WorldWideScience

Sample records for quadruplex digital fly-by-wire

  1. An overview of NASA's digital fly-by-wire technology development program

    Science.gov (United States)

    Jarvis, C. R.

    1976-01-01

    The feasibility of using digital fly by wire systems to control aircraft was demonstrated by developing and flight testing a single channel system, which used Apollo hardware, in an F-8C test airplane. This is the first airplane to fly with a digital fly by wire system as its primary means of control and with no mechanical reversion capability. The development and flight test of a triplex digital fly by wire system, which will serve as an experimental prototype for future operational digital fly by wire systems, are underway.

  2. A digital fly-by-wire technology development program using an F-8C test aircraft

    Science.gov (United States)

    Jarvis, C. R.

    1974-01-01

    A digital fly-by-wire flight control system has been installed in an F-8C test airplane and has undergone extensive ground and flight testing as part of an overall program to develop digital fly-by-wire technology. This is the first airplane to fly with a digital fly-by-wire system as its primary means of control and with no mechanical reversion capability. Forty-two test flights were made for a total flight time of 57 hours. Six pilots participated in the evaluation. This paper presents an overview of the digital fly-by-wire program and discusses some of the flight-test results.

  3. Computers Take Flight: A History of NASA's Pioneering Digital Fly-By-Wire Project

    Science.gov (United States)

    Tomayko, James E.

    2000-01-01

    An overview of the NASA F-8 Fly-by Wire project is presented. The project made two significant contributions to the new technology: (1) a solid design base of techniques that work and those that do not, and (2) credible evidence of good flying qualities and the ability of such a system to tolerate real faults and to continue operation without degradation. In 1972 the F-8C aircraft used in the program became he first digital fly-by-wire aircraft to operate without a mechanical backup system.

  4. A pilot's opinion of the F-8 digital fly-by-wire airplane

    Science.gov (United States)

    Krier, G. E.

    1976-01-01

    The handling qualities of the F-8 digital fly by wire airplane are evaluated by using the Cooper-Harper rating scale. The reasons for the ratings are given, as well as a short description of the flying tasks. It was concluded that the handling qualities of the airplane were good in most situations, although occasional ratings of unsatisfactory were given.

  5. Design of active controls for the NASA F-8 digital fly-by-wire airplane

    Science.gov (United States)

    Gera, J.

    1976-01-01

    The design of a set of control laws for the NASA F-8 digital fly by wire research airplane is described. These control laws implement several active controls functions: maneuver load control, ride smoothing and departure boundary limiting. The criteria and methods which were used in the design of the control laws are also included. Results of linear analyses and nonlinear simulation are summarized.

  6. F-8 Digital Fly-by-Wire (DFBW) in flight over snow capped mountains

    Science.gov (United States)

    1973-01-01

    F-8 Digital Fly-by-Wire (DFBW) aircraft in flight over snow capped mountains. Externally identical to a standard Navy F-8C, this aircraft had its control system replaced initially by a primary system using an Apollo digital computer. The backup system used three analog computers. When the pilot moved the airplane's stick and rudder, electronic signals went to the computer, which would generate signals to move the control surfaces. The system was designed so that the digital fly-by-wire aircraft would handle almost identically to a standard F-8C. Later, in Phase 2, the aircraft used three IBM AP-101 computers for its flight control system. The F-8 Digital Fly-By-Wire (DFBW) flight research project validated the principal concepts of all-electric flight control systems now used on nearly all modern high-performance aircraft and on military and civilian transports. The first flight of the 13-year project was on May 25, 1972, with research pilot Gary E. Krier at the controls of a modified F-8C Crusader that served as the testbed for the fly-by-wire technologies. The project was a joint effort between the NASA Flight Research Center, Edwards, California, (now the Dryden Flight Research Center) and Langley Research Center. It included a total of 211 flights. The last flight was December 16, 1985, with Dryden research pilot Ed Schneider at the controls. The F-8 DFBW system was the forerunner of current fly-by-wire systems used in the space shuttles and on today's military and civil aircraft to make them safer, more maneuverable, and more efficient. Electronic fly-by-wire systems replaced older hydraulic control systems, freeing designers to design aircraft with reduced in-flight stability. Fly-by-wire systems are safer because of their redundancies. They are more maneuverable because computers can command more frequent adjustments than a human pilot can. For airliners, computerized control ensures a smoother ride than a human pilot alone can provide. Digital-fly-by-wire

  7. Description and Flight Test Results of the NASA F-8 Digital Fly-by-Wire Control System

    Science.gov (United States)

    1975-01-01

    A NASA program to develop digital fly-by-wire (DFBW) technology for aircraft applications is discussed. Phase I of the program demonstrated the feasibility of using a digital fly-by-wire system for aircraft control through developing and flight testing a single channel system, which used Apollo hardware, in an F-8C airplane. The objective of Phase II of the program is to establish a technology base for designing practical DFBW systems. It will involve developing and flight testing a triplex digital fly-by-wire system using state-of-the-art airborne computers, system hardware, software, and redundancy concepts. The papers included in this report describe the Phase I system and its development and present results from the flight program. Man-rated flight software and the effects of lightning on digital flight control systems are also discussed.

  8. Lightning effects on the NASA F-8 digital-fly-by-wire airplane

    Science.gov (United States)

    Plumer, J. A.; Fisher, F. A.; Walko, L. C.

    1975-01-01

    The effects of lightning on a Digital Fly-By-Wire (DFBW)aircraft control system were investigated. The aircraft was a NASA operated F-8 fitted with a modified Apollo guidance computer. Current pulses similar in waveshape to natural lightning, but lower in amplitude, were injected into the aircraft. Measurements were made of the voltages induced on the DFBW circuits, the total current induced on the bundles of wires, the magnetic field intensity inside the aircraft, and the current density on the skin of the aircraft. Voltage measurements were made in both the line-to-ground and line-to-line modes. Voltages measured at the non-destructive test level were then scaled upward to determine how much would be produced by actual lightning. A 200,000 ampere severe lightning flash would produce between 40 and 2000 volts in DFBW circuits. Some system components are expected to be vulnerable to these voltages.

  9. Design and development experience with a digital fly-by-wire control system in an F-8C airplane

    Science.gov (United States)

    Deets, D. A.

    1976-01-01

    To assess the feasibility of a digital fly by wire system, the mechanical flight control system of an F-8C airplane was replaced with a digital primary system and an analog backup system. The Apollo computer was used as the heart of the primary system. This paper discusses the experience gained during the design and development of the system and relates it to active control systems that are anticipated for future civil transport applications.

  10. Lightning effects on the NASA F-8 digital fly-by-wire airplane

    Science.gov (United States)

    Plumer, J. A.

    1975-01-01

    An investigation was conducted to evaluate the possible electromagnetic effects of lightning on a fly-by-wire flight control system which had been developed for an F8 aircraft. A brief description is presented of the flight control system. The test and measurement technique used in the investigation is discussed. The results of the investigation are considered, taking into account the vulnerability of individual system components to lightning induced voltages.

  11. Design and flight experience with a digital fly-by-wire control system in an F-8 airplane

    Science.gov (United States)

    Deets, D. A.; Szalai, K. J.

    1974-01-01

    A digital fly-by-wire flight control system was designed, built, and for the first time flown in an airplane. The system, which uses components from the Apollo guidance system, is installed in an F-8 airplane as the primary control system. A lunar module guidance computer is the central element in the three-axis, single-channel, multimode, digital control system. A triplex electrical analog system which provides unaugmented control of the airplane is the only backup to the digital system. Flight results showed highly successful system operation, although the trim update rate was inadequate for precise trim changes, causing minor concern. The use of a digital system to implement conventional control laws proved to be practical for flight. Logic functions coded as an integral part of the control laws were found to be advantageous. Although software verification required extensive effort, confidence in the software was achieved.

  12. Modern trends of aircraft fly-by-wire systems

    Directory of Open Access Journals (Sweden)

    С. С. Юцкевич

    2013-07-01

    Full Text Available Specifics of civil aviation modern transport aircraft fly-by-wire control systems are described. A comparison of the systems-level hardware and software, expressed through modes of guidance, provision of aircraft Airbus A-320, Boeing B-777, Tupolev Tu-214, Sukhoi Superjet SSJ-100 are carried out. The possibility of transition from mechanical control wiring to control through fly-by-wire system in the backup channel is shown.

  13. Mechanization of and experience with a triplex fly-by-wire backup control system

    Science.gov (United States)

    Lock, W. P.; Petersen, W. R.; Whitman, G. B.

    1976-01-01

    A redundant three axis analog control system was designed and developed to back up a digital fly by wire control system for an F-8C airplane. The mechanization and operational experience with the backup control system, the problems involved in synchronizing it with the primary system, and the reliability of the system are discussed. The backup control system was dissimilar to the primary system, and it provided satisfactory handling through the flight envelope evaluated. Limited flight tests of a variety of control tasks showed that control was also satisfactory when the backup control system was controlled by a minimum displacement (force) side stick. The operational reliability of the F-8 digital fly by wire control system was satisfactory, with no unintentional downmodes to the backup control system in flight. The ground and flight reliability of the system's components is discussed.

  14. A learning flight control system for the F8-DFBW aircraft. [Digital Fly-By-Wire

    Science.gov (United States)

    Montgomery, R. C.; Mekel, R.; Nachmias, S.

    1978-01-01

    This report contains a complete description of a learning control system designed for the F8-DFBW aircraft. The system is parameter-adaptive with the additional feature that it 'learns' the variation of the control system gains needed over the flight envelope. It, thus, generates and modifies its gain schedule when suitable data are available. The report emphasizes the novel learning features of the system: the forms of representation of the flight envelope and the process by which identified parameters are used to modify the gain schedule. It contains data taken during piloted real-time 6 degree-of-freedom simulations that were used to develop and evaluate the system.

  15. Stability region of closed-loop pilot-vehicle system for fly-by-wire aircraft with limited actuator rate

    OpenAIRE

    Ying-hui, Li; Liang, Qu; Hao-jun, Xu; Qi-meng, Cao

    2017-01-01

    The category-II PIO (Pilot Induced Oscillations) caused by actuator rate limitation of fly-by-wire airplanes will badly threaten the flight safety. The stability regions of closed-loop pilot-vehicle (CLPV) system with rate limited actuator were studied in this paper to assess stability of such CLPV system. The augmented state  variables were introduced to segregate the rate limited element from the primary  system in order to build the saturation nonlinear model of CLPV system. To get the max...

  16. Using Fly-By-Wire Technology in Future Models of the UH-60 and Other Rotary Wing Aircraft

    Science.gov (United States)

    Solem, Courtney K.

    2011-01-01

    Several fixed-winged airplanes have successfully used fly-by-wire (FBW) technology for the last 40 years. This technology is now beginning to be incorporated into rotary wing aircraft. By using FBW technology, manufacturers are expecting to improve upon the weight, maintenance time and costs, handling and reliability of the aircraft. Before mass production of this new system begins in new models such as the UH-60MU, testing must be conducted to insure the safety of this technology as well as to reassure others it will be worth the time and money to make such a dramatic change to a perfectly functional machine. The RASCAL JUH-60A has been modified for these purposes. This Black Hawk helicopter has already been equipped with the FBW technology and can be configured as a near perfect representation of the UH-60MU. Because both machines have very similar qualities, the data collected from the RASCAL can be used to make future decisions about the UH-60MU. The U.S. Army AFDD Flight Project Office oversees all the design modifications for every hardware system used in the RASCAL aircraft. This project deals with specific designs and analyses of unique RASCAL aircraft subsystems and their modifications to conduct flight mechanics research.

  17. Life-critical digital flight control systems

    Science.gov (United States)

    Mcwha, James

    1990-01-01

    Digital autopilot systems were first used on commercial airplanes in the late 1970s. The A-320 airplane was the first air transport airplane with a fly-by-wire primary flight control system. On the 767-X (777) airplane Boeing will install all fly-by-wire flight controls. Activities related to safety, industry status and program phases are discussed.

  18. NASA/RAE collaboration on nonlinear control using the F-8C digital fly-by-wire aircraft

    Science.gov (United States)

    Butler, G. F.; Corbin, M. J.; Mepham, S.; Stewart, J. F.; Larson, R. R.

    1983-01-01

    Design procedures are reviewed for variable integral control to optimize response (VICTOR) algorithms and results of preliminary flight tests are presented. The F-8C aircraft is operated in the remotely augmented vehicle (RAV) mode, with the control laws implemented as FORTRAN programs on a ground-based computer. Pilot commands and sensor information are telemetered to the ground, where the data are processed to form surface commands which are then telemetered back to the aircraft. The RAV mode represents a singlestring (simplex) system and is therefore vulnerable to a hardover since comparison monitoring is not possible. Hence, extensive error checking is conducted on both the ground and airborne computers to prevent the development of potentially hazardous situations. Experience with the RAV monitoring and validation procedures is described.

  19. Simultaneous G-Quadruplex DNA Logic.

    Science.gov (United States)

    Bader, Antoine; Cockroft, Scott L

    2018-04-03

    A fundamental principle of digital computer operation is Boolean logic, where inputs and outputs are described by binary integer voltages. Similarly, inputs and outputs may be processed on the molecular level as exemplified by synthetic circuits that exploit the programmability of DNA base-pairing. Unlike modern computers, which execute large numbers of logic gates in parallel, most implementations of molecular logic have been limited to single computing tasks, or sensing applications. This work reports three G-quadruplex-based logic gates that operate simultaneously in a single reaction vessel. The gates respond to unique Boolean DNA inputs by undergoing topological conversion from duplex to G-quadruplex states that were resolved using a thioflavin T dye and gel electrophoresis. The modular, addressable, and label-free approach could be incorporated into DNA-based sensors, or used for resolving and debugging parallel processes in DNA computing applications. © 2018 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

  20. Macrocyclic G-quadruplex ligands

    DEFF Research Database (Denmark)

    Nielsen, M C; Ulven, Trond

    2010-01-01

    are macrocyclic structures which have been modeled after the natural product telomestatin or from porphyrin-based ligands discovered in the late 1990s. These two structural classes of G-quadruplex ligands are reviewed here with special attention to selectivity and structure-activity relationships, and with focus...

  1. DNA and RNA Quadruplex-Binding Proteins

    Czech Academy of Sciences Publication Activity Database

    Brázda, Václav; Haroniková, Lucia; Liao, J.C.C.; Fojta, Miroslav

    2014-01-01

    Roč. 15, č. 10 (2014), s. 17493-17517 E-ISSN 1422-0067 R&D Projects: GA ČR(CZ) GBP206/12/G151 Institutional support: RVO:68081707 Keywords : DNA quadruplex * RNA quadruplex * telomere Subject RIV: BO - Biophysics Impact factor: 2.862, year: 2014

  2. Multimerization rules for G-quadruplexes

    Czech Academy of Sciences Publication Activity Database

    Kolesnikova, Sofia; Hubálek, Martin; Bednárová, Lucie; Cvačka, Josef; Curtis, Edward A.

    2017-01-01

    Roč. 45, č. 15 (2017), s. 8684-8696 ISSN 0305-1048 Institutional support: RVO:61388963 Keywords : tetramolecular G-quadruplexes * RNA G-quadruplexes * circular dichroism Subject RIV: CE - Biochemistry OBOR OECD: Biochemistry and molecular biology Impact factor: 10.162, year: 2016 https://academic.oup.com/nar/article/45/15/8684/4002725/Multimerization-rules-for-Gquadruplexes

  3. Seven essential questions on G-quadruplexes.

    Science.gov (United States)

    König, Sebastian L B; Evans, Amanda C; Huppert, Julian L

    2010-08-01

    The helical duplex architecture of DNA was discovered by Francis Crick and James Watson in 1951 and is well known and understood. However, nucleic acids can also adopt alternative structural conformations that are less familiar, although no less biologically relevant, such as the G-quadruplex. G-quadruplexes continue to be the subject of a rapidly expanding area of research, owing to their significant potential as therapeutic targets and their unique biophysical properties. This review begins by focusing on G-quadruplex structure, elucidating the intermolecular and intramolecular interactions underlying its formation and highlighting several substructural variants. A variety of methods used to characterize these structures are also outlined. The current state of G-quadruplex research is then addressed by proffering seven pertinent questions for discussion. This review concludes with an overview of possible directions for future research trajectories in this exciting and relevant field.

  4. Designing a New Class of Bases for Nucleic Acid Quadruplexes and Quadruplex-Active Ligands.

    Science.gov (United States)

    Bazzi, Sophia; Novotný, Jan; Yurenko, Yevgen P; Marek, Radek

    2015-06-22

    A new class of quadruplex nucleobases, derived from 3-deazaguanine, has been designed for various applications as smart quadruplex ligands as well as quadruplex-based aptamers, receptors, and sensors. An efficient strategy for modifying the guanine quadruplex core has been developed and tested by using quantum chemistry methods. Several potential guanine derivatives modified at the 3- or 8-position or both are analyzed, and the results compared to reference systems containing natural guanine. Analysis of the formation energies (BLYP-D3(BJ)/def2-TZVPP level of theory, in combination with the COSMO model for water) in model systems consisting of two and three stacked tetrads with Na(+) /K(+) ion(s) inside the internal channel indicates that the formation of structures with 3-halo-3-deazaguanine bases leads to a substantial gain in energy, as compared to the corresponding reference guanine complexes. The results cast light on changes in the noncovalent interactions (hydrogen bonding, stacking, and ion coordination) in a quadruplex stem upon modification of the guanine core. In particular, the enhanced stability of the modified quadruplexes was shown to originate mainly from increased π-π stacking. Our study suggests the 3-halo-3-deazaguanine skeleton as a potential building unit for quadruplex systems and smart G-quadruplex ligands. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  5. Selectivity in ligand recognition of G-quadruplex loops.

    Science.gov (United States)

    Campbell, Nancy H; Patel, Manisha; Tofa, Amina B; Ghosh, Ragina; Parkinson, Gary N; Neidle, Stephen

    2009-03-03

    A series of disubstituted acridine ligands have been cocrystallized with a bimolecular DNA G-quadruplex. The ligands have a range of cyclic amino end groups of varying size. The crystal structures show that the diagonal loop in this quadruplex results in a large cavity for these groups, in contrast to the steric constraints imposed by propeller loops in human telomeric quadruplexes. We conclude that the nature of the loop has a significant influence on ligand selectivity for particular quadruplex folds.

  6. Thermal stability of DNA quadruplex-duplex hybrids.

    Science.gov (United States)

    Lim, Kah Wai; Khong, Zi Jian; Phan, Anh Tuân

    2014-01-14

    DNA has the capacity to adopt several distinct structural forms, such as duplex and quadruplex helices, which have been implicated in cellular processes and shown to exhibit important functional properties. Quadruplex-duplex hybrids, generated from the juxtaposition of these two structural elements, could find applications in therapeutics and nanotechnology. Here we used NMR and CD spectroscopy to investigate the thermal stability of two classes of quadruplex-duplex hybrids comprising fundamentally distinct modes of duplex and quadruplex connectivity: Construct I involves the coaxial orientation of the duplex and quadruplex helices with continual base stacking across the two components; Construct II involves the orthogonal orientation of the duplex and quadruplex helices with no base stacking between the two components. We have found that for both constructs, the stability of the quadruplex generally increases with the length of the stem-loop incorporated, with respect to quadruplexes comprising nonstructured loops of the same length, which showed a continuous drop in stability with increasing loop length. The stability of these complexes, particularly Construct I, can be substantially influenced by the base-pair steps proximal to the quadruplex-duplex junction. Bulges at the junction are largely detrimental to the adoption of the desired G-quadruplex topology for Construct I but not for Construct II. These findings should facilitate future design and prediction of quadruplex-duplex hybrids.

  7. Extended molecular dynamics of a c-kit promoter quadruplex

    Czech Academy of Sciences Publication Activity Database

    Islam, B.; Stadlbauer, Petr; Krepl, Miroslav; Koča, J.; Neidle, S.; Haider, S.; Šponer, Jiří

    2015-01-01

    Roč. 43, č. 18 (2015), s. 8673-8693 ISSN 0305-1048 R&D Projects: GA ČR(CZ) GAP208/11/1822 Institutional support: RVO:68081707 Keywords : TELOMERIC G-QUADRUPLEX * INTRAMOLECULAR DNA QUADRUPLEXES * GASTROINTESTINAL STROMAL TUMOR Subject RIV: BO - Biophysics Impact factor: 9.202, year: 2015

  8. Altered biochemical specificity of G-quadruplexes with mutated tetrads

    Czech Academy of Sciences Publication Activity Database

    Švehlová, Kateřina; Lawrence, M. S.; Bednárová, Lucie; Curtis, Edward A.

    2016-01-01

    Roč. 44, č. 22 (2016), s. 10789-10803 ISSN 0305-1048 Institutional support: RVO:61388963 Keywords : G-quadruplex * G motif GTP aptamer * peroxidase deoxyribozyme Subject RIV: CE - Biochemistry Impact factor: 10.162, year: 2016 https://academic.oup.com/nar/article/44/22/10789/2333933/Altered-biochemical-specificity-of-G-quadruplexes

  9. Xanthene and Xanthone Derivatives as G-Quadruplex Stabilizing Ligands

    Directory of Open Access Journals (Sweden)

    Alessandro Altieri

    2013-10-01

    Full Text Available Following previous studies on anthraquinone and acridine-based G-quadruplex ligands, here we present a study of similar aromatic cores, with the specific aim of increasing G-quadruplex binding and selectivity with respect to duplex DNA. Synthesized compounds include two and three-side chain xanthone and xanthene derivatives, as well as a dimeric “bridged” form. ESI and FRET measurements suggest that all the studied molecules are good G-quadruplex ligands, both at telomeres and on G-quadruplex forming sequences of oncogene promoters. The dimeric compound and the three-side chain xanthone derivative have been shown to represent the best compounds emerging from the different series of ligands presented here, having also high selectivity for G-quadruplex structures with respect to duplex DNA. Molecular modeling simulations are in broad agreement with the experimental data.

  10. Electrochemical and AFM Characterization of G-Quadruplex Electrochemical Biosensors and Applications

    Science.gov (United States)

    2018-01-01

    Guanine-rich DNA sequences are able to form G-quadruplexes, being involved in important biological processes and representing smart self-assembling nanomaterials that are increasingly used in DNA nanotechnology and biosensor technology. G-quadruplex electrochemical biosensors have received particular attention, since the electrochemical response is particularly sensitive to the DNA structural changes from single-stranded, double-stranded, or hairpin into a G-quadruplex configuration. Furthermore, the development of an increased number of G-quadruplex aptamers that combine the G-quadruplex stiffness and self-assembling versatility with the aptamer high specificity of binding to a variety of molecular targets allowed the construction of biosensors with increased selectivity and sensitivity. This review discusses the recent advances on the electrochemical characterization, design, and applications of G-quadruplex electrochemical biosensors in the evaluation of metal ions, G-quadruplex ligands, and other small organic molecules, proteins, and cells. The electrochemical and atomic force microscopy characterization of G-quadruplexes is presented. The incubation time and cations concentration dependence in controlling the G-quadruplex folding, stability, and nanostructures formation at carbon electrodes are discussed. Different G-quadruplex electrochemical biosensors design strategies, based on the DNA folding into a G-quadruplex, the use of G-quadruplex aptamers, or the use of hemin/G-quadruplex DNAzymes, are revisited. PMID:29666699

  11. Efficient Long-Range Hole Transport Through G-Quadruplexes.

    Science.gov (United States)

    Wu, Jingyuan; Meng, Zhenyu; Lu, Yunpeng; Shao, Fangwei

    2017-10-09

    DNA offers a means of long-range charge transport for biology and electric nanodevices. Here, a series of tetra-stranded G-quadruplexes were assembled within a dendritic DNA architecture to explore oxidative charge transport (hole transport) through the G-quadruplex. Efficient charge transport was achieved over 28 Å upon UV irradiation. Over a longer G-quadruplex bridge, hole transport was escalated to a higher efficiency, which resulted in a higher yield than that of the optimal duplex DNA for charge transport, that is, the adenine tract. Efficient long-range hole transport suggests tetra-stranded G-quadruplexes, instead of an oxidation hotspot, hold better potential as an electron conduit than duplex DNA. © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

  12. Guanine base stacking in G-quadruplex nucleic acids

    Science.gov (United States)

    Lech, Christopher Jacques; Heddi, Brahim; Phan, Anh Tuân

    2013-01-01

    G-quadruplexes constitute a class of nucleic acid structures defined by stacked guanine tetrads (or G-tetrads) with guanine bases from neighboring tetrads stacking with one another within the G-tetrad core. Individual G-quadruplexes can also stack with one another at their G-tetrad interface leading to higher-order structures as observed in telomeric repeat-containing DNA and RNA. In this study, we investigate how guanine base stacking influences the stability of G-quadruplexes and their stacked higher-order structures. A structural survey of the Protein Data Bank is conducted to characterize experimentally observed guanine base stacking geometries within the core of G-quadruplexes and at the interface between stacked G-quadruplex structures. We couple this survey with a systematic computational examination of stacked G-tetrad energy landscapes using quantum mechanical computations. Energy calculations of stacked G-tetrads reveal large energy differences of up to 12 kcal/mol between experimentally observed geometries at the interface of stacked G-quadruplexes. Energy landscapes are also computed using an AMBER molecular mechanics description of stacking energy and are shown to agree quite well with quantum mechanical calculated landscapes. Molecular dynamics simulations provide a structural explanation for the experimentally observed preference of parallel G-quadruplexes to stack in a 5′–5′ manner based on different accessible tetrad stacking modes at the stacking interfaces of 5′–5′ and 3′–3′ stacked G-quadruplexes. PMID:23268444

  13. Effect of Urea on G-Quadruplex Stability.

    Science.gov (United States)

    Aslanyan, Lusine; Ko, Jordan; Kim, Byul G; Vardanyan, Ishkhan; Dalyan, Yeva B; Chalikian, Tigran V

    2017-07-13

    G-quadruplexes represent a class of noncanonical nucleic acid structures implicated in transcriptional regulation, cellular function, and disease. An understanding of the forces involved in stabilization and destabilization of the G-quadruplex conformation relative to the duplex or single-stranded conformation is a key to elucidating the biological role of G-quadruplex-based genomic switches and the quest for therapeutic means for controlled induction or suppression of a G-quadruplex at selected genomic loci. Solute-solvent interactions provide a ubiquitous and, in many cases, the determining thermodynamic force in maintaining and modulating the stability of nucleic acids. These interactions involve water as well as water-soluble cosolvents that may be present in the solution or in the crowded environment in the cell. We present here the first quantitative investigation of the effect of urea, a destabilizing cosolvent, on the conformational preferences of a G-quadruplex formed by the telomeric d[A(G 3 T 2 A) 3 G 3 ] sequence (Tel22). At 20 mM NaCl and room temperature, Tel22 undergoes a two-state urea-induced unfolding transition. An increase in salt mitigates the deleterious effect of urea on Tel22. The urea m-value of Tel22 normalized per change in solvent-accessible surface area, ΔS A , is similar to those for other DNA and RNA structures while being several-fold larger than that of proteins. Our results suggest that urea can be employed as an analytical tool in thermodynamic characterizations of G-quadruplexes in a manner similar to the use of urea in protein studies. We emphasize the need for further studies involving a larger selection of G-quadruplexes varying in sequence, topology (parallel, antiparallel, hybrid), and molecularity (monomolecular, bimolecular, tetramolecular) to outline the advantages and the limits of the use of urea in G-quadruplex studies. A deeper understanding of the effect of solvent and cosolvents on the differential stability of the

  14. Studies of G-quadruplexes formed within self-assembled DNA mini-circles.

    Science.gov (United States)

    Klejevskaja, Beata; Pyne, Alice L B; Reynolds, Matthew; Shivalingam, Arun; Thorogate, Richard; Hoogenboom, Bart W; Ying, Liming; Vilar, Ramon

    2016-10-13

    We have developed self-assembled DNA mini-circles that contain a G-quadruplex-forming sequence from the c-Myc oncogene promoter and demonstrate by FRET that the G-quadruplex unfolding kinetics are 10-fold slower than for the simpler 24-mer G-quadruplex that is commonly used for FRET experiments.

  15. Transcriptional control by G-quadruplexes: In vivo roles and perspectives for specific intervention.

    Science.gov (United States)

    Armas, Pablo; David, Aldana; Calcaterra, Nora B

    2017-01-01

    G-quadruplexes are non-canonical DNA secondary structures involved in several genomic and molecular processes. Here, we summarize the main G-quadruplex features and evidences proving the in vivo role on the transcriptional regulation of genes required for zebrafish embryonic development. We also discuss alternative strategies for specifically interfering G-quadruplex in vivo.

  16. Dual Recognition of Human Telomeric G-quadruplex by Neomycin-anthraquinone Conjugate

    Science.gov (United States)

    Ranjan, Nihar; Davis, Erik; Xue, Liang

    2013-01-01

    The authors report the recognition of a G-quadruplex formed by four repeat human telomeric DNA with aminosugar intercalator conjugates. The recognition of G-quadruplex through dual binding mode ligands significantly increased the affinity of ligands for G-quadruplex. One such example is a neomycin-anthraquinone 2 which exhibited nanomolar affinity for the quadruplex, and the affinity of 2 is nearly 1000 fold higher for human telomeric G-quadruplex DNA than its constituent units, neomycin and anthraquinone. PMID:23698792

  17. G-Quadruplex Forming Oligonucleotides as Anti-HIV Agents.

    Science.gov (United States)

    Musumeci, Domenica; Riccardi, Claudia; Montesarchio, Daniela

    2015-09-22

    Though a variety of different non-canonical nucleic acids conformations have been recognized, G-quadruplex structures are probably the structural motifs most commonly found within known oligonucleotide-based aptamers. This could be ascribed to several factors, as their large conformational diversity, marked responsiveness of their folding/unfolding processes to external stimuli, high structural compactness and chemo-enzymatic and thermodynamic stability. A number of G-quadruplex-forming oligonucleotides having relevant in vitro anti-HIV activity have been discovered in the last two decades through either SELEX or rational design approaches. Improved aptamers have been obtained by chemical modifications of natural oligonucleotides, as terminal conjugations with large hydrophobic groups, replacement of phosphodiester linkages with phosphorothioate bonds or other surrogates, insertion of base-modified monomers, etc. In turn, detailed structural studies have elucidated the peculiar architectures adopted by many G-quadruplex-based aptamers and provided insight into their mechanism of action. An overview of the state-of-the-art knowledge of the relevance of putative G-quadruplex forming sequences within the viral genome and of the most studied G-quadruplex-forming aptamers, selectively targeting HIV proteins, is here presented.

  18. Aminoglycosylation can enhance the G-quadruplex binding activity of epigallocatechin.

    Directory of Open Access Journals (Sweden)

    Li-Ping Bai

    Full Text Available With the aim of enhancing G-quadruplex binding activity, two new glucosaminosides (16, 18 of penta-methylated epigallocatechin were synthesized by chemical glycosylation. Subsequent ESI-TOF-MS analysis demonstrated that these two glucosaminoside derivatives exhibit much stronger binding activity to human telomeric DNA and RNA G-quadruplexes than their parent structure (i.e., methylated EGC (14 as well as natural epigallocatechin (EGC, 6. The DNA G-quadruplex binding activity of 16 and 18 is even more potent than strong G-quadruplex binder quercetin, which has a more planar structure. These two synthetic compounds also showed a higher binding strength to human telomeric RNA G-quadruplex than its DNA counterpart. Analysis of the structure-activity relationship revealed that the more basic compound, 16, has a higher binding capacity with DNA and RNA G-quadruplexes than its N-acetyl derivative, 18, suggesting the importance of the basicity of the aminoglycoside for G-quadruplex binding activity. Molecular docking simulation predicted that the aromatic ring of 16 π-stacks with the aromatic ring of guanine nucleotides, with the glucosamine moiety residing in the groove of G-quadruplex. This research indicates that glycosylation of natural products with aminosugar can significantly enhance their G-quadruplex binding activities, thus is an effective way to generate small molecules targeting G-quadruplexes in nucleic acids. In addition, this is the first report that green tea catechin can bind to nucleic acid G-quadruplex structures.

  19. Distance-dependent duplex DNA destabilization proximal to G-quadruplex/i-motif sequences

    Science.gov (United States)

    König, Sebastian L. B.; Huppert, Julian L.; Sigel, Roland K. O.; Evans, Amanda C.

    2013-01-01

    G-quadruplexes and i-motifs are complementary examples of non-canonical nucleic acid substructure conformations. G-quadruplex thermodynamic stability has been extensively studied for a variety of base sequences, but the degree of duplex destabilization that adjacent quadruplex structure formation can cause has yet to be fully addressed. Stable in vivo formation of these alternative nucleic acid structures is likely to be highly dependent on whether sufficient spacing exists between neighbouring duplex- and quadruplex-/i-motif-forming regions to accommodate quadruplexes or i-motifs without disrupting duplex stability. Prediction of putative G-quadruplex-forming regions is likely to be assisted by further understanding of what distance (number of base pairs) is required for duplexes to remain stable as quadruplexes or i-motifs form. Using oligonucleotide constructs derived from precedented G-quadruplexes and i-motif-forming bcl-2 P1 promoter region, initial biophysical stability studies indicate that the formation of G-quadruplex and i-motif conformations do destabilize proximal duplex regions. The undermining effect that quadruplex formation can have on duplex stability is mitigated with increased distance from the duplex region: a spacing of five base pairs or more is sufficient to maintain duplex stability proximal to predicted quadruplex/i-motif-forming regions. PMID:23771141

  20. Digitization

    DEFF Research Database (Denmark)

    Finnemann, Niels Ole

    2014-01-01

    what a concept of digital media might add to the understanding of processes of mediatization and what the concept of mediatization might add to the understanding of digital media. It is argued that digital media open an array of new trajectories in human communication, trajectories which were...

  1. A Dual-Specific Targeting Approach Based on the Simultaneous Recognition of Duplex and Quadruplex Motifs.

    Science.gov (United States)

    Nguyen, Thi Quynh Ngoc; Lim, Kah Wai; Phan, Anh Tuân

    2017-09-20

    Small-molecule ligands targeting nucleic acids have been explored as potential therapeutic agents. Duplex groove-binding ligands have been shown to recognize DNA in a sequence-specific manner. On the other hand, quadruplex-binding ligands exhibit high selectivity between quadruplex and duplex, but show limited discrimination between different quadruplex structures. Here we propose a dual-specific approach through the simultaneous application of duplex- and quadruplex-binders. We demonstrated that a quadruplex-specific ligand and a duplex-specific ligand can simultaneously interact at two separate binding sites of a quadruplex-duplex hybrid harbouring both quadruplex and duplex structural elements. Such a dual-specific targeting strategy would combine the sequence specificity of duplex-binders and the strong binding affinity of quadruplex-binders, potentially allowing the specific targeting of unique quadruplex structures. Future research can be directed towards the development of conjugated compounds targeting specific genomic quadruplex-duplex sites, for which the linker would be highly context-dependent in terms of length and flexibility, as well as the attachment points onto both ligands.

  2. Stability of Human Telomere Quadruplexes at High DNA Concentrations

    Czech Academy of Sciences Publication Activity Database

    Kejnovská, Iva; Vorlíčková, Michaela; Brázdová, Marie; Sagi, J.

    2014-01-01

    Roč. 101, č. 4 (2014), s. 428-438 ISSN 0006-3525 R&D Projects: GA ČR(CZ) GAP205/12/0466 Institutional support: RVO:68081707 Keywords : quadruplex * DNA concentration * folding topology Subject RIV: BO - Biophysics Impact factor: 2.385, year: 2014

  3. Pyrrolobenzodiazepines (PBDs do not bind to DNA G-quadruplexes.

    Directory of Open Access Journals (Sweden)

    Khondaker M Rahman

    Full Text Available The pyrrolo[2,1-c][1,4] benzodiazepines (PBDs are a family of sequence-selective, minor-groove binding DNA-interactive agents that covalently attach to guanine residues. A recent publication in this journal (Raju et al, PloS One, 2012, 7, 4, e35920 reported that two PBD molecules were observed to bind with high affinity to the telomeric quadruplex of Tetrahymena glaucoma based on Electrospray Ionisation Mass Spectrometry (ESI-MS, Circular Dichroism, UV-Visible and Fluorescence spectroscopy data. This was a surprising result given the close 3-dimensional shape match between the structure of all PBD molecules and the minor groove of duplex DNA, and the completely different 3-dimensional structure of quadruplex DNA. Therefore, we evaluated the interaction of eight PBD molecules of diverse structure with a range of parallel, antiparallel and mixed DNA quadruplexes using DNA Thermal Denaturation, Circular Dichroism and Molecular Dynamics Simulations. Those PBD molecules without large C8-substitutents had an insignificant affinity for the eight quadruplex types, although those with large π-system-containing C8-substituents (as with the compounds evaluated by Raju and co-workers were found to interact to some extent. Our molecular dynamics simulations support the likelihood that molecules of this type, including those examined by Raju and co-workers, interact with quadruplex DNA through their C8-substituents rather than the PBD moiety itself. It is important for the literature to be clear on this matter, as the mechanism of action of these agents will be under close scrutiny in the near future due to the growing number of PBD-based agents entering the clinic as both single-agents and as components of antibody-drug conjugates (ADCs.

  4. DIGITAL

    Data.gov (United States)

    Federal Emergency Management Agency, Department of Homeland Security — The Digital Flood Insurance Rate Map (DFIRM) Database depicts flood risk information and supporting data used to develop the risk data. The primary risk...

  5. A multi-functional guanine derivative for studying the DNA G-quadruplex structure.

    Science.gov (United States)

    Ishizuka, Takumi; Zhao, Pei-Yan; Bao, Hong-Liang; Xu, Yan

    2017-10-23

    In the present study, we developed a multi-functional guanine derivative, 8F G, as a G-quadruplex stabilizer, a fluorescent probe for the detection of G-quadruplex formation, and a 19 F sensor for the observation of the G-quadruplex. We demonstrate that the functional nucleoside bearing a 3,5-bis(trifluoromethyl)benzene group at the 8-position of guanine stabilizes the DNA G-quadruplex structure and fluoresces following the G-quadruplex formation. Furthermore, we show that the functional sensor can be used to directly observe DNA G-quadruplexes by 19 F-NMR in living cells. To our knowledge, this is the first study showing that the nucleoside derivative simultaneously allows for three kinds of functions at a single G-quadruplex DNA. Our results suggest that the multi-functional nucleoside derivative can be broadly used for studying the G-quadruplex structure and serves as a powerful tool for examining the molecular basis of G-quadruplex formation in vitro and in living cells.

  6. Small Molecule Microarrays Enable the Identification of a Selective, Quadruplex-Binding Inhibitor of MYC Expression.

    Science.gov (United States)

    Felsenstein, Kenneth M; Saunders, Lindsey B; Simmons, John K; Leon, Elena; Calabrese, David R; Zhang, Shuling; Michalowski, Aleksandra; Gareiss, Peter; Mock, Beverly A; Schneekloth, John S

    2016-01-15

    The transcription factor MYC plays a pivotal role in cancer initiation, progression, and maintenance. However, it has proven difficult to develop small molecule inhibitors of MYC. One attractive route to pharmacological inhibition of MYC has been the prevention of its expression through small molecule-mediated stabilization of the G-quadruplex (G4) present in its promoter. Although molecules that bind globally to quadruplex DNA and influence gene expression are well-known, the identification of new chemical scaffolds that selectively modulate G4-driven genes remains a challenge. Here, we report an approach for the identification of G4-binding small molecules using small molecule microarrays (SMMs). We use the SMM screening platform to identify a novel G4-binding small molecule that inhibits MYC expression in cell models, with minimal impact on the expression of other G4-associated genes. Surface plasmon resonance (SPR) and thermal melt assays demonstrated that this molecule binds reversibly to the MYC G4 with single digit micromolar affinity, and with weaker or no measurable binding to other G4s. Biochemical and cell-based assays demonstrated that the compound effectively silenced MYC transcription and translation via a G4-dependent mechanism of action. The compound induced G1 arrest and was selectively toxic to MYC-driven cancer cell lines containing the G4 in the promoter but had minimal effects in peripheral blood mononucleocytes or a cell line lacking the G4 in its MYC promoter. As a measure of selectivity, gene expression analysis and qPCR experiments demonstrated that MYC and several MYC target genes were downregulated upon treatment with this compound, while the expression of several other G4-driven genes was not affected. In addition to providing a novel chemical scaffold that modulates MYC expression through G4 binding, this work suggests that the SMM screening approach may be broadly useful as an approach for the identification of new G4-binding small

  7. Thrombin-Binding Aptamer Quadruplex Formation: AFM and Voltammetric Characterization

    Directory of Open Access Journals (Sweden)

    Victor Constantin Diculescu

    2010-01-01

    Full Text Available The adsorption and the redox behaviour of thrombin-binding aptamer (TBA and extended TBA (eTBA were studied using atomic force microscopy and voltammetry at highly oriented pyrolytic graphite and glassy carbon. The different adsorption patterns and degree of surface coverage were correlated with the sequence base composition, presence/absence of K+, and voltammetric behaviour of TBA and eTBA. In the presence of K+, only a few single-stranded sequences present adsorption, while the majority of the molecules forms stable and rigid quadruplexes with no adsorption. Both TBA and eTBA are oxidized and the only anodic peak corresponds to guanine oxidation. Upon addition of K+ ions, TBA and eTBA fold into a quadruplex, causing the decrease of guanine oxidation peak and occurrence of a new peak at a higher potential due to the oxidation of G-quartets. The higher oxidation potential of G-quartets is due to the greater difficulty of electron transfer from the inside of the quadruplex to the electrode surface than electron transfer from the more flexible single strands.

  8. Superhelicity Constrains a Localized and R-Loop-Dependent Formation of G-Quadruplexes at the Upstream Region of Transcription.

    Science.gov (United States)

    Zheng, Ke-Wei; He, Yi-de; Liu, Hong-He; Li, Xin-Min; Hao, Yu-Hua; Tan, Zheng

    2017-10-20

    Transcription induces formation of intramolecular G-quadruplex structures at the upstream region of a DNA duplex by an upward transmission of negative supercoiling through the DNA. Currently the regulation of such G-quadruplex formation remains unclear. Using plasmid as a model, we demonstrate that while it is the dynamic negative supercoiling generated by a moving RNA polymerase that triggers a formation of a G-quadruplex, the constitutional superhelicity determines the potential and range of the formation of a G-quadruplex by constraining the propagation of the negative supercoiling. G-quadruplex formation is maximal in negatively supercoiled and nearly abolished in relaxed plasmids while being moderate in nicked and linear ones. The formation of a G-quadruplex strongly correlates with the presence of an R-loop. Preventing R-loop formation virtually abolished G-quadruplex formation even in the negatively supercoiled plasmid. Enzymatic action and protein binding that manipulate supercoiling or its propagation all impact the formation of G-quadruplexes. Because chromosomes and plasmids in cells in their natural form are maintained in a supercoiled state, our findings reveal a physical basis that justifies the formation and regulation of G-quadruplexes in vivo. The structural features involved in G-quadruplex formation may all serve as potential targets in clinical and therapeutic applications.

  9. Local epigenetic reprogramming induced by G-quadruplex ligands

    Science.gov (United States)

    Guilbaud, Guillaume; Murat, Pierre; Recolin, Bénédicte; Campbell, Beth C.; Maiter, Ahmed; Sale, Julian E.; Balasubramanian, Shankar

    2017-11-01

    DNA and histone modifications regulate transcriptional activity and thus represent valuable targets to reprogram the activity of genes. Current epigenetic therapies target the machinery that regulates these modifications, leading to global transcriptional reprogramming with the potential for extensive undesired effects. Epigenetic information can also be modified as a consequence of disrupting processive DNA replication. Here, we demonstrate that impeding replication by small-molecule-mediated stabilization of G-quadruplex nucleic acid secondary structures triggers local epigenetic plasticity. We report the use of the BU-1 locus of chicken DT40 cells to screen for small molecules able to induce G-quadruplex-dependent transcriptional reprogramming. Further characterization of the top hit compound revealed its ability to induce a dose-dependent inactivation of BU-1 expression in two steps: the loss of H3K4me3 and then subsequent DNA cytosine methylation, changes that were heritable across cell divisions even after the compound was removed. Targeting DNA secondary structures thus represents a potentially new approach for locus-specific epigenetic reprogramming.

  10. Studies of G-quadruplex DNA structures at the single molecule level

    DEFF Research Database (Denmark)

    Kragh, Sofie Louise

    2015-01-01

    Folding of G-quaduplex structures adopted by the human telomeric repeat is here studied by single molecule FRET microscopy. This method allows for the investigation of G-quadruplex structures and their conformational dynamic. Telomeres are located at the ends of our chromosomes and end in a single...... with human telomeric repeat adopt several different G-quadruplex conformations in the presence of K+ ions. G-quadruplexes inhibit telomerase activity and are therefore potential targets for anti-cancer drugs, which can be small molecule ligands capable of stabilizing G-quadruplex structures. Understanding...... range. FRET spectroscopy can be performed on an ensemble of molecules, or on the single molecule level. In single molecule FRET experiments it is possible to follow the behaviour in time for each molecule independently, allowing insight into both dynamically and statistically heterogeneous molecular...

  11. Design, synthesis and evaluation of 4,7-diamino-1,10-phenanthroline G-quadruplex ligands

    DEFF Research Database (Denmark)

    Nielsen, Mads Corvinius; Borch, Jonas; Ulven, Trond

    2009-01-01

    the central ionic column. Introduction of positively charged side chains results in compounds with appreciable G-quadruplex stabilizing properties and high aqueous solubility, with the longer side chains giving more potent compounds. Ligands carrying guanidine side chains in general show higher quadruplex...... stabilizing activity and distinctly slower kinetic properties than their amino and dimethylamino analogues, possibly due to specific hydrogen bond interactions with the G-quadruplex loops....

  12. Effect of Monovalent Ion Parameters on Molecular Dynamics Simulations of G-Quadruplexes

    Czech Academy of Sciences Publication Activity Database

    Havrila, Marek; Stadlbauer, Petr; Islam, Barira; Otyepka, M.; Šponer, Jiří

    2017-01-01

    Roč. 13, č. 8 (2017), s. 3911-3926 ISSN 1549-9618 R&D Projects: GA MŠk EF15_003/0000477; GA ČR(CZ) GA16-13721S Institutional support: RVO:68081707 Keywords : telomeric g-quadruplex * amber force-field * nucleic-acid quadruplexes Subject RIV: CF - Physical ; Theoretical Chemistry OBOR OECD: Physical chemistry Impact factor: 5.245, year: 2016

  13. Amyloid Precursor Protein Translation Is Regulated by a 3'UTR Guanine Quadruplex.

    Directory of Open Access Journals (Sweden)

    Ezekiel Crenshaw

    Full Text Available A central event in Alzheimer's disease is the accumulation of amyloid β (Aβ peptides generated by the proteolytic cleavage of the amyloid precursor protein (APP. APP overexpression leads to increased Aβ generation and Alzheimer's disease in humans and altered neuronal migration and increased long term depression in mice. Conversely, reduction of APP expression results in decreased Aβ levels in mice as well as impaired learning and memory and decreased numbers of dendritic spines. Together these findings indicate that therapeutic interventions that aim to restore APP and Aβ levels must do so within an ideal range. To better understand the effects of modulating APP levels, we explored the mechanisms regulating APP expression focusing on post-transcriptional regulation. Such regulation can be mediated by RNA regulatory elements such as guanine quadruplexes (G-quadruplexes, non-canonical structured RNA motifs that affect RNA stability and translation. Via a bioinformatics approach, we identified a candidate G-quadruplex within the APP mRNA in its 3'UTR (untranslated region at residues 3008-3027 (NM_201414.2. This sequence exhibited characteristics of a parallel G-quadruplex structure as revealed by circular dichroism spectrophotometry. Further, as with other G-quadruplexes, the formation of this structure was dependent on the presence of potassium ions. This G-quadruplex has no apparent role in regulating transcription or mRNA stability as wild type and mutant constructs exhibited equivalent mRNA levels as determined by real time PCR. Instead, we demonstrate that this G-quadruplex negatively regulates APP protein expression using dual luciferase reporter and Western blot analysis. Taken together, our studies reveal post-transcriptional regulation by a 3'UTR G-quadruplex as a novel mechanism regulating APP expression.

  14. Heterocyclic Dications as a New Class of Telomeric G-Quadruplex Targeting Agents

    Science.gov (United States)

    Nanjunda, Rupesh; Musetti, Caterina; Kumar, Arvind; Ismail, Mohamed A.; Farahat, Abdelbasset A.; Wang, Siming; Sissi, Claudia; Palumbo, Manlio; Boykin, David W.; Wilson, W. David

    2013-01-01

    Small molecules that can induce and stabilize G-quadruplex DNA structures represent a novel approach for anti-cancer and anti-parasitic therapy and extensive efforts have been directed towards discovering lead compounds that are capable of stabilizing quadruplexes. The purpose of this study is to explore conformational modifications in a series of heterocyclic dications to discover structural motifs that can selectively bind and stabilize specific G-quadruplexes, such as those present in the human telomere. The G-quadruplex has various potential recognition sites for small molecules; however, the primary interaction site of most of these ligands is the terminal tetrads. Similar to duplex-DNA groove recognition, quadruplex groove recognition by small molecules offers the potential for enhanced selectivity that can be developed into a viable therapeutic strategy. The compounds investigated were selected based on preliminary studies with DB832, a bifuryl-phenyl diamidine with a unique telomere interaction. This compound provides a paradigm that can help in understanding the optimum compound-DNA interactions that lead to quadruplex groove recognition. DNA recognition by the DB832 derivatives was investigated by biophysical experiments such as thermal melting, circular dichroism, mass spectrometry and NMR. Biological studies were also performed to complement the biophysical data. The results suggest a complex binding mechanism which involves the recognition of grooves for some ligands as well as stacking at the terminal tetrads of the human telomeric G-quadruplex for most of the ligands. These molecules represent an excellent starting point for further SAR analysis for diverse modes of quadruplex recognition and subsequent structure optimization for drug development. PMID:22380518

  15. Thermodynamic fingerprints of ligand binding to human telomeric G-quadruplexes

    OpenAIRE

    Bon?ina, Matja?; Podlipnik, ?rtomir; Piantanida, Ivo; Eilmes, Julita; Teulade-Fichou, Marie-Paule; Vesnaver, Gorazd; Lah, Jurij

    2015-01-01

    Thermodynamic studies of ligand binding to human telomere (ht) DNA quadruplexes, as a rule, neglect the involvement of various ht-DNA conformations in the binding process. Therefore, the thermodynamic driving forces and the mechanisms of ht-DNA G-quadruplex-ligand recognition remain poorly understood. In this work we characterize thermodynamically and structurally binding of netropsin (Net), dibenzotetraaza[14]annulene derivatives (DP77, DP78), cationic porphyrin (TMPyP4) and two bisquinolini...

  16. The G-quadruplex DNA stabilizing drug pyridostatin promotes DNA damage and downregulates transcription of Brca1 in neurons.

    Science.gov (United States)

    Moruno-Manchon, Jose F; Koellhoffer, Edward C; Gopakumar, Jayakrishnan; Hambarde, Shashank; Kim, Nayun; McCullough, Louise D; Tsvetkov, Andrey S

    2017-09-12

    The G-quadruplex is a non-canonical DNA secondary structure formed by four DNA strands containing multiple runs of guanines. G-quadruplexes play important roles in DNA recombination, replication, telomere maintenance, and regulation of transcription. Small molecules that stabilize the G-quadruplexes alter gene expression in cancer cells. Here, we hypothesized that the G-quadruplexes regulate transcription in neurons. We discovered that pyridostatin, a small molecule that specifically stabilizes G-quadruplex DNA complexes, induced neurotoxicity and promoted the formation of DNA double-strand breaks (DSBs) in cultured neurons. We also found that pyridostatin downregulated transcription of the Brca1 gene, a gene that is critical for DSB repair. Importantly, in an in vitro gel shift assay, we discovered that an antibody specific to the G-quadruplex structure binds to a synthetic oligonucleotide, which corresponds to the first putative G-quadruplex in the Brca1 gene promoter. Our results suggest that the G-quadruplex complexes regulate transcription in neurons. Studying the G-quadruplexes could represent a new avenue for neurodegeneration and brain aging research.

  17. G-quadruplexes as novel cis-elements controlling transcription during embryonic development.

    Science.gov (United States)

    David, Aldana P; Margarit, Ezequiel; Domizi, Pablo; Banchio, Claudia; Armas, Pablo; Calcaterra, Nora B

    2016-05-19

    G-quadruplexes are dynamic structures folded in G-rich single-stranded DNA regions. These structures have been recognized as a potential nucleic acid based mechanism for regulating multiple cellular processes such as replication, transcription and genomic maintenance. So far, their transcriptional role in vivo during vertebrate embryonic development has not yet been addressed. Here, we performed an in silico search to find conserved putative G-quadruplex sequences (PQSs) within proximal promoter regions of human, mouse and zebrafish developmental genes. Among the PQSs able to fold in vitro as G-quadruplex, those present in nog3, col2a1 and fzd5 promoters were selected for further studies. In cellulo studies revealed that the selected G-quadruplexes affected the transcription of luciferase controlled by the SV40 nonrelated promoter. G-quadruplex disruption in vivo by microinjection in zebrafish embryos of either small ligands or DNA oligonucleotides complementary to the selected PQSs resulted in lower transcription of the targeted genes. Moreover, zebrafish embryos and larvae phenotypes caused by the presence of complementary oligonucleotides fully resembled those ones reported for nog3, col2a1 and fzd5 morphants. To our knowledge, this is the first work revealing in vivo the role of conserved G-quadruplexes in the embryonic development, one of the most regulated processes of the vertebrates biology. © The Author(s) 2016. Published by Oxford University Press on behalf of Nucleic Acids Research.

  18. Conformation and stability of intramolecular telomeric G-quadruplexes: sequence effects in the loops.

    Directory of Open Access Journals (Sweden)

    Giovanna Sattin

    Full Text Available Telomeres are guanine-rich sequences that protect the ends of chromosomes. These regions can fold into G-quadruplex structures and their stabilization by G-quadruplex ligands has been employed as an anticancer strategy. Genetic analysis in human telomeres revealed extensive allelic variation restricted to loop bases, indicating that the variant telomeric sequences maintain the ability to fold into G-quadruplex. To assess the effect of mutations in loop bases on G-quadruplex folding and stability, we performed a comprehensive analysis of mutant telomeric sequences by spectroscopic techniques, molecular dynamics simulations and gel electrophoresis. We found that when the first position in the loop was mutated from T to C or A the resulting structure adopted a less stable antiparallel topology; when the second position was mutated to C or A, lower thermal stability and no evident conformational change were observed; in contrast, substitution of the third position from A to C induced a more stable and original hybrid conformation, while mutation to T did not significantly affect G-quadruplex topology and stability. Our results indicate that allelic variations generate G-quadruplex telomeric structures with variable conformation and stability. This aspect needs to be taken into account when designing new potential anticancer molecules.

  19. Experimental approaches to identify cellular G-quadruplex structures and functions.

    Science.gov (United States)

    Di Antonio, Marco; Rodriguez, Raphaël; Balasubramanian, Shankar

    2012-05-01

    Guanine-rich nucleic acids can fold into non-canonical DNA secondary structures called G-quadruplexes. The formation of these structures can interfere with the biology that is crucial to sustain cellular homeostases and metabolism via mechanisms that include transcription, translation, splicing, telomere maintenance and DNA recombination. Thus, due to their implication in several biological processes and possible role promoting genomic instability, G-quadruplex forming sequences have emerged as potential therapeutic targets. There has been a growing interest in the development of synthetic molecules and biomolecules for sensing G-quadruplex structures in cellular DNA. In this review, we summarise and discuss recent methods developed for cellular imaging of G-quadruplexes, and the application of experimental genomic approaches to detect G-quadruplexes throughout genomic DNA. In particular, we will discuss the use of engineered small molecules and natural proteins to enable pull-down, ChIP-Seq, ChIP-chip and fluorescence imaging of G-quadruplex structures in cellular DNA. Copyright © 2012 Elsevier Inc. All rights reserved.

  20. Putative DNA G-quadruplex formation within the promoters of Plasmodium falciparum var genes

    Directory of Open Access Journals (Sweden)

    Rowe J

    2009-08-01

    Full Text Available Abstract Background Guanine-rich nucleic acid sequences are capable of folding into an intramolecular four-stranded structure called a G-quadruplex. When found in gene promoter regions, G-quadruplexes can downregulate gene expression, possibly by blocking the transcriptional machinery. Here we have used a genome-wide bioinformatic approach to identify Putative G-Quadruplex Sequences (PQS in the Plasmodium falciparum genome, along with biophysical techniques to examine the physiological stability of P. falciparum PQS in vitro. Results We identified 63 PQS in the non-telomeric regions of the P. falciparum clone 3D7. Interestingly, 16 of these PQS occurred in the upstream region of a subset of the P. falciparum var genes (group B var genes. The var gene family encodes PfEMP1, the parasite's major variant antigen and adhesin expressed at the surface of infected erythrocytes, that plays a key role in malaria pathogenesis and immune evasion. The ability of the PQS found in the upstream regions of group B var genes (UpsB-Q to form stable G-quadruplex structures in vitro was confirmed using 1H NMR, circular dichroism, UV spectroscopy, and thermal denaturation experiments. Moreover, the synthetic compound BOQ1 that shows a higher affinity for DNA forming quadruplex rather than duplex structures was found to bind with high affinity to the UpsB-Q. Conclusion This is the first demonstration of non-telomeric PQS in the genome of P. falciparum that form stable G-quadruplexes under physiological conditions in vitro. These results allow the generation of a novel hypothesis that the G-quadruplex sequences in the upstream regions of var genes have the potential to play a role in the transcriptional control of this major virulence-associated multi-gene family.

  1. G-Quadruplex conformational change driven by pH variation with potential application as a nanoswitch.

    Science.gov (United States)

    Yan, Yi-Yong; Tan, Jia-Heng; Lu, Yu-Jing; Yan, Siu-Cheong; Wong, Kwok-Yin; Li, Ding; Gu, Lian-Quan; Huang, Zhi-Shu

    2013-10-01

    G-Quadruplex is a highly polymorphic structure, and its behavior in acidic condition has not been well studied. Circular dichroism (CD) spectra were used to study the conformational change of G-quadruplex. The thermal stabilities of the G-quadruplex were measured with CD melting. Interconversion kinetics profiles were investigated by using CD kinetics. The fluorescence of the inserted 2-Aminopurine (Ap) was monitored during pH change and acrylamide quenching, indicating the status of the loop. Proton NMR was adopted to help illustrate the change of the conformation. G-Quadruplex of specific loop was found to be able to transform upon pH variation. The transformation was resulted from the loop rearrangement. After screening of a library of diverse G-quadruplex, a sequence exhibiting the best transformation property was found. A pH-driven nanoswitch with three gears was obtained based on this transition cycle. Certain G-quadruplex was found to go through conformational change at low pH. Loop was the decisive factor controlling the interconversion upon pH variation. G-Quadruplex with TT central loop could be converted in a much milder condition than the one with TTA loop. It can be used to design pH-driven nanodevices such as a nanoswitch. These results provide more insights into G-quadruplex polymorphism, and also contribute to the design of DNA-based nanomachines and logic gates. © 2013.

  2. Folding of guanine quadruplex molecules-funnel-like mechanism or kinetic partitioning? An overview from MD simulation studies

    Czech Academy of Sciences Publication Activity Database

    Šponer, Jiří; Bussi, G.; Stadlbauer, Petr; Kührová, P.; Banáš, P.; Islam, Barira; Haider, S.; Neidle, S.; Otyepka, M.

    2017-01-01

    Roč. 1861, č. 5 (2017), s. 1246-1263 ISSN 0304-4165 R&D Projects: GA ČR(CZ) GA16-13721S Institutional support: RVO:68081707 Keywords : telomeric g-quadruplex * parallel g-quadruplex Subject RIV: CE - Biochemistry OBOR OECD: Biochemistry and molecular biology Impact factor: 4.702, year: 2016

  3. G-quadruplex induced chirality of methylazacalix[6]pyridine via unprecedented binding stoichiometry: en route to multiplex controlled molecular switch

    Science.gov (United States)

    Guan, Ai-Jiao; Shen, Meng-Jie; Xiang, Jun-Feng; Zhang, En-Xuan; Li, Qian; Sun, Hong-Xia; Wang, Li-Xia; Xu, Guang-Zhi; Tang, Ya-Lin; Xu, Li-Jin; Gong, Han-Yuan

    2015-05-01

    Nucleic acid based molecular device is a developing research field which attracts great interests in material for building machinelike nanodevices. G-quadruplex, as a new type of DNA secondary structures, can be harnessed to construct molecular device owing to its rich structural polymorphism. Herein, we developed a switching system based on G-quadruplexes and methylazacalix[6]pyridine (MACP6). The induced circular dichroism (CD) signal of MACP6 was used to monitor the switch controlled by temperature or pH value. Furthermore, the CD titration, Job-plot, variable temperature CD and 1H-NMR experiments not only confirmed the binding mode between MACP6 and G-quadruplex, but also explained the difference switching effect of MACP6 and various G-quadruplexes. The established strategy has the potential to be used as the chiral probe for specific G-quadruplex recognition.

  4. Selection of G-quadruplex folding topology with LNA-modified human telomeric sequences in K+ solution

    DEFF Research Database (Denmark)

    Pradhan, Devranjan; Hansen, Lykke H; Vester, Birte

    2011-01-01

    G-rich nucleic acid oligomers can form G-quadruplexes built by G-tetrads stacked upon each other. Depending on the nucleotide sequence, G-quadruplexes fold mainly with two topologies: parallel, in which all G-tracts are oriented parallel to each other, or antiparallel, in which one or more G......-tracts are oriented antiparallel to the other G-tracts. In the former topology, all glycosidic bond angles conform to anti conformations, while in the latter topology they adopt both syn and anti conformations. It is of interest to understand the molecular forces that govern G-quadruplex folding. Here, we approach...... this problem by examining the impact of LNA (locked nucleic acid) modifications on the folding topology of the dimeric model system of the human telomere sequence. In solution, this DNA G-quadruplex forms a mixture of G-quadruplexes with antiparallel and parallel topologies. Using CD and NMR spectroscopies, we...

  5. Disordering of human telomeric G-quadruplex with novel antiproliferative anthrathiophenedione.

    Directory of Open Access Journals (Sweden)

    Dmitry Kaluzhny

    Full Text Available Linear heteroareneanthracenediones have been shown to interfere with DNA functions, thereby causing death of human tumor cells and their drug resistant counterparts. Here we report the interaction of our novel antiproliferative agent 4,11-bis[(2-{[acetimido]amino}ethylamino]anthra[2,3-b]thiophene-5,10-dione with telomeric DNA structures studied by isothermal titration calorimetry, circular dichroism and UV absorption spectroscopy. New compound demonstrated a high affinity (K(ass∼10⁶ M⁻¹ for human telomeric antiparallel quadruplex d(TTAGGG₄ and duplex d(TTAGGG₄∶d(CCCTAA₄. Importantly, a ∼100-fold higher affinity was determined for the ligand binding to an unordered oligonucleotide d(TTAGGG TTAGAG TTAGGG TTAGGG unable to form quadruplex structures. Moreover, in the presence of Na+ the compound caused dramatic conformational perturbation of the telomeric G-quadruplex, namely, almost complete disordering of G-quartets. Disorganization of a portion of G-quartets in the presence of K+ was also detected. Molecular dynamics simulations were performed to illustrate how the binding of one molecule of the ligand might disrupt the G-quartet adjacent to the diagonal loop of telomeric G-quadruplex. Our results provide evidence for a non-trivial mode of alteration of G-quadruplex structure by tentative antiproliferative drugs.

  6. GNG Motifs Can Replace a GGG Stretch during G-Quadruplex Formation in a Context Dependent Manner.

    Directory of Open Access Journals (Sweden)

    Kohal Das

    Full Text Available G-quadruplexes are one of the most commonly studied non-B DNA structures. Generally, these structures are formed using a minimum of 4, three guanine tracts, with connecting loops ranging from one to seven. Recent studies have reported deviation from this general convention. One such deviation is the involvement of bulges in the guanine tracts. In this study, guanines along with bulges, also referred to as GNG motifs have been extensively studied using recently reported HOX11 breakpoint fragile region I as a model template. By strategic mutagenesis approach we show that the contribution from continuous G-tracts may be dispensible during G-quadruplex formation when such motifs are flanked by GNGs. Importantly, the positioning and number of GNG/GNGNG can also influence the formation of G-quadruplexes. Further, we assessed three genomic regions from HIF1 alpha, VEGF and SHOX gene for G-quadruplex formation using GNG motifs. We show that HIF1 alpha sequence harbouring GNG motifs can fold into intramolecular G-quadruplex. In contrast, GNG motifs in mutant VEGF sequence could not participate in structure formation, suggesting that the usage of GNG is context dependent. Importantly, we show that when two continuous stretches of guanines are flanked by two independent GNG motifs in a naturally occurring sequence (SHOX, it can fold into an intramolecular G-quadruplex. Finally, we show the specific binding of G-quadruplex binding protein, Nucleolin and G-quadruplex antibody, BG4 to SHOX G-quadruplex. Overall, our study provides novel insights into the role of GNG motifs in G-quadruplex structure formation which may have both physiological and pathological implications.

  7. Expanding the potential of G-quadruplex structures: formation of a heterochiral TBA analogue.

    Science.gov (United States)

    Virgilio, Antonella; Varra, Michela; Scuotto, Maria; Capuozzo, Antonella; Irace, Carlo; Mayol, Luciano; Esposito, Veronica; Galeone, Aldo

    2014-03-21

    In order to expand the potential applications of G-quadruplex structures, we explored the ability of heterochiral oligodeoxynucleotides based on the thrombin-binding aptamer (TBA) sequence to fold into similar complexes, with particular focus on their resistance in biological environments. A combination of CD and NMR techniques was used. Similarly to TBA, the ODN ggTTggtgtggTTgg (lower case letters indicate L residues) is able to fold into a chair-like antiparallel G-quadruplex structure, but has a slightly higher thermal stability. The discovery that heterochiral ODNs are able to form stable G-quadruplex structures opens up new possibilities for their development in several fields, as aptamers, sensors and, as recently shown, as catalysts for enantioselective reactions. © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  8. Synthesis and Molecular Modeling of Thermally Stable DNA G-Quadruplexes with Anthraquinone Insertions

    DEFF Research Database (Denmark)

    Gouda, Alaa S.; Amine, Mahasen S.; Pedersen, Erik Bjerregaard

    2017-01-01

    Two new phosphoramidite building blocks for DNA synthesis were synthesized from 1,5- and 2,6-dihydroxyanthraquinones through alkylation with 3-bromo-1-propanol followed by DMT-protection. The novel synthesized 1,5- and 2,6-disubstituted anthraquinone monomers H15 and H26 are incorporated into a G...... anthraquinone-modified quadruplexes revealed no change of the antiparallel structure when compared with the wild type under potassium buffer conditions. The significantly increased thermostabilities were interpreted by molecular modeling of anthraquinone-modified G-quadruplexes....

  9. Stabilization of Telomere G-Quadruplexes Interferes with Human Herpesvirus 6A Chromosomal Integration.

    Science.gov (United States)

    Gilbert-Girard, Shella; Gravel, Annie; Artusi, Sara; Richter, Sara N; Wallaschek, Nina; Kaufer, Benedikt B; Flamand, Louis

    2017-07-15

    Human herpesviruses 6A and 6B (HHV-6A/B) can integrate their genomes into the telomeres of human chromosomes using a mechanism that remains poorly understood. To achieve a better understanding of the HHV-6A/B integration mechanism, we made use of BRACO-19, a compound that stabilizes G-quadruplex secondary structures and prevents telomere elongation by the telomerase complex. First, we analyzed the folding of telomeric sequences into G-quadruplex structures and their binding to BRACO-19 using G-quadruplex-specific antibodies and surface plasmon resonance. Circular dichroism studies indicate that BRACO-19 modifies the conformation and greatly stabilizes the G-quadruplexes formed in G-rich telomeric DNA. Subsequently we assessed the effects of BRACO-19 on the HHV-6A initial phase of infection. Our results indicate that BRACO-19 does not affect entry of HHV-6A DNA into cells. We next investigated if stabilization of G-quadruplexes by BRACO-19 affected HHV-6A's ability to integrate its genome into host chromosomes. Incubation of telomerase-expressing cells with BRACO-19, such as HeLa and MCF-7, caused a significant reduction in the HHV-6A integration frequency ( P integration frequency in U2OS cells that lack telomerase activity and elongate their telomeres through alternative lengthening mechanisms. Our data suggest that the fluidity of telomeres is important for efficient chromosomal integration of HHV-6A and that interference with telomerase activity negatively affects the generation of cellular clones containing integrated HHV-6A. IMPORTANCE HHV-6A/B can integrate their genomes into the telomeres of infected cells. Telomeres consist of repeated hexanucleotides (TTAGGG) of various lengths (up to several kilobases) and end with a single-stranded 3' extension. To avoid recognition and induce a DNA damage response, the single-stranded overhang folds back on itself and forms a telomeric loop (T-loop) or adopts a tertiary structure, referred to as a G-quadruplex. In the

  10. Repair of O6-methylguanine adducts in human telomeric G-quadruplex DNA by O6-alkylguanine-DNA alkyltransferase

    Science.gov (United States)

    Hellman, Lance M.; Spear, Tyler J.; Koontz, Colton J.; Melikishvili, Manana; Fried, Michael G.

    2014-01-01

    O6-alkylguanine-DNA alkyltransferase (AGT) is a single-cycle DNA repair enzyme that removes pro-mutagenic O6-alkylguanine adducts from DNA. Its functions with short single-stranded and duplex substrates have been characterized, but its ability to act on other DNA structures remains poorly understood. Here, we examine the functions of this enzyme on O6-methylguanine (6mG) adducts in the four-stranded structure of the human telomeric G-quadruplex. On a folded 22-nt G-quadruplex substrate, binding saturated at 2 AGT:DNA, significantly less than the ∼5 AGT:DNA found with linear single-stranded DNAs of similar length, and less than the value found with the telomere sequence under conditions that inhibit quadruplex formation (4 AGT:DNA). Despite these differences, AGT repaired 6mG adducts located within folded G-quadruplexes, at rates that were comparable to those found for a duplex DNA substrate under analogous conditions. Repair was kinetically biphasic with the amplitudes of rapid and slow phases dependent on the position of the adduct within the G-quadruplex: in general, adducts located in the top or bottom tetrads of a quadruplex stack exhibited more rapid-phase repair than did adducts located in the inner tetrad. This distinction may reflect differences in the conformational dynamics of 6mG residues in G-quadruplex DNAs. PMID:25080506

  11. Controlling the stoichiometry and strand polarity of a tetramolecular G-quadruplex structure by using a DNA origami frame

    Science.gov (United States)

    Rajendran, Arivazhagan; Endo, Masayuki; Hidaka, Kumi; Lan Thao Tran, Phong; Mergny, Jean-Louis; Sugiyama, Hiroshi

    2013-01-01

    Guanine-rich oligonucleotides often show a strong tendency to form supramolecular architecture, the so-called G-quadruplex structure. Because of the biological significance, it is now considered to be one of the most important conformations of DNA. Here, we describe the direct visualization and single-molecule analysis of the formation of a tetramolecular G-quadruplex in KCl solution. The conformational changes were carried out by incorporating two duplex DNAs, with G–G mismatch repeats in the middle, inside a DNA origami frame and monitoring the topology change of the strands. In the absence of KCl, incorporated duplexes had no interaction and laid parallel to each other. Addition of KCl induced the formation of a G-quadruplex structure by stably binding the duplexes to each other in the middle. Such a quadruplex formation allowed the DNA synapsis without disturbing the duplex regions of the participating sequences, and resulted in an X-shaped structure that was monitored by atomic force microscopy. Further, the G-quadruplex formation in KCl solution and its disruption in KCl-free buffer were analyzed in real-time. The orientation of the G-quadruplex is often difficult to control and investigate using traditional biochemical methods. However, our method using DNA origami could successfully control the strand orientations, topology and stoichiometry of the G-quadruplex. PMID:23863846

  12. Fluorescent Dansyl-Guanosine Conjugates that Bind c-MYC Promoter G-Quadruplex and Downregulate c-MYC Expression.

    Science.gov (United States)

    Pavan Kumar, Y; Saha, Puja; Saha, Dhurjhoti; Bessi, Irene; Schwalbe, Harald; Chowdhury, Shantanu; Dash, Jyotirmayee

    2016-03-02

    The four-stranded G-quadruplex present in the c-MYC P1 promoter has been shown to play a pivotal role in the regulation of c-MYC transcription. Small-molecule compounds capable of inhibiting the c-MYC promoter activity by stabilising the c-MYC G-quadruplex could potentially be used as anticancer agents. In this context, here we report the synthesis of dansyl-guanosine conjugates through one-pot modular click reactions. The dansyl-guanosine conjugates can selectively detect c-MYC G-quadruplex over other biologically relevant quadruplexes and duplex DNA and can be useful as staining reagents for selective visualisation of c-MYC G-quadruplex over duplex DNA by gel electrophoresis. NMR spectroscopic titrations revealed the preferential binding sites of these dansyl ligands to the c-MYC G-quadruplex. A dual luciferase assay and qRT-PCR revealed that a dansyl-bisguanosine ligand represses the c-MYC expression, possibly by stabilising the c-MYC G-quadruplex. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  13. Charge splitters and charge transport junctions based on guanine quadruplexes

    Science.gov (United States)

    Sha, Ruojie; Xiang, Limin; Liu, Chaoren; Balaeff, Alexander; Zhang, Yuqi; Zhang, Peng; Li, Yueqi; Beratan, David N.; Tao, Nongjian; Seeman, Nadrian C.

    2018-04-01

    Self-assembling circuit elements, such as current splitters or combiners at the molecular scale, require the design of building blocks with three or more terminals. A promising material for such building blocks is DNA, wherein multiple strands can self-assemble into multi-ended junctions, and nucleobase stacks can transport charge over long distances. However, nucleobase stacking is often disrupted at junction points, hindering electric charge transport between the two terminals of the junction. Here, we show that a guanine-quadruplex (G4) motif can be used as a connector element for a multi-ended DNA junction. By attaching specific terminal groups to the motif, we demonstrate that charges can enter the structure from one terminal at one end of a three-way G4 motif, and can exit from one of two terminals at the other end with minimal carrier transport attenuation. Moreover, we study four-way G4 junction structures by performing theoretical calculations to assist in the design and optimization of these connectors.

  14. G-Quadruplexes influence pri-microRNA processing.

    Science.gov (United States)

    Rouleau, Samuel G; Garant, Jean-Michel; Bolduc, François; Bisaillon, Martin; Perreault, Jean-Pierre

    2018-02-01

    RNA G-Quadruplexes (G4) have been shown to possess many biological functions, including the regulation of microRNA (miRNA) biogenesis and function. However, their impact on pri-miRNA processing remains unknown. We identified G4 located near the Drosha cleavage site in three distinct pri-miRNAs: pri-mir200c, pri-mir451a, and pri-mir497. The folding of the potential G4 motifs was determined in solution. Subsequently, mutations disrupting G4 folding led to important changes in the mature miRNAs levels in cells. Moreover, using small antisense oligonucleotides binding to the pri-miRNA, it was possible to modulate, either positively or negatively, the mature miRNA levels. Together, these data demonstrate that G4 motifs could contribute to the regulation of pri-mRNA processing, a novel role for G4. Considering that bio-informatics screening indicates that between 9% and 50% of all pri-miRNAs contain a putative G4, these structures possess interesting potential as future therapeutic targets.

  15. Structural Insights into the Quadruplex-Duplex 3' Interface Formed from a Telomeric Repeat: A Potential Molecular Target.

    Science.gov (United States)

    Russo Krauss, Irene; Ramaswamy, Sneha; Neidle, Stephen; Haider, Shozeb; Parkinson, Gary N

    2016-02-03

    We report here on an X-ray crystallographic and molecular modeling investigation into the complex 3' interface formed between putative parallel stranded G-quadruplexes and a duplex DNA sequence constructed from the human telomeric repeat sequence TTAGGG. Our crystallographic approach provides a detailed snapshot of a telomeric 3' quadruplex-duplex junction: a junction that appears to have the potential to form a unique molecular target for small molecule binding and interference with telomere-related functions. This unique target is particularly relevant as current high-affinity compounds that bind putative G-quadruplex forming sequences only rarely have a high degree of selectivity for a particular quadruplex. Here DNA junctions were assembled using different putative quadruplex-forming scaffolds linked at the 3' end to a telomeric duplex sequence and annealed to a complementary strand. We successfully generated a series of G-quadruplex-duplex containing crystals, both alone and in the presence of ligands. The structures demonstrate the formation of a parallel folded G-quadruplex and a B-form duplex DNA stacked coaxially. Most strikingly, structural data reveals the consistent formation of a TAT triad platform between the two motifs. This triad allows for a continuous stack of bases to link the quadruplex motif with the duplex region. For these crystal structures formed in the absence of ligands, the TAT triad interface occludes ligand binding at the 3' quadruplex-duplex interface, in agreement with in silico docking predictions. However, with the rearrangement of a single nucleotide, a stable pocket can be produced, thus providing an opportunity for the binding of selective molecules at the interface.

  16. A new cationic porphyrin derivative (TMPipEOPP with large side arm substituents: a highly selective G-quadruplex optical probe.

    Directory of Open Access Journals (Sweden)

    Li-Na Zhu

    Full Text Available The discovery of uncommon DNA structures and speculation about their potential functions in genes has brought attention to specific DNA structure recognition. G-quadruplexes are four-stranded nucleic acid structures formed by G-rich DNA (or RNA sequences. G-rich sequences with a high potential to form G-quadruplexes have been found in many important genomic regions. Porphyrin derivatives with cationic side arm substituents are important G-quadruplex-binding ligands. For example, 5,10,15,20-Tetrakis(N-methylpyridinium-4-yl-21H,23H-porphyrin (TMPyP4, interacts strongly with G-quadruplexes, but has poor selectivity for G-quadruplex versus duplex DNA. To increase the G-quadruplex recognition specificity, a new cationic porphyrin derivative, 5,10,15,20-tetra-{4-[2-(1-methyl-1-piperidinylethoxy]phenyl} porphyrin (TMPipEOPP, with large side arm substituents was synthesized, and the interactions between TMPipEOPP and different DNA structures were compared. The results show that G-quadruplexes cause large changes in the UV-Vis absorption and fluorescence spectra of TMPipEOPP, but duplex and single-stranded DNAs do not, indicating that TMPipEOPP can be developed as a highly specific optical probe for discriminating G-quadruplex from duplex and single-stranded DNA. Visual discrimination is also possible. Job plot and Scatchard analysis suggest that a complicated binding interaction occurs between TMPipEOPP and G-quadruplexes. At a low [G-quadruplex]/[TMPipEOPP] ratio, one G-quadruplex binds two TMPipEOPP molecules by end-stacking and outside binding modes. At a high [G-quadruplex]/[TMPipEOPP] ratio, two G-quadruplexes bind to one TMPipEOPP molecule in a sandwich-like end-stacking mode.

  17. A new cationic porphyrin derivative (TMPipEOPP) with large side arm substituents: a highly selective G-quadruplex optical probe.

    Science.gov (United States)

    Zhu, Li-Na; Zhao, Shu-Juan; Wu, Bin; Li, Xiao-Zeng; Kong, De-Ming

    2012-01-01

    The discovery of uncommon DNA structures and speculation about their potential functions in genes has brought attention to specific DNA structure recognition. G-quadruplexes are four-stranded nucleic acid structures formed by G-rich DNA (or RNA) sequences. G-rich sequences with a high potential to form G-quadruplexes have been found in many important genomic regions. Porphyrin derivatives with cationic side arm substituents are important G-quadruplex-binding ligands. For example, 5,10,15,20-Tetrakis(N-methylpyridinium-4-yl)-21H,23H-porphyrin (TMPyP4), interacts strongly with G-quadruplexes, but has poor selectivity for G-quadruplex versus duplex DNA. To increase the G-quadruplex recognition specificity, a new cationic porphyrin derivative, 5,10,15,20-tetra-{4-[2-(1-methyl-1-piperidinyl)ethoxy]phenyl} porphyrin (TMPipEOPP), with large side arm substituents was synthesized, and the interactions between TMPipEOPP and different DNA structures were compared. The results show that G-quadruplexes cause large changes in the UV-Vis absorption and fluorescence spectra of TMPipEOPP, but duplex and single-stranded DNAs do not, indicating that TMPipEOPP can be developed as a highly specific optical probe for discriminating G-quadruplex from duplex and single-stranded DNA. Visual discrimination is also possible. Job plot and Scatchard analysis suggest that a complicated binding interaction occurs between TMPipEOPP and G-quadruplexes. At a low [G-quadruplex]/[TMPipEOPP] ratio, one G-quadruplex binds two TMPipEOPP molecules by end-stacking and outside binding modes. At a high [G-quadruplex]/[TMPipEOPP] ratio, two G-quadruplexes bind to one TMPipEOPP molecule in a sandwich-like end-stacking mode.

  18. Cation Coordination Alters the Conformation of a Thrombin-Binding G-Quadruplex DNA Aptamer That Affects Inhibition of Thrombin.

    Science.gov (United States)

    Zavyalova, Elena; Tagiltsev, Grigory; Reshetnikov, Roman; Arutyunyan, Alexander; Kopylov, Alexey

    2016-10-01

    Thrombin-binding aptamers are promising anticoagulants. HD1 is a monomolecular antiparallel G-quadruplex with two G-quartets linked by three loops. Aptamer-thrombin interactions are mediated with two TT-loops that bind thrombin exosite I. Several cations were shown to be coordinated inside the G-quadruplex, including K + , Na + , NH 4 + , Ba 2+ , and Sr 2+ ; on the contrary, Mn 2+ was coordinated in the grooves, outside the G-quadruplex. K + or Na + coordination provides aptamer functional activity. The effect of other cations on aptamer functional activity has not yet been described, because of a lack of relevant tests. Interactions between aptamer HD1 and a series of cations were studied. A previously developed enzymatic method was applied to evaluate aptamer inhibitory activity. The structure-function correlation was studied using the characterization of G-quadruplex conformation by circular dichroism spectroscopy. K + coordination provided the well-known high inhibitory activity of the aptamer, whereas Na + coordination supported low activity. Although NH 4 + coordination yielded a typical antiparallel G-quadruplex, no inhibitory activity was shown; a similar effect was observed for Ba 2+ and Sr 2+ coordination. Mn 2+ coordination destabilized the G-quadruplex that drastically diminished aptamer inhibitory activity. Therefore, G-quadruplex existence per se is insufficient for aptamer inhibitory activity. To elicit the nature of these effects, we thoroughly analyzed nuclear magnetic resonance (NMR) and X-ray data on the structure of the HD1 G-quadruplex with various cations. The most reasonable explanation is that cation coordination changes the conformation of TT-loops, affecting thrombin binding and inhibition. HD1 counterparts, aptamers 31-TBA and NU172, behaved similarly with some distinctions. In 31-TBA, an additional duplex module stabilized antiparallel G-quadruplex conformation at high concentrations of divalent cations; whereas in NU172, a different

  19. Unexpected Position-Dependent Effects of Ribose G-Quartets in G-Quadruplexes

    Czech Academy of Sciences Publication Activity Database

    Zhou, J.; Amrane, S.; Rosu, F.; Salgado, G.; Bian, Y.; Tateishi-Karimata, H.; Largy, E.; Korkut, D. N.; Bourdoncle, A.; Miyoshi, D.; Zhang, J.; Ju, H.; Wang, W.; Sugimoto, N.; Gabelica, V.; Mergny, Jean-Louis

    2017-01-01

    Roč. 139, č. 23 (2017), s. 7768-7779 ISSN 0002-7863 Institutional support: RVO:68081707 Keywords : human telomeric rna * electrospray mass-spectrometry * molecular crowding conditions * dna g-quadruplexes Subject RIV: BO - Biophysics OBOR OECD: Electrochemistry (dry cells, batteries, fuel cells, corrosion metals, electrolysis) Impact factor: 13.858, year: 2016

  20. Human telomeric DNA: G-quadruplex, i-motif and Watson–Crick double helix

    Science.gov (United States)

    Phan, Anh Tuân; Mergny, Jean-Louis

    2002-01-01

    Human telomeric DNA composed of (TTAGGG/CCCTAA)n repeats may form a classical Watson–Crick double helix. Each individual strand is also prone to quadruplex formation: the G-rich strand may adopt a G-quadruplex conformation involving G-quartets whereas the C-rich strand may fold into an i-motif based on intercalated C·C+ base pairs. Using an equimolar mixture of the telomeric oligonucleotides d[AGGG(TTAGGG)3] and d[(CCCTAA)3CCCT], we defined which structures existed and which would be the predominant species under a variety of experimental conditions. Under near-physiological conditions of pH, temperature and salt concentration, telomeric DNA was predominantly in a double-helix form. However, at lower pH values or higher temperatures, the G-quadruplex and/or the i-motif efficiently competed with the duplex. We also present kinetic and thermodynamic data for duplex association and for G-quadruplex/i-motif unfolding. PMID:12409451

  1. Multifunctional energy landscape for a DNA G-quadruplex: An evolved molecular switch

    Czech Academy of Sciences Publication Activity Database

    Cragnolini, T.; Chakraborty, D.; Šponer, Jiří; Derreumaux, P.; Pasquali, S.; Wales, D.J.

    2017-01-01

    Roč. 147, č. 15 (2017), č. článku 152715. ISSN 0021-9606 R&D Projects: GA ČR(CZ) GA16-13721S Institutional support: RVO:68081707 Keywords : telomeric g-quadruplex * gb1 hairpin peptide Subject RIV: CF - Physical ; Theoretical Chemistry OBOR OECD: Physical chemistry Impact factor: 2.965, year: 2016

  2. A Selective G-Quadruplex DNA-Stabilizing Ligand Based on a Cyclic Naphthalene Diimide Derivative

    Directory of Open Access Journals (Sweden)

    Md. Monirul Islam

    2015-06-01

    Full Text Available A cyclic naphthalene diimide (cyclic NDI, 1, carrying a benzene moiety as linker chain, was synthesized and its interaction with G-quadruplex DNAs of a-core and a-coreTT as a human telomeric DNA, c-kit and c-myc as DNA sequence at promoter region, or thrombin-binding aptamer (TBA studied based on UV-VIS and circular dichroism (CD spectroscopic techniques, thermal melting temperature measurement, and FRET-melting assay. The circular dichroism spectra showed that 1 induced the formation of different types of G-quadruplex DNA structure. Compound 1 bound to these G-quadruplexes with affinities in the range of 106–107 M−1 order and a 2:1 stoichiometry. Compound 1 showed 270-fold higher selectivity for a-core than dsDNA with a preferable a-core binding than a-coreTT, c-kit, c-myc and TBA in the presence of K+, which is supported by thermal melting studies. The FRET-melting assay also showed that 1 bound preferentially to human telomeric DNA. Compound 1 showed potent inhibition against telomerase activity with an IC50 value of 0.9 μM and preferable binding to G-quadruplexes DNA than our previously published cyclic NDI derivative 3 carrying a benzene moiety as longer linker chain.

  3. Spectroscopic insights into quadruplexes of five-repeat telomere DNA sequences upon G-block damage

    Czech Academy of Sciences Publication Activity Database

    Dvořáková, Zuzana; Vorlíčková, Michaela; Renčiuk, Daniel

    2017-01-01

    Roč. 1861, č. 11 (2017), s. 2750-2757 ISSN 0304-4165 R&D Projects: GA ČR(CZ) GJ17-19170Y Institutional support: RVO:68081707 Keywords : k+ solution * guanine quadruplexes Subject RIV: CE - Biochemistry OBOR OECD: Biochemistry and molecular biology Impact factor: 4.702, year: 2016

  4. Triplex intermediates in folding of human telomeric quadruplexes probed by microsecond-scale molecular dynamics simulations

    Czech Academy of Sciences Publication Activity Database

    Stadlbauer, Petr; Trantírek, L.; Cheatham III, T. E.; Koča, J.; Šponer, Jiří

    105C, OCT2014 (2014), s. 22-35 ISSN 0300-9084 R&D Projects: GA ČR(CZ) GAP208/12/1822; GA ČR(CZ) GA13-28310S Institutional support: RVO:68081707 Keywords : G-DNA folding * Quadruplex * Triplex Subject RIV: BO - Biophysics Impact factor: 2.963, year: 2014

  5. Quadruplexes in 'Dicty': crystal structure of a four-quartet G-quadruplex formed by G-rich motif found in the Dictyostelium discoideum genome.

    Science.gov (United States)

    Guédin, Aurore; Lin, Linda Yingqi; Armane, Samir; Lacroix, Laurent; Mergny, Jean-Louis; Thore, Stéphane; Yatsunyk, Liliya A

    2018-06-01

    Guanine-rich DNA has the potential to fold into non-canonical G-quadruplex (G4) structures. Analysis of the genome of the social amoeba Dictyostelium discoideum indicates a low number of sequences with G4-forming potential (249-1055). Therefore, D. discoideum is a perfect model organism to investigate the relationship between the presence of G4s and their biological functions. As a first step in this investigation, we crystallized the dGGGGGAGGGGTACAGGGGTACAGGGG sequence from the putative promoter region of two divergent genes in D. discoideum. According to the crystal structure, this sequence folds into a four-quartet intramolecular antiparallel G4 with two lateral and one diagonal loops. The G-quadruplex core is further stabilized by a G-C Watson-Crick base pair and a A-T-A triad and displays high thermal stability (Tm > 90°C at 100 mM KCl). Biophysical characterization of the native sequence and loop mutants suggests that the DNA adopts the same structure in solution and in crystalline form, and that loop interactions are important for the G4 stability but not for its folding. Four-tetrad G4 structures are sparse. Thus, our work advances understanding of the structural diversity of G-quadruplexes and yields coordinates for in silico drug screening programs and G4 predictive tools.

  6. Sugar-modified G-quadruplexes: effects of LNA-, 2′F-RNA– and 2′F-ANA-guanosine chemistries on G-quadruplex structure and stability

    Science.gov (United States)

    Li, Zhe; Lech, Christopher Jacques; Phan, Anh Tuân

    2014-01-01

    G-quadruplex-forming oligonucleotides containing modified nucleotide chemistries have demonstrated promising pharmaceutical potential. In this work, we systematically investigate the effects of sugar-modified guanosines on the structure and stability of a (4+0) parallel and a (3+1) hybrid G-quadruplex using over 60 modified sequences containing a single-position substitution of 2′-O-4′-C-methylene-guanosine (LNAG), 2′-deoxy-2′-fluoro-riboguanosine (FG) or 2′-deoxy-2′-fluoro-arabinoguanosine (FANAG). Our results are summarized in two parts: (I) Generally, LNAG substitutions into ‘anti’ position guanines within a guanine-tetrad lead to a more stable G-quadruplex, while substitutions into ‘syn’ positions disrupt the native G-quadruplex conformation. However, some interesting exceptions to this trend are observed. We discover that a LNAG modification upstream of a short propeller loop hinders G-quadruplex formation. (II) A single substitution of either FG or FANAG into a ‘syn’ position is powerful enough to perturb the (3+1) G-quadruplex. Substitution of either FG or FANAG into any ‘anti’ position is well tolerated in the two G-quadruplex scaffolds. FANAG substitutions to ‘anti’ positions are better tolerated than their FG counterparts. In both scaffolds, FANAG substitutions to the central tetrad layer are observed to be the most stabilizing. The observations reported herein on the effects of LNAG, FG and FANAG modifications on G-quadruplex structure and stability will enable the future design of pharmaceutically relevant oligonucleotides. PMID:24371274

  7. G-Quadruplex DNAzyme Molecular Beacon for Amplified Colorimetric Biosensing of Pseudostellaria heterophylla

    Directory of Open Access Journals (Sweden)

    Juan Hu

    2013-01-01

    Full Text Available With an internal transcribed spacer of 18 S, 5.8 S and 26 S nuclear ribosomal DNA (nrDNA ITS as DNA marker, we report a colorimetric approach for authentication of Pseudostellaria heterophylla (PH and its counterfeit species based on the differentiation of the nrDNA ITS sequence. The assay possesses an unlabelled G-quadruplex DNAzyme molecular beacon (MB probe, employing complementary sequence as biorecognition element and 1:1:1:1 split G-quadruplex halves as reporter. In the absence of target DNA (T-DNA, the probe can shape intermolecular G-quadruplex structures capable of binding hemin to form G-quadruplex-hemin DNAzyme and catalyze the oxidation of ABTS2− to blue-green ABTS•− by H2O2. In the presence of T-DNA, T-DNA can hybridize with the complementary sequence to form a duplex structure, hindering the formation of the G-quadruplex structure and resulting in the loss of the catalytic activity. Consequently, a UV-Vis absorption signal decrease is observed in the ABTS2−-H2O2 system. The “turn-off” assay allows the detection of T-DNA from 1.0 × 10−9 to 3.0 × 10−7 mol·L−1 (R2 = 0.9906, with a low detection limit of 3.1 × 10−10 mol·L−1. The present study provides a sensitive and selective method and may serve as a foundation of utilizing the DNAzyme MB sensor for identifying traditional Chinese medicines.

  8. UvrD in Deinococcus radiodurans is optimized for processing G-quadruplex DNA

    International Nuclear Information System (INIS)

    Das, Anubrata; Misra, H.S.

    2015-01-01

    Deinococcus radiodurans R1 is a radiation resistant Gram-positive bacterium capable of tolerating very high doses of DNA-damaging agents such as gamma radiation (D10 ∼ 12kGy) desiccation (∼ 5% relative humidity), UVC radiation (D10 ∼ 800J/m 2 ) and hydrogen peroxide (40 mM). It achieves this by using a complex regulatory mechanism and novel proteins. Recently bioinformatic analysis showed several stretches of guanine runs in D.radiodurans genome, which could form G-quartets. The role of G-quartets in regulatory processes is well documented in various organisms. The presence of G -quartets in D. radiodurans means that there are regulatory or structural proteins which would bind to these elements. Several proteins are known to bind G-quartets. Finding the proteins which would bind to G4 DNA is difficult as no specific motifs are available for binding these elements. Also most of the known proteins that are shown to bind to G-quadruplex DNA are of eukaryotic nature. To overcome these challenges we defined a set of known G-quadruplex binding proteins and used a smith-waterman algorithm with our own scoring matrix to homologs of G-quadruplex binding proteins in D.radiodurans. Using bioinformatics analysis, we showed that UvrD (DR 1775) of D. radiodurans has ability to bind/translocate along G-quadruplex DNA, a novel feature in prokaryotes. The translocase activity of DR1775 is ATP specific and this ATPase activity is attenuated by ssDNA. Data supporting UvrD of D. radiodurans as a G-quadruplex DNA metabolizing proteins would be presented. (author)

  9. Biochemical techniques for the characterization of G-quadruplex structures: EMSA, DMS footprinting, and DNA polymerase stop assay.

    Science.gov (United States)

    Sun, Daekyu; Hurley, Laurence H

    2010-01-01

    The proximal promoter region of many human growth-related genes contains a polypurine/polypyrimidine tract that serves as multiple binding sites for Sp1 or other transcription factors. These tracts often contain a guanine-rich sequence consisting of four runs of three or more contiguous guanines separated by one or more bases, corresponding to a general motif known for the formation of an intramolecular G-quadruplex. Recent results provide strong evidence that specific G-quadruplex structures form naturally within these polypurine/polypyrimidine tracts in many human promoter regions, raising the possibility that the transcriptional control of these genes can be modulated by G-quadruplex-interactive agents. In this chapter, we describe three general biochemical methodologies, electrophoretic mobility shift assay (EMSA), dimethylsulfate (DMS) footprinting, and the DNA polymerase stop assay, which can be useful for initial characterization of G-quadruplex structures formed by G-rich sequences.

  10. Inverting the G-Tetrad Polarity of a G-Quadruplex by Using Xanthine and 8-Oxoguanine.

    Science.gov (United States)

    Cheong, Vee Vee; Lech, Christopher Jacques; Heddi, Brahim; Phan, Anh Tuân

    2016-01-04

    G-quadruplexes are four-stranded nucleic acid structures that are built from consecutively stacked guanine tetrad (G-tetrad) assemblies. The simultaneous incorporation of two guanine base lesions, xanthine (X) and 8-oxoguanine (O), within a single G-tetrad of a G-quadruplex was recently shown to lead to the formation of a stable G⋅G⋅X⋅O tetrad. Herein, a judicious introduction of X and O into a human telomeric G-quadruplex-forming sequence is shown to reverse the hydrogen-bond polarity of the modified G-tetrad while preserving the original folding topology. The control exerted over G-tetrad polarity by joint X⋅O modification will be valuable for the design and programming of G-quadruplex structures and their properties. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  11. Interaction of Pyrrolobenzodiazepine (PBD) Ligands with Parallel Intermolecular G-Quadruplex Complex Using Spectroscopy and ESI-MS

    Science.gov (United States)

    Raju, Gajjela; Srinivas, Ragampeta; Santhosh Reddy, Vangala; Idris, Mohammed M.; Kamal, Ahmed; Nagesh, Narayana

    2012-01-01

    Studies on ligand interaction with quadruplex DNA, and their role in stabilizing the complex at concentration prevailing under physiological condition, has attained high interest. Electrospray ionization mass spectrometry (ESI-MS) and spectroscopic studies in solution were used to evaluate the interaction of PBD and TMPyP4 ligands, stoichiometry and selectivity to G-quadruplex DNA. Two synthetic ligands from PBD family, namely pyrene-linked pyrrolo[2,1-c][1,4]benzodiazepine hybrid (PBD1), mixed imine-amide pyrrolobenzodiazepine dimer (PBD2) and 5,10,15,20-tetrakis(N-methyl-4-pyridyl)porphyrin (TMPyP4) were studied. G-rich single-stranded oligonucleotide d(5′GGGGTTGGGG3′) designated as d(T2G8), from the telomeric region of Tetrahymena Glaucoma, was considered for the interaction with ligands. ESI-MS and spectroscopic methods viz., circular dichroism (CD), UV-Visible, and fluorescence were employed to investigate the G-quadruplex structures formed by d(T2G8) sequence and its interaction with PBD and TMPyP4 ligands. From ESI-MS spectra, it is evident that the majority of quadruplexes exist as d(T2G8)2 and d(T2G8)4 forms possessing two to ten cations in the centre, thereby stabilizing the complex. CD band of PBD1 and PBD2 showed hypo and hyperchromicity, on interaction with quadruplex DNA, indicating unfolding and stabilization of quadruplex DNA complex, respectively. UV-Visible and fluorescence experiments suggest that PBD1 bind externally where as PBD2 intercalate moderately and bind externally to G-quadruplex DNA. Further, melting experiments using SYBR Green indicate that PBD1 unfolds and PBD2 stabilizes the G-quadruplex complex. ITC experiments using d(T2G8) quadruplex with PBD ligands reveal that PBD1 and PBD2 prefer external/loop binding and external/intercalative binding to quadruplex DNA, respectively. From experimental results it is clear that the interaction of PBD2 and TMPyP4 impart higher stability to the quadruplex complex. PMID:22558271

  12. Interaction of pyrrolobenzodiazepine (PBD ligands with parallel intermolecular G-quadruplex complex using spectroscopy and ESI-MS.

    Directory of Open Access Journals (Sweden)

    Gajjela Raju

    Full Text Available Studies on ligand interaction with quadruplex DNA, and their role in stabilizing the complex at concentration prevailing under physiological condition, has attained high interest. Electrospray ionization mass spectrometry (ESI-MS and spectroscopic studies in solution were used to evaluate the interaction of PBD and TMPyP4 ligands, stoichiometry and selectivity to G-quadruplex DNA. Two synthetic ligands from PBD family, namely pyrene-linked pyrrolo[2,1-c][1,4]benzodiazepine hybrid (PBD1, mixed imine-amide pyrrolobenzodiazepine dimer (PBD2 and 5,10,15,20-tetrakis(N-methyl-4-pyridylporphyrin (TMPyP4 were studied. G-rich single-stranded oligonucleotide d(5'GGGGTTGGGG3' designated as d(T(2G(8, from the telomeric region of Tetrahymena Glaucoma, was considered for the interaction with ligands. ESI-MS and spectroscopic methods viz., circular dichroism (CD, UV-Visible, and fluorescence were employed to investigate the G-quadruplex structures formed by d(T(2G(8 sequence and its interaction with PBD and TMPyP4 ligands. From ESI-MS spectra, it is evident that the majority of quadruplexes exist as d(T(2G(8(2 and d(T(2G(8(4 forms possessing two to ten cations in the centre, thereby stabilizing the complex. CD band of PBD1 and PBD2 showed hypo and hyperchromicity, on interaction with quadruplex DNA, indicating unfolding and stabilization of quadruplex DNA complex, respectively. UV-Visible and fluorescence experiments suggest that PBD1 bind externally where as PBD2 intercalate moderately and bind externally to G-quadruplex DNA. Further, melting experiments using SYBR Green indicate that PBD1 unfolds and PBD2 stabilizes the G-quadruplex complex. ITC experiments using d(T(2G(8 quadruplex with PBD ligands reveal that PBD1 and PBD2 prefer external/loop binding and external/intercalative binding to quadruplex DNA, respectively. From experimental results it is clear that the interaction of PBD2 and TMPyP4 impart higher stability to the quadruplex complex.

  13. Behavior of the guanine base in G-quadruplexes probed by the fluorescent guanine analog, 6-methyl isozanthopterin

    Energy Technology Data Exchange (ETDEWEB)

    Han, Ji Hoon; Chitrapriya, Nataraj; Lee, Hyun Suk; Lee, Young Ae; Kim, Seog K. [Dept. of Chemistry, Yeungnam University, Gyeongsan (Korea, Republic of); Jung, Maeng Joon [Dept. of Chemistry, Kyungpook National University, Daegu (Korea, Republic of)

    2017-02-15

    In this study, circular dichroism (CD) spectrum and fluorescence techniques were used to examine the dynamic properties and microenvironment of the guanine base (G) at the central loop and at the middle of the G-stem of the G-quadruplex formed from the G{sub 3}T{sub 2}G{sub 3}TGTG{sub 3}T{sub 2}G{sub 3} sequence (G-quadruplex 1), in which the G base at the 10th and 13th position were replaced with a fluorescent G analog, 6-methyl isoxanthopterin (6MI) (G-quadruplex 2 and 3, respectively). For all G-quadruplexes, the CD spectrum revealed a positive band at 263 nm and a shoulder at 298 nm, and the thermal melting profiles were the sum of at least two sigmoidal curves. These observations indicated the presence of two conformers in the G-quadruplex. The fluorescence intensity of G-quadruplex 2 was greater than 3, as expected from the extent of stacking interaction, which is larger in the G(6MI)G sequence than the T(6MI)T sequence. The efficiency of fluorescence quenching by the polar acrylamide quencher and negatively charged I− quencher were larger for G-quadruplex 3, suggesting that 6MI in the G(6MI)G stem is exposed more to the aqueous environment compared to that in the T(6MI)T central loop. In the latter case, 6MI may direct to the center of the top G-quartet layer. The possibility of hydrogen bond formation between the carbonyl group of 6MI and the acrylamide of the G-quadruplex 3 was proposed.

  14. Volumetric contributions of loop regions of G-quadruplex DNA to the formation of the tertiary structure.

    Science.gov (United States)

    Takahashi, Shuntaro; Sugimoto, Naoki

    2017-12-01

    DNA guanine-quadruplexes (G-quadruplexes) are unique DNA structures formed by guanine-rich sequences. The loop regions of G-quadruplexes play key roles in stability and topology of G-quadruplexes. Here, we investigated volumetric changes induced by pressure in the folding of the G-quadruplex formed by the thrombin binding aptamer (TBA) with mutations within the loop regions. The change of partial molar volume in the transition from coil to G-quadruplex, ∆V tr , of TBA with a mutation from T to A in the 5' most loop (TBA T3A) was 75.5cm 3 mol -1 , which was larger than that of TBA (54.6cm 3 mol -1 ). TBA with a G to T mutation in the central loop (TBA G8T) had thermal stability similar to TBA T3A but a smaller ∆V tr of 41.1cm 3 mol -1 . In the presence of poly(ethylene)glycol 200 (PEG200), ∆V tr values were 14.7cm 3 mol -1 for TBA T3A and 13.2cm 3 mol -1 for TBA G8T. These results suggest that the two mutations destabilize the G-quadruplex structure differently. Thus, volumetric data obtained using pressure-based thermodynamic analyses provides information about the dynamics of the loop regions and the roles of loops in the stabilities and folding of G-quadruplex structures. Copyright © 2017 Elsevier B.V. All rights reserved.

  15. Xanthine and 8-oxoguanine in G-quadruplexes: formation of a G·G·X·O tetrad.

    Science.gov (United States)

    Cheong, Vee Vee; Heddi, Brahim; Lech, Christopher Jacques; Phan, Anh Tuân

    2015-12-02

    G-quadruplexes are four-stranded structures built from stacked G-tetrads (G·G·G·G), which are planar cyclical assemblies of four guanine bases interacting through Hoogsteen hydrogen bonds. A G-quadruplex containing a single guanine analog substitution, such as 8-oxoguanine (O) or xanthine (X), would suffer from a loss of a Hoogsteen hydrogen bond within a G-tetrad and/or potential steric hindrance. We show that a proper arrangement of O and X bases can reestablish the hydrogen-bond pattern within a G·G·X·O tetrad. Rational incorporation of G·G·X·O tetrads in a (3+1) G-quadruplex demonstrated a similar folding topology and thermal stability to that of the unmodified G-quadruplex. pH titration conducted on X·O-modified G-quadruplexes indicated a protonation-deprotonation equilibrium of X with a pKa ∼6.7. The solution structure of a G-quadruplex containing a G·G·X·O tetrad was determined, displaying the same folding topology in both the protonated and deprotonated states. A G-quadruplex containing a deprotonated X·O pair was shown to exhibit a more electronegative groove compared to that of the unmodified one. These differences are likely to manifest in the electronic properties of G-quadruplexes and may have important implications for drug targeting and DNA-protein interactions. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.

  16. A twice-as-smart synthetic G-quartet: PyroTASQ is both a smart quadruplex ligand and a smart fluorescent probe.

    Science.gov (United States)

    Laguerre, Aurélien; Stefan, Loic; Larrouy, Manuel; Genest, David; Novotna, Jana; Pirrotta, Marc; Monchaud, David

    2014-09-03

    Recent and unambiguous evidences of the formation of DNA and RNA G-quadruplexes in cells has provided solid support for these structures to be considered as valuable targets in oncology. Beyond this, they have lent further credence to the anticancer strategies relying on small molecules that selectively target these higher-order DNA/RNA architectures, referred to as G-quadruplex ligands. They have also shed bright light on the necessity of designing multitasking ligands, displaying not only enticing quadruplex interacting properties (affinity, structural selectivity) but also additional features that make them usable for detecting quadruplexes in living cells, notably for determining whether, when, and where these structures fold and unfold during the cell cycle and also for better assessing the consequences of their stabilization by external agents. Herein, we report a brand new design of such multitasking ligands, whose structure experiences a quadruplex-promoted conformational switch that triggers not only its quadruplex affinity (i.e., smart ligands, which display high affinity and selectivity for DNA/RNA quadruplexes) but also its fluorescence (i.e., smart probes, which behave as selective light-up fluorescent reporters on the basis of a fluorogenic electron redistribution). The first prototype of such multifunctional ligands, termed PyroTASQ, represents a brand new generation of quadruplex ligands that can be referred to as "twice-as-smart" quadruplex ligands.

  17. Simultaneous Binding of Hybrid Molecules Constructed with Dual DNA-Binding Components to a G-Quadruplex and Its Proximal Duplex.

    Science.gov (United States)

    Asamitsu, Sefan; Obata, Shunsuke; Phan, Anh Tuân; Hashiya, Kaori; Bando, Toshikazu; Sugiyama, Hiroshi

    2018-03-20

    A G-quadruplex (quadruplex) is a nucleic acid secondary structure adopted by guanine-rich sequences and is considered to be relevant to various pharmacological and biological contexts. Although a number of researchers have endeavored to discover and develop quadruplex-interactive molecules, poor ligand designability originating from topological similarity of the skeleton of diverse quadruplexes has remained a bottleneck for gaining specificity for individual quadruplexes. This work reports on hybrid molecules that were constructed with dual DNA-binding components, a cyclic imidazole/lysine polyamide (cIKP), and a hairpin pyrrole/imidazole polyamide (hPIP), with the aim toward specific quadruplex targeting by reading out the local duplex DNA sequence adjacent to designated quadruplexes in the genome. By means of circular dichroism (CD), fluorescence resonance energy transfer (FRET), surface plasmon resonance (SPR), and NMR techniques, we showed the dual and simultaneous recognition of the respective segment via hybrid molecules, and the synergistic and mutual effect of each binding component that was appropriately linked on higher binding affinity and modest sequence specificity. Monitoring quadruplex and duplex imino protons of the quadruplex/duplex motif titrated with hybrid molecules clearly revealed distinct features of the binding of hybrid molecules to the respective segments upon their simultaneous recognition. A series of the systematic and detailed binding assays described here showed that the concept of simultaneous recognition of quadruplex and its proximal duplex by hybrid molecules constructed with the dual DNA-binding components may provide a new strategy for ligand design, enabling targeting of a large variety of designated quadruplexes at specific genome locations. © 2018 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

  18. A G-quadruplex-containing RNA activates fluorescence in a GFP-like fluorophore

    Energy Technology Data Exchange (ETDEWEB)

    Huang, Hao; Suslov, Nikolai B.; Li, Nan-Sheng; Shelke, Sandip A.; Evans, Molly E.; Koldobskaya, Yelena; Rice, Phoebe A.; Piccirilli, Joseph A. [UC

    2014-08-21

    Spinach is an in vitro–selected RNA aptamer that binds a GFP-like ligand and activates its green fluorescence. Spinach is thus an RNA analog of GFP and has potentially widespread applications for in vivo labeling and imaging. We used antibody-assisted crystallography to determine the structures of Spinach both with and without bound fluorophore at 2.2-Å and 2.4-Å resolution, respectively. Spinach RNA has an elongated structure containing two helical domains separated by an internal bulge that folds into a G-quadruplex motif of unusual topology. The G-quadruplex motif and adjacent nucleotides comprise a partially preformed binding site for the fluorophore. The fluorophore binds in a planar conformation and makes extensive aromatic stacking and hydrogen bond interactions with the RNA. Our findings provide a foundation for structure-based engineering of new fluorophore-binding RNA aptamers.

  19. Effects of trimethylamine N-oxide and urea on DNA duplex and G-quadruplex.

    Science.gov (United States)

    Ueda, Yu-Mi; Zouzumi, Yu-Ki; Maruyama, Atsushi; Nakano, Shu-Ichi; Sugimoto, Naoki; Miyoshi, Daisuke

    2016-01-01

    We systematically investigated effects of molecular crowding with trimethylamine N -oxide (TMAO) as a zwitterionic and protective osmolyte and urea as a nonionic denaturing osmolyte on conformation and thermodynamics of the canonical DNA duplex and the non-canonical DNA G-quadruplex. It was found that TMAO and urea stabilized and destabilized, respectively, the G-quadruplex. On the other hand, these osmolytes generally destabilize the duplex; however, it was observed that osmolytes having the trimethylamine group stabilized the duplex at the lower concentrations because of a direct binding to a groove of the duplex. These results are useful not only to predict DNA structures and their thermodynamics under physiological environments in living cells, but also design of polymers and materials to regulate structure and stability of DNA sequences.

  20. Synthesis of potent G-quadruplex binders of macrocyclic heptaoxazole and evaluation of their activities.

    Science.gov (United States)

    Tera, Masayuki; Iida, Keisuke; Shin-ya, Kazuo; Nagasawa, Kazuo

    2009-01-01

    Guanine-rich DNA sequences form unique three-dimensional conformation known as G-quadruplexes (G-q). G-q structures have been found in telomere and in some oncogene promoter. Recently, it was suggested that G-q showed some biological activities including telomere shortening and transcriptional regulation. In this paper, we synthesized selective G-q binders and evaluated of their biological activities.

  1. A mRNA-Responsive G-Quadruplex-Based Drug Release System

    Directory of Open Access Journals (Sweden)

    Hidenobu Yaku

    2015-04-01

    Full Text Available G-quadruplex-based drug delivery carriers (GDDCs were designed to capture and release a telomerase inhibitor in response to a target mRNA. Hybridization between a loop on the GDDC structure and the mRNA should cause the G-quadruplex structure of the GDDC to unfold and release the bound inhibitor, anionic copper(II phthalocyanine (CuAPC. As a proof of concept, GDDCs were designed with a 10-30-mer loop, which can hybridize with a target sequence in epidermal growth factor receptor (EGFR mRNA. Structural analysis using circular dichroism (CD spectroscopy showed that the GDDCs form a (3 + 1 type G-quadruplex structure in 100 mM KCl and 10 mM MgCl2 in the absence of the target RNA. Visible absorbance titration experiments showed that the GDDCs bind to CuAPC with Ka values of 1.5 × 105 to 5.9 × 105 M−1 (Kd values of 6.7 to 1.7 μM at 25 °C, depending on the loop length. Fluorescence titration further showed that the G-quadruplex structure unfolds upon binding to the target RNA with Ka values above 1.0 × 108 M−1 (Kd values below 0.01 μM at 25 °C. These results suggest the carrier can sense and bind to the target RNA, which should result in release of the bound drug. Finally, visible absorbance titration experiments demonstrated that the GDDC release CuAPC in response to the target RNA.

  2. G-quadruplex formation in the Oct4 promoter positively regulates Oct4 expression

    Czech Academy of Sciences Publication Activity Database

    Renčiuk, Daniel; Ryneš, J.; Kejnovská, Iva; Foldynova-Trantirkova, S.; Andaeng, M.; Trantírek, L.; Vorlíčková, Michaela

    2017-01-01

    Roč. 1860, č. 2 (2017), s. 175-183 ISSN 1874-9399 R&D Projects: GA ČR(CZ) GP14-33947P; GA ČR GAP205/12/0466; GA ČR(CZ) GA15-06785S Institutional support: RVO:68081707 Keywords : linked polymorphic region * guanine quadruplexes * transcription factor Subject RIV: CE - Biochemistry OBOR OECD: Biochemistry and molecular biology Impact factor: 5.018, year: 2016

  3. Molecular dynamics simulations of guanine quadruplex loops: Advances and force field limitations

    Czech Academy of Sciences Publication Activity Database

    Fadrná, E.; Špačková, Naďa; Štefl, R.; Koča, J.; Cheatham III, T. E.; Šponer, Jiří

    2004-01-01

    Roč. 87, č. 1 (2004), s. 227-242 ISSN 0006-3495 R&D Projects: GA MŠk LN00A016 Grant - others:Wellcome Trust(GB) GR067507MF Institutional research plan: CEZ:AV0Z5004920 Keywords : quanine quadruplex * four-thymidine loop * locally enhanced sampling Subject RIV: BO - Biophysics Impact factor: 4.585, year: 2004

  4. RecQ-core of BLM unfolds telomeric G-quadruplex in the absence of ATP

    Czech Academy of Sciences Publication Activity Database

    Budhathoki, J.B.; Ray, S.; Urban, Václav; Janščák, Pavel; Jodh, J.G.; Balci, H.

    2014-01-01

    Roč. 42, č. 18 (2014), s. 11528-11545 ISSN 0305-1048 R&D Projects: GA ČR GA204/09/0565 Grant - others:U.S. National Science Foundation through the Physics Frontiers Center Program(US) 1430124 Institutional support: RVO:68378050 Keywords : single-stranded DNA * RECQ5 helicase * G-quadruplex structures Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 9.112, year: 2014

  5. Multifunctional energy landscape for a DNA G-quadruplex: An evolved molecular switch

    Science.gov (United States)

    Cragnolini, Tristan; Chakraborty, Debayan; Šponer, Jiří; Derreumaux, Philippe; Pasquali, Samuela; Wales, David J.

    2017-10-01

    We explore the energy landscape for a four-fold telomere repeat, obtaining interconversion pathways between six experimentally characterised G-quadruplex topologies. The results reveal a multi-funnel system, with a variety of intermediate configurations and misfolded states. This organisation is identified with the intrinsically multi-functional nature of the system, suggesting a new paradigm for the classification of such biomolecules and clarifying issues regarding apparently conflicting experimental results.

  6. Quadruplex-forming properties of FRAXA (CGG) repeats interrupted by (AGG) triplets

    Czech Academy of Sciences Publication Activity Database

    Renčiuk, Daniel; Zemánek, Michal; Kejnovská, Iva; Vorlíčková, Michaela

    2009-01-01

    Roč. 91, č. 3 (2009), s. 416-422 ISSN 0300-9084 R&D Projects: GA ČR(CZ) GA204/07/0057; GA AV ČR(CZ) IAA100040701 Institutional research plan: CEZ:AV0Z50040507; CEZ:AV0Z50040702 Keywords : fragile X-chromosome * quadruplex * CD spectroscopy Subject RIV: BO - Biophysics Impact factor: 3.897, year: 2009

  7. Bis-guanylhydrazone diimidazo[1,2-a:1,2-c]pyrimidine as a novel and specific G-quadruplex binding motif.

    Science.gov (United States)

    Sparapani, Silvia; Bellini, Stefania; Gunaratnam, Mekala; Haider, Shozeb M; Andreani, Aldo; Rambaldi, Mirella; Locatelli, Alessandra; Morigi, Rita; Granaiola, Massimiliano; Varoli, Lucilla; Burnelli, Silvia; Leoni, Alberto; Neidle, Stephen

    2010-08-21

    A bis-guanylhydrazone derivative of diimidazo[1,2-a:1,2-c]pyrimidine has unexpectedly been found to be a potent stabiliser of several quadruplex DNAs, whereas there is no significant interaction with duplex DNA. Molecular modeling suggests that the guanylhydrazone groups play an active role in quadruplex binding.

  8. Hsa-miR-1587 G-quadruplex formation and dimerization induced by NH4+, molecular crowding environment and jatrorrhizine derivatives.

    Science.gov (United States)

    Tan, Wei; Yi, Long; Zhu, Zhentao; Zhang, Lulu; Zhou, Jiang; Yuan, Gu

    2018-03-01

    A guanine-rich human mature microRNA, miR-1587, was discovered to form stable intramolecular G-quadruplexes in the presence of K + , Na + and low concentration of NH 4 + (25mM) by electrospray ionization mass spectrometry (ESI-MS) combined with circular dichroism (CD) spectroscopy. Furthermore, under high concentration of NH 4 + (100mM) or molecular crowding environments, miR-1587 formed a dimeric G-quadruplex through 3'-to-3' stacking of two monomeric G-quadruplex subunits with one ammonium ion sandwiched between the interfaces. Specifically, two synthesized jatrorrhizine derivatives with terminal amine groups could also induce the dimerization of miR-1587 G-quadruplex and formed 1:1 and 2:1 complexes with the dimeric G-quadruplex. In contrast, jatrorrhizine could bind with the dimeric miR-1587 G-quadruplex, but could not induce dimerization of miR-1587 G-quadruplex. These results provide a new strategy to regulate the functions of miR-1587 through induction of G-quadruplex formation and dimerization. Copyright © 2017 Elsevier B.V. All rights reserved.

  9. G-Quadruplexes Involving Both Strands of Genomic DNA Are Highly Abundant and Colocalize with Functional Sites in the Human Genome.

    Directory of Open Access Journals (Sweden)

    Andrzej S Kudlicki

    Full Text Available The G-quadruplex is a non-canonical DNA structure biologically significant in DNA replication, transcription and telomere stability. To date, only G4s with all guanines originating from the same strand of DNA have been considered in the context of the human nuclear genome. Here, I discuss interstrand topological configurations of G-quadruplex DNA, consisting of guanines from both strands of genomic DNA; an algorithm is presented for predicting such structures. I have identified over 550,000 non-overlapping interstrand G-quadruplex forming sequences in the human genome--significantly more than intrastrand configurations. Functional analysis of interstrand G-quadruplex sites shows strong association with transcription initiation, the results are consistent with the XPB and XPD transcriptional helicases binding only to G-quadruplex DNA with interstrand topology. Interstrand quadruplexes are also enriched in origin of replication sites. Several topology classes of interstrand quadruplex-forming sequences are possible, and different topologies are enriched in different types of structural elements. The list of interstrand quadruplex forming sequences, and the computer program used for their prediction are available at the web address http://moment.utmb.edu/allquads.

  10. Cation binding to 15-TBA quadruplex DNA is a multiple-pathway cation-dependent process.

    Science.gov (United States)

    Reshetnikov, Roman V; Sponer, Jiri; Rassokhina, Olga I; Kopylov, Alexei M; Tsvetkov, Philipp O; Makarov, Alexander A; Golovin, Andrey V

    2011-12-01

    A combination of explicit solvent molecular dynamics simulation (30 simulations reaching 4 µs in total), hybrid quantum mechanics/molecular mechanics approach and isothermal titration calorimetry was used to investigate the atomistic picture of ion binding to 15-mer thrombin-binding quadruplex DNA (G-DNA) aptamer. Binding of ions to G-DNA is complex multiple pathway process, which is strongly affected by the type of the cation. The individual ion-binding events are substantially modulated by the connecting loops of the aptamer, which play several roles. They stabilize the molecule during time periods when the bound ions are not present, they modulate the route of the ion into the stem and they also stabilize the internal ions by closing the gates through which the ions enter the quadruplex. Using our extensive simulations, we for the first time observed full spontaneous exchange of internal cation between quadruplex molecule and bulk solvent at atomistic resolution. The simulation suggests that expulsion of the internally bound ion is correlated with initial binding of the incoming ion. The incoming ion then readily replaces the bound ion while minimizing any destabilization of the solute molecule during the exchange. © The Author(s) 2011. Published by Oxford University Press.

  11. Identifying the impact of G-quadruplexes on Affymetrix 3' arrays using cloud computing.

    Science.gov (United States)

    Memon, Farhat N; Owen, Anne M; Sanchez-Graillet, Olivia; Upton, Graham J G; Harrison, Andrew P

    2010-01-15

    A tetramer quadruplex structure is formed by four parallel strands of DNA/ RNA containing runs of guanine. These quadruplexes are able to form because guanine can Hoogsteen hydrogen bond to other guanines, and a tetrad of guanines can form a stable arrangement. Recently we have discovered that probes on Affymetrix GeneChips that contain runs of guanine do not measure gene expression reliably. We associate this finding with the likelihood that quadruplexes are forming on the surface of GeneChips. In order to cope with the rapidly expanding size of GeneChip array datasets in the public domain, we are exploring the use of cloud computing to replicate our experiments on 3' arrays to look at the effect of the location of G-spots (runs of guanines). Cloud computing is a recently introduced high-performance solution that takes advantage of the computational infrastructure of large organisations such as Amazon and Google. We expect that cloud computing will become widely adopted because it enables bioinformaticians to avoid capital expenditure on expensive computing resources and to only pay a cloud computing provider for what is used. Moreover, as well as financial efficiency, cloud computing is an ecologically-friendly technology, it enables efficient data-sharing and we expect it to be faster for development purposes. Here we propose the advantageous use of cloud computing to perform a large data-mining analysis of public domain 3' arrays.

  12. Cation binding to 15-TBA quadruplex DNA is a multiple-pathway cation-dependent process

    Science.gov (United States)

    Reshetnikov, Roman V.; Sponer, Jiri; Rassokhina, Olga I.; Kopylov, Alexei M.; Tsvetkov, Philipp O.; Makarov, Alexander A.; Golovin, Andrey V.

    2011-01-01

    A combination of explicit solvent molecular dynamics simulation (30 simulations reaching 4 µs in total), hybrid quantum mechanics/molecular mechanics approach and isothermal titration calorimetry was used to investigate the atomistic picture of ion binding to 15-mer thrombin-binding quadruplex DNA (G-DNA) aptamer. Binding of ions to G-DNA is complex multiple pathway process, which is strongly affected by the type of the cation. The individual ion-binding events are substantially modulated by the connecting loops of the aptamer, which play several roles. They stabilize the molecule during time periods when the bound ions are not present, they modulate the route of the ion into the stem and they also stabilize the internal ions by closing the gates through which the ions enter the quadruplex. Using our extensive simulations, we for the first time observed full spontaneous exchange of internal cation between quadruplex molecule and bulk solvent at atomistic resolution. The simulation suggests that expulsion of the internally bound ion is correlated with initial binding of the incoming ion. The incoming ion then readily replaces the bound ion while minimizing any destabilization of the solute molecule during the exchange. PMID:21893589

  13. Thermodynamic fingerprints of ligand binding to human telomeric G-quadruplexes.

    Science.gov (United States)

    Bončina, Matjaž; Podlipnik, Črtomir; Piantanida, Ivo; Eilmes, Julita; Teulade-Fichou, Marie-Paule; Vesnaver, Gorazd; Lah, Jurij

    2015-12-02

    Thermodynamic studies of ligand binding to human telomere (ht) DNA quadruplexes, as a rule, neglect the involvement of various ht-DNA conformations in the binding process. Therefore, the thermodynamic driving forces and the mechanisms of ht-DNA G-quadruplex-ligand recognition remain poorly understood. In this work we characterize thermodynamically and structurally binding of netropsin (Net), dibenzotetraaza[14]annulene derivatives (DP77, DP78), cationic porphyrin (TMPyP4) and two bisquinolinium ligands (Phen-DC3, 360A-Br) to the ht-DNA fragment (Tel22) AGGG(TTAGGG)3 using isothermal titration calorimetry, CD and fluorescence spectroscopy, gel electrophoresis and molecular modeling. By global thermodynamic analysis of experimental data we show that the driving forces characterized by contributions of specific interactions, changes in solvation and conformation differ significantly for binding of ligands with low quadruplex selectivity over duplexes (Net, DP77, DP78, TMPyP4; KTel22 ≈ KdsDNA). These contributions are in accordance with the observed structural features (changes) and suggest that upon binding Net, DP77, DP78 and TMPyP4 select hybrid-1 and/or hybrid-2 conformation while Phen-DC3 and 360A-Br induce the transition of hybrid-1 and hybrid-2 to the structure with characteristics of antiparallel or hybrid-3 type conformation. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.

  14. RNA synthesis is modulated by G-quadruplex formation in Hepatitis C virus negative RNA strand.

    Science.gov (United States)

    Chloé, Jaubert; Amina, Bedrat; Laura, Bartolucci; Carmelo, Di Primo; Michel, Ventura; Jean-Louis, Mergny; Samir, Amrane; Marie-Line, Andreola

    2018-05-25

    DNA and RNA guanine-rich oligonucleotides can form non-canonical structures called G-quadruplexes or "G4" that are based on the stacking of G-quartets. The role of DNA and RNA G4 is documented in eukaryotic cells and in pathogens such as viruses. Yet, G4 have been identified only in a few RNA viruses, including the Flaviviridae family. In this study, we analysed the last 157 nucleotides at the 3'end of the HCV (-) strand. This sequence is known to be the minimal sequence required for an efficient RNA replication. Using bioinformatics and biophysics, we identified a highly conserved G4-prone sequence located in the stem-loop IIy' of the negative strand. We also showed that the formation of this G-quadruplex inhibits the in vitro RNA synthesis by the RdRp. Furthermore, Phen-DC3, a specific G-quadruplex binder, is able to inhibit HCV viral replication in cells in conditions where no cytotoxicity was measured. Considering that this domain of the negative RNA strand is well conserved among HCV genotypes, G4 ligands could be of interest for new antiviral therapies.

  15. The Effects of Molecular Crowding on the Structure and Stability of G-Quadruplexes with an Abasic Site

    Science.gov (United States)

    Fujimoto, Takeshi; Nakano, Shu-ichi; Miyoshi, Daisuke; Sugimoto, Naoki

    2011-01-01

    Both cellular environmental factors and chemical modifications critically affect the properties of nucleic acids. However, the structure and stability of DNA containing abasic sites under cell-mimicking molecular crowding conditions remain unclear. Here, we investigated the molecular crowding effects on the structure and stability of the G-quadruplexes including a single abasic site. Structural analysis by circular dichroism showed that molecular crowding by PEG200 did not affect the topology of the G-quadruplex structure with or without an abasic site. Thermodynamic analysis further demonstrated that the degree of stabilization of the G-quadruplex by molecular crowding decreased with substitution of an abasic site for a single guanine. Notably, we found that the molecular crowding effects on the enthalpy change for G-quadruplex formation had a linear relationship with the abasic site effects depending on its position. These results are useful for predicting the structure and stability of G-quadruplexes with abasic sites in the cell-mimicking conditions. PMID:21949901

  16. Effect of ATRX and G-Quadruplex Formation by the VNTR Sequence on α-Globin Gene Expression.

    Science.gov (United States)

    Li, Yue; Syed, Junetha; Suzuki, Yuki; Asamitsu, Sefan; Shioda, Norifumi; Wada, Takahito; Sugiyama, Hiroshi

    2016-05-17

    ATR-X (α-thalassemia/mental retardation X-linked) syndrome is caused by mutations in chromatin remodeler ATRX. ATRX can bind the variable number of tandem repeats (VNTR) sequence in the promoter region of the α-globin gene cluster. The VNTR sequence, which contains the potential G-quadruplex-forming sequence CGC(GGGGCGGGG)n , is involved in the downregulation of α-globin expression. We investigated G-quadruplex and i-motif formation in single-stranded DNA and long double-stranded DNA. The promoter region without the VNTR sequence showed approximately twofold higher luciferase activity than the promoter region harboring the VNTR sequence. G-quadruplex stabilizers hemin and TMPyP4 reduced the luciferase activity, whereas expression of ATRX led to a recovery in reporter activity. Our results demonstrate that stable G-quadruplex formation by the VNTR sequence downregulates the expression of α-globin genes and that ATRX might bind to and resolve the G-quadruplex. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  17. The role of alkali metal cations in the stabilization of guanine quadruplexes: why K(+) is the best.

    Science.gov (United States)

    Zaccaria, F; Paragi, G; Fonseca Guerra, C

    2016-08-21

    The alkali metal ion affinity of guanine quadruplexes has been studied using dispersion-corrected density functional theory (DFT-D). We have done computational investigations in aqueous solution that mimics artificial supramolecular conditions where guanine bases assemble into stacked quartets as well as biological environments in which telomeric quadruplexes are formed. In both cases, an alkali metal cation is needed to assist self-assembly. Our quantum chemical computations on these supramolecular systems are able to reproduce the experimental order of affinity of the guanine quadruplexes for the cations Li(+), Na(+), K(+), Rb(+), and Cs(+). The strongest binding is computed between the potassium cation and the quadruplex as it occurs in nature. The desolvation and the size of alkali metal cations are thought to be responsible for the order of affinity. Until now, the relative importance of these two factors has remained unclear and debated. By assessing the quantum chemical 'size' of the cation, determining the amount of deformation of the quadruplex needed to accommodate the cation and through the energy decomposition analysis (EDA) of the interaction energy between the cation and the guanines, we reveal that the desolvation and size of the alkali metal cation are both almost equally responsible for the order of affinity.

  18. Structure and possible function of a G-quadruplex in the long terminal repeat of the proviral HIV-1 genome.

    Science.gov (United States)

    De Nicola, Beatrice; Lech, Christopher J; Heddi, Brahim; Regmi, Sagar; Frasson, Ilaria; Perrone, Rosalba; Richter, Sara N; Phan, Anh Tuân

    2016-07-27

    The long terminal repeat (LTR) of the proviral human immunodeficiency virus (HIV)-1 genome is integral to virus transcription and host cell infection. The guanine-rich U3 region within the LTR promoter, previously shown to form G-quadruplex structures, represents an attractive target to inhibit HIV transcription and replication. In this work, we report the structure of a biologically relevant G-quadruplex within the LTR promoter region of HIV-1. The guanine-rich sequence designated LTR-IV forms a well-defined structure in physiological cationic solution. The nuclear magnetic resonance (NMR) structure of this sequence reveals a parallel-stranded G-quadruplex containing a single-nucleotide thymine bulge, which participates in a conserved stacking interaction with a neighboring single-nucleotide adenine loop. Transcription analysis in a HIV-1 replication competent cell indicates that the LTR-IV region may act as a modulator of G-quadruplex formation in the LTR promoter. Consequently, the LTR-IV G-quadruplex structure presented within this work could represent a valuable target for the design of HIV therapeutics. © The Author(s) 2016. Published by Oxford University Press on behalf of Nucleic Acids Research.

  19. Binding modes and pathway of RHPS4 to human telomeric G-quadruplex and duplex DNA probed by all-atom molecular dynamics simulations with explicit solvent.

    Science.gov (United States)

    Mulholland, Kelly; Siddiquei, Farzana; Wu, Chun

    2017-07-19

    RHPS4, a potent binder to human telomeric DNA G-quadruplex, shows high efficacy in tumor cell growth inhibition. However, it's preferential binding to DNA G-quadruplex over DNA duplex (about 10 fold) remains to be improved toward its clinical application. A high resolution structure of the single-stranded telomeric DNA G-quadruplexes, or B-DNA duplex, in complex with RHPS4 is not available yet, and the binding nature of this ligand to these DNA forms remains to be elusive. In this study, we carried out 40 μs molecular dynamics binding simulations with a free ligand to decipher the binding pathway of RHPS4 to a DNA duplex and three G-quadruplex folders (parallel, antiparallel and hybrid) of the human telomeric DNA sequence. The most stable binding mode identified for the duplex, parallel, antiparallel and hybrid G-quadruplexes is an intercalation, bottom stacking, top intercalation and bottom intercalation mode, respectively. The intercalation mode with similar binding strength to both the duplex and the G-quadruplexes, explains the lack of binding selectivity of RHPS4 to the G-quadruplex form. Therefore, a ligand modification that destabilizes the duplex intercalation mode but stabilizes the G-quadruplex intercalation mode will improve the binding selectivity toward G-quadruplex. The intercalation mode of RHPS4 to both the duplex and the antiparallel and the hybrid G-quadruplex follows a base flipping-insertion mechanism rather than an open-insertion mechanism. The groove binding, the side binding and the intercalation with flipping out of base were observed to be intermediate states before the full intercalation state with paired bases.

  20. Biophysical Characterization of G-Quadruplex Recognition in the PITX1 mRNA by the Specificity Domain of the Helicase RHAU.

    Directory of Open Access Journals (Sweden)

    Emmanuel O Ariyo

    Full Text Available Nucleic acids rich in guanine are able to fold into unique structures known as G-quadruplexes. G-quadruplexes consist of four tracts of guanylates arranged in parallel or antiparallel strands that are aligned in stacked G-quartet planes. The structure is further stabilized by Hoogsteen hydrogen bonds and monovalent cations centered between the planes. RHAU (RNA helicase associated with AU-rich element is a member of the ATP-dependent DExH/D family of RNA helicases and can bind and resolve G-quadruplexes. RHAU contains a core helicase domain with an N-terminal extension that enables recognition and full binding affinity to RNA and DNA G-quadruplexes. PITX1, a member of the bicoid class of homeobox proteins, is a transcriptional activator active during development of vertebrates, chiefly in the anterior pituitary gland and several other organs. We have previously demonstrated that RHAU regulates PITX1 levels through interaction with G-quadruplexes at the 3'-end of the PITX1 mRNA. To understand the structural basis of G-quadruplex recognition by RHAU, we characterize a purified minimal PITX1 G-quadruplex using a variety of biophysical techniques including electrophoretic mobility shift assays, UV-VIS spectroscopy, circular dichroism, dynamic light scattering, small angle X-ray scattering and nuclear magnetic resonance spectroscopy. Our biophysical analysis provides evidence that the RNA G-quadruplex, but not its DNA counterpart, can adopt a parallel orientation, and that only the RNA can interact with N-terminal domain of RHAU via the tetrad face of the G-quadruplex. This work extends our insight into how the N-terminal region of RHAU recognizes parallel G-quadruplexes.

  1. Space shuttle pilot-induced-oscillation research testing

    Science.gov (United States)

    Powers, B. G.

    1984-01-01

    The simulation requirements for investigation of pilot-induced-oscillation (PIO) characteristics during the landing phase are discussed. Orbiters simulations and F-8 digital fly-by-wire aircraft tests are addressed.

  2. Enhanced anti-HIV-1 activity of G-quadruplexes comprising locked nucleic acids and intercalating nucleic acids

    DEFF Research Database (Denmark)

    Pedersen, Erik Bjerregaard; Nielsen, Jakob Toudahl; Nielsen, Claus

    2011-01-01

    Two G-quadruplex forming sequences, 50-TGGGAG and the 17-mer sequence T30177, which exhibit anti-HIV-1 activity on cell lines, were modified using either locked nucleic acids (LNA) or via insertions of (R)-1-O-(pyren-1-ylmethyl)glycerol (intercalating nucleic acid, INA) or (R)-1-O-[4-(1......-pyrenylethynyl)phenylmethyl]glycerol (twisted intercalating nucleic acid, TINA). Incorporation of LNA or INA/TINA monomers provide as much as 8-fold improvement of anti-HIV-1 activity. We demonstrate for the first time a detailed analysis of the effect the incorporation of INA/TINA monomers in quadruplex forming...

  3. Formation of a unique cluster of G-quadruplex structures in the HIV-1 Nef coding region: implications for antiviral activity.

    Directory of Open Access Journals (Sweden)

    Rosalba Perrone

    Full Text Available G-quadruplexes are tetraplex structures of nucleic acids that can form in G-rich sequences. Their presence and functional role have been established in telomeres, oncogene promoters and coding regions of the human chromosome. In particular, they have been proposed to be directly involved in gene regulation at the level of transcription. Because the HIV-1 Nef protein is a fundamental factor for efficient viral replication, infectivity and pathogenesis in vitro and in vivo, we investigated G-quadruplex formation in the HIV-1 nef gene to assess the potential for viral inhibition through G-quadruplex stabilization. A comprehensive computational analysis of the nef coding region of available strains showed the presence of three conserved sequences that were uniquely clustered. Biophysical testing proved that G-quadruplex conformations were efficiently stabilized or induced by G-quadruplex ligands in all three sequences. Upon incubation with a G-quadruplex ligand, Nef expression was reduced in a reporter gene assay and Nef-dependent enhancement of HIV-1 infectivity was significantly repressed in an antiviral assay. These data constitute the first evidence of the possibility to regulate HIV-1 gene expression and infectivity through G-quadruplex targeting and therefore open a new avenue for viral treatment.

  4. Duplex/quadruplex oligonucleotides: Role of the duplex domain in the stabilization of a new generation of highly effective anti-thrombin aptamers.

    Science.gov (United States)

    Russo Krauss, Irene; Napolitano, Valeria; Petraccone, Luigi; Troisi, Romualdo; Spiridonova, Vera; Mattia, Carlo Andrea; Sica, Filomena

    2018-02-01

    Recently, mixed duplex/quadruplex oligonucleotides have attracted great interest for use as biomedical aptamers. In the case of anti-thrombin aptamers, the addition of duplex-forming sequences to a G-quadruplex module identical or very similar to the best-known G-quadruplex of the Thrombin Binding Aptamer (HD1) results in new or improved biological properties, such as higher activity or different recognition properties with respect to HD1. Remarkably, this bimodular fold was hypothesized, based on its sequence, for the only anti-thrombin aptamer in advanced clinical trial, NU172. Whereas cation modulation of G-quadruplex conformation and stability is well characterized, only few data from similar analysis on duplex/quadruplex oligonucleotides exist. Here we have performed a characterization of structure and stability of four different duplex/quadruplex anti-thrombin aptamers, including NU172, in the presence of different cations and in physiological-mimicking conditions in comparison to HD1, by means of spectroscopic techniques (UV and circular dichroism) and differential scanning calorimetry. Our data show a strong reciprocal influence of each domain on the stability of the other and in particular suggest a stabilizing effect of the duplex region in the presence of solutions mimicking the physiological conditions, strengthening the idea that bimodular aptamers present better therapeutic potentialities than those containing a single G-quadruplex domain. Copyright © 2017 Elsevier B.V. All rights reserved.

  5. Giardia telomeric sequence d(TAGGG)4 forms two intramolecular G-quadruplexes in K+ solution: effect of loop length and sequence on the folding topology.

    Science.gov (United States)

    Hu, Lanying; Lim, Kah Wai; Bouaziz, Serge; Phan, Anh Tuân

    2009-11-25

    Recently, it has been shown that in K(+) solution the human telomeric sequence d[TAGGG(TTAGGG)(3)] forms a (3 + 1) intramolecular G-quadruplex, while the Bombyx mori telomeric sequence d[TAGG(TTAGG)(3)], which differs from the human counterpart only by one G deletion in each repeat, forms a chair-type intramolecular G-quadruplex, indicating an effect of G-tract length on the folding topology of G-quadruplexes. To explore the effect of loop length and sequence on the folding topology of G-quadruplexes, here we examine the structure of the four-repeat Giardia telomeric sequence d[TAGGG(TAGGG)(3)], which differs from the human counterpart only by one T deletion within the non-G linker in each repeat. We show by NMR that this sequence forms two different intramolecular G-quadruplexes in K(+) solution. The first one is a novel basket-type antiparallel-stranded G-quadruplex containing two G-tetrads, a G x (A-G) triad, and two A x T base pairs; the three loops are consecutively edgewise-diagonal-edgewise. The second one is a propeller-type parallel-stranded G-quadruplex involving three G-tetrads; the three loops are all double-chain-reversal. Recurrence of several structural elements in the observed structures suggests a "cut and paste" principle for the design and prediction of G-quadruplex topologies, for which different elements could be extracted from one G-quadruplex and inserted into another.

  6. Quadruplex-forming sequences occupy discrete regions inside plant LTR retrotransposons

    Czech Academy of Sciences Publication Activity Database

    Lexa, M.; Kejnovský, Eduard; Šteflová, Pavlína; Konvalinová, H.; Vorlíčková, Michaela; Vyskot, Boris

    2014-01-01

    Roč. 42, č. 2 (2014), s. 968-978 ISSN 0305-1048 R&D Projects: GA ČR(CZ) GAP205/12/0466; GA ČR(CZ) GAP305/10/0930; GA ČR(CZ) GAP501/10/0102; GA ČR(CZ) GA522/09/0083; GA ČR GPP501/10/P483 Institutional support: RVO:68081707 Keywords : INTRAMOLECULAR DNA QUADRUPLEXES * VIRUS TYPE-1 RNA * CIRCULAR-DICHROISM Subject RIV: BO - Biophysics Impact factor: 9.112, year: 2014

  7. Cation binding to 15-TBA quadruplex DNA is a multiple-pathway cation-dependent process

    Czech Academy of Sciences Publication Activity Database

    Reshetnikov, R.V.; Šponer, Jiří; Rassokhina, O.I.; Kopylov, A.M.; Tsvetkov, P.O.; Makarov, A.A.; Golovin, A.V.

    2011-01-01

    Roč. 39, č. 22 (2011), s. 9789-9802 ISSN 0305-1048 R&D Projects: GA AV ČR(CZ) IAA400040802; GA ČR(CZ) GA203/09/1476; GA ČR(CZ) GAP208/11/1822; GA MŠk(CZ) LC06030 Institutional research plan: CEZ:AV0Z50040507; CEZ:AV0Z50040702 Keywords : QM/MM * quadruplex DNA * molecular dynamics simulation Subject RIV: BO - Biophysics Impact factor: 8.026, year: 2011

  8. Clustered abasic lesions profoundly change the structure and stability of human telomeric G-quadruplexes

    Czech Academy of Sciences Publication Activity Database

    Kejnovská, Iva; Bednářová, Klára; Renčiuk, Daniel; Dvořáková, Zuzana; Školáková, Petra; Trantírek, L.; Fiala, R.; Vorlíčková, Michaela; Sagi, J.

    2017-01-01

    Roč. 45, č. 8 (2017), s. 4294-4305 ISSN 0305-1048 R&D Projects: GA MŠk EF15_003/0000477; GA ČR GAP205/12/0466; GA ČR GA13-28310S; GA ČR(CZ) GA15-06785S; GA MŠk(CZ) LQ1601 Institutional support: RVO:68081707 Keywords : dna-damage clusters * k+ solution * guanine quadruplexes Subject RIV: CE - Biochemistry OBOR OECD: Biochemistry and molecular biology Impact factor: 10.162, year: 2016

  9. G-Quadruplexes in DNA Replication: A Problem or a Necessity?

    Science.gov (United States)

    Valton, Anne-Laure; Prioleau, Marie-Noëlle

    2016-11-01

    DNA replication is a highly regulated process that ensures the correct duplication of the genome at each cell cycle. A precise cell type-specific temporal program controls the duplication of complex vertebrate genomes in an orderly manner. This program is based on the regulation of both replication origin firing and replication fork progression. G-quadruplexes (G4s), DNA secondary structures displaying noncanonical Watson-Crick base pairing, have recently emerged as key controllers of genome duplication. Here we discuss the various means by which G4s affect this fundamental cellular process. Copyright © 2016 Elsevier Ltd. All rights reserved.

  10. DNA adducts of antitumor cisplatin preclude telomeric sequences from forming G quadruplexes

    Czech Academy of Sciences Publication Activity Database

    Heringová, Pavla; Kašpárková, Jana; Brabec, Viktor

    2009-01-01

    Roč. 14, č. 6 (2009), s. 959-968 ISSN 0949-8257 R&D Projects: GA MZd(CZ) NR8562; GA MŠk(CZ) LC06030; GA MŠk(CZ) ME08017; GA MŠk(CZ) OC08003; GA AV ČR(CZ) 1QS500040581; GA AV ČR(CZ) KAN200200651; GA AV ČR(CZ) IAA400040803 Grant - others:GA MŠk(CZ) OC09018 Institutional research plan: CEZ:AV0Z50040507; CEZ:AV0Z50040702 Keywords : cisplatin * DNA quadruplex * telomere Subject RIV: BO - Biophysics Impact factor: 3.415, year: 2009

  11. Development of an Efficient G-Quadruplex-Stabilised Thrombin-Binding Aptamer Containing a Three-Carbon Spacer Molecule

    DEFF Research Database (Denmark)

    Aaldering, Lukas J.; Poongavanam, Vasanthanathan; Langkjær, Niels

    2017-01-01

    The thrombin-binding aptamer (TBA), which shows anticoagulant properties, is one of the most studied G-quadruplex-forming aptamers. In this study, we investigated the impact of different chemical modifications such as a three-carbon spacer (spacer-C3), unlocked nucleic acid (UNA) and 3′-amino-mod...

  12. Identification of the DNA-Binding Domains of Human Replication Protein A That Recognize G-Quadruplex DNA

    Directory of Open Access Journals (Sweden)

    Aishwarya Prakash

    2011-01-01

    Full Text Available Replication protein A (RPA, a key player in DNA metabolism, has 6 single-stranded DNA-(ssDNA- binding domains (DBDs A-F. SELEX experiments with the DBDs-C, -D, and -E retrieve a 20-nt G-quadruplex forming sequence. Binding studies show that RPA-DE binds preferentially to the G-quadruplex DNA, a unique preference not observed with other RPA constructs. Circular dichroism experiments show that RPA-CDE-core can unfold the G-quadruplex while RPA-DE stabilizes it. Binding studies show that RPA-C binds pyrimidine- and purine-rich sequences similarly. This difference between RPA-C and RPA-DE binding was also indicated by the inability of RPA-CDE-core to unfold an oligonucleotide containing a TC-region 5′ to the G-quadruplex. Molecular modeling studies of RPA-DE and telomere-binding proteins Pot1 and Stn1 reveal structural similarities between the proteins and illuminate potential DNA-binding sites for RPA-DE and Stn1. These data indicate that DBDs of RPA have different ssDNA recognition properties.

  13. Targeting G-quadruplex DNA Structures by EMICORON has a strong antitumor efficacy against advanced models of human colon cancer

    DEFF Research Database (Denmark)

    Porru, Manuela; Artuso, Simona; Salvati, Erica

    2015-01-01

    We previously identified EMICORON as a novel G-quadruplex (G4) ligand showing high selectivity for G4 structures over the duplex DNA, causing telomere damage and inhibition of cell proliferation in transformed and tumor cells. Here, we evaluated the antitumoral effect of EMICORON on advanced mode...

  14. Loss of loop adenines alters human telomere d[AG3(TTAG3)3] quadruplex folding

    Czech Academy of Sciences Publication Activity Database

    Babinský, M.; Fiala, R.; Kejnovská, Iva; Bednářová, Klára; Marek, R.; Sagi, J.; Sklenář, V.; Vorlíčková, Michaela

    2014-01-01

    Roč. 42, č. 22 (2014), s. 14031-14041 ISSN 0305-1048 R&D Projects: GA ČR(CZ) GAP205/12/0466 Institutional support: RVO:68081707 Keywords : human telomere * DNA quadruplex * cellular DNA Subject RIV: BO - Biophysics Impact factor: 9.112, year: 2014

  15. Evaluation of the effect of polymorphism on G-quadruplex-ligand interaction by means of spectroscopic and chromatographic techniques

    Science.gov (United States)

    Benito, S.; Ferrer, A.; Benabou, S.; Aviñó, A.; Eritja, R.; Gargallo, R.

    2018-05-01

    Guanine-rich sequences may fold into highly ordered structures known as G-quadruplexes. Apart from the monomeric G-quadruplex, these sequences may form multimeric structures that are not usually considered when studying interaction with ligands. This work studies the interaction of a ligand, crystal violet, with three guanine-rich DNA sequences with the capacity to form multimeric structures. These sequences correspond to short stretches found near the promoter regions of c-kit and SMARCA4 genes. Instrumental techniques (circular dichroism, molecular fluorescence, size-exclusion chromatography and electrospray ionization mass spectrometry) and multivariate data analysis were used for this purpose. The polymorphism of G-quadruplexes was characterized prior to the interaction studies. The ligand was shown to interact preferentially with the monomeric G-quadruplex; the binding stoichiometry was 1:1 and the binding constant was in the order of 105 M-1 for all three sequences. The results highlight the importance of DNA treatment prior to interaction studies.

  16. Hairpins participating in folding of human telomeric sequence quadruplexes studied by standard and T-REMD simulations

    Czech Academy of Sciences Publication Activity Database

    Stadlbauer, Petr; Kuehrova, P.; Banáš, P.; Koča, J.; Bussi, G.; Trantírek, L.; Otyepka, M.; Šponer, Jiří

    2016-01-01

    Roč. 43, č. 20 (2016), s. 9626-9644 ISSN 0305-1048 R&D Projects: GA ČR(CZ) GAP208/11/1822 Institutional support: RVO:68081707 Keywords : MOLECULAR-DYNAMICS SIMULATIONS * INTRAMOLECULAR DNA QUADRUPLEXES * PARTICLE MESH EWALD Subject RIV: BO - Biophysics Impact factor: 10.162, year: 2016

  17. Can We Execute Reliable MM-PBSA Free Energy Computations of Relative Stabilities of Different Guanine Quadruplex Folds?

    Czech Academy of Sciences Publication Activity Database

    Islam, B.; Stadlbauer, Petr; Neidle, S.; Haider, S.; Šponer, Jiří

    2016-01-01

    Roč. 120, č. 11 (2016), s. 2899-2912 ISSN 1520-6106 R&D Projects: GA ČR(CZ) GA16-13721S Institutional support: RVO:68081707 Keywords : MOLECULAR-DYNAMICS SIMULATIONS * TELOMERIC G-QUADRUPLEX * AMBER FORCE-FIELD Subject RIV: BO - Biophysics Impact factor: 3.177, year: 2016

  18. The G-quadruplex augments translation in the 5' untranslated region of transforming growth factor β2.

    Science.gov (United States)

    Agarwala, Prachi; Pandey, Satyaprakash; Mapa, Koyeli; Maiti, Souvik

    2013-03-05

    Transforming growth factor β2 (TGFβ2) is a versatile cytokine with a prominent role in cell migration, invasion, cellular development, and immunomodulation. TGFβ2 promotes the malignancy of tumors by inducing epithelial-mesenchymal transition, angiogenesis, and immunosuppression. As it is well-documented that nucleic acid secondary structure can regulate gene expression, we assessed whether any secondary motif regulates its expression at the post-transcriptional level. Bioinformatics analysis predicts an existence of a 23-nucleotide putative G-quadruplex sequence (PG4) in the 5' untranslated region (UTR) of TGFβ2 mRNA. The ability of this stretch of sequence to form a highly stable, intramolecular parallel quadruplex was demonstrated using ultraviolet and circular dichroism spectroscopy. Footprinting studies further validated its existence in the presence of a neighboring nucleotide sequence. Following structural characterization, we evaluated the biological relevance of this secondary motif using a dual luciferase assay. Although PG4 inhibits the expression of the reporter gene, its presence in the context of the entire 5' UTR sequence interestingly enhances gene expression. Mutation or removal of the G-quadruplex sequence from the 5' UTR of the gene diminished the level of expression of this gene at the translational level. Thus, here we highlight an activating role of the G-quadruplex in modulating gene expression of TGFβ2 at the translational level and its potential to be used as a target for the development of therapeutics against cancer.

  19. Quinone methides tethered to naphthalene diimides as selective G-quadruplex alkylating agents.

    Science.gov (United States)

    Di Antonio, Marco; Doria, Filippo; Richter, Sara N; Bertipaglia, Carolina; Mella, Mariella; Sissi, Claudia; Palumbo, Manlio; Freccero, Mauro

    2009-09-16

    We have developed novel G-quadruplex (G-4) ligand/alkylating hybrid structures, tethering the naphthalene diimide moiety to quaternary ammonium salts of Mannich bases, as quinone-methide precursors, activatable by mild thermal digestion (40 degrees C). The bis-substituted naphthalene diimides were efficiently synthesized, and their reactivity as activatable bis-alkylating agents was investigated in the presence of thiols and amines in aqueous buffered solutions. The electrophilic intermediate, quinone-methide, involved in the alkylation process was trapped, in the presence of ethyl vinyl ether, in a hetero Diels-Alder [4 + 2] cycloaddition reaction, yielding a substituted 2-ethoxychroman. The DNA recognition and alkylation properties of these new derivatives were investigated by gel electrophoresis, circular dichroism, and enzymatic assays. The alkylation process occurred preferentially on the G-4 structure in comparison to other DNA conformations. By dissecting reversible recognition and alkylation events, we found that the reversible process is a prerequisite to DNA alkylation, which in turn reinforces the G-quadruplex structural rearrangement.

  20. Nucleotide Pool Depletion Induces G-Quadruplex-Dependent Perturbation of Gene Expression

    Directory of Open Access Journals (Sweden)

    Charikleia Papadopoulou

    2015-12-01

    Full Text Available Nucleotide pool imbalance has been proposed to drive genetic instability in cancer. Here, we show that slowing replication forks by depleting nucleotide pools with hydroxyurea (HU can also give rise to both transient and permanent epigenetic instability of a reporter locus, BU-1, in DT40 cells. HU induces stochastic formation of Bu-1low variants in dividing cells, which have lost the H3K4me3 present in untreated cells. This instability is potentiated by an intragenic G quadruplex, which also promotes local H2Ax phosphorylation and transient heterochromatinization. Genome-wide, gene expression changes induced by HU significantly overlap with those resulting from loss of the G4-helicases FANCJ, WRN, and BLM. Thus, the effects of global replication stress induced by nucleotide pool depletion can be focused by local replication impediments caused by G quadruplex formation to induce epigenetic instability and changes in gene expression, a mechanism that may contribute to selectable transcriptional changes in cancer.

  1. Intermolecular G-quadruplex structure-based fluorescent DNA detection system.

    Science.gov (United States)

    Zhou, Hui; Wu, Zai-Sheng; Shen, Guo-Li; Yu, Ru-Qin

    2013-03-15

    Adopting multi-donors to pair with one acceptor could improve the performance of fluorogenic detection probes. However, common dyes (e.g., fluorescein) in close proximity to each other would self-quench the fluorescence, and the fluorescence is difficult to restore. In this contribution, we constructed a novel "multi-donors-to-one acceptor" fluorescent DNA detection system by means of the intermolecular G-quadruplex (IGQ) structure-based fluorescence signal enhancement combined with the hairpin oligonucleotide. The novel IGQ-hairpin system was characterized using the p53 gene as the model target DNA. The proposed system showed an improved assay performance due to the introduction of IGQ-structure into fluorescent signaling probes, which could inhibit the background fluorescence and increase fluorescence restoration amplitude of fluoresceins upon target DNA hybridization. The proof-of-concept scheme is expected to provide new insight into the potential of G-quadruplex structure and promote the application of fluorescent oligonucleotide probes in fundamental research, diagnosis, and treatment of genetic diseases. Copyright © 2012 Elsevier B.V. All rights reserved.

  2. A G-quadruplex-based Label-free Fluorometric Aptasensor for Adenosine Triphosphate Detection.

    Science.gov (United States)

    Li, Li Juan; Tian, Xue; Kong, Xiang Juan; Chu, Xia

    2015-01-01

    A G-quadruplex-based, label-free fluorescence assay was demonstrated for the detection of adenosine triphosphate (ATP). A double-stranded DNA (dsDNA), hybridized by ATP-aptamer and its complementary sequence, was employed as a substrate for ATP binding. SYBR Green I (SG I) was a fluorescent probe and exonuclease III (Exo III) was a nuclease to digest the dsDNA. Consequently, in the absence of ATP, the dsDNA was inset with SG I and was digested by Exo III, resulting in a low background signal. In the presence of ATP, the aptamer in dsDNA folded into a G-quadruplex structure that resisted the digestion of Exo III. SG I was inserted into the structure, showing high fluorescence. Owing to a decrease of the background noise, a high signal-to-noise ratio could be obtained. This sensor can detect ATP with a concentration ranging from 50 μM to 5 mM, and possesses a capacity for the sensitive determination of other targets.

  3. Prospect of bioflavonoid fisetin as a quadruplex DNA ligand: a biophysical approach.

    Directory of Open Access Journals (Sweden)

    Bidisha Sengupta

    Full Text Available Quadruplex (G4 forming sequences in telomeric DNA and c-myc promoter regions of human DNA are associated with tumorogenesis. Ligands that can facilitate or stabilize the formation and increase the stabilization of G4 can prevent tumor cell proliferation and have been regarded as potential anti-cancer drugs. In the present study, steady state and time-resolved fluorescence measurements provide important structural and dynamical insights into the free and bound states of the therapeutically potent plant flavonoid fisetin (3,3',4',7-tetrahydroxyflavone in a G4 DNA matrix. The excited state intra-molecular proton transfer (ESPT of fisetin plays an important role in observing and understanding the binding of fisetin with the G4 DNA. Differential absorption spectra, thermal melting, and circular dichroism spectroscopic studies provide evidences for the formation of G4 DNA and size exclusion chromatography (SEC proves the binding and 1∶1 stoichiometry of fisetin in the DNA matrix. Comparative analysis of binding in the presence of EtBr proves that fisetin favors binding at the face of the G-quartet, mostly along the diagonal loop. Time resolved fluorescence anisotropy decay analysis indicates the increase in the restrictions in motion from the free to bound fisetin. We have also investigated the fingerprints of the binding of fisetin in the antiparallel quadruplex using Raman spectroscopy. Preliminary results indicate fisetin to be a prospective candidate as a G4 ligand.

  4. Prospect of Bioflavonoid Fisetin as a Quadruplex DNA Ligand: A Biophysical Approach

    Science.gov (United States)

    Sengupta, Bidisha; Pahari, Biswapathik; Blackmon, Laura; Sengupta, Pradeep K.

    2013-01-01

    Quadruplex (G4) forming sequences in telomeric DNA and c-myc promoter regions of human DNA are associated with tumorogenesis. Ligands that can facilitate or stabilize the formation and increase the stabilization of G4 can prevent tumor cell proliferation and have been regarded as potential anti-cancer drugs. In the present study, steady state and time-resolved fluorescence measurements provide important structural and dynamical insights into the free and bound states of the therapeutically potent plant flavonoid fisetin (3,3′,4′,7-tetrahydroxyflavone) in a G4 DNA matrix. The excited state intra-molecular proton transfer (ESPT) of fisetin plays an important role in observing and understanding the binding of fisetin with the G4 DNA. Differential absorption spectra, thermal melting, and circular dichroism spectroscopic studies provide evidences for the formation of G4 DNA and size exclusion chromatography (SEC) proves the binding and 1∶1 stoichiometry of fisetin in the DNA matrix. Comparative analysis of binding in the presence of EtBr proves that fisetin favors binding at the face of the G-quartet, mostly along the diagonal loop. Time resolved fluorescence anisotropy decay analysis indicates the increase in the restrictions in motion from the free to bound fisetin. We have also investigated the fingerprints of the binding of fisetin in the antiparallel quadruplex using Raman spectroscopy. Preliminary results indicate fisetin to be a prospective candidate as a G4 ligand. PMID:23785423

  5. G Quadruplex in Plants: A Ubiquitous Regulatory Element and Its Biological Relevance.

    Science.gov (United States)

    Yadav, Vikas; Hemansi; Kim, Nayun; Tuteja, Narendra; Yadav, Puja

    2017-01-01

    G quadruplexes (G4) are higher-order DNA and RNA secondary structures formed by G-rich sequences that are built around tetrads of hydrogen-bonded guanine bases. Potential G4 quadruplex sequences have been identified in G-rich eukaryotic non-telomeric and telomeric genomic regions. Upon function, G4 formation is known to involve in chromatin remodeling, gene regulation and has been associated with genomic instability, genetic diseases and cancer progression. The natural role and biological validation of G4 structures is starting to be explored, and is of particular interest for the therapeutic interventions for human diseases. However, the existence and physiological role of G4 DNA and G4 RNA in plants species have not been much investigated yet and therefore, is of great interest for the development of improved crop varieties for sustainable agriculture. In this context, several recent studies suggests that these highly diverse G4 structures in plants can be employed to regulate expression of genes involved in several pathophysiological conditions including stress response to biotic and abiotic stresses as well as DNA damage. In the current review, we summarize the recent findings regarding the emerging functional significance of G4 structures in plants and discuss their potential value in the development of improved crop varieties.

  6. G Quadruplex in Plants: A Ubiquitous Regulatory Element and Its Biological Relevance

    Directory of Open Access Journals (Sweden)

    Vikas Yadav

    2017-07-01

    Full Text Available G quadruplexes (G4 are higher-order DNA and RNA secondary structures formed by G-rich sequences that are built around tetrads of hydrogen-bonded guanine bases. Potential G4 quadruplex sequences have been identified in G-rich eukaryotic non-telomeric and telomeric genomic regions. Upon function, G4 formation is known to involve in chromatin remodeling, gene regulation and has been associated with genomic instability, genetic diseases and cancer progression. The natural role and biological validation of G4 structures is starting to be explored, and is of particular interest for the therapeutic interventions for human diseases. However, the existence and physiological role of G4 DNA and G4 RNA in plants species have not been much investigated yet and therefore, is of great interest for the development of improved crop varieties for sustainable agriculture. In this context, several recent studies suggests that these highly diverse G4 structures in plants can be employed to regulate expression of genes involved in several pathophysiological conditions including stress response to biotic and abiotic stresses as well as DNA damage. In the current review, we summarize the recent findings regarding the emerging functional significance of G4 structures in plants and discuss their potential value in the development of improved crop varieties.

  7. 6-Thioguanine alters the structure and stability of duplex DNA and inhibits quadruplex DNA formation.

    Science.gov (United States)

    Marathias, V M; Sawicki, M J; Bolton, P H

    1999-07-15

    The ability to chemically synthesize biomolecules has opened up the opportunity to observe changes in structure and activity that occur upon single atom substitution. In favorable cases this can provide information about the roles of individual atoms. The substitution of 6-thioguanine (6SG) for guanine is a potentially very useful single atom substitution as 6SG has optical, photocrosslinking, metal ion binding and other properties of potential utility. In addition, 6-mercaptopurine is a clinically important pro-drug that is activated by conversion into 6SG by cells. The results presented here indicate that the presence of 6SG blocks the formation of quadruplex DNA. The presence of 6SG alters the structure and lowers the thermal stability of duplex DNA, but duplex DNA can be formed in the presence of 6SG. These results indicate that some of the cytotoxic activity of 6SG may be due to disruption of the quadruplex structures formed by telomere and other DNAs. This additional mode of action is consistent with the delayed onset of cytotoxicity.

  8. Structure variations of TBA G-quadruplex induced by 2'-O-methyl nucleotide in K+ and Ca2+ environments.

    Science.gov (United States)

    Zhao, Xiaoyang; Liu, Bo; Yan, Jing; Yuan, Ying; An, Liwen; Guan, Yifu

    2014-10-01

    Thrombin binding aptamer (TBA), a 15-mer oligonucleotide of d(GGTTGGTGTGGTTGG) sequence, folds into a chair-type antiparallel G-quadruplex in the K(+) environment, and each of two G-tetrads is characterized by a syn-anti-syn-anti glycosidic conformation arrangement. To explore its folding topology and structural stability, 2'-O-methyl nucleotide (OMe) with the C3'-endo sugar pucker conformation and anti glycosidic angle was used to selectively substitute for the guanine residues of G-tetrads of TBA, and these substituted TBAs were characterized using a circular dichroism spectrum, thermally differential spectrum, ultraviolet stability analysis, electrophoresis mobility shift assay, and thermodynamic analysis in K(+) and Ca(2+) environments. Results showed that single substitutions for syn-dG residues destabilized the G-quadruplex structure, while single substitutions for anti-dG residues could preserve the G-quadruplex in the K(+) environment. When one or two G-tetrads were modified with OMe, TBA became unstructured. In contrast, in Ca(2+) environment, the native TBA appeared to be unstructured. When two G-tetrads were substituted with OMe, TBA seemed to become a more stable parallel G-4 structure. Further thermodynamic data suggested that OMe-substitutions were an enthalpy-driven event. The results in this study enrich our understanding about the effects of nucleotide derivatives on the G-quadruplex structure stability in different ionic environments, which will help to design G-quadruplex for biological and medical applications. © The Author 2014. Published by ABBS Editorial Office in association with Oxford University Press on behalf of the Institute of Biochemistry and Cell Biology, Shanghai Institutes for Biological Sciences, Chinese Academy of Sciences.

  9. Co-transcriptional formation of DNA:RNA hybrid G-quadruplex and potential function as constitutional cis element for transcription control.

    Science.gov (United States)

    Zheng, Ke-wei; Xiao, Shan; Liu, Jia-quan; Zhang, Jia-yu; Hao, Yu-hua; Tan, Zheng

    2013-05-01

    G-quadruplex formation in genomic DNA is considered to regulate transcription. Previous investigations almost exclusively focused on intramolecular G-quadruplexes formed by DNA carrying four or more G-tracts, and structure formation has rarely been studied in physiologically relevant processes. Here, we report an almost entirely neglected, but actually much more prevalent form of G-quadruplexes, DNA:RNA hybrid G-quadruplexes (HQ) that forms in transcription. HQ formation requires as few as two G-tracts instead of four on a non-template DNA strand. Potential HQ sequences (PHQS) are present in >97% of human genes, with an average of 73 PHQSs per gene. HQ modulates transcription under both in vitro and in vivo conditions. Transcriptomal analysis of human tissues implies that maximal gene expression may be limited by the number of PHQS in genes. These features suggest that HQs may play fundamental roles in transcription regulation and other transcription-mediated processes.

  10. “One Ring to Bind Them All”—Part I: The Efficiency of the Macrocyclic Scaffold for G-Quadruplex DNA Recognition

    Directory of Open Access Journals (Sweden)

    David Monchaud

    2010-01-01

    Full Text Available Macrocyclic scaffolds are particularly attractive for designing selective G-quadruplex ligands essentially because, on one hand, they show a poor affinity for the “standard” B-DNA conformation and, on the other hand, they fit nicely with the external G-quartets of quadruplexes. Stimulated by the pioneering studies on the cationic porphyrin TMPyP4 and the natural product telomestatin, follow-up studies have developed, rapidly leading to a large diversity of macrocyclic structures with remarkable-quadruplex binding properties and biological activities. In this review we summarize the current state of the art in detailing the three main categories of quadruplex-binding macrocycles described so far (telomestatin-like polyheteroarenes, porphyrins and derivatives, polyammonium cyclophanes, and in addressing both synthetic issues and biological aspects.

  11. Intramolecular telomeric G-quadruplexes dramatically inhibit DNA synthesis by replicative and translesion polymerases, revealing their potential to lead to genetic change.

    Directory of Open Access Journals (Sweden)

    Deanna N Edwards

    Full Text Available Recent research indicates that hundreds of thousands of G-rich sequences within the human genome have the potential to form secondary structures known as G-quadruplexes. Telomeric regions, consisting of long arrays of TTAGGG/AATCCC repeats, are among the most likely areas in which these structures might form. Since G-quadruplexes assemble from certain G-rich single-stranded sequences, they might arise when duplex DNA is unwound such as during replication. Coincidentally, these bulky structures when present in the DNA template might also hinder the action of DNA polymerases. In this study, single-stranded telomeric templates with the potential to form G-quadruplexes were examined for their effects on a variety of replicative and translesion DNA polymerases from humans and lower organisms. Our results demonstrate that single-stranded templates containing four telomeric GGG runs fold into intramolecular G-quadruplex structures. These intramolecular G quadruplexes are somewhat dynamic in nature and stabilized by increasing KCl concentrations and decreasing temperatures. Furthermore, the presence of these intramolecular G-quadruplexes in the template dramatically inhibits DNA synthesis by various DNA polymerases, including the human polymerase δ employed during lagging strand replication of G-rich telomeric strands and several human translesion DNA polymerases potentially recruited to sites of replication blockage. Notably, misincorporation of nucleotides is observed when certain translesion polymerases are employed on substrates containing intramolecular G-quadruplexes, as is extension of the resulting mismatched base pairs upon dynamic unfolding of this secondary structure. These findings reveal the potential for blockage of DNA replication and genetic changes related to sequences capable of forming intramolecular G-quadruplexes.

  12. Fragile X mental retardation protein recognizes a G quadruplex structure within the survival motor neuron domain containing 1 mRNA 5'-UTR.

    Science.gov (United States)

    McAninch, Damian S; Heinaman, Ashley M; Lang, Cara N; Moss, Kathryn R; Bassell, Gary J; Rita Mihailescu, Mihaela; Evans, Timothy L

    2017-07-25

    G quadruplex structures have been predicted by bioinformatics to form in the 5'- and 3'-untranslated regions (UTRs) of several thousand mature mRNAs and are believed to play a role in translation regulation. Elucidation of these roles has primarily been focused on the 3'-UTR, with limited focus on characterizing the G quadruplex structures and functions in the 5'-UTR. Investigation of the affinity and specificity of RNA binding proteins for 5'-UTR G quadruplexes and the resulting regulatory effects have also been limited. Among the mRNAs predicted to form a G quadruplex structure within the 5'-UTR is the survival motor neuron domain containing 1 (SMNDC1) mRNA, encoding a protein that is critical to the spliceosome. Additionally, this mRNA has been identified as a potential target of the fragile X mental retardation protein (FMRP), whose loss of expression leads to fragile X syndrome. FMRP is an RNA binding protein involved in translation regulation that has been shown to bind mRNA targets that form G quadruplex structures. In this study we have used biophysical methods to investigate G quadruplex formation in the 5'-UTR of SMNDC1 mRNA and analyzed its interactions with FMRP. Our results show that SMNDC1 mRNA 5'-UTR forms an intramolecular, parallel G quadruplex structure comprised of three G quartet planes, which is bound specifically by FMRP both in vitro and in mouse brain lysates. These findings suggest a model by which FMRP might regulate the translation of a subset of its mRNA targets by recognizing the G quadruplex structure present in their 5'-UTR, and affecting their accessibility by the protein synthesis machinery.

  13. Investigation of ‘Head-to-Tail’-Connected Oligoaryl N,O-Ligands as Recognition Motifs for Cancer-Relevant G-Quadruplexes

    Directory of Open Access Journals (Sweden)

    Natalia Rizeq

    2017-12-01

    Full Text Available Oligomeric compounds, constituted of consecutive N,O-heteroaromatic rings, introduce useful and tunable properties as alternative ligands for biomolecular recognition. In this study, we have explored a synthetic scheme relying on Van Leusen oxazole formation, in conjunction with C–H activation of the formed oxazoles and their subsequent C–C cross-coupling to 2-bromopyridines in order to assemble a library of variable-length, ‘head-to-tail’-connected, pyridyl-oxazole ligands. Through investigation of the interaction of the three longer ligands (5-mer, 6-mer, 7-mer with cancer-relevant G-quadruplex structures (human telomeric/22AG and c-Myc oncogene promoter/Myc2345-Pu22, the asymmetric pyridyl-oxazole motif has been demonstrated to be a prominent recognition element for G-quadruplexes. Fluorescence titrations reveal excellent binding affinities of the 7-mer and 6-mer for a Na+-induced antiparallel 22AG G-quadruplex (KD = 0.6 × 10−7 M−1 and 0.8 × 10−7 M−1, respectively, and satisfactory (albeit lower affinities for the 22AG/K+ and Myc2345-Pu22/K+ G-quadruplexes. All ligands tested exhibit substantial selectivity for G-quadruplex versus duplex (ds26 DNA, as evidenced by competitive Förster resonance energy transfer (FRET melting assays. Additionally, the 7-mer and 6-mer are capable of promoting a sharp morphology transition of 22AG/K+ G-quadruplex.

  14. Identification and characterisation of a G-quadruplex forming sequence in the promoter region of nuclear factor (erythroid-derived 2)-like 2 (Nrf2)

    Energy Technology Data Exchange (ETDEWEB)

    Waller, Zoë A.E., E-mail: z.waller@uea.ac.uk; Howell, Lesley A.; MacDonald, Colin J.; O’Connell, Maria A.; Searcey, Mark, E-mail: m.searcey@uea.ac.uk

    2014-04-25

    Highlights: • Discovery of a G-quadruplex forming sequence in the promoter sequence of Nrf2. • Characterisation of the G-quadruplex by UV, CD and NMR. • Conformational switching of G-quadruplex induced by 9-aminoacridine. - Abstract: The transcription factor nuclear factor (erythroid-derived 2)-like 2 (Nrf2) regulates multiple antioxidants, Phase II detoxification enzymes and other cytoprotective enzymes in cells. Activation of Nrf2 is recognised as being of potential therapeutic benefit in inflammatory-diseases whereas more recently, it has become clear that the inhibition of Nrf2 may have benefit in the alleviation of resistance in some tumour types. A potential G-quadruplex forming sequence was identified in the promoter region of Nrf2, close to a number of putative transcription factor binding sites. Characterisation of the sequence 5’-d[GGGAAGGGAGCAAGGGCGGGAGGG]-3’ using CD spectroscopy, imino proton NMR resonances and UV melting experiments demonstrated the formation of a parallel intramolecular G-quadruplex in the presence of K{sup +} ions. Incubation with 9-aminoacridine ligands induced a switch from antiparallel to parallel forms. The presence of a G-quadruplex forming sequence in the promoter region of Nrf2 suggests an approach to targeting the production of the protein through stabilisation of the structure, thereby avoiding resistance to antitumour drugs.

  15. Development of a carbazole-based fluorescence probe for G-quadruplex DNA: The importance of side-group effect on binding specificity

    Science.gov (United States)

    Wang, Ming-Qi; Ren, Gui-Ying; Zhao, Shuang; Lian, Guang-Chang; Chen, Ting-Ting; Ci, Yang; Li, Hong-Yao

    2018-06-01

    G-quadruplex DNAs are highly prevalent in the human genome and involved in many important biological processes. However, many aspects of their biological mechanism and significance still need to be elucidated. Therefore, the development of fluorescent probes for G-quadruplex detection is important for the basic research. We report here on the development of small molecular dyes designed on the basis of carbazole scaffold by introducing styrene-like substituents at its 9-position, for the purpose of G-quadruplex recognition. Results revealed that the side group on the carbazole scaffold was very important for their ability to selectively recognize G-quadruplex DNA structures. 1a with the pyridine side group displayed excellent fluorescence signal turn-on property for the specific discrimination of G-quadruplex DNAs against other nucleic acids. The characteristics of 1a were further investigated with UV-vis spectrophotometry, fluorescence, circular dichroism, FID assay and molecular docking to validate the selectivity, sensitivity and detailed binding mode toward G-quadruplex DNAs.

  16. Phylo-typing of clinical Escherichia coli isolates originating from bovine mastitis and canine pyometra and urinary tract infection by means of quadruplex PCR.

    Science.gov (United States)

    Müştak, Hamit Kaan; Günaydin, Elçin; Kaya, İnci Başak; Salar, Merve Özdal; Babacan, Orkun; Önat, Kaan; Ata, Zafer; Diker, Kadir Serdar

    2015-01-01

    Escherichia coli is one of the major causative agents of bovine mastitis worldwide, and is typically associated with acute, clinical mastitis. Besides this, E. coli strains which belong to the extra-intestinal pathogenic group are also the major cause of urinary tract infections and pyometra in dogs. In this study, it was aimed to investigate phylo-groups/subgroups in 155 E. coli isolates obtained from acute bovine mastitis, 43 from urinary tract infections of dogs and 20 from canine pyometra by a formerly described triplex PCR and recently described new quadruplex polymerase chain reaction (PCR) method. Group A1 (n = 118; 76%) and B1 (n = 71; 46%) were found to be the most prevalent groups by triplex and quadruplex PCR assays in mastitis isolates, respectively. Phylo-typing of 43 urinary tract isolates also revealed that most of the isolates belonged to A1 (n = 23; 54%) by triplex and B2 (n = 36; 84%) by quadruplex PCR assays. The isolates assigned as group A1 (n = 17; 85%) by triplex PCR could not be classified by quadruplex PCR in pyometra isolates. The results support the hypothesis that E. coli strains isolated from bovine mastitis cases are environmental. Also, groups C, E and F were identified as new phylo-groups for the first time in acute bovine mastitis cases. The comparison of triplex PCR with quadruplex PCR results revealed that most of the groups assigned in triplex PCR were altered by quadruplex PCR assay.

  17. Digital broadcasting

    International Nuclear Information System (INIS)

    Park, Ji Hyeong

    1999-06-01

    This book contains twelve chapters, which deals with digitization of broadcast signal such as digital open, digitization of video signal and sound signal digitization of broadcasting equipment like DTPP and digital VTR, digitization of equipment to transmit such as digital STL, digital FPU and digital SNG, digitization of transmit about digital TV transmit and radio transmit, digital broadcasting system on necessity and advantage, digital broadcasting system abroad and Korea, digital broadcasting of outline, advantage of digital TV, ripple effect of digital broadcasting and consideration of digital broadcasting, ground wave digital broadcasting of DVB-T in Europe DTV in U.S.A and ISDB-T in Japan, HDTV broadcasting, satellite broadcasting, digital TV broadcasting in Korea, digital radio broadcasting and new broadcasting service.

  18. DNA secondary structures: stability and function of G-quadruplex structures

    Science.gov (United States)

    Bochman, Matthew L.; Paeschke, Katrin; Zakian, Virginia A.

    2013-01-01

    In addition to the canonical double helix, DNA can fold into various other inter- and intramolecular secondary structures. Although many such structures were long thought to be in vitro artefacts, bioinformatics demonstrates that DNA sequences capable of forming these structures are conserved throughout evolution, suggesting the existence of non-B-form DNA in vivo. In addition, genes whose products promote formation or resolution of these structures are found in diverse organisms, and a growing body of work suggests that the resolution of DNA secondary structures is critical for genome integrity. This Review focuses on emerging evidence relating to the characteristics of G-quadruplex structures and the possible influence of such structures on genomic stability and cellular processes, such as transcription. PMID:23032257

  19. Phenanthroline-2,9-bistriazoles as selective G-quadruplex ligands

    DEFF Research Database (Denmark)

    Nielsen, Mads Corvinius; Larsen, Anders Foller; Abdikadir, Faisal Hussein

    2014-01-01

    G-quadruplex (G4) ligands are currently receiving considerable attention as potential anticancer therapeutics. A series of phenanthroline-2,9-bistriazoles carrying tethered positive end groups has been synthesized and evaluated as G4 stabilizers. The compounds were efficiently assembled by copper......(I)-catalyzed azide-alkyne cycloaddition (CuAAC) in CH2Cl2 and water in the presence of a complexing agent. Characterization of the target compounds on telomeric and c-KIT G4 sequences led to the identification of guanidinium-substituted compounds as potent G4 DNA ligands with high selectivity over duplex DNA....... The diisopropylguanidium ligands exhibited high selectivity for the proto-oncogenic sequence c-KIT over the human telomeric sequence in the surface plasmon resonance (SPR) assay, whereas the compounds appeared potent on both G4 structures in the FRET melting temperature assay. The phenanthroline-2,9-bistriazole ligands...

  20. Tetrasubstituted phenanthrolines as highly potent, water-soluble, and selective g-quadruplex ligands

    DEFF Research Database (Denmark)

    Larsen, Anders Foller; Nielsen, Mads Corvinius; Ulven, Trond

    2012-01-01

    Small molecules capable of stabilizing the G-quadruplex (G4) structure are of interest for the development of improved anticancer drugs. Novel 4,7-diamino-substituted 1,10-phenanthroline-2,9-dicarboxamides that represent hybrid structures of known phenanthroline-based ligands have been designed....... An efficient synthetic route to the compounds has been developed and their interactions with various G4 sequences have been evaluated by Förster resonance energy transfer (FRET) melting assays, fluorescent intercalator displacement (FID), electrospray ionization mass spectrometry (ESI-MS), and circular...... dichroism (CD) spectroscopy. The preferred compounds have high aqueous solubility and are strong and potent G4 binders with a high selectivity over duplex DNA; thus, they represent a significant improvement over the lead compounds. Two of the compounds are inhibitors of HeLa and HT1080 cell proliferation....

  1. Use of alternative alkali chlorides in RT and PCR of polynucleotides containing G quadruplex structures.

    Science.gov (United States)

    Ramos-Alemán, Fabiola; González-Jasso, Eva; Pless, Reynaldo C

    2018-02-15

    Several alkali chlorides were compared for their use in reverse transcription (RT) and PCR of different types of nucleic acid templates. On a test region of biological DNA incapable of forming G quadruplex (G4) structures, Taq DNA polymerase showed similar PCR performance with 50 mM KCl, CsCl, LiCl, and NaCl. In contrast, on a synthetic model polydeoxyribonucleotide prone to G4 formation, good PCR amplification was obtained with 50 mM CsCl, but little or none with LiCl or KCl. Similarly, in RT of a G4-prone model polyribonucleotide, MMLV reverse transcriptase produced a good yield with 50 mM CsCl, mediocre yields with LiCl or without added alkali chloride, and a poor yield with 50 mM KCl. The full RT-PCR assay starting from the G4-prone polyribonucleotide, showed good results with CsCl in both stages, poor results with LiCl, and no product formation with KCl. The model polynucleotides showed fast G quadruplex formation under PCR or RT conditions with 50 mM KCl, but not with CsCl or LiCl. The results argue for the use of CsCl instead of KCl for RT and PCR of G4-prone sequences. No advantage was observed when using the 7-deaza type nucleotide analog c 7 dGTP in PCR amplification of the G4-prone polydeoxyribonucleotide. Copyright © 2017 Elsevier Inc. All rights reserved.

  2. Investigation of a Quadruplex-Forming Repeat Sequence Highly Enriched in Xanthomonas and Nostoc sp.

    Science.gov (United States)

    Rehm, Charlotte; Wurmthaler, Lena A; Li, Yuanhao; Frickey, Tancred; Hartig, Jörg S

    2015-01-01

    In prokaryotes simple sequence repeats (SSRs) with unit sizes of 1-5 nucleotides (nt) are causative for phase and antigenic variation. Although an increased abundance of heptameric repeats was noticed in bacteria, reports about SSRs of 6-9 nt are rare. In particular G-rich repeat sequences with the propensity to fold into G-quadruplex (G4) structures have received little attention. In silico analysis of prokaryotic genomes show putative G4 forming sequences to be abundant. This report focuses on a surprisingly enriched G-rich repeat of the type GGGNATC in Xanthomonas and cyanobacteria such as Nostoc. We studied in detail the genomes of Xanthomonas campestris pv. campestris ATCC 33913 (Xcc), Xanthomonas axonopodis pv. citri str. 306 (Xac), and Nostoc sp. strain PCC7120 (Ana). In all three organisms repeats are spread all over the genome with an over-representation in non-coding regions. Extensive variation of the number of repetitive units was observed with repeat numbers ranging from two up to 26 units. However a clear preference for four units was detected. The strong bias for four units coincides with the requirement of four consecutive G-tracts for G4 formation. Evidence for G4 formation of the consensus repeat sequences was found in biophysical studies utilizing CD spectroscopy. The G-rich repeats are preferably located between aligned open reading frames (ORFs) and are under-represented in coding regions or between divergent ORFs. The G-rich repeats are preferentially located within a distance of 50 bp upstream of an ORF on the anti-sense strand or within 50 bp from the stop codon on the sense strand. Analysis of whole transcriptome sequence data showed that the majority of repeat sequences are transcribed. The genetic loci in the vicinity of repeat regions show increased genomic stability. In conclusion, we introduce and characterize a special class of highly abundant and wide-spread quadruplex-forming repeat sequences in bacteria.

  3. Atomistic picture for the folding pathway of a hybrid-1 type human telomeric DNA G-quadruplex.

    Directory of Open Access Journals (Sweden)

    Yunqiang Bian

    2014-04-01

    Full Text Available In this work we studied the folding process of the hybrid-1 type human telomeric DNA G-quadruplex with solvent and K(+ ions explicitly modeled. Enabled by the powerful bias-exchange metadynamics and large-scale conventional molecular dynamic simulations, the free energy landscape of this G-DNA was obtained for the first time and four folding intermediates were identified, including a triplex and a basically formed quadruplex. The simulations also provided atomistic pictures for the structures and cation binding patterns of the intermediates. The results showed that the structure formation and cation binding are cooperative and mutually supporting each other. The syn/anti reorientation dynamics of the intermediates was also investigated. It was found that the nucleotides usually take correct syn/anti configurations when they form native and stable hydrogen bonds with the others, while fluctuating between two configurations when they do not. Misfolded intermediates with wrong syn/anti configurations were observed in the early intermediates but not in the later ones. Based on the simulations, we also discussed the roles of the non-native interactions. Besides, the formation process of the parallel conformation in the first two G-repeats and the associated reversal loop were studied. Based on the above results, we proposed a folding pathway for the hybrid-1 type G-quadruplex with atomistic details, which is new and more complete compared with previous ones. The knowledge gained for this type of G-DNA may provide a general insight for the folding of the other G-quadruplexes.

  4. Ball with hair: modular functionalization of highly stable G-quadruplex DNA nano-scaffolds through N2-guanine modification.

    Science.gov (United States)

    Lech, Christopher Jacques; Phan, Anh Tuân

    2017-06-20

    Functionalized nanoparticles have seen valuable applications, particularly in the delivery of therapeutic and diagnostic agents in biological systems. However, the manufacturing of such nano-scale systems with the consistency required for biological application can be challenging, as variation in size and shape have large influences in nanoparticle behavior in vivo. We report on the development of a versatile nano-scaffold based on the modular functionalization of a DNA G-quadruplex. DNA sequences are functionalized in a modular fashion using well-established phosphoramidite chemical synthesis with nucleotides containing modification of the amino (N2) position of the guanine base. In physiological conditions, these sequences fold into well-defined G-quadruplex structures. The resulting DNA nano-scaffolds are thermally stable, consistent in size, and functionalized in a manner that allows for control over the density and relative orientation of functional chemistries on the nano-scaffold surface. Various chemistries including small modifications (N2-methyl-guanine), bulky aromatic modifications (N2-benzyl-guanine), and long chain-like modifications (N2-6-amino-hexyl-guanine) are tested and are found to be generally compatible with G-quadruplex formation. Furthermore, these modifications stabilize the G-quadruplex scaffold by 2.0-13.3 °C per modification in the melting temperature, with concurrent modifications producing extremely stable nano-scaffolds. We demonstrate the potential of this approach by functionalizing nano-scaffolds for use within the biotin-avidin conjugation approach. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.

  5. Surface Plasmon Resonance kinetic analysis of the interaction between G-quadruplex nucleic acids and an anti-G-quadruplex monoclonal antibody.

    Science.gov (United States)

    Lago, Sara; Nadai, Matteo; Rossetto, Monica; Richter, Sara N

    2018-06-01

    G-quadruplexes (G4s) are nucleic acids secondary structures formed in guanine-rich sequences. Anti-G4 antibodies represent a tool for the direct investigation of G4s in cells. Surface Plasmon Resonance (SPR) is a highly sensitive technology, suitable for assessing the affinity between biomolecules. We here aimed at improving the orientation of an anti-G4 antibody on the SPR sensor chip to optimize detection of binding antigens. SPR was employed to characterize the anti-G4 antibody interaction with G4 and non-G4 oligonucleotides. Dextran-functionalized sensor chips were used both in covalent coupling and capturing procedures. The use of two leading molecule for orienting the antibody of interest allowed to improve its activity from completely non-functional to 65% active. The specificity of the anti-G4 antobody for G4 structures could thus be assessed with high sensitivity and reliability. Optimization of the immobilization protocol for SPR biosensing, allowed us to determine the anti-G4 antibody affinity and specificity for G4 antigens with higher sensitivity with respect to other in vitro assays such as ELISA. Anti-G4 antibody specificity is a fundamental assumption for the future utilization of this kind of antibodies for monitoring G4s directly in cells. The heterogeneous orientation of amine-coupling immobilized ligands is a general problem that often leads to partial or complete inactivation of the molecules. Here we describe a new strategy for improving ligand orientation: driving it from two sides. This principle can be virtually applied to every molecule that loses its activity or is poorly immobilized after standard coupling to the SPR chip surface. Copyright © 2018 The Authors. Published by Elsevier B.V. All rights reserved.

  6. DNA sensors and aptasensors based on the hemin/G-quadruplex-controlled aggregation of Au NPs in the presence of L-cysteine.

    Science.gov (United States)

    Niazov-Elkan, Angelica; Golub, Eyal; Sharon, Etery; Balogh, Dora; Willner, Itamar

    2014-07-23

    L-cysteine induces the aggregation of Au nanoparticles (NPs), resulting in a color transition from red to blue due to interparticle plasmonic coupling in the aggregated structure. The hemin/G-quadruplex horseradish peroxidase-mimicking DNAzyme catalyzes the aerobic oxidation of L-cysteine to cystine, a process that inhibits the aggregation of the NPs. The degree of inhibition of the aggregation process is controlled by the concentration of the DNAzyme in the system. These functions are implemented to develop sensing platforms for the detection of a target DNA, for the analysis of aptamer-substrate complexes, and for the analysis of L-cysteine in human urine samples. A hairpin DNA structure that includes a recognition site for the DNA analyte and a caged G-quadruplex sequence, is opened in the presence of the target DNA. The resulting self-assembled hemin/G-quadruplex acts as catalyst that controls the aggregation of the Au NPs. Also, the thrombin-binding aptamer folds into a G-quadruplex nanostructure upon binding to thrombin. The association of hemin to the resulting G-quadruplex aptamer-thrombin complex leads to a catalytic label that controls the L-cysteine-mediated aggregation of the Au NPs. The hemin/G-qaudruplex-controlled aggregation of Au NPs process is further implemented for visual and spectroscopic detection of L-cysteine concentration in urine samples. © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  7. Fluorescence detection of DNA, adenosine-5'-triphosphate (ATP), and telomerase activity by zinc(II)-protoporphyrin IX/G-quadruplex labels.

    Science.gov (United States)

    Zhang, Zhanxia; Sharon, Etery; Freeman, Ronit; Liu, Xiaoqing; Willner, Itamar

    2012-06-05

    The zinc(II)-protoporphyrin IX (ZnPPIX) fluorophore binds to G-quadruplexes, and this results in the enhanced fluorescence of the fluorophore. This property enabled the development of DNA sensors, aptasensors, and a sensor following telomerase activity. The DNA sensor is based on the design of a hairpin structure that includes a "caged" inactive G-quadruplex sequence. Upon opening the hairpin by the analyte DNA, the resulting fluorescence of the ZnPPIX/G-quadruplex provides the readout signal for the sensing event (detection limit 5 nM). Addition of Exonuclease III to the system allows the recycling of the analyte and its amplified analysis (detection limit, 200 pM). The association of the ZnPPIX to G-quadruplex aptamer-substrate complexes allowed the detection of adenosine-5'-triphosphate (ATP, detection limit 10 μM). Finally, the association of ZnPPIX to the G-quadruplex repeat units of telomers allowed the detection of telomerase activity originating from 380 ± 20 cancer 293T cell extract.

  8. Toward the design of new DNA G-quadruplex ligands through rational analysis of polymorphism and binding data.

    Science.gov (United States)

    Artese, Anna; Costa, Giosuè; Distinto, Simona; Moraca, Federica; Ortuso, Francesco; Parrotta, Lucia; Alcaro, Stefano

    2013-10-01

    Human telomeres play a key role in protecting chromosomal ends from fusion events; they are composed of d(TTAGGG) repeats, ranging in size from 3 to 15 kb. They form G-quadruplex DNA structures, stabilized by G-quartets in the presence of cations, and are involved in several biological processes. In particular, a telomere maintenance mechanism is provided by a specialized enzyme called telomerase, a reverse transcriptase able to add multiple copies of the 5'-GGTTAG-3' motif to the end of the G-strand of the telomere and which is over-expressed in the majority of cancer cells. The central cation has a crucial role in maintaining the stability of the structure. Based on its nature, it can be associated with different topological telomeric quadruplexes, which depend also on the orientation of the DNA strands and the syn/anti conformation of the guanines. Such a polymorphism, confirmed by the different structures deposited in the Protein Data Bank (PDB), prompted us to apply a computational protocol in order to investigate the conformational properties of a set of known G-quadruplex ligands and their molecular recognition against six different experimental models of the human telomeric sequence d[AG3(T2AG3)3]. The average AutoDock correlation between theoretical and experimental data yielded an r2 value equal to 0.882 among all the studied models. Such a result was always improved with respect to those of the single folds, with the exception of the parallel structure (r2 equal to 0.886), thus suggesting a key role of this G4 conformation in the stacking interaction network. Among the studied binders, a trisubstituted acridine and a dibenzophenanthroline derivative were well recognized by the parallel and the mixed G-quadruplex structures, allowing the identification of specific key contacts with DNA and the further design of more potent or target specific G-quadruplex ligands. Copyright © 2013 Elsevier Masson SAS. All rights reserved.

  9. Utilization of circular dichroism and electrospray ionization mass spectrometry to understand the formation and conversion of G-quadruplex DNA at the human c-myb proto-oncogene.

    Science.gov (United States)

    Fu, Hengqing; Yang, Pengfei; Hai, Jinhui; Li, Huihui

    2018-10-05

    G-quadruplex DNAs are involved in a number of key biological processes, including gene expression, transcription, and apoptosis. The c-myb oncogene contains a number of GGA repeats in its promoter which forms G-quadruplex, thus it could be used as a target in cancer therapeutics. Several in-vitro studies have used Circular Dichroism (CD) spectroscopy or electrospray ionization mass spectrometry (ESI-MS) to demonstrate formation and stability of G-quadruplex DNA structure in the promoter region of human c-myb oncogene. The factors affecting the c-myb G-quadruplex structures were investigated, such as cations (i.e. K + , NH 4 + and Na + ) and co-solutes (methanol and polyethylene glycol). The results indicated that the presence of cations and co-solutes could change the G-quadruplex structural population and promote its thermodynamic stabilization as indicated by CD melting curves. It indicated that the co-solutes preferentially stabilize the c-myb G-quadruplex structure containing both homo- and hetero-stacking. In addition, protopine was demonstrated as a binder of c-myb G-quadruplex as screened from a library of natural alkaloids using ESI-MS method. CD spectra showed that it could selectively stabilize the c-myb G-quadruplex structure compared to other six G-quadruplexes from tumor-related G-rich sequences and the duplex DNAs (both long and short-chain ones). The binding of protopine could induce the change in the G-quadruplex structural populations. Therefore, protopine with its high binding specificity could be considered as a precursor for the design of drugs to target and regulate c-myb oncogene transcription. Copyright © 2018 Elsevier B.V. All rights reserved.

  10. Investigation of a Quadruplex-Forming Repeat Sequence Highly Enriched in Xanthomonas and Nostoc sp.

    Directory of Open Access Journals (Sweden)

    Charlotte Rehm

    Full Text Available In prokaryotes simple sequence repeats (SSRs with unit sizes of 1-5 nucleotides (nt are causative for phase and antigenic variation. Although an increased abundance of heptameric repeats was noticed in bacteria, reports about SSRs of 6-9 nt are rare. In particular G-rich repeat sequences with the propensity to fold into G-quadruplex (G4 structures have received little attention. In silico analysis of prokaryotic genomes show putative G4 forming sequences to be abundant. This report focuses on a surprisingly enriched G-rich repeat of the type GGGNATC in Xanthomonas and cyanobacteria such as Nostoc. We studied in detail the genomes of Xanthomonas campestris pv. campestris ATCC 33913 (Xcc, Xanthomonas axonopodis pv. citri str. 306 (Xac, and Nostoc sp. strain PCC7120 (Ana. In all three organisms repeats are spread all over the genome with an over-representation in non-coding regions. Extensive variation of the number of repetitive units was observed with repeat numbers ranging from two up to 26 units. However a clear preference for four units was detected. The strong bias for four units coincides with the requirement of four consecutive G-tracts for G4 formation. Evidence for G4 formation of the consensus repeat sequences was found in biophysical studies utilizing CD spectroscopy. The G-rich repeats are preferably located between aligned open reading frames (ORFs and are under-represented in coding regions or between divergent ORFs. The G-rich repeats are preferentially located within a distance of 50 bp upstream of an ORF on the anti-sense strand or within 50 bp from the stop codon on the sense strand. Analysis of whole transcriptome sequence data showed that the majority of repeat sequences are transcribed. The genetic loci in the vicinity of repeat regions show increased genomic stability. In conclusion, we introduce and characterize a special class of highly abundant and wide-spread quadruplex-forming repeat sequences in bacteria.

  11. c-MYC G-quadruplex binding by the RNA polymerase I inhibitor BMH-21 and analogues revealed by a combined NMR and biochemical Approach.

    Science.gov (United States)

    Musso, Loana; Mazzini, Stefania; Rossini, Anna; Castagnoli, Lorenzo; Scaglioni, Leonardo; Artali, Roberto; Di Nicola, Massimo; Zunino, Franco; Dallavalle, Sabrina

    2018-03-01

    Pyridoquinazolinecarboxamides have been reported as RNA polymerase I inhibitors and represent a novel class of potential antitumor agents. BMH-21, was reported to intercalate with GC-rich rDNA, resulting in nucleolar stress as a primary mechanism of cytotoxicity. The interaction of BMH-21 and analogues with DNA G-quadruplex structures was studied by NMR and molecular modelling. The cellular response was investigated in a panel of human tumor cell lines and protein expression was examined by Western Blot analysis. We explored the ability of BMH-21 and its analogue 2 to bind to G-quadruplex present in the c-MYC promoter, by NMR and molecular modelling studies. We provide evidence that both compounds are not typical DNA intercalators but are effective binders of the tested G-quadruplex. The interaction with c-MYC G-quadruplex was reflected in down-regulation of c-Myc expression in human tumor cells. The inhibitory effect was almost complete in lymphoma cells SUDHL4 characterized by overexpression of c-Myc protein. This downregulation reflected an early and persistent modulation of cMyc mRNA. Given the relevance of c-MYC in regulation of ribosome biogenesis, it is conceivable that the inhibition of c-MYC contributes to the perturbation of nuclear functions and RNA polymerase I activity. Similar experiments with CX-5461, another RNA polymerase I transcription inhibitor, indicate the same behaviour in G-quadruplex stabilization. Our results support the hypothesis that BMH-21 and analogue compounds share the same mechanism, i.e. G-quadruplex binding as a primary event of a cascade leading to inhibition of RNA polymerase I and apoptosis. Copyright © 2017 Elsevier B.V. All rights reserved.

  12. Spectroscopic studies on the interactions of 5-ethyl-6-phenyl-3,8-bis((3-aminoalkyl)propanamido)phenanthridin-5-ium derivatives with G-quadruplex DNA

    Science.gov (United States)

    Yalçın, Ergin; Duyar, Halil; Ihmels, Heiko; Seferoğlu, Zeynel

    2018-05-01

    An improved microwave-induced synthesis of five ethidium derivatives (Ethidium derivatives, 2a-d) is presented. As the derivatives 2a-d have been proposed previously to be telomerase inhibitors, the binding interactions of these ethidium derivatives with G-quadruplex DNA were evaluated by means of photometric and fluorimetric titration, thermal DNA denaturation, CD and 1H NMR spectroscopy. In particular, the compound bearing 3,8-bis(pyrrolidin-1-yl)propanamido substituent 2a exhibits high selectivity for G-quadruplex DNA relative to duplex DNA.

  13. Mms1 is an assistant for regulating G-quadruplex DNA structures.

    Science.gov (United States)

    Schwindt, Eike; Paeschke, Katrin

    2017-11-02

    The preservation of genome stability is fundamental for every cell. Genomic integrity is constantly challenged. Among those challenges are also non-canonical nucleic acid structures. In recent years, scientists became aware of the impact of G-quadruplex (G4) structures on genome stability. It has been shown that folded G4-DNA structures cause changes in the cell, such as transcriptional up/down-regulation, replication stalling, or enhanced genome instability. Multiple helicases have been identified to regulate G4 structures and by this preserve genome stability. Interestingly, although these helicases are mostly ubiquitous expressed, they show specificity for G4 regulation in certain cellular processes (e.g., DNA replication). To this date, it is not clear how this process and target specificity of helicases are achieved. Recently, Mms1, an ubiquitin ligase complex protein, was identified as a novel G4-DNA-binding protein that supports genome stability by aiding Pif1 helicase binding to these regions. In this perspective review, we discuss the question if G4-DNA interacting proteins are fundamental for helicase function and specificity at G4-DNA structures.

  14. Binding polarity of RPA to telomeric sequences and influence of G-quadruplex stability.

    Science.gov (United States)

    Safa, Layal; Delagoutte, Emmanuelle; Petruseva, Irina; Alberti, Patrizia; Lavrik, Olga; Riou, Jean-François; Saintomé, Carole

    2014-08-01

    Replication protein A (RPA) is a single-stranded DNA binding protein that plays an essential role in telomere maintenance. RPA binds to and unfolds G-quadruplex (G4) structures formed in telomeric DNA, thus facilitating lagging strand DNA replication and telomerase activity. To investigate the effect of G4 stability on the interactions with human RPA (hRPA), we used a combination of biochemical and biophysical approaches. Our data revealed an inverse relationship between G4 stability and ability of hRPA to bind to telomeric DNA; notably small G4 ligands that enhance G4 stability strongly impaired G4 unfolding by hRPA. To gain more insight into the mechanism of binding and unfolding of telomeric G4 structures by RPA, we carried out photo-crosslinking experiments to elucidate the spatial arrangement of the RPA subunits along the DNA strands. Our results showed that RPA1 and RPA2 are arranged from 5' to 3' along the unfolded telomeric G4, as already described for unstructured single-stranded DNA, while no contact is possible with RPA3 on this short oligonucleotide. In addition, these data are compatible with a 5' to 3' directionality in G4 unfolding by hRPA. Copyright © 2014 Elsevier Masson SAS. All rights reserved.

  15. RPA-mediated unfolding of systematically varying G-quadruplex structures.

    Science.gov (United States)

    Ray, Sujay; Qureshi, Mohammad H; Malcolm, Dominic W; Budhathoki, Jagat B; Celik, Uğur; Balci, Hamza

    2013-05-21

    G-quadruplex (GQ) is a noncanonical nucleic acid structure that is formed by guanine rich sequences. Unless it is destabilized by proteins such as replication protein A (RPA), GQ could interfere with DNA metabolic functions, such as replication or repair. We studied RPA-mediated GQ unfolding using single-molecule FRET on two groups of GQ structures that have different loop lengths and different numbers of G-tetrad layers. We observed a linear increase in the steady-state stability of the GQ against RPA-mediated unfolding with increasing number of layers or decreasing loop length. The stability demonstrated by different GQ structures varied by at least three orders of magnitude. Those with shorter loops (less than three nucleotides long) or a greater number of layers (more than three layers) maintained a significant folded population even at physiological RPA concentration (≈1 μM), raising the possibility of physiological viability of such GQ structures. Finally, we measured the transition time between the start and end of the RPA-mediated GQ unfolding process to be 0.35 ± 0.10 s for all GQ constructs we studied, despite significant differences in their steady-state stabilities. We propose a two-step RPA-mediated GQ unfolding mechanism that is consistent with our observations. Copyright © 2013 Biophysical Society. Published by Elsevier Inc. All rights reserved.

  16. G-quadruplex formation in telomeres enhances POT1/TPP1 protection against RPA binding

    Science.gov (United States)

    Ray, Sujay; Bandaria, Jigar N.; Qureshi, Mohammad H.; Yildiz, Ahmet; Balci, Hamza

    2014-01-01

    Human telomeres terminate with a single-stranded 3′ G overhang, which can be recognized as a DNA damage site by replication protein A (RPA). The protection of telomeres (POT1)/POT1-interacting protein 1 (TPP1) heterodimer binds specifically to single-stranded telomeric DNA (ssTEL) and protects G overhangs against RPA binding. The G overhang spontaneously folds into various G-quadruplex (GQ) conformations. It remains unclear whether GQ formation affects the ability of POT1/TPP1 to compete against RPA to access ssTEL. Using single-molecule Förster resonance energy transfer, we showed that POT1 stably loads to a minimal DNA sequence adjacent to a folded GQ. At 150 mM K+, POT1 loading unfolds the antiparallel GQ, as the parallel conformation remains folded. POT1/TPP1 loading blocks RPA’s access to both folded and unfolded telomeres by two orders of magnitude. This protection is not observed at 150 mM Na+, in which ssTEL forms only a less-stable antiparallel GQ. These results suggest that GQ formation of telomeric overhangs may contribute to suppression of DNA damage signals. PMID:24516170

  17. QuadBase2: web server for multiplexed guanine quadruplex mining and visualization

    Science.gov (United States)

    Dhapola, Parashar; Chowdhury, Shantanu

    2016-01-01

    DNA guanine quadruplexes or G4s are non-canonical DNA secondary structures which affect genomic processes like replication, transcription and recombination. G4s are computationally identified by specific nucleotide motifs which are also called putative G4 (PG4) motifs. Despite the general relevance of these structures, there is currently no tool available that can allow batch queries and genome-wide analysis of these motifs in a user-friendly interface. QuadBase2 (quadbase.igib.res.in) presents a completely reinvented web server version of previously published QuadBase database. QuadBase2 enables users to mine PG4 motifs in up to 178 eukaryotes through the EuQuad module. This module interfaces with Ensembl Compara database, to allow users mine PG4 motifs in the orthologues of genes of interest across eukaryotes. PG4 motifs can be mined across genes and their promoter sequences in 1719 prokaryotes through ProQuad module. This module includes a feature that allows genome-wide mining of PG4 motifs and their visualization as circular histograms. TetraplexFinder, the module for mining PG4 motifs in user-provided sequences is now capable of handling up to 20 MB of data. QuadBase2 is a comprehensive PG4 motif mining tool that further expands the configurations and algorithms for mining PG4 motifs in a user-friendly way. PMID:27185890

  18. Escherichia coli DNA polymerase I can disrupt G-quadruplex structures during DNA replication.

    Science.gov (United States)

    Teng, Fang-Yuan; Hou, Xi-Miao; Fan, San-Hong; Rety, Stephane; Dou, Shuo-Xing; Xi, Xu-Guang

    2017-12-01

    Non-canonical four-stranded G-quadruplex (G4) DNA structures can form in G-rich sequences that are widely distributed throughout the genome. The presence of G4 structures can impair DNA replication by hindering the progress of replicative polymerases (Pols), and failure to resolve these structures can lead to genetic instability. In the present study, we combined different approaches to address the question of whether and how Escherichia coli Pol I resolves G4 obstacles during DNA replication and/or repair. We found that E. coli Pol I-catalyzed DNA synthesis could be arrested by G4 structures at low protein concentrations and the degree of inhibition was strongly dependent on the stability of the G4 structures. Interestingly, at high protein concentrations, E. coli Pol I was able to overcome some kinds of G4 obstacles without the involvement of other molecules and could achieve complete replication of G4 DNA. Mechanistic studies suggested that multiple Pol I proteins might be implicated in G4 unfolding, and the disruption of G4 structures requires energy derived from dNTP hydrolysis. The present work not only reveals an unrealized function of E. coli Pol I, but also presents a possible mechanism by which G4 structures can be resolved during DNA replication and/or repair in E. coli. © 2017 Federation of European Biochemical Societies.

  19. Quadruplex gold immunochromatogaraphic assay for four families of antibiotic residues in milk.

    Science.gov (United States)

    Zhou, Jinyu; Nie, Wei; Chen, Yiqiang; Yang, Chunjiang; Gong, Lu; Zhang, Chi; Chen, Qian; He, Lidong; Feng, Xiaoyu

    2018-08-01

    In this study, we developed a quadruplex gold immunochromatogaraphic assay (GICA) for the simultaneous determination of four families of antibiotics including β-lactams, tetracyclines, streptomycin and chloramphenicol in milk. For qualitative analysis, the visual cut-off values were measured to be 2-100 ng/mL, 16-32 ng/mL, 50 ng/mL and 2.4 ng/mL for β-lactams, tetracyclines, streptomycin and chloramphenicol, respectively. For quantitative analysis, the detection ranges were 0.13-1 ng/mL for penicillin G, 0.13-8 ng/mL for tetracycline, 0.78-25 ng/mL for streptomycin, 0.019-1.2 ng/mL for chloramphenicol in milk respectively, with linear correlation coefficients higher than 0.97. The spiked experiment indicated that the mean recoveries ranged from 84.5% to 107.6% with coefficient of variations less than 16.2%, and real sample analysis revealed that the GICA can produce consistent results with instrumental analysis. These results demonstrated that this novel immunoassay is a promising approach for rapidly screening common antibiotic residues in milk. Copyright © 2018 Elsevier Ltd. All rights reserved.

  20. Modular Assembly of Cell-targeting Devices Based on an Uncommon G-quadruplex Aptamer

    Directory of Open Access Journals (Sweden)

    Felipe Opazo

    2015-01-01

    Full Text Available Aptamers are valuable tools that provide great potential to develop cost-effective diagnostics and therapies in the biomedical field. Here, we report a novel DNA aptamer that folds into an unconventional G-quadruplex structure able to recognize and enter specifically into human Burkitt's lymphoma cells. We further optimized this aptamer to a highly versatile and stable minimized version. The minimized aptamer can be easily equipped with different functionalities like quantum dots, organic dyes, or even a second different aptamer domain yielding a bi-paratopic aptamer. Although the target molecule of the aptamer remains unknown, our microscopy and pharmacological studies revealed that the aptamer hijacks the clathrin-mediated endocytosis pathway for its cellular internalization. We conclude that this novel class of aptamers can be used as a modular tool to specifically deliver different cargoes into malignant cells. This work provides a thorough characterization of the aptamer and we expect that our strategy will pave the path for future therapeutic applications.

  1. Exploring the Dynamics of Propeller Loops in Human Telomeric DNA Quadruplexes Using Atomistic Simulations

    Science.gov (United States)

    2017-01-01

    We have carried out a series of extended unbiased molecular dynamics (MD) simulations (up to 10 μs long, ∼162 μs in total) complemented by replica-exchange with the collective variable tempering (RECT) approach for several human telomeric DNA G-quadruplex (GQ) topologies with TTA propeller loops. We used different AMBER DNA force-field variants and also processed simulations by Markov State Model (MSM) analysis. The slow conformational transitions in the propeller loops took place on a scale of a few μs, emphasizing the need for long simulations in studies of GQ dynamics. The propeller loops sampled similar ensembles for all GQ topologies and for all force-field dihedral-potential variants. The outcomes of standard and RECT simulations were consistent and captured similar spectrum of loop conformations. However, the most common crystallographic loop conformation was very unstable with all force-field versions. Although the loss of canonical γ-trans state of the first propeller loop nucleotide could be related to the indispensable bsc0 α/γ dihedral potential, even supporting this particular dihedral by a bias was insufficient to populate the experimentally dominant loop conformation. In conclusion, while our simulations were capable of providing a reasonable albeit not converged sampling of the TTA propeller loop conformational space, the force-field description still remained far from satisfactory. PMID:28475322

  2. Integration of G-quadruplex and DNA-templated Ag NCs for nonarithmetic information processing.

    Science.gov (United States)

    Gao, Ru-Ru; Yao, Tian-Ming; Lv, Xiao-Yan; Zhu, Yan-Yan; Zhang, Yi-Wei; Shi, Shuo

    2017-06-01

    To create sophisticated molecular logic circuits from scratch, you may not believe how common the building blocks can be and how diverse and powerful such circuits can be when scaled up. Using the two simple building blocks of G-quadruplex and silver nanoclusters (Ag NCs), we experimentally construct a series of multifunctional, label-free, and multi-output logic circuits to perform nonarithmetic functions: a 1-to-2 decoder, a 4-to-2 encoder, an 8-to-3 encoder, dual transfer gates, a 2 : 1 multiplexer, and a 1 : 2 demultiplexer. Moreover, a parity checker which is capable of identifying odd and even numbers from natural numbers is constructed conceptually. Finally, a multi-valued logic gate (ternary inhibit gate) is readily achieved by taking this DNA/Ag NC system as a universal platform. All of the above logic circuits share the same building blocks, indicating the great prospects of the assembly of nanomaterials and DNA for biochemical logic devices. Considering its biocompatibility, the novel prototypes developed here may have potential applications in the fields of biological computers and medical diagnosis and serve as a promising proof of principle in the not-too-distant future.

  3. G-quadruplexes Significantly Stimulate Pif1 Helicase-catalyzed Duplex DNA Unwinding*

    Science.gov (United States)

    Duan, Xiao-Lei; Liu, Na-Nv; Yang, Yan-Tao; Li, Hai-Hong; Li, Ming; Dou, Shuo-Xing; Xi, Xu-Guang

    2015-01-01

    The evolutionarily conserved G-quadruplexes (G4s) are faithfully inherited and serve a variety of cellular functions such as telomere maintenance, gene regulation, DNA replication initiation, and epigenetic regulation. Different from the Watson-Crick base-pairing found in duplex DNA, G4s are formed via Hoogsteen base pairing and are very stable and compact DNA structures. Failure of untangling them in the cell impedes DNA-based transactions and leads to genome instability. Cells have evolved highly specific helicases to resolve G4 structures. We used a recombinant nuclear form of Saccharomyces cerevisiae Pif1 to characterize Pif1-mediated DNA unwinding with a substrate mimicking an ongoing lagging strand synthesis stalled by G4s, which resembles a replication origin and a G4-structured flap in Okazaki fragment maturation. We find that the presence of G4 may greatly stimulate the Pif1 helicase to unwind duplex DNA. Further studies reveal that this stimulation results from G4-enhanced Pif1 dimerization, which is required for duplex DNA unwinding. This finding provides new insights into the properties and functions of G4s. We discuss the observed activation phenomenon in relation to the possible regulatory role of G4s in the rapid rescue of the stalled lagging strand synthesis by helping the replicator recognize and activate the replication origin as well as by quickly removing the G4-structured flap during Okazaki fragment maturation. PMID:25627683

  4. Long-range charge transport in single G-quadruplex DNA molecules

    DEFF Research Database (Denmark)

    Livshits, Gideon I.; Stern, Avigail; Rotem, Dvir

    2014-01-01

    DNA and DNA-based polymers are of interest in molecular electronics because of their versatile and programmable structures. However, transport measurements have produced a range of seemingly contradictory results due to differences in the measured molecules and experimental set-ups, and transport......DNA and DNA-based polymers are of interest in molecular electronics because of their versatile and programmable structures. However, transport measurements have produced a range of seemingly contradictory results due to differences in the measured molecules and experimental set......-ups, and transporting significant current through individual DNA-based molecules remains a considerable challenge. Here, we report reproducible charge transport in guanine-quadruplex (G4) DNA molecules adsorbed on a mica substrate. Currents ranging from tens of picoamperes to more than 100 pA were measured in the G4......-DNA over distances ranging from tens of nanometres to more than 100 nm. Our experimental results, combined with theoretical modelling, suggest that transport occurs via a thermally activated long-range hopping between multi-tetrad segments of DNA. These results could re-ignite interest in DNA...

  5. Identification of a New G-Quadruplex Motif in the KRAS Promoter and Design of Pyrene-Modified G4-Decoys with Antiproliferative Activity in Pancreatic Cancer Cells

    DEFF Research Database (Denmark)

    Cogoi, Susanna; Paramasivam, Manikandan; Filitchev, Vyacheslav Viatcheslav

    2009-01-01

    A new quadruplex motif located in the promoter of the human KRAS gene, within a nuclease hypersensitive element (NHE), has been characterized. Oligonucleotides mimicking this quadruplex are found to compete with a DNA-protein complex between NHE and a nuclear extract from pancreatic cancer cells........ When modified with (R)-1-O-[4-1-(1-pyrenylethynyl) phenylmethyl]glycerol insertions (TINA), the quadruplex oligonucleotides showed a dramatic increase of the Tm (ΔTm from 22 to 32 °C) and a strong antiproliferative effects in Panc-1 cells....

  6. Porous platinum nanotubes labeled with hemin/G-quadruplex based electrochemical aptasensor for sensitive thrombin analysis via the cascade signal amplification.

    Science.gov (United States)

    Sun, Aili; Qi, Qingan; Wang, Xuannian; Bie, Ping

    2014-07-15

    For the first time, a sensitive electrochemical aptasensor for thrombin (TB) was developed by using porous platinum nanotubes (PtNTs) labeled with hemin/G-quadruplex and glucose dehydrogenase (GDH) as labels. Porous PtNTs with large surface area exhibited the peroxidase-like activity. Coupling with GDH and hemin/G-quadruplex as NADH oxidase and HRP-mimicking DNAzyme, the cascade signal amplification was achieved by the following ways: in the presence of glucose and NAD(+) in the working buffer, GDH electrocatalyzed the oxidation of glucose with the production of NADH. Then, hemin/G-quadruplex as NADH oxidase catalyzed the oxidation of NADH to in situ generate H2O2. Based on the corporate electrocatalysis of PtNTs and hemin/G-quadruplex toward H2O2, the electrochemical signal was significantly amplified, allowing the detection limit of TB down to 0.15 pM level. Moreover, the proposed strategy was simple because the intercalated hemin offered the readout signal, avoiding the adding of additional redox mediator as signal donator. Such an electrochemical aptasensor is highly promising for sensitive detection of other proteins in clinical diagnostics. Copyright © 2014 Elsevier B.V. All rights reserved.

  7. Toehold strand displacement-driven assembly of G-quadruplex DNA for enzyme-free and non-label sensitive fluorescent detection of thrombin.

    Science.gov (United States)

    Xu, Yunying; Zhou, Wenjiao; Zhou, Ming; Xiang, Yun; Yuan, Ruo; Chai, Yaqin

    2015-02-15

    Based on a new signal amplification strategy by the toehold strand displacement-driven cyclic assembly of G-quadruplex DNA, the development of an enzyme-free and non-label aptamer sensing approach for sensitive fluorescent detection of thrombin is described. The target thrombin associates with the corresponding aptamer of the partial dsDNA probes and liberates single stranded initiation sequences, which trigger the toehold strand displacement assembly of two G-quadruplex containing hairpin DNAs. This toehold strand displacement reaction leads to the cyclic reuse of the initiation sequences and the production of DNA assemblies with numerous G-quadruplex structures. The fluorescent dye, N-Methyl mesoporphyrin IX, binds to these G-quadruplex structures and generates significantly amplified fluorescent signals to achieve highly sensitive detection of thrombin down to 5 pM. Besides, this method shows high selectivity towards the target thrombin against other control proteins. The developed thrombin sensing method herein avoids the modification of the probes and the involvement of any enzyme or nanomaterial labels for signal amplification. With the successful demonstration for thrombin detection, our approach can be easily adopted to monitor other target molecules in a simple, low-cost, sensitive and selective way by choosing appropriate aptamer/ligand pairs. Copyright © 2014 Elsevier B.V. All rights reserved.

  8. G-quadruplex-based structural transitions in 15-mer DNA oligonucleotides varying in lengths of internal oligo(dG) stretches detected by voltammetric techniques

    Czech Academy of Sciences Publication Activity Database

    Vidláková, Pavlína; Pivoňková, Hana; Kejnovská, Iva; Trnková, L.; Vorlíčková, Michaela; Fojta, Miroslav; Havran, Luděk

    2015-01-01

    Roč. 407, č. 19 (2015), s. 5817-5826 ISSN 1618-2642 R&D Projects: GA ČR GAP206/12/2378 Institutional support: RVO:68081707 Keywords : Oligonucleotides * Electrochemical methods * G-quadruplex Subject RIV: BO - Biophysics Impact factor: 3.125, year: 2015

  9. Voltammetry and Molecular Assembly of G-quadruplex DNAzyme on Single-crystal Au(111)-electrode Surfaces – Hemin as an Electrochemical Intercalator

    DEFF Research Database (Denmark)

    Zhang, Ling; Ulstrup, Jens; Zhang, Jingdong

    2016-01-01

    DNA quadruplexes (qs’s) are a class of “non-canonical” oligonucleotides (OGNs) composed of stacked guanine (G) quartets generally stabilized by monovalent cations. Metal porphyrins selectively bind to G-qs complexes to form DNAzyme, which can exhibit peroxidase and other catalytic activity simila...

  10. Separation of the potential G-quadruplex ligands from the butanol extract of Zanthoxylum ailanthoides Sieb. & Zucc. by countercurrent chromatography and preparative high performance liquid chromatography.

    Science.gov (United States)

    Han, Tian; Cao, Xueli; Xu, Jing; Pei, Hairun; Zhang, Hong; Tang, Yalin

    2017-07-21

    G-quadruplex DNA structure is considered to be a very attractive target for antitumor drug design due to its unique role in maintaining telomerase activities. Therefore, discovering ligands with high stability of G-quadruplex structure is of great interest. In this paper, pH-zone refining counter current chromatography (CCC) and preparative high performance liquid chromatography (HPLC) were employed for the separation of potent G-quadruplex ligands from the n-butanol fraction of the crude extract of Zanthoxylum ailanthoides, which is a traditional Chinese medicine recently found to display high inhibitory activity against several human cancer cells. The 75% aqueous ethanol extract of the stem bark of Z. ailanthoides and its fractions with petroleum ether, ethyl acetate and n-butanol displayed almost the same G-quadruplex stabilization ability. Here, pH-zone refining CCC was used for the separation of the alkaloids from the n-butanol fraction by a seldom used solvent system composed of dichloromethane-methanol-water (4:1:2.5) with 10mM TEA in the organic stationary phase as retainer and 10mM HCl in the aqueous mobile phase as eluter. Compounds I, II and III were obtained, with purity greater than 95%, in the quantities of 31.2, 94.0, and 26.4mg respectively from 300mg of lipophilic fraction within 80min, which were identified as three tetrahydroprotoberberines isolated for the first time in this plant. In addition, a phenylpropanoid glycoside compound IV (Syringin), an isoquinoline (Magnoflorine, V), and two lignin isomers (+)-lyoniresiol-3α-O-β-d-glucopyranoside (VI) and (-)-lyoniresinol -3α-O-β-D -glucopyranoside (VII) were isolated by traditional CCC together with preparative HPLC. Compounds IV, V, VI and VII were obtained, with purity greater than 95%, in the quantities of 4.0, 13.2, 6.7, and 6.5mg respectively from 960mg of hydrophilic fraction. Among the seven isolated compounds, tetrahydroprotoberberine I, II and III were found to display remarkable

  11. Ligand binding to telomeric G-quadruplex DNA investigated by funnel-metadynamics simulations.

    Science.gov (United States)

    Moraca, Federica; Amato, Jussara; Ortuso, Francesco; Artese, Anna; Pagano, Bruno; Novellino, Ettore; Alcaro, Stefano; Parrinello, Michele; Limongelli, Vittorio

    2017-03-14

    G-quadruplexes (G4s) are higher-order DNA structures typically present at promoter regions of genes and telomeres. Here, the G4 formation decreases the replicative DNA at each cell cycle, finally leading to apoptosis. The ability to control this mitotic clock, particularly in cancer cells, is fascinating and passes through a rational understanding of the ligand/G4 interaction. We demonstrate that an accurate description of the ligand/G4 binding mechanism is possible using an innovative free-energy method called funnel-metadynamics (FM), which we have recently developed to investigate ligand/protein interaction. Using FM simulations, we have elucidated the binding mechanism of the anticancer alkaloid berberine to the human telomeric G4 ( d [AG 3 (T 2 AG 3 ) 3 ]), computing also the binding free-energy landscape. Two ligand binding modes have been identified as the lowest energy states. Furthermore, we have found prebinding sites, which are preparatory to reach the final binding mode. In our simulations, the ions and the water molecules have been explicitly represented and the energetic contribution of the solvent during ligand binding evaluated. Our theoretical results provide an accurate estimate of the absolute ligand/DNA binding free energy ([Formula: see text] = -10.3 ± 0.5 kcal/mol) that we validated through steady-state fluorescence binding assays. The good agreement between the theoretical and experimental value demonstrates that FM is a most powerful method to investigate ligand/DNA interaction and can be a useful tool for the rational design also of G4 ligands.

  12. APTO-253 Stabilizes G-quadruplex DNA, Inhibits MYC Expression, and Induces DNA Damage in Acute Myeloid Leukemia Cells.

    Science.gov (United States)

    Local, Andrea; Zhang, Hongying; Benbatoul, Khalid D; Folger, Peter; Sheng, Xia; Tsai, Cheng-Yu; Howell, Stephen B; Rice, William G

    2018-06-01

    APTO-253 is a phase I clinical stage small molecule that selectively induces CDKN1A (p21), promotes G 0 -G 1 cell-cycle arrest, and triggers apoptosis in acute myeloid leukemia (AML) cells without producing myelosuppression in various animal species and humans. Differential gene expression analysis identified a pharmacodynamic effect on MYC expression, as well as induction of DNA repair and stress response pathways. APTO-253 was found to elicit a concentration- and time-dependent reduction in MYC mRNA expression and protein levels. Gene ontogeny and structural informatic analyses suggested a mechanism involving G-quadruplex (G4) stabilization. Intracellular pharmacokinetic studies in AML cells revealed that APTO-253 is converted intracellularly from a monomer to a ferrous complex [Fe(253) 3 ]. FRET assays demonstrated that both monomeric APTO-253 and Fe(253) 3 stabilize G4 structures from telomeres, MYC, and KIT promoters but do not bind to non-G4 double-stranded DNA. Although APTO-253 exerts a host of mechanistic sequelae, the effect of APTO-253 on MYC expression and its downstream target genes, on cell-cycle arrest, DNA damage, and stress responses can be explained by the action of Fe(253) 3 and APTO-253 on G-quadruplex DNA motifs. Mol Cancer Ther; 17(6); 1177-86. ©2018 AACR . ©2018 American Association for Cancer Research.

  13. A light-up probe targeting for Bcl-2 2345 G-quadruplex DNA with carbazole TO

    Science.gov (United States)

    Gu, Yingchun; Lin, Dayong; Tang, Yalin; Fei, Xuening; Wang, Cuihong; Zhang, Baolian; Zhou, Jianguo

    2018-02-01

    As its significant role, the selective recognition of G-quadruplex with specific structures and functions is important in biological and medicinal chemistry. Carbazole derivatives have been reported as a kind of fluorescent probe with many excellent optical properties. In the present study, the fluorescence of the dye (carbazole TO) increased almost 70 fold in the presence of bcl-2 2345 G4 compared to that alone in aqueous buffer condition with almost no fluorescence and 10-30 fold than those in the presence of other DNAs. The binding study results by activity inhibition of G4/Hemin peroxidase experiment, NMR titration and molecular docking simulation showed the high affinity and selectivity to bcl-2 2345 G4 arises from its end-stacking interaction with G-quartet. It is said that a facile approach with excellent sensitive, good selectivity and quick response for bcl-2 2345 G-quadruplex was developed and may be used for antitumor recognition or antitumor agents.

  14. Identification of New Natural DNA G-Quadruplex Binders Selected by a Structure-Based Virtual Screening Approach

    Directory of Open Access Journals (Sweden)

    Stefano Alcaro

    2013-09-01

    Full Text Available The G-quadruplex DNA structures are mainly present at the terminal portion of telomeres and can be stabilized by ligands able to recognize them in a specific manner. The recognition process is usually related to the inhibition of the enzyme telomerase indirectly involved and over-expressed in a high percentage of human tumors. There are several ligands, characterized by different chemical structures, already reported in the literature for their ability to bind and stabilize the G-quadruplex structures. Using the structural and biological information available on these structures; we performed a high throughput in silico screening of commercially natural compounds databases by means of a structure-based approach followed by docking experiments against the human telomeric sequence d[AG3(T2AG33]. We identified 12 best hits characterized by different chemical scaffolds and conformational and physicochemical properties. All of them were associated to an improved theoretical binding affinity with respect to that of known selective G-binders. Among these hits there is a chalcone derivative; structurally very similar to the polyphenol butein; known to remarkably inhibit the telomerase activity.

  15. Colorimetric detection of genetically modified organisms based on exonuclease III-assisted target recycling and hemin/G-quadruplex DNAzyme amplification.

    Science.gov (United States)

    Zhang, Decai; Wang, Weijia; Dong, Qian; Huang, Yunxiu; Wen, Dongmei; Mu, Yuejing; Yuan, Yong

    2017-12-21

    An isothermal colorimetric method is described for amplified detection of the CaMV 35S promoter sequence in genetically modified organism (GMO). It is based on (a) target DNA-triggered unlabeled molecular beacon (UMB) termini binding, and (b) exonuclease III (Exo III)-assisted target recycling, and (c) hemin/G-quadruplex (DNAzyme) based signal amplification. The specific binding of target to the G-quadruplex sequence-locked UMB triggers the digestion of Exo III. This, in turn, releases an active G-quadruplex segment and target DNA for successive hybridization and cleavage. The Exo III impellent recycling of targets produces numerous G-quadruplex sequences. These further associate with hemin to form DNAzymes and hence will catalyze H 2 O 2 -mediated oxidation of the chromogenic enzyme substrate ABTS 2- causing the formation of a green colored product. This finding enables a sensitive colorimetric determination of GMO DNA (at an analytical wavelength of 420 nm) at concentrations as low as 0.23 nM. By taking advantage of isothermal incubation, this method does not require sophisticated equipment or complicated syntheses. Analyses can be performed within 90 min. The method also discriminates single base mismatches. In our perception, it has a wide scope in that it may be applied to the detection of many other GMOs. Graphical abstract An isothermal and sensitive colorimetric method is described for amplified detection of CaMV 35S promoter sequence in genetically modified organism (GMO). It is based on target DNA-triggered molecular beacon (UMB) termini-binding and exonuclease III assisted target recycling, and on hemin/G-quadruplex (DNAzyme) signal amplification.

  16. Digital radiography

    International Nuclear Information System (INIS)

    Brody, W.R.

    1984-01-01

    Digital Radiography begins with an orderly introduction to the fundamental concepts of digital imaging. The entire X-ray digital imagining system is described, from an overall characterization of image quality to specific components required for a digital radiographic system. Because subtraction is central to digital radiographic systems, the author details the use of various subtraction methods for image enhancement. Complex concepts are illustrated with numerous examples and presented in terms that can readily be understood by physicians without an advanced mathematics background. The second part of the book discusses implementations and applications of digital imagining systems based on area and scanned detector technologies. This section includes thorough coverage of digital fluoroscopy, scanned projection radiography, and film-based digital imaging systems, and features a state-of-the-art synopsis of the applications of digital subtraction angiography. The book concludes with a timely assessment of anticipated technological advances

  17. Digital Culture and Digital Library

    Directory of Open Access Journals (Sweden)

    Yalçın Yalçınkaya

    2016-12-01

    Full Text Available In this study; digital culture and digital library which have a vital connection with each other are examined together. The content of the research consists of the interaction of culture, information, digital culture, intellectual technologies, and digital library concepts. The study is an entry work to integrity of digital culture and digital library theories and aims to expand the symmetry. The purpose of the study is to emphasize the relation between the digital culture and digital library theories acting intersection of the subjects that are examined. Also the perspective of the study is based on examining the literature and analytical evaluation in both studies (digital culture and digital library. Within this context, the methodology of the study is essentially descriptive and has an attribute for the transmission and synthesis of distributed findings produced in the field of the research. According to the findings of the study results, digital culture is an inclusive term that describes the effects of intellectual technologies in the field of information and communication. Information becomes energy and the spectrum of the information is expanding in the vertical rise through the digital culture. In this context, the digital library appears as a new living space of a new environment. In essence, the digital library is information-oriented; has intellectual technology support and digital platform; is in a digital format; combines information resources and tools in relationship/communication/cooperation by connectedness, and also it is the dynamic face of the digital culture in time and space independence. Resolved with the study is that the digital libraries are active and effective in the formation of global knowing and/or mass wisdom in the process of digital culture.

  18. Digital mammography; Mamografia digital

    Energy Technology Data Exchange (ETDEWEB)

    Chevalier, M.; Torres, R.

    2010-07-01

    Mammography represents one of the most demanding radiographic applications, simultaneously requiring excellent contrast sensitivity, high spatial resolution, and wide dynamic range. Film/screen is the most widely extended image receptor in mammography due to both its high spatial resolution and contrast. The film/screen limitations are related with its narrow latitude, structural noise and that is at the same time the medium for the image acquisition, storage and presentation. Several digital detector made with different technologies can overcome these difficulties. Here, these technologies as well as their main advantages and disadvantages are analyzed. Also it is discussed its impact on the mammography examinations, mainly on the breast screening programs. (Author).

  19. Digital Tectonics

    DEFF Research Database (Denmark)

    Christiansen, Karl; Borup, Ruben; Søndergaard, Asbjørn

    2014-01-01

    Digital Tectonics treats the architectonical possibilities in digital generation of form and production. The publication is the first volume of a series, in which aspects of the strategic focus areas of the Aarhus School of Architecture will be disseminated.......Digital Tectonics treats the architectonical possibilities in digital generation of form and production. The publication is the first volume of a series, in which aspects of the strategic focus areas of the Aarhus School of Architecture will be disseminated....

  20. Digital squares

    DEFF Research Database (Denmark)

    Forchhammer, Søren; Kim, Chul E

    1988-01-01

    Digital squares are defined and their geometric properties characterized. A linear time algorithm is presented that considers a convex digital region and determines whether or not it is a digital square. The algorithm also determines the range of the values of the parameter set of its preimages....... The analysis involves transforming the boundary of a digital region into parameter space of slope and y-intercept...

  1. Digital skrivedidaktik

    DEFF Research Database (Denmark)

    Digital skrivedidaktik består af to dele. Første del præsenterer teori om skrivekompetence og digital skrivning. Digital skrivning er karakteriseret ved at tekster skrives på computer og med digitale værktøjer, hvilket ændrer skrivningens traditionelle praksis, produkt og processer. Hvad er digital...... om elevens skriveproces) og Blogskrivning (der styrker eleverne i at bruge blogs i undervisningen)....

  2. Digital Citizenship

    Science.gov (United States)

    Isman, Aytekin; Canan Gungoren, Ozlem

    2014-01-01

    Era in which we live is known and referred as digital age.In this age technology is rapidly changed and developed. In light of these technological advances in 21st century, schools have the responsibility of training "digital citizen" as well as a good citizen. Digital citizens must have extensive skills, knowledge, Internet and …

  3. G-quadruplex recognition activities of E. Coli MutS

    Directory of Open Access Journals (Sweden)

    Ehrat Edward A

    2012-07-01

    Full Text Available Abstract Background Guanine quadruplex (G4 DNA is a four-stranded structure that contributes to genome instability and site-specific recombination. G4 DNA folds from sequences containing tandemly repetitive guanines, sequence motifs that are found throughout prokaryote and eukaryote genomes. While some cellular activities have been identified with binding or processing G4 DNA, the factors and pathways governing G4 DNA metabolism are largely undefined. Highly conserved mismatch repair factors have emerged as potential G4-responding complexes because, in addition to initiating heteroduplex correction, the human homologs bind non-B form DNA with high affinity. Moreover, the MutS homologs across species have the capacity to recognize a diverse range of DNA pairing variations and damage, suggesting a conserved ability to bind non-B form DNA. Results Here, we asked if E. coli MutS and a heteroduplex recognition mutant, MutS F36A, were capable of recognizing and responding to G4 DNA structures. We find by mobility shift assay that E. coli MutS binds to G4 DNA with high affinity better than binding to G-T heteroduplexes. In the same assay, MutS F36A failed to recognize G-T mismatched oligonucleotides, as expected, but retained an ability to bind to G4 DNA. Association with G4 DNA by MutS is not likely to activate the mismatch repair pathway because nucleotide binding did not promote release of MutS or MutS F36A from G4 DNA as it does for heteroduplexes. G4 recognition activities occur under physiological conditions, and we find that M13 phage harboring G4-capable DNA poorly infected a MutS deficient strain of E. coli compared to M13mp18, suggesting functional roles for mismatch repair factors in the cellular response to unstable genomic elements. Conclusions Taken together, our findings demonstrate that E. coli MutS has a binding activity specific for non-B form G4 DNA, but such binding appears independent of canonical heteroduplex repair activation.

  4. Digital subtraktion

    DEFF Research Database (Denmark)

    Mussmann, Bo Redder

    2004-01-01

    Digital subtraktion er en metode til at fjerne uønskede oplysninger i et røntgenbillede. Subtraktionsteknikken bruges primært i forbindelse med angiografi hvor man kun er interesseret i at se selve karret. Derfor er digital subtraktion i daglig tale synonymt med DSA eller DVI – hhv. Digital...... Subtraction Angiography eller Digital Vascular Imaging. Benævnelserne er to røntgenfirmaers navn for den samme teknik. Digital subtraktion kræver speciel software, samt at apparaturet kan eksponere i serier....

  5. Digital preservation

    CERN Document Server

    Deegan, Marilyn

    2013-01-01

    Digital preservation is an issue of huge importance to the library and information profession right now. With the widescale adoption of the internet and the rise of the world wide web, the world has been overwhelmed by digital information. Digital data is being produced on a massive scale by individuals and institutions: some of it is born, lives and dies only in digital form, and it is the potential death of this data, with its impact on the preservation of culture, that is the concern of this book. So how can information professionals try to remedy this? Digital preservation is a complex iss

  6. Digital Natives or Digital Tribes?

    Science.gov (United States)

    Watson, Ian Robert

    2013-01-01

    This research builds upon the discourse surrounding digital natives. A literature review into the digital native phenomena was undertaken and found that researchers are beginning to identify the digital native as not one cohesive group but of individuals influenced by other factors. Primary research by means of questionnaire survey of technologies…

  7. Computational Analysis of G-Quadruplex Forming Sequences across Chromosomes Reveals High Density Patterns Near the Terminal Ends.

    Directory of Open Access Journals (Sweden)

    Julia H Chariker

    Full Text Available G-quadruplex structures (G4 are found throughout the human genome and are known to play a regulatory role in a variety of molecular processes. Structurally, they have many configurations and can form from one or more DNA strands. At the gene level, they regulate gene expression and protein synthesis. In this paper, chromosomal-level patterns of distribution are analyzed on the human genome to identify high-level distribution patterns potentially related to global functional processes. Here we show unique high density banding patterns on individual chromosomes that are highly correlated, appearing in a mirror pattern, across forward and reverse DNA strands. The highest density of G4 sequences occurs within four megabases of one end of most chromosomes and contains G4 motifs that bind with zinc finger proteins. These findings suggest that G4 may play a role in global chromosomal processes such as those found in meiosis.

  8. G-quadruplex DNA sequences are evolutionarily conserved and associated with distinct genomic features in Saccharomyces cerevisiae.

    Directory of Open Access Journals (Sweden)

    John A Capra

    2010-07-01

    Full Text Available G-quadruplex DNA is a four-stranded DNA structure formed by non-Watson-Crick base pairing between stacked sets of four guanines. Many possible functions have been proposed for this structure, but its in vivo role in the cell is still largely unresolved. We carried out a genome-wide survey of the evolutionary conservation of regions with the potential to form G-quadruplex DNA structures (G4 DNA motifs across seven yeast species. We found that G4 DNA motifs were significantly more conserved than expected by chance, and the nucleotide-level conservation patterns suggested that the motif conservation was the result of the formation of G4 DNA structures. We characterized the association of conserved and non-conserved G4 DNA motifs in Saccharomyces cerevisiae with more than 40 known genome features and gene classes. Our comprehensive, integrated evolutionary and functional analysis confirmed the previously observed associations of G4 DNA motifs with promoter regions and the rDNA, and it identified several previously unrecognized associations of G4 DNA motifs with genomic features, such as mitotic and meiotic double-strand break sites (DSBs. Conserved G4 DNA motifs maintained strong associations with promoters and the rDNA, but not with DSBs. We also performed the first analysis of G4 DNA motifs in the mitochondria, and surprisingly found a tenfold higher concentration of the motifs in the AT-rich yeast mitochondrial DNA than in nuclear DNA. The evolutionary conservation of the G4 DNA motif and its association with specific genome features supports the hypothesis that G4 DNA has in vivo functions that are under evolutionary constraint.

  9. Label-free logic modules and two-layer cascade based on stem-loop probes containing a G-quadruplex domain.

    Science.gov (United States)

    Guo, Yahui; Cheng, Junjie; Wang, Jine; Zhou, Xiaodong; Hu, Jiming; Pei, Renjun

    2014-09-01

    A simple, versatile, and label-free DNA computing strategy was designed by using toehold-mediated strand displacement and stem-loop probes. A full set of logic gates (YES, NOT, OR, NAND, AND, INHIBIT, NOR, XOR, XNOR) and a two-layer logic cascade were constructed. The probes contain a G-quadruplex domain, which was blocked or unfolded through inputs initiating strand displacement and the obviously distinguishable light-up fluorescent signal of G-quadruplex/NMM complex was used as the output readout. The inputs are the disease-specific nucleotide sequences with potential for clinic diagnosis. The developed versatile computing system based on our label-free and modular strategy might be adapted in multi-target diagnosis through DNA hybridization and aptamer-target interaction. © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  10. A label-free luminescent switch-on assay for ATP using a G-quadruplex-selective iridium(III) complex.

    Science.gov (United States)

    Leung, Ka-Ho; Lu, Lihua; Wang, Modi; Mak, Tsun-Yin; Chan, Daniel Shiu-Hin; Tang, Fung-Kit; Leung, Chung-Hang; Kwan, Hiu-Yee; Yu, Zhiling; Ma, Dik-Lung

    2013-01-01

    We report herein the G-quadruplex-selective property of a luminescent cyclometallated iridium(III) complex for the detection of adenosine-5'-triphosphate (ATP) in aqueous solution. The ATP-binding aptamer was employed as the ATP recognition unit, while the iridium(III) complex was used to monitor the formation of the G-quadruplex structure induced by ATP. The sensitivity and fold enhancement of the assay were higher than those of the previously reported assay using the organic dye crystal violet as a fluorescent probe. This label-free luminescent switch-on assay exhibits high sensitivity and selectivity towards ATP with a limit of detection of 2.5 µM.

  11. A label-free luminescent switch-on assay for ATP using a G-quadruplex-selective iridium(III complex.

    Directory of Open Access Journals (Sweden)

    Ka-Ho Leung

    Full Text Available We report herein the G-quadruplex-selective property of a luminescent cyclometallated iridium(III complex for the detection of adenosine-5'-triphosphate (ATP in aqueous solution. The ATP-binding aptamer was employed as the ATP recognition unit, while the iridium(III complex was used to monitor the formation of the G-quadruplex structure induced by ATP. The sensitivity and fold enhancement of the assay were higher than those of the previously reported assay using the organic dye crystal violet as a fluorescent probe. This label-free luminescent switch-on assay exhibits high sensitivity and selectivity towards ATP with a limit of detection of 2.5 µM.

  12. Enantioselective light switch effect of Δ- and Λ-[Ru(phenanthroline)2 dipyrido[3,2-a:2', 3'-c]phenazine]2+ bound to G-quadruplex DNA.

    Science.gov (United States)

    Park, Jin Ha; Lee, Hyun Suk; Jang, Myung Duk; Han, Sung Wook; Kim, Seog K; Lee, Young-Ae

    2018-06-01

    The interaction of Δ- and Λ-[Ru(phen) 2 DPPZ] 2+ (DPPZ = dipyrido[3,2-a:2', 3'-c]phenazine, phen = phenanthroline) with a G-quadruplex formed from 5'-G 2 T 2 G 2 TGTG 2 T 2 G 2-3 '(15-mer) was investigated. The well-known enhancement of luminescence intensity (the 'light-switch' effect) was observed for the [Ru(phen) 2 DPPZ] 2+ complexes upon formation of an adduct with the G-quadruplex. The emission intensity of the G-quadruplex-bound Λ-isomer was 3-fold larger than that of the Δ-isomer when bound to the G-quadruplex, which is opposite of the result observed in the case of double stranded DNA (dsDNA); the light switch effect is larger for the dsDNA-bound Δ-isomer. In the job plot of the G-quadruplex with Δ- and Λ-[Ru(phen) 2 DPPZ] 2+ , a major inflection point for the two isomers was observed at x ≈ .65, which suggests a binding stoichiometry of 2:1 for both enantiomers. When the G base at the 8th position was replaced with 6-methyl isoxanthopterin (6MI), a fluorescent guanine analog, the excited energy of 6-MI transferred to bound Δ- or Λ-[Ru(phen) 2 DPPZ] 2+ , which suggests that at least a part of both Ru(II) enantiomers is close to or in contact with the diagonal loop of the G-quadruplex. A luminescence quenching experiment using [Fe(CN) 6 ] 4- for the G-quadruplex-bound Ru(II) complex revealed downward bending curves for both enantiomers in the Stern-Volmer plot, which suggests the presence of Ru(II) complexes that are both accessible and inaccessible to the quencher and may be related to the 2:1 binding stoichiometry.

  13. Digital mammography

    International Nuclear Information System (INIS)

    Bick, Ulrich; Diekmann, Felix

    2010-01-01

    This state-of-the-art reference book provides in-depth coverage of all aspects of digital mammography, including detector technology, image processing, computer-aided diagnosis, soft-copy reading, digital workflow, and PACS. Specific advantages and disadvantages of digital mammography in comparison to screen-film mammography are thoroughly discussed. By including authors from both North America and Europe, the book is able to outline variations in the use, acceptance, and quality assurance of digital mammography between the different countries and screening programs. Advanced imaging techniques and future developments such as contrast mammography and digital breast tomosynthesis are also covered in detail. All of the chapters are written by internationally recognized experts and contain numerous high-quality illustrations. This book will be of great interest both to clinicians who already use or are transitioning to digital mammography and to basic scientists working in the field. (orig.)

  14. Digital Insights

    DEFF Research Database (Denmark)

    Knudsen, Gry Høngsmark

    , by incorporating media as both channel, frame, and apparatus for advertising response, the dissertation brings into attention that more aspects than the text-reader relationship influence ad response. Finally, the dissertation proposes the assemblage approach for exploring big data in consumer culture research...... and practices with digital media, when they meet and interpret advertising. Through studies of advertising response on YouTube and experiments with consumers’ response to digitally manipulated images, the dissertation shows how digital media practices facilitate polysemic and socially embedded advertising......This dissertation forwards the theory of digital consumer-response as a perspective to examine how digital media practices influence consumers’ response to advertising. Digital consumer-response is a development of advertising theory that encompasses how consumers employ their knowledge...

  15. Structural dynamics of thrombin-binding DNA aptamer d(GGTTGGTGTGGTTGG) quadruplex DNA studied by large-scale explicit solvent simulations

    Czech Academy of Sciences Publication Activity Database

    Reshetnikov, R.; Golovin, A.; Spiridonova, V.; Kopylov, A.; Šponer, Jiří

    2010-01-01

    Roč. 6, č. 10 (2010), s. 3003-3014 ISSN 1549-9618 R&D Projects: GA AV ČR(CZ) IAA400040802; GA ČR(CZ) GA203/09/1476; GA MŠk(CZ) LC06030 Institutional research plan: CEZ:AV0Z50040507; CEZ:AV0Z50040702 Keywords : molecular dynamics * quadruplex DNA * thrombin Subject RIV: BO - Biophysics Impact factor: 5.138, year: 2010

  16. Exonuclease-assisted multicolor aptasensor for visual detection of ochratoxin A based on G-quadruplex-hemin DNAzyme-mediated etching of gold nanorod.

    Science.gov (United States)

    Yu, Xinhui; Lin, Yaohui; Wang, Xusheng; Xu, Liangjun; Wang, Zongwen; Fu, FengFu

    2018-04-21

    An exonuclease-assisted multicolor aptasensor was developed for the visual detection of ochratoxin A (OTA). It is based on the etching of gold nanorods (AuNRs) mediated by a G-quadruplex-hemin DNAzyme. A DNA sequence (AG4-OTA) was designed that comprises a hemin aptamer and an OTA aptamer. OTA binds to AG4-OTA to form an antiparallel G-quadruplex, which halts its digestion by exonuclease I (Exo I) from the 3'-end of AG4-OTA. Thus, the retained hemin aptamer can bind to hemin to form a G-quadruplex-hemin DNAzyme. This DNAzyme has peroxidase-like activity that catalyzes the oxidation of 3,3',5,5'-tetramethylbenzidine (TMB) by H 2 O 2 to produce its diimine derivative (TMB 2+ ) in acidic solution. TMB 2+ can etch the AuNRs by oxidizing Au(0) into Au(I). This results in the generation of rainbow-like colors and provides a multicolor platform for the visual detection of OTA. The assay is based on the use of a single isolated aptamer and possesses obvious advantages such as multi-color visual inspection, relatively high sensitivity and accuracy. It can be used to detect as little as 30 nM concentrations of OTA by visual observation and even 10 nM concentrations by spectrophotometry. The method was successfully applied to the determination of OTA in spiked beer where it gave recoveries of 101-108%, with a relative standard deviation (RSD, n = 5) of <5%. Graphical abstract Schematic of an exonuclease-assisted multicolor bioassay based on the G-quadruplex-hemin DNAzyme-mediated etching of gold nanorods (AuNRs). It enables visual detection of ochratoxin A (OTA) with a detection limit of 30 nM.

  17. Ion Binding to Quadruplex DNA Stems. Comparison of MM and QM Descriptions Reveals Sizable Polarization Effects Not Included in Contemporary Simulations

    Czech Academy of Sciences Publication Activity Database

    Gkionis, K.; Kruse, H.; Platts, J. A.; Mládek, Arnošt; Koča, J.; Šponer, Jiří

    2014-01-01

    Roč. 10, č. 3 (2014), s. 1326-1340 ISSN 1549-9618 R&D Projects: GA ČR(CZ) GAP208/11/1822; GA MŠk(CZ) ED1.1.00/02.0068 Institutional support: RVO:68081707 Keywords : MOLECULAR-DYNAMICS SIMULATIONS * GAUSSIAN-BASIS SETS * TETRAMOLECULAR G-QUADRUPLEXES Subject RIV: BO - Biophysics Impact factor: 5.498, year: 2014

  18. Triple Quenching of a Novel Self-Enhanced Ru(II) Complex by Hemin/G-Quadruplex DNAzymes and Its Potential Application to Quantitative Protein Detection.

    Science.gov (United States)

    Zhao, Min; Liao, Ni; Zhuo, Ying; Chai, Ya-Qin; Wang, Ji-Peng; Yuan, Ruo

    2015-08-04

    Herein, a novel "on-off" electrochemiluminescence (ECL) aptasensor for highly sensitive determination of thrombin has been constructed based on the triple quenching of the effect of hemin/G-quadruplex DNAzymes upon the Ru(II) complex-based ECL system. First, a strong initial ECL signal was achieved by the dual amplification strategies of (i) intramolecular coreaction of a self-enhanced Ru(II)-based molecule (PTCA-PEI-Ru(II)) and (ii) intermolecular coreaction between PTCA-PEI-Ru(II) and nicotinamide adenine dinucleotide (NADH), which was named the signal-on state. Then, a novel triple quenching of the effect of multifunctional hemin/G-quadruplex DNAzymes upon the Ru(II) complex-based ECL system was designed to realize the desirable signal-off state, which was outlined as follows: (i) the hemin/G-quadruplex DNAzymes mimicked NADH oxidase to oxidize NADH and in situ generate the H2O2, consuming the coreactant of NADH; (ii) its active center of hemin could oxidize the excited state PTCA-PEI-Ru(II)* to PTCA-PEI-Ru(III), making the energy and electron transfer quench; (iii) it also acted as horseradish peroxidase (HRP) to catalyze the H2O2 for in situ producing the quencher of O2. Based on triple quenching of the effect of hemin/G-quadruplex DNAzymes, the highly sensitive "on-off" thrombin aptasensor was developed with a wide linear detection range of 1.0 × 10(-14) M to 1.0 × 10(-10) M and a detection limit down to the femtomolar level.

  19. Human telomere sequence DNA in water-free and high-viscosity solvents: G-quadruplex folding governed by Kramers rate theory.

    Science.gov (United States)

    Lannan, Ford M; Mamajanov, Irena; Hud, Nicholas V

    2012-09-19

    Structures formed by human telomere sequence (HTS) DNA are of interest due to the implication of telomeres in the aging process and cancer. We present studies of HTS DNA folding in an anhydrous, high viscosity deep eutectic solvent (DES) comprised of choline choride and urea. In this solvent, the HTS DNA forms a G-quadruplex with the parallel-stranded ("propeller") fold, consistent with observations that reduced water activity favors the parallel fold, whereas alternative folds are favored at high water activity. Surprisingly, adoption of the parallel structure by HTS DNA in the DES, after thermal denaturation and quick cooling to room temperature, requires several months, as opposed to less than 2 min in an aqueous solution. This extended folding time in the DES is, in part, due to HTS DNA becoming kinetically trapped in a folded state that is apparently not accessed in lower viscosity solvents. A comparison of times required for the G-quadruplex to convert from its aqueous-preferred folded state to its parallel fold also reveals a dependence on solvent viscosity that is consistent with Kramers rate theory, which predicts that diffusion-controlled transitions will slow proportionally with solvent friction. These results provide an enhanced view of a G-quadruplex folding funnel and highlight the necessity to consider solvent viscosity in studies of G-quadruplex formation in vitro and in vivo. Additionally, the solvents and analyses presented here should prove valuable for understanding the folding of many other nucleic acids and potentially have applications in DNA-based nanotechnology where time-dependent structures are desired.

  20. Digital Signage

    OpenAIRE

    Fischer, Karl Peter

    2011-01-01

    Digital Signage for in-store advertising at gas stations/retail stores in Germany: A field study Digital Signage networks provide a novel means of advertising with the advantage of easily changeable and highly customizable animated content. Despite the potential and increasing use of these media empirical research is scarce. In a field study at 8 gas stations (with integrated convenience stores) we studied the effect of digital signage advertising on sales for different products and servi...

  1. Sports Digitalization

    DEFF Research Database (Denmark)

    Xiao, Xiao; Hedman, Jonas; Tan, Felix Ter Chian

    2017-01-01

    evolution, as digital technologies are increasingly entrenched in a wide range of sporting activities and for applications beyond mere performance enhancement. Despite such trends, research on sports digitalization in the IS discipline is surprisingly still nascent. This paper aims at establishing...... a discourse on sports digitalization within the discipline. Toward this, we first provide an understanding of the institutional characteristics of the sports industry, establishing its theoretical importance and relevance in our discipline; second, we reveal the latest trends of digitalization in the sports...

  2. Digital printing

    Science.gov (United States)

    Sobotka, Werner K.

    1997-02-01

    Digital printing is described as a tool to replace conventional printing machines completely. Still this goal was not reached until now with any of the digital printing technologies to be described in the paper. Productivity and costs are still the main parameters and are not really solved until now. Quality in digital printing is no problem anymore. Definition of digital printing is to transfer digital datas directly on the paper surface. This step can be carried out directly or with the use of an intermediate image carrier. Keywords in digital printing are: computer- to-press; erasable image carrier; image carrier with memory. Digital printing is also the logical development of the new digital area as it is pointed out in Nicholas Negropotes book 'Being Digital' and also the answer to networking and Internet technologies. Creating images text and color in one country and publishing the datas in another country or continent is the main advantage. Printing on demand another big advantage and last but not least personalization the last big advantage. Costs and being able to coop with this new world of prepress technology is the biggest disadvantage. Therefore the very optimistic growth rates for the next few years are really nonexistent. The development of complete new markets is too slow and the replacing of old markets is too small.

  3. Expression of Telomere-Associated Proteins is Interdependent to Stabilize Native Telomere Structure and Telomere Dysfunction by G-Quadruplex Ligand Causes TERRA Upregulation.

    Science.gov (United States)

    Sadhukhan, Ratan; Chowdhury, Priyanka; Ghosh, Sourav; Ghosh, Utpal

    2018-06-01

    Telomere DNA can form specialized nucleoprotein structure with telomere-associated proteins to hide free DNA ends or G-quadruplex structures under certain conditions especially in presence of G-quadruplex ligand. Telomere DNA is transcribed to form non-coding telomere repeat-containing RNA (TERRA) whose biogenesis and function is poorly understood. Our aim was to find the role of telomere-associated proteins and telomere structures in TERRA transcription. We silenced four [two shelterin (TRF1, TRF2) and two non-shelterin (PARP-1, SLX4)] telomere-associated genes using siRNA and verified depletion in protein level. Knocking down of one gene modulated expression of other telomere-associated genes and increased TERRA from 10q, 15q, XpYp and XqYq chromosomes in A549 cells. Telomere was destabilized or damaged by G-quadruplex ligand pyridostatin (PDS) and bleomycin. Telomere dysfunction-induced foci (TIFs) were observed for each case of depletion of proteins, treatment with PDS or bleomycin. TERRA level was elevated by PDS and bleomycin treatment alone or in combination with depletion of telomere-associated proteins.

  4. Determinants for Tight and Selective Binding of a Medicinal Dicarbene Gold(I) Complex to a Telomeric DNA G-Quadruplex: a Joint ESI MS and XRD Investigation.

    Science.gov (United States)

    Bazzicalupi, Carla; Ferraroni, Marta; Papi, Francesco; Massai, Lara; Bertrand, Benoît; Messori, Luigi; Gratteri, Paola; Casini, Angela

    2016-03-18

    The dicarbene gold(I) complex [Au(9-methylcaffein-8-ylidene)2 ]BF4 is an exceptional organometallic compound of profound interest as a prospective anticancer agent. This gold(I) complex was previously reported to be highly cytotoxic toward various cancer cell lines in vitro and behaves as a selective G-quadruplex stabilizer. Interactions of the gold complex with various telomeric DNA models have been analyzed by a combined ESI MS and X-ray diffraction (XRD) approach. ESI MS measurements confirmed formation of stable adducts between the intact gold(I) complex and Tel 23 DNA sequence. The crystal structure of the adduct formed between [Au(9-methylcaffein-8-ylidene)2 ](+) and Tel 23 DNA G-quadruplex was solved. Tel 23 maintains a characteristic propeller conformation while binding three gold(I) dicarbene moieties at two distinct sites. Stacking interactions appear to drive noncovalent binding of the gold(I) complex. The structural basis for tight gold(I) complex/G-quadruplex recognition and its selectivity are described. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  5. Allelic Dropout During Polymerase Chain Reaction due to G-Quadruplex Structures and DNA Methylation Is Widespread at Imprinted Human Loci

    Directory of Open Access Journals (Sweden)

    Aaron J. Stevens

    2017-03-01

    Full Text Available Loss of one allele during polymerase chain reaction (PCR amplification of DNA, known as allelic dropout, can be caused by a variety of mechanisms. Allelic dropout during PCR may have profound implications for molecular diagnostic and research procedures that depend on PCR and assume biallelic amplification has occurred. Complete allelic dropout due to the combined effects of cytosine methylation and G-quadruplex formation was previously described for a differentially methylated region of the human imprinted gene, MEST. We now demonstrate that this parent-of-origin specific allelic dropout can potentially occur at several other genomic regions that display genomic imprinting and have propensity for G-quadruplex formation, including AIM1, BLCAP, DNMT1, PLAGL1, KCNQ1, and GRB10. These findings demonstrate that systematic allelic dropout during PCR is a general phenomenon for regions of the genome where differential allelic methylation and G-quadruplex motifs coincide, and suggest that great care must be taken to ensure biallelic amplification is occurring in such situations.

  6. Allelic Dropout During Polymerase Chain Reaction due to G-Quadruplex Structures and DNA Methylation Is Widespread at Imprinted Human Loci.

    Science.gov (United States)

    Stevens, Aaron J; Taylor, Millie G; Pearce, Frederick Grant; Kennedy, Martin A

    2017-03-10

    Loss of one allele during polymerase chain reaction (PCR) amplification of DNA, known as allelic dropout, can be caused by a variety of mechanisms. Allelic dropout during PCR may have profound implications for molecular diagnostic and research procedures that depend on PCR and assume biallelic amplification has occurred. Complete allelic dropout due to the combined effects of cytosine methylation and G-quadruplex formation was previously described for a differentially methylated region of the human imprinted gene, MEST We now demonstrate that this parent-of-origin specific allelic dropout can potentially occur at several other genomic regions that display genomic imprinting and have propensity for G-quadruplex formation, including AIM1 , BLCAP , DNMT1 , PLAGL1 , KCNQ1 , and GRB10 These findings demonstrate that systematic allelic dropout during PCR is a general phenomenon for regions of the genome where differential allelic methylation and G-quadruplex motifs coincide, and suggest that great care must be taken to ensure biallelic amplification is occurring in such situations. Copyright © 2017 Stevens et al.

  7. A colorimetric platform for sensitively differentiating telomere DNA with different lengths, monitoring G-quadruplex and dsDNA based on silver nanoclusters and unmodified gold nanoparticles

    Science.gov (United States)

    Qu, Fei; Chen, Zeqiu; You, Jinmao; Song, Cuihua

    2018-05-01

    Human telomere DNA plays a vital role in genome integrity control and carcinogenesis as an indication for extensive cell proliferation. Herein, silver nanoclusters (Ag NCs) templated by polymer and unmodified gold nanoparticles (Au NPs) are designed as a new colorimetric platform for sensitively differentiating telomere DNA with different lengths, monitoring G-quadruplex and dsDNA. Ag NCs can produce the aggregation of Au NPs, so the color of Au NPs changes to blue and the absorption peak moves to 700 nm. While the telomere DNA can protect Au NPs from aggregation, the color turns to red again and the absorption band blue shift. Benefiting from the obvious color change, we can differentiate the length of telomere DNA by naked eyes. As the length of telomere DNA is longer, the variation of color becomes more noticeable. The detection limits of telomere DNA containing 10, 22, 40, 64 bases are estimated to be 1.41, 1.21, 0.23 and 0.22 nM, respectively. On the other hand, when telomere DNA forms G-quadruplex in the presence of K+, or dsDNA with complementary sequence, both G-quadruplex and dsDNA can protect Au NPs better than the unfolded telomere DNA. Hence, a new colorimetric platform for monitoring structure conversion of DNA is established by Ag NCs-Au NPs system, and to prove this type of application, a selective K+ sensor is developed.

  8. Fully integrated graphene electronic biosensor for label-free detection of lead (II) ion based on G-quadruplex structure-switching.

    Science.gov (United States)

    Li, Yijun; Wang, Cheng; Zhu, Yibo; Zhou, Xiaohong; Xiang, Yu; He, Miao; Zeng, Siyu

    2017-03-15

    This work presents a fully integrated graphene field-effect transistor (GFET) biosensor for the label-free detection of lead ions (Pb 2+ ) in aqueous-media, which first implements the G-quadruplex structure-switching biosensing principle in graphene nanoelectronics. We experimentally illustrate the biomolecular interplay that G-rich DNA single-strands with one-end confined on graphene surface can specifically interact with Pb 2+ ions and switch into G-quadruplex structures. Since the structure-switching of electrically charged DNA strands can disrupt the charge distribution in the vicinity of graphene surface, the carrier equilibrium in graphene sheet might be altered, and manifested by the conductivity variation of GFET. The experimental data and theoretical analysis show that our devices are capable of the label-free and specific quantification of Pb 2+ with a detection limit down to 163.7ng/L. These results first verify the signaling principle competency of G-quadruplex structure-switching in graphene electronic biosensors. Combining with the advantages of the compact device structure and convenient electrical signal, a label-free GFET biosensor for Pb 2+ monitoring is enabled with promising application potential. Copyright © 2016 Elsevier B.V. All rights reserved.

  9. Digital Audiobooks

    DEFF Research Database (Denmark)

    Have, Iben; Pedersen, Birgitte Stougaard

    Audiobooks are rapidly gaining popularity with widely accessible digital downloading and streaming services. The paper is framing how the digital audiobook expands and changes the target groups for book publications and how it as an everyday activity is creating new reading experiences, places...

  10. Digital TMI

    Science.gov (United States)

    Rios, Joseph

    2012-01-01

    Presenting the current status of the Digital TMI project to visiting members of the FAA Command Center. Digital TMI is an effort to store national-level traffic management initiatives in a standards-compliant manner. Work is funded by the FAA.

  11. Digital displacements

    DEFF Research Database (Denmark)

    Pors, Anja Svejgaard

    2014-01-01

    In recent years digital reforms are being introduced in the municipal landscape of Denmark. The reforms address the interaction between citizen and local authority. The aim is, that by 2015 at least 80 per cent of all correspondence between citizens and public authority will be transmitted through...... digital interface. However, the transformation of citizen services from traditional face-to-face interaction to digital self-service gives rise to new practices; some citizens need support to be able to manage self-service through digital tools. A mixture of support and teaching, named co......-service, is a new task in public administration, where street level bureaucrats assist citizens in using the new digital solutions. The paper is based on a case study conducted primarily in a citizen service centre in Copenhagen, Denmark. Based on ethnography the paper gives an empirical account of the ongoing...

  12. Digitized mammograms

    International Nuclear Information System (INIS)

    Bruneton, J.N.; Balu-Maestro, C.; Rogopoulos, A.; Chauvel, C.; Geoffray, A.

    1988-01-01

    Two observers conducted a blind evaluation of 100 mammography files, including 47 malignant cases. Films were read both before and after image digitization at 50 μm and 100 μm with the FilmDRSII. Digitization permitted better analysis of the normal anatomic structures and moderately improved diagnostic sensitivity. Searches for microcalcifications before and after digitization at 100 μm and 50 μm showed better analysis of anatomic structures after digitization (especially for solitary microcalcifications). The diagnostic benefit, with discovery of clustered microcalcifications, was more limited (one case at 100 μm, nine cases at 50 μm). Recognition of microcalcifications was clearly improved in dense breasts, which can benefit from reinterpretation after digitization at 50 μm rather 100μm

  13. Digital Ethics/Going Digital.

    Science.gov (United States)

    Wilson, Bradley

    1996-01-01

    Finds that the recent National Press Photographers Association code of ethics can serve as a model for any photography staff. Discusses how digital imaging is becoming commonplace in classrooms, due to decreasing costs and easier software. Explains digital terminology. Concludes that time saved in the darkroom and at the printer is now spent on…

  14. Digital radiography

    International Nuclear Information System (INIS)

    Coulomb, M.; Dal Soglio, S.; Pittet-Barbier, L.; Ranchoup, Y.; Thony, F.; Ferretti, G.; Robert, F.

    1992-01-01

    Digital projection radiography may replace conventional radiography some day, provided it can meet several requirements: equal or better diagnostic effectiveness of the screen-film systems; reasonable image cost; real improvement in the productivity of the Departments of Imaging. All digital radiographic systems include an X-ray source, an image acquisition and formatting sub-system, a display and manipulation sub-system, and archiving subsystem and a laser editing system, preferably shared by other sources of digital images. Three digitization processes are available: digitization of the radiographic film, digital fluorography and phospholuminescent detectors with memory. The advantages of digital fluoroscopy are appealing: real-time image acquisition, suppression of cassettes; but its disadvantages are far from negligible: it cannot be applied to bedside radiography, the field of examination is limited, and the wide-field spatial resolution is poor. Phospholuminescent detectors with memory have great advantages: they can be used for bedside radiographs and on all the common radiographic systems; spatial resolution is satisfactory; its current disadvantages are considerable. These two systems, have common properties making up the entire philosophy of digital radiology and specific features that must guide our choice according to the application. Digital fluorography is best applied in pediatric radiology. However, evaluation works have showed that it was applicable with sufficient quality to many indications of general radiology in which a fluoroscopic control and fast acquisition of the images are essential; the time gained on the examination may be considerable, as well as the savings on film. Detectors with memory are required for bedside radiographs, in osteoarticular and thoracic radiology, in all cases of traumatic emergency and in the resuscitation and intensive care departments

  15. Becoming digital

    DEFF Research Database (Denmark)

    Pors, Anja Svejgaard

    2015-01-01

    . An ethnographic account of how digital reforms are implemented in practice shows how street-level bureaucrat’s classic tasks such as specialized casework are being reconfigured into educational tasks that promote the idea of “becoming digital”. In the paper, the author argues that the work of “becoming digital....... Originality/value: The study contributes to ethnographic research in public administration by combining two separate subfields, e-government and street-level bureaucracy, to discern recent transformations in public service delivery. In the digital era, tasks, control and equality are distributed in ways...

  16. Digital Humanities

    DEFF Research Database (Denmark)

    Brügger, Niels

    2016-01-01

    , and preserving material to study, as an object of study in its own right, as an analytical tool, or for collaborating, and for disseminating results. The term "digital humanities" was coined around 2001, and gained currency within academia in the following years. However, computers had been used within......Digital humanities is an umbrella term for theories, methodologies, and practices related to humanities scholarship that use the digital computer as an integrated and essential part of its research and teaching activities. The computer can be used for establishing, finding, collecting...

  17. Digital Snaps

    DEFF Research Database (Denmark)

    Sandbye, Mette; Larsen, Jonas

    . Distance as the New Punctum / Mikko Villi -- pt. II. FAMILY ALBUMS IN TRANSITION -- ch. 4. How Digital Technologies Do Family Snaps, Only Better / Gillian Rose -- ch. 5. Friendship Photography: Memory, Mobility and Social Networking / Joanne Garde-Hansen -- ch. 6. Play, Process and Materiality in Japanese...... -- ch. 9. Retouch Yourself: The Pleasures and Politics of Digital Cosmetic Surgery / Tanya Sheehan -- ch. 10. Virtual Selves: Art and Digital Autobiography / Louise Wolthers -- ch. 11. Mobile-Media Photography: New Modes of Engagement / Michael Shanks and Connie Svabo....

  18. Digital electronics

    CERN Document Server

    Morris, John

    2013-01-01

    An essential companion to John C Morris's 'Analogue Electronics', this clear and accessible text is designed for electronics students, teachers and enthusiasts who already have a basic understanding of electronics, and who wish to develop their knowledge of digital techniques and applications. Employing a discovery-based approach, the author covers fundamental theory before going on to develop an appreciation of logic networks, integrated circuit applications and analogue-digital conversion. A section on digital fault finding and useful ic data sheets completes th

  19. Digital Leadership

    DEFF Research Database (Denmark)

    Zupancic, Tadeja; Verbeke, Johan; Achten, Henri

    2016-01-01

    Leadership is an important quality in organisations. Leadership is needed to introduce change and innovation. In our opinion, in architectural and design practices, the role of leadership has not yet been sufficiently studied, especially when it comes to the role of digital tools and media....... With this paper we intend to initiate a discussion in the eCAADe community to reflect and develop ideas in order to develop digital leadership skills amongst the membership. This paper introduces some important aspects, which may be valuable to look into when developing digital leadership skills....

  20. Digital radiography

    International Nuclear Information System (INIS)

    Zani, M.L.

    2002-01-01

    X-ray radiography is a very common technique used to check the homogeneity of a material or the inside of a mechanical part. Generally the radiation that goes through the material to check, produced an image on a sensitized film. This method requires time because the film needs to be developed, digital radiography has no longer this inconvenient. In digital radiography the film is replaced by digital data and can be processed as any computer file. This new technique is promising but its main inconvenient is that today its resolution is not so good as that of film radiography. (A.C.)

  1. Digital radiography

    International Nuclear Information System (INIS)

    Kusano, Shoichi

    1993-01-01

    Firstly, from an historic point of view, fundamental concepts on digital imaging were reviewed to provide a foundation for discussion of digital radiography. Secondly, this review summarized the results of ongoing research in computed radiography that replaces the conventional film-screen system with a photo-stimulable phosphor plate; and thirdly, image quality, radiation protection, and image processing techniques were discussed with emphasis on picture archiving and communication system environment as our final goal. Finally, future expansion of digital radiography was described based on the present utilization of computed tomography at the National Defense Medical College Hospital. (author) 60 refs

  2. The SARS-unique domain (SUD of SARS coronavirus contains two macrodomains that bind G-quadruplexes.

    Directory of Open Access Journals (Sweden)

    Jinzhi Tan

    2009-05-01

    Full Text Available Since the outbreak of severe acute respiratory syndrome (SARS in 2003, the three-dimensional structures of several of the replicase/transcriptase components of SARS coronavirus (SARS-CoV, the non-structural proteins (Nsps, have been determined. However, within the large Nsp3 (1922 amino-acid residues, the structure and function of the so-called SARS-unique domain (SUD have remained elusive. SUD occurs only in SARS-CoV and the highly related viruses found in certain bats, but is absent from all other coronaviruses. Therefore, it has been speculated that it may be involved in the extreme pathogenicity of SARS-CoV, compared to other coronaviruses, most of which cause only mild infections in humans. In order to help elucidate the function of the SUD, we have determined crystal structures of fragment 389-652 ("SUD(core" of Nsp3, which comprises 264 of the 338 residues of the domain. Both the monoclinic and triclinic crystal forms (2.2 and 2.8 A resolution, respectively revealed that SUD(core forms a homodimer. Each monomer consists of two subdomains, SUD-N and SUD-M, with a macrodomain fold similar to the SARS-CoV X-domain. However, in contrast to the latter, SUD fails to bind ADP-ribose, as determined by zone-interference gel electrophoresis. Instead, the entire SUD(core as well as its individual subdomains interact with oligonucleotides known to form G-quadruplexes. This includes oligodeoxy- as well as oligoribonucleotides. Mutations of selected lysine residues on the surface of the SUD-N subdomain lead to reduction of G-quadruplex binding, whereas mutations in the SUD-M subdomain abolish it. As there is no evidence for Nsp3 entering the nucleus of the host cell, the SARS-CoV genomic RNA or host-cell mRNA containing long G-stretches may be targets of SUD. The SARS-CoV genome is devoid of G-stretches longer than 5-6 nucleotides, but more extended G-stretches are found in the 3'-nontranslated regions of mRNAs coding for certain host-cell proteins

  3. Digital fabrication

    CERN Document Server

    2012-01-01

    The Winter 2012 (vol. 14 no. 3) issue of the Nexus Network Journal features seven original papers dedicated to the theme “Digital Fabrication”. Digital fabrication is changing architecture in fundamental ways in every phase, from concept to artifact. Projects growing out of research in digital fabrication are dependent on software that is entirely surface-oriented in its underlying mathematics. Decisions made during design, prototyping, fabrication and assembly rely on codes, scripts, parameters, operating systems and software, creating the need for teams with multidisciplinary expertise and different skills, from IT to architecture, design, material engineering, and mathematics, among others The papers grew out of a Lisbon symposium hosted by the ISCTE-Instituto Universitario de Lisboa entitled “Digital Fabrication – A State of the Art”. The issue is completed with four other research papers which address different mathematical instruments applied to architecture, including geometric tracing system...

  4. Digital Relationships

    DEFF Research Database (Denmark)

    Ledborg Hansen, Richard

    -­rich information and highly interesting communication are sky-­high and rising. With a continuous increase in digitized communication follows a decrease in face-­to-­face encounters and our ability to engage in inter-­personal relationships are suffering for it (Davis, 2013). The behavior described in this paper......-­‐Jones, 2011) for increases in effectiveness and efficiency we indiscriminately embrace digital communication and digitized information dissemination with enthusiasm – at the risk of ignoring the potentially dark side of technology. However, technology also holds a promise for better understanding precisely...... for the same reasons – that the growing amount of digitized communication “out there” represents data waiting to be sifted, analyzed and decoded. In this paper “Facebook behavior” refers to a particular behavior characterized by presenting your self and representations of selected self in the hope of getting...

  5. Digital Discretion

    DEFF Research Database (Denmark)

    Busch, Peter Andre; Zinner Henriksen, Helle

    2018-01-01

    discretion is suggested to reduce this footprint by influencing or replacing their discretionary practices using ICT. What is less researched is whether digital discretion can cause changes in public policy outcomes, and under what conditions such changes can occur. Using the concept of public service values......This study reviews 44 peer-reviewed articles on digital discretion published in the period from 1998 to January 2017. Street-level bureaucrats have traditionally had a wide ability to exercise discretion stirring debate since they can add their personal footprint on public policies. Digital......, we suggest that digital discretion can strengthen ethical and democratic values but weaken professional and relational values. Furthermore, we conclude that contextual factors such as considerations made by policy makers on the macro-level and the degree of professionalization of street...

  6. Multicriteria Gain Tuning for Rotorcraft Flight Controls (also entitled The Development of the Conduit Advanced Control System Design and Evaluation Interface with a Case Study Application Fly by Wire Helicopter Design)

    Science.gov (United States)

    Biezad, Daniel

    1997-01-01

    Handling qualities analysis and control law design would seem to be naturally complimenting components of aircraft flight control system design, however these two closely coupled disciplines are often not well integrated in practice. Handling qualities engineers and control system engineers may work in separate groups within an aircraft company. Flight control system engineers and handling quality specialists may come from different backgrounds and schooling and are often not aware of the other group's research. Thus while the handling qualities specifications represent desired aircraft response characteristics, these are rarely incorporated directly in the control system design process. Instead modem control system design techniques are based on servo-loop robustness specifications, and simple representations of the desired control response. Comprehensive handling qualities analysis is often left until the end of the design cycle and performed as a check of the completed design for satisfactory performance. This can lead to costly redesign or less than satisfactory aircraft handling qualities when the flight testing phase is reached. The desire to integrate the fields of handling qualities and flight,control systems led to the development of the CONDUIT system. This tool facilitates control system designs that achieve desired handling quality requirements and servo-loop specifications in a single design process. With CONDUIT, the control system engineer is now able to directly design and control systems to meet the complete handling specifications. CONDUIT allows the designer to retain a preferred control law structure, but then tunes the system parameters to meet the handling quality requirements.

  7. Digital Collections, Digital Libraries & the Digitization of Cultural Heritage Information.

    Science.gov (United States)

    Lynch, Clifford

    2002-01-01

    Discusses digital collections and digital libraries. Topics include broadband availability; digital rights protection; content, both non-profit and commercial; digitization of cultural content; sustainability; metadata harvesting protocol; infrastructure; authorship; linking multiple resources; data mining; digitization of reference works;…

  8. digital natives and digital immigrants

    OpenAIRE

    Cardina, Bruno; Francisco, Jerónimo; Reis, Pedro; trad. Silva, Fátima

    2011-01-01

    This article focuses on the generational gaps in school learning. Initially, we have tried to provide the framework in relation to the term digital native in order to understand the key aspects of the generation born after the advent and the global use of the Internet. They were found to be “multitasking” people, linked to technology and connectivity, as opposed to digital immigrants, born in an earlier period and seeking to adapt to the technological world. We also present some r...

  9. Detection of G-Quadruplex Structures Formed by G-Rich Sequences from Rice Genome and Transcriptome Using Combined Probes.

    Science.gov (United States)

    Chang, Tianjun; Li, Weiguo; Ding, Zhan; Cheng, Shaofei; Liang, Kun; Liu, Xiangjun; Bing, Tao; Shangguan, Dihua

    2017-08-01

    Putative G-quadruplex (G4) forming sequences (PQS) are highly prevalent in the genome and transcriptome of various organisms and are considered as potential regulation elements in many biological processes by forming G4 structures. The formation of G4 structures highly depends on the sequences and the environment. In most cases, it is difficult to predict G4 formation by PQS, especially PQS containing G2 tracts. Therefore, the experimental identification of G4 formation is essential in the study of G4-related biological functions. Herein, we report a rapid and simple method for the detection of G4 structures by using a pair of complementary reporters, hemin and BMSP. This method was applied to detect G4 structures formed by PQS (DNA and RNA) searched in the genome and transcriptome of Oryza sativa. Unlike most of the reported G4 probes that only recognize part of G4 structures, the proposed method based on combined probes positively responded to almost all G4 conformations, including parallel, antiparallel, and mixed/hybrid G4, but did not respond to non-G4 sequences. This method shows potential for high-throughput identification of G4 structures in genome and transcriptome. Furthermore, BMSP was observed to drive some PQS to form more stable G4 structures or induce the G4 formation of some PQS that cannot form G4 in normal physiological conditions, which may provide a powerful molecular tool for gene regulation.

  10. Higher-order human telomeric G-quadruplex DNA metalloenzymes enhance enantioselectivity in the Diels-Alder reaction.

    Science.gov (United States)

    Li, Yinghao; Jia, Guoqing; Wang, Changhao; Cheng, Mingpan; Li, Can

    2015-03-02

    Short human telomeric (HT) DNA sequences form single G-quadruplex (G4 ) units and exhibit structure-based stereocontrol for a series of reactions. However, for more biologically relevant higher-order HT G4 -DNAs (beyond a single G4 unit), the catalytic performances are unknown. Here, we found that higher-order HT G4 -DNA copper metalloenzymes (two or three G4 units) afford remarkably higher enantioselectivity (>90 % ee) and a five- to sixfold rate increase, compared to a single G4 unit, for the Diels-Alder reaction. Electron paramagnetic resonance (EPR) and enzymatic kinetic studies revealed that the distinct catalytic function between single and higher-order G4 -DNA copper metalloenzymes can be attributed to different Cu(II) coordination environments and substrate specificity. Our finding suggests that, like protein enzymes and ribozymes, higher-order structural organization is crucial for G4 -DNA-based catalysis. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  11. G-Quadruplex Identification in the Genome of Protozoan Parasites Points to Naphthalene Diimide Ligands as New Antiparasitic Agents.

    Science.gov (United States)

    Belmonte-Reche, Efres; Martínez-García, Marta; Guédin, Aurore; Zuffo, Michela; Arévalo-Ruiz, Matilde; Doria, Filippo; Campos-Salinas, Jenny; Maynadier, Marjorie; López-Rubio, José Juan; Freccero, Mauro; Mergny, Jean-Louis; Pérez-Victoria, José María; Morales, Juan Carlos

    2018-02-08

    G-quadruplexes (G4) are DNA secondary structures that take part in the regulation of gene expression. Putative G4 forming sequences (PQS) have been reported in mammals, yeast, bacteria, and viruses. Here, we present PQS searches on the genomes of T. brucei, L. major, and P. falciparum. We found telomeric sequences and new PQS motifs. Biophysical experiments showed that EBR1, a 29 nucleotide long highly repeated PQS in T. brucei, forms a stable G4 structure. G4 ligands based on carbohydrate conjugated naphthalene diimides (carb-NDIs) that bind G4's including hTel could bind EBR1 with selectivity versus dsDNA. These ligands showed important antiparasitic activity. IC 50 values were in the nanomolar range against T. brucei with high selectivity against MRC-5 human cells. Confocal microscopy confirmed these ligands localize in the nucleus and kinetoplast of T. brucei suggesting they can reach their potential G4 targets. Cytotoxicity and zebrafish toxicity studies revealed sugar conjugation reduces intrinsic toxicity of NDIs.

  12. Sites of instability in the human TCF3 (E2A) gene adopt G-quadruplex DNA structures in vitro

    Science.gov (United States)

    Williams, Jonathan D.; Fleetwood, Sara; Berroyer, Alexandra; Kim, Nayun; Larson, Erik D.

    2015-01-01

    The formation of highly stable four-stranded DNA, called G-quadruplex (G4), promotes site-specific genome instability. G4 DNA structures fold from repetitive guanine sequences, and increasing experimental evidence connects G4 sequence motifs with specific gene rearrangements. The human transcription factor 3 (TCF3) gene (also termed E2A) is subject to genetic instability associated with severe disease, most notably a common translocation event t(1;19) associated with acute lymphoblastic leukemia. The sites of instability in TCF3 are not randomly distributed, but focused to certain sequences. We asked if G4 DNA formation could explain why TCF3 is prone to recombination and mutagenesis. Here we demonstrate that sequences surrounding the major t(1;19) break site and a region associated with copy number variations both contain G4 sequence motifs. The motifs identified readily adopt G4 DNA structures that are stable enough to interfere with DNA synthesis in physiological salt conditions in vitro. When introduced into the yeast genome, TCF3 G4 motifs promoted gross chromosomal rearrangements in a transcription-dependent manner. Our results provide a molecular rationale for the site-specific instability of human TCF3, suggesting that G4 DNA structures contribute to oncogenic DNA breaks and recombination. PMID:26029241

  13. Mechanism and manipulation of DNA:RNA hybrid G-quadruplex formation in transcription of G-rich DNA.

    Science.gov (United States)

    Zhang, Jia-yu; Zheng, Ke-wei; Xiao, Shan; Hao, Yu-hua; Tan, Zheng

    2014-01-29

    We recently reported that a DNA:RNA hybrid G-quadruplex (HQ) forms during transcription of DNA that bears two or more tandem guanine tracts (G-tract) on the nontemplate strand. Putative HQ-forming sequences are enriched in the nearby 1000 nt region right downstream of transcription start sites in the nontemplate strand of warm-blooded animals, and HQ regulates transcription under both in vitro and in vivo conditions. Therefore, knowledge of the mechanism of HQ formation is important for understanding the biological function of HQ as well as for manipulating gene expression by targeting HQ. In this work, we studied the mechanism of HQ formation using an in vitro T7 transcription model. We show that RNA synthesis initially produces an R-loop, a DNA:RNA heteroduplex formed by a nascent RNA transcript and the template DNA strand. In the following round of transcription, the RNA in the R-loop is displaced, releasing the RNA in single-stranded form (ssRNA). Then the G-tracts in the RNA can jointly form HQ with those in the nontemplate DNA strand. We demonstrate that the structural cascade R-loop → ssRNA → HQ offers opportunities to intercept HQ formation, which may provide a potential method to manipulate gene expression.

  14. Label-free detection of kanamycin based on a G-quadruplex DNA aptamer-based fluorescent intercalator displacement assay

    Science.gov (United States)

    Xing, Yun-Peng; Liu, Chun; Zhou, Xiao-Hong; Shi, Han-Chang

    2015-01-01

    This work was the first to report that the kanamycin-binding DNA aptamer (5'-TGG GGG TTG AGG CTA AGC CGA-3') can form stable parallel G-quadruplex DNA (G4-DNA) structures by themselves and that this phenomenon can be verified by nondenaturing polyacrylamide gel electrophoresis and circular dichroism spectroscopy. Based on these findings, we developed a novel label-free strategy for kanamycin detection based on the G4-DNA aptamer-based fluorescent intercalator displacement assay with thiazole orange (TO) as the fluorescence probe. In the proposed strategy, TO became strongly fluorescent upon binding to kanamycin-binding G4-DNA. However, the addition of kanamycin caused the displacement of TO from the G4-DNA-TO conjugate, thereby resulting in decreased fluorescent signal, which was inversely related to the kanamycin concentration. The detection limit of the proposed assay decreased to 59 nM with a linear working range of 0.1 μM to 20 μM for kanamycin. The cross-reactivity against six other antibiotics was negligible compared with the response to kanamycin. A satisfactory recovery of kanamycin in milk samples ranged from 80.1% to 98.0%, confirming the potential of this bioassay in the measurement of kanamycin in various applications. Our results also served as a good reference for developing similar fluorescent G4-DNA-based bioassays in the future.

  15. G-quadruplex aptamer targeting Protein A and its capability to detect Staphylococcus aureus demonstrated by ELONA.

    Science.gov (United States)

    Stoltenburg, Regina; Krafčiková, Petra; Víglaský, Viktor; Strehlitz, Beate

    2016-09-21

    Aptamers for whole cell detection are selected mostly by the Cell-SELEX procedure. Alternatively, the use of specific cell surface epitopes as target during aptamer selections allows the development of aptamers with ability to bind whole cells. In this study, we integrated a formerly selected Protein A-binding aptamer PA#2/8 in an assay format called ELONA (Enzyme-Linked OligoNucleotide Assay) and evaluated the ability of the aptamer to recognise and bind to Staphylococcus aureus presenting Protein A on the cell surface. The full-length aptamer and one of its truncated variants could be demonstrated to specifically bind to Protein A-expressing intact cells of S. aureus, and thus have the potential to expand the portfolio of aptamers that can act as an analytical agent for the specific recognition and rapid detection of the bacterial pathogen. The functionality of the aptamer was found to be based on a very complex, but also highly variable structure. Two structural key elements were identified. The aptamer sequence contains several G-clusters allowing folding into a G-quadruplex structure with the potential of dimeric and multimeric assembly. An inverted repeat able to form an imperfect stem-loop at the 5'-end also contributes essentially to the aptameric function.

  16. Digital evidence

    Directory of Open Access Journals (Sweden)

    Lukić Tatjana

    2012-01-01

    Full Text Available Although computer makes human activities faster and easier, innovating and creating new forms of work and other kinds of activities, it also influenced the criminal activity. The development of information technology directly affects the development of computer forensics without which, it can not even imagine the discovering and proving the computer offences and apprehending the perpetrator. Information technology and computer forensic allows us to detect and prove the crimes committed by computer and capture the perpetrators. Computer forensics is a type of forensics which can be defined as a process of collecting, preserving, analyzing and presenting digital evidence in court proceedings. Bearing in mind, that combat against crime, in which computers appear as an asset or object of the offense, requires knowledge of digital evidence as well as specific rules and procedures, the author in this article specifically addresses the issues of digital evidence, forensic (computer investigation, specific rules and procedures for detecting, fixing and collecting digital evidence and use of this type of evidence in criminal proceedings. The author also delas with international standards regarding digital evidence and cyber-space investigation.

  17. Digital watermark

    Directory of Open Access Journals (Sweden)

    Jasna Maver

    2000-01-01

    Full Text Available The huge amount of multimedia contents available on the World-Wide-Web is beginning to raise the question of their protection. Digital watermarking is a technique which can serve various purposes, including intellectual property protection, authentication and integrity verification, as well as visible or invisible content labelling of multimedia content. Due to the diversity of digital watermarking applicability, there are many different techniques, which can be categorised according to different criteria. A digital watermark can be categorised as visible or invisible and as robust or fragile. In contrast to the visible watermark where a visible pattern or image is embedded into the original image, the invisible watermark does not change the visual appearance of the image. The existence of such a watermark can be determined only through a watermark ex¬traction or detection algorithm. The robust watermark is used for copyright protection, while the fragile watermark is designed for authentication and integrity verification of multimedia content. A watermark must be detectable or extractable to be useful. In some watermarking schemes, a watermark can be extracted in its exact form, in other cases, we can detect only whether a specific given watermarking signal is present in an image. Digital libraries, through which cultural institutions will make multimedia contents available, should support a wide range of service models for intellectual property protection, where digital watermarking may play an important role.

  18. Label-free and enzyme-free detection of transcription factors with graphene oxide fluorescence switch-based multifunctional G-quadruplex-hairpin probe.

    Science.gov (United States)

    Zhu, Desong; Wang, Lei; Xu, Xiaowen; Jiang, Wei

    2016-01-15

    Transcription factors (TFs) play pivotal roles in the regulation of a variety of essential cellular processes and some of them have been recognized as potential diagnostic markers and therapeutic targets of some diseases. Sensitive and accurate detection of TFs is of great importance to better understanding their roles in gene regulation and evaluation of disease state. Here, we developed a simple, label-free and enzyme-free new fluorescent strategy for the detection of TFs by graphene oxide (GO) fluorescence switch-based multifunctional G-quadruplex-hairpin probe (MGHP). The MGHP possessed of three functions simultaneously, adsorbing onto GO with the loop part, binding to target with the stem part and serving as signal carrier with the terminal G-quadruplex. First, the MGHP was adsorbed quickly to GO. Next, the TF bound to the stem part of MGHP to form a huge target-MGHP complex, which led to desorption of the complex from GO. Finally, NMM was inserted into G-quadruplex in the complex to yield an enhanced fluorescence response. The GO used here, as a fluorescence switch, could quickly and efficiently quench the fluorescence of NMM inserted into the MGHP absorbed on the GO, guaranteeing a high signal-to-noise ratio. Sensitive detection of purified NF-κB p50 and HeLa cell nuclear extracts were achieved with detection limits of 0.2nM and 7.8ng/µL, respectively. Moreover, this proposed strategy could be used to screen inhibitors of NF-κB p50 activity. The strategy proposed here might offer a new potential approach for reliable quantification of TFs in clinical diagnostics and treatment research of some diseases. Copyright © 2015 Elsevier B.V. All rights reserved.

  19. Thioflavin T binds dimeric parallel-stranded GA-containing non-G-quadruplex DNAs: a general approach to lighting up double-stranded scaffolds.

    Science.gov (United States)

    Liu, Shuangna; Peng, Pai; Wang, Huihui; Shi, Lili; Li, Tao

    2017-12-01

    A molecular rotor thioflavin T (ThT) is usually used as a fluorescent ligand specific for G-quadruplexes. Here, we demonstrate that ThT can tightly bind non-G-quadruplex DNAs with several GA motifs and dimerize them in a parallel double-stranded mode, accompanied by over 100-fold enhancement in the fluorescence emission of ThT. The introduction of reverse Watson-Crick T-A base pairs into these dimeric parallel-stranded DNA systems remarkably favors the binding of ThT into the pocket between G•G and A•A base pairs, where ThT is encapsulated thereby restricting its two rotary aromatic rings in the excited state. A similar mechanism is also demonstrated in antiparallel DNA duplexes where several motifs of two consecutive G•G wobble base pairs are incorporated and serve as the active pockets for ThT binding. The insight into the interactions of ThT with non-G-quadruplex DNAs allows us to introduce a new concept for constructing DNA-based sensors and devices. As proof-of-concept experiments, we design a DNA triplex containing GA motifs in its Hoogsteen hydrogen-bonded two parallel strands as a pH-driven nanoswitch and two GA-containing parallel duplexes as novel metal sensing platforms where C-C and T-T mismatches are included. This work may find further applications in biological systems (e.g. disease gene detection) where parallel duplex or triplex stretches are involved. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.

  20. Digital Creativity

    DEFF Research Database (Denmark)

    Petersson Brooks, Eva; Brooks, Anthony Lewis

    2014-01-01

    This paper reports on a study exploring the outcomes from children’s play with technology in early childhood learning practices. The paper addresses questions related to how digital technology can foster creativity in early childhood learning environments. It consists of an analysis of children......’s interaction with the KidSmart furniture focusing on digital creativity potentials and play values suggested by the technology. The study applied a qualitative approach and included125 children (aged three to five), 10 pedagogues, and two librarians. The results suggests that educators should sensitively...... consider intervening when children are interacting with technology, and rather put emphasize into the integration of the technology into the environment and to the curriculum in order to shape playful structures for children’s digital creativity....

  1. Digital radiography

    International Nuclear Information System (INIS)

    Rath, M.; Lissner, J.; Rienmueller, R.; Haendle, J.; Siemens A.G., Erlangen

    1984-01-01

    Using a prototype of an electronic, universal examination unit equipped with a special X-ray TV installation, spotfilm exposures and digital angiographies with high spatial resolution and wide-range contrast could be made in the clinic for the first time. With transvenous contrast medium injection, the clinical results of digital angiography show excellent image quality in the region of the carotids and renal arteries as well as the arteries of the extremities. The electronic series exposures have an image quality almost comparable to the quality obtained with cutfilm changers in conventional angiography. There are certain limitations due to the input field of 25 cm X-ray image intensified used. In respect of the digital angiography imaging technique, the electronic universal unit is fully suitable for clinical application. (orig.) [de

  2. Digital photogrammetry

    CERN Document Server

    Egels, Yves

    2003-01-01

    Photogrammetry is the use of photography for surveying primarily and is used for the production of maps from aerial photographs. Along with remote sensing, it represents the primary means of generating data for Geographic Information Systems (GIS). As technology develops, it is becoming easier to gain access to it. The cost of digital photogrammetric workstations are falling quickly and these new tools are therefore becoming accessible to more and more users. Digital Photogrammetry is particularly useful as a text for graduate students in geomantic and is also suitable for people with a good basic scientific knowledge who need to understand photogrammetry, and who wish to use the book as a reference.

  3. Digital Marketing

    OpenAIRE

    Jerry Wind; Vijay Mahajan

    2002-01-01

    The digital revolution has shaken marketing to its core with consumers being offered greater price transparency and often even the chance to dictate the price. What does pricing mean in a world in which customers propose their own prices (as at priceline.com) or buyers and sellers haggle independently in auctions (as at e-Bay)? The most significant changes in the digital marketing show the emergence of 'cyber consumers', the cyber business-to-business world and the changing reality of an incr...

  4. Digital "X"

    DEFF Research Database (Denmark)

    Baiyere, Abayomi; Grover, Varun; Gupta, Alok

    2017-01-01

    Interest in using digital before existing research concepts seem to be on the rise in the IS field. This panel is positioned to explore what value lies in labelling our research as digital “x” as opposed to the well established IT “x” (where “x” can be strategy, infrastructure, innovation, artifa...... between this stream of research and existing research. Central among the expected output of the panel is the advancement of suggestions for future research and the critical pitfalls to avoid in doing so....

  5. Digital Radiography

    Science.gov (United States)

    1986-01-01

    System One, a digital radiography system, incorporates a reusable image medium (RIM) which retains an image. No film is needed; the RIM is read with a laser scanner, and the information is used to produce a digital image on an image processor. The image is stored on an optical disc. System allows the radiologist to "dial away" unwanted images to compare views on three screens. It is compatible with existing equipment and cost efficient. It was commercialized by a Stanford researcher from energy selective technology developed under a NASA grant.

  6. Digital filters

    CERN Document Server

    Hamming, Richard W

    1997-01-01

    Digital signals occur in an increasing number of applications: in telephone communications; in radio, television, and stereo sound systems; and in spacecraft transmissions, to name just a few. This introductory text examines digital filtering, the processes of smoothing, predicting, differentiating, integrating, and separating signals, as well as the removal of noise from a signal. The processes bear particular relevance to computer applications, one of the focuses of this book.Readers will find Hamming's analysis accessible and engaging, in recognition of the fact that many people with the s

  7. Digital voltmeter

    International Nuclear Information System (INIS)

    Yohannes Kamadi; Soekarno.

    1976-01-01

    The electrical voltage measuring equipment with digital display has been made. This equipment uses four digits display with single polarity measurement and integrating system. Pulses from the oscillator will be counted and converted to the staircase voltages, and compared to the voltage measured. When the balance is already achieved, the pulse will appear at the comparator circuit. This pulse will be used to trigger univibrator circuit. The univibrator output is used as signal for stopping the counting, and when reading time T already stops, the counting system will be reset. (authors)

  8. Digital communication

    CERN Document Server

    Das, Apurba

    2010-01-01

    ""Digital Communications"" presents the theory and application of the philosophy of Digital Communication systems in a unique but lucid form. This book inserts equal importance to the theory and application aspect of the subject whereby the authors selected a wide class of problems. The Salient features of the book are: the foundation of Fourier series, Transform and wavelets are introduces in a unique way but in lucid language; the application area is rich and resemblance to the present trend of research, as we are attached with those areas professionally; a CD is included which contains code

  9. Digital literacies

    CERN Document Server

    Hockly, Nicky; Pegrum, Mark

    2014-01-01

    Dramatic shifts in our communication landscape have made it crucial for language teaching to go beyond print literacy and encompass the digital literacies which are increasingly central to learners' personal, social, educational and professional lives. By situating these digital literacies within a clear theoretical framework, this book provides educators and students alike with not just the background for a deeper understanding of these key 21st-century skills, but also the rationale for integrating these skills into classroom practice. This is the first methodology book to address not jus

  10. Digital delicacies

    OpenAIRE

    Holley, Rose

    2001-01-01

    This presentation outlines the purpose and work of the newly appointed Digital Projects Librarian at the University of Auckland. It gives a brief overview of what digitisation is, the benefits, the stages of a digitisation project and also samples of interesting international digitisation projects and new University of Auckland Library Digitisation projects.

  11. Digital Forensics

    Science.gov (United States)

    Harron, Jason; Langdon, John; Gonzalez, Jennifer; Cater, Scott

    2017-01-01

    The term forensic science may evoke thoughts of blood-spatter analysis, DNA testing, and identifying molds, spores, and larvae. A growing part of this field, however, is that of digital forensics, involving techniques with clear connections to math and physics. This article describes a five-part project involving smartphones and the investigation…

  12. Digital Disruption

    DEFF Research Database (Denmark)

    Rosenstand, Claus Andreas Foss

    det digitale domæne ud over det niveau, der kendetegner den nuværende debat, så præsenteres der ny viden om digital disruption. Som noget nyt udlægges Clayton Christens teori om disruptiv innovation med et særligt fokus på små organisationers mulighed for eksponentiel vækst. Specielt udfoldes...... forholdet mellem disruption og den stadig accelererende digitale udvikling i konturerne til ny teoridannelse om digital disruption. Bogens undertitel ”faretruende og fascinerende forandringer” peger på, at der er behov for en nuanceret debat om digital disruption i modsætning til den tone, der er slået an i...... videre kalder et ”disruption-råd”. Faktisk er rådet skrevet ind i 2016 regeringsgrundlaget for VLK-regeringen. Disruption af organisationer er ikke et nyt fænomen; men hastigheden, hvormed det sker, er stadig accelererende. Årsagen er den globale mega-trend: Digitalisering. Og derfor er specielt digital...

  13. Digital books.

    Science.gov (United States)

    Wink, Diane M

    2011-01-01

    In this bimonthly series, the author examines how nurse educators can use the Internet and Web-based computer technologies such as search, communication, and collaborative writing tools; social networking and social bookmarking sites; virtual worlds; and Web-based teaching and learning programs. This article describes digital books.

  14. Digital forvaltning

    DEFF Research Database (Denmark)

    Remmen, Arne; Larsen, Torben; Mosgaard, Mette

    2004-01-01

    Større effektivitet, bedre service og mere demokrai er blot nogle af forventningerne til indførelse af digital forveltning i kommunerne. Kapitlet giver bland andet svar på spørgsmålene : Hvordan lever kommunerne op hertil i dagligdagen? hvilke virkemidler anvender de? Hvilke barrierer har der været...

  15. Digital Methods

    NARCIS (Netherlands)

    Rogers, R.

    2013-01-01

    In Digital Methods, Richard Rogers proposes a methodological outlook for social and cultural scholarly research on the Web that seeks to move Internet research beyond the study of online culture. It is not a toolkit for Internet research, or operating instructions for a software package; it deals

  16. A sensitive electrochemical aptasensor based on the co-catalysis of hemin/G-quadruplex, platinum nanoparticles and flower-like MnO2 nanosphere functionalized multi-walled carbon nanotubes.

    Science.gov (United States)

    Xu, Wenju; Xue, Shuyan; Yi, Huayu; Jing, Pei; Chai, Yaqin; Yuan, Ruo

    2015-01-28

    In this work, a sensitive electrochemical aptasensor for the detection of thrombin (TB) is developed and demonstrated based on the co-catalysis of hemin/G-quadruplex, platinum nanoparticles (PtNPs) and flower-like MnO2 nanosphere functionalized multi-walled carbon nanotubes (MWCNT-MnO2).

  17. The Effect of INA [(R)-1-O-(1-Pyrenylmethyl)Glycerol] Insertions on the Structure and Biological Activity of a G-Quadruplex from a Critical Kras G-Rich Sequence

    DEFF Research Database (Denmark)

    Cogoi, Susanna; Paramasivan, Manikandan; Xodo, Luigi E.

    2007-01-01

    Quadruplex-forming oligonucleotides containing INA [(R)-1-O-(1-pyrenylmethyl)glycerol] insertions have been designed and studied for their capacity to inhibit the expression of the KRAS oncogene in pancreatic adenocarcinoma cells. It is found that INA can influence the folding topology of the G-q...

  18. Transcription arrest by a G quadruplex forming-trinucleotide repeat sequence from the human c-myb gene.

    Science.gov (United States)

    Broxson, Christopher; Beckett, Joshua; Tornaletti, Silvia

    2011-05-17

    Non canonical DNA structures correspond to genomic regions particularly susceptible to genetic instability. The transcription process facilitates formation of these structures and plays a major role in generating the instability associated with these genomic sites. However, little is known about how non canonical structures are processed when encountered by an elongating RNA polymerase. Here we have studied the behavior of T7 RNA polymerase (T7RNAP) when encountering a G quadruplex forming-(GGA)(4) repeat located in the human c-myb proto-oncogene. To make direct correlations between formation of the structure and effects on transcription, we have taken advantage of the ability of the T7 polymerase to transcribe single-stranded substrates and of G4 DNA to form in single-stranded G-rich sequences in the presence of potassium ions. Under physiological KCl concentrations, we found that T7 RNAP transcription was arrested at two sites that mapped to the c-myb (GGA)(4) repeat sequence. The extent of arrest did not change with time, indicating that the c-myb repeat represented an absolute block and not a transient pause to T7 RNAP. Consistent with G4 DNA formation, arrest was not observed in the absence of KCl or in the presence of LiCl. Furthermore, mutations in the c-myb (GGA)(4) repeat, expected to prevent transition to G4, also eliminated the transcription block. We show T7 RNAP arrest at the c-myb repeat in double-stranded DNA under conditions mimicking the cellular concentration of biomolecules and potassium ions, suggesting that the G4 structure formed in the c-myb repeat may represent a transcription roadblock in vivo. Our results support a mechanism of transcription-coupled DNA repair initiated by arrest of transcription at G4 structures.

  19. The binding efficiency of RPA to telomeric G-strands folded into contiguous G-quadruplexes is independent of the number of G4 units.

    Science.gov (United States)

    Lancrey, Astrid; Safa, Layal; Chatain, Jean; Delagoutte, Emmanuelle; Riou, Jean-François; Alberti, Patrizia; Saintomé, Carole

    2018-03-01

    Replication protein A (RPA) is a single-stranded DNA binding protein involved in replication and in telomere maintenance. During telomere replication, G-quadruplexes (G4) can accumulate on the lagging strand template and need to be resolved. It has been shown that human RPA is able to unfold a single G4. Nevertheless, the G-strand of human telomeres is prone to fold into higher-order structures formed by contiguous G-quadruplexes. To understand how RPA deals with these structures, we studied its interaction with telomeric G-strands folding into an increasing number of contiguous G4s. The aim of this study was to determine whether the efficiency of binding/unfolding of hRPA to telomeric G-strands depends on the number of G4 units. Our data show that the number n of contiguous G4 units (n ≥ 2) does not affect the efficiency of hRPA to coat transiently exposed single-stranded telomeric G-strands. This feature may be essential in preventing instability due to G4 structures during telomere replication. Copyright © 2017 Elsevier B.V. and Société Française de Biochimie et Biologie Moléculaire (SFBBM). All rights reserved.

  20. Fluorescence enhancement upon G-quadruplex folding: synthesis, structure, and biophysical characterization of a dansyl/cyclodextrin-tagged thrombin binding aptamer.

    Science.gov (United States)

    De Tito, Stefano; Morvan, François; Meyer, Albert; Vasseur, Jean-Jacques; Cummaro, Annunziata; Petraccone, Luigi; Pagano, Bruno; Novellino, Ettore; Randazzo, Antonio; Giancola, Concetta; Montesarchio, Daniela

    2013-11-20

    A novel fluorescent thrombin binding aptamer (TBA), conjugated with the environmentally sensitive dansyl probe at the 3'-end and a β-cyclodextrin residue at the 5'-end, has been efficiently synthesized exploiting Cu(I)-catalyzed azide-alkyne cycloaddition procedures. Its conformation and stability in solution have been studied by an integrated approach, combining in-depth NMR, CD, fluorescence, and DSC studies. ITC measurements have allowed us to analyze in detail its interaction with human thrombin. All the collected data show that this bis-conjugated aptamer fully retains its G-quadruplex formation ability and thrombin recognition properties, with the terminal appendages only marginally interfering with the conformational behavior of TBA. Folding of this modified aptamer into the chairlike, antiparallel G-quadruplex structure, promoted by K(+) and/or thrombin binding, typical of TBA, is associated with a net fluorescence enhancement, due to encapsulation of dansyl, attached at the 3'-end, into the apolar cavity of the β-cyclodextrin at the 5'-end. Overall, the structural characterization of this novel, bis-conjugated TBA fully demonstrates its potential as a diagnostic tool for thrombin recognition, also providing a useful basis for the design of suitable aptamer-based devices for theranostic applications, allowing simultaneously both detection and inhibition or modulation of the thrombin activity.

  1. Quantification of Chemical and Mechanical Effects on the Formation of the G-Quadruplex and i-Motif in Duplex DNA.

    Science.gov (United States)

    Selvam, Sangeetha; Mandal, Shankar; Mao, Hanbin

    2017-09-05

    The formation of biologically significant tetraplex DNA species, such as G-quadruplexes and i-motifs, is affected by chemical (ions and pH) and mechanical [superhelicity (σ) and molecular crowding] factors. Because of the extremely challenging experimental conditions, the relative importance of these factors on tetraplex folding is unknown. In this work, we quantitatively evaluated the chemical and mechanical effects on the population dynamics of DNA tetraplexes in the insulin-linked polymorphic region using magneto-optical tweezers. By mechanically unfolding individual tetraplexes, we found that ions and pH have the largest effects on the formation of the G-quadruplex and i-motif, respectively. Interestingly, superhelicity has the second largest effect followed by molecular crowding conditions. While chemical effects are specific to tetraplex species, mechanical factors have generic influences. The predominant effect of chemical factors can be attributed to the fact that they directly change the stability of a specific tetraplex, whereas the mechanical factors, superhelicity in particular, reduce the stability of the competing species by changing the kinetics of the melting and annealing of the duplex DNA template in a nonspecific manner. The substantial dependence of tetraplexes on superhelicity provides strong support that DNA tetraplexes can serve as topological sensors to modulate fundamental cellular processes such as transcription.

  2. Label-Free and Ultrasensitive Biomolecule Detection Based on Aggregation Induced Emission Fluorogen via Target-Triggered Hemin/G-Quadruplex-Catalyzed Oxidation Reaction.

    Science.gov (United States)

    Li, Haiyin; Chang, Jiafu; Gai, Panpan; Li, Feng

    2018-02-07

    Fluorescence biosensing strategy has drawn substantial attention due to their advantages of simplicity, convenience, sensitivity, and selectivity, but unsatisfactory structure stability, low fluorescence quantum yield, high cost of labeling, and strict reaction conditions associated with current fluorescence methods severely prohibit their potential application. To address these challenges, we herein propose an ultrasensitive label-free fluorescence biosensor by integrating hemin/G-quadruplex-catalyzed oxidation reaction with aggregation induced emission (AIE) fluorogen-based system. l-Cysteine/TPE-M, which is carefully and elaborately designed and developed, obviously contributes to strong fluorescence emission. In the presence of G-rich DNA along with K + and hemin, efficient destruction of l-cysteine occurs due to hemin/G-quadruplex-catalyzed oxidation reactions. As a result, highly sensitive fluorescence detection of G-rich DNA is readily realized, with a detection limit down to 33 pM. As a validation for the further development of the proposed strategy, we also successfully construct ultrasensitive platforms for microRNA by incorporating the l-cysteine/TPE-M system with target-triggered cyclic amplification reaction. Thus, this proposed strategy is anticipated to find use in basic biochemical research and clinical diagnosis.

  3. Nonlinear optical and G-Quadruplex DNA stabilization properties of novel mixed ligand copper(II) complexes and coordination polymers: Synthesis, structural characterization and computational studies

    Science.gov (United States)

    Rajasekhar, Bathula; Bodavarapu, Navya; Sridevi, M.; Thamizhselvi, G.; RizhaNazar, K.; Padmanaban, R.; Swu, Toka

    2018-03-01

    The present study reports the synthesis and evaluation of nonlinear optical property and G-Quadruplex DNA Stabilization of five novel copper(II) mixed ligand complexes. They were synthesized from copper(II) salt, 2,5- and 2,3- pyridinedicarboxylic acid, diethylenetriamine and amide based ligand (AL). The crystal structure of these complexes were determined through X-ray diffraction and supported by ESI-MAS, NMR, UV-Vis and FT-IR spectroscopic methods. Their nonlinear optical property was studied using Gaussian09 computer program. For structural optimization and nonlinear optical property, density functional theory (DFT) based B3LYP method was used with LANL2DZ basis set for metal ion and 6-31G∗ for C,H,N,O and Cl atoms. The present work reveals that pre-polarized Complex-2 showed higher β value (29.59 × 10-30e.s.u) as compared to that of neutral complex-1 (β = 0.276 × 10-30e.s.u.) which may be due to greater advantage of polarizability. Complex-2 is expected to be a potential material for optoelectronic and photonic technologies. Docking studies using AutodockVina revealed that complex-2 has higher binding energy for both G-Quadruplex DNA (-8.7 kcal/mol) and duplex DNA (-10.1 kcal/mol). It was also observed that structure plays an important role in binding efficiency.

  4. Digital Humanities and networked digital media

    DEFF Research Database (Denmark)

    Finnemann, Niels Ole

    2014-01-01

    This article discusses digital humanities and the growing diversity of digital media, digital materials and digital methods. The first section describes the humanities computing tradition formed around the interpretation of computation as a rule-based process connected to a concept of digital...... materials centred on the digitisation of non-digital, finite works, corpora and oeuvres. The second section discusses “the big tent” of contemporary digital humanities. It is argued that there can be no unifying interpretation of digital humanities above the level of studying digital materials with the help...... of software-supported methods. This is so, in part, because of the complexity of the world and, in part, because digital media remain open to the projection of new epistemologies onto the functional architecture of these media. The third section discusses the heterogeneous character of digital materials...

  5. Digital Materia

    OpenAIRE

    Lindgren, Marcus; Richey, Emma

    2014-01-01

    Med tankar från pedagogen Montessori och filosoferna Platon och Baudrillard har detta arbete behandlat frågor om datorn och dess betydelse för en grafiker. Frågeställningen formulerades efter hand och lydde tillslut: ”Hur kan materia te sig i digital form?” Forskningen resulterade i en hypotes för hur digital materia skulle födas i datorn: genom att blanda två uppsättningar av data, såsom två genuppsättningar tillsammans skapar en ny organism. Under produktionen utvecklades därmed en metod fö...

  6. Becoming digital

    DEFF Research Database (Denmark)

    Pors, Anja Svejgaard

    2015-01-01

    government, and draws on empirical material generated through observations, field notes, interviews and policy documents. The material is documenting how service is performed by frontline agents in the ‘bureaucratic encounter’ with citizens, who needs assistance to use digital self-service in order to apply...... online for a public benefit. Findings: The paper shows that e-government technology changes the mode of professionalism in citizen service from service to support. The paper gives an empirical account of recent Danish digital reforms and shows how the reforms both enable and constrain the work...... of ‘becoming digital’ by frontline agents. Overall the street-level bureaucrat’s classical tasks such as specialized casework are being displaced into promoting and educational tasks. An implication of this is blurred distinctions between professional skills and personal competences of the frontline agent...

  7. Digital resources

    Directory of Open Access Journals (Sweden)

    Redazione Reti Medievali (a cura di

    2005-12-01

    Full Text Available Bibliotheca Latinitatis Mediaevalis (circa VII sec. - XIV sec. IntraText Digital Library [01/06] Corpus Scriptorum Latinorum. A digital library of Latin literature by David Camden [01/06] Fonti disponibili online concernenti la vita religiosa medievale Rete Vitae Religiosae Mediaevalis Studia Conectens [01/06] Fuentes del Medievo Hispanico Instituto de Historia, Consejo Superior de Investigaciones Científicas [01/06] Latin Literature Forum Romanum [01/06] Ludovico Antonio Muratori, Dissertazioni sopra le antichità italiane, 1751 Biblioteca dei Classici Italiani di Giuseppe Bonghi [01/06] Medieval Latin The Latin Library [01/06] Médiévales Presses Universitaires de Vincennes - Revues.org [01/06] Regesta imperii Deutsche Kommission für die Bearbeitung der Regesta Imperii e.V. [01/06] Suda On Line Byzantine Lexicography [01/06

  8. Digital teenagers

    Directory of Open Access Journals (Sweden)

    Rafael Conde Melguizo

    2011-12-01

    Full Text Available Espín, Manuel (Coord.(2011 Adolescentes Digitales.  Revista Estudios de Juventud, Nº 92. Marzo 2011. INJUVE, Madrid."Adolescentes digitales" se nos muestra como una obra que pretende explorar desde distintos puntos de vista la realidad de la generación conocida como “nativos digitales” (Prensky, la generación actual de adolescentes que ha crecido con internet y el mundo digital como su entorno normal de socialización.

  9. Digital Flora

    OpenAIRE

    Bunnell, Katie

    2007-01-01

    This research is concerned with developing a new business model for flexible small scale ceramic production that exploits the customisation capabilities of digital manufacturing technologies and the market potential and global connectivity of the world wide web. It is arguably of particular relevance to regional economic development in remote areas (Amin, Tomaney, Sabel) such as Cornwall where there is a culture of high quality small scale production, limited market and manufacturing opportun...

  10. Digital citizens Digital nations: the next agenda

    NARCIS (Netherlands)

    A.W. (Bert) Mulder; M.W. (Martijn) Hartog

    2015-01-01

    DIGITAL CITIZENS CREATE A DIGITAL NATION Citizens will play the lead role as they – in the next phase of the information society – collectively create a digital nation. Personal adoption of information and communication technology will create a digital infrastructure that supports individual and

  11. Digital fluorimeter

    International Nuclear Information System (INIS)

    Mello, H.A. de.

    1980-11-01

    The specifications of a digital fluorimeter. That with adequated analytical techniques permits to determine trace amounts of fluorescents materials in samples, are described. The fluorimeter is of the reflection type, and uses fluorescents lamps for the excitation and an optical system which is connected to a photomultiplyer machine and permits the measurement of the light intensity. In the case of IEN (Instituto de Engenharia Nuclear) the equipment is used for to determine the uranium content in sample materials to be exported. The precision of the instrument is about + - 1% in the scale of 0.1 which is the normally one used in the current researchs. (E.G.) [pt

  12. Digital entrepreneurship

    DEFF Research Database (Denmark)

    Brem, Alexander; Richter, Chris; Kraus, Sascha

    2017-01-01

    comprising guided interviews with 14 companies from Germany, Austria and Switzerland provides detailed insights into different aspects of the sharing economy phenomenon. Our results make a direct contribution to sharing economy research, especially regarding the new business models of start-ups. Here, we...... find a clear difference between the relevance of economic and social orientation. The latter appears to be in higher demand among customers than entrepreneurs. The increasingly digitalized environment has led to a changed living situation characterized by urbanity, openness to new solutions, changed...

  13. Focus: Digital

    DEFF Research Database (Denmark)

    Technology has been an all-important and defining element within the arts throughout the 20th century, and it has fundamentally changed the ways in which we produce and consume music. With this Focus we investigate the latest developments in the digital domain – and their pervasiveness and rapid...... production and reception of contemporary music and sound art. With ‘Digital’ we present four composers' very different answers to how technology impact their work. To Juliana Hodkinson it has become an integral part of her sonic writing. Rudiger Meyer analyses the relationships between art and design and how...

  14. Digital Humanities

    DEFF Research Database (Denmark)

    Nielsen, Hans Jørn

    2015-01-01

    overgangen fra trykkekultur til digital kultur. For det første problemstillingen omkring digitalisering af litterær kulturarv med fokus på kodning og tagging af teksten samt organisering i hypertekststrukturer. For det andet reorganiseringen af det digitale dokument i dataelementer og database. For det......Artiklen præsenterer først nogle generelle problemstillinger omkring Digital Humanities (DH) med det formål at undersøge dem nærmere i relation til konkrete eksempler på forskellige digitaliseringsmåder og ændringer i dokumentproduktion. I en nærmere afgrænsning vælger artiklen den tendens i DH......, der betragter DH som forbundet med "making" og "building" af digitale objekter og former. Dette kan også karakteriseres som DH som praktisk-produktiv vending. Artiklen har valgt tre typer af digitalisering. De er valgt ud fra, at de skal repræsentere forskellige måder at håndtere digitaliseringen på...

  15. Digital radiography

    DEFF Research Database (Denmark)

    Precht, H; Gerke, O; Rosendahl, K

    2012-01-01

    BACKGROUND: New developments in processing of digital radiographs (DR), including multi-frequency processing (MFP), allow optimization of image quality and radiation dose. This is particularly promising in children as they are believed to be more sensitive to ionizing radiation than adults....... OBJECTIVE: To examine whether the use of MFP software reduces the radiation dose without compromising quality at DR of the femur in 5-year-old-equivalent anthropomorphic and technical phantoms. MATERIALS AND METHODS: A total of 110 images of an anthropomorphic phantom were imaged on a DR system (Canon DR...... with CXDI-50 C detector and MLT[S] software) and analyzed by three pediatric radiologists using Visual Grading Analysis. In addition, 3,500 images taken of a technical contrast-detail phantom (CDRAD 2.0) provide an objective image-quality assessment. RESULTS: Optimal image-quality was maintained at a dose...

  16. Fokus: Digital

    DEFF Research Database (Denmark)

    2014-01-01

    i det digitale domæne – udviklinger, der foregår hastigt og er gennemgribende, og som derfor kræver et nærmere blik på forholdet mellem kunsten og teknologien. Komponistens forståelse af sin metier udfordres – samtidig med at befæstede ideer om kunstværket møder modstand fra nye mediemæssige...... sammenhænge og fra forandrede distributionsformer. Dette betyder ændrede betingelser for både produktion og reception af kunstmusik og lydkunst. Med Digital tager vi udgangspunkt i fire komponisters meget forskellige bud på hvordan teknologien spiller en rolle i arbejdet. Juliana Hodkinson beskriver hvordan...

  17. Digital work in a digitally challenged organization

    NARCIS (Netherlands)

    Davison, R.M.; Ou, Carol

    Digitally literate employees are accustomed to having free access to digital media technologies. However, some organizations enact information technology (IT) governance structures that explicitly proscribe access to these technologies, resulting in considerable tension between employees and the

  18. Microwave-Assisted Synthesis of Arene Ru(II Complexes Induce Tumor Cell Apoptosis Through Selectively Binding and Stabilizing bcl-2 G-Quadruplex DNA

    Directory of Open Access Journals (Sweden)

    Yanhua Chen

    2016-05-01

    Full Text Available A series of arene Ru(II complexes coordinated with phenanthroimidazole derivatives, [(η6-C6H6Ru(lCl]Cl(1b L = p-ClPIP = 2-(4-Chlorophenylimidazole[4,5f] 1,10-phenanthroline; 2b L = m-ClPIP = 2-(3-Chlorophenylimidazole[4,5f] 1,10-phenanthroline; 3b L = p-NPIP = 2-(4-Nitrophenylimidazole[4,5f] 1,10-phenanthroline; 4b L = m-NPIP = 2-(3-Nitrophenyl imidazole [4,5f] 1,10-phenanthroline were synthesized in yields of 89.9%–92.7% under conditions of microwave irradiation heating for 30 min to liberate four arene Ru(II complexes (1b, 2b, 3b, 4b. The anti-tumor activity of 1b against various tumor cells was evaluated by MTT assay. The results indicated that this complex blocked the growth of human lung adenocarcinoma A549 cells with an IC50 of 16.59 μM. Flow cytometric analysis showed that apoptosis of A549 cells was observed following treatment with 1b. Furthermore, the in vitro DNA-binding behaviors that were confirmed by spectroscopy indicated that 1b could selectively bind and stabilize bcl-2 G-quadruplex DNA to induce apoptosis of A549 cells. Therefore, the synthesized 1b has impressive bcl-2 G-quadruplex DNA-binding and stabilizing activities with potential applications in cancer chemotherapy.

  19. USNA DIGITAL FORENSICS LAB

    Data.gov (United States)

    Federal Laboratory Consortium — To enable Digital Forensics and Computer Security research and educational opportunities across majors and departments. Lab MissionEstablish and maintain a Digital...

  20. Can We Teach Digital Natives Digital Literacy?

    Science.gov (United States)

    Ng, Wan

    2012-01-01

    In recent years, there has been much debate about the concept of digital natives, in particular the differences between the digital natives' knowledge and adoption of digital technologies in informal versus formal educational contexts. This paper investigates the knowledge about educational technologies of a group of undergraduate students…

  1. Phenolic promiscuity in the cell nucleus--epigallocatechingallate (EGCG) and theaflavin-3,3'-digallate from green and black tea bind to model cell nuclear structures including histone proteins, double stranded DNA and telomeric quadruplex DNA.

    Science.gov (United States)

    Mikutis, Gediminas; Karaköse, Hande; Jaiswal, Rakesh; LeGresley, Adam; Islam, Tuhidul; Fernandez-Lahore, Marcelo; Kuhnert, Nikolai

    2013-02-01

    Flavanols from tea have been reported to accumulate in the cell nucleus in considerable concentrations. The nature of this phenomenon, which could provide novel approaches in understanding the well-known beneficial health effects of tea phenols, is investigated in this contribution. The interaction between epigallocatechin gallate (EGCG) from green tea and a selection of theaflavins from black tea with selected cell nuclear structures such as model histone proteins, double stranded DNA and quadruplex DNA was investigated using mass spectrometry, Circular Dichroism spectroscopy and fluorescent assays. The selected polyphenols were shown to display affinity to all of the selected cell nuclear structures, thereby demonstrating a degree of unexpected molecular promiscuity. Most interestingly theaflavin-digallate was shown to display the highest affinity to quadruplex DNA reported for any naturally occurring molecule reported so far. This finding has immediate implications in rationalising the chemopreventive effect of the tea beverage against cancer and possibly the role of tea phenolics as "life span essentials".

  2. DNA Sequences Proximal to Human Mitochondrial DNA Deletion Breakpoints Prevalent in Human Disease Form G-quadruplexes, a Class of DNA Structures Inefficiently Unwound by the Mitochondrial Replicative Twinkle Helicase*

    Science.gov (United States)

    Bharti, Sanjay Kumar; Sommers, Joshua A.; Zhou, Jun; Kaplan, Daniel L.; Spelbrink, Johannes N.; Mergny, Jean-Louis; Brosh, Robert M.

    2014-01-01

    Mitochondrial DNA deletions are prominent in human genetic disorders, cancer, and aging. It is thought that stalling of the mitochondrial replication machinery during DNA synthesis is a prominent source of mitochondrial genome instability; however, the precise molecular determinants of defective mitochondrial replication are not well understood. In this work, we performed a computational analysis of the human mitochondrial genome using the “Pattern Finder” G-quadruplex (G4) predictor algorithm to assess whether G4-forming sequences reside in close proximity (within 20 base pairs) to known mitochondrial DNA deletion breakpoints. We then used this information to map G4P sequences with deletions characteristic of representative mitochondrial genetic disorders and also those identified in various cancers and aging. Circular dichroism and UV spectral analysis demonstrated that mitochondrial G-rich sequences near deletion breakpoints prevalent in human disease form G-quadruplex DNA structures. A biochemical analysis of purified recombinant human Twinkle protein (gene product of c10orf2) showed that the mitochondrial replicative helicase inefficiently unwinds well characterized intermolecular and intramolecular G-quadruplex DNA substrates, as well as a unimolecular G4 substrate derived from a mitochondrial sequence that nests a deletion breakpoint described in human renal cell carcinoma. Although G4 has been implicated in the initiation of mitochondrial DNA replication, our current findings suggest that mitochondrial G-quadruplexes are also likely to be a source of instability for the mitochondrial genome by perturbing the normal progression of the mitochondrial replication machinery, including DNA unwinding by Twinkle helicase. PMID:25193669

  3. TMPyP4 porphyrin distorts RNA G-quadruplex structures of the disease-associated r(GGGGCC)n repeat of the C9orf72 gene and blocks interaction of RNA-binding proteins.

    Science.gov (United States)

    Zamiri, Bita; Reddy, Kaalak; Macgregor, Robert B; Pearson, Christopher E

    2014-02-21

    Certain DNA and RNA sequences can form G-quadruplexes, which can affect genetic instability, promoter activity, RNA splicing, RNA stability, and neurite mRNA localization. Amyotrophic lateral sclerosis and frontotemporal dementia can be caused by expansion of a (GGGGCC)n repeat in the C9orf72 gene. Mutant r(GGGGCC)n- and r(GGCCCC)n-containing transcripts aggregate in nuclear foci, possibly sequestering repeat-binding proteins such as ASF/SF2 and hnRNPA1, suggesting a toxic RNA pathogenesis, as occurs in myotonic dystrophy. Furthermore, the C9orf72 repeat RNA was recently demonstrated to undergo the noncanonical repeat-associated non-AUG translation (RAN translation) into pathologic dipeptide repeats in patient brains, a process that is thought to depend upon RNA structure. We previously demonstrated that the r(GGGGCC)n RNA forms repeat tract length-dependent G-quadruplex structures that bind the ASF/SF2 protein. Here we show that the cationic porphyrin (5,10,15,20-tetra(N-methyl-4-pyridyl) porphyrin (TMPyP4)), which can bind some G-quadruplex-forming sequences, can bind and distort the G-quadruplex formed by r(GGGGCC)8, and this ablates the interaction of either hnRNPA1 or ASF/SF2 with the repeat. These findings provide proof of concept that nucleic acid binding small molecules, such as TMPyP4, can distort the secondary structure of the C9orf72 repeat, which may beneficially disrupt protein interactions, which may ablate either protein sequestration and/or RAN translation into potentially toxic dipeptides. Disruption of secondary structure formation of the C9orf72 RNA repeats may be a viable therapeutic avenue, as well as a means to test the role of RNA structure upon RAN translation.

  4. Digital produktion

    DEFF Research Database (Denmark)

    Bogen sætter fokus på digital produktion, som er en stærk læringsform, der faciliterer elevernes læreprocesser og kvalificerer elevernes faglige læringsresultater. Det sker når lærerne udarbejder didaktiske rammedesign, hvor eleverne arbejder selvstændigt inden for dette rammedesign, og hvor mål og...... procesevaluering stilladserer elevernes faglige proces. I digitale produktionsprocesser arbejder eleverne iterativt, de udvikler ejerskab til produktionen og fastholder selv deres læreprocesser. It’s multimodalitet, elevernes kollaborative tilgange, videndeling mellem eleverne og elevernes uformelle lege- og...... elevernes digitale produktion er lærernes didaktiske rammesætning og stilladserende tilgange. Her lægger lærerne op til, at eleverne som didaktiske designere i relation til rammesætningen skal organisere og planlægge deres læreprocesser, inddrages i målsætning, evaluering og valg af digitale ressourcer...

  5. Digital dannelse

    DEFF Research Database (Denmark)

    Bundsgaard, Jeppe

    2012-01-01

    I al vores iver efter at få presset nogle flere digitale dimser ind i skolen, er vi i fare for at glemme hvad det er vi skal med disse dimser. Der er store forventninger til at de kan gøre det lettere at være lærer (og dermed billigere), og det kan det måske. Men der er jo også et dannelsesspørgs......I al vores iver efter at få presset nogle flere digitale dimser ind i skolen, er vi i fare for at glemme hvad det er vi skal med disse dimser. Der er store forventninger til at de kan gøre det lettere at være lærer (og dermed billigere), og det kan det måske. Men der er jo også et...... dannelsesspørgsmål knyttet til it. Hvad er egentlig digital dannelse? Og hvad betyder det for danskfaget?...

  6. Digital forensics digital evidence in criminal investigations

    CERN Document Server

    Marshall, Angus McKenzie

    2009-01-01

    The vast majority of modern criminal investigations involve some element of digital evidence, from mobile phones, computers, CCTV and other devices. Digital Forensics: Digital Evidence in Criminal Investigations provides the reader with a better understanding of how digital evidence complements "traditional" scientific evidence and examines how it can be used more effectively and efficiently in a range of investigations. Taking a new approach to the topic, this book presents digital evidence as an adjunct to other types of evidence and discusses how it can be deployed effectively in s

  7. pH-Modulated Watson-Crick duplex-quadruplex equilibria of guanine-rich and cytosine-rich DNA sequences 140 base pairs upstream of the c-kit transcription initiation site.

    Science.gov (United States)

    Bucek, Pavel; Jaumot, Joaquim; Aviñó, Anna; Eritja, Ramon; Gargallo, Raimundo

    2009-11-23

    Guanine-rich regions of DNA are sequences capable of forming G-quadruplex structures. The formation of a G-quadruplex structure in a region 140 base pairs (bp) upstream of the c-kit transcription initiation site was recently proposed (Fernando et al., Biochemistry, 2006, 45, 7854). In the present study, the acid-base equilibria and the thermally induced unfolding of the structures formed by a guanine-rich region and by its complementary cytosine-rich strand in c-kit were studied by means of circular dichroism and molecular absorption spectroscopies. In addition, competition between the Watson-Crick duplex and the isolated structures was studied as a function of pH value and temperature. Multivariate data analysis methods based on both hard and soft modeling were used to allow accurate quantification of the various acid-base species present in the mixtures. Results showed that the G-quadruplex and i-motif coexist with the Watson-Crick duplex over the pH range from 3.0 to 6.5, approximately, under the experimental conditions tested in this study. At pH 7.0, the duplex is practically the only species present.

  8. Digital platforms as enablers for digital transformation

    DEFF Research Database (Denmark)

    Hossain, Mokter; Lassen, Astrid Heidemann

    transformation is crucial. This study aims at exploring how organizations are driven towards transformation in various ways to embrace digital platforms for ideas, technologies, and knowledge. It shows the opportunities and challenges digital platforms bring in organizations. It also highlights underlying......Digital platforms offer new ways for organizations to collaborate with the external environment for ideas, technologies, and knowledge. They provide new possibilities and competence but they also bring new challenges for organizations. Understanding the role of these platforms in digital...... mechanisms and potential outcomes of various digital platforms. The contribution of the submission is valuable for scholars to understand and further explore this area. It provides insight for practitioners to capture value through digital platforms and accelerate the pace of organizations’ digital...

  9. H. Sapiens Digital: From Digital Immigrants and Digital Natives to Digital Wisdom

    Science.gov (United States)

    Prensky, Marc

    2009-01-01

    As we move further into the 21st century, the digital native/digital immigrant paradigm created by Marc Prensky in 2001 is becoming less relevant. In this article, Prensky suggests that we should focus instead on the development of what he calls "digital wisdom." Arguing that digital technology can make us not just smarter but truly wiser, Prensky…

  10. Dual beam vidicon digitizer

    International Nuclear Information System (INIS)

    Evans, T.L.

    1976-01-01

    A vidicon waveform digitizer which can simultaneously digitize two independent signals has been developed. Either transient or repetitive waveforms can be digitized with this system. A dual beam oscilloscope is used as the signal input device. The light from the oscilloscope traces is optically coupled to a television camera, where the signals are temporarily stored prior to digitizing

  11. Enabling Digital Literacy

    DEFF Research Database (Denmark)

    Ryberg, Thomas; Georgsen, Marianne

    2010-01-01

    There are some tensions between high-level policy definitions of “digital literacy” and actual teaching practice. We need to find workable definitions of digital literacy; obtain a better understanding of what digital literacy might look like in practice; and identify pedagogical approaches, which...... support teachers in designing digital literacy learning. We suggest that frameworks such as Problem Based Learning (PBL) are approaches that enable digital literacy learning because they provide good settings for engaging with digital literacy. We illustrate this through analysis of a case. Furthermore......, these operate on a meso-level mediating between high-level concepts of digital literacy and classroom practice....

  12. Progress in digital radiography

    International Nuclear Information System (INIS)

    Cappelle, A.

    2016-01-01

    Because of its practical aspect digital radiography is more and more used in the industrial sector. There are 2 kinds of digital radiography. First, the 'computed radiography' that uses a photon-stimulated screen, and after radiation exposure this screen must be read by an analyser to get a digit image. The second type is the 'direct radiography' that allows one to get a digit radiograph of the object directly. Digital radiography uses the same radioactive nuclides as radiography with silver films: cobalt, iridium or selenium. The spatial resolution of digital radiography is less good than with classical silver film radiography but digital radiography offers a better visual contrast. (A.C.)

  13. Digital Sensor Technology

    Energy Technology Data Exchange (ETDEWEB)

    Ted Quinn; Jerry Mauck; Richard Bockhorst; Ken Thomas

    2013-07-01

    The nuclear industry has been slow to incorporate digital sensor technology into nuclear plant designs due to concerns with digital qualification issues. However, the benefits of digital sensor technology for nuclear plant instrumentation are substantial in terms of accuracy, reliability, availability, and maintainability. This report demonstrates these benefits in direct comparisons of digital and analog sensor applications. It also addresses the qualification issues that must be addressed in the application of digital sensor technology.

  14. Digital preservation for heritages

    CERN Document Server

    Lu, Dongming

    2011-01-01

    ""Digital Preservation for Heritages: Technologies and Applications"" provides a comprehensive and up-to-date coverage of digital technologies in the area of cultural heritage preservation, including digitalization, research aiding, conservation aiding, digital exhibition, and digital utilization. Processes, technical frameworks, key technologies, as well as typical systems and applications are discussed in the book. It is intended for researchers and students in the fields of computer science and technology, museology, and archaeology. Dr. Dongming Lu is a professor at College of Computer Sci

  15. Cognitive Hacking and Digital Government: Digital Identity

    OpenAIRE

    Paul Thompson

    2004-01-01

    Recently the National Center for Digital Government held a workshop on "The Virtual Citizen: Identity, Autonomy, and Accountability: A Civic Scenario Exploration of the Role of Identity in On-Line. Discussions at the workshop focused on five scenarios for future authentication policies with respect to digital identity. The underlying technologies considered for authentication were: biometrics: cryptography, with a focus on digital signatures; secure processing/computation; and reputation syst...

  16. Digital Materialisms: Frameworks for Digital Media Studies

    OpenAIRE

    Casemajor, Nathalie

    2015-01-01

    Since the 1980s, digital materialism has received increasing interest in the field of media studies. Materialism as a theoretical paradigm assumes that all things in the world are tied to physical processes and matter. Yet within digital media studies, the understanding of what should be the core object of a materialist analysis is debated. This paper proposes to untangle some of the principal theoretical propositions that compose the field of digital materialism. It outlines six frameworks t...

  17. Digital multilayer tomography

    International Nuclear Information System (INIS)

    Dueber, C.; Klose, K.J.; Thelen, M.

    1991-01-01

    With digital multilayer tomography a sequence of projection images is recorded by an image intensifier television system and stored as digital data during a linear run of a layer sequence. Using this data record, tomograms of the examined body region can be computed for any layer thickness by shifts and superimposition of the single projections later at a digital workstation. The qualities of digital and conventional tomograms are basically comparable. A drawback of digital tomography is its lower local resolution (512 x 512 image matrix), advantages are a lower radiation exposure, a shorter patient examination time, and the facilities of digital image processing (later processing, archive setup, transmission). (orig.) [de

  18. Experience with digital mammography

    Directory of Open Access Journals (Sweden)

    G. P. Korzhenkova

    2011-01-01

    Full Text Available The use of digital techniques in mammography has become a last step for completing the process of digitization in diagnostic imaging. It is assumed that such a spatial decision will be required for digital mammography, as well as for high-resolution intensifying screen-film systems used in conventional mammography and that the digital techniques will be limited by the digitizer pixel size on detecting minor structures, such as microcalcifications. The introduction of digital technologies in mammography involves a tight control over an image and assures its high quality.

  19. Logic of the digital

    CERN Document Server

    Evens, Aden

    2015-01-01

    Building a foundational understanding of the digital, Logic of the Digital reveals a unique digital ontology. Beginning from formal and technical characteristics, especially the binary code at the core of all digital technologies, Aden Evens traces the pathways along which the digital domain of abstract logic encounters the material, human world. How does a code using only 0s and 1s give rise to the vast range of applications and information that constitutes a great and growing portion of our world? Evens' analysis shows how any encounter between the actual and the digital must cross an ontolo

  20. Coastal California Digital Imagery

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — This digital ortho-imagery dataset is a survey of coastal California. The project area consists of approximately 3774 square miles. The project design of the digital...

  1. Digital rectal exam

    Science.gov (United States)

    ... this page: //medlineplus.gov/ency/article/007069.htm Digital rectal exam To use the sharing features on this page, please enable JavaScript. A digital rectal exam is an examination of the lower ...

  2. Digital dannelse til gymnasieeleverne

    DEFF Research Database (Denmark)

    Kaarsted, Thomas; Holch Andersen, Knud

    2012-01-01

    Søsætningen af en ny tænketank skal udstikke nye digital retningslinjer for gymnasiekolerne. Baggrunden er en erkendelse af, at it-infrastruktur og digital teknologi ikke gør de alene.......Søsætningen af en ny tænketank skal udstikke nye digital retningslinjer for gymnasiekolerne. Baggrunden er en erkendelse af, at it-infrastruktur og digital teknologi ikke gør de alene....

  3. Basic digital signal processing

    CERN Document Server

    Lockhart, Gordon B

    1985-01-01

    Basic Digital Signal Processing describes the principles of digital signal processing and experiments with BASIC programs involving the fast Fourier theorem (FFT). The book reviews the fundamentals of the BASIC program, continuous and discrete time signals including analog signals, Fourier analysis, discrete Fourier transform, signal energy, power. The text also explains digital signal processing involving digital filters, linear time-variant systems, discrete time unit impulse, discrete-time convolution, and the alternative structure for second order infinite impulse response (IIR) sections.

  4. Digital asset management.

    Science.gov (United States)

    Humphrey, Clinton D; Tollefson, Travis T; Kriet, J David

    2010-05-01

    Facial plastic surgeons are accumulating massive digital image databases with the evolution of photodocumentation and widespread adoption of digital photography. Managing and maximizing the utility of these vast data repositories, or digital asset management (DAM), is a persistent challenge. Developing a DAM workflow that incorporates a file naming algorithm and metadata assignment will increase the utility of a surgeon's digital images. Copyright 2010 Elsevier Inc. All rights reserved.

  5. Digital Inkjet Textile Printing

    OpenAIRE

    Wang, Meichun

    2017-01-01

    Digital inkjet textile printing is an emerging technology developed with the rise of the digital world. It offers a possibility to print high-resolution images with unlimited color selection on fabrics. Digital inkjet printing brings a revolutionary chance for the textile printing industry. The history of textile printing shows the law how new technology replaces the traditional way of printing. This indicates the future of digital inkjet textile printing is relatively positive. Differen...

  6. Digital Language Death

    Science.gov (United States)

    Kornai, András

    2013-01-01

    Of the approximately 7,000 languages spoken today, some 2,500 are generally considered endangered. Here we argue that this consensus figure vastly underestimates the danger of digital language death, in that less than 5% of all languages can still ascend to the digital realm. We present evidence of a massive die-off caused by the digital divide. PMID:24167559

  7. Digital language death.

    Directory of Open Access Journals (Sweden)

    András Kornai

    Full Text Available Of the approximately 7,000 languages spoken today, some 2,500 are generally considered endangered. Here we argue that this consensus figure vastly underestimates the danger of digital language death, in that less than 5% of all languages can still ascend to the digital realm. We present evidence of a massive die-off caused by the digital divide.

  8. Digital Imaging. Chapter 16

    Energy Technology Data Exchange (ETDEWEB)

    Clunie, D. [CoreLab Partners, Princeton (United States)

    2014-09-15

    The original means of recording X ray images was a photographic plate. Nowadays, all medical imaging modalities provide for digital acquisition, though globally, the use of radiographic film is still widespread. Many modalities are fundamentally digital in that they require image reconstruction from quantified digital signals, such as computed tomography (CT) and magnetic resonance imaging (MRI)

  9. Preparing collections for digitization

    CERN Document Server

    Bulow, Anna E

    2010-01-01

    Most libraries, archives and museums are confronting the challenges of providing digital access to their collections. This guide offers guidance covering the end-to-end process of digitizing collections, from selecting records for digitization to choosing suppliers and equipment and dealing with documents that present individual problems.

  10. Digital voltage discriminator

    International Nuclear Information System (INIS)

    Zhou Zhicheng

    1992-01-01

    A digital voltage discriminator is described, which is synthesized by digital comparator and ADC. The threshold is program controllable with high stability. Digital region of confusion is approximately equal to 1.5 LSB. This discriminator has a single channel analyzer function model with channel width of 1.5 LSB

  11. Playtesting the Digital Playground

    DEFF Research Database (Denmark)

    Majgaard, G.; Jessen, Carsten

    2009-01-01

    Being able to be absorbed in play in the digital playground is motivating for children who are used digital computer games. The children can play and exercise outdoors while using the same literacy as in indoor digital games. This paper presents a new playground product where an outdoor playgroun...

  12. Flower bud transcriptome analysis of Sapium sebiferum (Linn.) Roxb. and primary investigation of drought induced flowering: pathway construction and G-quadruplex prediction based on transcriptome.

    Science.gov (United States)

    Yang, Minglei; Wu, Ying; Jin, Shan; Hou, Jinyan; Mao, Yingji; Liu, Wenbo; Shen, Yangcheng; Wu, Lifang

    2015-01-01

    Sapium sebiferum (Linn.) Roxb. (Chinese Tallow Tree) is a perennial woody tree and its seeds are rich in oil which hold great potential for biodiesel production. Despite a traditional woody oil plant, our understanding on S. sebiferum genetics and molecular biology remains scant. In this study, the first comprehensive transcriptome of S. sebiferum flower has been generated by sequencing and de novo assembly. A total of 149,342 unigenes were generated from raw reads, of which 24,289 unigenes were successfully matched to public database. A total of 61 MADS box genes and putative pathways involved in S. sebiferum flower development have been identified. Abiotic stress response network was also constructed in this work, where 2,686 unigenes are involved in the pathway. As for lipid biosynthesis, 161 unigenes have been identified in fatty acid (FA) and triacylglycerol (TAG) biosynthesis. Besides, the G-Quadruplexes in RNA of S. sebiferum also have been predicted. An interesting finding is that the stress-induced flowering was observed in S. sebiferum for the first time. According to the results of semi-quantitative PCR, expression tendencies of flowering-related genes, GA1, AP2 and CRY2, accorded with stress-related genes, such as GRX50435 and PRXⅡ39562. This transcriptome provides functional genomic information for further research of S. sebiferum, especially for the genetic engineering to shorten the juvenile period and improve yield by regulating flower development. It also offers a useful database for the research of other Euphorbiaceae family plants.

  13. Glucose oxidase-initiated cascade catalysis for sensitive impedimetric aptasensor based on metal-organic frameworks functionalized with Pt nanoparticles and hemin/G-quadruplex as mimicking peroxidases.

    Science.gov (United States)

    Zhou, Xingxing; Guo, Shijing; Gao, Jiaxi; Zhao, Jianmin; Xue, Shuyan; Xu, Wenju

    2017-12-15

    Based on cascade catalysis amplification driven by glucose oxidase (GOx), a sensitive electrochemical impedimetric aptasensor for protein (carcinoembryonic antigen, CEA as tested model) was proposed by using Cu-based metal-organic frameworks functionalized with Pt nanoparticles, aptamer, hemin and GOx (Pt@CuMOFs-hGq-GOx). CEA aptamer loaded onto Pt@CuMOFs was bound with hemin to form hemin@G-quadruplex (hGq) with mimicking peroxidase activity. Through sandwich-type reaction of target CEA and CEA aptamers (Apt1 and Apt2), the obtained Pt@CuMOFs-hGq-GOx as signal transduction probes (STPs) was captured to the modified electrode interface. When 3,3-diaminobenzidine (DAB) and glucose were introduced, the cascade reaction was initiated by GOx to catalyze the oxidation of glucose, in situ generating H 2 O 2 . Simultaneously, the decomposition of the generated H 2 O 2 was greatly promoted by Pt@CuMOFs and hGq as synergistic peroxide catalysts, accompanying with the significant oxidation process of DAB and the formation of nonconductive insoluble precipitates (IPs). As a result, the electron transfer in the resultant sensing interface was effectively hindered and the electrochemical impedimetric signal (EIS) was efficiently amplified. Thus, the high sensitivity of the proposed CEA aptasensor was successfully improved with 0.023pgmL -1 , which may be promising and potential in assaying certain clinical disease related to CEA. Copyright © 2017 Elsevier B.V. All rights reserved.

  14. Derivation of Reliable Geometries in QM Calculations of DNA Structures: Explicit Solvent QM/MM and Restrained Implicit Solvent QM Optimizations of G-Quadruplexes.

    Science.gov (United States)

    Gkionis, Konstantinos; Kruse, Holger; Šponer, Jiří

    2016-04-12

    Modern dispersion-corrected DFT methods have made it possible to perform reliable QM studies on complete nucleic acid (NA) building blocks having hundreds of atoms. Such calculations, although still limited to investigations of potential energy surfaces, enhance the portfolio of computational methods applicable to NAs and offer considerably more accurate intrinsic descriptions of NAs than standard MM. However, in practice such calculations are hampered by the use of implicit solvent environments and truncation of the systems. Conventional QM optimizations are spoiled by spurious intramolecular interactions and severe structural deformations. Here we compare two approaches designed to suppress such artifacts: partially restrained continuum solvent QM and explicit solvent QM/MM optimizations. We report geometry relaxations of a set of diverse double-quartet guanine quadruplex (GQ) DNA stems. Both methods provide neat structures without major artifacts. However, each one also has distinct weaknesses. In restrained optimizations, all errors in the target geometries (i.e., low-resolution X-ray and NMR structures) are transferred to the optimized geometries. In QM/MM, the initial solvent configuration causes some heterogeneity in the geometries. Nevertheless, both approaches represent a decisive step forward compared to conventional optimizations. We refine earlier computations that revealed sizable differences in the relative energies of GQ stems computed with AMBER MM and QM. We also explore the dependence of the QM/MM results on the applied computational protocol.

  15. The estimation of H-bond and metal ion-ligand interaction energies in the G-Quadruplex ⋯ Mn+ complexes

    Science.gov (United States)

    Mostafavi, Najmeh; Ebrahimi, Ali

    2018-06-01

    In order to characterize various interactions in the G-quadruplex ⋯ Mn+ (G-Q ⋯ Mn+) complexes, the individual H-bond (EHB) and metal ion-ligand interaction (EMO) energies have been estimated using the electron charge densities (ρs) calculated at the X ⋯ H (X = N and O) and Mn+ ⋯ O (Mn+ is an alkaline, alkaline earth and transition metal ion) bond critical points (BCPs) obtained from the atoms in molecules (AIM) analysis. The estimated values of EMO and EHB were evaluated using the structural parameters, results of natural bond orbital analysis (NBO), aromaticity indexes and atomic charges. The EMO value increase with the ratio of ionic charge to radius, e/r, where a linear correlation is observed between EMO and e/r (R = 0.97). Meaningful relationships are also observed between EMO and indexes used for aromaticity estimation. The ENH value is higher than EOH in the complexes; this is in complete agreement with the trend of N⋯Hsbnd N and O⋯Hsbnd N angles, the E (2) value of nN → σ*NH and nO → σ*NH interactions and the difference between the natural charges on the H-bonded atom and the hydrogen atom of guanine (Δq). In general, the O1MO2 angle becomes closer to 109.5° with the increase in EMO and decrease in EHB in the presence of metal ion.

  16. Molecular recognition of naphthalene diimide ligands by telomeric quadruplex-DNA: the importance of the protonation state and mediated hydrogen bonds.

    Science.gov (United States)

    Spinello, A; Barone, G; Grunenberg, J

    2016-01-28

    In depth Monte Carlo conformational scans in combination with molecular dynamics (MD) simulations and electronic structure calculations were applied in order to study the molecular recognition process between tetrasubstituted naphthalene diimide (ND) guests and G-quadruplex (G4) DNA receptors. ND guests are a promising class of telomere stabilizers due to which they are used in novel anticancer therapeutics. Though several ND guests have been studied experimentally in the past, the protonation state under physiological conditions is still unclear. Based on chemical intuition, in the case of N-methyl-piperazine substitution, different protonation states are possible and might play a crucial role in the molecular recognition process by G4-DNA. Depending on the proton concentration, different nitrogen atoms of the N-methyl-piperazine might (or might not) be protonated. This fact was considered in our simulation in terms of a case by case analysis, since the process of molecular recognition is determined by possible donor or acceptor positions. The results of our simulations show that the electrostatic interactions between the ND ligands and the G4 receptor are maximized in the case of the protonation of the terminal nitrogen atoms, forming compact ND G4 complexes inside the grooves. The influence of different protonation states in terms of the ability to form hydrogen bonds with the sugar-phosphate backbone, as well as the importance of mediated vs. direct hydrogen bonding, was analyzed in detail by MD and relaxed force constant (compliance constant) simulations.

  17. Exploring the Interactions of the Dietary Plant Flavonoids Fisetin and Naringenin with G-Quadruplex and Duplex DNA, Showing Contrasting Binding Behavior: Spectroscopic and Molecular Modeling Approaches.

    Science.gov (United States)

    Bhattacharjee, Snehasish; Chakraborty, Sandipan; Sengupta, Pradeep K; Bhowmik, Sudipta

    2016-09-01

    Guanine-rich sequences have the propensity to fold into a four-stranded DNA structure known as a G-quadruplex (G4). G4 forming sequences are abundant in the promoter region of several oncogenes and become a key target for anticancer drug binding. Here we have studied the interactions of two structurally similar dietary plant flavonoids fisetin and naringenin with G4 as well as double stranded (duplex) DNA by using different spectroscopic and modeling techniques. Our study demonstrates the differential binding ability of the two flavonoids with G4 and duplex DNA. Fisetin more strongly interacts with parallel G4 structure than duplex DNA, whereas naringenin shows stronger binding affinity to duplex rather than G4 DNA. Molecular docking results also corroborate our spectroscopic results, and it was found that both of the ligands are stacked externally in the G4 DNA structure. C-ring planarity of the flavonoid structure appears to be a crucial factor for preferential G4 DNA recognition of flavonoids. The goal of this study is to explore the critical effects of small differences in the structure of closely similar chemical classes of such small molecules (flavonoids) which lead to the contrasting binding properties with the two different forms of DNA. The resulting insights may be expected to facilitate the designing of the highly selective G4 DNA binders based on flavonoid scaffolds.

  18. Telomeric repeat-containing RNA/G-quadruplex-forming sequences cause genome-wide alteration of gene expression in human cancer cells in vivo.

    Science.gov (United States)

    Hirashima, Kyotaro; Seimiya, Hiroyuki

    2015-02-27

    Telomere erosion causes cell mortality, suggesting that longer telomeres enable more cell divisions. In telomerase-positive human cancer cells, however, telomeres are often kept shorter than those of surrounding normal tissues. Recently, we showed that cancer cell telomere elongation represses innate immune genes and promotes their differentiation in vivo. This implies that short telomeres contribute to cancer malignancy, but it is unclear how such genetic repression is caused by elongated telomeres. Here, we report that telomeric repeat-containing RNA (TERRA) induces a genome-wide alteration of gene expression in telomere-elongated cancer cells. Using three different cell lines, we found that telomere elongation up-regulates TERRA signal and down-regulates innate immune genes such as STAT1, ISG15 and OAS3 in vivo. Ectopic TERRA oligonucleotides repressed these genes even in cells with short telomeres under three-dimensional culture conditions. This appeared to occur from the action of G-quadruplexes (G4) in TERRA, because control oligonucleotides had no effect and a nontelomeric G4-forming oligonucleotide phenocopied the TERRA oligonucleotide. Telomere elongation and G4-forming oligonucleotides showed similar gene expression signatures. Most of the commonly suppressed genes were involved in the innate immune system and were up-regulated in various cancers. We propose that TERRA G4 counteracts cancer malignancy by suppressing innate immune genes. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.

  19. Characterizing and controlling intrinsic biases of lambda exonuclease in nascent strand sequencing reveals phasing between nucleosomes and G-quadruplex motifs around a subset of human replication origins

    DEFF Research Database (Denmark)

    Foulk, M. S.; Urban, J. M.; Casella, Cinzia

    2015-01-01

    Nascent strand sequencing (NS-seq) is used to discover DNA replication origins genome-wide, allowing identification of features for their specification. NS-seq depends on the ability of lambda exonuclease (lambda-exo) to efficiently digest parental DNA while leaving RNA-primer protected nascent...... strands intact. We used genomics and biochemical approaches to determine if lambda-exo digests all parental DNA sequences equally. We report that lambda-exo does not efficiently digest G-quadruplex (G4) structures in a plasmid. Moreover, lambda-exo digestion of nonreplicating genomic DNA (LexoG0) enriches...... GC-rich DNA and G4 motifs genome-wide. We used LexoG0 data to control for nascent strand-independent lambda-exo biases in NSseq and validated this approach at the rDNA locus. The lambda-exo-controlled NS-seq peaks are not GC-rich, and only 35.5% overlap with 6.8% of all G4s, suggesting that G4s...

  20. G-quadruplex and G-rich sequence stimulate Pif1p-catalyzed downstream duplex DNA unwinding through reducing waiting time at ss/dsDNA junction

    Science.gov (United States)

    Zhang, Bo; Wu, Wen-Qiang; Liu, Na-Nv; Duan, Xiao-Lei; Li, Ming; Dou, Shuo-Xing; Hou, Xi-Miao; Xi, Xu-Guang

    2016-01-01

    Alternative DNA structures that deviate from B-form double-stranded DNA such as G-quadruplex (G4) DNA can be formed by G-rich sequences that are widely distributed throughout the human genome. We have previously shown that Pif1p not only unfolds G4, but also unwinds the downstream duplex DNA in a G4-stimulated manner. In the present study, we further characterized the G4-stimulated duplex DNA unwinding phenomenon by means of single-molecule fluorescence resonance energy transfer. It was found that Pif1p did not unwind the partial duplex DNA immediately after unfolding the upstream G4 structure, but rather, it would dwell at the ss/dsDNA junction with a ‘waiting time’. Further studies revealed that the waiting time was in fact related to a protein dimerization process that was sensitive to ssDNA sequence and would become rapid if the sequence is G-rich. Furthermore, we identified that the G-rich sequence, as the G4 structure, equally stimulates duplex DNA unwinding. The present work sheds new light on the molecular mechanism by which G4-unwinding helicase Pif1p resolves physiological G4/duplex DNA structures in cells. PMID:27471032

  1. Digital disruption ?syndromes.

    Science.gov (United States)

    Sullivan, Clair; Staib, Andrew

    2017-05-18

    The digital transformation of hospitals in Australia is occurring rapidly in order to facilitate innovation and improve efficiency. Rapid transformation can cause temporary disruption of hospital workflows and staff as processes are adapted to the new digital workflows. The aim of this paper is to outline various types of digital disruption and some strategies for effective management. A large tertiary university hospital recently underwent a rapid, successful roll-out of an integrated electronic medical record (EMR). We observed this transformation and propose several digital disruption "syndromes" to assist with understanding and management during digital transformation: digital deceleration, digital transparency, digital hypervigilance, data discordance, digital churn and post-digital 'depression'. These 'syndromes' are defined and discussed in detail. Successful management of this temporary digital disruption is important to ensure a successful transition to a digital platform. What is known about this topic? Digital disruption is defined as the changes facilitated by digital technologies that occur at a pace and magnitude that disrupt established ways of value creation, social interactions, doing business and more generally our thinking. Increasing numbers of Australian hospitals are implementing digital solutions to replace traditional paper-based systems for patient care in order to create opportunities for improved care and efficiencies. Such large scale change has the potential to create transient disruption to workflows and staff. Managing this temporary disruption effectively is an important factor in the successful implementation of an EMR. What does this paper add? A large tertiary university hospital recently underwent a successful rapid roll-out of an integrated electronic medical record (EMR) to become Australia's largest digital hospital over a 3-week period. We observed and assisted with the management of several cultural, behavioural and

  2. Ageing and digital games

    DEFF Research Database (Denmark)

    Iversen, Sara Mosberg

    Digital games are still to a great degree considered a medium mainly for young boys. However, available statistics on Western media use show that this is far from the case. Increasingly, people of all ages and genders play digital games, also older adults in their early 60s and beyond. The aim...... of the book is to examine, analyse and discuss: 1) What older adults do with digital games and what meanings the use of digital games take on in the everyday life of older adults; 2) How older adults are perceived by society in relation to digital games; 3) How play and games can be used both...

  3. Digital Living at Home

    DEFF Research Database (Denmark)

    Andersen, Pernille Viktoria Kathja; Christiansen, Ellen Tove

    2013-01-01

    of these user voices has directed us towards a ‘home-keeping’ design discourse, which opens new horizons for design of digital home control systems by allowing users to perform as self-determined controllers and groomers of their habitat. The paper concludes by outlining the implications of a ‘home......Does living with digital technology inevitably lead to digital living? Users talking about a digital home control system, they have had in their homes for eight years, indicate that there is more to living with digital technology than a functional-operational grip on regulation. Our analysis......-keeping’ design discourse....

  4. Digital positron annihilation spectrometer

    International Nuclear Information System (INIS)

    Cheng Bin; Weng Huimin; Han Rongdian; Ye Bangjiao

    2010-01-01

    With the high speed development of digital signal process, the technique of the digitization and processing of signals was applied in the domain of a broad class of nuclear technique. The development of digital positron lifetime spectrometer (DPLS) is more promising than the conventional positron lifetime spectrometer equipped with nuclear instrument modules. And digital lifetime spectrometer has many advantages, such as low noise, long term stability, flexible online or offline digital processing, simple setup, low expense, easy to setting, and more physical information. Digital constant fraction discrimination is for timing. And a new method of optimizing energy windows setting for digital positron lifetime spectrometer is also developed employing the simulated annealing for the convenient use. The time resolution is 220ps and the count rate is 200cps. (authors)

  5. A label-free ultrasensitive fluorescence detection of viable Salmonella enteritidis using enzyme-induced cascade two-stage toehold strand-displacement-driven assembly of G-quadruplex DNA.

    Science.gov (United States)

    Zhang, Peng; Liu, Hui; Ma, Suzhen; Men, Shuai; Li, Qingzhou; Yang, Xin; Wang, Hongning; Zhang, Anyun

    2016-06-15

    The harm of Salmonella enteritidis (S. enteritidis ) to public health mainly by contaminating fresh food and water emphasizes the urgent need for rapid detection techniques to help control the spread of the pathogen. In this assay, an newly designed capture probe complex that contained specific S. enteritidis-aptamer and hybridized signal target sequence was used for viable S. enteritidis recognition directly. In the presence of the target S. enteritidis, single-stranded target sequences were liberated and initiated the replication-cleavage reaction, producing numerous G-quadruplex structures with a linker on the 3'-end. And then, the sensing system took innovative advantage of quadratic linker-induced strand-displacement for the first time to release target sequence in succession, leading to the cyclic reuse of the target sequences and cascade signal amplification, thereby achieving the successive production of G-quadruplex structures. The fluorescent dye, N-Methyl mesoporphyrin IX, binded to these G-quadruplex structures and generated significantly enhanced fluorescent signals to achieve highly sensitive detection of S. enteritidis down to 60 CFU/mL with a linear range from 10(2) to 10(7)CFU/mL. By coupling the cascade two-stage target sequences-recyclable toehold strand-displacement with aptamer-based target recognition successfully, it is the first report on a novel non-label, modification-free and DNA extraction-free ultrasensitive fluorescence biosensor for detecting viable S. enteritidis directly, which can discriminate from dead S. enteritidis. Copyright © 2016 Elsevier B.V. All rights reserved.

  6. Digital Banking: Risks of Financial Digitalization

    Directory of Open Access Journals (Sweden)

    Kornіvska Valerіa O.

    2017-09-01

    Full Text Available The paper demonstrates the results of the research into development of the digital economy in the global financial space, shows the contradictions of these processes in the context of the growth of financial inclusion of households, identifies the risks of active introduction of digital banking in poor countries of the world. The characteristics of the processes of growth of the influence of banking institutions on the operational activity and daily life of households are given, and it is proved that under conditions of digital banking, without having any other alternative ways of economic activity in terms of money circulation than non-cash turnover, clients are forced to agree to unlimited presence of financial operators in social systems. It is substantiated that in Ukraine the global risk of digitalization of the society is gradually developing as a result of the creation of unified information systems for the control of global financial flows.

  7. Digital rights management for digital cinema

    Science.gov (United States)

    Kirovski, Darko; Peinado, Marcus; Petitcolas, Fabien A. P.

    2001-12-01

    There is a wide consensus among the feature film production studios that the Internet era brings a new paradigm for film distribution to cinemas worldwide. The benefits of digital cinema to both producers and cinemas are numerous: significantly lower distribution and maintenance costs, immediate access to film libraries, higher presentation quality, and strong potential for developing new business models. Despite these advantages, the studios are still reluctant to jump into the digital age. The main showstopper for digital cinema is the danger of widespread piracy. Piracy already costs Hollywood an estimated two billion dollars annually and digital cinema without proper copyright enforcement could increase this number. In this paper, we present a copyright management system that aims at providing the set of necessary security tools: standard cryptographic primitives and copyright protection mechanisms that enable a reliable and secure feature film delivery system.

  8. Digital Collections, Digital Libraries and the Digitization of Cultural Heritage Information.

    Science.gov (United States)

    Lynch, Clifford

    2002-01-01

    Discusses the development of digital collections and digital libraries. Topics include digitization of cultural heritage information; broadband issues; lack of compelling content; training issues; types of materials being digitized; sustainability; digital preservation; infrastructure; digital images; data mining; and future possibilities for…

  9. Reliability analysis of Airbus A-330 computer flight management system

    OpenAIRE

    Fajmut, Metod

    2010-01-01

    Diploma thesis deals with digitized, computerized flight control system »Fly-by-wire« and security aspects of the computer system of an aircraft Airbus A330. As for space and military aircraft structures is also in commercial airplanes, much of the financial contribution devoted to reliability. Conventional aircraft control systems have, and some are still, to rely on mechanical and hydraulic connections between the controls on aircraft operated by the pilot and control surfaces. But newer a...

  10. Digital Simulation in the Geosciences

    Directory of Open Access Journals (Sweden)

    Alexandr A. Lobanov

    2014-09-01

    Full Text Available This article provides an analysis of methods for digital modeling in the area of Earth Sciences. The author illustrates the difference between digital modeling in radio communication and that in the area of Earth Sciences. The article examines the integration aspect of digital models, demonstrates the advantages of digital over analog models, and illustrates that digital models are discrete. The author outlines the characteristics of digital modeling and illustrates the logical structure of digital models.

  11. Digital radiology and ultrasound

    International Nuclear Information System (INIS)

    Todd-Pokropek, A.

    1991-01-01

    With the access to digital methods for handling and processing images in general, many medical imaging methods are becoming more effectively handled digitally. This applies in particular to basically digital techniques such as CT and MR but also now includes Nuclear Medicine (NM), Ultrasound (US) and a variety of radiological procedures such as Digital Subtraction Angiography (DSA) and Fluoroscopy (DF). The access to conventional projection images by stimulatable plates (CR) or by digitization of film makes all of radiology potentially accessible, and the management of such images by a network is the basic aim of Picture Archiving and Communication Systems (PACS). However, it is suggested that in order for such systems to be of greater value, that way in which such images are treated needs to change, that is, digital images can be used to derive additional clinical value by appropriate processing

  12. Digital cine-imaging

    International Nuclear Information System (INIS)

    Masuda, Kazuhiro

    1992-01-01

    Digitization of fluoroscopic images has been developed for the digital cine imaging system as a result of the computer technology, television technology, and popularization of interventional radiology. Present digital cine imaging system is able to offer images similar to cine film because of the higher operatability and better image quality with the development of interventional radiology. As a result, its higher usefulness for catheter diagnosis examination except for interventional radiology was reported, and the possibility of having filmless cine is close to becoming a reality. However several problems have been pointed out, such as spatial resolution, time resolution, storage and exchangeability of data, disconsolidated viewing functions, etc. Anyhow, digital cine imaging system has some unresolved points and lots the needs to be discussed. The tendency of digitization is the passage of the time and we have to promote a study for more useful digital cine imaging system in team medical treatment which centers on the patients. (author)

  13. Theory of Digital Automata

    CERN Document Server

    Borowik, Bohdan; Lahno, Valery; Petrov, Oleksandr

    2013-01-01

    This book serves a dual purpose: firstly to combine the treatment of circuits and digital electronics, and secondly, to establish a strong connection with the contemporary world of digital systems. The need for this approach arises from the observation that introducing digital electronics through a course in traditional circuit analysis is fast becoming obsolete. Our world has gone digital. Automata theory helps with the design of digital circuits such as parts of computers, telephone systems and control systems. A complete perspective is emphasized, because even the most elegant computer architecture will not function without adequate supporting circuits. The focus is on explaining the real-world implementation of complete digital systems. In doing so, the reader is prepared to immediately begin design and implementation work. This work serves as a bridge to take readers from the theoretical world to the everyday design world where solutions must be complete to be successful.

  14. Digital collections and exhibits

    CERN Document Server

    Denzer, Juan

    2015-01-01

    Today's libraries are taking advantage of cutting-edge technologies such as flat panel displays using touch, sound, and hands-free motions to design amazing exhibits using everything from simple computer hardware to advanced technologies such as the Microsoft Kinect. Libraries of all types are striving to add new interactive experiences for their patrons through exciting digital exhibits, both online and off. Digital Collections and Exhibits takes away the mystery of designing stunning digital exhibits to spotlight library trea

  15. The digital computer

    CERN Document Server

    Parton, K C

    2014-01-01

    The Digital Computer focuses on the principles, methodologies, and applications of the digital computer. The publication takes a look at the basic concepts involved in using a digital computer, simple autocode examples, and examples of working advanced design programs. Discussions focus on transformer design synthesis program, machine design analysis program, solution of standard quadratic equations, harmonic analysis, elementary wage calculation, and scientific calculations. The manuscript then examines commercial and automatic programming, how computers work, and the components of a computer

  16. Digital Textile Printing

    OpenAIRE

    Moltchanova, Julia

    2011-01-01

    Rapidly evolving technology of digital printing opens new opportunities on many markets. One of them is the printed fabric market where printing companies as well as clients benefit from new printing methods. This thesis focuses on the digital textile printing technology and its implementation for fabric-on-demand printing service in Finland. The purpose of this project was to study the technology behind digital textile printing, areas of application of this technology, the requirements ...

  17. Digital Sensor Technology

    Energy Technology Data Exchange (ETDEWEB)

    Thomas, Ken D. [Idaho National Lab. (INL), Idaho Falls, ID (United States); Quinn, Edward L. [Technology Resources, Dana Point, CA (United States); Mauck, Jerry L. [Technology Resources, Dana Point, CA (United States); Bockhorst, Richard M. [Technology Resources, Dana Point, CA (United States)

    2015-02-01

    The nuclear industry has been slow to incorporate digital sensor technology into nuclear plant designs due to concerns with digital qualification issues. However, the benefits of digital sensor technology for nuclear plant instrumentation are substantial in terms of accuracy and reliability. This paper, which refers to a final report issued in 2013, demonstrates these benefits in direct comparisons of digital and analog sensor applications. Improved accuracy results from the superior operating characteristics of digital sensors. These include improvements in sensor accuracy and drift and other related parameters which reduce total loop uncertainty and thereby increase safety and operating margins. An example instrument loop uncertainty calculation for a pressure sensor application is presented to illustrate these improvements. This is a side-by-side comparison of the instrument loop uncertainty for both an analog and a digital sensor in the same pressure measurement application. Similarly, improved sensor reliability is illustrated with a sample calculation for determining the probability of failure on demand, an industry standard reliability measure. This looks at equivalent analog and digital temperature sensors to draw the comparison. The results confirm substantial reliability improvement with the digital sensor, due in large part to ability to continuously monitor the health of a digital sensor such that problems can be immediately identified and corrected. This greatly reduces the likelihood of a latent failure condition of the sensor at the time of a design basis event. Notwithstanding the benefits of digital sensors, there are certain qualification issues that are inherent with digital technology and these are described in the report. One major qualification impediment for digital sensor implementation is software common cause failure (SCCF).

  18. Preserving Digital Materials

    CERN Document Server

    Harvey, Ross

    2011-01-01

    This book provides a single-volume introduction to the principles, strategies and practices currently applied by librarians and recordkeeping professionals to the critical issue of preservation of digital information. It incorporates practice from both the recordkeeping and the library communities, taking stock of current knowledge about digital preservation and describing recent and current research, to provide a framework for reflecting on the issues that digital preservation raises in professional practice.

  19. Dakwah di Era Digital

    OpenAIRE

    Budiantoro, Wahyu

    2018-01-01

    These days dakwah is not only interpreted as transformation of a pure religious value, but also transformation of a more relevant value including many aspects in digital era. Digital era is when society succumbed into the flow of information causing cultural shock and difficulties on synthesizing meaning from those scattered information. Dakwah on Digital age must accommodate societal needs which tend to move into a mass society. It results in strategy and more humane and innovative dakwah me...

  20. The Digital Imperative

    OpenAIRE

    Veling, Louise; Murnane, Sinéad; Carcary, Marian; Zlydareva, Olga

    2014-01-01

    The pervasiveness of digital technologies and their potential for reshaping the industry landscape dictates that organizations operating today have little choice but to incorporate digital technologies into their business strategies. Failure to do so will impede the business’s viability, and may ultimately lead to business failure. However, for those organizations that successfully transition to digital business, unprecedented business opportunities exist for value creation and reali...

  1. Digital piracy : theory

    OpenAIRE

    BELLEFLAMME, Paul; PEITZ, Martin

    2010-01-01

    This article reviews recent theoretical contributions on digital piracy. It starts by elaborating on the reasons for intellectual property protection, by reporting a few facts about copyright protection, and by examining reasons to become a digital pirate. Next, it provides an exploration of the consequences of digital piracy, using a base model and several extensions (with consumer sampling, network effects, and indirect appropriation). A closer look at market-structure implications of end-u...

  2. La radio digital

    Directory of Open Access Journals (Sweden)

    Carlos Eduardo Cortés S.

    2015-01-01

    Full Text Available La radio digital es un producto de la llamada convergencia digital. Las nuevas tecnologías interconectadas permiten la aparición de nuevos modos de audiencia y la implementación de herramientas versátiles. Habla del problema de los estándares, de la radio satelital, la radio digital terrestre, las radios internacionales, la interactividad.

  3. Easy digital engineering

    International Nuclear Information System (INIS)

    Jin, Dal Bok

    2002-02-01

    This book lists basic of digital engineering, number system and digital code, Boolean algebra and basic logic circuit, simplify of logical expression, combinational circuit, arithmetic circuit, multivibrator circuit, sequential circuit, memory unit of semiconductor and logical element for program, D/A converter and A/D converter, logic element and integrated circuit and logic circuit and micro controller. It has exercises and answers about digital engineering and summary in the end of each chapter.

  4. Debunking the "Digital Native": Beyond Digital Apartheid, towards Digital Democracy

    Science.gov (United States)

    Brown, C.; Czerniewicz, L.

    2010-01-01

    This paper interrogates the currently pervasive discourse of the "net generation" finding the concept of the "digital native" especially problematic, both empirically and conceptually. We draw on a research project of South African higher education students' access to and use of Information and Communication Technologies (ICTs)…

  5. Digital Natives and Digital Divide: Analysing Perspective for Emerging Pedagogy

    Science.gov (United States)

    Onye, Uriel U.; Du, Yunfei

    2016-01-01

    This paper addresses the concepts of digital natives and digital divide from the perspective of the digital outsiders (part of digital natives). It takes a critical look at the implications of available ICT in both developed and underdeveloped countries in the fight against digital divide. The major contribution to literature is by drawing…

  6. The digital media handbook

    CERN Document Server

    Dewdney, Andrew

    2013-01-01

    The new edition of The Digital Media Handbook presents an essential guide to the historical and theoretical development of digital media, emphasising cultural continuity alongside technological change, and highlighting the emergence of new forms of communication in contemporary networked culture.Andrew Dewdney and Peter Ride present detailed critical commentary and descriptive historical accounts, as well as a series of interviews from a range of digital media practitioners, including producers, developers, curators and artists.The Digital Media Handbook highlights key concerns of today's prac

  7. Digitization of conventional radiographs

    International Nuclear Information System (INIS)

    Wenz, W.; Buitrago-Tellez, C.; Blum, U.; Hauenstein, K.H.; Gufler, H.; Meyer, E.; Ruediger, K.

    1992-01-01

    The diagnostic value of a digitization system for analogue films based on a charge-coupled-device (CCD) scanner with adjustable resolution of 2.5 or 5 lp/mm was assessed. Some 110 skeletal radiographs, 50 contrast studies, including 25 of patients with Crohn's disease, and 70 abdominal plain films before and after successful lithotripsy for renal stones were digitized. Receiver operating characteristic (ROC) studies showed improved detection of cortical and trabecular defects with contrast-optimized digitized films. Edge enhancement algorithms yielded no additional information. Inflammatory lesions of Crohn's disease were detected equally well by conventional films and digitized images. A statistically significant improvement (p [de

  8. Digital security technology simplified.

    Science.gov (United States)

    Scaglione, Bernard J

    2007-01-01

    Digital security technology is making great strides in replacing analog and other traditional security systems including CCTV card access, personal identification and alarm monitoring applications. Like any new technology, the author says, it is important to understand its benefits and limitations before purchasing and installing, to ensure its proper operation and effectiveness. This article is a primer for security directors on how digital technology works. It provides an understanding of the key components which make up the foundation for digital security systems, focusing on three key aspects of the digital security world: the security network, IP cameras and IP recorders.

  9. Digitally-Driven Architecture

    Directory of Open Access Journals (Sweden)

    Henriette Bier

    2014-07-01

    Full Text Available The shift from mechanical to digital forces architects to reposition themselves: Architects generate digital information, which can be used not only in designing and fabricating building components but also in embedding behaviours into buildings. This implies that, similar to the way that industrial design and fabrication with its concepts of standardisation and serial production influenced modernist architecture, digital design and fabrication influences contemporary architecture. While standardisation focused on processes of rationalisation of form, mass-customisation as a new paradigm that replaces mass-production, addresses non-standard, complex, and flexible designs. Furthermore, knowledge about the designed object can be encoded in digital data pertaining not just to the geometry of a design but also to its physical or other behaviours within an environment. Digitally-driven architecture implies, therefore, not only digitally-designed and fabricated architecture, it also implies architecture – built form – that can be controlled, actuated, and animated by digital means.In this context, this sixth Footprint issue examines the influence of digital means as pragmatic and conceptual instruments for actuating architecture. The focus is not so much on computer-based systems for the development of architectural designs, but on architecture incorporating digital control, sens­ing, actuating, or other mechanisms that enable buildings to inter­act with their users and surroundings in real time in the real world through physical or sensory change and variation.

  10. Digitally-Driven Architecture

    Directory of Open Access Journals (Sweden)

    Henriette Bier

    2010-06-01

    Full Text Available The shift from mechanical to digital forces architects to reposition themselves: Architects generate digital information, which can be used not only in designing and fabricating building components but also in embedding behaviours into buildings. This implies that, similar to the way that industrial design and fabrication with its concepts of standardisation and serial production influenced modernist architecture, digital design and fabrication influences contemporary architecture. While standardisa­tion focused on processes of rationalisation of form, mass-customisation as a new paradigm that replaces mass-production, addresses non-standard, complex, and flexible designs. Furthermore, knowledge about the designed object can be encoded in digital data pertaining not just to the geometry of a design but also to its physical or other behaviours within an environment. Digitally-driven architecture implies, therefore, not only digitally-designed and fabricated architecture, it also implies architecture – built form – that can be controlled, actuated, and animated by digital means. In this context, this sixth Footprint issue examines the influence of digital means as prag­matic and conceptual instruments for actuating architecture. The focus is not so much on computer-based systems for the development of architectural designs, but on architecture incorporating digital control, sens­ing, actuating, or other mechanisms that enable buildings to inter­act with their users and surroundings in real time in the real world through physical or sensory change and variation.

  11. Exploring digital professionalism.

    Science.gov (United States)

    Ellaway, Rachel H; Coral, Janet; Topps, David; Topps, Maureen

    2015-01-01

    The widespread use of digital media (both computing devices and the services they access) has blurred the boundaries between our personal and professional lives. Contemporary students are the last to remember a time before the widespread use of the Internet and they will be the first to practice in a largely e-health environment. This article explores concepts of digital professionalism and their place in contemporary medical education, and proposes a series of principles of digital professionalism to guide teaching, learning and practice in the healthcare professions. Despite the many risks and fears surrounding their use, digital media are not an intrinsic threat to medical professionalism. Professionals should maintain the capacity for deliberate, ethical, and accountable practice when using digital media. The authors describe a digital professionalism framework structured around concepts of proficiency, reputation, and responsibility. Digital professionalism can be integrated into medical education using strategies based on awareness, alignment, assessment, and accountability. These principles of digital professionalism provide a way for medical students and medical practitioners to embrace the positive aspects of digital media use while being mindful and deliberate in its use to avoid or minimize any negative consequences.

  12. Radiographic film digitizing devices

    International Nuclear Information System (INIS)

    McFee, W.H.

    1988-01-01

    Until recently, all film digitizing devices for use with teleradiology or picture archiving and communication systems used a video camera to capture an image of the radiograph for subsequent digitization. The development of film digitizers that use a laser beam to scan the film represents a significant advancement in digital technology, resulting in improved image quality compared with video scanners. This paper discusses differences in resolution, efficiency, reliability, and the cost between these two types of devices. The results of a modified receiver operating characteristic comparison study of a video scanner and a laser scanner manufactured by the same company are also discussed

  13. Cognitive Hacking and Digital Government: Digital Identity

    Directory of Open Access Journals (Sweden)

    Paul Thompson

    2004-04-01

    Full Text Available Recently the National Center for Digital Government held a workshop on "The Virtual Citizen: Identity, Autonomy, and Accountability: A Civic Scenario Exploration of the Role of Identity in On-Line. Discussions at the workshop focused on five scenarios for future authentication policies with respect to digital identity. The underlying technologies considered for authentication were: biometrics: cryptography, with a focus on digital signatures; secure processing/computation; and reputation systems. Most discussion at the workshop focused on issues related to authentication of users of digital government, but, as implied by the inclusion of a scenario related to ubiquitous identity theft, there was also discussion of problems related to misinformation, including cognitive hacking. Cognitive hacking refers to a computer or information system attack that relies on changing human users' perceptions and corresponding behaviors in order to succeed. This paper describes cognitive hacking, suggests countermeasures, and discusses the implications of cognitive hacking for identity in digital government. In particular, spoofing of government websites and insider misuse are considered.

  14. Flower bud transcriptome analysis of Sapium sebiferum (Linn. Roxb. and primary investigation of drought induced flowering: pathway construction and G-quadruplex prediction based on transcriptome.

    Directory of Open Access Journals (Sweden)

    Minglei Yang

    Full Text Available Sapium sebiferum (Linn. Roxb. (Chinese Tallow Tree is a perennial woody tree and its seeds are rich in oil which hold great potential for biodiesel production. Despite a traditional woody oil plant, our understanding on S. sebiferum genetics and molecular biology remains scant. In this study, the first comprehensive transcriptome of S. sebiferum flower has been generated by sequencing and de novo assembly. A total of 149,342 unigenes were generated from raw reads, of which 24,289 unigenes were successfully matched to public database. A total of 61 MADS box genes and putative pathways involved in S. sebiferum flower development have been identified. Abiotic stress response network was also constructed in this work, where 2,686 unigenes are involved in the pathway. As for lipid biosynthesis, 161 unigenes have been identified in fatty acid (FA and triacylglycerol (TAG biosynthesis. Besides, the G-Quadruplexes in RNA of S. sebiferum also have been predicted. An interesting finding is that the stress-induced flowering was observed in S. sebiferum for the first time. According to the results of semi-quantitative PCR, expression tendencies of flowering-related genes, GA1, AP2 and CRY2, accorded with stress-related genes, such as GRX50435 and PRXⅡ39562. This transcriptome provides functional genomic information for further research of S. sebiferum, especially for the genetic engineering to shorten the juvenile period and improve yield by regulating flower development. It also offers a useful database for the research of other Euphorbiaceae family plants.

  15. A Role for the Fifth G-Track in G-Quadruplex Forming Oncogene Promoter Sequences during Oxidative Stress: Do These "Spare Tires" Have an Evolved Function?

    Science.gov (United States)

    Fleming, Aaron M; Zhou, Jia; Wallace, Susan S; Burrows, Cynthia J

    2015-08-26

    Uncontrolled inflammation or oxidative stress generates electron-deficient species that oxidize the genome increasing its instability in cancer. The G-quadruplex (G4) sequences regulating the c-MYC , KRAS , VEGF , BCL-2 , HIF-1α , and RET oncogenes, as examples, are targets for oxidation at loop and 5'-core guanines (G) as showcased in this study by CO 3 •- oxidation of the VEGF G4. Products observed include 8-oxo-7,8-dihydroguanine (OG), spiroiminodihydantoin (Sp), and 5-guanidinohydantoin (Gh). Our previous studies found that OG and Gh, when present in the four G-tracks of the solved structure for VEGF and c-MY C, were not substrates for the base excision repair (BER) DNA glycosylases in biologically relevant KCl solutions. We now hypothesize that a fifth G-track found a few nucleotides distant from the G4 tracks involved in folding can act as a "spare tire," facilitating extrusion of a damaged G-run into a large loop that then becomes a substrate for BER. Thermodynamic, spectroscopic, and DMS footprinting studies verified the fifth domain replacing a damaged G-track with OG or Gh at a loop or core position in the VEGF G4. These new "spare tire"-containing strands with Gh in loops are now found to be substrates for initiation of BER with the NEIL1, NEIL2, and NEIL3 DNA glycosylases. The results support a hypothesis in which regulatory G4s carry a "spare-tire" fifth G-track for aiding in the repair process when these sequences are damaged by radical oxygen species, a feature observed in a large number of these sequences. Furthermore, formation and repair of oxidized bases in promoter regions may constitute an additional example of epigenetic modification, in this case of guanine bases, to regulate gene expression in which the G4 sequences act as sensors of oxidative stress.

  16. Delineation of G-Quadruplex Alkylation Sites Mediated by 3,6-Bis(1-methyl-4-vinylpyridinium iodide)carbazole-Aniline Mustard Conjugates.

    Science.gov (United States)

    Chen, Chien-Han; Hu, Tsung-Hao; Huang, Tzu-Chiao; Chen, Ying-Lan; Chen, Yet-Ran; Cheng, Chien-Chung; Chen, Chao-Tsen

    2015-11-23

    A new G-quadruplex (G-4)-directing alkylating agent BMVC-C3M was designed and synthesized to integrate 3,6-bis(1-methyl-4-vinylpyridinium iodide)carbazole (BMVC) with aniline mustard. Various telomeric G-4 structures (hybrid-2 type and antiparallel) and an oncogene promoter, c-MYC (parallel), were constructed to react with BMVC-C3M, yielding 35 % alkylation yield toward G-4 DNA over other DNA categories (alkylation adducts by electrospray ionization mass spectroscopy (ESI-MS) revealed the stepwise DNA alkylation mechanism of aniline mustard for the first time. Furthermore, the monoalkylation sites and intrastrand cross-linking sites were determined and found to be dependent on G-4 topology based on the results of footprinting analysis in combination with mass spectroscopic techniques and in silico modeling. The results indicated that BMVC-C3M preferentially alkylated at A15 (H26), G12 (H24), and G2 (c-MYC), respectively, as monoalkylated adducts and formed A15-C3M-A21 (H26), G12-C3M-G4 (H24), and G2-C3M-G4/G17 (c-MYC), respectively, as cross-linked dialkylated adducts. Collectively, the stability and site-selective cross-linking capacity of BMVC-C3M provides a credible tool for the structural and functional characterization of G-4 DNAs in biological systems. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  17. Oligomer formation and G-quadruplex binding by purified murine Rif1 protein, a key organizer of higher-order chromatin architecture.

    Science.gov (United States)

    Moriyama, Kenji; Yoshizawa-Sugata, Naoko; Masai, Hisao

    2018-03-09

    Rap1-interacting protein 1 (Rif1) regulates telomere length in budding yeast. We previously reported that, in metazoans and fission yeast, Rif1 also plays pivotal roles in controlling genome-wide DNA replication timing. We proposed that Rif1 may assemble chromatin compartments that contain specific replication-timing domains by promoting chromatin loop formation. Rif1 also is involved in DNA lesion repair, restart after replication fork collapse, anti-apoptosis activities, replicative senescence, and transcriptional regulation. Although multiple physiological functions of Rif1 have been characterized, biochemical and structural information on mammalian Rif1 is limited, mainly because of difficulties in purifying the full-length protein. Here, we expressed and purified the 2418-amino-acid-long, full-length murine Rif1 as well as its partially truncated variants in human 293T cells. Hydrodynamic analyses indicated that Rif1 forms elongated or extended homo-oligomers in solution, consistent with the presence of a HEAT-type helical repeat segment known to adopt an elongated shape. We also observed that the purified murine Rif1 bound G-quadruplex (G4) DNA with high specificity and affinity, as was previously shown for Rif1 from fission yeast. Both the N-terminal (HEAT-repeat) and C-terminal segments were involved in oligomer formation and specifically bound G4 DNA, and the central intrinsically disordered polypeptide segment increased the affinity for G4. Of note, pulldown assays revealed that Rif1 simultaneously binds multiple G4 molecules. Our findings support a model in which Rif1 modulates chromatin loop structures through binding to multiple G4 assemblies and by holding chromatin fibers together. © 2018 by The American Society for Biochemistry and Molecular Biology, Inc.

  18. Characterizing and controlling intrinsic biases of lambda exonuclease in nascent strand sequencing reveals phasing between nucleosomes and G-quadruplex motifs around a subset of human replication origins.

    Science.gov (United States)

    Foulk, Michael S; Urban, John M; Casella, Cinzia; Gerbi, Susan A

    2015-05-01

    Nascent strand sequencing (NS-seq) is used to discover DNA replication origins genome-wide, allowing identification of features for their specification. NS-seq depends on the ability of lambda exonuclease (λ-exo) to efficiently digest parental DNA while leaving RNA-primer protected nascent strands intact. We used genomics and biochemical approaches to determine if λ-exo digests all parental DNA sequences equally. We report that λ-exo does not efficiently digest G-quadruplex (G4) structures in a plasmid. Moreover, λ-exo digestion of nonreplicating genomic DNA (LexoG0) enriches GC-rich DNA and G4 motifs genome-wide. We used LexoG0 data to control for nascent strand-independent λ-exo biases in NS-seq and validated this approach at the rDNA locus. The λ-exo-controlled NS-seq peaks are not GC-rich, and only 35.5% overlap with 6.8% of all G4s, suggesting that G4s are not general determinants for origin specification but may play a role for a subset. Interestingly, we observed a periodic spacing of G4 motifs and nucleosomes around the peak summits, suggesting that G4s may position nucleosomes at this subset of origins. Finally, we demonstrate that use of Na(+) instead of K(+) in the λ-exo digestion buffer reduced the effect of G4s on λ-exo digestion and discuss ways to increase both the sensitivity and specificity of NS-seq. © 2015 Foulk et al.; Published by Cold Spring Harbor Laboratory Press.

  19. Yeast Sub1 and human PC4 are G-quadruplex binding proteins that suppress genome instability at co-transcriptionally formed G4 DNA.

    Science.gov (United States)

    Lopez, Christopher R; Singh, Shivani; Hambarde, Shashank; Griffin, Wezley C; Gao, Jun; Chib, Shubeena; Yu, Yang; Ira, Grzegorz; Raney, Kevin D; Kim, Nayun

    2017-06-02

    G-quadruplex or G4 DNA is a non-B secondary DNA structure consisting of a stacked array of guanine-quartets that can disrupt critical cellular functions such as replication and transcription. When sequences that can adopt Non-B structures including G4 DNA are located within actively transcribed genes, the reshaping of DNA topology necessary for transcription process stimulates secondary structure-formation thereby amplifying the potential for genome instability. Using a reporter assay designed to study G4-induced recombination in the context of an actively transcribed locus in Saccharomyces cerevisiae, we tested whether co-transcriptional activator Sub1, recently identified as a G4-binding factor, contributes to genome maintenance at G4-forming sequences. Our data indicate that, upon Sub1-disruption, genome instability linked to co-transcriptionally formed G4 DNA in Top1-deficient cells is significantly augmented and that its highly conserved DNA binding domain or the human homolog PC4 is sufficient to suppress G4-associated genome instability. We also show that Sub1 interacts specifically with co-transcriptionally formed G4 DNA in vivo and that yeast cells become highly sensitivity to G4-stabilizing chemical ligands by the loss of Sub1. Finally, we demonstrate the physical and genetic interaction of Sub1 with the G4-resolving helicase Pif1, suggesting a possible mechanism by which Sub1 suppresses instability at G4 DNA. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.

  20. New techniques in digital holography

    CERN Document Server

    Picart, Pascal

    2015-01-01

    A state of the art presentation of important advances in the field of digital holography, detailing advances related to fundamentals of digital holography, in-line holography applied to fluid mechanics, digital color holography, digital holographic microscopy, infrared holography, special techniques in full field vibrometry and inverse problems in digital holography

  1. A new signal-on method for the detection of protein based on binding-induced strategy and photoinduced electron transfer between Ag nanoclusters and split G-quadruplex-hemin complexes

    Energy Technology Data Exchange (ETDEWEB)

    Zhang, Kai, E-mail: zhangkai@jsinm.org; Wang, Ke; Zhu, Xue; Xie, Minhao

    2015-08-05

    Proteins play important roles in biological and cellular processes. The levels of proteins can be useful biomarkers for cellular events or disease diagnosis, thus the method for sensitive and selective detection of proteins is imperative to proteins express, study, and clinical diagnosis. Herein, we report a “signal-on” platform for the assay of protein based on binding-induced strategy and photoinduced electron transfer between Ag nanoclusters and split G-quadruplex-hemin complexes. By using biotin as the affinity ligand, this simple protocol could sensitively detect streptavidin with a detection limit down to 10 pM. With the use of an antibody as the affinity ligand, a method for homogeneous fluorescence detection of Prostate Specific Antigen (PSA) was also proposed with a detection limit of 10 pM. The one-step and wash-free assay showed good selectivity. Its high sensitivity, acceptable accuracy, and satisfactory versatility of analytes led to various applications in bioanalysis. - Highlights: • AgNCs have great potential for application in biomedicine. • Binding of two affinity ligands can result in binding-induced DNA assemblies. • PET can be happened between DNA/AgNCs and G-quadruplex/hemin complexes. • A platform for the detection of proteins was proposed by using PET and binding-induced strategy.

  2. Digital temperature meter

    Energy Technology Data Exchange (ETDEWEB)

    Glowacki, S

    1982-01-01

    Digital temperature meter for precise temperature measurements is presented. Its parts such as thermostat, voltage-frequency converter and digital frequency meter are described. Its technical parameters such as temperature range 50degC-700degC, measurement precision 1degC, measurement error +-1degC are given. (A.S.).

  3. Changing State Digital Libraries

    Science.gov (United States)

    Pappas, Marjorie L.

    2006-01-01

    Research has shown that state virtual or digital libraries are evolving into websites that are loaded with free resources, subscription databases, and instructional tools. In this article, the author explores these evolving libraries based on the following questions: (1) How user-friendly are the state digital libraries?; (2) How do state digital…

  4. Digital signage sobre IP

    OpenAIRE

    Casademont Filella, Albert

    2012-01-01

    Projecte que versa sobre el disseny i la implementació d'un sistema de Digital Signage (Cartelleria Digital) sobre IP, creant un gestor que permeti controlar de forma remota tot un conjunt de petits dispositius connectats a pantalles que emeten continguts multimèdia com vídeos, imatges, feeds rss...

  5. Digital gaming expertise

    DEFF Research Database (Denmark)

    Toft-Nielsen, Claus

    In a digitally saturated environment digital media users of all kinds, engaged in different areas of activity, are increasingly categorized in terms of their ability to appropriate and use digital media – they are regarded as non-users, experts, natives, or literates for instance. Within communic......In a digitally saturated environment digital media users of all kinds, engaged in different areas of activity, are increasingly categorized in terms of their ability to appropriate and use digital media – they are regarded as non-users, experts, natives, or literates for instance. Within...... communication and game studies there are multiple understandings of how digital expertise is expressed and performed, and subsequently how these expressions and performances can be valued, understood and theorized within the research community. Among other things expertise with and within digital games has......-of-game (Schrøder, 2003) in a three-year-long study of men and women (couples and singles) playing the largest Massively Multiplayer Online Role-Playing Game to date, World of Warcraft. In focusing on how different aspects of gaming expertise are articulated, negotiated, and performed, I aim to illustrate how...

  6. The First Digit 1

    Indian Academy of Sciences (India)

    IAS Admin

    1075. RESONANCE | December 2013. GENERAL | ARTICLE. Table 2. The first digits distri- bution according to Benford's law. First Frequency. Digit. 1. 30.1 %. 2. 17.6 %. 3. 12.4 %. 4. 9.7 %. 5. 7.9 %. 6. 6.7 %. 7. 5.8 %. 8. 5.1 %. 9. 4.5 % ...

  7. Digital Cultural Heritage

    NARCIS (Netherlands)

    Navarrete, T.; Rizzo, I.; Mignosa, A.

    2013-01-01

    What is the impact of media technology on the supply and demand of heritage with what is usually described as digitization? This chapter presents the concept of digitization as concerning far more than just the introduction of computers, the development of databases and websites, and the conversion

  8. Digital formidling af kulturarv

    DEFF Research Database (Denmark)

    En af tidens store kulturelle dagsordner drejer sig om digital tilgængeliggørelse af kulturarv. Fortidens spor dukker op i nye former på nettet - næsten alle kulturinstitutioner arbejder med, og befolkningen har fået helt nye muligheder for at se med og deltage. Digital formidling af kulturarv...

  9. Digitizing migration heritage

    DEFF Research Database (Denmark)

    Marselis, Randi

    2011-01-01

    Museums are increasingly digitizing their collections and making them available to the public on-line. Creating such digital resources may become means for social inclusion. For museums that acknowledge migration history and cultures of ethnic minority groups as important subjects in multiethnic...

  10. Beyond Digital Citizenship

    Science.gov (United States)

    Mitchell, Lynn

    2016-01-01

    Conversations in middle school about digital citizenship tend to focus on the responsibilities of citizenship and the issues of surveillance, safety, cyberbullying, and internet etiquette. While these are important and essential conversations, digital citizenship education needs to consider youth political identity and democratic participation in…

  11. Navigate the Digital Rapids

    Science.gov (United States)

    Lindsay, Julie; Davis, Vicki

    2010-01-01

    How can teachers teach digital citizenship when the digital landscape is changing so rapidly? How can teachers teach proper online social interactions when the students are outside their classroom and thus outside their control? Will encouraging students to engage in global collaborative environments land teachers in hot water? These are the…

  12. Monetizing Digital Assets

    Directory of Open Access Journals (Sweden)

    Felician ALECU

    2013-04-01

    Full Text Available This article covers the options the digital content creators have to monetize their creations. The simplest solution seems to be the winning one, so by enabling the ads, the digital content may be quickly transformed into money with no cost.

  13. Digital chest radiography

    DEFF Research Database (Denmark)

    Debess, Jeanne Elisabeth; Johnsen, Karen Kirstine; Thomsen, Henrik

    on collimation and dose reduction in digital chest radiography Methods and Materials A retrospective study of digital chest radiography is performed to evaluate the primary x-ray tube collimation of the PA and lateral radiographs. Data from one hundred fifty self-reliant female patients between 15 and 55 years...

  14. Recurrent infantile digital fibromatosis

    African Journals Online (AJOL)

    We present a case of an 8-year-old-boy with recurrent infantile digital fibromatosis (IDF) who presented with new ... Keywords: fibrous tumors, inclusion body fibromatosis, infantile digital fibromatosis, spindle cells, Reye tumor .... watch-and-wait strategy for patients with histologically confirmed IDF nodules that do not cause ...

  15. Practical digital mammography

    Energy Technology Data Exchange (ETDEWEB)

    Hashimoto, Beverly E. [Washington Univ., Seattle, WA (United States)]|[Virginia Mason Medical Center, VA (United States)

    2008-07-01

    This book is meant for the radiologist who is facing the challenge of organizing a digital mammographic imaging center. This text is meant to be a practical book that provides information about digital mammographic physics and equipment which will allow one to intelligently compare technologies and systems. Some of the major challenges include: large expense; rapidly changing technology, and inconsistent connectivity; and finally, need for strong information technology support. The initial conversion cost to digital mammographic imaging is relatively expensive due to the cost of digital mammography hardware, software, and storage. Virtually all other imaging modalities are being converted to purely digital storage and transfer, and the digital trend in mammography is inevitable. Technical advantages of digital mammography are described. However, the improved flexibility in image display and transfer are some of its strongest features. In conclusion, although there are increasing imaging modalities that may be used to evaluate breast disease, mammography will continue to play a key role in detecting breast cancer. To be an effective imager, the radiologist should become familiar with digital mammography and understand its role within the increasing complex structure of breast imaging techniques.

  16. Practical digital mammography

    International Nuclear Information System (INIS)

    Hashimoto, Beverly E.

    2008-01-01

    This book is meant for the radiologist who is facing the challenge of organizing a digital mammographic imaging center. This text is meant to be a practical book that provides information about digital mammographic physics and equipment which will allow one to intelligently compare technologies and systems. Some of the major challenges include: large expense; rapidly changing technology, and inconsistent connectivity; and finally, need for strong information technology support. The initial conversion cost to digital mammographic imaging is relatively expensive due to the cost of digital mammography hardware, software, and storage. Virtually all other imaging modalities are being converted to purely digital storage and transfer, and the digital trend in mammography is inevitable. Technical advantages of digital mammography are described. However, the improved flexibility in image display and transfer are some of its strongest features. In conclusion, although there are increasing imaging modalities that may be used to evaluate breast disease, mammography will continue to play a key role in detecting breast cancer. To be an effective imager, the radiologist should become familiar with digital mammography and understand its role within the increasing complex structure of breast imaging techniques

  17. Educating Digital Citizens

    Science.gov (United States)

    Tan, Thomas

    2011-01-01

    Digital citizenship is how educators, citizens, and parents can teach where the lines of cyber safety and ethics are in the interconnected online world their students will inhabit. Aside from keeping technology users safe, digital citizenship also prepares students to survive and thrive in an environment embedded with information, communication,…

  18. Digital Rights Management

    NARCIS (Netherlands)

    Koster, P.; Jonker, Willem; Blanken, Henk; de Vries, A.P.; Blok, H.E.; Feng, L.

    2007-01-01

    Digital Rights Management, or DRM for short, is a much-discussed topic nowadays. The main reason for this is that DRM technology is often mentioned in the context of protection of digital audio and video content, for example to avoid large scale copying of CDs and DVDs via peer-to-peer networks in

  19. Digitalization of daycare institutions

    DEFF Research Database (Denmark)

    Chimirri, Niklas Alexander

    in the intergenerational interaction with as well as the intragenerational interaction among daycare children. To some extent, digital media usage, foremost of tablet computers, has seen a discursive and material normalization across a number Danish daycare institutions before at all clarifying how it could be rendered...... as on situated sociomaterial approaches to critical psychological practice research in order to inquire into possible specificities of digital media device usage: How is this usage similar to and different from interacting via other material-communicative devices in a pedagogical practice? How do digital media......The digitalization of Danish daycare institutions is not only affecting the ways staff is documenting and reporting on its pedagogical work. It also appears to be redefining what pedagogical work itself is about, given the drastic increase in deployment of digital (mobile) media devices...

  20. Creative Digital Media Practices

    DEFF Research Database (Denmark)

    Frølunde, Lisbeth

    , 2006, 2009), machinima (machine + cinema + anime, real-time animation captured in games etc.), and the digital storytelling movement. A dialogic perspective on the diversity of digital media practices opens up for understanding the complex evolution of language on socio-historical, cultural......The presentation reviews the interplay of dialogic (Bakhtin, 1981) and multimodal theories on media production practices, with attention to visual communication (Kress and van Leeuwen, 2001, 2006). This theoretical approach aids in reflecting on digital media practices as novel (new) sign systems...... develop a collaborative digital storytelling showcase for their own digital stories about Roskilde University. This course is intended to bring up reflections on the wider phenomenon of contemporary media practices, such as: YouTube, DIY (do-it-yourself) filmmaking or homemade, garage cinema (Jenkins...

  1. Digital Technology Entrepreneurship

    DEFF Research Database (Denmark)

    Giones, Ferran; Brem, Alexander

    2017-01-01

    Technology entrepreneurship is an established concept in academia. However, recent developments in the context of digital entrepreneurship call for revision and advance- ment. The multiple possible combinations of technology and entrepreneurship have res- ulted in a diversity of phenomena...... with significantly different characteristics and socio-economic impact. This article is focused on the identification and description of technology entrepreneurship in times of digitization. Based on current examples, we identify and describe characterizations of technology entrepreneurship, digital techno- logy...... entrepreneurship, and digital entrepreneurship. With this new delineation of terms, we would like to foster discussion between researchers, entrepreneurs, and policy makers on the impact of digitization on entrepreneurship, and set a future research agenda....

  2. Transformation of Digital Ecosystems

    DEFF Research Database (Denmark)

    Henningsson, Stefan; Hedman, Jonas

    2014-01-01

    the Digital Ecosystem Technology Transformation (DETT) framework for explaining technology-based transformation of digital ecosystems by integrating theories of business and technology ecosystems. The framework depicts ecosystem transformation as distributed and emergent from micro-, meso-, and macro- level......In digital ecosystems, the fusion relation between business and technology means that the decision of technical compatibility of the offering is also the decision of how to position the firm relative to the coopetive relations that characterize business ecosystems. In this article we develop...... coopetition. The DETT framework consists an alternative to the existing explanations of digital ecosystem transformation as the rational management of one central actor balancing ecosystem tensions. We illustrate the use of the framework by a case study of transformation in the digital payment ecosystem...

  3. The digital spine

    DEFF Research Database (Denmark)

    Ebbesen, Toke Riis

    2019-01-01

    In the words of the Oxford English Dictionary, a book is 'a portable volume consisting of a series of written, printed, or illustrated pages bound together for ease of reading' (‘book, n.’nd). Yet, the world of books isn’t what it used to be. If differences between media are material differences...... analyze books as digital or even 'post-digital' artifacts (Cramer 2014), while preserving the material dimension of the book artifact. In other words: is there is such a thing as a (post-)digital spine, and how can it be described? This article outlines an answer to this question within an inferential...... (Seiter 2015), and books are produced, distributed and read on various digital media and devices, it is no longer possible to understand digital books on the basis of the material and syntactical features of the codex artifact. It then becomes important to discuss how to conceptualize and subsequently...

  4. Digital Tectonic Tools

    DEFF Research Database (Denmark)

    Schmidt, Anne Marie Due

    2005-01-01

    Tectonics has been an inherent part of the architectural field since the Greek temples while the digital media is new to the field. This paper is built on the assumption that in the intermediate zone between the two there is a lot to be learned about architecture in general and the digital media...... in particular. A model of the aspects in the term tectonics – epresentation, ontology and culture – will be presented and used to discuss the current digital tools’ ability in tectonics. Furthermore it will be discussed what a digital tectonic tool is and could be and how a connection between the digital...... and tectonic could become a part of the architectural education....

  5. Digital forensic standards: international progress

    CSIR Research Space (South Africa)

    Grobler, MM

    2010-05-01

    Full Text Available With the explosion of digital crime, digital forensics is more often applied. The digital forensic discipline developed rather rapidly, but up to date very little international standardization with regard to processes, procedures or management has...

  6. Computing Logarithms Digit-by-Digit

    Science.gov (United States)

    Goldberg, Mayer

    2005-01-01

    In this work, we present an algorithm for computing logarithms of positive real numbers, that bears structural resemblance to the elementary school algorithm of long division. Using this algorithm, we can compute successive digits of a logarithm using a 4-operation pocket calculator. The algorithm makes no use of Taylor series or calculus, but…

  7. Principles of synchronous digital hierarchy

    CERN Document Server

    Jain, Rajesh Kumar

    2012-01-01

    The book presents the current standards of digital multiplexing, called synchronous digital hierarchy, including analog multiplexing technologies. It is aimed at telecommunication professionals who want to develop an understanding of digital multiplexing and synchronous digital hierarchy in particular and the functioning of practical telecommunication systems in general. The text includes all relevant fundamentals and provides a handy reference for problem solving or defining operations and maintenance strategies. The author covers digital conversion and TDM principles, line coding and digital

  8. Research on Digital Product Modeling Key Technologies of Digital Manufacturing

    Institute of Scientific and Technical Information of China (English)

    DING Guoping; ZHOU Zude; HU Yefa; ZHAO Liang

    2006-01-01

    With the globalization and diversification of the market and the rapid development of Information Technology (IT) and Artificial Intelligence (AI), the digital revolution of manufacturing is coming. One of the key technologies in digital manufacturing is product digital modeling. This paper firstly analyzes the information and features of the product digital model during each stage in the product whole lifecycle, then researches on the three critical technologies of digital modeling in digital manufacturing-product modeling, standard for the exchange of product model data and digital product data management. And the potential signification of the product digital model during the process of digital manufacturing is concluded-product digital model integrates primary features of each stage during the product whole lifecycle based on graphic features, applies STEP as data exchange mechanism, and establishes PDM system to manage the large amount, complicated and dynamic product data to implement the product digital model data exchange, sharing and integration.

  9. DSA in digital replantations

    International Nuclear Information System (INIS)

    Wang Liuhong; Chao Ming; Jiang Dingyao; Zhang Guangqiang; Wu Jianjun; Chen Xianyi; Li Bin; Sun Jihong

    2008-01-01

    Objective: To assess revascularization and vessel anastomosis in digital replantations with DSA. Methods: Twelve cases of digital replantations underwent digital subtract angiography during 2 to 4 days after fingers reattachment. The vessel anastomosis, hemodynamics, stenosis and discontinuation were investigated. The unobstructed and smooth anastomosis was suggested as early stage survival of the reattached fingers, the spasm and stenosis of the reattached vessels were considered as mild vascular crisis, and the discontinuation of hemodynamics were indicated as severe vascular crisis. Results: The total 27 vessels were clearly displayed on DSA. Of these vessels, 23 vessels were unobstructed and smooth, all digits were survived. Diagnosis coincidence of early stage survival was 100% (23/23). Two vessels were obstructed, which were testified having thrombus by operation research. The other 2 vessels were spasm, the digits were also survived ultimately by expectant treatment. All 4 abnormal vessel anatomosis were found by DSA. Conclusion: DSA is important modality in assessing revascularization and blood circulation for digital replantations, guiding in dealing with the vascular crisis, and in predicting early stage survival of the reattached digits. (authors)

  10. Digital mineral logging system

    International Nuclear Information System (INIS)

    West, J.B.

    1980-01-01

    A digital mineral logging system acquires data from a mineral logging tool passing through a borehole and transmits the data uphole to an electronic digital signal processor. A predetermined combination of sensors, including a deviometer, is located in a logging tool for the acquisition of the desired data as the logging tool is raised from the borehole. Sensor data in analog format is converted in the logging tool to a digital format and periodically batch transmitted to the surface at a predetermined sampling rate. An identification code is provided for each mineral logging tool, and the code is transmitted to the surface along with the sensor data. The self-identifying tool code is transmitted to the digital signal processor to identify the code against a stored list of the range of numbers assigned to that type of tool. The data is transmitted up the d-c power lines of the tool by a frequency shift key transmission technique. At the surface, a frequency shift key demodulation unit transmits the decoupled data to an asynchronous receiver interfaced to the electronic digital signal processor. During a recording phase, the signals from the logging tool are read by the electronic digital signal processor and stored for later processing. During a calculating phase, the stored data is processed by the digital signal processor and the results are outputted to a printer or plotter, or both

  11. Digital cardiovascular imaging

    International Nuclear Information System (INIS)

    Myerowitz, P.D.; Mistretta, C.A.; Shaw, C.-G.; Van Lysel, M.S.; Swanson, D.K.; Lasser, T.A.; Dhanani, S.P.; Zarnstorff, W.C.; Vander Ark, C.R.; Dobbins, J.T.; Peppler, W.W.; Crummy, A.B.

    1982-01-01

    The authors have previously reported on real time digital fluoroscopic subtraction techniques developed in the laboratory during the past 10 years. This paper outlines basic apparatus configuration and imaging modes used for preliminary studies involving visualization of the canine and human heart. All of the techniques involve the use of real time digital subtraction processing of data from an image intensified television fluoroscopy system. Based on the configuration of the digital processing equipment a number of different imaging modalities are possible. A brief description of the apparatus and these imaging modes is given. (Auth.)

  12. Digital Enlightenment Yearbook 2012

    CERN Document Server

    Bus, J; Hildebrandt, M

    2012-01-01

    There have been many inevitable transformations in society due to digitization - the introduction of digital technology, including communication technology, through the Internet and its use via the Web.This book is the first Yearbook of the Digital Enlightenment Forum. Whilst it cannot cover all the many aspects which the forum encompasses, the book gives an impression of the broad spectrum of the forum and a clear picture of the multi-disciplinary nature of the issues at stake.The first paper in the book is a contribution from the father of the Web, Sir Tim Berners-Lee, and Harry Halpin. They

  13. Fast transient digitizer

    International Nuclear Information System (INIS)

    Villa, F.

    1982-01-01

    Method and apparatus for sequentially scanning a plurality of target elements with an electron scanning beam modulated in accordance with variations in a high-frequency analog signal to provide discrete analog signal samples representative of successive portions of the analog signal; coupling the discrete analog signal samples from each of the target elements to a different one of a plurality of high speed storage devices; converting the discrete analog signal samples to equivalent digital signals; and storing the digital signals in a digital memory unit for subsequent measurement or display

  14. Digital Marketing Communication

    OpenAIRE

    Margherita Corniani

    2006-01-01

    Digital marketing communication is directed to profiled targets, which are active in the communication process. Every communication flow can ask for an information answer from the market. This opportunity grants immediate feed-backs and feed-forwards, so that digital communication can be easily and cheaply measured; digital communication flows are diffused at costs that are getting lower and lower, but it asks specialized and deep competences to communication managers. The ease in the flowing...

  15. plano de Marketing Digital

    OpenAIRE

    Bento, Daniel Jorge Cunha Correia

    2015-01-01

    O projeto aqui apresentado consiste no desenvolvimento de um plano estratégico de marketing digital para o projeto Laboratório de Criação Digital (LCDPorto). O LCDPorto tem sete anos de existência, sem nunca ter definido uma estratégia de comunicação. O principal objetivo passa por aprofundar os vários temas que integram Marketing Digital, e desenvolver um plano que permita ao LCDPorto ganhar mais notoriedade pelas atividades que desenvolve e, também, obter mais público para...

  16. Transitioning to digital radiography

    Energy Technology Data Exchange (ETDEWEB)

    Miranda, F., E-mail: Francisco.Miranda@pwc.ca [Pratt & Whitney Canada, Longueuil, Quebec (Canada)

    2015-09-15

    This article provides insight on the technical and business considerations necessary to implement or to transition to digital radiography Continued refinements in digital radiography technology have resulted in significant improvements in image quality and detectability of indications. These improvements have resulted in the acceptance of the technology by users and aerospace primes for final product inspection and disposition. Digital radiography has also been identified as an interesting cost reduction initiative with the potential of providing gains in productivity through increased throughput and decreased inspection lead-times and resulting costs. (author)

  17. The Digital Marmor Parium

    OpenAIRE

    Berti, Monica

    2017-01-01

    The Digital Marmor Parium is a project of the Alexander von Humboldt Chair of Digital Humanities at the University of Leipzig (http://www.dh.uni-leipzig.de/wo/dmp). The aim of this work is to produce a new digital edition of the so called Marmor Parium (Parian Marble), which is a Hellenistic chronicle on a marble slab coming from the Greek island of Paros. The importance of the document is due to the fact that it preserves a Greek chronology (1581/80-299/98 BC) with a list of kings and archon...

  18. SHDAS Production Digitizer Evaluation.

    Energy Technology Data Exchange (ETDEWEB)

    Merchant, Bion J. [Sandia National Lab. (SNL-NM), Albuquerque, NM (United States)

    2017-07-01

    The Seismo-Hydroacoustic Data Acquisition System (SHDAS) is undergoing evaluation in preparation for its engineering, development, and deployment by the U.S Navy as an ocean bottom seismic monitoring system. At the current stage of development, the production digitizers are being evaluated to confirm their performance prior to packaging and assembly for deployment. The testing of the digitizers is being conducted at Delta Group Electronics, the digitizer fabricator, in San Diego, California, performed by Sandia National Laboratories with the assistance of Leidos and Delta Group Electronics.

  19. Advanced Digital Preservation

    CERN Document Server

    Giaretta, David

    2011-01-01

    There is growing recognition of the need to address the fragility of digital information, on which our society heavily depends for smooth operation in all aspects of daily life. This has been discussed in many books and articles on digital preservation, so why is there a need for yet one more? Because, for the most part, those other publications focus on documents, images and webpages -- objects that are normally rendered to be simply displayed by software to a human viewer. Yet there are clearly many more types of digital objects that may need to be preserved, such as databases, scientific da

  20. Digitization in Maritime Industry

    DEFF Research Database (Denmark)

    Constantiou, Ioanna; Shollo, Arisa; Kreiner, Kristian

    2017-01-01

    Digitization in the maritime industry is expected to transform businesses. The recently introduced mobile technologies in inter-organizational processes is an example of digitization in an industry which moves very slowly towards digital transformation. We focus on the influence of mobile...... technologies on control practices in inter-organizational processes related to coping with an engine failure. We collected qualitative data from in depth interviews with representatives of the involved parties. We identify organizational and behavioural challenges hindering information sharing during problem...... technologies increase information sharing and thus the efficiency of inter-organizational processes when coping with an engine failure....

  1. Digital archives. Alcune note

    Directory of Open Access Journals (Sweden)

    Francesca Zanella

    2014-12-01

    Full Text Available MoRE is a digital native museum where projects of artworks are exposed, and also a digital archive where documents about art projectsare collected. MoRE is a multi-layered platform where artists, curators, art historians confront each other collecting art projects, organizing their documentation and defining tools for the communication and surveys on the public. In this paper some critical referencesare identified, that constitute a model for the project as they reflect on the impact of the digital dimension on the transformation of the museum and archive.

  2. Digital Library and Digital Reference Service: Integration and Mutual Complementarity

    Science.gov (United States)

    Liu, Jia

    2008-01-01

    Both the digital library and the digital reference service were invented and have been developed under the networked environment. Among their intersections, the fundamental thing is their symbiotic interest--serving the user in a more efficient way. The article starts by discussing the digital library and its service and the digital reference…

  3. Digital Literacy Learning in Higher Education through Digital Storytelling Approach

    Science.gov (United States)

    Chan, Banny S. K.; Churchill, Daniel; Chiu, Thomas K. F.

    2017-01-01

    It is necessary to develop digital literacy skills with which students can communicate and express their ideas effectively using digital media. The educational sectors around the world are beginning to incorporate digital literacy into the curriculum. Digital storytelling, one of the possible classroom activities, is an approach which may help…

  4. Digitization and digital archiving a practical guide for librarians

    CERN Document Server

    Leggett, Elizabeth R

    2014-01-01

    Modern library patrons are embracing the ease with which information can be accessed digitally, and so many librarians are currently working toward making information available electronically. Digitization and Digital Archiving: A Practical Guide for Librarians is a comprehensive guide with step-by-step instructions for forming digital archives.

  5. Digital Citizenship Means Character Education for the Digital Age

    Science.gov (United States)

    Ohler, Jason

    2012-01-01

    The reality of students' cyber lives has thrust upon educators a new approach: creating character education programs tuned to digital youth that are proactive and aggressive. This will help integrate students' digital activities within the context of the communities in which they live, both local and digital. The digital age beckons a new era of…

  6. Fast digitization and digital receiver technology

    International Nuclear Information System (INIS)

    Kimball, Ralph C.

    2002-01-01

    The potentially lucrative wireless market has led to technological advances in mixed signal devices such as high speed, high resolution A/D and D/A converters. This same market has also driven the development of high performance multi-channel digital receiver and digital transmitter ICs. Similarly, advances in semiconductor processes, coupled with the need for reduced time-to-market, has led to the development of large, enhanced performance, in-circuit programmable logic devices. A review of the key characteristics of these mixed-signal, signal processing and programmable logic devices is presented. The application of these devices and technologies to the instrumentation of Accelerators and Storage Rings is discussed and presented by way of examples. Issues relating to the requirements associated with real-time processing, I/O throughput, reconfigurability, reliability, maintainability and packaging requirements are also addressed

  7. Digital literacies at school. Students' digital profiles

    Directory of Open Access Journals (Sweden)

    Valentina Pennazio

    2013-04-01

    Full Text Available L’articolo presenta una ricerca volta a focalizzare le modalità in cui la Digital Literacy si traduce a scuola. Lo studio ha inteso sottolineare le molteplici dimensioni della Digital Literacy: Information Technology Literacy; Information Literacy; Visual Literacy e Media Literacy ed è stato effettuato nelle scuole primarie e secondarie di primo grado in Liguria. Sono state organizzate settimane di attività di ricerca, analisi e rielaborazione di informazioni, in classe e in rete, individualmente e in gruppo. Dalle autovalutazione degli studenti, svolte al termine di ogni attività, sono emersi i profili digitali che gli studenti tendono ad assumere quando utilizzano le tecnologie digitali. Tali profili possono essere utilizzati dagli insegnanti per progettare in maniera più mirata e significativa le attività con le tecnologie a scuola.

  8. When Forgetting Becomes Digital

    DEFF Research Database (Denmark)

    Marton, Attila; Kallinikos, Jannis

    The structure of social memory is in a process of significant change as social operations of forgetting and remembering are increasingly written in IT and mediated in digital media. Based on an in-depth case study about the digitalization of memory institutions (libraries, archives, museums......), the paper demonstrates the emergence of a digital social memory structure that stores data as a means of forgetting. Building on such a concept, we explain the shifting structure of social memory from pre-defined, taxonomic order to algorithmic computation of artefacts and ordering. Finally, we draw...... implications from our study with regards to core organizational concepts of institutions and platforms as well as broader categories of information infrastructures and a sociology of digital knowledge....

  9. TV Digital Station Transmitters

    Data.gov (United States)

    Department of Homeland Security — This file is an extract from the Consolidated Database System (CDBS) licensed by the Media Bureau. It consists of Digital Television broadcasters (see Rule Part47...

  10. Digital pulse shape discrimination

    International Nuclear Information System (INIS)

    Miller, L. F.; Preston, J.; Pozzi, S.; Flaska, M.; Neal, J.

    2007-01-01

    Pulse-shape discrimination (PSD) has been utilised for about 40 years as a method to obtain estimates for dose in mixed neutron and photon fields. Digitizers that operate close to GHz are currently available at a reasonable cost, and they can be used to directly sample signals from photomultiplier tubes. This permits one to perform digital PSD rather than the traditional, and well-established, analogous techniques. One issue that complicates PSD for neutrons in mixed fields is that the light output characteristics of typical scintillators available for PSD, such as BC501A, vary as a function of energy deposited in the detector. This behaviour is more easily accommodated with digital processing of signals than with analogous signal processing. Results illustrate the effectiveness of digital PSD. (authors)

  11. Comprehension of digital media

    International Nuclear Information System (INIS)

    Kim, Ju Hwan

    2008-11-01

    This book is divided four parts. The first part describes media and mark on sign and media, what is the sign?, interpretation of sign and semiotics. The second part is for production sign theory and origin of digital revolution such as the problem of origin of digital revolution, homogeneity of producing goods and sign : triple triangle model for production sign theory, triple triangle model for producing goods, triple triangle model of producing sign and triple triangle model of art works. The third parts deals with development of the media and meaning of digital revolution with four changes : invention of letter, appearance of printed media and establishment modernity, appearance electronic media and mess media and appearance of digital media. The last part mentions ontology of world wide web.

  12. Students’ digital learning environments

    DEFF Research Database (Denmark)

    Caviglia, Francesco; Dalsgaard, Christian; Davidsen, Jacob

    2018-01-01

    The objective of the paper is to examine the nature of students’ digital learning environments to understand the interplay of institutional systems and tools that are managed by the students themselves. The paper is based on a study of 128 students’ digital learning environments. The objectives...... used tools in the students’ digital learning environments are Facebook, Google Drive, tools for taking notes, and institutional systems. Additionally, the study shows that the tools meet some very basic demands of the students in relation to collaboration, communication, and feedback. Finally...... of the study are 1) to provide an overview of tools for students’ study activities, 2) to identify the most used and most important tools for students and 3) to discover which activities the tools are used for. The empirical study reveals that the students have a varied use of digital media. Some of the most...

  13. Digital Mammography Tomosynthesis

    International Nuclear Information System (INIS)

    Gergov, I.; Alexov, G.; Rusonov, K.

    2017-01-01

    Siemens MAMMOMAT Inspiration with Tomosynthesis enhances the diagnostic precision in mammographic screening. The apparatus has a wide-angle tomosynthesis up to 50 degrees. The Siemens breast augmentation algorithm reconstructs multiple two-dimensional breast images into three-dimensional images at the lowest doses to help detect tumors hidden from the overlapping chest tissue, allowing for a more accurate diagnosis than standard 2-dimensional digital mammography, and reducing the number of false positive results. 3D digital tomosynthesis improves the precision of detecting and diagnosing a larger number of expansive lesions, ensures better morphological mass analysis and architectural distortion, and detecting calcifications by adding digital breast tomosynthesis to the traditional two-dimensional digital mammogram of the patient. In this way, it solves the problem of overlapping parenchyma, reduces the number of unnecessary biopsies from questionable sonomammographic findings, and the need for stressful repeating procedures, which usually contributes to both better patient outcomes and cost saving. [bg

  14. Digital image processing

    National Research Council Canada - National Science Library

    Gonzalez, Rafael C; Woods, Richard E

    2008-01-01

    Completely self-contained-and heavily illustrated-this introduction to basic concepts and methodologies for digital image processing is written at a level that truly is suitable for seniors and first...

  15. Developing digital forensic governance

    CSIR Research Space (South Africa)

    Grobler, M

    2010-03-01

    Full Text Available This paper presents a Digital Forensic (DF) governance framework and its mapping on the SANS ISO/IEC 38500:2009 Corporate governance of information technology structure. DF governance assists organisations in guiding the management team...

  16. Academia Leads Digital Revolution

    Institute of Scientific and Technical Information of China (English)

    2006-01-01

    @@ As the Chinese book publishing industry sits nervously on the edqe of possible market economy led reforms, one key area to address will be its ability to come to terms with the onset of digital publishing.

  17. Students’ digital learning environments

    DEFF Research Database (Denmark)

    Caviglia, Francesco; Dalsgaard, Christian; Davidsen, Jacob

    2018-01-01

    of the study are 1) to provide an overview of tools for students’ study activities, 2) to identify the most used and most important tools for students and 3) to discover which activities the tools are used for. The empirical study reveals that the students have a varied use of digital media. Some of the most......, the study shows that most of the important tools are not related to the systems provided by the educational institutions. Based on the study, the paper concludes with a discussion of how institutional systems connect to the other tools in the students’ practices, and how we can qualify students’ digital......The objective of the paper is to examine the nature of students’ digital learning environments to understand the interplay of institutional systems and tools that are managed by the students themselves. The paper is based on a study of 128 students’ digital learning environments. The objectives...

  18. Digital radiology. Clinical experience

    Energy Technology Data Exchange (ETDEWEB)

    Stacul, F; Smathers, R L

    1985-01-01

    The authors report the experience achieved ad the Stanford University (USA) with a digital radiography system which allows the digitization of the film and of the images collected with photostimulable phophors. The phophor is essentially an intensifying screen where a latent image is stored after exposure to X-rays and is extracted by a laser scanning. The images collected with the digitized film and with the phophor (chest, breast, bone) have been analyzed. The digitized film offers potential diagnostic advantages over the conventional film, because of the contrast manipulation and many other processing options. The possibility to recover the information of overexposed films appears very attractive. The photostimulable phophors allow to get good quality images, with a consistent reduction of dose and costs. These plates offer the possibility, in the next future, to replace the conventional screen-film systems.

  19. Digital signature feasibility study

    Science.gov (United States)

    2008-06-01

    The purpose of this study was to assess the advantages and disadvantages of using digital signatures to assist the Arizona Department of Transportation in conducting business. The Department is evaluating the potential of performing more electronic t...

  20. Performing Digital Literature

    Directory of Open Access Journals (Sweden)

    Jerome Fletcher

    2015-11-01

    Full Text Available Digital literature is a complex assemblage of related elements –material, spatial, linguistic, performative, textual, cultural, social– each of which is at one time interdependent and detached. This article discusses the literary creation within the cyberculture from the performativity point of view in relation to the textual apparatus. This is done through the analysis of a selection of performances where physical corporeality has a collaborative function with the body to a greater or lesser degree. Therefore, this physical feature can not only change, but stand at three possible and hybridizable axes: 1 the digital text as protagonist, 2 the digital text as counterpart, and 3 the digital text as site.

  1. Comprehension of digital media

    Energy Technology Data Exchange (ETDEWEB)

    Kim, Ju Hwan

    2008-11-15

    This book is divided four parts. The first part describes media and mark on sign and media, what is the sign?, interpretation of sign and semiotics. The second part is for production sign theory and origin of digital revolution such as the problem of origin of digital revolution, homogeneity of producing goods and sign : triple triangle model for production sign theory, triple triangle model for producing goods, triple triangle model of producing sign and triple triangle model of art works. The third parts deals with development of the media and meaning of digital revolution with four changes : invention of letter, appearance of printed media and establishment modernity, appearance electronic media and mess media and appearance of digital media. The last part mentions ontology of world wide web.

  2. NLM Digital Collections

    Data.gov (United States)

    U.S. Department of Health & Human Services — The National Library of Medicine's (NLM) Digital Collections offers a search-based Web service that provides access to the Dublin Core metadata and full-text OCR of...

  3. Digital subtraction angiography

    International Nuclear Information System (INIS)

    Neuwirth, J. Jr.; Bohutova, J.

    1987-01-01

    The quality of radiodiagnostic methods to a great extent depends on the quality of the resulting image. The basic technical principles are summed up of the different parts of digital subtraction angiography apparatus and of methods of improving the image. The instrument is based on a videochain consisting of an X-ray tube, an intensifier of the radiographic image, optical parts, a video camera, an analog-to-digital converter and a computer. The main advantage of the digitally processed image is the possibility of optimizing the image into a form which will contain the biggest amount of diagnostically valuable information. Described are the mathematical operations for improving the digital image: spatial filtration, pixel shift, time filtration, image integration, time interval differentation and matched filtering. (M.D.). 8 refs., 3 figs

  4. Digital imaging primer

    CERN Document Server

    Parkin, Alan

    2016-01-01

    Digital Imaging targets everyyone with an interest in digital imaging, be they professional or private, who uses even quite modest equipment such as a PC, digital camera and scanner, a graphics editor such as Paint, and an inkjet printer. Uniquely, it is intended to fill the gap between highly technical texts for academics (with access to expensive equipment) and superficial introductions for amateurs. The four-part treatment spans theory, technology, programs and practice. Theory covers integer arithmetic, additive and subtractive color, greyscales, computational geometry, and a new presentation of discrete Fourier analysis; Technology considers bitmap file structures, scanners, digital cameras, graphic editors, and inkjet printers; Programs develops several processing tools for use in conjunction with a standard Paint graphics editor and supplementary processing tools; Practice discusses 1-bit, greyscale, 4-bit, 8-bit, and 24-bit images for the practice section. Relevant QBASIC code is supplied an accompa...

  5. Advanced digital optical communications

    CERN Document Server

    Binh, Le Nguyen

    2015-01-01

    This book provides a fundamental understanding of digital communication applications in optical communication technologies. Emphasizing operation principles versus mathematical analysis, the Second Edition includes new coverage of superchannel optical transmission systems, metropolitan and long-haul optical systems and networks, and Nyquist pulse shaping and high spectral efficiency of optical transmission systems, as well as new homework problems and examples. Featuring theoretical foundations as well as practical case studies, the text focuses on enhancements to digital technologies that are

  6. Digital Communication and Modulation

    DEFF Research Database (Denmark)

    Sørensen, John Aasted

    2010-01-01

    Fundamental principles in modern digital communication system like modems and wire- and wireless transmission over physical channels. Class room sessions and projects. Semester: Spring 2010 Extent: 7.5 ects Class size: 9......Fundamental principles in modern digital communication system like modems and wire- and wireless transmission over physical channels. Class room sessions and projects. Semester: Spring 2010 Extent: 7.5 ects Class size: 9...

  7. Digital Communication and Modulation

    DEFF Research Database (Denmark)

    Sørensen, John Aasted

    2010-01-01

    Fundamental principles in modern digital communication system like modems and wire- and wireless transmission over physical channels. Class room sessions and projects. Semester: Autumn 2010 Extent: 7.5 ects Class size: 18......Fundamental principles in modern digital communication system like modems and wire- and wireless transmission over physical channels. Class room sessions and projects. Semester: Autumn 2010 Extent: 7.5 ects Class size: 18...

  8. Strategies in digital marketing

    OpenAIRE

    Robert DRAGOMIR; Mihai ANDRONIE

    2017-01-01

    The present paper deals with digital marketing. The approach into discussion is the strategies met with the concept mentioned above. Within the actual socio-economic context, the electronic equipments offer on one hand new and innovative methods for products promoting and, on the other hand new challenges for the consumers. Thus, we analysed different and major types of strategies, which have a great impact on the digital marketing.

  9. Science & Technology Digital Library

    OpenAIRE

    Solodovnik, Iryna

    2014-01-01

    This document contains information on the activities carried out within the project Science & Technology Digital Library and in particular, it describes the Metadata Core Reference Model. Metadata are strategic for semantic interoperability to and, from the repository. Metadata are essential for available and safe management of digital objects, and for their sustainability and preservation. For these reasons, the project needs to define a specific metadata model. The purpose of this document ...

  10. Introduction of digital control

    International Nuclear Information System (INIS)

    Kim, Sang Jin

    1988-01-01

    This book is one of mechatronics series. It deals with digital control, which includes what is digital control?, display way of control system, output of primary system, secondary system like example of system and display way of the system, stabilizing of control system such as method to decide stability and system out of control, displaying equation of state into vector, good control such as the right characteristic, transient behavior and design of position control system using DC servo motor.

  11. Digital academia: How higher education is affected by digital technology

    OpenAIRE

    Eriksmo, Anton; Sundberg, Johan

    2016-01-01

    Digital technology in higher education is constantly evolving. Understanding the effects of digital technology is important for higher education institutions in order to make good investments of digital technology. Previous research has focused on learning, teaching or the organization and the relation between one of these aspects and digital technology, thereby missing a broader understanding of how materiality in digital technology affects higher education. In this study themed interviews w...

  12. Digital Inheritance in the Netherlands

    NARCIS (Netherlands)

    Berlee, A.

    2017-01-01

    Our accumulation of assets is increasingly digital. What happens to these digital assets upon our death? In this Country Report, the topic of a digital inheritance is discussed in the context of Dutch law. It includes general rules on succession and their application to digital assets, which

  13. The Coevolution of Digital Ecosystems

    Science.gov (United States)

    SungYong, Um

    2016-01-01

    Digital ecosystems are one of the most important strategic issues in the current digital economy. Digital ecosystems are dynamic and generative. They evolve as new firms join and as heterogeneous systems are integrated into other systems. These features digital ecosystems determine economic and technological success in the competition among…

  14. Digital tomosynthesis of the breast

    International Nuclear Information System (INIS)

    Barkhausen, Joerg; Rody, Achim; Schaefer, Fritz K.W.

    2015-01-01

    The digital tomosynthesis applies the digital image analysis and 3D technology for improves diagnostic uses. The text book on the digital tomosynthesis of the breast covers the following issues: technique of tomosynthesis, clinical significance of digital breast tomosynthesis, innovations and future developments, case studies.

  15. Digital and analog communication systems

    Science.gov (United States)

    Shanmugam, K. S.

    1979-01-01

    The book presents an introductory treatment of digital and analog communication systems with emphasis on digital systems. Attention is given to the following topics: systems and signal analysis, random signal theory, information and channel capacity, baseband data transmission, analog signal transmission, noise in analog communication systems, digital carrier modulation schemes, error control coding, and the digital transmission of analog signals.

  16. Digital imaging in health care

    International Nuclear Information System (INIS)

    1987-01-01

    This volume describes equipment for the generation and processing of digital images in medicine. Separate chapters deal with international trade i this equipment, with economic and social considerations of digital imaging, with experiences in the use and production of digital imaging equipment and with the current status and likely trends in applications of digital imaging. 84 refs, figs and tabs

  17. Future approaches to digital systems

    International Nuclear Information System (INIS)

    Woodrough, R.E.; Beckmann, E.; Jenkins, D.; Belcher, D.

    1984-01-01

    The introduction of the first digital imaging systems has led to the concept of a totally digital imaging department - the 'filmless department'. This concept and its associated network system for digital departments are briefly considered. A transducer system of scanned projection radiography with solid state detectors used in digital chest imaging is described. The principles of this transducer system are applicable to other forms of digital radiography. (U.K.)

  18. Film-screen digital radiography

    International Nuclear Information System (INIS)

    Schwenker, R.P.; Eger, H.

    1985-01-01

    The excellent performance of the digital film-screen system as a receptor for projection radiographic data is discussed. An experimental system for obtaining high quality digital radiographic data by laser scanning radiographic films is described. This system is being used to evaluate the clinical utility of various digital image processing algorithms. Future plans include an investigation of quantitative analysis of projection radiographic data. Digital data obtained by film scanning can be used with digital image archiving and communications systems. (author)

  19. Digital citizenship and neoliberalization: governing digital citizens in Denmark

    DEFF Research Database (Denmark)

    Schou, Jannick; Hjelholt, Morten

    2018-01-01

    Digital citizenship is becoming increasingly normalized within advanced democratic states. As society and governmental institutions become reliant on digital technologies, citizens are expected to be and act digitally. This article examines the governance of digital citizens through a case study...... this case study, the article contributes to current critical perspectives on the digital citizen as a new political figure. It adds new insights into digital citizenship by connecting this figure to wider processes of neoliberalization and state restructuring, pushing for a more pronounced focus...... of digitalization efforts in Denmark. Drawing on multiple forms of data, the article showcases how digital citizens are governed through a combination of discursive, legal and institutional means. The article highlights the political, but also institutional work that goes into making citizens digital. Providing...

  20. Digital Actuator Technology

    Energy Technology Data Exchange (ETDEWEB)

    Ken Thomas; Ted Quinn; Jerry Mauck; Richard Bockhorst

    2014-09-01

    There are significant developments underway in new types of actuators for power plant active components. Many of these make use of digital technology to provide a wide array of benefits in performance of the actuators and in reduced burden to maintain them. These new product offerings have gained considerable acceptance in use in process plants. In addition, they have been used in conventional power generation very successfully. This technology has been proven to deliver the benefits promised and substantiate the claims of improved performance. The nuclear industry has been reluctant to incorporate digital actuator technology into nuclear plant designs due to concerns due to a number of concerns. These could be summarized as cost, regulatory uncertainty, and a certain comfort factor with legacy analog technology. The replacement opportunity for these types of components represents a decision point for whether to invest in more modern technology that would provide superior operational and maintenance benefits. Yet, the application of digital technology has been problematic for the nuclear industry, due to qualification and regulatory issues. With some notable exceptions, the result has been a continuing reluctance to undertake the risks and uncertainties of implementing digital actuator technology when replacement opportunities present themselves. Rather, utilities would typically prefer to accept the performance limitations of the legacy analog actuator technologies to avoid impacts to project costs and schedules. The purpose of this report is to demonstrate that the benefits of digital actuator technology can be significant in terms of plant performance and that it is worthwhile to address the barriers currently holding back the widespread development and use of this technology. It addresses two important objectives in pursuit of the beneficial use of digital actuator technology for nuclear power plants: 1. To demonstrate the benefits of digital actuator

  1. Digital imaging in dentistry.

    Science.gov (United States)

    Essen, S Donovan

    2011-01-01

    Information technology is vital to operations, marketing, accounting, finance and administration. One of the most exciting and quickly evolving technologies in the modern dental office is digital applications. The dentist is often the business manager, information technology officer and strategic planning chief for his small business. The information systems triangle applies directly to this critical manager supported by properly trained ancillary staff and good equipment. With emerging technology driving all medical disciplines and the rapid pace at which it emerges, it is vital for the contemporary practitioner to keep abreast of the newest information technology developments. This article compares the strategic and operational advantages of digital applications, specifically imaging. The focus of this paper will be on digital radiography (DR), 3D computerized tomography, digital photography and digitally-driven CAD/CAM to what are now considered obsolescing modalities and contemplates what may arrive in the future. It is the purpose of this essay to succinctly evaluate the decisions involved in the role, application and implications of employing this tool in the dental environment

  2. Digital Information and Value

    Directory of Open Access Journals (Sweden)

    Paul Walton

    2015-11-01

    Full Text Available Digital information changes the ways in which people and organisations interact. This paper examines the nature of this change in the context of the author’s Model for Information (MfI. It investigates the relationship between outcomes and value, selection processes and some attributes of information and explores how this relationship changes in the move from analogue to digital information. Selection processes shape the evolution of information ecosystems in which conventions are established for the ways in which information is used. The conventions determine norms for information friction and information quality as well as the sources of information and channels used. Digital information reduces information friction, often dramatically, and changes information quality. The increasing use of analytics in business increasingly delivers predictive or prescriptive digital information. These changes are happening faster than information ecosystem conventions can change. The relationships established in the paper enable an analysis of, and guide changes to, these conventions enabling a more effective use of digital information.

  3. Dakwah di Era Digital

    Directory of Open Access Journals (Sweden)

    Wahyu Budiantoro

    2018-04-01

    Full Text Available These days dakwah is not only interpreted as transformation of a pure religious value, but also transformation of a more relevant value including many aspects in digital era. Digital era is when society succumbed into the flow of information causing cultural shock and difficulties on synthesizing meaning from those scattered information. Dakwah on Digital age must accommodate societal needs which tend to move into a mass society. It results in strategy and more humane and innovative dakwah methods. One of innovative dakwah methods is conducted dakwah activities through digital media,with the consequences of this is that da’i must developed soft skill and technological capabilities. Another beneficial comes from this is that dakwah could become more modern and practical in terms of methods and material. On the other hand, citizen Journalism as a mass cultural product and the results of technological development, gives an opportunity for da’i to able to record the entire activities, including the dynamics of islamic life. In terms of learning curriculum, dakwah in digital format must be included, so then the intellectual and cultural spirit which flourished in pesantren could be adapted and competed in a global world.

  4. Digital radiography in NDT applications

    International Nuclear Information System (INIS)

    Deprins, E.

    2004-01-01

    A lot of film radiography could be replaced by today's technologies in the field of digital radiography. Only few of these applications have indeed replaced film. The choice to go digital depends on cost, quality requirement, workflow and throughput. Digital images offer a lot of advantages in terms of image manipulation and workflow. But despite the many advantages, a lot of considerations are needed before someone can decide to convert his organization from conventional to digital radiography. This paper gives an overview of all different modalities that can be used in digital radiography with today's technologies, together with the experiences of the pioneers of digital radiography. Film Scanning, Computed Radiography and Digital Radiography by using of different kinds of flat panel detectors all have their specific application fields and customers. What is the status of the technology today, which advantages brings digital radiography, and which are the limitations radiographers have to consider when replacing film by digital systems. (author)

  5. CERN Courier goes digital

    CERN Multimedia

    Christine Sutton, CERN Courier editor

    2013-01-01

    The January/February 2013 issue of the CERN Courier offers a new way to access the content – the first digital edition of the magazine.   The CERN Courier dates back to August 1959, when the first issue appeared, consisting of 8 black-and-white pages. Since then it has seen many changes in design and layout, leading to the current full-colour editions of more than 50 pages on average. It went on the web for the first time in October 1998, when IOP Publishing took over the production work. Now, we have taken another step forward with a digital edition that provides yet another means to access the content beyond the web and print editions, which continue as before. To download the digital edition, click here. To sign up to the new issue alert, please visit: http://cerncourier.com/cws/sign-up.

  6. Precision digital control systems

    Science.gov (United States)

    Vyskub, V. G.; Rozov, B. S.; Savelev, V. I.

    This book is concerned with the characteristics of digital control systems of great accuracy. A classification of such systems is considered along with aspects of stabilization, programmable control applications, digital tracking systems and servomechanisms, and precision systems for the control of a scanning laser beam. Other topics explored are related to systems of proportional control, linear devices and methods for increasing precision, approaches for further decreasing the response time in the case of high-speed operation, possibilities for the implementation of a logical control law, and methods for the study of precision digital control systems. A description is presented of precision automatic control systems which make use of electronic computers, taking into account the existing possibilities for an employment of computers in automatic control systems, approaches and studies required for including a computer in such control systems, and an analysis of the structure of automatic control systems with computers. Attention is also given to functional blocks in the considered systems.

  7. Critical Digital Tourism Studies

    DEFF Research Database (Denmark)

    Gyimóthy, Szilvia; Munar, Ana María

    2013-01-01

    This paper advocates the need for a critical and cross-disciplinary research agenda on the field of digital technologies and tourism. The changing virtual landscape of tourism has received increased attention by tourism scholars. However, contemporary studies on information technologies (IT......) are approached mostly from a business administration perspective and informed by conceptual frameworks developed in management and marketing. IT studies in tourism are still at a stage similar to the first advocacy phase of tourism research in general (Jafari, 1990) and are seldom inspired by relevant...... to studying digital socio-technical systems and virtual mediation in tourism. Critical Digital Tourism Studies opens a new cross-disciplinary field where the sociality of virtual tourism interactions is examined (entailing the study of structures, social rules, ideologies, power relations, sustainability...

  8. Digital cinema video compression

    Science.gov (United States)

    Husak, Walter

    2003-05-01

    The Motion Picture Industry began a transition from film based distribution and projection to digital distribution and projection several years ago. Digital delivery and presentation offers the prospect to increase the quality of the theatrical experience for the audience, reduce distribution costs to the distributors, and create new business opportunities for the theater owners and the studios. Digital Cinema also presents an opportunity to provide increased flexibility and security of the movies for the content owners and the theater operators. Distribution of content via electronic means to theaters is unlike any of the traditional applications for video compression. The transition from film-based media to electronic media represents a paradigm shift in video compression techniques and applications that will be discussed in this paper.

  9. Digital Communication and Modulation

    DEFF Research Database (Denmark)

    Sørensen, John Aasted

    2011-01-01

    system. Having passed the course, the student will be able to accomplish the following, within the areas shown below: Model for Communication System. Prepare and explain the functional block in a digital communication system, corresponding to the specific course contents. Model for Communication Channel...... system.   Sessions in class with active participation by the students. The time will be divided between lectures and the students solving problems, including simulating digital communication building blocks in Matlab. Combines lectures and hands-on work. Semester: E2011 Extent: 7.5 ects......, the fundamental principles for modulation and detection in Gaussian noise is treated. This includes the principles for the determination of the bit-error rate for a digital communication system. During the course, a selection of small Matlab exercises are prepared, for simulation of parts of a communication...

  10. Digital Communication and Modulation

    DEFF Research Database (Denmark)

    Sørensen, John Aasted

    2011-01-01

    system. Having passed the course, the student will be able to accomplish the following, within the areas shown below: Model for Communication System. Prepare and explain the functional block in a digital communication system, corresponding to the specific course contents. Model for Communication Channel...... system. Sessions in class with active participation by the students. The time will be divided between lectures and the students solving problems, including simulating digital communication building blocks in Matlab. Combines lectures and hands-on work. Semester: F2011 Extent: 7.5 ects......, the fundamental principles for modulation and detection in Gaussian noise is treated. This includes the principles for the determination of the bit-error rate for a digital communication system. During the course, a selection of small Matlab exercises are prepared, for simulation of parts of a communication...

  11. Towards Digital Integration

    DEFF Research Database (Denmark)

    Schou, Finn

    2006-01-01

    In 1963, Ivan Sutherland at MIT in his doctoral dissertation, “Sketchpad” introduced a program that has hence been broadly acknowledged as a major step towards drawing digitally. 43 years later the majority of industrial designers within diverse businesses to a high degree still lean upon the use...... of the original “paper and pencil” tools and procedures for conceptual sketching of product style. Through presentation of literature studies and by case studies in the fashion business (eyewear design), this paper puts forward why the penetration of digital tools and methodologies for conceptual styling so far...... has been low. This paper advocates for a paradigm shift. The claim is that implementing digital tools and methodologies is a necessity in order to heighten concept generation productivity - and the outcome. For businesses seeking incremental as well as radical innovation there is no alternative....

  12. Digital Social Science Lab

    DEFF Research Database (Denmark)

    Svendsen, Michael; Lauersen, Christian Ulrich

    2015-01-01

    At the Faculty Library of Social Sciences (part of Copenhagen University Library) we are currently working intensely towards the establishment of a Digital Social Science Lab (DSSL). The purpose of the lab is to connect research, education and learning processes with the use of digital tools...... at the Faculty of Social Sciences. DSSL will host and facilitate an 80 m2 large mobile and intelligent study- and learning environment with a focus on academic events, teaching and collaboration. Besides the physical settings DSSL has two primary functions: 1. To implement relevant social scientific software...... and hardware at the disposal for students and staff at The Faculty of Social Sciences along with instruction and teaching in the different types of software, e.g. Stata, Nvivo, Atlas.ti, R Studio, Zotero and GIS-software. 2. To facilitate academic events focusing on use of digital tools and analytic software...

  13. 3D Digital Modelling

    DEFF Research Database (Denmark)

    Hundebøl, Jesper

    wave of new building information modelling tools demands further investigation, not least because of industry representatives' somewhat coarse parlance: Now the word is spreading -3D digital modelling is nothing less than a revolution, a shift of paradigm, a new alphabet... Research qeustions. Based...... on empirical probes (interviews, observations, written inscriptions) within the Danish construction industry this paper explores the organizational and managerial dynamics of 3D Digital Modelling. The paper intends to - Illustrate how the network of (non-)human actors engaged in the promotion (and arrest) of 3...... important to appreciate the analysis. Before turning to the presentation of preliminary findings and a discussion of 3D digital modelling, it begins, however, with an outline of industry specific ICT strategic issues. Paper type. Multi-site field study...

  14. Chronopolis Digital Preservation Network

    Directory of Open Access Journals (Sweden)

    David Minor

    2010-07-01

    Full Text Available The Chronopolis Digital Preservation Initiative, one of the Library of Congress’ latest efforts to collect and preserve at-risk digital information, has completed its first year of service as a multi-member partnership to meet the archival needs of a wide range of domains.Chronopolis is a digital preservation data grid framework developed by the San Diego Supercomputer Center (SDSC at UC San Diego, the UC San Diego Libraries (UCSDL, and their partners at the National Center for Atmospheric Research (NCAR in Colorado and the University of Maryland's Institute for Advanced Computer Studies (UMIACS.Chronopolis addresses a critical problem by providing a comprehensive model for the cyberinfrastructure of collection management, in which preserved intellectual capital is easily accessible, and research results, education material, and new knowledge can be incorporated smoothly over the long term. Integrating digital library, data grid, and persistent archive technologies, Chronopolis has created trusted environments that span academic institutions and research projects, with the goal of long-term digital preservation.A key goal of the Chronopolis project is to provide cross-domain collection sharing for long-term preservation. Using existing high-speed educational and research networks and mass-scale storage infrastructure investments, the partnership is leveraging the data storage capabilities at SDSC, NCAR, and UMIACS to provide a preservation data grid that emphasizes heterogeneous and highly redundant data storage systems.In this paper we will explore the major themes within Chronopolis, including:a The philosophy and theory behind a nationally federated data grid for preservation. b The core tools and technologies used in Chronopolis. c The metadata schema that is being developed within Chronopolis for all of the data elements. d Lessons learned from the first year of the project.e Next steps in digital preservation using Chronopolis: how we

  15. Artifacts in digital radiography

    Energy Technology Data Exchange (ETDEWEB)

    Min, Jung Whan [Dept. of Radiological Technology, Shin Gu University, Sungnam (Korea, Republic of); Kim, Jung Min [Dept. of Radiological Technology, Korea University, Seoul (Korea, Republic of); Jeong, Hoi Woun [Dept. of Radiological Technology, Beakseok Culture University, Cheonan (Korea, Republic of)

    2015-12-15

    Digital Radiography is a big part of diagnostic radiology. Because uncorrected digital radiography image supported false effect of Patient’s health care. We must be manage the correct digital radiography image. Thus, the artifact images can have effect to make a wrong diagnosis. We report types of occurrence by analyzing the artifacts that occurs in digital radiography system. We had collected the artifacts occurred in digital radiography system of general hospital from 2007 to 2014. The collected data had analyzed and then had categorize as the occurred causes. The artifacts could be categorized by hardware artifacts, software artifacts, operating errors, system artifacts, and others. Hardware artifact from a Ghost artifact that is caused by lag effect occurred most frequently. The others cases are the artifacts caused by RF noise and foreign body in equipments. Software artifacts are many different types of reasons. The uncorrected processing artifacts and the image processing error artifacts occurred most frequently. Exposure data recognize (EDR) error artifacts, the processing error of commissural line, and etc., the software artifacts were caused by various reasons. Operating artifacts were caused when the user did not have the full understanding of the digital medical image system. System artifacts had appeared the error due to DICOM header information and the compression algorithm. The obvious artifacts should be re-examined, and it could result in increasing the exposure dose of the patient. The unclear artifact leads to a wrong diagnosis and added examination. The ability to correctly determine artifact are required. We have to reduce the artifact occurrences by understanding its characteristic and providing sustainable education as well as the maintenance of the equipments.

  16. Artifacts in digital radiography

    International Nuclear Information System (INIS)

    Min, Jung Whan; Kim, Jung Min; Jeong, Hoi Woun

    2015-01-01

    Digital Radiography is a big part of diagnostic radiology. Because uncorrected digital radiography image supported false effect of Patient’s health care. We must be manage the correct digital radiography image. Thus, the artifact images can have effect to make a wrong diagnosis. We report types of occurrence by analyzing the artifacts that occurs in digital radiography system. We had collected the artifacts occurred in digital radiography system of general hospital from 2007 to 2014. The collected data had analyzed and then had categorize as the occurred causes. The artifacts could be categorized by hardware artifacts, software artifacts, operating errors, system artifacts, and others. Hardware artifact from a Ghost artifact that is caused by lag effect occurred most frequently. The others cases are the artifacts caused by RF noise and foreign body in equipments. Software artifacts are many different types of reasons. The uncorrected processing artifacts and the image processing error artifacts occurred most frequently. Exposure data recognize (EDR) error artifacts, the processing error of commissural line, and etc., the software artifacts were caused by various reasons. Operating artifacts were caused when the user did not have the full understanding of the digital medical image system. System artifacts had appeared the error due to DICOM header information and the compression algorithm. The obvious artifacts should be re-examined, and it could result in increasing the exposure dose of the patient. The unclear artifact leads to a wrong diagnosis and added examination. The ability to correctly determine artifact are required. We have to reduce the artifact occurrences by understanding its characteristic and providing sustainable education as well as the maintenance of the equipments

  17. Digital Receiver Phase Meter

    Science.gov (United States)

    Marcin, Martin; Abramovici, Alexander

    2008-01-01

    The software of a commercially available digital radio receiver has been modified to make the receiver function as a two-channel low-noise phase meter. This phase meter is a prototype in the continuing development of a phase meter for a system in which radiofrequency (RF) signals in the two channels would be outputs of a spaceborne heterodyne laser interferometer for detecting gravitational waves. The frequencies of the signals could include a common Doppler-shift component of as much as 15 MHz. The phase meter is required to measure the relative phases of the signals in the two channels at a sampling rate of 10 Hz at a root power spectral density measurements in laser metrology of moving bodies. To illustrate part of the principle of operation of the phase meter, the figure includes a simplified block diagram of a basic singlechannel digital receiver. The input RF signal is first fed to the input terminal of an analog-to-digital converter (ADC). To prevent aliasing errors in the ADC, the sampling rate must be at least twice the input signal frequency. The sampling rate of the ADC is governed by a sampling clock, which also drives a digital local oscillator (DLO), which is a direct digital frequency synthesizer. The DLO produces samples of sine and cosine signals at a programmed tuning frequency. The sine and cosine samples are mixed with (that is, multiplied by) the samples from the ADC, then low-pass filtered to obtain in-phase (I) and quadrature (Q) signal components. A digital signal processor (DSP) computes the ratio between the Q and I components, computes the phase of the RF signal (relative to that of the DLO signal) as the arctangent of this ratio, and then averages successive such phase values over a time interval specified by the user.

  18. Digital vascular imaging

    International Nuclear Information System (INIS)

    Ludwig, J.W.; Engels, B.C.H.

    1981-01-01

    Digitalizing videosignals from an image intensifying TV-chain, followed by subtraction, contrast intensifying, and reformation to analogous signal deliver angiography pictures of high quality after intravenous injection of the contrast medium. As the examination is only little invasive it can be carried out on outdoor patients or in the polyclinics. The possibilities of the digital vessel imagination (DVI) are shown at vessel images of different parts of the body; a 36 cm image intensifyer which can be switched to 3 different sorts of operation and has a plumbicon-TV recording tube is used as receiver. (orig.) [de

  19. Digital logic circuit test

    Energy Technology Data Exchange (ETDEWEB)

    Yun, Gil Jung; Yang, Hong Young

    2011-03-15

    This book is about digital logic circuit test, which lists the digital basic theory, basic gate like and, or And Not gate, NAND/NOR gate such as NAND gate, NOR gate, AND and OR, logic function, EX-OR gate, adder and subtractor, decoder and encoder, multiplexer, demultiplexer, flip-flop, counter such as up/down counter modulus N counter and Reset type counter, shift register, D/A and A/D converter and two supplements list of using components and TTL manual and CMOS manual.

  20. SERVICIO DE CONVERGENCIA DIGITAL

    OpenAIRE

    Lizzet Mirafuentes Garay

    2009-01-01

    El propósito del estudio fue analizar cuáles son las principales ventajas que proporciona el servicio de convergencia digital en los hoteles de la zona conurbada de Veracruz-Boca del Río. Para ello, se aplicaron 30 encuestas en hoteles que cuentan con un sistema de convergencia digital como sistema de comunicación y entretenimiento dentro de la zona conurbada Veracruz Boca del Río. El informante fue la persona de mayor jerarquía y que además se relacionara con la tecnología utilizada en el ho...

  1. Digital landscapes of imagination

    Directory of Open Access Journals (Sweden)

    Starlight Vattano

    2014-05-01

    Full Text Available Urban landscapes that exist in the expression of an imaginative sequence define their shape through the digital representation. These hyperreal dimensions, combine imagination and representation as constituents a new reality, which follows the utopian, suprematist and constructivist theories, where the two-dimensional dynamics is transformed into an infinite space in which the imagination creates new forms. Although interpretations of the urban landscape film, put in place a correspondence between reality and virtuality, into the modeling of spatial movements, from which do not arise contraries, but only interdependencies. It is a particular type of representation that takes shape via the digital in motion and provides new tools for urban representation.

  2. Digital breast tomosynthesis

    International Nuclear Information System (INIS)

    Haegele, Julian; Barkhausen, Joerg; Pursche, Telja; Schaefer, Fritz K.W.

    2015-01-01

    In digital breast tomosynthesis a digital tomographic data set with a very high spatial resolution is reconstructed from low-dose projections collected over a limited rotation angle. This allows a very detailed assessment of e. g. masses and architectural distortions. The average glandular dose is comparable to 2 D mammography. First clinical studies demonstrated that tomosynthesis is able to supply important additional information in suspicious mammographic findings. In comparison to projection mammography, tomosynthesis shows an at least comparable diagnostic accuracy. In everyday practice, tomosynthesis is currently mostly used for further evaluation of suspicious findings in mammography.

  3. Digital computers in action

    CERN Document Server

    Booth, A D

    1965-01-01

    Digital Computers in Action is an introduction to the basics of digital computers as well as their programming and various applications in fields such as mathematics, science, engineering, economics, medicine, and law. Other topics include engineering automation, process control, special purpose games-playing devices, machine translation and mechanized linguistics, and information retrieval. This book consists of 14 chapters and begins by discussing the history of computers, from the idea of performing complex arithmetical calculations to the emergence of a modern view of the structure of a ge

  4. Digital luminecence radiography

    International Nuclear Information System (INIS)

    Erlemann, R.; Adolph, J.M.G.; Reuther, G.; Wiesmann, W.; Fervers, J.; Vestring, T.; Roos, N.; Peters, P.E.

    1990-01-01

    This paper reports on the value of contrast post processing with DLR (2.5 lp/mm; gray-scale, 10 bit) evaluated in myelography (decision making depends more on image contrast than on spatial resolution). DLR was compared with conventional myelography by means of ROC methodology. Ninety-five conventional (CR), digital (DR), and edge- enhanced digital (EDR) myelographic images (49 disk herniations, 46 normal) were read independently by five board-certified radiologists with no clinical information. Findings were scored using a 5-point confidence-scale, and an ROC analysis was performed based on CT-myelography as the gold standard

  5. DAFX Digital Audio Effects

    CERN Document Server

    2011-01-01

    The rapid development in various fields of Digital Audio Effects, or DAFX, has led to new algorithms and this second edition of the popular book, DAFX: Digital Audio Effects has been updated throughout to reflect progress in the field. It maintains a unique approach to DAFX with a lecture-style introduction into the basics of effect processing. Each effect description begins with the presentation of the physical and acoustical phenomena, an explanation of the signal processing techniques to achieve the effect, followed by a discussion of musical applications and the control of effect parameter

  6. Digital audiovisual archives

    CERN Document Server

    Stockinger, Peter

    2013-01-01

    Today, huge quantities of digital audiovisual resources are already available - everywhere and at any time - through Web portals, online archives and libraries, and video blogs. One central question with respect to this huge amount of audiovisual data is how they can be used in specific (social, pedagogical, etc.) contexts and what are their potential interest for target groups (communities, professionals, students, researchers, etc.).This book examines the question of the (creative) exploitation of digital audiovisual archives from a theoretical, methodological, technical and practical

  7. Energy Efficient Digital Networks

    Energy Technology Data Exchange (ETDEWEB)

    Lanzisera, Steven [Lawrence Berkeley National Lab. (LBNL), Berkeley, CA (United States); Brown, Richard [Lawrence Berkeley National Lab. (LBNL), Berkeley, CA (United States)

    2013-01-01

    Digital networks are the foundation of the information services, and play an expanding and indispensable role in our lives, via the Internet, email, mobile phones, etc. However, these networks consume energy, both through the direct energy use of the network interfaces and equipment that comprise the network, and in the effect they have on the operating patterns of devices connected to the network. The purpose of this research was to investigate a variety of technology and policy issues related to the energy use caused by digital networks, and to further develop several energy-efficiency technologies targeted at networks.

  8. Digital signal processing

    CERN Document Server

    O'Shea, Peter; Hussain, Zahir M

    2011-01-01

    In three parts, this book contributes to the advancement of engineering education and that serves as a general reference on digital signal processing. Part I presents the basics of analog and digital signals and systems in the time and frequency domain. It covers the core topics: convolution, transforms, filters, and random signal analysis. It also treats important applications including signal detection in noise, radar range estimation for airborne targets, binary communication systems, channel estimation, banking and financial applications, and audio effects production. Part II considers sel

  9. Yucca Mountain digital database

    International Nuclear Information System (INIS)

    Daudt, C.R.; Hinze, W.J.

    1992-01-01

    This paper discusses the Yucca Mountain Digital Database (DDB) which is a digital, PC-based geographical database of geoscience-related characteristics of the proposed high-level waste (HLW) repository site of Yucca Mountain, Nevada. It was created to provide the US Nuclear Regulatory Commission's (NRC) Advisory Committee on Nuclear Waste (ACNW) and its staff with a visual perspective of geological, geophysical, and hydrological features at the Yucca Mountain site as discussed in the Department of Energy's (DOE) pre-licensing reports

  10. Applying corrections to digitized data while digitizing magnetic chart

    Digital Repository Service at National Institute of Oceanography (India)

    Suresh, T.

    data could be time consuming during online digitizing operation. Secondly, this could be more error prone if proper error detection and correction methods are not em- ployed. Here a simpler method is illustrated which has been used for digitizing...

  11. Digital Pulser for Characterization and Diagnostic of Digital Spectrometers

    International Nuclear Information System (INIS)

    Jordanov, V.T.

    2013-01-01

    The concept and the realization of the digital pulser are presented. The digital pulser is implemented as a functional block of a digital spectrometer. The digital pulser provides noise free and distortion free measurement of the inherent electronic noise of the entire spectroscopy system. The digital pulser is introduced at the end of the signal processing chain and allows separate evaluation of the individual spectroscopy blocks. It offers the ability to characterize and diagnose problems of the digital pulse height analysers by grounding their inputs. The digital pulser does not interfere with the processing of the detector signals and does not contribute to the dead time and the pulse pile-up of the system. The digital pulser peaks are not affected by the presence of detector pulses and are stored in a separate histogram memory leaving the detector spectrum undistorted. (author)

  12. Topographic Digital Raster Graphics - USGS DIGITAL RASTER GRAPHICS

    Data.gov (United States)

    NSGIC Local Govt | GIS Inventory — USGS Topographic Digital Raster Graphics downloaded from LABINS (http://data.labins.org/2003/MappingData/drg/drg_stpl83.cfm). A digital raster graphic (DRG) is a...

  13. Digital Tourism on the Way to Digital Marketing Success

    OpenAIRE

    RATIU, Monica Paula; PURCAREA, Ioan Matei

    2015-01-01

    There is a real need of digital support of the tourist experience before, during and after the tourist activity, because digitization is steadily becoming the main pathway for consumer journeys. The digital revolution changed the way consumers shop for travel products and interact with brands. Tourism businesses need to utilize digital marketing techniques in their practices and to right track consumer activity across channels and devices. Getting vital information from customers via social m...

  14. Materialising digital collecting: An extended view of digital materiality

    OpenAIRE

    Mardon, Rebecca; Belk, Russell

    2018-01-01

    If digital objects are abundant and ubiquitous, why should consumers pay for, much less collect them? The qualities of digital code present numerous challenges for collecting, yet digital collecting can and does occur. We explore the role of companies in constructing digital consumption objects that encourage and support collecting behaviours, identifying material configuration techniques that materialise these objects as elusive and authentic. Such techniques, we argue, may facilitate those ...

  15. PERSEPSI GURU TENTANG DIGITAL NATIVES, SUMBER BELAJAR DIGITAL DAN MOTIVASI MEMANFAATKAN SUMBER BELAJAR DIGITAL

    Directory of Open Access Journals (Sweden)

    Ferdinandus Bate Dopo

    2016-06-01

    TEACHER’S PERCEPTION OF DIGITAL NATIVES, DIGITAL LEARNING RESOURCES AND MOTIVATION TO UTILIZE DIGITAL LEARNING RESOURCES Abstract This study aims to reveal (1 the influence of teacher's perception of digital natives toward teacher’s motivation to utilize digital learning resources. (2 the influence of teacher's perception of digital learning resources toward teacher’s motivation to utilize digital learning resources and (3 the influence both of teacher's perception of digital natives and digital learning resources toward teacher’s motivation to utilize digital learning resources. This study used the descriptive-correlational quantitative approach. The Population and sample were high school teachers of Regina Pacis Bajawa, SMA Seminari Mataloko and SMA Negeri 1 Golewa. Sampling technique in this research was proportional random sampling. A questionnaire was used to obtain the data. The data were analyzed using the Likert scale. The instrument was developed based on lattice theory of assessment instruments relevant to the study variables. The analysis technique used is a regression followed by statistic technique of t test and F test with the significance level of 0.05. The results are as follows. (1 There is a positive and significant influence of teacher's perception of digital natives toward teacher’s motivation to utilize digital learning resources. (2 There is a positive and significant influence of teacher's perception of digital learning resources and teacher’s motivation to utilize digital learning resources. (3 There is a positive and significant influence both of teacher's perception of digital learning resources and teacher’s motivation to utilize digital learning resources. Keywords: perception, digital natives, digital learning resources, motivation

  16. Digital Level Layers for Digital Curve Decomposition and Vectorization

    Directory of Open Access Journals (Sweden)

    Laurent Provot

    2014-07-01

    Full Text Available The purpose of this paper is to present Digital Level Layers and show the motivations for working with such analytical primitives in the framework of Digital Geometry. We first compare their properties to morphological and topological counterparts, and then we explain how to recognize them and use them to decompose or vectorize digital curves and contours.

  17. Digital Preservation in Open-Source Digital Library Software

    Science.gov (United States)

    Madalli, Devika P.; Barve, Sunita; Amin, Saiful

    2012-01-01

    Digital archives and digital library projects are being initiated all over the world for materials of different formats and domains. To organize, store, and retrieve digital content, many libraries as well as archiving centers are using either proprietary or open-source software. While it is accepted that print media can survive for centuries with…

  18. Digital Natives and Digital Immigrants: Teaching with Technology

    Science.gov (United States)

    Martin, Ellen Marie Peterson

    2011-01-01

    Education is witnessing an increasing demand for technology use in the classroom. At the same time, new teachers are entering the profession in high numbers, some being labeled as "Digital Natives" while others are labeled "Digital Immigrants". This qualitative case study investigated the technology practices of Digital Native and Digital…

  19. Digital Downsides: Exploring University Students' Negative Engagements with Digital Technology

    Science.gov (United States)

    Selwyn, Neil

    2016-01-01

    Digital technologies are now an integral feature of university study. As such, academic research has tended to concentrate on the potential of digital technologies to support, extend and even "enhance" student learning. This paper, in contrast, explores the rather more messy realities of students' engagements with digital technology. In…

  20. Central Dogma Goes Digital.

    Science.gov (United States)

    Lin, Yihan; Elowitz, Michael B

    2016-03-17

    In this issue of Molecular Cell, Tay and colleagues (Albayrak et al., 2016) describe a new technique to digitally quantify the numbers of protein and mRNA in the same mammalian cell, providing a new way to look at the central dogma of molecular biology. Copyright © 2016 Elsevier Inc. All rights reserved.