuable opportunities for instrument calibration and data gathering available during the mission's multi-year voyage. In just three months, on 4 July, Rosetta will be in a good position to observe and gather data during NASA's spectacular Deep Impact event, when the Deep Impact probe will hurl a 380 kg projectile into Comet Tempel 1, revealing data on the comet's internal structure. Certain of

Nanopowder production by gas-embedded electrical explosion of wire

International Nuclear Information System (INIS)

Zou Xiao-Bing; Wang Xin-Xin; Jiang Wei-Hua; Mao Zhi-Guo

2013-01-01

A small electrical explosion of wire (EEW) setup for nanopowder production is constructed. It consists of a low inductance capacitor bank of 2 μF–4 μF typically charged to 8 kV−30 kV, a triggered gas switch, and a production chamber housing the exploding wire load and ambient gas. With the EEW device, nanosize powders of titanium oxides, titanium nitrides, copper oxides, and zinc oxides are successfully synthesized. The average particle size of synthesized powders under different experimental conditions is in a range of 20 nm−80 nm. The pressure of ambient gas or wire vapor can strongly affect the average particle size. The lower the pressure, the smaller the particle size is. For wire material with relatively high resistivity, such as titanium, whose deposited energy W d is often less than sublimation energy W s due to the flashover breakdown along the wire prematurely ending the Joule heating process, the synthesized particle size of titanium oxides or titanium nitrides increases with overheat coefficient k (k = W d /W s ) increasing. (physics of gases, plasmas, and electric discharges)

Nanopowder production by gas-embedded electrical explosion of wire

Institute of Scientific and Technical Information of China (English)

Zou Xiao-Bing; Mao Zhi-Guo; Wang Xin-Xin; Jiang Wei-Hua

2013-01-01

A small electrical explosion of wire (EEW) setup for nanopowder production is constructed.It consists of a low inductance capacitor bank of 2 μF--4 μF typically charged to 8 kV-30 kV,a triggered gas switch,and a production chamber housing the exploding wire load and ambient gas.With the EEW device,nanosize powders of titanium oxides,titanium nitrides,copper oxides,and zinc oxides are successfully synthesized.The average particle size of synthesized powders under different experimental conditions is in a range of 20 nm-80 nm.The pressure of ambient gas or wire vapor can strongly affect the average particle size.The lower the pressure,the smaller the particle size is.For wire material with relatively high resistivity,such as titanium,whose deposited energy Wd is often less than sublimation energy Ws due to the flashover breakdown along the wire prematurely ending the Joule heating process,the synthesized particle size of titanium oxides or titanium nitrides increases with overheat coefficient k (k =Wd/Ws) increasing.

Fly-by-light flight control system technology development plan

Science.gov (United States)

Chakravarty, A.; Berwick, J. W.; Griffith, D. M.; Marston, S. E.; Norton, R. L.

1990-01-01

The results of a four-month, phased effort to develop a Fly-by-Light Technology Development Plan are documented. The technical shortfalls for each phase were identified and a development plan to bridge the technical gap was developed. The production configuration was defined for a 757-type airplane, but it is suggested that the demonstration flight be conducted on the NASA Transport Systems Research Vehicle. The modifications required and verification and validation issues are delineated in this report. A detailed schedule for the phased introduction of fly-by-light system components has been generated. It is concluded that a fiber-optics program would contribute significantly toward developing the required state of readiness that will make a fly-by-light control system not only cost effective but reliable without mitigating the weight and high-energy radio frequency related benefits.

Underwater electrical wire explosion: Shock wave from melting being overtaken by shock wave from vaporization

Science.gov (United States)

Li, Liuxia; Qian, Dun; Zou, Xiaobing; Wang, Xinxin

2018-05-01

The shock waves generated by an underwater electrical wire explosion were investigated. A microsecond time-scale pulsed current source was used to trigger the electrical explosion of copper wires with a length of 5 cm and a diameter of 200 μm. The energy-storage capacitor was charged to a relatively low energy so that the energy deposited onto the wire was not large enough to fully vaporize the whole wire. Two shock waves were recorded with a piezoelectric gauge that was located at a position of 100 mm from the exploding wire. The first and weak shock wave was confirmed to be the contribution from wire melting, while the second and stronger shock wave was the contribution from wire vaporization. The phenomenon whereby the first shock wave generated by melting being overtaken by the shock wave due to vaporization was observed.

Magnetic properties of iron nanoparticles prepared by exploding wire technique

OpenAIRE

Alqudami, Abdullah; Annapoorni, S.; Lamba, Subhalakshmi; Kothari, P C; Kotnala, R K

2006-01-01

Nanoparticles of iron were prepared in distilled water using very thin iron wires and sheets, by the electro-exploding wire technique. Transmission electron microscopy reveals the size of the nanoparticles to be in the range 10 to 50 nm. However, particles of different sizes can be segregated by using ultrahigh centrifuge. X-ray diffraction studies confirm the presence of the cubic phase of iron. These iron nanoparticles were found to exhibit fluorescence in the visible region in contrast to ...

A colorimetric platform for sensitively differentiating telomere DNA with different lengths, monitoring G-quadruplex and dsDNA based on silver nanoclusters and unmodified gold nanoparticles

Science.gov (United States)

Qu, Fei; Chen, Zeqiu; You, Jinmao; Song, Cuihua

2018-05-01

Human telomere DNA plays a vital role in genome integrity control and carcinogenesis as an indication for extensive cell proliferation. Herein, silver nanoclusters (Ag NCs) templated by polymer and unmodified gold nanoparticles (Au NPs) are designed as a new colorimetric platform for sensitively differentiating telomere DNA with different lengths, monitoring G-quadruplex and dsDNA. Ag NCs can produce the aggregation of Au NPs, so the color of Au NPs changes to blue and the absorption peak moves to 700 nm. While the telomere DNA can protect Au NPs from aggregation, the color turns to red again and the absorption band blue shift. Benefiting from the obvious color change, we can differentiate the length of telomere DNA by naked eyes. As the length of telomere DNA is longer, the variation of color becomes more noticeable. The detection limits of telomere DNA containing 10, 22, 40, 64 bases are estimated to be 1.41, 1.21, 0.23 and 0.22 nM, respectively. On the other hand, when telomere DNA forms G-quadruplex in the presence of K+, or dsDNA with complementary sequence, both G-quadruplex and dsDNA can protect Au NPs better than the unfolded telomere DNA. Hence, a new colorimetric platform for monitoring structure conversion of DNA is established by Ag NCs-Au NPs system, and to prove this type of application, a selective K+ sensor is developed.

Prospect of bioflavonoid fisetin as a quadruplex DNA ligand: a biophysical approach.

Directory of Open Access Journals (Sweden)

Bidisha Sengupta

Full Text Available Quadruplex (G4 forming sequences in telomeric DNA and c-myc promoter regions of human DNA are associated with tumorogenesis. Ligands that can facilitate or stabilize the formation and increase the stabilization of G4 can prevent tumor cell proliferation and have been regarded as potential anti-cancer drugs. In the present study, steady state and time-resolved fluorescence measurements provide important structural and dynamical insights into the free and bound states of the therapeutically potent plant flavonoid fisetin (3,3',4',7-tetrahydroxyflavone in a G4 DNA matrix. The excited state intra-molecular proton transfer (ESPT of fisetin plays an important role in observing and understanding the binding of fisetin with the G4 DNA. Differential absorption spectra, thermal melting, and circular dichroism spectroscopic studies provide evidences for the formation of G4 DNA and size exclusion chromatography (SEC proves the binding and 1∶1 stoichiometry of fisetin in the DNA matrix. Comparative analysis of binding in the presence of EtBr proves that fisetin favors binding at the face of the G-quartet, mostly along the diagonal loop. Time resolved fluorescence anisotropy decay analysis indicates the increase in the restrictions in motion from the free to bound fisetin. We have also investigated the fingerprints of the binding of fisetin in the antiparallel quadruplex using Raman spectroscopy. Preliminary results indicate fisetin to be a prospective candidate as a G4 ligand.

Prospect of Bioflavonoid Fisetin as a Quadruplex DNA Ligand: A Biophysical Approach

Science.gov (United States)

Sengupta, Bidisha; Pahari, Biswapathik; Blackmon, Laura; Sengupta, Pradeep K.

2013-01-01

Quadruplex (G4) forming sequences in telomeric DNA and c-myc promoter regions of human DNA are associated with tumorogenesis. Ligands that can facilitate or stabilize the formation and increase the stabilization of G4 can prevent tumor cell proliferation and have been regarded as potential anti-cancer drugs. In the present study, steady state and time-resolved fluorescence measurements provide important structural and dynamical insights into the free and bound states of the therapeutically potent plant flavonoid fisetin (3,3′,4′,7-tetrahydroxyflavone) in a G4 DNA matrix. The excited state intra-molecular proton transfer (ESPT) of fisetin plays an important role in observing and understanding the binding of fisetin with the G4 DNA. Differential absorption spectra, thermal melting, and circular dichroism spectroscopic studies provide evidences for the formation of G4 DNA and size exclusion chromatography (SEC) proves the binding and 1∶1 stoichiometry of fisetin in the DNA matrix. Comparative analysis of binding in the presence of EtBr proves that fisetin favors binding at the face of the G-quartet, mostly along the diagonal loop. Time resolved fluorescence anisotropy decay analysis indicates the increase in the restrictions in motion from the free to bound fisetin. We have also investigated the fingerprints of the binding of fisetin in the antiparallel quadruplex using Raman spectroscopy. Preliminary results indicate fisetin to be a prospective candidate as a G4 ligand. PMID:23785423

Studies on the control of the Mediterranean fruit fly, Ceratitis capitata Wiedemann, using gamma radiation. Part of a coordinated programme on fruit fly eradication or control by the sterile-male technique. Final report for the period 1 December 1972 - 30 November 1974

Energy Technology Data Exchange (ETDEWEB)

Wakid, A M

1975-01-01

Wheat bran and molasses were used in larval medium of the Mediterranean fruit fly, Ceratitis capitata instead of the dried carrot previously used in Egypt. The new larval medium consists of wheat bran, molasses, yeast, sodium benzoate, hydrochloric acid and tap water. This substitution reduced the production costs of pupae in our laboratories. The adults produced from this medium showed almost similar emergence, fecundity, fertility and longevity as those produced from carrot medium. New large larval breeding cabinet was constructed which improved the larval production and can help in mass production purposes. Large oviposition cage was also used instead of the small ones previously used in Egypt. Six field cages made of wire screen, glass and wood were constructed to conduct semi field experiments on the competitiveness of the irradiated males. Competitiveness decreased with increased dose, doses of 5-9 krad led to almost similar reduction in egg hatch. Ratios of 13:13:1:1 and 2:2:1:1 (treated males : treated females : untreated males : untreated females) were tested in the field cages. There was no clear indication of whether male competitiveness of a particular dose was affected by the ratio of irradiated males to untreated males and females. Generally competitiveness of the irradiated males decreased by time. Flight range of the irradiated (9 krad) tagged flies was found to be 700 m within an orchard. Flies released in an orchard did not reach another orchard 700 m far from the release point.

Minimisation of the wire position uncertainties of the new CERN vacuum wire scanner

CERN Document Server

AUTHOR|(CDS)2069346; Barjau Condomines, A

In the next years the luminosity of the LHC will be significantly increased. This will require a much higher accuracy of beam profile measurement than actually achievable by the current wire scanner. The new fast wire scanner is foreseen to measure small emittance beams throughout the LHC injector chain, which demands a wire travelling speed up to 20 ms-1 and position measurement accuracy of the order of a few microns. The vibrations of the mechanical parts of the system, and particularly the vibrations of the thin carbon wire, were identified as the major error sources of wire position uncertainty. Therefore the understanding of the wire vibrations is a high priority for the design and operation of the new device. This document presents the work performed to understand the main causes of the wire vibrations observed in one of the existing wire scanner and the new proposed design.

Vibration of signal wires in wire detectors under irradiation

International Nuclear Information System (INIS)

Bojko, I.R.; Shelkov, G.A.; Dodonov, V.I.; Ignatenko, M.A.; Nikolenko, M.Yu.

1995-01-01

Radiation-induced vibration of signal wires in wire detectors is found and explained. The phenomenon is based on repulsion of a signal wire with a positive potential and a cloud of positive ions that remains after neutralization of the electron part of the avalanche formed in the course of gas amplification. Vibration with a noticeable amplitude may arise from fluctuations of repulsive forces, which act on the wire and whose sources are numerous ion clusters. A formula is obtained which allows wire oscillations to be estimated for all types of wire detectors. Calculation shows that oscillations of signal wires can be substantial for the coordinate accuracy of a detector working in the limited streamer mode at fluxes over 10 5 particles per second per wire. In the proportional mode an average oscillation amplitude can be as large as 20-30 μm at some detector parameters and external radiation fluxes over 10 5 . The experimental investigations show that the proposed model well describes the main features of the phenomenon. 6 refs., 8 figs

Quantification of Chemical and Mechanical Effects on the Formation of the G-Quadruplex and i-Motif in Duplex DNA.

Science.gov (United States)

Selvam, Sangeetha; Mandal, Shankar; Mao, Hanbin

2017-09-05

The formation of biologically significant tetraplex DNA species, such as G-quadruplexes and i-motifs, is affected by chemical (ions and pH) and mechanical [superhelicity (σ) and molecular crowding] factors. Because of the extremely challenging experimental conditions, the relative importance of these factors on tetraplex folding is unknown. In this work, we quantitatively evaluated the chemical and mechanical effects on the population dynamics of DNA tetraplexes in the insulin-linked polymorphic region using magneto-optical tweezers. By mechanically unfolding individual tetraplexes, we found that ions and pH have the largest effects on the formation of the G-quadruplex and i-motif, respectively. Interestingly, superhelicity has the second largest effect followed by molecular crowding conditions. While chemical effects are specific to tetraplex species, mechanical factors have generic influences. The predominant effect of chemical factors can be attributed to the fact that they directly change the stability of a specific tetraplex, whereas the mechanical factors, superhelicity in particular, reduce the stability of the competing species by changing the kinetics of the melting and annealing of the duplex DNA template in a nonspecific manner. The substantial dependence of tetraplexes on superhelicity provides strong support that DNA tetraplexes can serve as topological sensors to modulate fundamental cellular processes such as transcription.

Cation binding to 15-TBA quadruplex DNA is a multiple-pathway cation-dependent process

Czech Academy of Sciences Publication Activity Database

Reshetnikov, R.V.; Šponer, Jiří; Rassokhina, O.I.; Kopylov, A.M.; Tsvetkov, P.O.; Makarov, A.A.; Golovin, A.V.

2011-01-01

Roč. 39, č. 22 (2011), s. 9789-9802 ISSN 0305-1048 R&D Projects: GA AV ČR(CZ) IAA400040802; GA ČR(CZ) GA203/09/1476; GA ČR(CZ) GAP208/11/1822; GA MŠk(CZ) LC06030 Institutional research plan: CEZ:AV0Z50040507; CEZ:AV0Z50040702 Keywords : QM/MM * quadruplex DNA * molecular dynamics simulation Subject RIV: BO - Biophysics Impact factor: 8.026, year: 2011

Microstructure and mechanical properties of aluminum–fly ash nano composites made by ultrasonic method

International Nuclear Information System (INIS)

Narasimha Murthy, I.; Venkata Rao, D.; Babu Rao, J.

2012-01-01

Highlights: ► Nano structured fly ash has been produced by 30 h milling time. ► Al–fly ash nano composites were produced by ultrasonic cavitation route. ► A homogeneous distribution of nano fly ash particles was observed in the matrix. ► No additional contamination in the nano composites from the atmosphere. ► Presence of nano fly ash leads to improvement in the strength of the composites. -- Abstract: In this paper an attempt has been made to modify the micro sized fly ash into nano structured fly ash using high energy ball mill. Ball milling was carried out for the total duration of 30 h. The sample was taken out after every 5 h of milling for characterizing. The nano structured fly ash was characterized for its crystallite size and lattice strain by using X-ray diffractometer. It was found that a steady decrease in the crystallite size and increased lattice strain was observed with milling time; the crystallite size at 30 h milling time was found to be 23 nm. The fresh fly ash particles are mostly spherical in shape; whereas the shape of the 30 h milled fly ash particles is irregular and the surface morphology is rough. Al–fly ash nano composites were produced by ultrasonic cavitation route successfully. Scanning electron microscopy images of nano composites reveal a homogeneous distribution of the nano fly ash particles in the AA 2024 matrix. Energy dispersive spectroscopy analysis of nano composites reveals that the fabricated nano composite did not contain any additional contamination from the atmosphere. As the amount of nano fly ash is increasing the hardness of the composite also increasing. The nano fly ash addition leads to improvement in the compression strength of the composites.

Calibration of magnetic force microscopy tips by using nanoscale current-carrying parallel wires

International Nuclear Information System (INIS)

Kebe, Th.; Carl, A.

2004-01-01

Experimental results on the characterization of commercially available magnetic force microscopy (MFM) thin film tips as a function of an external magnetic field are presented. Magnetic stray fields with a definitive z-component (perpendicular to the substrate) and a magnetic field strength of up to H z =±45 Oe are produced with current carrying parallel nanowires with a thickness of t=60 nm, which are fabricated by electron-beam lithography. The magnetic fields are generated by electrical dc-currents of up to ±6 mA which are directed antiparallel through the nanowires. The geometry and the dimensions of the nanowires are systematically varied by choosing different wire widths w as well as separations b between the parallel wires for two different sets of samples. On the one hand, the wire width w is varied within 380 nm< w<2460 nm while the separation b≅450 nm between the wires is kept constant. On the other hand the separation b between the parallel wires is varied within 120 nm< b<5100 nm, while the wire width w=960 nm is kept constant. For all the geometrical configurations of parallel wires the resulting magnetic contrast is imaged by MFM at various tip lift-heights. By treating the MFM tip as a point probe, the analysis of the image contrast as a function of both the magnetic field strength and the tip lift height allows one to quantitatively determine the effective magnetic dipole and monopole moments of the tip as well as their imaginary locations within the real physical tip. Our systematic study quantitatively relates the above point-probe parameters to (i) the dimensions of the parallel wires and (ii) to the characteristic decay length of the z-component of the magnetic field of parallel wires. From this the effective tip-volume of the real thin film tip is determined which is relevant in MFM-imaging. Our results confirm the reliability of earlier tip calibration schemes for which nanofabricated current carrying rings were used instead of parallel

Determination of separation efficiency in wire mesh mist eliminator by CFD

International Nuclear Information System (INIS)

Shen Shengqiang; Zhen Ni; Mu Xingsen

2014-01-01

On the assumption of the staggered array model, a numerical simulation of the vapor flow field in wire mesh mist eliminator along with the mechanism for droplet capture due to inertial impaction is presented in this paper. The efficiency of a single wire in the eliminator is computed in order that the efficiency of wire mesh mist eliminator can be calculated. The obtained efficiency is found to be within a reasonable agreement with the published literature data. The effect of wire diameter, pad thickness, packing fraction on the separation efficiency and the relation between Stk and the efficiency of a single wire is investigated. (authors)

Convergent optical wired and wireless long-reach access network using high spectral-efficient modulation.

Science.gov (United States)

Chow, C W; Lin, Y H

2012-04-09

To provide broadband services in a single and low cost perform, the convergent optical wired and wireless access network is promising. Here, we propose and demonstrate a convergent optical wired and wireless long-reach access networks based on orthogonal wavelength division multiplexing (WDM). Both the baseband signal and the radio-over-fiber (ROF) signal are multiplexed and de-multiplexed in optical domain, hence it is simple and the operation speed is not limited by the electronic bottleneck caused by the digital signal processing (DSP). Error-free de-multiplexing and down-conversion can be achieved for all the signals after 60 km (long-reach) fiber transmission. The scalability of the system for higher bit-rate (60 GHz) is also simulated and discussed.

Strain-tempering of low carbon martensite steel wire by rapid heating

International Nuclear Information System (INIS)

Torisaka, Yasunori; Kihara, Junji

1978-01-01

In the production of prestressed concrete steel wires, a series of the cold drawing-patenting process are performed to improve the strength. In order to reduce cyclic process, the low carbon martensite steel wire which can be produced only by the process of hot rolling and direct quench has been investigated as strain-tempering material. When strain-tempering is performed on the low carbon martensite steel wire, stress relaxation (Re%) increases and mechanical properties such as total elongation, reduction of area, ultimate tensile strength and proof stress decrease remarkably by annealing. In order to shorten the heating time, the authors performed on the steel wire the strain-tempering with a heating time of 1.0 s using direct electrical resistance heating and examined the effects of rapid heating on the stress relaxation and the mechanical properties. Stress relaxation decreases without impairment of the mechanical properties up to a strain-tempering temperature of 573 K. Re(%) after 10.8 ks is 0% at the testing temperature 301 K, 0.49% at 363 K and 1.39% at 433 K. (auth.)

A label-free ultrasensitive fluorescence detection of viable Salmonella enteritidis using enzyme-induced cascade two-stage toehold strand-displacement-driven assembly of G-quadruplex DNA.

Science.gov (United States)

Zhang, Peng; Liu, Hui; Ma, Suzhen; Men, Shuai; Li, Qingzhou; Yang, Xin; Wang, Hongning; Zhang, Anyun

2016-06-15

The harm of Salmonella enteritidis (S. enteritidis ) to public health mainly by contaminating fresh food and water emphasizes the urgent need for rapid detection techniques to help control the spread of the pathogen. In this assay, an newly designed capture probe complex that contained specific S. enteritidis-aptamer and hybridized signal target sequence was used for viable S. enteritidis recognition directly. In the presence of the target S. enteritidis, single-stranded target sequences were liberated and initiated the replication-cleavage reaction, producing numerous G-quadruplex structures with a linker on the 3'-end. And then, the sensing system took innovative advantage of quadratic linker-induced strand-displacement for the first time to release target sequence in succession, leading to the cyclic reuse of the target sequences and cascade signal amplification, thereby achieving the successive production of G-quadruplex structures. The fluorescent dye, N-Methyl mesoporphyrin IX, binded to these G-quadruplex structures and generated significantly enhanced fluorescent signals to achieve highly sensitive detection of S. enteritidis down to 60 CFU/mL with a linear range from 10(2) to 10(7)CFU/mL. By coupling the cascade two-stage target sequences-recyclable toehold strand-displacement with aptamer-based target recognition successfully, it is the first report on a novel non-label, modification-free and DNA extraction-free ultrasensitive fluorescence biosensor for detecting viable S. enteritidis directly, which can discriminate from dead S. enteritidis. Copyright © 2016 Elsevier B.V. All rights reserved.

Water Desalination with Wires

NARCIS (Netherlands)

Porada, S.; Sales, B.B.; Hamelers, H.V.M.; Biesheuvel, P.M.

2012-01-01

We show the significant potential of water desalination using a novel capacitive wire-based technology in which anode/cathode wire pairs are constructed from coating a thin porous carbon electrode layer on top of electrically conducting rods (or wires). By alternately dipping an array of electrode

Charge splitters and charge transport junctions based on guanine quadruplexes

Science.gov (United States)

Sha, Ruojie; Xiang, Limin; Liu, Chaoren; Balaeff, Alexander; Zhang, Yuqi; Zhang, Peng; Li, Yueqi; Beratan, David N.; Tao, Nongjian; Seeman, Nadrian C.

2018-04-01

Self-assembling circuit elements, such as current splitters or combiners at the molecular scale, require the design of building blocks with three or more terminals. A promising material for such building blocks is DNA, wherein multiple strands can self-assemble into multi-ended junctions, and nucleobase stacks can transport charge over long distances. However, nucleobase stacking is often disrupted at junction points, hindering electric charge transport between the two terminals of the junction. Here, we show that a guanine-quadruplex (G4) motif can be used as a connector element for a multi-ended DNA junction. By attaching specific terminal groups to the motif, we demonstrate that charges can enter the structure from one terminal at one end of a three-way G4 motif, and can exit from one of two terminals at the other end with minimal carrier transport attenuation. Moreover, we study four-way G4 junction structures by performing theoretical calculations to assist in the design and optimization of these connectors.

Maximizing commonality between military and general aviation fly-by-light helicopter system designs

Science.gov (United States)

Enns, Russell; Mossman, David C.

1995-05-01

In the face of shrinking defense budgets, survival of the United States rotorcraft industry is becoming increasingly dependent on increased sales in a highly competitive civil helicopter market. As a result, only the most competitive rotorcraft manufacturers are likely to survive. A key ingredient in improving our competitive position is the ability to produce more versatile, high performance, high quality, and low cost of ownership helicopters. Fiber optic technology offers a path of achieving these objectives. Also, adopting common components and architectures for different helicopter models (while maintaining each models' uniqueness) will further decrease design and production costs. Funds saved (or generated) by exploiting this commonality can be applied to R&D used to further improve the product. In this paper, we define a fiber optics based avionics architecture which provides the pilot a fly-by-light / digital flight control system which can be implemented in both civilian and military helicopters. We then discuss the advantages of such an architecture.

Ionization waves of arbitrary velocity driven by a flying focus

Science.gov (United States)

Palastro, J. P.; Turnbull, D.; Bahk, S.-W.; Follett, R. K.; Shaw, J. L.; Haberberger, D.; Bromage, J.; Froula, D. H.

2018-03-01

A chirped laser pulse focused by a chromatic lens exhibits a dynamic, or flying, focus in which the trajectory of the peak intensity decouples from the group velocity. In a medium, the flying focus can trigger an ionization front that follows this trajectory. By adjusting the chirp, the ionization front can be made to travel at an arbitrary velocity along the optical axis. We present analytical calculations and simulations describing the propagation of the flying focus pulse, the self-similar form of its intensity profile, and ionization wave formation. The ability to control the speed of the ionization wave and, in conjunction, mitigate plasma refraction has the potential to advance several laser-based applications, including Raman amplification, photon acceleration, high-order-harmonic generation, and THz generation.

A space release/deployment system actuated by shape memory wires

Science.gov (United States)

Fragnito, Marino; Vetrella and, Sergio

2002-11-01

In this paper, the design of an innovative hold down/release and deployment device actuated by shape memory wires, to be used for the first time for the S MA RT microsatellite solar wings is shown. The release and deployment mechanisms are actuated by a Shape Memory wire (Nitinol), which allows a complete symmetrical and synchronous release, in a very short time, of the four wings in pairs. The hold down kinematic mechanism is preloaded to avoid vibration nonlinearities and unwanted deployment at launch. The deployment mechanism is a simple pulley system. The stiffness of the deployed panel-hinge system needs to be dimensioned in order to meet the on-orbit requirement for attitude control. One-way roller clutches are used to keep the panel at the desired angle during the mission. An ad hoc software has been developed to simulate both the release and deployment operations, coupling the SMA wire behavior with the system mechanics.

Vibrating wire for beam profile scanning

Directory of Open Access Journals (Sweden)

S. G. Arutunian

1999-12-01

Full Text Available A method that measures the transverse profile (emittance of the bunch by detecting radiation arising at the scattering of the bunch on scanning wire is widely used. In this work information about bunch scattering is obtained by measuring the oscillation frequency of the tightened scanning wire. In such a way, the system of radiation (or secondary particles extraction and measurement can be removed. The entire unit consists of a compact fork with tightened wire and a scanning system. Normal oscillation frequency of a wire depends on wire tension, its geometric parameters, and, in a second approximation, its elastic characteristics. Normal oscillations are generated by interaction of an alternating current through the wire with magnetic field of a permanent magnet. In this case, it is suggested that the magnetic field of the accelerator (field of dipole magnets or quadrupole magnets be used for excitation of oscillations. The dependence of oscillation frequency on beam scattering is determined by several factors, including changes of wire tension caused by transverse force of the beam and influence of beam self-field. Preliminary calculations show that the influence of wire heating will dominate. We have studied strain gauges on the basis of vibrating wire from various materials (tungsten, beryl bronze, and niobium zirconium alloys. A scheme of normal oscillation generation by alternating current in autogeneration circuit with automatic frequency adjustment was selected. A special method of wire fixation and elimination of transverse degrees of freedom allows us to achieve relative stability better than 10^{-5} during several days at a relative resolution of 10^{-6}. Experimental results and estimates of wire heating of existing scanners show that the wire heats up to a few hundred grades, which is enough for measurements. The usage of wire of micrometer thickness diminishes the problem of wire thermalization speed during the scanning of the bunch.

Electrodeposition of nickel nano wire arrays

International Nuclear Information System (INIS)

Nur Ubaidah Saidin; Kok Kuan Ying; Ng Inn Khuan; Nurazila Mat Zali; Siti Salwa Zainal Abidin

2010-01-01

Synthesis, characterization and assembly of one-dimensional nickel nano wires prepared by template directed electrodeposition are discussed in this paper. Parallel arrays of high aspect ratio nickel nano wires were electrodeposited using electrolytes with different cations and pH. The nano wires were characterized using X-ray diffractometry and scanning electron microscopy. It was found that the orientations of the electro deposited Ni nano wires were governed by the deposition current and the electrolyte conditions. Free standing nickel nano wires can be obtained by dissolving the template. Due to the magnetic nature of the nano wires, magnetic alignment was employed to assemble and position the free standing nano wires in the device structure. (author)

Clustered abasic lesions profoundly change the structure and stability of human telomeric G-quadruplexes

Czech Academy of Sciences Publication Activity Database

Kejnovská, Iva; Bednářová, Klára; Renčiuk, Daniel; Dvořáková, Zuzana; Školáková, Petra; Trantírek, L.; Fiala, R.; Vorlíčková, Michaela; Sagi, J.

2017-01-01

Roč. 45, č. 8 (2017), s. 4294-4305 ISSN 0305-1048 R&D Projects: GA MŠk EF15_003/0000477; GA ČR GAP205/12/0466; GA ČR GA13-28310S; GA ČR(CZ) GA15-06785S; GA MŠk(CZ) LQ1601 Institutional support: RVO:68081707 Keywords : dna-damage clusters * k+ solution * guanine quadruplexes Subject RIV: CE - Biochemistry OBOR OECD: Biochemistry and molecular biology Impact factor: 10.162, year: 2016

Examination of rapid phase change in copper wires to improve material models and understanding of burst

Science.gov (United States)

Olles, Joseph; Garasi, Christopher; Ball, J. Patrick

2017-11-01

Electrically-pulsed wires undergo multiple phase changes including a postulated metastable phase resulting in explosive wire growth. Simulations using the MHD approximation attempt to account for the governing physics, but lack the material properties (equations-of-state and electrical conductivity) to accurately predict the phase evolution of the exploding (bursting) wire. To explore the dynamics of an exploding copper wire (in water), we employ a digital micro-Schlieren streak photography technique. This imaging quantifies wire expansion and shock waves emitted from the wire during phase changes. Using differential voltage probes, a Rogowski coil, and timing fiducials, the phase change of the wire is aligned with electrical power and energy deposition. Time-correlated electrical diagnostics and imaging allow for detailed validation of MHD simulations, comparing observed phases with phase change details found in the material property descriptions. In addition to streak imaging, a long exposure image is taken to capture axial striations along the length of the wire. These images are used to compare with results from 3D MHD simulations which propose that these perturbations impact the rate of wire expansion and temporal change in phases. If successful, the experimental data will identify areas for improvement in the material property models, and modeling results will provide insight into the details of phase change in the wire with correlation to variations in the electrical signals.

Digital BPM Systems for Hadron Accelerators

CERN Document Server

Belleman, J; Kasprowicz, G; Raich, U

2009-01-01

The CERN Proton Synchrotron has been fitted with a new trajectory measurement system (TMS). Analogue signals from forty beam position monitors are digitized at 125MS/s, and then further treated entirely in the digital domain to derive the positions of all individual particle bunches on the fly. Large FPGAs handle all digital processing. The system fits in fourteen plug-in modules distributed over three half-width cPCI crates. Data are stored in circular buffers of large enough size to keep a fewseconds-worth of position data. Multiple clients can then request selected portions of the data, possibly representing many thousands of consecutive turns, for display on operator consoles. The system uses digital phase-locked loops to derive its beamlocked timing reference. Programmable state machines, driven by accelerator timing pulses and information from the accelerator control system, direct the order of operations. The cPCI crates are connected to a standard Linux computer by means of a private Gigabit Ethernet ...

Label-free and enzyme-free detection of transcription factors with graphene oxide fluorescence switch-based multifunctional G-quadruplex-hairpin probe.

Science.gov (United States)

Zhu, Desong; Wang, Lei; Xu, Xiaowen; Jiang, Wei

2016-01-15

Transcription factors (TFs) play pivotal roles in the regulation of a variety of essential cellular processes and some of them have been recognized as potential diagnostic markers and therapeutic targets of some diseases. Sensitive and accurate detection of TFs is of great importance to better understanding their roles in gene regulation and evaluation of disease state. Here, we developed a simple, label-free and enzyme-free new fluorescent strategy for the detection of TFs by graphene oxide (GO) fluorescence switch-based multifunctional G-quadruplex-hairpin probe (MGHP). The MGHP possessed of three functions simultaneously, adsorbing onto GO with the loop part, binding to target with the stem part and serving as signal carrier with the terminal G-quadruplex. First, the MGHP was adsorbed quickly to GO. Next, the TF bound to the stem part of MGHP to form a huge target-MGHP complex, which led to desorption of the complex from GO. Finally, NMM was inserted into G-quadruplex in the complex to yield an enhanced fluorescence response. The GO used here, as a fluorescence switch, could quickly and efficiently quench the fluorescence of NMM inserted into the MGHP absorbed on the GO, guaranteeing a high signal-to-noise ratio. Sensitive detection of purified NF-κB p50 and HeLa cell nuclear extracts were achieved with detection limits of 0.2nM and 7.8ng/µL, respectively. Moreover, this proposed strategy could be used to screen inhibitors of NF-κB p50 activity. The strategy proposed here might offer a new potential approach for reliable quantification of TFs in clinical diagnostics and treatment research of some diseases. Copyright © 2015 Elsevier B.V. All rights reserved.

Building the Digital Library Infrastructure: A Primer.

Science.gov (United States)

Tebbetts, Diane R.

1999-01-01

Provides a framework for examining the complex infrastructure needed to successfully implement a digital library. Highlights include database development, online public-access catalogs, interactive technical services, full-text documents, hardware and wiring, licensing, access, and security issues. (Author/LRW)

Can antibodies against flies alter malaria transmission in birds by changing vector behavior?

Science.gov (United States)

Ghosh, Suma; Waite, Jessica L; Clayton, Dale H; Adler, Frederick R

2014-10-07

Transmission of insect-borne diseases is shaped by the interactions among parasites, vectors, and hosts. Any factor that alters movement of infected vectors from infected to uninfeced hosts will in turn alter pathogen spread. In this paper, we study one such pathogen-vector-host system, avian malaria in pigeons transmitted by fly ectoparasites, where both two-way and three-way interactions play a key role in shaping disease spread. Bird immune defenses against flies can decrease malaria prevalence by reducing fly residence time on infected birds or increase disease prevalence by enhancing fly movement and thus infection transmission. We develop a mathematical model that illustrates how these changes in vector behavior influence pathogen transmission and show that malaria prevalence is maximized at an intermediate level of defense avoidance by the flies. Understanding how host immune defenses indirectly alter disease transmission by influencing vector behavior has implications for reducing the transmission of human malaria and other vectored pathogens. Published by Elsevier Ltd.

Towards plant wires

OpenAIRE

Adamatzky, Andrew

2014-01-01

In experimental laboratory studies we evaluate a possibility of making electrical wires from living plants. In scoping experiments we use lettuce seedlings as a prototype model of a plant wire. We approximate an electrical potential transfer function by applying direct current voltage to the lettuce seedlings and recording output voltage. We analyse oscillation frequencies of the output potential and assess noise immunity of the plant wires. Our findings will be used in future designs of self...

Red-cockaded woodpecker cavity tree resin avoidance by southern flying squirrels

Science.gov (United States)

Richard R. Schaefer; Daniel Saenz

1998-01-01

While examining red-cockaded woodpecker (Picoides borealis) cavity contents in eastern Texas, the authors observed cavity tree resin avoidance by southern flying squirrels (Glaucomys volans). The tree surface around an active red-cockaded woodpecker cavity is coated with sticky resin which flows from resin wells created by the woodpecker. The southern flying squirrel...

Reduction of Gas Bubbles and Improved Critical Current Density in Bi-2212 Round Wire by Swaging

CERN Document Server

Jiang, J; Huang, Y; Hong, S; Parrell, J; Scheuerlein, C; Di Michiel, M; Ghosh, A; Trociewitz, U; Hellstrom, E; Larbalestier, D

2013-01-01

Bi-2212 round wire is made by the powder-in-tube technique. An unavoidable property of powder-in-tube conductors is that there is about 30% void space in the as-drawn wire. We have recently shown that the gas present in the as-drawn Bi-2212 wire agglomerates into large bubbles and that they are presently the most deleterious current limiting mechanism. By densifying short 2212 wires before reaction through cold isostatic pressing (CIPping), the void space was almost removed and the gas bubble density was reduced significantly, resulting in a doubled engineering critical current density (JE) of 810 A/mm2 at 5 T, 4.2 K. Here we report on densifying Bi-2212 wire by swaging, which increased JE (4.2 K, 5 T) from 486 A/mm2 for as-drawn wire to 808 A/mm2 for swaged wire. This result further confirms that enhancing the filament packing density is of great importance for making major JE improvement in this round-wire magnet conductor.

Corrosion of Wires on Wooden Wire-Bound Packaging Crates

Science.gov (United States)

Samuel L. Zelinka; Stan Lebow

2015-01-01

Wire-bound packaging crates are used by the US Army to transport materials. Because these crates may be exposed to harsh environments, they are dip-treated with a wood preservative (biocide treatment). For many years, zinc-naphthenate was the most commonly used preservative for these packaging crates and few corrosion problems with the wires were observed. Recently,...

Fluorescence enhancement upon G-quadruplex folding: synthesis, structure, and biophysical characterization of a dansyl/cyclodextrin-tagged thrombin binding aptamer.

Science.gov (United States)

De Tito, Stefano; Morvan, François; Meyer, Albert; Vasseur, Jean-Jacques; Cummaro, Annunziata; Petraccone, Luigi; Pagano, Bruno; Novellino, Ettore; Randazzo, Antonio; Giancola, Concetta; Montesarchio, Daniela

2013-11-20

A novel fluorescent thrombin binding aptamer (TBA), conjugated with the environmentally sensitive dansyl probe at the 3'-end and a β-cyclodextrin residue at the 5'-end, has been efficiently synthesized exploiting Cu(I)-catalyzed azide-alkyne cycloaddition procedures. Its conformation and stability in solution have been studied by an integrated approach, combining in-depth NMR, CD, fluorescence, and DSC studies. ITC measurements have allowed us to analyze in detail its interaction with human thrombin. All the collected data show that this bis-conjugated aptamer fully retains its G-quadruplex formation ability and thrombin recognition properties, with the terminal appendages only marginally interfering with the conformational behavior of TBA. Folding of this modified aptamer into the chairlike, antiparallel G-quadruplex structure, promoted by K(+) and/or thrombin binding, typical of TBA, is associated with a net fluorescence enhancement, due to encapsulation of dansyl, attached at the 3'-end, into the apolar cavity of the β-cyclodextrin at the 5'-end. Overall, the structural characterization of this novel, bis-conjugated TBA fully demonstrates its potential as a diagnostic tool for thrombin recognition, also providing a useful basis for the design of suitable aptamer-based devices for theranostic applications, allowing simultaneously both detection and inhibition or modulation of the thrombin activity.

DNA adducts of antitumor cisplatin preclude telomeric sequences from forming G quadruplexes

Czech Academy of Sciences Publication Activity Database

Heringová, Pavla; Kašpárková, Jana; Brabec, Viktor

2009-01-01

Roč. 14, č. 6 (2009), s. 959-968 ISSN 0949-8257 R&D Projects: GA MZd(CZ) NR8562; GA MŠk(CZ) LC06030; GA MŠk(CZ) ME08017; GA MŠk(CZ) OC08003; GA AV ČR(CZ) 1QS500040581; GA AV ČR(CZ) KAN200200651; GA AV ČR(CZ) IAA400040803 Grant - others:GA MŠk(CZ) OC09018 Institutional research plan: CEZ:AV0Z50040507; CEZ:AV0Z50040702 Keywords : cisplatin * DNA quadruplex * telomere Subject RIV: BO - Biophysics Impact factor: 3.415, year: 2009

NASA/RAE collaboration on nonlinear control using the F-8C digital fly-by-wire aircraft

Science.gov (United States)

Butler, G. F.; Corbin, M. J.; Mepham, S.; Stewart, J. F.; Larson, R. R.

1983-01-01

Design procedures are reviewed for variable integral control to optimize response (VICTOR) algorithms and results of preliminary flight tests are presented. The F-8C aircraft is operated in the remotely augmented vehicle (RAV) mode, with the control laws implemented as FORTRAN programs on a ground-based computer. Pilot commands and sensor information are telemetered to the ground, where the data are processed to form surface commands which are then telemetered back to the aircraft. The RAV mode represents a singlestring (simplex) system and is therefore vulnerable to a hardover since comparison monitoring is not possible. Hence, extensive error checking is conducted on both the ground and airborne computers to prevent the development of potentially hazardous situations. Experience with the RAV monitoring and validation procedures is described.

Improvement of cold wire drawing process by electropulsing

OpenAIRE

Sánchez Egea, Antonio José; González Rojas, Hernan Alberto; Jorba Peiró, Jordi

2015-01-01

The electroplastic effects on wire drawing process assisted with different short time current pulses configurations are investigated experimentally. The current pulses were induced to a specimen during the drawing process. The studied material is the 308L stainless steel. Current densities of 185 A/mm2, frequencies range from 140 to 350 Hz and pulse duration range from 100 to 250 μs were used in the electrically‐assisted wire drawing process. Frequency and pulse duration are...

Evaluation of surface roughness of orthodontic wires by means of atomic force microscopy.

Science.gov (United States)

D'Antò, Vincenzo; Rongo, Roberto; Ametrano, Gianluca; Spagnuolo, Gianrico; Manzo, Paolo; Martina, Roberto; Paduano, Sergio; Valletta, Rosa

2012-09-01

To compare the surface roughness of different orthodontic archwires. Four nickel-titanium wires (Sentalloy(®), Sentalloy(®) High Aesthetic, Titanium Memory ThermaTi Lite(®), and Titanium Memory Esthetic(®)), three β-titanium wires (TMA(®), Colored TMA(®), and Beta Titanium(®)), and one stainless-steel wire (Stainless Steel(®)) were considered for this study. Three samples for each wire were analyzed by atomic force microscopy (AFM). Three-dimensional images were processed using Gwiddion software, and the roughness average (Ra), the root mean square (Rms), and the maximum height (Mh) values of the scanned surface profile were recorded. Statistical analysis was performed by one-way analysis of variance (ANOVA) followed by Tukey's post hoc test (P Sentalloy High Aesthetic was the roughest (Ra  =  133.5 ± 10.8; Rms  =  165.8 ± 9.8; Mh  =  949.6 ± 192.1) of the archwires. The surface quality of the wires investigated differed significantly. Ion implantation effectively reduced the roughness of TMA. Moreover, Teflon(®)-coated Titanium Memory Esthetic was less rough than was ion-implanted Sentalloy High Aesthetic.

Mercury release from fly ashes and hydrated fly ash cement pastes

Science.gov (United States)

Du, Wen; Zhang, Chao-yang; Kong, Xiang-ming; Zhuo, Yu-qun; Zhu, Zhen-wu

2018-04-01

The large-scale usage of fly ash in cement and concrete introduces mercury (Hg) into concrete structures and a risk of secondary emission of Hg from the structures during long-term service was evaluated. Three fly ashes were collected from coal-fired power plants and three blend cements were prepared by mixing Ordinary Portland cement (OPC) with the same amount of fly ash. The releasing behaviors of Hg0 from the fly ash and the powdered hydrated cement pastes (HCP) were measured by a self-developed Hg measurement system, where an air-blowing part and Hg collection part were involved. The Hg release of fly ashes at room temperature varied from 25.84 to 39.69 ng/g fly ash during 90-days period of air-blowing experiment. In contrast, the Hg release of the HCPs were in a range of 8.51-18.48 ng/g HCP. It is found that the Hg release ratios of HCPs were almost the same as those of the pure fly ashes, suggesting that the hydration products of the HCP have little immobilization effect on Hg0. Increasing temperature and moisture content markedly promote the Hg release.

Digitization of radiographic inspection for pipeline girth welded joints

International Nuclear Information System (INIS)

Uemura, Shimpei

2016-01-01

In radiographic inspection for the girth welded joints of natural gas pipeline, film radiographic testing (FRT) is applied presently in Japan. However, as of July 2016, the work of establishing JIS standard for radiographic inspection with digital detector is in progress. In order to provide users with the merit of digitization as soon as possible, the authors have developed NSDART (Nittetsu-Sumikin digital detector array technology) as a field X-ray inspection system for the girth welded joints of pipeline. This paper reports the required performances discussed in face of development of NSDART, selection of digital detector, and outline of NSDART, and shows part of the radiographic images acquired with NSDART. As required performances, the following were established: (1) required image quality for radiographic image, (2) identifiable minimum wire diameter of transmission meter, (3) density range of radiographic image and value of gradation meter, (4) spatial resolution via Duplex Wire, (5) X-ray generator, (6) real time performance, and (7) display for observing radiographic image. As for the selection of digital detector, flat panel detector was judged to be the most suitable, and its incorporation to NSDART was determined. NSDART devices are composed of a magnet-wheeled self-propelled imaging device, personal computer, controller, and externally installed display for judgment. (A.O.)

DNA secondary structures: stability and function of G-quadruplex structures

Science.gov (United States)

Bochman, Matthew L.; Paeschke, Katrin; Zakian, Virginia A.

2013-01-01

In addition to the canonical double helix, DNA can fold into various other inter- and intramolecular secondary structures. Although many such structures were long thought to be in vitro artefacts, bioinformatics demonstrates that DNA sequences capable of forming these structures are conserved throughout evolution, suggesting the existence of non-B-form DNA in vivo. In addition, genes whose products promote formation or resolution of these structures are found in diverse organisms, and a growing body of work suggests that the resolution of DNA secondary structures is critical for genome integrity. This Review focuses on emerging evidence relating to the characteristics of G-quadruplex structures and the possible influence of such structures on genomic stability and cellular processes, such as transcription. PMID:23032257

G-Quadruplexes influence pri-microRNA processing.

Science.gov (United States)

Rouleau, Samuel G; Garant, Jean-Michel; Bolduc, François; Bisaillon, Martin; Perreault, Jean-Pierre

2018-02-01

RNA G-Quadruplexes (G4) have been shown to possess many biological functions, including the regulation of microRNA (miRNA) biogenesis and function. However, their impact on pri-miRNA processing remains unknown. We identified G4 located near the Drosha cleavage site in three distinct pri-miRNAs: pri-mir200c, pri-mir451a, and pri-mir497. The folding of the potential G4 motifs was determined in solution. Subsequently, mutations disrupting G4 folding led to important changes in the mature miRNAs levels in cells. Moreover, using small antisense oligonucleotides binding to the pri-miRNA, it was possible to modulate, either positively or negatively, the mature miRNA levels. Together, these data demonstrate that G4 motifs could contribute to the regulation of pri-mRNA processing, a novel role for G4. Considering that bio-informatics screening indicates that between 9% and 50% of all pri-miRNAs contain a putative G4, these structures possess interesting potential as future therapeutic targets.

Narrow, highly P-doped, planar wires in silicon created by scanning probe microscopy

Energy Technology Data Exchange (ETDEWEB)

Ruess, F J [Australian Research Council Centre of Excellence for Quantum Computer Technology, University of New South Wales, Sydney, NSW 2052 (Australia); Goh, K E J [Australian Research Council Centre of Excellence for Quantum Computer Technology, University of New South Wales, Sydney, NSW 2052 (Australia); Butcher, M J [School of Physics, University of New South Wales, Sydney, NSW 2052 (Australia); Reusch, T C G [Australian Research Council Centre of Excellence for Quantum Computer Technology, University of New South Wales, Sydney, NSW 2052 (Australia); Oberbeck, L [Australian Research Council Centre of Excellence for Quantum Computer Technology, University of New South Wales, Sydney, NSW 2052 (Australia); Weber, B [School of Physics, University of New South Wales, Sydney, NSW 2052 (Australia); Hamilton, A R [School of Physics, University of New South Wales, Sydney, NSW 2052 (Australia); Simmons, M Y [Australian Research Council Centre of Excellence for Quantum Computer Technology, University of New South Wales, Sydney, NSW 2052 (Australia)

2007-01-31

We demonstrate the use of a scanning tunnelling microscope (STM) to pattern buried, highly planar phosphorus-doped silicon wires with widths down to the sub-10 nm level. We confirm the structural integrity of these wires using both buried dopant imaging techniques and ex situ electrical characterization. Four terminal I-V characteristics at 4 K show ohmic behaviour for all wires with resistivities between 1 and 24 x 10{sup -8} {omega} cm. Magnetotransport measurements reveal that conduction is dominated by disordered scattering with quantum corrections consistent with 2D weak localization theory. Our results show that these quantum corrections become more pronounced as the electron phase coherence length approaches the width of the wire.

A high extinction ratio THz polarizer fabricated by double-bilayer wire grid structure

Science.gov (United States)

Lu, Bin; Wang, Haitao; Shen, Jun; Yang, Jun; Mao, Hongyan; Xia, Liangping; Zhang, Weiguo; Wang, Guodong; Peng, Xiao-Yu; Wang, Deqiang

2016-02-01

We designed a new style of broadband terahertz (THz) polarizer with double-bilayer wire grid structure by fabricating them on both sides of silicon substrate. This THz polarizer shows a high average extinction ratio of 60dB in 0.5 to 2.0 THz frequency range and the maximum of 87 dB at 1.06 THz, which is much higher than that of conventional monolayer wire grid polarizers and single-bilayer wire grid ones.

A high extinction ratio THz polarizer fabricated by double-bilayer wire grid structure

Directory of Open Access Journals (Sweden)

Bin Lu

2016-02-01

Full Text Available We designed a new style of broadband terahertz (THz polarizer with double-bilayer wire grid structure by fabricating them on both sides of silicon substrate. This THz polarizer shows a high average extinction ratio of 60dB in 0.5 to 2.0 THz frequency range and the maximum of 87 dB at 1.06 THz, which is much higher than that of conventional monolayer wire grid polarizers and single-bilayer wire grid ones.

Design of Model-based Controller with Disturbance Estimation in Steer-by-wire System

Directory of Open Access Journals (Sweden)

Jung Sanghun

2018-01-01

Full Text Available The steer-by-wire system is a next generation steering control technology that has been actively studied because it has many advantages such as fast response, space efficiency due to removal of redundant mechanical elements, and high connectivity with vehicle chassis control, such as active steering. Steer-by-wire system has disturbance composed of tire friction torque and self-aligning torque. These disturbances vary widely due to the weight or friction coefficient change. Therefore, disturbance compensation logic is strongly required to obtain desired performance. This paper proposes model-based controller with disturbance compensation to achieve the robust control performance. Targeted steer-by-wire system is identified through the experiment and system identification method. Moreover, model-based controller is designed using the identified plant model. Disturbance of targeted steer-by-wire is estimated using disturbance observer(DOB, and compensate the estimated disturbance into control input. Experiment of various scenarios are conducted to validate the robust performance of proposed model-based controller.

Removal of metallic ions from aqueous solutions by fluidized bed fly ashes

Energy Technology Data Exchange (ETDEWEB)

Rio, S.; Delebarre, A.; Hequet, V. [Ecole des Mines de Nantes, 44 - Nantes (France); Blondin, J. [Cerchar 62 - Mazingarbe (France)

2001-07-01

One of the main constraints deriving from the generation of power by coal combustion is to find some use for the fly ashes instead of disposing of them. Fly ashes from two fluidized bed power plants were tested to remove Pb{sup 2+}, Cu{sup 2+}, Cr (III), Ni{sup 2+}, Zn{sup 2+} and Cr (VI) from aqueous solutions. Experimental design methodology was used to study the removal and the leaching as a function of (i) the water pollutant content, (ii) the metal concentration in water, (iii) the pH of the solution and (iv) the addition of lime to fly ashes. The results show that the percentage of adsorbed ions was more important when they were in contact with silico-aluminous fly ashes than sulfo-calcic fly ashes, except in the case of the ion Ni{sup 2+}. The removal of metallic ions increases with increasing pH. The metallic canons removal accounting for the leaching test was higher when lime was added to silico-aluminous fly ashes during the adsorption. (authors)

Label-Free and Ultrasensitive Biomolecule Detection Based on Aggregation Induced Emission Fluorogen via Target-Triggered Hemin/G-Quadruplex-Catalyzed Oxidation Reaction.

Science.gov (United States)

Li, Haiyin; Chang, Jiafu; Gai, Panpan; Li, Feng

2018-02-07

Fluorescence biosensing strategy has drawn substantial attention due to their advantages of simplicity, convenience, sensitivity, and selectivity, but unsatisfactory structure stability, low fluorescence quantum yield, high cost of labeling, and strict reaction conditions associated with current fluorescence methods severely prohibit their potential application. To address these challenges, we herein propose an ultrasensitive label-free fluorescence biosensor by integrating hemin/G-quadruplex-catalyzed oxidation reaction with aggregation induced emission (AIE) fluorogen-based system. l-Cysteine/TPE-M, which is carefully and elaborately designed and developed, obviously contributes to strong fluorescence emission. In the presence of G-rich DNA along with K + and hemin, efficient destruction of l-cysteine occurs due to hemin/G-quadruplex-catalyzed oxidation reactions. As a result, highly sensitive fluorescence detection of G-rich DNA is readily realized, with a detection limit down to 33 pM. As a validation for the further development of the proposed strategy, we also successfully construct ultrasensitive platforms for microRNA by incorporating the l-cysteine/TPE-M system with target-triggered cyclic amplification reaction. Thus, this proposed strategy is anticipated to find use in basic biochemical research and clinical diagnosis.

Audio wiring guide how to wire the most popular audio and video connectors

CERN Document Server

Hechtman, John

2012-01-01

Whether you're a pro or an amateur, a musician or into multimedia, you can't afford to guess about audio wiring. The Audio Wiring Guide is a comprehensive, easy-to-use guide that explains exactly what you need to know. No matter the size of your wiring project or installation, this handy tool provides you with the essential information you need and the techniques to use it. Using The Audio Wiring Guide is like having an expert at your side. By following the clear, step-by-step directions, you can do professional-level work at a fraction of the cost.

Measurement of wire deflection on loading may indicate union in Ilizarov constructs, an in vitro model.

Science.gov (United States)

Lineham, Beth; Stewart, Todd; Harwood, Paul

2018-02-02

No entirely reliable method exists for assessing union during Ilizarov treatment. Premature removal results in potential treatment failure; hence, alternative methods warrant investigation. Wire deflection might provide an indication of fracture site deformation on weight bearing, indicating progress towards union. This study aimed to test a method for assessing wire deflection within an Ilizarov frame. (1) To assess the repeatability of our novel measurement method in measuring wire deflection within an Ilizarov frame in vitro. (2) To compare the amount of wire deflection in an unstable model with that in an intact bone model. (3) To assess accuracy of this method by comparing wire deflection measured with overall machine extension. Tests were performed on clinical grade-tensioned fine wire 4-ring Ilizarov constructs stabilising a simulated fracture, with and without an unstable defect. Models were sequentially loaded to 700 N using an Instron testing machine. A digital depth gauge attached to the superior ring measured relative wire displacement at the ring closest to the fracture. Tests were repeated 3 times. (1) Both unstable and stable bone models produced highly repeatable load deformation curves (R 2  = 0.98 and 0.99). (2) In the unstable model, wires tensioned at 882 and 1274 N produced mean maximum deflections of 2.41 and 2.69 mm compared with 0.05 and 0.04 mm in the intact bone model (significant p measurable difference in wire deflection between stable and unstable situations exists using this method which appears accurate and repeatable, with clear correlation between displacement and load and displacement and machine extension. This approach might be clinically applicable, and further clinical testing is required.

Digital bus technology in new coal-fired plants

Energy Technology Data Exchange (ETDEWEB)

Blaney, J.; Murray, J. [Emerson Process Management (United States)

2007-10-15

The main issues associated with including digital bus technology such as Foundation fieldbus, Profibus-DP or DeviceNet, in a coal-fired power plant are deciding which systems to install and determining how to implement it. Although still new, digital bus experiences to date have shown that the technology performs solidly and when wiring best practices are followed a significantly shorted commissioning cycle can be achieved. 1 fig., 2 tabs.

A study on direct alloying with molybdenum oxides by feed wire method

Directory of Open Access Journals (Sweden)

Jingjing Zou

2018-04-01

Full Text Available Direct alloying with molybdenum oxides has been regarded in years; the main addition methods are adding to the bottom of electric arc furnace (EAF with scrap, adding to the ladle during the converter tapping and mixing molybdenum oxide, lime and reductant to prepare pellet added to basic oxygen furnace (BOF. In this paper, a new method for direct alloying with molybdenum trioxide is proposed, adding molybdenum trioxide molten steel by feeding wire method in ladle furnace (LF refining process. The feasibility of molybdenum oxide reduction, the influence rules of bottom-blown on liquid steel fluidity and the yield of molybdenum by feeding wire method were analyzed. Results show that molybdenum oxide can be reduced by [Al], [Si], [C], and even [Fe] in molten steel. Bottom blowing position has a significant influence on the flow of molten steel when the permeable brick is located in 1/2 radius. The yields of Mo are higher than 97% for the experiments with feed wire method, the implementation of direct alloying with molybdenum trioxide by feed wire method works even better than that uses of ferromolybdenum in the traditional process.

Multisensory integration for odor tracking by flying Drosophila: Behavior, circuits and speculation

OpenAIRE

Duistermars, Brian J; Frye, Mark A

2010-01-01

Many see fruit flies as an annoyance, invading our homes with a nagging persistence and efficiency. Yet from a scientific perspective, these tiny animals are a wonder of multisensory integration, capable of tracking fragmented odor plumes amidst turbulent winds and constantly varying visual conditions. The peripheral olfactory, mechanosensory, and visual systems of the fruit fly, Drosophila melanogaster, have been studied in great detail;1–4 however, the mechanisms by which fly brains integra...

Tetrahelical structural family adopted by AGCGA-rich regulatory DNA regions

Science.gov (United States)

Kocman, Vojč; Plavec, Janez

2017-05-01

Here we describe AGCGA-quadruplexes, an unexpected addition to the well-known tetrahelical families, G-quadruplexes and i-motifs, that have been a focus of intense research due to their potential biological impact in G- and C-rich DNA regions, respectively. High-resolution structures determined by solution-state nuclear magnetic resonance (NMR) spectroscopy demonstrate that AGCGA-quadruplexes comprise four 5'-AGCGA-3' tracts and are stabilized by G-A and G-C base pairs forming GAGA- and GCGC-quartets, respectively. Residues in the core of the structure are connected with edge-type loops. Sequences of alternating 5'-AGCGA-3' and 5'-GGG-3' repeats could be expected to form G-quadruplexes, but are shown herein to form AGCGA-quadruplexes instead. Unique structural features of AGCGA-quadruplexes together with lower sensitivity to cation and pH variation imply their potential biological relevance in regulatory regions of genes responsible for basic cellular processes that are related to neurological disorders, cancer and abnormalities in bone and cartilage development.

Wire chambers: Trends and alternatives

Energy Technology Data Exchange (ETDEWEB)

Regler, Meinhard

1992-05-15

The subtitle of this year's Vienna Wire Chamber Conference - 'Recent Trends and Alternative Techniques' - signalled that it covered a wide range of science and technology. While an opening Vienna talk by wire chamber pioneer Georges Charpak many years ago began 'Les funerailles des chambres a fils (the burial of wire chambers)', the contrary feeling this year was that wire chambers are very much alive!.

The onion fly

International Nuclear Information System (INIS)

Loosjes, M.

1990-01-01

This paper describes the origin, practical application, problems in application and prospects of control of the onion fly, Delia antiqua (Diptera: Anthomyiidae), in the Netherlands by the Sterile Insect Technique (SIT). The larva of the onion fly is a severe pest in onions in temperate regions. Development of resistance of the onion fly against insecticides caused research on the SIT to be started by the Dutch Government in 1965. This research was on mass-rearing, long-term storage of pupae, sterilization, and release and ratio assessment techniques. By 1979 sufficient information had been turned over to any interested private company. In the case of the onion fly the SIT can be applied like a control treatment instead of chemical control to individual onion fields. This is due to the limited dispersal activity of the flies and the scattered distribution of onion fields in the Netherlands, with 5-10% of the onion growing areas planted with onions

Effect of discrete wires on the implosion dynamics of wire array Z pinches

International Nuclear Information System (INIS)

Lebedev, S. V.; Beg, F. N.; Bland, S. N.; Chittenden, J. P.; Dangor, A. E.; Haines, M. G.; Kwek, K. H.; Pikuz, S. A.; Shelkovenko, T. A.

2001-01-01

A phenomenological model of wire array Z-pinch implosions, based on the analysis of experimental data obtained on the mega-ampere generator for plasma implosion experiments (MAGPIE) generator [I. H. Mitchell , Rev. Sci. Instrum. 67, 1533 (1996)], is described. The data show that during the first ∼80% of the implosion the wire cores remain stationary in their initial positions, while the coronal plasma is continuously jetting from the wire cores to the array axis. This phase ends by the formation of gaps in the wire cores, which occurs due to the nonuniformity of the ablation rate along the wires. The final phase of the implosion starting at this time occurs as a rapid snowplow-like implosion of the radially distributed precursor plasma, previously injected in the interior of the array. The density distribution of the precursor plasma, being peaked on the array axis, could be a key factor providing stability of the wire array implosions operating in the regime of discrete wires. The modified ''initial'' conditions for simulations of wire array Z-pinch implosions with one-dimension (1D) and two-dimensions (2D) in the r--z plane, radiation-magnetohydrodynamic (MHD) codes, and a possible scaling to a larger drive current are discussed

Tetrasubstituted phenanthrolines as highly potent, water-soluble, and selective g-quadruplex ligands

DEFF Research Database (Denmark)

Larsen, Anders Foller; Nielsen, Mads Corvinius; Ulven, Trond

2012-01-01

Small molecules capable of stabilizing the G-quadruplex (G4) structure are of interest for the development of improved anticancer drugs. Novel 4,7-diamino-substituted 1,10-phenanthroline-2,9-dicarboxamides that represent hybrid structures of known phenanthroline-based ligands have been designed....... An efficient synthetic route to the compounds has been developed and their interactions with various G4 sequences have been evaluated by Förster resonance energy transfer (FRET) melting assays, fluorescent intercalator displacement (FID), electrospray ionization mass spectrometry (ESI-MS), and circular...... dichroism (CD) spectroscopy. The preferred compounds have high aqueous solubility and are strong and potent G4 binders with a high selectivity over duplex DNA; thus, they represent a significant improvement over the lead compounds. Two of the compounds are inhibitors of HeLa and HT1080 cell proliferation....

TMPyP4 porphyrin distorts RNA G-quadruplex structures of the disease-associated r(GGGGCC)n repeat of the C9orf72 gene and blocks interaction of RNA-binding proteins.

Science.gov (United States)

Zamiri, Bita; Reddy, Kaalak; Macgregor, Robert B; Pearson, Christopher E

2014-02-21

Certain DNA and RNA sequences can form G-quadruplexes, which can affect genetic instability, promoter activity, RNA splicing, RNA stability, and neurite mRNA localization. Amyotrophic lateral sclerosis and frontotemporal dementia can be caused by expansion of a (GGGGCC)n repeat in the C9orf72 gene. Mutant r(GGGGCC)n- and r(GGCCCC)n-containing transcripts aggregate in nuclear foci, possibly sequestering repeat-binding proteins such as ASF/SF2 and hnRNPA1, suggesting a toxic RNA pathogenesis, as occurs in myotonic dystrophy. Furthermore, the C9orf72 repeat RNA was recently demonstrated to undergo the noncanonical repeat-associated non-AUG translation (RAN translation) into pathologic dipeptide repeats in patient brains, a process that is thought to depend upon RNA structure. We previously demonstrated that the r(GGGGCC)n RNA forms repeat tract length-dependent G-quadruplex structures that bind the ASF/SF2 protein. Here we show that the cationic porphyrin (5,10,15,20-tetra(N-methyl-4-pyridyl) porphyrin (TMPyP4)), which can bind some G-quadruplex-forming sequences, can bind and distort the G-quadruplex formed by r(GGGGCC)8, and this ablates the interaction of either hnRNPA1 or ASF/SF2 with the repeat. These findings provide proof of concept that nucleic acid binding small molecules, such as TMPyP4, can distort the secondary structure of the C9orf72 repeat, which may beneficially disrupt protein interactions, which may ablate either protein sequestration and/or RAN translation into potentially toxic dipeptides. Disruption of secondary structure formation of the C9orf72 RNA repeats may be a viable therapeutic avenue, as well as a means to test the role of RNA structure upon RAN translation.

Evaluation of mechanical properties of steel wire ropes by statistical methods

Directory of Open Access Journals (Sweden)

Boroška Ján

1999-12-01

Full Text Available The contribution deals with the evaluation of mechanical properties of steel wire ropes using statistical methods from the viewpoint of the quality of single wires as well as the internal construction of the wire ropes. The evaluation is based on the loading capacity calculated from the strength, number of folds and torsions. For the better ilustration, a box plot has been constructed.

Wire chambers: Trends and alternatives

International Nuclear Information System (INIS)

Regler, Meinhard

1992-01-01

The subtitle of this year's Vienna Wire Chamber Conference - 'Recent Trends and Alternative Techniques' - signalled that it covered a wide range of science and technology. While an opening Vienna talk by wire chamber pioneer Georges Charpak many years ago began 'Les funerailles des chambres a fils (the burial of wire chambers)', the contrary feeling this year was that wire chambers are very much alive!

[XPS analysis of beads formed by fuse breaking of electric copper wire].

Science.gov (United States)

Wu, Ying; Meng, Qing-Shan; Wang, Xin-Ming; Gao, Wei; Di, Man

2010-05-01

The in-depth composition of beads formed by fuse breaking of the electric copper wire in different circumstances was studied by XPS with Ar+ ion sputtering. In addition, the measured Auger spectra and the calculated Auger parameters were compared for differentiation of the substances of Cu and Cu2O. Corresponding to the sputtering depth, the molten product on a bead induced directly by fuse breaking of the copper wire without cover may be distinguished as three portions: surface layer with a drastic decrease in carbon content; intermediate layer with a gentle change in oxygen content and gradually diminished carbon peak, and consisting of Cu2O; transition layer without Cu2O and with a rapid decrease in oxygen content. While the molten product on a bead formed by fuse breaking of the copper wire after its insulating cover had been burned out may be distinguished as two portions: surface layer with carbon content decreasing quickly; subsurface layer without Cu2O and with carbon and oxygen content decreasing gradually. Thus, it can be seen that there was an obvious interface between the layered surface product and the substrate for the first type of bead, while as to the second type of bead there was no interface. As a result, the presence of Cu2O and the quantitative results can be used to identify the molten product on a bead induced directly by fuse breaking of the copper wire without cover and the molten product on a bead formed by fuse breaking of the cupper wire after its insulating cover had been burned out, as a complementary technique for the judgments of fire cause.

Mercury capture by selected Bulgarian fly ashes: Influence of coal rank and fly ash carbon pore structure on capture efficiency

Science.gov (United States)

Kostova, I.J.; Hower, J.C.; Mastalerz, Maria; Vassilev, S.V.

2011-01-01

Mercury capture by fly ash C was investigated at five lignite- and subbituminous-coal-burning Bulgarian power plants (Republika, Bobov Dol, Maritza East 2, Maritza East 3, and Sliven). Although the C content of the ashes is low, never exceeding 1.6%, the Hg capture on a unit C basis demonstrates that the low-rank-coal-derived fly ash carbons are more efficient in capturing Hg than fly ash carbons from bituminous-fired power plants. While some low-C and low-Hg fly ashes do not reveal any trends of Hg versus C, the 2nd and, in particular, the 3rd electrostatic precipitator (ESP) rows at the Republika power plant do have sufficient fly ash C range and experience flue gas sufficiently cool to capture measurable amounts of Hg. The Republika 3rd ESP row exhibits an increase in Hg with increasing C, as observed in other power plants, for example, in Kentucky power plants burning Appalachian-sourced bituminous coals. Mercury/C decreases with an increase in fly ash C, suggesting that some of the C is isolated from the flue gas stream and does not contribute to Hg capture. Mercury capture increases with an increase in Brunauer-Emmett-Teller (BET) surface area and micropore surface area. The differences in Hg capture between the Bulgarian plants burning low-rank coal and high volatile bituminous-fed Kentucky power plants suggests that the variations in C forms resulting from the combustion of the different ranks also influence the efficiency of Hg capture. ?? 2010 Elsevier Ltd.

Mercury capture by selected Bulgarian fly ashes: Influence of coal rank and fly ash carbon pore structure on capture efficiency

Energy Technology Data Exchange (ETDEWEB)

Kostova, I.J.; Hower, J.C.; Mastalerz, M.; Vassilev, S.V. [University of Kentucky, Lexington, KY (United States). Center of Applied Energy Research

2011-01-15

Mercury capture by fly ash C was investigated at five lignite- and subbituminous-coal-burning Bulgarian power plants (Republika, Bobov Dol, Maritza East 2, Maritza East 3, and Sliven). Although the C content of the ashes is low, never exceeding 1.6%, the Hg capture on a unit C basis demonstrates that the low-rank-coal-derived fly ash carbons are more efficient in capturing Hg than fly ash carbons from bituminous-fired power plants. While some low-C and low-Hg fly ashes do not reveal any trends of Hg versus C, the 2nd and, in particular, the 3rd electrostatic precipitator (ESP) rows at the Republika power plant do have sufficient fly ash C range and experience flue gas sufficiently cool to capture measurable amounts of Hg. The Republika 3rd ESP row exhibits an increase in Hg with increasing C, as observed in other power plants, for example, in Kentucky power plants burning Appalachian-sourced bituminous coals. Mercury/C decreases with an increase in fly ash C, suggesting that some of the C is isolated from the flue gas stream and does not contribute to Hg capture. Mercury capture increases with an increase in Brunauer-Emmett-Teller (BET) surface area and micropore surface area. The differences in Hg capture between the Bulgarian plants burning low-rank coal and high volatile bituminous-fed Kentucky power plants suggests that the variations in C forms resulting from the combustion of the different ranks also influence the efficiency of Hg capture.

Natural infection of the sand fly Phlebotomus kazeruni by Trypanosoma species in Pakistan

Directory of Open Access Journals (Sweden)

Iwata Hiroyuki

2010-02-01

Full Text Available Abstract The natural infection of phlebotomine sand flies by Leishmania parasites was surveyed in a desert area of Pakistan where cutaneous leishmaniasis is endemic. Out of 220 female sand flies dissected, one sand fly, Phlebotomus kazeruni, was positive for flagellates in the hindgut. Analyses of cytochrome b (cyt b, glycosomal glyceraldehyde phosphate dehydrogenase (gGAPDH and small subunit ribosomal RNA (SSU rRNA gene sequences identified the parasite as a Trypanosoma species of probably a reptile or amphibian. This is the first report of phlebotomine sand flies naturally infected with a Trypanosoma species in Pakistan. The possible infection of sand flies with Trypanosoma species should be taken into consideration in epidemiological studies of vector species in areas where leishmaniasis is endemic.

1 mil gold bond wire study.

Energy Technology Data Exchange (ETDEWEB)

Huff, Johnathon; McLean, Michael B.; Jenkins, Mark W.; Rutherford, Brian Milne

2013-05-01

In microcircuit fabrication, the diameter and length of a bond wire have been shown to both affect the current versus fusing time ratio of a bond wire as well as the gap length of the fused wire. This study investigated the impact of current level on the time-to-open and gap length of 1 mil by 60 mil gold bond wires. During the experiments, constant current was provided for a control set of bond wires for 250ms, 410ms and until the wire fused; non-destructively pull-tested wires for 250ms; and notched wires. The key findings were that as the current increases, the gap length increases and 73% of the bond wires will fuse at 1.8A, and 100% of the wires fuse at 1.9A within 60ms. Due to the limited scope of experiments and limited data analyzed, further investigation is encouraged to confirm these observations.

49 CFR 236.74 - Protection of insulated wire; splice in underground wire.

Science.gov (United States)

2010-10-01

... underground wire. 236.74 Section 236.74 Transportation Other Regulations Relating to Transportation (Continued) FEDERAL RAILROAD ADMINISTRATION, DEPARTMENT OF TRANSPORTATION RULES, STANDARDS, AND INSTRUCTIONS GOVERNING... wire; splice in underground wire. Insulated wire shall be protected from mechanical injury. The...

49 CFR 234.241 - Protection of insulated wire; splice in underground wire.

Science.gov (United States)

2010-10-01

... underground wire. 234.241 Section 234.241 Transportation Other Regulations Relating to Transportation (Continued) FEDERAL RAILROAD ADMINISTRATION, DEPARTMENT OF TRANSPORTATION GRADE CROSSING SIGNAL SYSTEM SAFETY... of insulated wire; splice in underground wire. Insulated wire shall be protected from mechanical...

G-quadruplex aptamer targeting Protein A and its capability to detect Staphylococcus aureus demonstrated by ELONA.

Science.gov (United States)

Stoltenburg, Regina; Krafčiková, Petra; Víglaský, Viktor; Strehlitz, Beate

2016-09-21

Aptamers for whole cell detection are selected mostly by the Cell-SELEX procedure. Alternatively, the use of specific cell surface epitopes as target during aptamer selections allows the development of aptamers with ability to bind whole cells. In this study, we integrated a formerly selected Protein A-binding aptamer PA#2/8 in an assay format called ELONA (Enzyme-Linked OligoNucleotide Assay) and evaluated the ability of the aptamer to recognise and bind to Staphylococcus aureus presenting Protein A on the cell surface. The full-length aptamer and one of its truncated variants could be demonstrated to specifically bind to Protein A-expressing intact cells of S. aureus, and thus have the potential to expand the portfolio of aptamers that can act as an analytical agent for the specific recognition and rapid detection of the bacterial pathogen. The functionality of the aptamer was found to be based on a very complex, but also highly variable structure. Two structural key elements were identified. The aptamer sequence contains several G-clusters allowing folding into a G-quadruplex structure with the potential of dimeric and multimeric assembly. An inverted repeat able to form an imperfect stem-loop at the 5'-end also contributes essentially to the aptameric function.

Reliability analysis of Airbus A-330 computer flight management system

OpenAIRE

Fajmut, Metod

2010-01-01

Diploma thesis deals with digitized, computerized flight control system »Fly-by-wire« and security aspects of the computer system of an aircraft Airbus A330. As for space and military aircraft structures is also in commercial airplanes, much of the financial contribution devoted to reliability. Conventional aircraft control systems have, and some are still, to rely on mechanical and hydraulic connections between the controls on aircraft operated by the pilot and control surfaces. But newer a...

Diagnostics for exploding wires (abstract)

International Nuclear Information System (INIS)

Moosman, B.; Bystritskii, V.; Wessel, F.J.; Van Drie, A.

1999-01-01

Two diagnostics, capable of imaging fast, high temperature, plasmas were used on exploding wire experiments at UC Irvine. An atmospheric pressure nitrogen laser (λ=337.1 nm) was used to generate simultaneous shadow and shearing interferogram images with a temporal resolution of ∼1 ns and a spatial resolution of 10 μm. An x-ray backlighter imaged the exploding wire 90 degree with respect to the laser and at approximately the same instant in time. The backlighter spatial resolution as determined by geometry and film resolution was 25 μm. Copper wires of diameters (25, 50, and 100 μm) and steel wire d=25 μm were exploded in vacuum (10 -5 Torr) at a maximum current level of 12 kA, by a rectified marx bank at a voltage of 50 kV and a current rise time (quarter period) of 900 ns. Copper wires which were cleaned and then resistively heated under vacuum to incandescence for several hours prior to high current initiation, exhibited greater expansion velocities at peak current than wires which had not been heated prior to discharge. Axial variations on the surface of the wire observed with the laser were found to correlate with bulk axial mass differences from x-ray backlighting. High electron density, measured near the opaque surface of the exploding wire, suggests that much of the current is shunted outward away from the bulk of the wire. copyright 1999 American Institute of Physics

A cycloidal wobble motor driven by shape memory alloy wires

International Nuclear Information System (INIS)

Hwang, Donghyun; Higuchi, Toshiro

2014-01-01

A cycloidal wobble motor driven by shape memory alloy (SMA) wires is proposed. In realizing a motor driving mechanism well known as a type of reduction system, a cycloidal gear mechanism is utilized. It facilitates the achievement of bidirectional continuous rotation with high-torque capability, based on its high efficiency and high reduction ratio. The applied driving mechanism consists of a pin/roller based annular gear as a wobbler, a cycloidal disc as a rotor, and crankshafts to guide the eccentric wobbling motion. The wobbling motion of the annular gear is generated by sequential activation of radially phase-symmetrically placed SMA wires. Consequently the cycloidal disc is rotated by rolling contact based cycloidal gearing between the wobbler and the rotor. In designing the proposed motor, thermomechanical characterization of an SMA wire biased by extension springs is experimentally performed. Then, a simplified geometric model for the motor is devised to conduct theoretical assessment of design parametric effects on structural features and working performance. With consideration of the results from parametric analysis, a functional prototype three-phase motor is fabricated to carry out experimental verification of working performance. The observed experimental results including output torque, rotational speed, bidirectional positioning characteristic, etc obviously demonstrate the practical applicability and potentiality of the wobble motor. (paper)

Wire Scanner Motion Control Card

CERN Document Server

Forde, S E

2006-01-01

Scientists require a certain beam quality produced by the accelerator rings at CERN. The discovery potential of LHC is given by the reachable luminosity at its interaction points. The luminosity is maximized by minimizing the beam size. Therefore an accurate beam size measurement is required for optimizing the luminosity. The wire scanner performs very accurate profile measurements, but as it can not be used at full intensity in the LHC ring, it is used for calibrating other profile monitors. As the current wire scanner system, which is used in the present CERN accelerators, has not been made for the required specification of the LHC, a new design of a wire scanner motion control card is part of the LHC wire scanner project. The main functions of this card are to control the wire scanner motion and to acquire the position of the wire. In case of further upgrades at a later stage, it is required to allow an easy update of the firmware, hence the programmable features of FPGAs will be used for this purpose. The...

Non-Destructive Detection of Wire Rope Discontinuities from Residual Magnetic Field Images Using the Hilbert-Huang Transform and Compressed Sensing

Directory of Open Access Journals (Sweden)

Juwei Zhang

2017-03-01

Full Text Available Electromagnetic methods are commonly employed to detect wire rope discontinuities. However, determining the residual strength of wire rope based on the quantitative recognition of discontinuities remains problematic. We have designed a prototype device based on the residual magnetic field (RMF of ferromagnetic materials, which overcomes the disadvantages associated with in-service inspections, such as large volume, inconvenient operation, low precision, and poor portability by providing a relatively small and lightweight device with improved detection precision. A novel filtering system consisting of the Hilbert-Huang transform and compressed sensing wavelet filtering is presented. Digital image processing was applied to achieve the localization and segmentation of defect RMF images. The statistical texture and invariant moment characteristics of the defect images were extracted as the input of a radial basis function neural network. Experimental results show that the RMF device can detect defects in various types of wire rope and prolong the service life of test equipment by reducing the friction between the detection device and the wire rope by accommodating a high lift-off distance.

Ligand binding to telomeric G-quadruplex DNA investigated by funnel-metadynamics simulations.

Science.gov (United States)

Moraca, Federica; Amato, Jussara; Ortuso, Francesco; Artese, Anna; Pagano, Bruno; Novellino, Ettore; Alcaro, Stefano; Parrinello, Michele; Limongelli, Vittorio

2017-03-14

G-quadruplexes (G4s) are higher-order DNA structures typically present at promoter regions of genes and telomeres. Here, the G4 formation decreases the replicative DNA at each cell cycle, finally leading to apoptosis. The ability to control this mitotic clock, particularly in cancer cells, is fascinating and passes through a rational understanding of the ligand/G4 interaction. We demonstrate that an accurate description of the ligand/G4 binding mechanism is possible using an innovative free-energy method called funnel-metadynamics (FM), which we have recently developed to investigate ligand/protein interaction. Using FM simulations, we have elucidated the binding mechanism of the anticancer alkaloid berberine to the human telomeric G4 ( d [AG 3 (T 2 AG 3 ) 3 ]), computing also the binding free-energy landscape. Two ligand binding modes have been identified as the lowest energy states. Furthermore, we have found prebinding sites, which are preparatory to reach the final binding mode. In our simulations, the ions and the water molecules have been explicitly represented and the energetic contribution of the solvent during ligand binding evaluated. Our theoretical results provide an accurate estimate of the absolute ligand/DNA binding free energy ([Formula: see text] = -10.3 ± 0.5 kcal/mol) that we validated through steady-state fluorescence binding assays. The good agreement between the theoretical and experimental value demonstrates that FM is a most powerful method to investigate ligand/DNA interaction and can be a useful tool for the rational design also of G4 ligands.

Flight test of a resident backup software system

Science.gov (United States)

Deets, Dwain A.; Lock, Wilton P.; Megna, Vincent A.

1987-01-01

A new fault-tolerant system software concept employing the primary digital computers as host for the backup software portion has been implemented and flight tested in the F-8 digital fly-by-wire airplane. The system was implemented in such a way that essentially no transients occurred in transferring from primary to backup software. This was accomplished without a significant increase in the complexity of the backup software. The primary digital system was frame synchronized, which provided several advantages in implementing the resident backup software system. Since the time of the flight tests, two other flight vehicle programs have made a commitment to incorporate resident backup software similar in nature to the system described here.

Charpak hemispherical wire chamber

CERN Multimedia

1970-01-01

pieces. Mesures are of the largest one. Multi-wire detectors contain layers of positively and negatively charged wires enclosed in a chamber full of gas. A charged particle passing through the chamber knocks negatively charged electrons out of atoms in the gas, leaving behind positive ions. The electrons are pulled towards the positively charged wires. They collide with other atoms on the way, producing an avalanche of electrons and ions. The movement of these electrons and ions induces an electric pulse in the wires which is collected by fast electronics. The size of the pulse is proportional to the energy loss of the original particle.

High-Resolution Remotely Sensed Small Target Detection by Imitating Fly Visual Perception Mechanism

Directory of Open Access Journals (Sweden)

Fengchen Huang

2012-01-01

Full Text Available The difficulty and limitation of small target detection methods for high-resolution remote sensing data have been a recent research hot spot. Inspired by the information capture and processing theory of fly visual system, this paper endeavors to construct a characterized model of information perception and make use of the advantages of fast and accurate small target detection under complex varied nature environment. The proposed model forms a theoretical basis of small target detection for high-resolution remote sensing data. After the comparison of prevailing simulation mechanism behind fly visual systems, we propose a fly-imitated visual system method of information processing for high-resolution remote sensing data. A small target detector and corresponding detection algorithm are designed by simulating the mechanism of information acquisition, compression, and fusion of fly visual system and the function of pool cell and the character of nonlinear self-adaption. Experiments verify the feasibility and rationality of the proposed small target detection model and fly-imitated visual perception method.

High-resolution remotely sensed small target detection by imitating fly visual perception mechanism.

Science.gov (United States)

Huang, Fengchen; Xu, Lizhong; Li, Min; Tang, Min

2012-01-01

The difficulty and limitation of small target detection methods for high-resolution remote sensing data have been a recent research hot spot. Inspired by the information capture and processing theory of fly visual system, this paper endeavors to construct a characterized model of information perception and make use of the advantages of fast and accurate small target detection under complex varied nature environment. The proposed model forms a theoretical basis of small target detection for high-resolution remote sensing data. After the comparison of prevailing simulation mechanism behind fly visual systems, we propose a fly-imitated visual system method of information processing for high-resolution remote sensing data. A small target detector and corresponding detection algorithm are designed by simulating the mechanism of information acquisition, compression, and fusion of fly visual system and the function of pool cell and the character of nonlinear self-adaption. Experiments verify the feasibility and rationality of the proposed small target detection model and fly-imitated visual perception method.

Wire-number effects on high-power annular z-pinches and some characteristics at high wire number

Energy Technology Data Exchange (ETDEWEB)

SANFORD,THOMAS W. L.

2000-05-23

Characteristics of annular wire-array z-pinches as a function of wire number and at high wire number are reviewed. The data, taken primarily using aluminum wires on Saturn are comprehensive. The experiments have provided important insights into the features of wire-array dynamics critical for high x-ray power generation, and have initiated a renaissance in z-pinches when high numbers of wires are used. In this regime, for example, radiation environments characteristic of those encountered during the early pulses required for indirect-drive ICF ignition on the NIF have been produced in hohlraums driven by x-rays from a z-pinch, and are commented on here.

Wire-number effects on high-power annular z-pinches and some characteristics at high wire number

International Nuclear Information System (INIS)

SANFORD, THOMAS W. L.

2000-01-01

Characteristics of annular wire-array z-pinches as a function of wire number and at high wire number are reviewed. The data, taken primarily using aluminum wires on Saturn are comprehensive. The experiments have provided important insights into the features of wire-array dynamics critical for high x-ray power generation, and have initiated a renaissance in z-pinches when high numbers of wires are used. In this regime, for example, radiation environments characteristic of those encountered during the early pulses required for indirect-drive ICF ignition on the NIF have been produced in hohlraums driven by x-rays from a z-pinch, and are commented on here

Fly ash carbon passivation

Science.gov (United States)

La Count, Robert B; Baltrus, John P; Kern, Douglas G

2013-05-14

A thermal method to passivate the carbon and/or other components in fly ash significantly decreases adsorption. The passivated carbon remains in the fly ash. Heating the fly ash to about 500 and 800 degrees C. under inert gas conditions sharply decreases the amount of surfactant adsorbed by the fly ash recovered after thermal treatment despite the fact that the carbon content remains in the fly ash. Using oxygen and inert gas mixtures, the present invention shows that a thermal treatment to about 500 degrees C. also sharply decreases the surfactant adsorption of the recovered fly ash even though most of the carbon remains intact. Also, thermal treatment to about 800 degrees C. under these same oxidative conditions shows a sharp decrease in surfactant adsorption of the recovered fly ash due to the fact that the carbon has been removed. This experiment simulates the various "carbon burnout" methods and is not a claim in this method. The present invention provides a thermal method of deactivating high carbon fly ash toward adsorption of AEAs while retaining the fly ash carbon. The fly ash can be used, for example, as a partial Portland cement replacement in air-entrained concrete, in conductive and other concretes, and for other applications.

A principal skeleton algorithm for standardizing confocal images of fruit fly nervous systems

Science.gov (United States)

Qu, Lei; Peng, Hanchuan

2010-01-01

Motivation: The fruit fly (Drosophila melanogaster) is a commonly used model organism in biology. We are currently building a 3D digital atlas of the fruit fly larval nervous system (LNS) based on a large collection of fly larva GAL4 lines, each of which targets a subset of neurons. To achieve such a goal, we need to automatically align a number of high-resolution confocal image stacks of these GAL4 lines. One commonly employed strategy in image pattern registration is to first globally align images using an affine transform, followed by local non-linear warping. Unfortunately, the spatially articulated and often twisted LNS makes it difficult to globally align the images directly using the affine method. In a parallel project to build a 3D digital map of the adult fly ventral nerve cord (VNC), we are confronted with a similar problem. Results: We proposed to standardize a larval image by best aligning its principal skeleton (PS), and thus used this method as an alternative of the usually considered affine alignment. The PS of a shape was defined as a series of connected polylines that spans the entire shape as broadly as possible, but with the shortest overall length. We developed an automatic PS detection algorithm to robustly detect the PS from an image. Then for a pair of larval images, we designed an automatic image registration method to align their PSs and the entire images simultaneously. Our experimental results on both simulated images and real datasets showed that our method does not only produce satisfactory results for real confocal larval images, but also perform robustly and consistently when there is a lot of noise in the data. We also applied this method successfully to confocal images of some other patterns such as the adult fruit fly VNC and center brain, which have more complicated PS. This demonstrates the flexibility and extensibility of our method. Availability: The supplementary movies, full size figures, test data, software, and tutorial on

Investigation of nocturnal oviposition by necrophilous flies in central Texas.

Science.gov (United States)

Baldridge, Robert S; Wallace, Susan G; Kirkpatrick, Ryan

2006-01-01

The need to accurately estimate the postmortem interval (PMI) has prompted research into factors affecting fly oviposition (i.e., oviposition and/or larviposition) on a corpse. Research efforts have focused on whether or not diurnally active flies oviposit during nighttime hours. This study reports that nocturnal oviposition (defined as occurring between 2100-0600 h CDST (Central Daylight Savings Time)) did not occur on freshly killed white rats or mice, on beef (fresh or aged up to 48 h), on freshly thawed pigs, nor, usually, on thawed pigs that were aged for up to 48 h. Limited oviposition did occur between 2100 and 2120 h on one bloated pig at a lighted rural site. Necrophilous flies were present and active at lighted and dark sites (urban and rural) before and immediately after sunset, but fly activity on the bait ceased within 50 min postsunset and did not resume until after 0600 h. These observations support other studies reporting that diurnally active flies do not oviposit during the nighttime.

THE MODULATED SOUNDS MADE BY THE TSETSE FLY ...

African Journals Online (AJOL)

11), but by conditioning them beforehand the response was improved. Since the acoustic .... had a meaJ, the abdomen was transparent and therefore contained only air. She only lived four ..... The natural history of tsetse flies. London, Lewis.

Temperature Effects on Olive Fruit Fly Infestation in the FlySim Cellular Automata Model

Science.gov (United States)

Bruno, Vincenzo; Baldacchini, Valerio; di Gregorio, Salvatore

FlySim is a Cellular Automata model developed for simulating infestation of olive fruit flies (Bactrocera Oleae) on olive (Olea europaea) groves. The flies move into the groves looking for mature olives where eggs are spawn. This serious agricultural problem is mainly tackled by using chemical agents at the first signs of the infestation, but organic productions with no or few chemicals are strongly requested by the market. Oil made with infested olives is poor in quality, nor olives are suitable for selling in stores. The FlySim model simulates the diffusion of flies looking for mature olives and the growing of flies due to atmospheric conditions. Foreseeing an infestation is the best way to prevent it and to reduce the need of chemicals in agriculture. In this work we investigated the effects of temperature on olive fruit flies and resulting infestation during late spring and summer.

Inhomogeneous wire explosion in water

International Nuclear Information System (INIS)

Hwangbo, C.K.; Kong, H.J.; Lee, S.S.

1980-01-01

Inhomogeneous processes are observed in underwater copper wire explosion induced by a condensed capacitor discharge. The wire used is 0.1 mm in diameter and 10 mm long, and the capacitor of 2 μF is charged to 5 KV. A N 2 laser is used for the diagnostic of spatial extension of exploding copper vapour. The photographs obtained in this experiment show unambiguously the inhomogeneous explosion along the exploding wire. The quenching of plasma by the surrounding water inhibits the expansion of the vapour. It is believed the observed inhomogeneous explosion along the wire is located and localized around Goronkin's striae, which was first reported by Goronkin and discussed by Froengel as a pre-breakdown phenomenon. (author)

Induction of subterahertz surface waves on a metal wire by intense laser interaction with a foil

Science.gov (United States)

Teramoto, Kensuke; Inoue, Shunsuke; Tokita, Shigeki; Yasuhara, Ryo; Nakamiya, Yoshihide; Nagashima, Takeshi; Mori, Kazuaki; Hashida, Masaki; Sakabe, Shuji

2018-02-01

We have demonstrated that a pulsed electromagnetic wave (Sommerfeld wave) of subterahertz frequency and 11-MV/m field strength can be induced on a metal wire by the interaction of an intense femtosecond laser pule with an adjacent metal foil at a laser intensity of 8.5 × 1018W /c m2 . The polarity of the electric field of this surface wave is opposite to that obtained by the direct interaction of the laser with the wire. Numerical simulations suggest that an electromagnetic wave associated with electron emission from the foil induces the surface wave. A tungsten wire is placed normal to an aluminum foil with a gap so that the wire is not irradiated and damaged by the laser pulse, thus making it possible to generate surface waves on the wire repeatedly.

Mechanical and metallurgical changes on 308L wires drawn by electropulses

OpenAIRE

Sánchez Egea, Antonio José; González Rojas, Hernan Alberto; Celentano, Diego Javier; Jorba Peiró, Jordi

2015-01-01

The electroplastic effects resulting from different electropulses configurations on a wire drawing process are investigated experimentally and numerically. Electropulses are induced into 308L stainless steel while it is simultaneously wire drawn. A current density of 185 A/mm2, a frequency range from 140 to 355 Hz and a pulse duration range from 100 to 250 µs are combined to electrically assist the wire drawing process. The electropulsing influence is studied in several mechanical parameters,...

Removal of uranium from simulated fly ash by chloride volatilization method

International Nuclear Information System (INIS)

Nobuaki, Sato; Yoshikatsu, Tochigi; Toshiki, Fukui; Takeo, Fujino

2003-01-01

Fly ash is generated from LWR nuclear power plant as a low-level waste, which is contaminated with a small amount of radioactive materials, composed mainly of uranium oxide. The constituents of the fly ash are similar to those of the ore; the major components of the ash are oxides of silicon, aluminum, sodium, magnesium, zinc, iron sodium and uranium. In this study, removal of uranium from the simulated fly ash, of which composition was U 3 O 8 : 10, CaO:25, SiO 2 : 25, Al 2 O 3 : 20, MgO: 10, ZnO:5, Fe 2 O 3 : 3 and Na 2 CO 3 : 2 wt%, by chloride volatilization method was examined. The simulated fly ash was chlorinated by the same manner as the dry way processing for the ore; namely, the ash was heated in a flow of chlorine in the presence of carbon at high temperatures. In the case of volatilization of uranium from U 3 O 8 and a simulated fly ash by chlorination using chlorine and carbon, it was seen that uranium of both samples showed similar volatilization behaviour: The volatilization ratio of uranium (VU) increased with increasing temperature from 800 to 1100 C. The VU value attained 99.9% at 1100 C. Iron, silicon and zinc showed similar behaviour to uranium, namely, they vaporized completely. The volatilization ratio of aluminum, magnesium and sodium were still high in a range 80-90%. The volatilization ratio of calcium was ∼40% under the same chlorination condition, though it changed to chloride. For recovery of uranium from fly ash by chlorination using chlorine in the presence of carbon, high volatilization ratio of uranium can be achieved at high temperatures. Volatilization ratio of other components also increases, which decreases the amount of decontaminated residue resulting in the reducing of decontamination effect. Selection of heating condition is important. (author)

Enhancing GMI properties of melt-extracted Co-based amorphous wires by twin-zone Joule annealing

Energy Technology Data Exchange (ETDEWEB)

Liu, J.S.; Cao, F.Y.; Xing, D.W.; Zhang, L.Y. [School of Materials Science and Engineering, Harbin Institute of Technology, Harbin 150001 (China); Qin, F.X. [Advanced Composite Center for Innovation and Science (ACCIS), Department of Aerospace Engineering, University of Bristol, University Walk, Bristol BS8 1TR (United Kingdom); Peng, H.X. [Advanced Composite Center for Innovation and Science (ACCIS), Department of Aerospace Engineering, University of Bristol, University Walk, Bristol BS8 1TR (United Kingdom); Centre for Nanoscience and Quantum Information, University of Bristol, Tyndall Avenue, Bristol BS8 1FD (United Kingdom); Xue, X. [School of Materials Science and Engineering, Harbin Institute of Technology, Harbin 150001 (China); Sun, J.F., E-mail: jfsun_hit@263.net [School of Materials Science and Engineering, Harbin Institute of Technology, Harbin 150001 (China)

2012-11-15

Highlights: Black-Right-Pointing-Pointer GMI effect is closely related to annealed microstructures observed by HRTEM. Black-Right-Pointing-Pointer Twin-zone Joule-heated annealing (TJHA) as a novel effective annealing treatment. Black-Right-Pointing-Pointer TJHA wires have relatively larger GMI ratio and field sensitivity. Black-Right-Pointing-Pointer From HRTEM perspective to explain the GMI peaks feature of different states wires. Black-Right-Pointing-Pointer TJHA wires are useful for high-resolution magnetic sensor applications. - Abstract: The influence of twin-zone Joule annealing (TJA) on the microstructure and magnetic properties of melt-extracted Co{sub 68.2}Fe{sub 4.3}B{sub 15}Si{sub 12.5} amorphous microwires has been investigated. Experimental results indicated that twin-zone Joule annealing treatment improved the GMI property of as-cast wires to a greater extent comparing with Joule annealing (JA) and conventional vacuum annealing (CVA) techniques. At 15 MHz, e.g., the maximum GMI ratio [{Delta}Z/Z{sub 0}]{sub max} of a TJA wire increases to 104.29%, which is more than 5 times of 20.49% for the as-cast wire, nearly two times of 56.47% for the JA wire, while the CVA wire has a decreased GMI ratio; the field response sensitivity of the TJA wire increased to 171.62%/Oe from 80.32%/Oe for the as-cast wire, exceeding the values of 140.76%/Oe for the JA wire and of 39.17%/Oe for the CVA wire. The stress or structural relaxation in TJA wire increases circumferential permeability, and magnetic moment achieves a critical state of excitation for overcoming eddy-current damping or 'nail-sticked' action in rotational magnetization process at relatively high frequency. From the microstructural point of view, the role of regularly arranged atomic micro-regions (RAAM) and of medium range order region (MROR) determines the efficiency of various annealing techniques. Conclusively, TJA is established as an efficient annealing technique to enhance the GMI effect

APTO-253 Stabilizes G-quadruplex DNA, Inhibits MYC Expression, and Induces DNA Damage in Acute Myeloid Leukemia Cells.

Science.gov (United States)

Local, Andrea; Zhang, Hongying; Benbatoul, Khalid D; Folger, Peter; Sheng, Xia; Tsai, Cheng-Yu; Howell, Stephen B; Rice, William G

2018-06-01

APTO-253 is a phase I clinical stage small molecule that selectively induces CDKN1A (p21), promotes G 0 -G 1 cell-cycle arrest, and triggers apoptosis in acute myeloid leukemia (AML) cells without producing myelosuppression in various animal species and humans. Differential gene expression analysis identified a pharmacodynamic effect on MYC expression, as well as induction of DNA repair and stress response pathways. APTO-253 was found to elicit a concentration- and time-dependent reduction in MYC mRNA expression and protein levels. Gene ontogeny and structural informatic analyses suggested a mechanism involving G-quadruplex (G4) stabilization. Intracellular pharmacokinetic studies in AML cells revealed that APTO-253 is converted intracellularly from a monomer to a ferrous complex [Fe(253) 3 ]. FRET assays demonstrated that both monomeric APTO-253 and Fe(253) 3 stabilize G4 structures from telomeres, MYC, and KIT promoters but do not bind to non-G4 double-stranded DNA. Although APTO-253 exerts a host of mechanistic sequelae, the effect of APTO-253 on MYC expression and its downstream target genes, on cell-cycle arrest, DNA damage, and stress responses can be explained by the action of Fe(253) 3 and APTO-253 on G-quadruplex DNA motifs. Mol Cancer Ther; 17(6); 1177-86. ©2018 AACR . ©2018 American Association for Cancer Research.

Fly Diversity Revealed by PCR-RFLP of Mitochondrial DNA

Science.gov (United States)

Asraoui, Jimmy F.; Sayar, Nancy P.; Knio, Khouzama M.; Smith, Colin A.

2008-01-01

In this article, we describe an inexpensive, two-session undergraduate laboratory activity that introduces important molecular biology methods in the context of biodiversity. In the first session, students bring tentatively identified flies (order Diptera, true flies) to the laboratory, extract DNA, and amplify a region of the mitochondrial gene…

Wire bonding in microelectronics

CERN Document Server

Harman, George G

2010-01-01

Wire Bonding in Microelectronics, Third Edition, has been thoroughly revised to help you meet the challenges of today's small-scale and fine-pitch microelectronics. This authoritative guide covers every aspect of designing, manufacturing, and evaluating wire bonds engineered with cutting-edge techniques. In addition to gaining a full grasp of bonding technology, you'll learn how to create reliable bonds at exceedingly high yields, test wire bonds, solve common bonding problems, implement molecular cleaning methods, and much more. Coverage includes: Ultrasonic bonding systems and technologies, including high-frequency systems Bonding wire metallurgy and characteristics, including copper wire Wire bond testing Gold-aluminum intermetallic compounds and other interface reactions Gold and nickel-based bond pad plating materials and problems Cleaning to improve bondability and reliability Mechanical problems in wire bonding High-yield, fine-pitch, specialized-looping, soft-substrate, and extreme-temperature wire bo...

Seismic fragility analysis of lap-spliced reinforced concrete columns retrofitted by SMA wire jackets

International Nuclear Information System (INIS)

Choi, Eunsoo; Park, Sun-Hee; Chung, Young-Soo; Kim, Hee Sun

2013-01-01

The aim of this study is to provide seismic fragility curves of reinforced concrete columns retrofitted by shape memory alloy wire jackets and thus assess the seismic performance of the columns against earthquakes, comparing them with reinforced concrete columns with lap-spliced and continuous reinforcement. For that purpose, this study first developed analytical models of the experimental results of the three types of columns, (1) lap-spliced reinforcement, (2) continuous reinforcement and (3) lap-spliced reinforcement and retrofitted by SMA wire jackets, using the OpenSEES program, which is oriented to nonlinear dynamic analysis. Then, a suite of ten recorded ground motions was used to conduct dynamic analyses of the analytical models with scaling of the peak ground acceleration from 0.1g to 1.0g in steps of 0.1g. From the static experimental tests, the column retrofitted with SMA wire jackets had a larger displacement ductility by a factor of 2.3 times that of the lap-spliced column, which was 6% larger compared with the ductility of the continuous reinforcement column. From the fragility analyses, the SMA wire jacketed column had median values of 0.162g and 0.567g for yield and collapse, respectively. For the yield damage state, the SMA wire jacketed column had a median value similar to the continuous reinforcement column. However, for the complete damage state, the SMA wire jacketed column showed a 1.33 times larger median value than the continuously reinforcement column. (paper)

A new wire chamber front-end system, based on the ASD-8 B chip

NARCIS (Netherlands)

Krusemann, BAM; Bassini, R; Ellinghaus, F; Frekers, D; Hagemann, M; Hannen, VM; von Heynitz, H; Heyse, J; Sohlbach, H; Wortche, HJ

1999-01-01

The Focal-Plane Polarimeter (FPP) for the Big-Bite Spectrometer van den Berg (Nucl Instr. and Meth. B 99 (1995) 637ff) at the KVI requires the read-out of four large-area MWPCs and two VDCs with 3872 wires in-total. The EUROSUPERNOVA collaboration (SNOVA) developed a digital 16 channel preamplifier

Towards plant wires.

Science.gov (United States)

Adamatzky, Andrew

2014-08-01

In experimental laboratory studies we evaluate a possibility of making electrical wires from living plants. In scoping experiments we use lettuce seedlings as a prototype model of a plant wire. We approximate an electrical potential transfer function by applying direct current voltage to the lettuce seedlings and recording output voltage. We analyse oscillation frequencies of the output potential and assess noise immunity of the plant wires. Our findings will be used in future designs of self-growing wetware circuits and devices, and integration of plant-based electronic components into future and emergent bio-hybrid systems. Copyright © 2014 Elsevier Ireland Ltd. All rights reserved.

Natural infections of man-biting sand flies by Leishmania and Trypanosoma species in the northern Peruvian Andes.

Science.gov (United States)

Kato, Hirotomo; Gomez, Eduardo A; Cáceres, Abraham G; Vargas, Franklin; Mimori, Tatsuyuki; Yamamoto, Kento; Iwata, Hiroyuki; Korenaga, Masataka; Velez, Lenin; Hashiguchi, Yoshihisa

2011-05-01

The natural infection of sand flies by Leishmania species was studied in the Andean areas of Peru where cutaneous leishmaniasis caused by Leishmania (Viannia) peruviana is endemic. Sand flies were captured by human bait and Center for Disease Control (CDC) light trap catches at Nambuque and Padregual, Department of La Libertad, Peru, and morphologically identified. Among 377 female sand flies dissected, the two dominant man-biting species were Lutzomyia (Helcocyrtomyia) peruensis (211 flies) and Lutzomyia (Helcocyrtomyia) caballeroi (151 flies). Another sand fly species captured by light trap was Warileya phlebotomanica (15 flies). The natural infection of sand flies by flagellates was detected in 1.4% of Lu. (H.) peruensis and 2.6% of Lu. (H.) caballeroi, and the parasite species were identified as Le. (V.) peruviana and Trypanosoma avium, respectively, by molecular biological methods. The results indicated that the vector species responsible for the transmission of leishmaniasis in the study areas is Lu. (H.) peruensis. In addition, the presence of Trypanosoma in man-biting sand fly species means that more careful consideration is necessary for vector research in areas of Andean Peru where leishmaniasis is endemic.

Wiring Together Synthetic Bacterial Consortia to Create a Biological Integrated Circuit.

Science.gov (United States)

Perry, Nicolas; Nelson, Edward M; Timp, Gregory

2016-12-16

The promise of adapting biology to information processing will not be realized until engineered gene circuits, operating in different cell populations, can be wired together to express a predictable function. Here, elementary biological integrated circuits (BICs), consisting of two sets of transmitter and receiver gene circuit modules with embedded memory placed in separate cell populations, were meticulously assembled using live cell lithography and wired together by the mass transport of quorum-sensing (QS) signal molecules to form two isolated communication links (comlinks). The comlink dynamics were tested by broadcasting "clock" pulses of inducers into the networks and measuring the responses of functionally linked fluorescent reporters, and then modeled through simulations that realistically captured the protein production and molecular transport. These results show that the comlinks were isolated and each mimicked aspects of the synchronous, sequential networks used in digital computing. The observations about the flow conditions, derived from numerical simulations, and the biofilm architectures that foster or silence cell-to-cell communications have implications for everything from decontamination of drinking water to bacterial virulence.

75 FR 60480 - In the Matter of Certain Bulk Welding Wire Containers and Components Thereof and Welding Wire...

Science.gov (United States)

2010-09-30

... Welding Wire Containers and Components Thereof and Welding Wire; Notice of Commission Determination To... within the United States after importation of certain bulk welding wire containers, components thereof, and welding wire by reason of infringement of certain claims of United States Patent Nos. 6,260,781; 6...

Base Information Transport Infrastructure Wired (BITI Wired)

Science.gov (United States)

2016-03-01

2016 Major Automated Information System Annual Report Base Information Transport Infrastructure Wired (BITI Wired) Defense Acquisition Management...Combat Information Transport System program was restructured into two pre-Major Automated Information System (pre-MAIS) components: Information...Major Automated Information System MAIS OE - MAIS Original Estimate MAR – MAIS Annual Report MDA - Milestone Decision Authority MDD - Materiel

Load-Deflection and Friction Properties of PEEK Wires as Alternative Orthodontic Wires.

Science.gov (United States)

Tada, Yoshifumi; Hayakawa, Tohru; Nakamura, Yoshiki

2017-08-09

Polyetheretherketone (PEEK) is now attracting attention as an alternative to metal alloys in the dental field. In the present study, we evaluated the load-deflection characteristics of PEEK wires in addition to their frictional properties. Three types of PEEK wires are used: two sizes of rectangular shape, 0.016 × 0.022 in² and 0.019 × 0.025 in² (19-25PEEK), and rounded shape, diameter 0.016 in (16PEEK). As a control, Ni-Ti orthodontic wire, diameter 0.016 in, was used. The three-point bending properties were evaluated in a modified three-point bending system for orthodontics. The static friction between the orthodontic wire and the bracket was also measured. The load-deflection curves were similar among Ni-Ti and PEEK wires, except for 16PEEK with slot-lid ligation. The bending force of 19-25PEEK wire was comparable with that of Ni-Ti wire. 19-25PEEK showed the highest load at the deflection of 1500 μm ( p 0.05). No significant difference was seen in static friction between all three PEEK wires and Ni-Ti wire ( p > 0.05). It is suggested that 19-25PEEK will be applicable for orthodontic treatment with the use of slot-lid ligation.

Soluble components of the flagellar export apparatus, FliI, FliJ, and FliH, do not deliver flagellin, the major filament protein, from the cytosol to the export gate.

Science.gov (United States)

Sajó, Ráchel; Liliom, Károly; Muskotál, Adél; Klein, Agnes; Závodszky, Péter; Vonderviszt, Ferenc; Dobó, József

2014-11-01

Flagella, the locomotion organelles of bacteria, extend from the cytoplasm to the cell exterior. External flagellar proteins are synthesized in the cytoplasm and exported by the flagellar type III secretion system. Soluble components of the flagellar export apparatus, FliI, FliH, and FliJ, have been implicated to carry late export substrates in complex with their cognate chaperones from the cytoplasm to the export gate. The importance of the soluble components in the delivery of the three minor late substrates FlgK, FlgL (hook-filament junction) and FliD (filament-cap) has been convincingly demonstrated, but their role in the transport of the major filament component flagellin (FliC) is still unclear. We have used continuous ATPase activity measurements and quartz crystal microbalance (QCM) studies to characterize interactions between the soluble export components and flagellin or the FliC:FliS substrate-chaperone complex. As controls, interactions between soluble export component pairs were characterized providing Kd values. FliC or FliC:FliS did not influence the ATPase activity of FliI alone or in complex with FliH and/or FliJ suggesting lack of interaction in solution. Immobilized FliI, FliH, or FliJ did not interact with FliC or FliC:FliS detected by QCM. The lack of interaction in the fluid phase between FliC or FliC:FliS and the soluble export components, in particular with the ATPase FliI, suggests that cells use different mechanisms for the export of late minor substrates, and the major substrate, FliC. It seems that the abundantly produced flagellin does not require the assistance of the soluble export components to efficiently reach the export gate. Copyright © 2014 Elsevier B.V. All rights reserved.

Identification of Algerian Field-Caught Phlebotomine Sand Fly Vectors by MALDI-TOF MS.

Directory of Open Access Journals (Sweden)

Ismail Lafri

2016-01-01

Full Text Available Phlebotomine sand flies are known to transmit Leishmania parasites, bacteria and viruses that affect humans and animals in many countries worldwide. Precise sand fly identification is essential to prevent phlebotomine-borne diseases. Over the past two decades, progress in matrix-assisted laser desorption/ionization time-of-flight mass spectrometry (MALDI-TOF MS has emerged as an accurate tool for arthropod identification. The objective of the present study was to investigate the usefulness of MALDI-TOF MS as a tool for identifying field-caught phlebotomine.Sand flies were captured in four sites in north Algeria. A subset was morphologically and genetically identified. Six species were found in these areas and a total of 28 stored frozen specimens were used for the creation of the reference spectrum database. The relevance of this original method for sand fly identification was validated by two successive blind tests including the morphological identification of 80 new specimens which were stored at -80°C, and 292 unknown specimens, including engorged specimens, which were preserved under different conditions. Intra-species reproducibility and inter-species specificity of the protein profiles were obtained, allowing us to distinguish specimens at the gender level. Querying of the sand fly database using the MS spectra from the blind test groups revealed concordant results between morphological and MALDI-TOF MS identification. However, MS identification results were less efficient for specimens which were engorged or stored in alcohol. Identification of 362 phlebotomine sand flies, captured at four Algerian sites, by MALDI-TOF MS, revealed that the subgenus Larroussius was predominant at all the study sites, except for in M'sila where P. (Phlebotomus papatasi was the only sand fly species detected.The present study highlights the application of MALDI-TOF MS for monitoring sand fly fauna captured in the field. The low cost, reliability and

Identification of Algerian Field-Caught Phlebotomine Sand Fly Vectors by MALDI-TOF MS.

Science.gov (United States)

Lafri, Ismail; Almeras, Lionel; Bitam, Idir; Caputo, Aurelia; Yssouf, Amina; Forestier, Claire-Lise; Izri, Arezki; Raoult, Didier; Parola, Philippe

2016-01-01

Phlebotomine sand flies are known to transmit Leishmania parasites, bacteria and viruses that affect humans and animals in many countries worldwide. Precise sand fly identification is essential to prevent phlebotomine-borne diseases. Over the past two decades, progress in matrix-assisted laser desorption/ionization time-of-flight mass spectrometry (MALDI-TOF MS) has emerged as an accurate tool for arthropod identification. The objective of the present study was to investigate the usefulness of MALDI-TOF MS as a tool for identifying field-caught phlebotomine. Sand flies were captured in four sites in north Algeria. A subset was morphologically and genetically identified. Six species were found in these areas and a total of 28 stored frozen specimens were used for the creation of the reference spectrum database. The relevance of this original method for sand fly identification was validated by two successive blind tests including the morphological identification of 80 new specimens which were stored at -80°C, and 292 unknown specimens, including engorged specimens, which were preserved under different conditions. Intra-species reproducibility and inter-species specificity of the protein profiles were obtained, allowing us to distinguish specimens at the gender level. Querying of the sand fly database using the MS spectra from the blind test groups revealed concordant results between morphological and MALDI-TOF MS identification. However, MS identification results were less efficient for specimens which were engorged or stored in alcohol. Identification of 362 phlebotomine sand flies, captured at four Algerian sites, by MALDI-TOF MS, revealed that the subgenus Larroussius was predominant at all the study sites, except for in M'sila where P. (Phlebotomus) papatasi was the only sand fly species detected. The present study highlights the application of MALDI-TOF MS for monitoring sand fly fauna captured in the field. The low cost, reliability and rapidity of MALDI

Chromium removal from tannery wastewater by using of flying ash

International Nuclear Information System (INIS)

Gil P, E.; Saldarriaga M, C.

1998-01-01

A simple and economic method to chromium removal from tannery wastewater by means of flying ash is presented. The chromium removal operation is a discontinuous process that involve the mass of flying ash, time of contact and temperature or ph as variables, their which are optimized through Box-Wilson type experimental design. The results were successful: From an initial fluid whit chromium concentration of 1850m ppm, final concentrations of 0.008 ppm and 0.5 ppm of Cr+3 and Cr+6 respectively were achieved. These post-treatment concentrations are into the approved range definite by Government's Laws to this waste type

Copper wire bonding

CERN Document Server

Chauhan, Preeti S; Zhong, ZhaoWei; Pecht, Michael G

2014-01-01

This critical volume provides an in-depth presentation of copper wire bonding technologies, processes and equipment, along with the economic benefits and risks.  Due to the increasing cost of materials used to make electronic components, the electronics industry has been rapidly moving from high cost gold to significantly lower cost copper as a wire bonding material.  However, copper wire bonding has several process and reliability concerns due to its material properties.  Copper Wire Bonding book lays out the challenges involved in replacing gold with copper as a wire bond material, and includes the bonding process changes—bond force, electric flame off, current and ultrasonic energy optimization, and bonding tools and equipment changes for first and second bond formation.  In addition, the bond–pad metallurgies and the use of bare and palladium-coated copper wires on aluminum are presented, and gold, nickel and palladium surface finishes are discussed.  The book also discusses best practices and re...

Regulation of Drosophila Brain Wiring by Neuropil Interactions via a Slit-Robo-RPTP Signaling Complex.

Science.gov (United States)

Oliva, Carlos; Soldano, Alessia; Mora, Natalia; De Geest, Natalie; Claeys, Annelies; Erfurth, Maria-Luise; Sierralta, Jimena; Ramaekers, Ariane; Dascenco, Dan; Ejsmont, Radoslaw K; Schmucker, Dietmar; Sanchez-Soriano, Natalia; Hassan, Bassem A

2016-10-24

The axonal wiring molecule Slit and its Round-About (Robo) receptors are conserved regulators of nerve cord patterning. Robo receptors also contribute to wiring brain circuits. Whether molecular mechanisms regulating these signals are modified to fit more complex brain wiring processes is unclear. We investigated the role of Slit and Robo receptors in wiring Drosophila higher-order brain circuits and identified differences in the cellular and molecular mechanisms of Robo/Slit function. First, we find that signaling by Robo receptors in the brain is regulated by the Receptor Protein Tyrosine Phosphatase RPTP69d. RPTP69d increases membrane availability of Robo3 without affecting its phosphorylation state. Second, we detect no midline localization of Slit during brain development. Instead, Slit is enriched in the mushroom body, a neuronal structure covering large areas of the brain. Thus, a divergent molecular mechanism regulates neuronal circuit wiring in the Drosophila brain, partly in response to signals from the mushroom body. Copyright © 2016 The Authors. Published by Elsevier Inc. All rights reserved.

G-quadruplex DNA sequences are evolutionarily conserved and associated with distinct genomic features in Saccharomyces cerevisiae.

Directory of Open Access Journals (Sweden)

John A Capra

2010-07-01

Full Text Available G-quadruplex DNA is a four-stranded DNA structure formed by non-Watson-Crick base pairing between stacked sets of four guanines. Many possible functions have been proposed for this structure, but its in vivo role in the cell is still largely unresolved. We carried out a genome-wide survey of the evolutionary conservation of regions with the potential to form G-quadruplex DNA structures (G4 DNA motifs across seven yeast species. We found that G4 DNA motifs were significantly more conserved than expected by chance, and the nucleotide-level conservation patterns suggested that the motif conservation was the result of the formation of G4 DNA structures. We characterized the association of conserved and non-conserved G4 DNA motifs in Saccharomyces cerevisiae with more than 40 known genome features and gene classes. Our comprehensive, integrated evolutionary and functional analysis confirmed the previously observed associations of G4 DNA motifs with promoter regions and the rDNA, and it identified several previously unrecognized associations of G4 DNA motifs with genomic features, such as mitotic and meiotic double-strand break sites (DSBs. Conserved G4 DNA motifs maintained strong associations with promoters and the rDNA, but not with DSBs. We also performed the first analysis of G4 DNA motifs in the mitochondria, and surprisingly found a tenfold higher concentration of the motifs in the AT-rich yeast mitochondrial DNA than in nuclear DNA. The evolutionary conservation of the G4 DNA motif and its association with specific genome features supports the hypothesis that G4 DNA has in vivo functions that are under evolutionary constraint.

Feasibility studies on the direct wire readout on wire scanners in electron accelerators

International Nuclear Information System (INIS)

Markert, Michael

2010-10-01

This bachelor thesis deals essentially with the signal processing of a so-called wire scanner, a special monitor, which comes to application in the beam diagnostics of particle accelerators. In this direct wire readout the voltage signal, which is induced by the particle beam in the measurement wire of the wire scanner, shall be directly read out. The aim of this thesis is to show fundamental considerations and perform studies, which study, whether and how in the future by means of a suited data transmission as well as readout electronics conclusion on the most important parameters of the beam, like position and profile, are possible. The measurement system presented here is divided in three main components: Signal measurement, signal preparation, and signal stretching. A suited test facility was developed and is presented in detail, in which then all components, like for instance the transmission cables, the wire-scanner fork, and the developed measurement circuit, are studied, which are of importance for a faultless signal transmission and presentation. Extensive measurements on the single components, as well as calculations for the signal transmission on and in the wire scanner were performed, whereby a good agreement could be found. Thereafter a comparison and a selection of the component used in this project were made. Furthermore improvement proposals, new constructions, and outlooks are presented, which could be of importance in further works.

An interconnecting bus power optimization method combining interconnect wire spacing with wire ordering

International Nuclear Information System (INIS)

Zhu Zhang-Ming; Hao Bao-Tian; En Yun-Fei; Yang Yin-Tang; Li Yue-Jin

2011-01-01

On-chip interconnect buses consume tens of percents of dynamic power in a nanometer scale integrated circuit and they will consume more power with the rapid scaling down of technology size and continuously rising clock frequency, therefore it is meaningful to lower the interconnecting bus power in design. In this paper, a simple yet accurate interconnect parasitic capacitance model is presented first and then, based on this model, a novel interconnecting bus optimization method is proposed. Wire spacing is a process for spacing wires for minimum dynamic power, while wire ordering is a process that searches for wire orders that maximally enhance it. The method, i.e., combining wire spacing with wire ordering, focuses on bus dynamic power optimization with a consideration of bus performance requirements. The optimization method is verified based on various nanometer technology parameters, showing that with 50% slack of routing space, 25.71% and 32.65% of power can be saved on average by the proposed optimization method for a global bus and an intermediate bus, respectively, under a 65-nm technology node, compared with 21.78% and 27.68% of power saved on average by uniform spacing technology. The proposed method is especially suitable for computer-aided design of nanometer scale on-chip buses. (interdisciplinary physics and related areas of science and technology)

Optically pumped ultraviolet and infrared lasers driven by exploding metal films and wires

International Nuclear Information System (INIS)

Jones, C.R.; Ware, K.D.

1983-01-01

The 342-nm molecular iodine and 1315-nm atomic iodine lasers have been optically pumped by intense light from exploding-metal-film and exploding-wire discharges. Brightness temperatures for the exploding-film discharges were approx. 25,000 K and for the wire discharges were approx. 30,000 K. For the I 2 laser the 3.5-cm-diameter by 40-cm-long pumped volume lies adjacent to the wire or film of the same length. Pressures of 1 to 6 torr I 2 and 1 to 3 atm SF, CF 4 , or Ar were used in the stainless-steel cell. Using 20-μF capacitance charged to 40 kV, a 0.25-mm tungsten wire, 3-torr I 2 , and a 2-atm SF 6 , an energy of 2 J was obtained from the laser in a pulse of 8-μs duration. The specific output energy was 7 J/l. Substitution of a cylindrical Al film for the wire, under otherwise similar conditions, led to a X10 output energies and efficiencies were obtained with similar input energy. An output pulse of 12 J and 12-μs duration was measured for a specific output energy of 18 J/l. A laser energy of 110 J in a 20-us-long pulse has been measured from atomic iodine using a wire discharge along the axis of a larger cell. The active volume available was 20 cm in diameter and 80 cm in length. Input energy was 32 kJ. In similar measurements using a cylindrical Al film for discharge initiation, the measured output energy was 40 J

PPM-based System for Guided Waves Communication Through Corrosion Resistant Multi-wire Cables

Science.gov (United States)

Trane, G.; Mijarez, R.; Guevara, R.; Pascacio, D.

Novel wireless communication channels are a necessity in applications surrounded by harsh environments, for instance down-hole oil reservoirs. Traditional radio frequency (RF) communication schemes are not capable of transmitting signals through metal enclosures surrounded by corrosive gases and liquids. As an alternative to RF, a pulse position modulation (PPM) guided waves communication system has been developed and evaluated using a corrosion resistant 4H18 multi-wire cable, commonly used to descend electronic gauges in down-hole oil applications, as the communication medium. The system consists of a transmitter and a receiver that utilizes a PZT crystal, for electrical/mechanical coupling, attached to each extreme of the multi-wire cable. The modulator is based on a microcontroller, which transmits60 kHz guided wave pulses, and the demodulator is based on a commercial digital signal processor (DSP) module that performs real time DSP algorithms. Experimental results are presented, which were obtained using a 1m corrosion resistant 4H18multi-wire cable, commonly used with downhole electronic gauges in the oil sector. Although there was significant dispersion and multiple mode excitations of the transmitted guided wave energy pulses, the results show that data rates on the order of 500 bits per second are readily available employing PPM and simple communications techniques.

Welding wire pressure sensor assembly

Science.gov (United States)

Morris, Timothy B. (Inventor); Milly, Peter F., Sr. (Inventor); White, J. Kevin (Inventor)

1994-01-01

The present invention relates to a device which is used to monitor the position of a filler wire relative to a base material being welded as the filler wire is added to a welding pool. The device is applicable to automated welding systems wherein nonconsumable electrode arc welding processes are utilized in conjunction with a filler wire which is added to a weld pool created by the electrode arc. The invention senses pressure deviations from a predetermined pressure between the filler wire and the base material, and provides electrical signals responsive to the deviations for actuating control mechanisms in an automatic welding apparatus so as to minimize the pressure deviation and to prevent disengagement of the contact between the filler wire and the base material.

Eradication of the melon fly, Bactrocera cucurbitae Coquillett, by mass release of sterile flies in Okinawa prefecture, Japan

International Nuclear Information System (INIS)

Kakinohana, H.; Kuba, H.; Kohama, T.; Kinjo, K.; Taniguchi, M.; Nakamori, H.; Tanahara, A.; Sokei, Y.

1997-01-01

In 1972, MAFF, Japan and the Okinawa Prefectural Government initiated an experimental eradication project of the melon fly from Kume Island, Okinawa Prefecture, Japan using the sterile insect technique (SIT). Following the successful eradication on Kume Island in 1978, large scale SIT was started to eradicate the melon fly on the 3 groups of islands, Miyako, Okinawa and Yaeyama of Okinawa Prefecture, Japan in 1984, 1986 and 1989, and eradication was achieved in 1987, 1990 and 1993, respectively. For the successful eradication on Miyako, Okinawa and Yaeyama groups of islands, about 6,340, 30,940 and 15,440 million sterile melon flies were released, respectively

Mechanical behavior of M-Wire and conventional NiTi wire used to manufacture rotary endodontic instruments.

Science.gov (United States)

Pereira, Erika S J; Gomes, Renata O; Leroy, Agnès M F; Singh, Rupinderpal; Peters, Ove A; Bahia, Maria G A; Buono, Vicente T L

2013-12-01

Comparison of physical and mechanical properties of one conventional and a new NiTi wire, which had received an additional thermomechanical treatment. Specimens of both conventional (NiTi) and the new type of wire, called M-Wire (MW), were subjected to tensile and three-point bending tests, Vickers microhardness measurements, and to rotating-bending fatigue tests at a strain-controlled level of 6%. Fracture surfaces were observed by scanning electron microscopy and the non-deformed microstructures by transmission electron microscopy. The thermomechanical treatment applied to produce the M-Wire apparently increased the tensile strength and Vickers microhardness of the material, but its apparent Young modulus was smaller than that of conventionally treated NiTi. The three-point bending tests showed a higher flexibility for MW which also exhibited a significantly higher number of cycles to failure. M-Wire presented mechanical properties that can render endodontic instruments more flexible and fatigue resistant than those made with conventionally processed NiTi wires. Copyright © 2013 Academy of Dental Materials. Published by Elsevier Ltd. All rights reserved.

Cortical Composition Hierarchy Driven by Spine Proportion Economical Maximization or Wire Volume Minimization.

Directory of Open Access Journals (Sweden)

Jan Karbowski

2015-10-01

Full Text Available The structure and quantitative composition of the cerebral cortex are interrelated with its computational capacity. Empirical data analyzed here indicate a certain hierarchy in local cortical composition. Specifically, neural wire, i.e., axons and dendrites take each about 1/3 of cortical space, spines and glia/astrocytes occupy each about (1/3(2, and capillaries around (1/3(4. Moreover, data analysis across species reveals that these fractions are roughly brain size independent, which suggests that they could be in some sense optimal and thus important for brain function. Is there any principle that sets them in this invariant way? This study first builds a model of local circuit in which neural wire, spines, astrocytes, and capillaries are mutually coupled elements and are treated within a single mathematical framework. Next, various forms of wire minimization rule (wire length, surface area, volume, or conduction delays are analyzed, of which, only minimization of wire volume provides realistic results that are very close to the empirical cortical fractions. As an alternative, a new principle called "spine economy maximization" is proposed and investigated, which is associated with maximization of spine proportion in the cortex per spine size that yields equally good but more robust results. Additionally, a combination of wire cost and spine economy notions is considered as a meta-principle, and it is found that this proposition gives only marginally better results than either pure wire volume minimization or pure spine economy maximization, but only if spine economy component dominates. However, such a combined meta-principle yields much better results than the constraints related solely to minimization of wire length, wire surface area, and conduction delays. Interestingly, the type of spine size distribution also plays a role, and better agreement with the data is achieved for distributions with long tails. In sum, these results suggest

Composite superconducting wires produced by rapid coating in Bi-Sr-Ca-Cu-O metal oxide system

International Nuclear Information System (INIS)

Grozav, A.D.; Konopko, L.A.; Leoporda, N.I.

1989-01-01

Method for producing superconducting composite wires by dip coating of copper wires in metal-oxide BiSrCaCu 2 O x melt is developed. The thickness of the coating is regulated by the change of dip rate, melt viscosity and by the number of passages through the melt. Wire annealing at 700-800 deg C leads to the production of two phases, one of them being superconducting with T c =80K

submitter Dynamical Models of a Wire Scanner

CERN Document Server

Barjau, Ana; Dehning, Bernd

2016-01-01

The accuracy of the beam profile measurements achievable by the current wire scanners at CERN is limited by the vibrations of their mechanical parts. In particular, the vibrations of the carbon wire represent the major source of wire position uncertainty which limits the beam profile measurement accuracy. In the coming years, due to the Large Hadron Collider (LHC) luminosity upgrade, a wire traveling speed up to 20 $m s^{−1}$ and a position measurement accuracy of the order of 1 μm will be required. A new wire scanner design based on the understanding of the wire vibration origin is therefore needed. We present the models developed to understand the main causes of the wire vibrations observed in an existing wire scanner. The development and tuning of those models are based on measurements and tests performed on that CERN proton synchrotron (PS) scanner. The final model for the (wire + fork) system has six degrees-of-freedom (DOF). The wire equations contain three different excitation terms: inertia...

Experimental and numerical investigations of wire bending by linear winding of rectangular tooth coils

Science.gov (United States)

Komodromos, A.; Tekkaya, A. E.; Hofmann, J.; Fleischer, J.

2018-05-01

Since electric motors are gaining in importance in many fields of application, e.g. hybrid electric vehicles, optimization of the linear coil winding process greatly contributes to an increase in productivity and flexibility. For the investigation of the forming behavior of the winding wire the material behavior is characterized in different experimental setups. Numerical examinatons of the linear winding process are carried out in a case study for a rectangular bobbin in order to analyze the influence of forming parameters on the resulting properties of the wound coil. Besides the numerical investigation of the linear winding method by using the finite element method (FEM), a multi-body dynamics (MBD) simulation is carried out. The multi-body dynamics simulation is necessary to represent the movement of the bodies as well as the connection of the components during winding. The finite element method is used to represent the material behavior of the copper wire and the plastic strain distribution within the wire. It becomes clear that the MBD simulation is not sufficient for analyzing the process and the wire behavior in its entirety. Important parameters that define the final coil properties cannot be analyzed in the manner of a precise manifestation, e.g. the clearance between coil bobbin and wire as well as the wire deformation behavior in form of a diameter reduction which negatively affects the ohmic resistance. Finally, the numerical investigations are validated experimentally by linear winding tests.

Application of digital waveform processing to position-sensitive proportional counter

International Nuclear Information System (INIS)

Takenaka, Yasuto; Uritani, Akira; Mori, Chizuo

1995-01-01

In a charge-division type position-sensitive proportional counter (PSPC) with an anode wire of small resistance, a reflected component from an opposite end and thermal noise involved in signals deteriorate the position resolution of the PSPC. A digital waveform processing method was applied to the reduction of these undesirable effects by skillfully utilizing their signal characteristics that can be observed as inversely correlative signals between two-output signals from both sides of the PSPC. The digital waveform processing could improve the position resolution compared to a conventional pulse height processing method with analog filters. When the digital waveform processing was applied to signals of an equivalent circuit simulating the PSPC, the position resolutions defined by the full width at half maximum were improved to about 30% of those of conventional analog pulse processing. In the case of an actual PSPC, the position resolutions by the digital waveform processing were improved by 4-10% as compared with those of conventional pulse height processing. (author)

Plasma chemistry in wire chambers

International Nuclear Information System (INIS)

Wise, J.

1990-05-01

The phenomenology of wire chamber aging is discussed and fundamentals of proportional counters are presented. Free-radical polymerization and plasma polymerization are discussed. The chemistry of wire aging is reviewed. Similarities between wire chamber plasma (>1 atm dc-discharge) and low-pressure rf-discharge plasmas, which have been more widely studied, are suggested. Construction and use of a system to allow study of the plasma reactions occurring in wire chambers is reported. A proportional tube irradiated by an 55 Fe source is used as a model wire chamber. Condensable species in the proportional tube effluent are concentrated in a cryotrap and analyzed by gas chromatography/mass spectrometry. Several different wire chamber gases (methane, argon/methane, ethane, argon/ethane, propane, argon/isobutane) are tested and their reaction products qualitatively identified. For all gases tested except those containing methane, use of hygroscopic filters to remove trace water and oxygen contaminants from the gas resulted in an increase in the average molecular weight of the products, consistent with results from low-pressure rf-discharge plasmas. It is suggested that because water and oxygen inhibit polymer growth in the gas phase that they may also reduce polymer deposition in proportional tubes and therefore retard wire aging processes. Mechanistic implications of the plasma reactions of hydrocarbons with oxygen are suggested. Unresolved issues in this work and proposals for further study are discussed

Use of alternative alkali chlorides in RT and PCR of polynucleotides containing G quadruplex structures.

Science.gov (United States)

Ramos-Alemán, Fabiola; González-Jasso, Eva; Pless, Reynaldo C

2018-02-15

Several alkali chlorides were compared for their use in reverse transcription (RT) and PCR of different types of nucleic acid templates. On a test region of biological DNA incapable of forming G quadruplex (G4) structures, Taq DNA polymerase showed similar PCR performance with 50 mM KCl, CsCl, LiCl, and NaCl. In contrast, on a synthetic model polydeoxyribonucleotide prone to G4 formation, good PCR amplification was obtained with 50 mM CsCl, but little or none with LiCl or KCl. Similarly, in RT of a G4-prone model polyribonucleotide, MMLV reverse transcriptase produced a good yield with 50 mM CsCl, mediocre yields with LiCl or without added alkali chloride, and a poor yield with 50 mM KCl. The full RT-PCR assay starting from the G4-prone polyribonucleotide, showed good results with CsCl in both stages, poor results with LiCl, and no product formation with KCl. The model polynucleotides showed fast G quadruplex formation under PCR or RT conditions with 50 mM KCl, but not with CsCl or LiCl. The results argue for the use of CsCl instead of KCl for RT and PCR of G4-prone sequences. No advantage was observed when using the 7-deaza type nucleotide analog c 7 dGTP in PCR amplification of the G4-prone polydeoxyribonucleotide. Copyright © 2017 Elsevier Inc. All rights reserved.

Dual wire welding torch and method

Science.gov (United States)

Diez, Fernando Martinez; Stump, Kevin S.; Ludewig, Howard W.; Kilty, Alan L.; Robinson, Matthew M.; Egland, Keith M.

2009-04-28

A welding torch includes a nozzle with a first welding wire guide configured to orient a first welding wire in a first welding wire orientation, and a second welding wire guide configured to orient a second welding wire in a second welding wire orientation that is non-coplanar and divergent with respect to the first welding wire orientation. A method of welding includes moving a welding torch with respect to a workpiece joint to be welded. During moving the welding torch, a first welding wire is fed through a first welding wire guide defining a first welding wire orientation and a second welding wire is fed through a second welding wire guide defining a second welding wire orientation that is divergent and non-coplanar with respect to the first welding wire orientation.

Production of diamond wire by Cu15 v-% Nb 'in situ' process

International Nuclear Information System (INIS)

Filgueira, M.; Pinatti, D.G.

2001-01-01

Diamond wires are cutting tools used in the slabbing of dimension stones, such as marbles and granites, as well as in cutting of concrete structures. This tool consists of a steel cable on which diamond annular segments (pearls) are mounted with spacing between them. This work has developed a new technological route to obtain the diamond wires, whose fabrication involves metal forming processes such as rotary forging and wire drawing, copper tubes restacking, and thermal treatments of sintering and recrystallization. It was idealized the use of Cu 15v% Nb composite wires as the high tensile strength cable, covered with an external cutting rope made of bronze 4wt% diamond composite, along the overall wire surface. Investigations were carried out on the mechanical behavior and on the microstructural evolution of the Cu 15 vol % Nb wires, which showed ultimate tensile strength (UTS) of 960 MPa and deformation of approximately 3,0 %. The cutting external rope of 1.84 mm in diameter showed UTS = 230 MPa. On the microstructural side aspect it was observed that the diamond crystals were uniformly distributed throughout the tool bulk in the several processing steps. Cutting tests were carried out starting with an external diamond rope of 1.93 mm in diameter, which cut a marble sectional area of 1188 cm 2 , and the tool degraded to a final diameter of 1.23 mm. For marble the 'in situ' wire showed a probable performance 4 times higher than the diamond saws, however their probable performance was about 5 to 8 times less than the conventional diamond wires due to the low abrasion resistance of the bronze matrix and the low adhesion between the pair bronze-diamond. (author)

Ommatidia of blow fly, house fly, and flesh fly: implication of their vision efficiency.

Science.gov (United States)

Sukontason, Kabkaew L; Chaiwong, Tarinee; Piangjai, Somsak; Upakut, Sorawit; Moophayak, Kittikhun; Sukontason, Kom

2008-06-01

This work aims to elucidate the number of ommatidia or facets (the outwardly visible units of each ommatidium) for compound eyes in blow flies [Chrysomya megacephala (F.), Chrysomya rufifacies (Macquart), Chrysomya nigripes (Aubertin), Lucilia cuprina (Wiedemann)], house flies (Musca domestica L.), and flesh flies (Liosarcophaga dux Thomson) by manual counts of the corneal spreads. The head of the fly in each species was soaked in 20% potassium hydroxide solution at room temperature for 7 days, and the clear compound eye was dissected into six small parts, each of which was placed onto a slide and flattened using a coverslip. Images of each part were obtained using a microscope connected to a computer. The printed images of each part were magnified, and the total number of ommatidia per eye was manually counted. For males, the mean number of ommatidia was statistically different among all flies examined: L. dux (6,032) > C. rufifacies (5,356) > C. nigripes (4,798) > C. megacephala (4,376) > L. cuprina (3,665) > M. domestica (3,484). Likewise, the mean number of facets in females was statistically different: L. dux (6,086) > C. megacephala (5,641) > C. rufifacies (5,208) > C. nigripes (4,774) > L. cuprina (3,608) > M. domestica (3433). Scanning electron microscopy analysis of adult flies revealed the sexual dimorphism in the compound eye. Male C. megacephala had large ommatidia in the upper two thirds part and small ommatidia in the lower one third part, whereas only small ommatidia were detected in females. Dense postulate appearance was detected in the external surface of the corneal lens of the ommatidia of C. megacephala, C. rufifacies, and C. nigripes, while a mix of dense postulate appearance and variable groove array length was detected in L. cuprina and M. domestica. The probable functions of ommatidia are discussed with reference to other literature.

Geochemistry of fly ash from desulphurisation process performed by sodium bicarbonate

Energy Technology Data Exchange (ETDEWEB)

Raclavska, Helena; Matysek, Dalibor; Raclavsky, Konstantin; Juchelkova, Dagmar [VSB - Technical University Ostrava, 17. listopadu 15, 708 33 Ostrava, Poruba (Czech Republic)

2010-02-15

The application of NEUTREC {sup registered} technology - desulphurisation by means of sodium bicarbonate - has been tested at the Trebovice coal-fired power plant (Ostrava, Czech Republic). This technology significantly influences the chemical composition of fly ash and the leachability of total dissolved substances (TDS), e.g., sulphates, fluorides and oxyanions (Se, Sb, Cr, As), which are monitored according to the Council of the European Union Decision 2003/33/EC. An increase of TDS in the water leachate from the fly ash obtained at 60% desulphurisation was influenced by sodium content, which is present in the form of Na{sup +} ions (85-90%). The percentages of sodium sulphate and sodium carbonate were between 5 and 10% of the total sodium content. In order to decrease the leachability of TDS, sodium, sulphates and oxyanion mixtures were prepared containing a sorbent (60% bentonite) and mixed with desulphurised and non-desulphurised fly ash in various ratios. The addition of CaO resulted in the formation of a new mineral phase, burkeite. None of the applied technologies tested for the processed fly ash resulted in the preparation of a water leachate which complied in all monitored parameters to the requirements of Council Decision 2003/33 EC for nonhazardous wastes. (author)

One century of Kirschner wires and Kirschner wire insertion techniques : A historical review

NARCIS (Netherlands)

Franssen, Bas B. G. M.; Schuurman, Arnold H.; Van der Molen, Aebele Mink; Kon, Moshe

A century ago, in 1909, Martin Kirschner (1879-942) introduced a smooth pin, presently known as the Kirschner wire (K-wire). The K-wire was initiallly used for skeletal traction and is now currently used for many different goals. The development of the K-wire and its insertion devices were mainly

Release of microspherolites and metals extraction from energetical fly ashes by Bacillus isolates

Directory of Open Access Journals (Sweden)

Štyriaková Iveta

2000-09-01

they have a different resistance to the bacterial destruction. Metals (iron, titanium are comprised in an oxide form both in a non-combusted residue and allotrimorphic grains with amorphous aluminosilicate spherical particles.SEM enabled us to observe that the fresh fly-ash contains disseminated aluminosilicate spherical particles, with the size 1-70 µm that are released, probably together with metals, especially iron and titanium. The yielding of individual elements show a lower extraction of iron (3,3% and titanium (15,2% in the case of sample of 5 year - deposited fly-ash and a slightly higher yielding of iron (6,2% and titanium (29,1% in the case of sample of 20 year deposited fly-ash. A long-term deposition of energy fly-ash causes chemical and mineralogical changes as a result of weathering processes demonstrated by a lower extraction of metals from fly-ash.Although acids produced by Bacillus spp. were not measured in these experiments, in our previous experiments were detected several organic acids such as acetic, butyric, pyruvic, lactic, and formic acids after bioleaching of aluminosilicate samples.

[Constructing 3-dimensional colorized digital dental model assisted by digital photography].

Science.gov (United States)

Ye, Hong-qiang; Liu, Yu-shu; Liu, Yun-song; Ning, Jing; Zhao, Yi-jiao; Zhou, Yong-sheng

2016-02-18

To explore a method of constructing universal 3-dimensional (3D) colorized digital dental model which can be displayed and edited in common 3D software (such as Geomagic series), in order to improve the visual effect of digital dental model in 3D software. The morphological data of teeth and gingivae were obtained by intra-oral scanning system (3Shape TRIOS), constructing 3D digital dental models. The 3D digital dental models were exported as STL files. Meanwhile, referring to the accredited photography guide of American Academy of Cosmetic Dentistry (AACD), five selected digital photographs of patients'teeth and gingivae were taken by digital single lens reflex camera (DSLR) with the same exposure parameters (except occlusal views) to capture the color data. In Geomagic Studio 2013, after STL file of 3D digital dental model being imported, digital photographs were projected on 3D digital dental model with corresponding position and angle. The junctions of different photos were carefully trimmed to get continuous and natural color transitions. Then the 3D colorized digital dental model was constructed, which was exported as OBJ file or WRP file which was a special file for software of Geomagic series. For the purpose of evaluating the visual effect of the 3D colorized digital model, a rating scale on color simulation effect in views of patients'evaluation was used. Sixteen patients were recruited and their scores on colored and non-colored digital dental models were recorded. The data were analyzed using McNemar-Bowker test in SPSS 20. Universal 3D colorized digital dental model with better color simulation was constructed based on intra-oral scanning and digital photography. For clinical application, the 3D colorized digital dental models, combined with 3D face images, were introduced into 3D smile design of aesthetic rehabilitation, which could improve the patients' cognition for the esthetic digital design and virtual prosthetic effect. Universal 3D colorized