Extended representations of observables and states for a noncontextual reinterpretation of QM

International Nuclear Information System (INIS)

Garola, Claudio; Sozzo, Sandro

2012-01-01

A crucial and problematical feature of quantum mechanics (QM) is nonobjectivity of properties. The ESR model restores objectivity reinterpreting quantum probabilities as conditional on detection and embodying the mathematical formalism of QM into a broader noncontextual (hence local) framework. We propose here an improved presentation of the ESR model containing a more complete mathematical representation of the basic entities of the model. We also extend the model to mixtures showing that the mathematical representations of proper mixtures do not coincide with the mathematical representation of mixtures provided by QM, while the representation of improper mixtures does. This feature of the ESR model entails that some interpretative problems raising in QM when dealing with mixtures are avoided. From an empirical point of view, the predictions of the ESR model depend on some parameters which may be such that they are very close to the predictions of QM in most cases. But the nonstandard representation of proper mixtures allows us to propose the scheme of an experiment that could check whether the predictions of QM or the predictions of the ESR model are correct. (paper)

QM Automata: A New Class of Restricted Quantum Membrane Automata.

Science.gov (United States)

Giannakis, Konstantinos; Singh, Alexandros; Kastampolidou, Kalliopi; Papalitsas, Christos; Andronikos, Theodore

2017-01-01

The term "Unconventional Computing" describes the use of non-standard methods and models in computing. It is a recently established field, with many interesting and promising results. In this work we combine notions from quantum computing with aspects of membrane computing to define what we call QM automata. Specifically, we introduce a variant of quantum membrane automata that operate in accordance with the principles of quantum computing. We explore the functionality and capabilities of the QM automata through indicative examples. Finally we suggest future directions for research on QM automata.

Extracting dimer structures from simulations of organic-based materials using QM/MM methods

Energy Technology Data Exchange (ETDEWEB)

Pérez-Jiménez, A.J., E-mail: aj.perez@ua.es; Sancho-García, J.C., E-mail: jc.sancho@ua.es

2015-09-28

Highlights: • DFT geometries of isolated dimers in organic crystals differ from experimental ones. • This can be corrected using QM/MM geometry optimizations. • The QM = B3LYP–D3(ZD)/cc-pVDZ and MM = GAFF combination works reasonably well. - Abstract: The functionality of weakly bound organic materials, either in Nanoelectronics or in Materials Science, is known to be strongly affected by their morphology. Theoretical predictions of the underlying structure–property relationships are frequently based on calculations performed on isolated dimers, but the optimized structure of the latter may significantly differ from experimental data even when dispersion-corrected methods are used for it. Here, we address this problem on two organic crystals, namely coronene and 5,6,11,12-tetrachlorotetracene, concluding that it is caused by the absence of the surrounding monomers present in the crystal, and that it can be efficiently cured when the dimer is embedded into a general Quantum Mechanics/Molecular Mechanics (QM/MM) geometry optimization scheme. We also investigate how the size of the MM region affects the results. These findings may be helpful for the simulation of the morphology of active materials in crystalline or glassy samples.

On the problem of completeness of QM: von Neumann against Einstein, Podolsky, and Rosen

OpenAIRE

Khrennikov, Andrei

2008-01-01

We performed a comparative analysis of the arguments of Einstein, Podolsky and Rosen -- EPR, 1935 (against the completeness of QM) and the theoretical formalism of QM (due to von Neumann, 1932). We found that the EPR considerations do not match at all with the von Neumann's theory. Thus EPR did not criticize the real theoretical model of QM. The root of EPR's paradoxical conclusion on incompleteness of QM is the misuse of von Neumann's projection postulate. EPR applied this postulate to obser...

Solvent Boundary Potentials for Hybrid QM/MM Computations Using Classical Drude Oscillators: A Fully Polarizable Model.

Science.gov (United States)

Boulanger, Eliot; Thiel, Walter

2012-11-13

Accurate quantum mechanical/molecular mechanical (QM/MM) treatments should account for MM polarization and properly include long-range electrostatic interactions. We report on a development that covers both these aspects. Our approach combines the classical Drude oscillator (DO) model for the electronic polarizability of the MM atoms with the generalized solvent boundary Potential (GSBP) and the solvated macromolecule boundary potential (SMBP). These boundary potentials (BP) are designed to capture the long-range effects of the outer region of a large system on its interior. They employ a finite difference approximation to the Poisson-Boltzmann equation for computing electrostatic interactions and take into account outer-region bulk solvent through a polarizable dielectric continuum (PDC). This approach thus leads to fully polarizable three-layer QM/MM-DO/BP methods. As the mutual responses of each of the subsystems have to be taken into account, we propose efficient schemes to converge the polarization of each layer simultaneously. For molecular dynamics (MD) simulations using GSBP, this is achieved by considering the MM polarizable model as a dynamical degree of freedom, and hence contributions from the boundary potential can be evaluated for a frozen state of polarization at every time step. For geometry optimizations using SMBP, we propose a dual self-consistent field approach for relaxing the Drude oscillators to their ideal positions and converging the QM wave function with the proper boundary potential. The chosen coupling schemes are evaluated with a test system consisting of a glycine molecule in a water ball. Both boundary potentials are capable of properly reproducing the gradients at the inner-region atoms and the Drude oscillators. We show that the effect of the Drude oscillators must be included in all terms of the boundary potentials to obtain accurate results and that the use of a high dielectric constant for the PDC does not lead to a polarization

Accelerator complex for a radioactive ion beam facility at ATLAS

International Nuclear Information System (INIS)

Nolen, J.A.

1995-01-01

Since the superconducting heavy ion linac ATLAS is an ideal post-accelerator for radioactive beams, plans are being developed for expansion of the facility with the addition of a driver accelerator, a production target/ion source combination, and a low q/m pre-accelerator for radioactive ions. A working group including staff from the ANL Physics Division and current ATLAS users are preparing a radioactive beam facility proposal. The present paper reviews the specifications of the accelerators required for the facility

Analysis of Peer Review Comments: QM Recommendations and Feedback Intervention Theory

Science.gov (United States)

Schwegler, Andria F.; Altman, Barbara W.

2015-01-01

Because feedback is a critical component of the continuous improvement cycle of the Quality Matters (QM) peer review process, the present research analyzed the feedback that peer reviewers provided to course developers after a voluntary, nonofficial QM peer review of online courses. Previous research reveals that the effects of feedback on…

Development and application of QM/MM methods to study the solvation effects and surfaces

Energy Technology Data Exchange (ETDEWEB)

Dibya, Pooja Arora [Iowa State Univ., Ames, IA (United States)

2010-01-01

Quantum mechanical (QM) calculations have the advantage of attaining high-level accuracy, however QM calculations become computationally inefficient as the size of the system grows. Solving complex molecular problems on large systems and ensembles by using quantum mechanics still poses a challenge in terms of the computational cost. Methods that are based on classical mechanics are an inexpensive alternative, but they lack accuracy. A good trade off between accuracy and efficiency is achieved by combining QM methods with molecular mechanics (MM) methods to use the robustness of the QM methods in terms of accuracy and the MM methods to minimize the computational cost. Two types of QM combined with MM (QM/MM) methods are the main focus of the present dissertation: the application and development of QM/MM methods for solvation studies and reactions on the Si(100) surface. The solvation studies were performed using a discreet solvation model that is largely based on first principles called the effective fragment potential method (EFP). The main idea of combining the EFP method with quantum mechanics is to accurately treat the solute-solvent and solvent-solvent interactions, such as electrostatic, polarization, dispersion and charge transfer, that are important in correctly calculating solvent effects on systems of interest. A second QM/MM method called SIMOMM (surface integrated molecular orbital molecular mechanics) is a hybrid QM/MM embedded cluster model that mimics the real surface.3 This method was employed to calculate the potential energy surfaces for reactions of atomic O on the Si(100) surface. The hybrid QM/MM method is a computationally inexpensive approach for studying reactions on larger surfaces in a reasonably accurate and efficient manner. This thesis is comprised of four chapters: Chapter 1 describes the general overview and motivation of the dissertation and gives a broad background of the computational methods that have been employed in this work

Advances in quantum and molecular mechanical (QM/MM) simulations for organic and enzymatic reactions.

Science.gov (United States)

Acevedo, Orlando; Jorgensen, William L

2010-01-19

Application of combined quantum and molecular mechanical (QM/MM) methods focuses on predicting activation barriers and the structures of stationary points for organic and enzymatic reactions. Characterization of the factors that stabilize transition structures in solution and in enzyme active sites provides a basis for design and optimization of catalysts. Continued technological advances allowed for expansion from prototypical cases to mechanistic studies featuring detailed enzyme and condensed-phase environments with full integration of the QM calculations and configurational sampling. This required improved algorithms featuring fast QM methods, advances in computing changes in free energies including free-energy perturbation (FEP) calculations, and enhanced configurational sampling. In particular, the present Account highlights development of the PDDG/PM3 semi-empirical QM method, computation of multi-dimensional potentials of mean force (PMF), incorporation of on-the-fly QM in Monte Carlo (MC) simulations, and a polynomial quadrature method for efficient modeling of proton-transfer reactions. The utility of this QM/MM/MC/FEP methodology is illustrated for a variety of organic reactions including substitution, decarboxylation, elimination, and pericyclic reactions. A comparison to experimental kinetic results on medium effects has verified the accuracy of the QM/MM approach in the full range of solvents from hydrocarbons to water to ionic liquids. Corresponding results from ab initio and density functional theory (DFT) methods with continuum-based treatments of solvation reveal deficiencies, particularly for protic solvents. Also summarized in this Account are three specific QM/MM applications to biomolecular systems: (1) a recent study that clarified the mechanism for the reaction of 2-pyrone derivatives catalyzed by macrophomate synthase as a tandem Michael-aldol sequence rather than a Diels-Alder reaction, (2) elucidation of the mechanism of action of fatty

Density-Dependent Formulation of Dispersion-Repulsion Interactions in Hybrid Multiscale Quantum/Molecular Mechanics (QM/MM) Models

DEFF Research Database (Denmark)

Curutchet, Carles; Cupellini, Lorenzo; Kongsted, Jacob

2018-01-01

embedding approaches, respectively, nonelectrostatic dispersion and repulsion interactions are instead commonly described through classical potentials despite their quantum mechanical origin. Here we present an extension of the Tkatchenko-Scheffler semiempirical van der Waals (vdWTS) scheme aimed......Mixed multiscale quantum/molecular mechanics (QM/MM) models are widely used to explore the structure, reactivity, and electronic properties of complex chemical systems. Whereas such models typically include electrostatics and potentially polarization in so-called electrostatic and polarizable...... at describing dispersion and repulsion interactions between quantum and classical regions within a QM/MM polarizable embedding framework. Starting from the vdWTSexpression, we define a dispersion and a repulsion term, both of them density-dependent and consistently based on a Lennard-Jones-like potential. We...

Grid-Based Projector Augmented Wave (GPAW) Implementation of Quantum Mechanics/Molecular Mechanics (QM/MM) Electrostatic Embedding and Application to a Solvated Diplatinum Complex

DEFF Research Database (Denmark)

Dohn, A. O.; Jónsson, E. Ö.; Levi, Gianluca

2017-01-01

A multiscale density functional theory-quantum mechanics/molecular mechanics (DFT-QM/MM) scheme is presented, based on an efficient electrostatic coupling between the electronic density obtained from a grid-based projector augmented wave (GPAW) implementation of density functional theory...... and a classical potential energy function. The scheme is implemented in a general fashion and can be used with various choices for the descriptions of the QM or MM regions. Tests on H2O clusters, ranging from dimer to decamer show that no systematic energy errors are introduced by the coupling that exceeds...

Common QA/QM Criteria for Multinational Vendor Inspection

International Nuclear Information System (INIS)

2014-01-01

This VICWG document provides the 'Common QA/QM Criteria' which will be used in Multinational Vendor Inspection. The 'Common QA/QM Criteria' provides the basic consideration when performing the Vendor Inspection. These criteria has been developed in conformity with International Codes and Standards such as IAEA, ISO and so on that MDEP member countries adopted. The purpose of the VICWG is to establish areas of co-operation in the Vendor Inspection practices among MDEP member countries as described in the MDEP issue-specific Terms of Reference (ToR). As part of this, from the beginning, a survey was performed to understand and to identify areas of commonality and differences between regulatory practices of member countries in the area of vendor inspection. The VICWG also collaborated by performing Witnessed Inspections and Joint Inspections. Through these activities, it was recognized that member countries commonly apply the IAEA safety standard (GS-R-3) to the vendor inspection criteria, and almost ail European member countries apply the ISO standard (ISO9001). In the US, the NRC regulatory requirement in 10 CFR, Part 50, Appendix B is used. South Korea uses the same criteria as in the US. As a result of the information obtained, a comparison table between codes and standards (IAEAGS-R-3, ISO 9001:2008.10CFR50 Appendix Band ASME NQA-1) has been developed in order to inform the development of 'Common QA/QM Criteria'. The result is documented in Table 1, 'MDEP CORE QA/QM Requirement and Comparison between Codes and Standards'. In addition, each country's criteria were compared with the US 10CFR50 Appendix B as a template. Table 2 shows VICWG Survey on Quality Assurance Program Requirements. Through these activities above, we considered that the core requirements should be consistent with both IAEA safety standard and ISO standard, and considered that the common requirements in the US 10CFR50 Appendix B used to the survey

Generation of auroral kilometric radiation and the structure of auroral acceleration region

International Nuclear Information System (INIS)

Lee, L.C.; Kan, J.R.; Wu, C.S.

1980-01-01

Generation of auroral kilometric radiation (AKR) in the auroral acceleration region is studied. It is shown that auroral kilometric radiation can be generated by the backscattered electrons trapped in the acceleration region via a cyclotron maser process. The parallel electric field in the acceleration region is required to be distributed over 1-2 Rsub(E). The observed AKR frequency spectrum can be used to estimate the altitude range of the auroral acceleration region. The altitudes of the lower and upper boundaries of the acceleration region determined from the AKR data are respectively approximately 2000 and approximately 9000 km. (author)

Grid-Based Projector Augmented Wave (GPAW) Implementation of Quantum Mechanics/Molecular Mechanics (QM/MM) Electrostatic Embedding and Application to a Solvated Diplatinum Complex.

Science.gov (United States)

Dohn, A O; Jónsson, E Ö; Levi, G; Mortensen, J J; Lopez-Acevedo, O; Thygesen, K S; Jacobsen, K W; Ulstrup, J; Henriksen, N E; Møller, K B; Jónsson, H

2017-12-12

A multiscale density functional theory-quantum mechanics/molecular mechanics (DFT-QM/MM) scheme is presented, based on an efficient electrostatic coupling between the electronic density obtained from a grid-based projector augmented wave (GPAW) implementation of density functional theory and a classical potential energy function. The scheme is implemented in a general fashion and can be used with various choices for the descriptions of the QM or MM regions. Tests on H 2 O clusters, ranging from dimer to decamer show that no systematic energy errors are introduced by the coupling that exceeds the differences in the QM and MM descriptions. Over 1 ns of liquid water, Born-Oppenheimer QM/MM molecular dynamics (MD) are sampled combining 10 parallel simulations, showing consistent liquid water structure over the QM/MM border. The method is applied in extensive parallel MD simulations of an aqueous solution of the diplatinum [Pt 2 (P 2 O 5 H 2 ) 4 ] 4- complex (PtPOP), spanning a total time period of roughly half a nanosecond. An average Pt-Pt distance deviating only 0.01 Å from experimental results, and a ground-state Pt-Pt oscillation frequency deviating by <2% from experimental results were obtained. The simulations highlight a remarkable harmonicity of the Pt-Pt oscillation, while also showing clear signs of Pt-H hydrogen bonding and directional coordination of water molecules along the Pt-Pt axis of the complex.

Density-Dependent Formulation of Dispersion-Repulsion Interactions in Hybrid Multiscale Quantum/Molecular Mechanics (QM/MM) Models.

Science.gov (United States)

Curutchet, Carles; Cupellini, Lorenzo; Kongsted, Jacob; Corni, Stefano; Frediani, Luca; Steindal, Arnfinn Hykkerud; Guido, Ciro A; Scalmani, Giovanni; Mennucci, Benedetta

2018-03-13

Mixed multiscale quantum/molecular mechanics (QM/MM) models are widely used to explore the structure, reactivity, and electronic properties of complex chemical systems. Whereas such models typically include electrostatics and potentially polarization in so-called electrostatic and polarizable embedding approaches, respectively, nonelectrostatic dispersion and repulsion interactions are instead commonly described through classical potentials despite their quantum mechanical origin. Here we present an extension of the Tkatchenko-Scheffler semiempirical van der Waals (vdW TS ) scheme aimed at describing dispersion and repulsion interactions between quantum and classical regions within a QM/MM polarizable embedding framework. Starting from the vdW TS expression, we define a dispersion and a repulsion term, both of them density-dependent and consistently based on a Lennard-Jones-like potential. We explore transferable atom type-based parametrization strategies for the MM parameters, based on either vdW TS calculations performed on isolated fragments or on a direct estimation of the parameters from atomic polarizabilities taken from a polarizable force field. We investigate the performance of the implementation by computing self-consistent interaction energies for the S22 benchmark set, designed to represent typical noncovalent interactions in biological systems, in both equilibrium and out-of-equilibrium geometries. Overall, our results suggest that the present implementation is a promising strategy to include dispersion and repulsion in multiscale QM/MM models incorporating their explicit dependence on the electronic density.

Final report of APMP.QM-S6: clenbuterol in porcine meat

Science.gov (United States)

Sin, D. W.-M.; Ho, C.; Yip, Y.-C.

2016-01-01

At the CCQM Organic Analysis Working Group (OAWG) Meeting held in April 2012 and the APMP TCQM Meeting held in November 2012, an APMP supplementary comparison (APMP.QM-S6) on the determination of clenbuterol in porcine meat was supported by the OAWG and APMP TCQM. This comparison was organized by the Government Laboratory, Hong Kong. In order to accommodate a wider participation, a pilot study (APMP.QM-P22) was run in parallel to APMP.QM-S6. This study provided the means for assessing the measurement capabilities for determination of low-polarity measurands in a procedure that requires extraction, clean-up, analytical separation, and selective detection in a food matrix. A total of 7 institutes registered for the supplementary comparison and 6 of them submitted their results. 4 results were included for SCRV calculation. All participating laboratories applied Isotope Dilution Liquid Chromatography-Tandem Mass Spectrometry (ID-LCMS/MS) technique with clenbuterol-d9 as internal standard spiked for quantitation in this programme. KEY WORDS FOR SEARCH APMP.QM-S6 and Clenbuterol Main text To reach the main text of this paper, click on Final Report. Note that this text is that which appears in Appendix B of the BIPM key comparison database kcdb.bipm.org/. The final report has been peer-reviewed and approved for publication by the CCQM, according to the provisions of the CIPM Mutual Recognition Arrangement (CIPM MRA).

Current-voltage relationship in the auroral particle acceleration region

Directory of Open Access Journals (Sweden)

M. Morooka

2004-11-01

Full Text Available The current-voltage relationship in the auroral particle acceleration region has been studied statistically by the Akebono (EXOS-D satellite in terms of the charge carriers of the upward field-aligned current. The Akebono satellite often observed field-aligned currents which were significantly larger than the model value predicted by Knight (1973. We compared the upward field-aligned current estimated by three different methods, and found that low-energy electrons often play an important role as additional current carriers, together with the high-energy primary electrons which are expected from Knight's relation. Such additional currents have been observed especially at high and middle altitudes of the particle acceleration region. Some particular features of electron distribution functions, such as "cylindrical distribution functions" and "electron conics", have often been observed coinciding with the additional currents. They indicated time variability of the particle acceleration region. Therefore, we have concluded that the low-energy electrons within the "forbidden" region of electron phase space in the stationary model often contribute to charge carriers of the current because of the rapid time variability of the particle acceleration region. "Cylindrical distribution functions" are expected to be found below the time-varying potential difference. We statistically examined the locations of "cylindrical distribution function", and found that their altitudes are related to the location where the additional currents have been observed. This result is consistent with the idea that the low-energy electrons can also carry significant current when the acceleration region changes in time.

SPECTRAL PROPERTIES OF LARGE GRADUAL SOLAR ENERGETIC PARTICLE EVENTS. II. SYSTEMATIC Q/M DEPENDENCE OF HEAVY ION SPECTRAL BREAKS

Energy Technology Data Exchange (ETDEWEB)

Desai, M. I.; Dayeh, M. A.; Ebert, R. W.; Schwadron, N. A. [Southwest Research Institute, 6220 Culebra Road, San Antonio, TX 78238 (United States); Mason, G. M. [Johns Hopkins University/Applied Physics Laboratory, Laurel, MD 20723 (United States); McComas, D. J. [Department of Astrophysical Sciences, Princeton University, NJ 08544 (United States); Li, G. [The Center for Space Plasma and Aeronomic Research (CSPAR), University of Alabama in Huntsville, Huntsville, AL 35756 (United States); Cohen, C. M. S.; Mewaldt, R. A. [California Institute of Technology, Pasadena, CA 91125 (United States); Smith, C. W., E-mail: mdesai@swri.edu [University of New Hampshire, 8 College Road, Durham NH 03824 (United States)

2016-09-10

We fit ∼0.1–500 MeV nucleon{sup −1} H–Fe spectra in 46 large solar energetic particle (SEP) events with the double power-law Band function to obtain a normalization constant, low- and high-energy parameters γ {sub a} and γ {sub b}, and break energy E {sub B}, and derive the low-energy spectral slope γ {sub 1}. We find that: (1) γ {sub a}, γ {sub 1}, and γ {sub b} are species-independent and the spectra steepen with increasing energy; (2) E {sub B} decreases systematically with decreasing Q/M scaling as (Q/M){sup α}; (3) α varies between ∼0.2–3 and is well correlated with the ∼0.16–0.23 MeV nucleon{sup −1} Fe/O; (4) in most events, α < 1.4, γ {sub b}– γ {sub a} > 3, and O E {sub B} increases with γ {sub b}– γ {sub a}; and (5) in many extreme events (associated with faster coronal mass ejections (CMEs) and GLEs), Fe/O and {sup 3}He/{sup 4}He ratios are enriched, α ≥ 1.4, γ {sub b}– γ {sub a} < 3, and E {sub B} decreases with γ {sub b}– γ {sub a}. The species-independence of γ {sub a}, γ {sub 1}, and γ {sub b} and the Q/M dependence of E {sub B} within an event and the α values suggest that double power-law SEP spectra occur due to diffusive acceleration by near-Sun CME shocks rather than scattering in interplanetary turbulence. Using γ {sub 1}, we infer that the average compression ratio for 33 near-Sun CME shocks is 2.49 ± 0.08. In most events, the Q/M dependence of E {sub B} is consistent with the equal diffusion coefficient condition and the variability in α is driven by differences in the near-shock wave intensity spectra, which are flatter than the Kolmogorov turbulence spectrum but weaker than the spectra for extreme events. In contrast, in extreme events, enhanced wave power enables faster CME shocks to accelerate impulsive suprathermal ions more efficiently than ambient coronal ions.

Seismic acceleration map expected for Japanese central region

International Nuclear Information System (INIS)

Sugiyama, Takeshi; Maeda, Kouji; Ishii, Kiyoshi; Suzuki, Makoto.

1990-01-01

Since electric generating and supplying facilities scatter in large areas, the seismic acceleration map, which defines the anticipated earthquake ground motions in a broad region, is very useful information for the design of those facilities against large earthquakes. This paper describes the development of a seismic acceleration map for the Central Japanese Region by incorporating the analytical results based on historical earthquake records and active fault data using probability and statistics. In the region, there have occurred several destructive earthquakes; Anseitokai (1854, M = 8.4) and Tohnankai (1944, M = 7.9) earthquakes along the Nankai trough; Nohbi (1891, M = 8.0) and Fukui (1948, M = 7.1) earthquakes in inland ares. Some of the historical earthquake data were obtained by instrument last one hundred years, whereas others by literary descriptions for nearly 1,000 years. The active fault data, have been collected mainly from the surveys of fault topography and geology, and are considered to indicate the average seismic activity for the past million years. A proposed seismic acceleration map for the return period of 75 years, calculated on the free surface of base stratum, was estimated by the following way. The analytical result based on the historical earthquake records was adopted mainly, because the Japanese seismic design criteria have been developed based on them. The proposed seismic acceleration map was revised by including the result based on the active fault data for the areas, where historical earthquake records lack, and the result was smoothed to evaluate the final seismic acceleration map. (author)

Combined quantum mechanics/molecular mechanics (QM/MM) simulations for protein-ligand complexes: free energies of binding of water molecules in influenza neuraminidase.

Science.gov (United States)

Woods, Christopher J; Shaw, Katherine E; Mulholland, Adrian J

2015-01-22

The applicability of combined quantum mechanics/molecular mechanics (QM/MM) methods for the calculation of absolute binding free energies of conserved water molecules in protein/ligand complexes is demonstrated. Here, we apply QM/MM Monte Carlo simulations to investigate binding of water molecules to influenza neuraminidase. We investigate five different complexes, including those with the drugs oseltamivir and peramivir. We investigate water molecules in two different environments, one more hydrophobic and one hydrophilic. We calculate the free-energy change for perturbation of a QM to MM representation of the bound water molecule. The calculations are performed at the BLYP/aVDZ (QM) and TIP4P (MM) levels of theory, which we have previously demonstrated to be consistent with one another for QM/MM modeling. The results show that the QM to MM perturbation is significant in both environments (greater than 1 kcal mol(-1)) and larger in the more hydrophilic site. Comparison with the same perturbation in bulk water shows that this makes a contribution to binding. The results quantify how electronic polarization differences in different environments affect binding affinity and also demonstrate that extensive, converged QM/MM free-energy simulations, with good levels of QM theory, are now practical for protein/ligand complexes.

QM/MM Calculations with deMon2k

Directory of Open Access Journals (Sweden)

Dennis R. Salahub

2015-03-01

Full Text Available The density functional code deMon2k employs a fitted density throughout (Auxiliary Density Functional Theory, which offers a great speed advantage without sacrificing necessary accuracy. Powerful Quantum Mechanical/Molecular Mechanical (QM/MM approaches are reviewed. Following an overview of the basic features of deMon2k that make it efficient while retaining accuracy, three QM/MM implementations are compared and contrasted. In the first, deMon2k is interfaced with the CHARMM MM code (CHARMM-deMon2k; in the second MM is coded directly within the deMon2k software; and in the third the Chemistry in Ruby (Cuby wrapper is used to drive the calculations. Cuby is also used in the context of constrained-DFT/MM calculations. Each of these implementations is described briefly; pros and cons are discussed and a few recent applications are described briefly. Applications include solvated ions and biomolecules, polyglutamine peptides important in polyQ neurodegenerative diseases, copper monooxygenases and ultra-rapid electron transfer in cryptochromes.

Modeling Chemical Reactions by QM/MM Calculations: The Case of the Tautomerization in Fireflies Bioluminescent Systems.

Science.gov (United States)

Berraud-Pache, Romain; Garcia-Iriepa, Cristina; Navizet, Isabelle

2018-01-01

In less than half a century, the hybrid QM/MM method has become one of the most used technique to model molecules embedded in a complex environment. A well-known application of the QM/MM method is for biological systems. Nowadays, one can understand how enzymatic reactions work or compute spectroscopic properties, like the wavelength of emission. Here, we have tackled the issue of modeling chemical reactions inside proteins. We have studied a bioluminescent system, fireflies, and deciphered if a keto-enol tautomerization is possible inside the protein. The two tautomers are candidates to be the emissive molecule of the bioluminescence but no outcome has been reached. One hypothesis is to consider a possible keto-enol tautomerization to treat this issue, as it has been already observed in water. A joint approach combining extensive MD simulations as well as computation of key intermediates like TS using QM/MM calculations is presented in this publication. We also emphasize the procedure and difficulties met during this approach in order to give a guide for this kind of chemical reactions using QM/MM methods.

Modelling chemical reactions by QM/MM calculations: the case of the tautomerization in fireflies bioluminescent systems

Science.gov (United States)

Berraud-Pache, Romain; Garcia-Iriepa, Cristina; Navizet, Isabelle

2018-04-01

In less than half a century, the hybrid QM/MM method has become one of the most used technique to model molecules embedded in a complex environment. A well-known application of the QM/MM method is for biological systems. Nowadays, one can understand how enzymatic reactions work or compute spectroscopic properties, like the wavelength of emission. Here, we have tackled the issue of modelling chemical reactions inside proteins. We have studied a bioluminescent system, fireflies, and deciphered if a keto-enol tautomerization is possible inside the protein. The two tautomers are candidates to be the emissive molecule of the bioluminescence but no outcome has been reached. One hypothesis is to consider a possible keto-enol tautomerization to treat this issue, as it has been already observed in water. A joint approach combining extensive MD simulations as well as computation of key intermediates like TS using QM/MM calculations is presented in this publication. We also emphasize the procedure and difficulties met during this approach in order to give a guide for this kind of chemical reactions using QM/MM methods.

Investigation into the Use of the Concept Laser QM System as an In-Situ Research and Evaluation Tool

Science.gov (United States)

Bagg, Stacey

2014-01-01

The NASA Marshall Space Flight Center (MSFC) is using a Concept Laser Fusing (Cusing) M2 powder bed additive manufacturing system for the build of space flight prototypes and hardware. NASA MSFC is collecting and analyzing data from the M2 QM Meltpool and QM Coating systems for builds. This data is intended to aide in understanding of the powder-bed additive manufacturing process, and in the development of a thermal model for the process. The QM systems are marketed by Concept Laser GmbH as in-situ quality management modules. The QM Meltpool system uses both a high-speed near-IR camera and a photodiode to monitor the melt pool generated by the laser. The software determines from the camera images the size of the melt pool. The camera also measures the integrated intensity of the IR radiation, and the photodiode gives an intensity value based on the brightness of the melt pool. The QM coating system uses a high resolution optical camera to image the surface after each layer has been formed. The objective of this investigation was to determine the adequacy of the QM Meltpool system as a research instrument for in-situ measurement of melt pool size and temperature and its applicability to NASA's objectives in (1) Developing a process thermal model and (2) Quantifying feedback measurements with the intent of meeting quality requirements or specifications. Note that Concept Laser markets the system only as capable of giving an indication of changes between builds, not as an in-situ research and evaluation tool. A secondary objective of the investigation is to determine the adequacy of the QM Coating system as an in-situ layer-wise geometry and layer quality evaluation tool.

Isolation and identification of the immune-relevant ribosomal protein L10 (RPL10/QM-like gene) from the large yellow croaker Pseudosciaena crocea (Pisces: Sciaenidae).

Science.gov (United States)

Chen, X; Su, Y Q; Wang, J; Liu, M; Niu, S F; Zhong, S P; Qiu, F

2012-10-15

In order to investigate the immune role of ribosomal protein L10 (RPL10/QM-like gene) in marine fish, we challenged the large yellow croaker Pseudosciaena (= Larimichthys) crocea, the most important marine fish culture species in China, by injection with a mixture of the bacteria Vibrio harveyi and V. parahaemolyticus (3:1 in volume). Microarray analysis and real-time PCR were performed 24 and 48 h post-challenge to isolate and identify the QM-like gene from the gill P. crocea (designated PcQM). The expression level of the PcQM gene did not changed significantly at 24 h post-challenge, but was significantly downregulated at 48 h post-challenge, suggesting that the gene had an immune-modulatory effect in P. crocea. Full-length PcQM cDNA and genomic sequences were obtained by rapid amplification of cDNA ends (RACE)-PCR. The sequence of the PcQM gene clustered together with those of other QM-like genes from other aquatic organisms, indicating that the QM-like gene is highly conserved in teleosts.

GPU Linear Algebra Libraries and GPGPU Programming for Accelerating MOPAC Semiempirical Quantum Chemistry Calculations.

Science.gov (United States)

Maia, Julio Daniel Carvalho; Urquiza Carvalho, Gabriel Aires; Mangueira, Carlos Peixoto; Santana, Sidney Ramos; Cabral, Lucidio Anjos Formiga; Rocha, Gerd B

2012-09-11

In this study, we present some modifications in the semiempirical quantum chemistry MOPAC2009 code that accelerate single-point energy calculations (1SCF) of medium-size (up to 2500 atoms) molecular systems using GPU coprocessors and multithreaded shared-memory CPUs. Our modifications consisted of using a combination of highly optimized linear algebra libraries for both CPU (LAPACK and BLAS from Intel MKL) and GPU (MAGMA and CUBLAS) to hasten time-consuming parts of MOPAC such as the pseudodiagonalization, full diagonalization, and density matrix assembling. We have shown that it is possible to obtain large speedups just by using CPU serial linear algebra libraries in the MOPAC code. As a special case, we show a speedup of up to 14 times for a methanol simulation box containing 2400 atoms and 4800 basis functions, with even greater gains in performance when using multithreaded CPUs (2.1 times in relation to the single-threaded CPU code using linear algebra libraries) and GPUs (3.8 times). This degree of acceleration opens new perspectives for modeling larger structures which appear in inorganic chemistry (such as zeolites and MOFs), biochemistry (such as polysaccharides, small proteins, and DNA fragments), and materials science (such as nanotubes and fullerenes). In addition, we believe that this parallel (GPU-GPU) MOPAC code will make it feasible to use semiempirical methods in lengthy molecular simulations using both hybrid QM/MM and QM/QM potentials.

Genome sequencing and transcriptome analysis of Trichoderma reesei QM9978 strain reveals a distal chromosome translocation to be responsible for loss of vib1 expression and loss of cellulase induction.

Science.gov (United States)

Ivanova, Christa; Ramoni, Jonas; Aouam, Thiziri; Frischmann, Alexa; Seiboth, Bernhard; Baker, Scott E; Le Crom, Stéphane; Lemoine, Sophie; Margeot, Antoine; Bidard, Frédérique

2017-01-01

The hydrolysis of biomass to simple sugars used for the production of biofuels in biorefineries requires the action of cellulolytic enzyme mixtures. During the last 50 years, the ascomycete Trichoderma reesei , the main source of industrial cellulase and hemicellulase cocktails, has been subjected to several rounds of classical mutagenesis with the aim to obtain higher production levels. During these random genetic events, strains unable to produce cellulases were generated. Here, whole genome sequencing and transcriptomic analyses of the cellulase-negative strain QM9978 were used for the identification of mutations underlying this cellulase-negative phenotype. Sequence comparison of the cellulase-negative strain QM9978 to the reference strain QM6a identified a total of 43 mutations, of which 33 were located either close to or in coding regions. From those, we identified 23 single-nucleotide variants, nine InDels, and one translocation. The translocation occurred between chromosomes V and VII, is located upstream of the putative transcription factor vib1 , and abolishes its expression in QM9978 as detected during the transcriptomic analyses. Ectopic expression of vib1 under the control of its native promoter as well as overexpression of vib1 under the control of a strong constitutive promoter restored cellulase expression in QM9978, thus confirming that the translocation event is the reason for the cellulase-negative phenotype. Gene deletion of vib1 in the moderate producer strain QM9414 and in the high producer strain Rut-C30 reduced cellulase expression in both cases. Overexpression of vib1 in QM9414 and Rut-C30 had no effect on cellulase production, most likely because vib1 is already expressed at an optimal level under normal conditions. We were able to establish a link between a chromosomal translocation in QM9978 and the cellulase-negative phenotype of the strain. We identified the transcription factor vib1 as a key regulator of cellulases in T. reesei whose

A QM/MM refinement of an experimental DNA structure with metal-mediated base pairs.

Science.gov (United States)

Kumbhar, Sadhana; Johannsen, Silke; Sigel, Roland K O; Waller, Mark P; Müller, Jens

2013-10-01

A series of hybrid quantum mechanical/molecular mechanical (QM/MM) calculations was performed on models of a DNA duplex with artificial silver(I)-mediated imidazole base pairs. The optimized structures were compared to the original experimental NMR structure (Nat. Chem. 2 (2010) 229-234). The metal⋯metal distances are significantly shorter (~0.5Å) in the QM/MM model than in the original NMR structure. As a result, argentophilic interactions are feasible between the silver(I) ions of neighboring metal-mediated base pairs. Using the computationally determined metal⋯metal distances, a re-refined NMR solution structure of the DNA duplex was obtained. In this new NMR structure, all experimental constraints remain fulfilled. The new NMR structure shows less deviation from the regular B-type conformation than the original one. This investigation shows that the application of QM/MM models to generate additional constraints to be used during NMR structural refinements represents an elegant approach to obtaining high-resolution NMR structures. Copyright © 2013 Elsevier Inc. All rights reserved.

Determination of excited states of quantum systems by finite difference time domain method (FDTD) with supersymmetric quantum mechanics (SUSY-QM)

Energy Technology Data Exchange (ETDEWEB)

Sudiarta, I. Wayan; Angraini, Lily Maysari, E-mail: lilyangraini@unram.ac.id [Physics Study Program, University of Mataram, Jln. Majapahit 62 Mataram, NTB (Indonesia)

2016-04-19

We have applied the finite difference time domain (FDTD) method with the supersymmetric quantum mechanics (SUSY-QM) procedure to determine excited energies of one dimensional quantum systems. The theoretical basis of FDTD, SUSY-QM, a numerical algorithm and an illustrative example for a particle in a one dimensional square-well potential were given in this paper. It was shown that the numerical results were in excellent agreement with theoretical results. Numerical errors produced by the SUSY-QM procedure was due to errors in estimations of superpotentials and supersymmetric partner potentials.

Omics Analyses of Trichoderma reesei CBS999.97 and QM6a Indicate the Relevance of Female Fertility to Carbohydrate-Active Enzyme and Transporter Levels.

Science.gov (United States)

Tisch, Doris; Pomraning, Kyle R; Collett, James R; Freitag, Michael; Baker, Scott E; Chen, Chia-Ling; Hsu, Paul Wei-Che; Chuang, Yu Chien; Schuster, Andre; Dattenböck, Christoph; Stappler, Eva; Sulyok, Michael; Böhmdorfer, Stefan; Oberlerchner, Josua; Wang, Ting-Fang; Schmoll, Monika

2017-11-15

The filamentous fungus Trichoderma reesei is found predominantly in the tropics but also in more temperate regions, such as Europe, and is widely known as a producer of large amounts of plant cell wall-degrading enzymes. We sequenced the genome of the sexually competent isolate CBS999.97, which is phenotypically different from the female sterile strain QM6a but can cross sexually with QM6a. Transcriptome data for growth on cellulose showed that entire carbohydrate-active enzyme (CAZyme) families are consistently differentially regulated between these strains. We evaluated backcrossed strains of both mating types, which acquired female fertility from CBS999.97 but maintained a mostly QM6a genetic background, and we could thereby distinguish between the effects of strain background and female fertility or mating type. We found clear regulatory differences associated with female fertility and female sterility, including regulation of CAZyme and transporter genes. Analysis of carbon source utilization, transcriptomes, and secondary metabolites in these strains revealed that only a few changes in gene regulation are consistently correlated with different mating types. Different strain backgrounds (QM6a versus CBS999.97) resulted in the most significant alterations in the transcriptomes and in carbon source utilization, with decreased growth of CBS999.97 on several amino acids (for example proline or alanine), which further correlated with the downregulation of genes involved in the respective pathways. In combination, our findings support a role of fertility-associated processes in physiology and gene regulation and are of high relevance for the use of sexual crossing in combining the characteristics of two compatible strains or quantitative trait locus (QTL) analysis. IMPORTANCE Trichoderma reesei is a filamentous fungus with a high potential for secretion of plant cell wall-degrading enzymes. We sequenced the genome of the fully fertile field isolate CBS999.97 and

QM/MM Molecular Dynamics Studies of Metal Binding Proteins

Directory of Open Access Journals (Sweden)

Pietro Vidossich

2014-07-01

Full Text Available Mixed quantum-classical (quantum mechanical/molecular mechanical (QM/MM simulations have strongly contributed to providing insights into the understanding of several structural and mechanistic aspects of biological molecules. They played a particularly important role in metal binding proteins, where the electronic effects of transition metals have to be explicitly taken into account for the correct representation of the underlying biochemical process. In this review, after a brief description of the basic concepts of the QM/MM method, we provide an overview of its capabilities using selected examples taken from our work. Specifically, we will focus on heme peroxidases, metallo-β-lactamases, α-synuclein and ligase ribozymes to show how this approach is capable of describing the catalytic and/or structural role played by transition (Fe, Zn or Cu and main group (Mg metals. Applications will reveal how metal ions influence the formation and reduction of high redox intermediates in catalytic cycles and enhance drug metabolism, amyloidogenic aggregate formation and nucleic acid synthesis. In turn, it will become manifest that the protein frame directs and modulates the properties and reactivity of the metal ions.

Active Site Dynamics in Substrate Hydrolysis Catalyzed by DapE Enzyme and Its Mutants from Hybrid QM/MM-Molecular Dynamics Simulation.

Science.gov (United States)

Dutta, Debodyuti; Mishra, Sabyashachi

2017-07-27

The mechanism of the catalytic hydrolysis of N-succinyl diaminopimelic acid (SDAP) by the microbial enzyme DapE in its wild-type (wt) form as well as three of its mutants (E134D, H67A, and H349A) is investigated employing a hybrid quantum mechanics/molecular mechanics (QM/MM) method coupled with molecular dynamics (MD) simulations, wherein the time evolution of the atoms of the QM and MM regions are obtained from the forces acting on the individual atoms. The free-energy profiles along the reaction coordinates of this multistep hydrolysis reaction process are explored using a combination of equilibrium and nonequilibrium (umbrella sampling) QM/MM-MD simulation techniques. In the enzyme-substrate complexes of wt-DapE and the E134D mutant, nucleophilic attack is found to be the rate-determining step involving a barrier of 15.3 and 21.5 kcal/mol, respectively, which satisfactorily explains the free energy of activation obtained from kinetic experiments in wt-DapE-SDAP (15.2 kcal/mol) and the 3 orders of magnitude decrease in the catalytic activity due to E134D mutation. The catalysis is found to be quenched in the H67A and H349A mutants of DapE due to conformational rearrangement in the active site induced by the absence of the active site His residues that prohibits activation of the catalytic water molecule.

QM/MM studies of cisplatin complexes with DNA dimer and octamer

KAUST Repository

Gkionis, Konstantinos

2012-08-01

Hybrid QM/MM calculations on adducts of cisplatin with DNA dimer and octamer are reported. Starting from the crystal structure of a cisplatin-DNA dimer complex and an NMR structure of a cisplatin-DNA octamer complex, several variants of the ONIOM approach are tested, all employing BHandH for the QM part and AMBER for MM. We demonstrate that a generic set of molecular mechanics parameters for description of Pt-coordination can be used within the subtractive ONIOM scheme without loss of accuracy, such that dedicated parameters for new platinum complexes may not be required. Comparison of optimised structures obtained with different strategies indicates that electrostatic embedding is vital for proper description of the complex, while inclusion of water molecules as explicit solvent further improves performance. The resulting DNA structural parameters are in good general agreement with the experimental structure obtained, particularly when the inherent variability in NMR-derived parameters is taken into account. © 2012 Elsevier B.V.

Final report on AFRIMETS.QM-K27: Determination of ethanol in aqueous matrix

Science.gov (United States)

Archer, Marcellé; Fernandes-Whaley, Maria; Visser, Ria; de Vos, Jayne; Prins, Sara; Rosso, Adriana; Ruiz de Arechavaleta, Mariana; Tahoun, Ibrahim; Kakoulides, Elias; Luvonga, Caleb; Muriira, Geoffrey; Naujalis, Evaldas; Zakaria, Osman Bin; Buzoianu, Mirella; Bebic, Jelena; Achour Mounir, Ben; Thanh, Ngo Huy

2013-01-01

From within AFRIMETS, the Regional Metrology Organization (RMO) for Africa, the RMO Key Comparison AFRIMETS.QM-K27 was coordinated by the National Metrology Institute of South Africa (NMISA) in 2011. Ten Metrology Institutes participated, comprising three AFRIMETS, two APMP, four EURAMET and one SIM participant. Participants were required to determine the forensic level concentration of two aqueous ethanol solutions that were gravimetrically prepared by the NMISA. Concentrations were expected to lie in the range of 0.1 mg/g to 5.0 mg/g. The accurate determination of ethanol content in aqueous medium is critical for regulatory forensic and trade purposes. The CCQM Organic Analysis Working Group has carried out several key comparisons (CCQM-K27 series) on the determination of ethanol in wine and aqueous matrices. Developing NMIs now had the opportunity to link to the earlier CCQM-K27 studies through the AFRIMETS.QM-K27 study. Gas chromatography coupled to flame ionisation or mass spectrometric detection was applied by eight of the participants, while three participants (including NMISA) applied titrimetry for the ethanol assay. The assigned reference value of the aqueous ethanol solutions was used to link AFRIMETS.QM-K27 to the CCQM-K27 key comparison reference value. The assigned reference values for AFRIMETS.QM-K27 Level 1 and Level 2 were (0.3249 ± 0.0021) mg/g (k = 2) and (4.6649 ± 0.0152) mg/g (k = 2), respectively. The reference values were determined using the purity-corrected gravimetric preparation values, while the standard uncertainty incorporated the gravimetric preparation and titrimetric homogeneity uncertainties. From previous CCQM-K27 studies, the expected spread (%CV) of higher order measurements of ethanol in aqueous medium is about 0.85% relative. In this study the CV for Level 1 is about 12% (10% with two outliers removed) and for Level 2 about 4%. Three of the ten laboratories submitted results within 1.5% of the gravimetric reference value for

BUILDING A RELATIONSHIP WITH THE CUSTOMER: A CRM VERSUS A QM PERSPECTIVE

Directory of Open Access Journals (Sweden)

Sandru Ioana Maria Diana

2009-05-01

Full Text Available Customer relationship management (CRM and quality management (QM both define the customer as being the focus of all business activities. The question arises on how these two concepts work together. In the change defined environment, where getting ahead

Particle acceleration at corotating interaction regions in the three-dimensional heliosphere

International Nuclear Information System (INIS)

Desai, M.I.; Marsden, R.G.; Sanderson, T.R.; Balogh, A.; Forsyth, R.J.; Gosling, J.T.

1998-01-01

We have investigated the relationship between the energetic (∼1MeV) proton intensity (J) and the magnetic compression ratio (C) measured at the trailing edges of corotating interaction regions observed at Ulysses. In general, our results show that the proton intensity was well correlated with the compression ratio, provided that the seed intensity remained constant, consistent with predictions of the Fermi model. Specifically, our results indicate that particles were accelerated to above ∼1MeV in energy at or near the trailing edges of the compression regions observed in the midlatitude southern heliosphere, irrespective of whether the bounding reverse shocks were present or not. On the basis of this, we conclude that shock acceleration is probably not the only mechanism by which particles are accelerated to above ∼1MeV in energy at compression or interaction regions (CIRs). On the basis of magnetic field measurements obtained near the trailing edges of several midlatitude CIRs, we propose that particles could have been accelerated via the Fermi mechanism by being scattered back and forth across the trailing edges of the compression regions by large-amplitude Alfvacute en waves. Our results also show that the proton intensity was well correlated with the compression ratio during low solar activity periods but was essentially independent of C during periods of high solar activity. We suggest that the correlation between J and C was not observed during solar active periods because of significant variations in the seed intensity that result from sporadic contributions from transient solar events. In contrast, the correlation was observable during quiescent periods probably because contributions from transients had decreased dramatically, which allowed the CIRs to accelerate particles out of a seed population whose intensity remained relatively unperturbed. copyright 1998 American Geophysical Union

Southern California Regional Technology Acceleration Program

Energy Technology Data Exchange (ETDEWEB)

Ochoa, Rosibel [Univ. of California, San Diego, CA (United States). Jacobs School of Engineering; Rasochova, Lada [Univ. of California, San Diego, CA (United States). Rady School of Management

2014-09-30

UC San Diego and San Diego State University are partnering to address these deficiencies in the renewable energy space in the greater San Diego region, accelerating the movement of clean energy innovation from the university laboratory into the marketplace, building on the proven model of the William J. von Liebig Center’s (vLC’s) Proof of Concept (POC) program and virtualizing the effort to enable a more inclusive environment for energy innovation and expansion of the number of clean energy start-ups and/or technology licenses in greater California.

Ion acceleration at the earth's bow shock: A review of observations in the upstream region

International Nuclear Information System (INIS)

Gosling, J.T.; Asbridge, J.R.; Bame, S.J.; Feldman, W.C.

1979-01-01

Positive ions are accelerated at or near the earth's bow shock and propagate into the upstream region. Two distinctly different population of these ions, distinguished by their greatly different spectral and angular widths, can be identified there. The type of ion population observed in the upstream region is strongly correlated with the presence or absence of long-period compresive waves in the solar wind. Very few ions are accelerated in the vicinity of the shock to energies much above about 100 keV. It is not yet clear whether the most energetic ions (i.e. those near 100 keV) are accelerated at the shock or in the broad disturbed region upstream from the shock. In either case stochastic acceleration by turbulent electrostatic fields seems to be the most viable candidate for the acceleration of the most energetic particles

Ion acceleration at the earth's bow shock: a review of observations in the upstream region

International Nuclear Information System (INIS)

Gosling, J.T.; Asbridge, J.R.; Bame, S.J.; Feldman, W.C.

1979-01-01

Positive ions are accelerated at or near the earth's bow shock and propagate into the upstream region. Two distinctly different populations of these ions, distinguished by their greatly different spectral and angular widths, can be identified there. The type of ion population observed in the upstream region is strongly correlated with the presence or absence of long-period compressive waves in the solar wind. Very few ions are accelerated in the vicinity of the shock to energies much above about 100 keV. It is not yet clear whether the most energetic ions (i.e., those near 100 keV) are accelerated at the shock or in broad disturbed region upstream from the shock. In either case stochastic acceleration by turbulent electrostatic fields seems to be the most viable candidate for the acceleration of the most energetic particles

Stepwise catalytic mechanism via short-lived intermediate inferred from combined QM/MM MERP and PES calculations on retaining glycosyltransferase ppGalNAcT2.

Science.gov (United States)

Trnka, Tomáš; Kozmon, Stanislav; Tvaroška, Igor; Koča, Jaroslav

2015-04-01

The glycosylation of cell surface proteins plays a crucial role in a multitude of biological processes, such as cell adhesion and recognition. To understand the process of protein glycosylation, the reaction mechanisms of the participating enzymes need to be known. However, the reaction mechanism of retaining glycosyltransferases has not yet been sufficiently explained. Here we investigated the catalytic mechanism of human isoform 2 of the retaining glycosyltransferase polypeptide UDP-GalNAc transferase by coupling two different QM/MM-based approaches, namely a potential energy surface scan in two distance difference dimensions and a minimum energy reaction path optimisation using the Nudged Elastic Band method. Potential energy scan studies often suffer from inadequate sampling of reactive processes due to a predefined scan coordinate system. At the same time, path optimisation methods enable the sampling of a virtually unlimited number of dimensions, but their results cannot be unambiguously interpreted without knowledge of the potential energy surface. By combining these methods, we have been able to eliminate the most significant sources of potential errors inherent to each of these approaches. The structural model is based on the crystal structure of human isoform 2. In the QM/MM method, the QM region consists of 275 atoms, the remaining 5776 atoms were in the MM region. We found that ppGalNAcT2 catalyzes a same-face nucleophilic substitution with internal return (SNi). The optimized transition state for the reaction is 13.8 kcal/mol higher in energy than the reactant while the energy of the product complex is 6.7 kcal/mol lower. During the process of nucleophilic attack, a proton is synchronously transferred to the leaving phosphate. The presence of a short-lived metastable oxocarbenium intermediate is likely, as indicated by the reaction energy profiles obtained using high-level density functionals.

Stepwise catalytic mechanism via short-lived intermediate inferred from combined QM/MM MERP and PES calculations on retaining glycosyltransferase ppGalNAcT2.

Directory of Open Access Journals (Sweden)

Tomáš Trnka

2015-04-01

Full Text Available The glycosylation of cell surface proteins plays a crucial role in a multitude of biological processes, such as cell adhesion and recognition. To understand the process of protein glycosylation, the reaction mechanisms of the participating enzymes need to be known. However, the reaction mechanism of retaining glycosyltransferases has not yet been sufficiently explained. Here we investigated the catalytic mechanism of human isoform 2 of the retaining glycosyltransferase polypeptide UDP-GalNAc transferase by coupling two different QM/MM-based approaches, namely a potential energy surface scan in two distance difference dimensions and a minimum energy reaction path optimisation using the Nudged Elastic Band method. Potential energy scan studies often suffer from inadequate sampling of reactive processes due to a predefined scan coordinate system. At the same time, path optimisation methods enable the sampling of a virtually unlimited number of dimensions, but their results cannot be unambiguously interpreted without knowledge of the potential energy surface. By combining these methods, we have been able to eliminate the most significant sources of potential errors inherent to each of these approaches. The structural model is based on the crystal structure of human isoform 2. In the QM/MM method, the QM region consists of 275 atoms, the remaining 5776 atoms were in the MM region. We found that ppGalNAcT2 catalyzes a same-face nucleophilic substitution with internal return (SNi. The optimized transition state for the reaction is 13.8 kcal/mol higher in energy than the reactant while the energy of the product complex is 6.7 kcal/mol lower. During the process of nucleophilic attack, a proton is synchronously transferred to the leaving phosphate. The presence of a short-lived metastable oxocarbenium intermediate is likely, as indicated by the reaction energy profiles obtained using high-level density functionals.

Electron dynamics in complex environments with real-time time dependent density functional theory in a QM-MM framework

International Nuclear Information System (INIS)

Morzan, Uriel N.; Ramírez, Francisco F.; Scherlis, Damián A.; Oviedo, M. Belén; Sánchez, Cristián G.; Lebrero, Mariano C. González

2014-01-01

This article presents a time dependent density functional theory (TDDFT) implementation to propagate the Kohn-Sham equations in real time, including the effects of a molecular environment through a Quantum-Mechanics Molecular-Mechanics (QM-MM) hamiltonian. The code delivers an all-electron description employing Gaussian basis functions, and incorporates the Amber force-field in the QM-MM treatment. The most expensive parts of the computation, comprising the commutators between the hamiltonian and the density matrix—required to propagate the electron dynamics—, and the evaluation of the exchange-correlation energy, were migrated to the CUDA platform to run on graphics processing units, which remarkably accelerates the performance of the code. The method was validated by reproducing linear-response TDDFT results for the absorption spectra of several molecular species. Two different schemes were tested to propagate the quantum dynamics: (i) a leap-frog Verlet algorithm, and (ii) the Magnus expansion to first-order. These two approaches were confronted, to find that the Magnus scheme is more efficient by a factor of six in small molecules. Interestingly, the presence of iron was found to seriously limitate the length of the integration time step, due to the high frequencies associated with the core-electrons. This highlights the importance of pseudopotentials to alleviate the cost of the propagation of the inner states when heavy nuclei are present. Finally, the methodology was applied to investigate the shifts induced by the chemical environment on the most intense UV absorption bands of two model systems of general relevance: the formamide molecule in water solution, and the carboxy-heme group in Flavohemoglobin. In both cases, shifts of several nanometers are observed, consistently with the available experimental data

Efficient parallel implementations of QM/MM-REMD (quantum mechanical/molecular mechanics-replica-exchange MD) and umbrella sampling: isomerization of H2O2 in aqueous solution.

Science.gov (United States)

Fedorov, Dmitri G; Sugita, Yuji; Choi, Cheol Ho

2013-07-03

An efficient parallel implementation of QM/MM-based replica-exchange molecular dynamics (REMD) as well as umbrella samplings techniques was proposed by adopting the generalized distributed data interface (GDDI). Parallelization speed-up of 40.5 on 48 cores was achieved, making our QM/MM-MD engine a robust tool for studying complex chemical dynamics in solution. They were comparatively used to study the torsional isomerization of hydrogen peroxide in aqueous solution. All results by QM/MM-REMD and QM/MM umbrella sampling techniques yielded nearly identical potentials of mean force (PMFs) regardless of the particular QM theories for solute, showing that the overall dynamics are mainly determined by solvation. Although the entropic penalty of solvent rearrangements exists in cisoid conformers, it was found that both strong intermolecular hydrogen bonding and dipole-dipole interactions preferentially stabilize them in solution, reducing the torsional free-energy barrier at 0° by about 3 kcal/mol as compared to that in gas phase.

Insights into the Lactonase Mechanism of Serum Paraoxonase 1 (PON1): Experimental and Quantum Mechanics/Molecular Mechanics (QM/MM) Studies.

Science.gov (United States)

Le, Quang Anh Tuan; Kim, Seonghoon; Chang, Rakwoo; Kim, Yong Hwan

2015-07-30

Serum paraoxonase 1 (PON1) is a versatile enzyme for the hydrolysis of various substrates (e.g., lactones, phosphotriesters) and for the formation of a promising chemical platform γ-valerolactone. Elucidation of the PON1-catalyzed lactonase reaction mechanism is very important for understanding the enzyme function and for engineering this enzyme for specific applications. Kinetic study and hybrid quantum mechanics/molecular mechanics (QM/MM) method were used to investigate the PON1-catalyzed lactonase reaction of γ-butyrolactone (GBL) and (R)-γ-valerolactone (GVL). The activation energies obtained from the QM/MM calculations were in good agreement with the experiments. Interestingly, the QM/MM energy barriers at MP2/3-21G(d,p) level for the lactonase of GVL and GBL were respectively 14.3-16.2 and 11.5-13.1 kcal/mol, consistent with the experimental values (15.57 and 14.73 kcal/mol derived from respective kcat values of 36.62 and 147.21 s(-1)). The QM/MM energy barriers at MP2/6-31G(d) and MP2/6-31G(d,p) levels were also in relatively good agreements with the experiments. Importantly, the difference in the QM/MM energy barriers at MP2 level with all investigated basis sets for the lactonase of GVL and GBL were in excellent agreement with the experiments (0.9-3.1 and 0.8 kcal/mol, respectively). A detailed mechanism for the PON1-catalyzed lactonase reaction was also proposed in this study.

Direct hydride shift mechanism and stereoselectivity of P450nor confirmed by QM/MM calculations.

Science.gov (United States)

Krámos, Balázs; Menyhárd, Dóra K; Oláh, Julianna

2012-01-19

Nitric oxide reductase (P450(nor)) found in Fusarium oxysporum catalyzes the reduction of nitric oxide to N(2)O in a multistep process. The reducing agent, NADH, is bound in the distal pocket of the enzyme, and direct hydride transfer occurs from NADH to the nitric oxide bound heme enzyme, forming intermediate I. Here we studied the possibility of hydride transfer from NADH to both the nitrogen and oxygen of the heme-bound nitric oxide, using quantum chemical and combined quantum mechanics/molecular mechanics (QM/MM) calculations, on two different protein models, representing both possible stereochemistries, a syn- and an anti-NADH arrangement. All calculations clearly favor hydride transfer to the nitrogen of nitric oxide, and the QM-only barrier and kinetic isotope effects are good agreement with the experimental values of intermediate I formation. We obtained higher barriers in the QM/MM calculations for both pathways, but hydride transfer to the nitrogen of nitric oxide is still clearly favored. The barriers obtained for the syn, Pro-R conformation of NADH are lower and show significantly less variation than the barriers obtained in the case of anti conformation. The effect of basis set and wide range of functionals on the obtained results are also discussed.

KINETIKA FERMENTASI SELULOSA MURNI OLEH Trichoderma reesi QM 9414 MENJADI GLUKOSA DAN PENERAPANNYA PADA JERAMI PADI BEBAS LIGNIN [Kinetics of Pure Cellulose Fermentation by Trichoderma Reesei QM 9414 to Glucose and Its Application of on Lignin Free Rice Straw

Directory of Open Access Journals (Sweden)

M Iyan Sofyan

2004-12-01

Full Text Available The objectives of this research were: 1 to determine aeration rate and substrate concentration of pure cellulose to produce maximum glucose by Trichoderma reesei QM 9414 at 30 oC, and agitation 150 rpm; 2 to study the kinetics of pure cellulose fermentation by Trichoderma reesei QM 9414 to glucose and its implication upon fermentation of the lignin free rice straw. The experiment was arranged in factorial randomized complete design in three times replication. Treatments consisted of three levels of aeration (1,00 vvm; 1,5 vvm; 2,0 vvm and three levels of substrate concentration (0,75 ; 1,00 ; 1,25 % w/v. The results showed that at the exponential phase the average specific growth of Trichoderma reesei QM 9414 was 0,05374 hour-1, the maximum glucose product concentration of pure cellulose was 0.1644 gL-1,and the oxygen transfer was 0,0328 mg L-1 hour-1. According to t-test, the kinetics of pure cellulose fermentation model just the same as the lignin free rice straw fermentation.The enzymes produced by Trichoderma reesei QM 9414 in pure cellulose fermentation media followed the Michaelis-Menten model. The enzyme kinetic parameters were the maximum growth rate was 37x10-3 hour-1 and Michaelis-Menten constant was ½ maximum μ =17,5x10-3 hour-1. The volumetric oxygen transfer (KLa using rice straw was 0,0337 mg.hour-1. The value of KLa could be used for conversion from bioreactor at laboratory scale to commercial scale design.

Tuned and Balanced Redistributed Charge Scheme for Combined Quantum Mechanical and Molecular Mechanical (QM/MM) Methods and Fragment Methods: Tuning Based on the CM5 Charge Model.

Science.gov (United States)

Wang, Bo; Truhlar, Donald G

2013-02-12

Tuned and balanced redistributed charge schemes have been developed for modeling the electrostatic fields of bonds that are cut by a quantum mechanical-molecular mechanical boundary in combined quantum mechanical and molecular mechanical (QM/MM) methods. First, the charge is balanced by adjusting the charge on the MM boundary atom to conserve the total charge of the entire QM/MM system. In the balanced smeared redistributed charge (BSRC) scheme, the adjusted MM boundary charge is smeared with a smearing width of 1.0 Å and is distributed in equal portions to the midpoints of the bonds between the MM boundary atom and the MM atoms bonded to it; in the balanced redistributed charge-2 (BRC2) scheme, the adjusted MM boundary charge is distributed as point charges in equal portions to the MM atoms that are bonded to the MM boundary atom. The QM subsystem is capped by a fluorine atom that is tuned to reproduce the sum of partial atomic charges of the uncapped portion of the QM subsystem. The new aspect of the present study is a new way to carry out the tuning process; in particular, the CM5 charge model, rather than the Mulliken population analysis applied in previous studies, is used for tuning the capping atom that terminates the dangling bond of the QM region. The mean unsigned error (MUE) of the QM/MM deprotonation energy for a 15-system test suite of deprotonation reactions is 2.3 kcal/mol for the tuned BSRC scheme (TBSRC) and 2.4 kcal/mol for the tuned BRC2 scheme (TBRC2). As was the case for the original tuning method based on Mulliken charges, the new tuning method performs much better than using conventional hydrogen link atoms, which have an MUE on this test set of about 7 kcal/mol. However, the new scheme eliminates the need to use small basis sets, which can be problematic, and it allows one to be more consistent by tuning the parameters with whatever basis set is appropriate for applications. (Alternatively, since the tuning parameters and partial charges

Particle Acceleration in a Statistically Modeled Solar Active-Region Corona

Science.gov (United States)

Toutounzi, A.; Vlahos, L.; Isliker, H.; Dimitropoulou, M.; Anastasiadis, A.; Georgoulis, M.

2013-09-01

Elaborating a statistical approach to describe the spatiotemporally intermittent electric field structures formed inside a flaring solar active region, we investigate the efficiency of such structures in accelerating charged particles (electrons). The large-scale magnetic configuration in the solar atmosphere responds to the strong turbulent flows that convey perturbations across the active region by initiating avalanche-type processes. The resulting unstable structures correspond to small-scale dissipation regions hosting strong electric fields. Previous research on particle acceleration in strongly turbulent plasmas provides a general framework for addressing such a problem. This framework combines various electromagnetic field configurations obtained by magnetohydrodynamical (MHD) or cellular automata (CA) simulations, or by employing a statistical description of the field's strength and configuration with test particle simulations. Our objective is to complement previous work done on the subject. As in previous efforts, a set of three probability distribution functions describes our ad-hoc electromagnetic field configurations. In addition, we work on data-driven 3D magnetic field extrapolations. A collisional relativistic test-particle simulation traces each particle's guiding center within these configurations. We also find that an interplay between different electron populations (thermal/non-thermal, ambient/injected) in our simulations may also address, via a re-acceleration mechanism, the so called `number problem'. Using the simulated particle-energy distributions at different heights of the cylinder we test our results against observations, in the framework of the collisional thick target model (CTTM) of solar hard X-ray (HXR) emission. The above work is supported by the Hellenic National Space Weather Research Network (HNSWRN) via the THALIS Programme.

Structural insight into RNA catalysis revealed by molecular dynamics simulations and QM/MM calculation

Czech Academy of Sciences Publication Activity Database

Banáš, P.; Walter, N.G.; Šponer, Jiří; Otyepka, Michal

2009-01-01

Roč. 26, č. 6 (2009), s. 816 ISSN 0739-1102. [The 17th Conversation . 16.06.2009-20.06.2009, Albany] Institutional research plan: CEZ:AV0Z50040507; CEZ:AV0Z50040702 Keywords : QM/MM * RNA Subject RIV: BO - Biophysics

Pre-discovery detections and progenitor candidate for SPIRITS17qm in NGC 1365

Science.gov (United States)

Jencson, J. E.; Bond, H. E.; Adams, S. M.; Kasliwal, M. M.

2018-04-01

We report the detection of a pre-discovery outburst of SPIRITS17qm, discovered as part of the ongoing Spitzer InfraRed Intensive Transients Survey (SPIRITS) using the 3.6 and 4.5 micron imaging channels ([3.6] and [4.5]) of the Infrared Array Camera (IRAC) on the Spitzer Space Telescope (ATel #11575).

Preface [EmQM15: 3. international symposium on emergent quantum mechanics

International Nuclear Information System (INIS)

2016-01-01

These proceedings comprise the invited lectures of the third international symposium on Emergent Quantum Mechanics (EmQM15), which was held at the Vienna University of Technology in Vienna, Austria, 23-25 October 2015. The symposium convened at the Festsaal and the adjacent Boeckl-Saal of the Technical University, and was devoted to the open exploration of the quantum state as a reality. The resurgence of interest in ontological quantum theory, including both deterministic and indeterministic approaches, challenges long held assumptions and focuses on the following questions: Is the world local or nonlocal? What is the nature of quantum nonlocality? If nonlocal, i.e., superluminal, influences exist then why can't they be used for superluminal signaling and communication? How is the role of the scientific observer/agent to be accounted for in realistic approaches to quantum theory? How could recent developments in the field of space-time as an emergent phenomenon advance new insight at this research frontier? What new experiments might contribute to new understanding? These and related questions were addressed in the context also of a possible deeper level theory for quantum mechanics that interconnects three fields of knowledge: emergence, the quantum, and information. Could there appear a revised image of physical reality from recognizing new links between emergence, the quantum, and information? The symposium provided a forum for considering (i) current theoretical and conceptual obstacles which need to be overcome as well as (ii) promising developments and research opportunities on the way towards realistic quantum mechanics. Contributions were invited that present current advances in both standard as well as unconventional approaches. The EmQM15 symposium was co-organized by Gerhard Grössing (Austrian Institute for Nonlinear Studies (AINS), Vienna), and by Jan Walleczek (Fetzer Franklin Fund, USA, and Phenoscience Laboratories, Berlin). After two

FT-Raman and QM/MM study of the interaction between histamine and DNA

International Nuclear Information System (INIS)

Ruiz-Chica, A.J.; Soriano, A.; Tunon, I.; Sanchez-Jimenez, F.M.; Silla, E.; Ramirez, F.J.

2006-01-01

The interaction between histamine and highly polymerized calf-thymus DNA has been investigated using FT-Raman spectroscopy and the hybrid QM/MM (quantum mechanics/molecular mechanics) methodology. Raman spectra of solutions containing histamine and calf-thymus DNA, at different molar ratios, were recorded. Solutions were prepared at physiological settings of pH and ionic strength, using both natural and heavy water as the solvent. The analysis of the spectral changes on the DNA Raman spectra when adding different concentrations of histamine allowed us to identify the reactive sites of DNA and histamine, which were used to built two minor groove and one intercalated binding models. They were further used as starting points of the QM/MM theoretical study. However, minimal energy points were only reached for the two minor groove models. For each optimized structure, we calculated analytical force constants of histamine molecule in order to perform the vibrational dynamics. Normal mode descriptions allowed us to compare calculated wavenumbers for DNA-interacting histamine to those measured in the Raman spectra of DNA-histamine solutions

QM/MM study of dislocation—hydrogen/helium interactions in α-Fe

International Nuclear Information System (INIS)

Zhao, Yi; Lu, Gang

2011-01-01

Impurities such as hydrogen (H) and helium (He) interact strongly with dislocations in metals. Using a multiscale quantum-mechanics/molecular-mechanics (QM/MM) approach, we have examined the interactions between the impurities (H and He) with dislocations (edge and screw) in α-Fe. The impurity trapping at the dislocation core is examined by calculating the impurity-dislocation binding energy and the impurity solution energy. We find that in general both H and He prefer the tetrahedral sites at the dislocation core, as well as in the bulk; the exceptions are due to deformed structures at the dislocation cores. Both H and He have a greater solution energy and binding energy to the edge dislocation than to the screw dislocation. The impurity pipe diffusion along the dislocation core is investigated using the QM/MM nudged-elastic-band method. We find that the diffusion barrier along the screw dislocation is lower than the bulk value for both H and He impurities. For the edge dislocation, although H has similar diffusion barriers as in the bulk, He has much higher diffusion energy barriers compared with the bulk. Finally we have examined the impurity effect on the dislocation mobility. We find that both H and He can lower the Peierls energy barrier for the screw dislocation significantly. The H enhanced dislocation mobility is consistent with experimental observations

76 FR 23543 - The Jobs and Innovation Accelerator Challenge; a Coordinated Initiative To Advance Regional...

Science.gov (United States)

2011-04-27

... Jobs and Innovation Accelerator Challenge; a Coordinated Initiative To Advance Regional Competitiveness... Federal resources to support regional innovation and sustainable economic prosperity. Knowing that regional innovation clusters provide a globally proven approach for developing economic prosperity, this...

Cluster in the Auroral Acceleration Region

Science.gov (United States)

Pickett, Jolene S.; Fazakerley, Andrew N.; Marklund, Gorun; Dandouras, Iannis; Christopher, Ivar W.; Kistler, Lynn; Lucek, Elizabeth; Masson, Arnaud; Taylor, Matthew G.; Mutel, Robert L.;

Particle acceleration in solar active regions being in the state of self-organized criticality.

Science.gov (United States)

Vlahos, Loukas

We review the recent observational results on flare initiation and particle acceleration in solar active regions. Elaborating a statistical approach to describe the spatiotemporally intermittent electric field structures formed inside a flaring solar active region, we investigate the efficiency of such structures in accelerating charged particles (electrons and protons). The large-scale magnetic configuration in the solar atmosphere responds to the strong turbulent flows that convey perturbations across the active region by initiating avalanche-type processes. The resulting unstable structures correspond to small-scale dissipation regions hosting strong electric fields. Previous research on particle acceleration in strongly turbulent plasmas provides a general framework for addressing such a problem. This framework combines various electromagnetic field configurations obtained by magnetohydrodynamical (MHD) or cellular automata (CA) simulations, or by employing a statistical description of the field’s strength and configuration with test particle simulations. We work on data-driven 3D magnetic field extrapolations, based on a self-organized criticality models (SOC). A relativistic test-particle simulation traces each particle’s guiding center within these configurations. Using the simulated particle-energy distributions we test our results against observations, in the framework of the collisional thick target model (CTTM) of solar hard X-ray (HXR) emission and compare our results with the current observations.

Report of the advisory group meeting on the establishment of regional ion accelerator centers and user networks

International Nuclear Information System (INIS)

1997-11-01

In this report it is shown that ion accelerators have had a tremendous economic and technological impact on most developed countries, and are beginning to have a significant impact on developing countries. Through the formation of Accelerator Centers and User Networks (which may be national, regional or inter-regional) a mechanism will be outlined by which scientists and other users from developing countries can receive the necessary training and have available the necessary accelerator facilities to use these machines for economic improvement and technological development in their countries

MDEP Common Position CP-VICWG-01. Common Position: Establishment of Common QA/QM Criteria for the Multinational Vendor Inspection CP-VICWG-01

International Nuclear Information System (INIS)

2015-01-01

This document provides a set of common positions for harmonizing inspection criteria called 'Common QA/QM Criteria' which will be used in Multinational Vendor Inspections. This document was prepared by the Vendor Inspection Co-operation Working Group (VICWG) of the Multinational Design Evaluation Program (MDEP). The 'Common QA/QM Criteria' provides the basic areas for consideration when performing Vendor Inspections. The criteria have been developed in conformity with International Codes and Standards such as IAEA, ISO, etc. that MDEP member countries have adopted

The Quality of the Embedding Potential Is Decisive for Minimal Quantum Region Size in Embedding Calculations

DEFF Research Database (Denmark)

Nåbo, Lina J; Olsen, Jógvan Magnus Haugaard; Martínez, Todd J

2017-01-01

correct description of the MM region, and that this enables the use of much smaller QM regions compared to fixed charge electrostatic embedding. Furthermore, absorption intensities converge very slowly with system size and inclusion of effective external field effects in the MM region through...

A QM/MM–Based Computational Investigation on the Catalytic Mechanism of Saccharopine Reductase

OpenAIRE

Almasi, Joel N.; Bushnell, Eric A.C.; Gauld, James W.

2011-01-01

Saccharopine reductase from Magnaporthe grisea, an NADPH-containing enzyme in the α-aminoadipate pathway, catalyses the formation of saccharopine, a precursor to L-lysine, from the substrates glutamate and α-aminoadipate-δ-semialdehyde. Its catalytic mechanism has been investigated using quantum mechanics/molecular mechanics (QM/MM) ONIOM-based approaches. In particular, the overall catalytic pathway has been elucidated and the effects of electron correlation and the anisotropic polar protein...

ELECTROMAGNETIC AND THERMAL SIMULATIONS FOR THE SWITCH REGION OF A COMPACT PROTON ACCELERATOR

International Nuclear Information System (INIS)

Wang, L; Caporaso, G J; Sullivan, J S

2007-01-01

A compact proton accelerator for medical applications is being developed at Lawrence Livermore National Laboratory. The accelerator architecture is based on the dielectric wall accelerator (DWA) concept. One critical area to consider is the switch region. Electric field simulations and thermal calculations of the switch area were performed to help determine the operating limits of rmed SiC switches. Different geometries were considered for the field simulation including the shape of the thin Indium solder meniscus between the electrodes and SiC. Electric field simulations were also utilized to demonstrate how the field stress could be reduced. Both transient and steady steady-state thermal simulations were analyzed to find the average power capability of the switches

Contribution to the central region study of the first cyclotron of the Rhone-Alpes accelerator system

International Nuclear Information System (INIS)

Khallouf, A.

1986-01-01

Some changes seemed necessary such as the structure of the central region in order to obtain good centring and good axial and radial stabilities for the different conditions of acceleration. The most simple calculations of the center of cyclotron already developed such as the acceleration in a constant electric field, but with enough regions to obtain a good precision have been resumed. As analytic tool a computer program calculates the trajectories of a charged particle given its characteristics and the conditions of injection, and the parameters of the system of acceleration and guiding. The program calculates orbit of the particle. A criterion of judgement to permit modifications of the hypothesis leading to the solution needed to obtain good working conditions for the cyclotron has been established [fr

Multiscale Treatment for the Molecular Mechanism of a Diels-Alder Reaction in Solution: A QM/MM-MD Study.

Science.gov (United States)

Soto-Delgado, Jorge; Tapia, Ricardo A; Torras, Juan

2016-10-11

Thermodynamics and the solvent role in the acceleration of the Diels-Alder reaction between cyclopentadiene (CPD) and methyl vinyl ketone (MVK) have been revisited. In this work we use an ab initio hybrid QM/MM-MD scheme combined with multiple steered molecular dynamics to extract the free energy pofile in water and methanol using the bidirectional Minh-Adib estimator. We obtain 18.7 kcal mol -1 and 20.8 kcal mol -1 free energy barrier for the reaction in water and methanol, respectively. This methodology reproduces experimental values with an absolute error of about 0.8 kcal mol -1 . The experimental difference between the activation free-energy barriers of water and methanol is also reproduced with an absolute error of about 0.1 kcal mol -1 . We explore the charge transfer evolution along reaction coordinates to characterize the electronic behavior for this reaction. It is shown that the solvent molecules around the reaction system produce a global polarization along the reaction coordinate which is consistent with the solvent polarity. The results highlight the role of hydrogen bonding formed in the transition state to stabilize the system charge reorganization in the reaction process.

Atomistic insight into the catalytic mechanism of glycosyltransferases by combined quantum mechanics/molecular mechanics (QM/MM) methods.

Science.gov (United States)

Tvaroška, Igor

2015-02-11

Glycosyltransferases catalyze the formation of glycosidic bonds by assisting the transfer of a sugar residue from donors to specific acceptor molecules. Although structural and kinetic data have provided insight into mechanistic strategies employed by these enzymes, molecular modeling studies are essential for the understanding of glycosyltransferase catalyzed reactions at the atomistic level. For such modeling, combined quantum mechanics/molecular mechanics (QM/MM) methods have emerged as crucial. These methods allow the modeling of enzymatic reactions by using quantum mechanical methods for the calculation of the electronic structure of the active site models and treating the remaining enzyme environment by faster molecular mechanics methods. Herein, the application of QM/MM methods to glycosyltransferase catalyzed reactions is reviewed, and the insight from modeling of glycosyl transfer into the mechanisms and transition states structures of both inverting and retaining glycosyltransferases are discussed. Copyright © 2014 Elsevier Ltd. All rights reserved.

PREFACE: EmQM13: Emergent Quantum Mechanics 2013

Science.gov (United States)

2014-04-01

These proceedings comprise the invited lectures of the second international symposium on Emergent Quantum Mechanics (EmQM13), which was held at the premises of the Austrian Academy of Sciences in Vienna, Austria, 3-6 October 2013. The symposium was held at the ''Theatersaal'' of the Academy of Sciences, and was devoted to the open exploration of emergent quantum mechanics, a possible ''deeper level theory'' that interconnects three fields of knowledge: emergence, the quantum, and information. Could there appear a revised image of physical reality from recognizing new links between emergence, the quantum, and information? Could a novel synthesis pave the way towards a 21st century, ''superclassical'' physics? The symposium provided a forum for discussing (i) important obstacles which need to be overcome as well as (ii) promising developments and research opportunities on the way towards emergent quantum mechanics. Contributions were invited that presented current advances in both standard as well as unconventional approaches to quantum mechanics. The EmQM13 symposium was co-organized by Gerhard Grössing (Austrian Institute for Nonlinear Studies (AINS), Vienna), and by Jan Walleczek (Fetzer Franklin Fund, USA, and Phenoscience Laboratories, Berlin). After a very successful first conference on the same topic in 2011, the new partnership between AINS and the Fetzer Franklin Fund in producing the EmQM13 symposium was able to further expand interest in the promise of emergent quantum mechanics. The symposium consisted of two parts, an opening evening addressing the general public, and the scientific program of the conference proper. The opening evening took place at the Great Ceremonial Hall (Grosser Festsaal) of the Austrian Academy of Sciences, and it presented talks and a panel discussion on ''The Future of Quantum Mechanics'' with three distinguished speakers: Stephen Adler (Princeton), Gerard 't Hooft (Utrecht) and Masanao Ozawa (Nagoya). The articles contained in

Regional strategies for the accelerating global problem of groundwater depletion

Science.gov (United States)

Aeschbach-Hertig, Werner; Gleeson, Tom

2012-12-01

Groundwater--the world's largest freshwater resource--is critically important for irrigated agriculture and hence for global food security. Yet depletion is widespread in large groundwater systems in both semi-arid and humid regions of the world. Excessive extraction for irrigation where groundwater is slowly renewed is the main cause of the depletion, and climate change has the potential to exacerbate the problem in some regions. Globally aggregated groundwater depletion contributes to sea-level rise, and has accelerated markedly since the mid-twentieth century. But its impacts on water resources are more obvious at the regional scale, for example in agriculturally important parts of India, China and the United States. Food production in such regions can only be made sustainable in the long term if groundwater levels are stabilized. To this end, a transformation is required in how we value, manage and characterize groundwater systems. Technical approaches--such as water diversion, artificial groundwater recharge and efficient irrigation--have failed to balance regional groundwater budgets. They need to be complemented by more comprehensive strategies that are adapted to the specific social, economic, political and environmental settings of each region.

Regional blood flow in the domestic fowl immediately following chronic acceleration

International Nuclear Information System (INIS)

Weidner, W.J.; Hoffman, L.F.; Clark, S.D.

1982-01-01

In order to examine the effects of chronic low G acceleration on blood flow distribution and cardiac output, chickens (N.10) were centrifuged at +2Gz for 30-61 d. Controls (N.12) were not centrifuged. The animals were anesthetized with sodium pentobarbital after removal from the centrifuge and surgically prepared in order to measure cardiac output and regional blood flows by the reference sample method with 85 Sr labeled microspheres (15 +/- 5 mum diam.). Both brachial arteries were cannulated to withdraw timed, paired blood samples at a known rate. The chest was opened and a cannula inserted into the left ventricle for administration of microspheres. Tissue samples were taken after completion of experimental procedures and their radioactivity was determined. The cardiac outputs in the two groups were not significantly different. Regional blood flows to the kidney, eyes, and skeletal muscle were significantly increased in the animals subjected to chronic +2Gz. While the mechanism by which these increases in blood flow occurred is not known, results indicate that chronic exposure to hyperdynamic gravitational fields can alter circulatory dynamics. We conclude that the cardiovascular system is directly involved in the process of adaptation to chronic positive acceleration

Rapid Convergence of Energy and Free Energy Profiles with Quantum Mechanical Size in Quantum Mechanical-Molecular Mechanical Simulations of Proton Transfer in DNA.

Science.gov (United States)

Das, Susanta; Nam, Kwangho; Major, Dan Thomas

2018-03-13

In recent years, a number of quantum mechanical-molecular mechanical (QM/MM) enzyme studies have investigated the dependence of reaction energetics on the size of the QM region using energy and free energy calculations. In this study, we revisit the question of QM region size dependence in QM/MM simulations within the context of energy and free energy calculations using a proton transfer in a DNA base pair as a test case. In the simulations, the QM region was treated with a dispersion-corrected AM1/d-PhoT Hamiltonian, which was developed to accurately describe phosphoryl and proton transfer reactions, in conjunction with an electrostatic embedding scheme using the particle-mesh Ewald summation method. With this rigorous QM/MM potential, we performed rather extensive QM/MM sampling, and found that the free energy reaction profiles converge rapidly with respect to the QM region size within ca. ±1 kcal/mol. This finding suggests that the strategy of QM/MM simulations with reasonably sized and selected QM regions, which has been employed for over four decades, is a valid approach for modeling complex biomolecular systems. We point to possible causes for the sensitivity of the energy and free energy calculations to the size of the QM region, and potential implications.

Quantum-mechanical vs. semi-classical spectral-line widths and shifts from the line core in the non-impact region for the Ar-perturbed/ K-radiator system

International Nuclear Information System (INIS)

Kreye, W.C.

2007-01-01

New quantum-mechanical (QM) and semi-classical (SC) shifts (d's) and widths (HWHM's, w's) were measured from the line core of computed full spectral-line shapes for the Ar-perturbed/K-radiator system (K/Ar). The initial state of our model was based on a 4p 2 P 3/2,1/2 pseudo-potential for the K/Ar system, and the final state on a zero potential. The Fourier transform of the line shape formed the basis for the computations. Excellent agreement was found between the QM and SC values of d and of w in a high-pressure (P) non-impact region, which was characterized by a √P dependence of w and a P dependence of d. These agreements were shown to be another example of a correspondence between classical (SC) quantities and QM quantities in the limit of large quantum numbers. Typically at P=1x10 6 Torr and T=400 K, w QM =448 cm -1 and w SC =479 cm -1 , where the deviation from the mean is ±3.3%. Also, d QM =-3815 cm -1 and d SC =-3716 cm -1 , where the deviation from the mean is ±1.3%. A new general method was formulated which yielded a definite pressure P 0 , which was defined as an upper limit to the low-pressure impact approximation and a lower limit to the non-impact region

Quantifying the mechanism of phosphate monoester hydrolysis in aqueous solution by evaluating the relevant ab initio QM/MM free-energy surfaces.

Science.gov (United States)

Plotnikov, Nikolay V; Prasad, B Ram; Chakrabarty, Suman; Chu, Zhen T; Warshel, Arieh

2013-10-24

Understanding the nature of the free-energy surfaces for phosphate hydrolysis is a prerequisite for understanding the corresponding key chemical reactions in biology. Here, the challenge has been to move to careful ab initio QM/MM (QM(ai)/MM) free-energy calculations, where obtaining converging results is very demanding and computationally expensive. This work describes such calculations, focusing on the free-energy surface for the hydrolysis of phosphate monoesters, paying special attention to the comparison between the one water (1W) and two water (2W) paths for the proton-transfer (PT) step. This issue has been explored before by energy minimization with implicit solvent models and by nonsystematic QM/MM energy minimization, as well as by nonsystematic free-energy mapping. However, no study has provided the needed reliable 2D (3D) surfaces that are necessary for reaching concrete conclusions. Here we report a systematic evaluation of the 2D (3D) free-energy maps for several relevant systems, comparing the results of QM(ai)/MM and QM(ai)/implicit solvent surfaces, and provide an advanced description of the relevant energetics. It is found that the 1W path for the hydrolysis of the methyl diphosphate (MDP) trianion is 6-9 kcal/mol higher than that the 2W path. This difference becomes slightly larger in the presence of the Mg(2+) ion because this ion reduces the pKa of the conjugated acid form of the phosphate oxygen that accepts the proton. Interestingly, the BLYP approach (which has been used extensively in some studies) gives a much smaller difference between the 1W and 2W activation barriers. At any rate, it is worth pointing out that the 2W transition state for the PT is not much higher that the common plateau that serves as the starting point of both the 1W and 2W PT paths. Thus, the calculated catalytic effects of proteins based on the 2W PT mechanistic model are not expected to be different from the catalytic effects predicted using the 1W PT mechanistic

Energy analysis of four dimensional extended hyperbolic Scarf I plus three dimensional separable trigonometric noncentral potentials using SUSY QM approach

International Nuclear Information System (INIS)

Suparmi, A.; Cari, C.; Deta, U. A.; Handhika, J.

2016-01-01

The non-relativistic energies and wave functions of extended hyperbolic Scarf I plus separable non-central shape invariant potential in four dimensions are investigated using Supersymmetric Quantum Mechanics (SUSY QM) Approach. The three dimensional separable non-central shape invariant angular potential consists of trigonometric Scarf II, Manning Rosen and Poschl-Teller potentials. The four dimensional Schrodinger equation with separable shape invariant non-central potential is reduced into four one dimensional Schrodinger equations through variable separation method. By using SUSY QM, the non-relativistic energies and radial wave functions are obtained from radial Schrodinger equation, the orbital quantum numbers and angular wave functions are obtained from angular Schrodinger equations. The extended potential means there is perturbation terms in potential and cause the decrease in energy spectra of Scarf I potential. (paper)

Ion beam dynamics in the acceleration region of the Vincy Cyclotron

International Nuclear Information System (INIS)

Tomic, S.; Samsonov, E.

1998-01-01

Modern concept of heavy ion cyclotrons assumes a tendency of decreasing the gaps between magnet poles, enabling better efficiency of the magnetic field circuit. This restricts possible solutions of acceleration structure and imposes the necessity of installing the dees in valleys of magnetic structures. This approach, which is accepted in the VINCY Cyclotron, requires a detailed study of the ion beam dynamics in the acceleration region. Consequently, we analyzed ion beams with eta = 1,05 and 0.25 in radial and axial phase space. Also, the energy spread in emittances and the influence of the first harmonic of the magnetic field on the radial betatron oscillations are discussed. The transformation of coherent into incoherent radial oscillations as well as the effect to radial off-centering on the beam vertical size at Walkinshaw resonance location, is pointed out (author)

Kinetic modeling of particle acceleration in a solar null point reconnection region

DEFF Research Database (Denmark)

Baumann, Gisela; Haugbølle, Troels; Nordlund, Åke

2013-01-01

The primary focus of this paper is on the particle acceleration mechanism in solar coronal 3D reconnection null-point regions. Starting from a potential field extrapolation of a SOHO magnetogram taken on 2002 November 16, we first performed MHD simulations with horizontal motions observed by SOHO...... particles and 3.5 billion grid cells of size 17.5\\,km --- these simulations offer a new opportunity to study particle acceleration in solar-like settings....... applied to the photospheric boundary of the computational box. After a build-up of electric current in the fan-plane of the null-point, a sub-section of the evolved MHD data was used as initial and boundary conditions for a kinetic particle-in-cell model of the plasma. We find that sub...

Marker list: QM109927 [PGDBj Registered plant list, Marker list, QTL list, Plant DB link and Genome analysis methods[Archive

Lifescience Database Archive (English)

Full Text Available ulation VWP2 x VWP4 and pseudo-F2 population ... Chr12 ... 10.1007/s00438-005-1149-2 16021467 ... QM109927 Solanum lycopersicum Solanaceae L16L Others ATAGTGTCTACTTCAGGG CCATCAAACAGTTCTCT S. peruvianum pop

Marker list: QM109928 [PGDBj Registered plant list, Marker list, QTL list, Plant DB link and Genome analysis methods[Archive

Lifescience Database Archive (English)

Full Text Available GATGGCGTT S. peruvianum population VWP2 x VWP4 and pseudo-F2 population ... Chr12 ... 10.1007/s00438-005-1149-2 16021467 ... QM109928 Solanum lycopersicum Solanaceae DH8R Others TAGAGAGACTATCCTTTA CACATTCAGT

Marker list: QM357356 [PGDBj Registered plant list, Marker list, QTL list, Plant DB link and Genome analysis methods[Archive

Lifescience Database Archive (English)

Full Text Available QM357356 Solanum tuberosum Solanaceae toPt-437059 Others ... CIP703825 ... Chr10 ratio of tuber length to tuber... width trait and eye depth of tuber trait 1 10.1186/s12863-015-0213-0 26024857

Analytical Solution of Dirac Equation for q-Deformed Hyperbolic Manning-Rosen Potential in D Dimensions using SUSY QM and its Thermodynamics Application

International Nuclear Information System (INIS)

Cari, C; Suparmi, A; Yunianto, M; Pratiwi, B N

2016-01-01

The Dirac equation of q-deformed hyperbolic Manning Rosen potential in D dimension was solved by using Supersymmetric Quantum Mechanics (SUSY QM). The D dimensional relativistic energy spectra were obtained by using SUSY QM and shape invariant properties and D dimensional wave functions of q-deformed hyperbolic Manning Rosen potential were obtained by using the SUSY raising and lowering operators. In the nonrelativistic limit, the relativistic energy spectra for exact spin symmetry case reduced into nonrelativistic energy spectra and so for the wave functions. In the classical regime, the partition function, the vibrational specific heat, and the vibrational mean energy of some diatomic molecules were calculated from the non-relativistic energy spectra with the help of error function and imaginary error function. (paper)

Photodissociation dynamics of CH3C(O)SH in argon matrix: A QM/MM nonadiabatic dynamics simulation

Science.gov (United States)

Xia, Shu-Hua; Liu, Xiang-Yang; Fang, Qiu; Cui, Ganglong

2015-11-01

In this work, we have first employed the combined quantum mechanics/molecular mechanics (QM/MM) method to study the photodissociation mechanism of thioacetic acid CH3C(O)SH in the S1, T1, and S0 states in argon matrix. CH3C(O)SH is treated quantum mechanically using the complete active space self-consistent field and complete active space second-order perturbation theory methods; argon matrix is described classically using Lennard-Jones potentials. We find that the C-S bond fission is predominant due to its small barriers of ca. 3.0 and 1.0 kcal/mol in the S1 and T1 states. It completely suppresses the nearby C—C bond fission. After the bond fission, the S1 radical pair of CH3CO and SH can decay to the S0 and T1 states via internal conversion and intersystem crossing, respectively. In the S0 state, the radical pair can either recombine to form CH3C(O)SH or proceed to form molecular products of CH2CO and H2S. We have further employed our recently developed QM/MM generalized trajectory-based surface-hopping method to simulate the photodissociation dynamics of CH3C(O)SH. In 1 ps dynamics simulation, 56% trajectories stay at the Franck-Condon region; the S1 C—S bond fission takes place in the remaining 44% trajectories. Among all nonadiabatic transitions, the S1 → S0 internal conversion is major (55%) but the S1 → T1 intersystem crossing is still comparable and cannot be ignored, which accounts for 28%. Finally, we have found a radical channel generating the molecular products of CH2CO and H2S, which is complementary to the concerted molecular channel. The present work sets the stage for simulating photodissociation dynamics of similar thio-carbonyl systems in matrix.

Marker list: QM183663 [PGDBj Registered plant list, Marker list, QTL list, Plant DB link and Genome analysis methods[Archive

Lifescience Database Archive (English)

Full Text Available CG GCTCCAACTTCAATGCCTGT Gold Ball Livingston x Yellow Pear|San Marzano x Gold Ball Livingston|T1693 x Yellow Pear ... chr11 fruit shape 1 10.1038/hdy.2013.45 23673388 ... QM183663 Solanum lycopersicum Solanaceae 11EP186 CAPS/dCAPS TGGAAGCTTTAAACTTGTCGTT

Recent applications of a QM/MM scheme at the CASPT2//CASSCF/AMBER (or CHARMM) level of theory in photochemistry and photobiology

International Nuclear Information System (INIS)

Sinicropi, A; Basosi, R; Olivucci, M

2008-01-01

The excited-state properties of chemically different chromophores embedded in diverse protein environments or in solution can be nowadays correctly evaluated by means of a hybrid quantum mechanics/molecular mechanics (QM/MM) computational strategy based on multiconfigurational perturbation theory and complete-active-space-self-consistent-field geometry optimization. In particular, in this article we show how a QM/MM strategy has been recently developed in our laboratory and has been successfully applied to the investigation of the fluorescence of the green fluorescent protein (GFP) and how the same strategy (embedding the chromophores in methanol solution) has been combined with retrosynthetic analysis to design a prototype light-driven Z/E molecular switch featuring a single reactive double bond and the same electronic structure and photoisomerization mechanism of the chromophore of the visual pigment Rhodopsin

Efficient Computational Research Protocol to Survey Free Energy Surface for Solution Chemical Reaction in the QM/MM Framework: The FEG-ER Methodology and Its Application to Isomerization Reaction of Glycine in Aqueous Solution.

Science.gov (United States)

Takenaka, Norio; Kitamura, Yukichi; Nagaoka, Masataka

2016-03-03

In solution chemical reaction, we often need to consider a multidimensional free energy (FE) surface (FES) which is analogous to a Born-Oppenheimer potential energy surface. To survey the FES, an efficient computational research protocol is proposed within the QM/MM framework; (i) we first obtain some stable states (or transition states) involved by optimizing their structures on the FES, in a stepwise fashion, finally using the free energy gradient (FEG) method, and then (ii) we directly obtain the FE differences among any arbitrary states on the FES, efficiently by employing the QM/MM method with energy representation (ER), i.e., the QM/MM-ER method. To validate the calculation accuracy and efficiency, we applied the above FEG-ER methodology to a typical isomerization reaction of glycine in aqueous solution, and reproduced quite satisfactorily the experimental value of the reaction FE. Further, it was found that the structural relaxation of the solute in the QM/MM force field is not negligible to estimate correctly the FES. We believe that the present research protocol should become prevailing as one computational strategy and will play promising and important roles in solution chemistry toward solution reaction ergodography.

Photodissociation dynamics of CH{sub 3}C(O)SH in argon matrix: A QM/MM nonadiabatic dynamics simulation

Energy Technology Data Exchange (ETDEWEB)

Xia, Shu-Hua; Liu, Xiang-Yang; Fang, Qiu; Cui, Ganglong, E-mail: ganglong.cui@bnu.edu.cn [Key Laboratory of Theoretical and Computational Photochemistry, Ministry of Education, College of Chemistry, Beijing Normal University, Beijing 100875 (China)

2015-11-21

In this work, we have first employed the combined quantum mechanics/molecular mechanics (QM/MM) method to study the photodissociation mechanism of thioacetic acid CH{sub 3}C(O)SH in the S{sub 1}, T{sub 1}, and S{sub 0} states in argon matrix. CH{sub 3}C(O)SH is treated quantum mechanically using the complete active space self-consistent field and complete active space second-order perturbation theory methods; argon matrix is described classically using Lennard-Jones potentials. We find that the C-S bond fission is predominant due to its small barriers of ca. 3.0 and 1.0 kcal/mol in the S{sub 1} and T{sub 1} states. It completely suppresses the nearby C—C bond fission. After the bond fission, the S{sub 1} radical pair of CH{sub 3}CO and SH can decay to the S{sub 0} and T{sub 1} states via internal conversion and intersystem crossing, respectively. In the S{sub 0} state, the radical pair can either recombine to form CH{sub 3}C(O)SH or proceed to form molecular products of CH{sub 2}CO and H{sub 2}S. We have further employed our recently developed QM/MM generalized trajectory-based surface-hopping method to simulate the photodissociation dynamics of CH{sub 3}C(O)SH. In 1 ps dynamics simulation, 56% trajectories stay at the Franck-Condon region; the S{sub 1} C—S bond fission takes place in the remaining 44% trajectories. Among all nonadiabatic transitions, the S{sub 1} → S{sub 0} internal conversion is major (55%) but the S{sub 1} → T{sub 1} intersystem crossing is still comparable and cannot be ignored, which accounts for 28%. Finally, we have found a radical channel generating the molecular products of CH{sub 2}CO and H{sub 2}S, which is complementary to the concerted molecular channel. The present work sets the stage for simulating photodissociation dynamics of similar thio-carbonyl systems in matrix.

Hybrid Quantum Mechanics/Molecular Mechanics/Coarse Grained Modeling: A Triple-Resolution Approach for Biomolecular Systems.

Science.gov (United States)

Sokkar, Pandian; Boulanger, Eliot; Thiel, Walter; Sanchez-Garcia, Elsa

2015-04-14

We present a hybrid quantum mechanics/molecular mechanics/coarse-grained (QM/MM/CG) multiresolution approach for solvated biomolecular systems. The chemically important active-site region is treated at the QM level. The biomolecular environment is described by an atomistic MM force field, and the solvent is modeled with the CG Martini force field using standard or polarizable (pol-CG) water. Interactions within the QM, MM, and CG regions, and between the QM and MM regions, are treated in the usual manner, whereas the CG-MM and CG-QM interactions are evaluated using the virtual sites approach. The accuracy and efficiency of our implementation is tested for two enzymes, chorismate mutase (CM) and p-hydroxybenzoate hydroxylase (PHBH). In CM, the QM/MM/CG potential energy scans along the reaction coordinate yield reaction energies that are too large, both for the standard and polarizable Martini CG water models, which can be attributed to adverse effects of using large CG water beads. The inclusion of an atomistic MM water layer (10 Å for uncharged CG water and 5 Å for polarizable CG water) around the QM region improves the energy profiles compared to the reference QM/MM calculations. In analogous QM/MM/CG calculations on PHBH, the use of the pol-CG description for the outer water does not affect the stabilization of the highly charged FADHOOH-pOHB transition state compared to the fully atomistic QM/MM calculations. Detailed performance analysis in a glycine-water model system indicates that computation times for QM energy and gradient evaluations at the density functional level are typically reduced by 40-70% for QM/MM/CG relative to fully atomistic QM/MM calculations.

Economic impact of accelerated cleanup on regions surrounding the US DOE's major nuclear weapons sites

International Nuclear Information System (INIS)

Greenberg, M.; Solitare, L.; Frisch, M.; Lowrie, K.

1999-01-01

The regional economic impacts of the US Department of Energy's accelerated environmental cleanup plan are estimated for the major nuclear weapons sites in Colorado, Idaho, New Mexico, South Carolina, Tennessee, and Washington. The analysis shows that the impact falls heavily on the three relatively rural regions around the Savannah River (SC), Hanford (WA), and Idaho National Engineering and Environmental Laboratory (ID) sites. A less aggressive phase-down of environmental management funds and separate funds to invest in education and infrastructure in the regions helps buffer the impacts on jobs, personal income, and gross regional product. Policy options open to the federal and state and local governments are discussed

Fractal supersymmetric QM, Geometric Probability and the Riemann Hypothesis

CERN Document Server

Castro, C

2004-01-01

The Riemann's hypothesis (RH) states that the nontrivial zeros of the Riemann zeta-function are of the form $ s_n =1/2+i\\lambda_n $. Earlier work on the RH based on supersymmetric QM, whose potential was related to the Gauss-Jacobi theta series, allows to provide the proper framework to construct the well defined algorithm to compute the probability to find a zero (an infinity of zeros) in the critical line. Geometric probability theory furnishes the answer to the very difficult question whether the probability that the RH is true is indeed equal to unity or not. To test the validity of this geometric probabilistic framework to compute the probability if the RH is true, we apply it directly to the the hyperbolic sine function $ \\sinh (s) $ case which obeys a trivial analog of the RH (the HSRH). Its zeros are equally spaced in the imaginary axis $ s_n = 0 + i n \\pi $. The geometric probability to find a zero (and an infinity of zeros) in the imaginary axis is exactly unity. We proceed with a fractal supersymme...

Trial of accelerator cells machining with high precision and high efficiency at Okayama region

International Nuclear Information System (INIS)

Yoshikawa, Mitsuo; Yoden, Hiroyuki; Yokomizo, Seiichi; Sumida, Tsuneto; Kunishida, Jun; Oshita, Isao

2005-01-01

In the framework of the project 'Promotion of Science and Technology in Regional Areas' by the Ministry of Education, Culture, Sports, Science and Technology, we have prepared a special apparatus for machining accelerator cells with a high precision and a high efficiency for the future linear collider. A machining with as small an error as 2 micrometers has been realized. Necessary time to finish one accelerator cell is reduced from 128 minutes to 34 minutes due to the suppression of the heating of the object at the machining. If newly developed one chuck method was employed, the precision and efficiency would be further improved. By cutting at both sides of the spindle, the necessary time for machining would be reduced by half. (author)

Preoperative concurrent CBDCA chemotherapy and accelerated hyperfractionated radiotherapy for squamous cell carcinoma of the maxillary region

International Nuclear Information System (INIS)

Omura, Ken; Harada, Hiroyuki; Suzuki, Haruhiko; Takeuchi, Yosuke; Hatano, Kazuo; Togawa, Takashi

2001-01-01

Between 1994 and 2000, 28 patients with T3/T4 squamus cell carcinoma of the maxillary region (maxillary sinus, 22; maxillary gingiva, 4; maxillary bone, 1; buccal mucosa, 1) had accelerated hyperfractionated radiotherapy combined with simultaneous CBDCA chemotherapy preoperatively, at Chiba Cancer Center Hospital. The protocol consisted of combined therapy with accelerated hyperfractionated irradiation of 1.6 Gy, twice a day, to a total dose of 32.0-51.2 Gy and concurrent intra-arterial or intravenous infusion of CBDCA 20-30 mg/body/day for a cumulative total dose of 270-480 mg. After completion of the preoperative combined therapy, the clinical CR rate was 17.9%, and the good PR·CR rate was 32.1%. According to the initial findings and response to the combined therapy, all patients had maxillectomy (subtotal, 3; total, 16; extended, 9) 4 weeks after completion of the preoperative combined therapy. Postoperatively, the complete pathologic response (Ohboshi and Shimozato's classification, grade III and IV) rate was 28.6%. And the actuarial local control rate was 85.7%, with a mean follow-up of 46.2 months. Based on these results, we believe this preoperative therapy with CBDCA chemotherapy and accelerated hyperfractionated radiation is a significant choice as treatment for squamous cell cancer of the maxillary region. (author)

On acceleration of <1 MeV/n He ions in the corotating compression regions near 1 AU: STEREO observations

Directory of Open Access Journals (Sweden)

R. Bučík

2009-09-01

Full Text Available Observations of multi-MeV corotating interaction region (CIR ions are in general consistent with models of CIR shock acceleration and transport. The presence of suprathermal particles near 1 AU in unshocked compression regions is not adequately explained. Nonetheless, more recent works demonstrate that unshocked compression regions associated with CIRs near 1 AU could energize particles. In the energy range from ~0.1 to ~1 MeV/n we investigate CIR events observed in 2007–2008 by the STEREO A and B spacecraft. We treat the predictions of compression acceleration by comparing the observed ion intensities with the model parameters. These observations show that the ion intensity in CIR events with in-situ reverse shock is well organized by the parameters which characterize the compression region itself, like compression width, solar wind speed gradients and the total pressure. In turn, for CIR events with the absence of the shocks the model predictions are not fulfilled.

QM/MM Geometry Optimization on Extensive Free-Energy Surfaces for Examination of Enzymatic Reactions and Design of Novel Functional Properties of Proteins.

Science.gov (United States)

Hayashi, Shigehiko; Uchida, Yoshihiro; Hasegawa, Taisuke; Higashi, Masahiro; Kosugi, Takahiro; Kamiya, Motoshi

2017-05-05

Many remarkable molecular functions of proteins use their characteristic global and slow conformational dynamics through coupling of local chemical states in reaction centers with global conformational changes of proteins. To theoretically examine the functional processes of proteins in atomic detail, a methodology of quantum mechanical/molecular mechanical (QM/MM) free-energy geometry optimization is introduced. In the methodology, a geometry optimization of a local reaction center is performed with a quantum mechanical calculation on a free-energy surface constructed with conformational samples of the surrounding protein environment obtained by a molecular dynamics simulation with a molecular mechanics force field. Geometry optimizations on extensive free-energy surfaces by a QM/MM reweighting free-energy self-consistent field method designed to be variationally consistent and computationally efficient have enabled examinations of the multiscale molecular coupling of local chemical states with global protein conformational changes in functional processes and analysis and design of protein mutants with novel functional properties.

The mean photon energy anti E{sub F} at the point of measurement determines the detector-specific radiation quality correction factor k{sub Q,M} in {sup 192}Ir brachytherapy dosimetry

Energy Technology Data Exchange (ETDEWEB)

Chofor, Ndimofor; Harder, Dietrich; Selbach, Hans-Joachim; Poppe, Bjoern [University of Oldenburg and Pius-Hospital Oldenburg (Germany). Medical Radiation Physics Group

2016-11-01

The application of various radiation detectors for brachytherapy dosimetry has motivated this study of the energy dependence of radiation quality correction factor k{sub Q,M}, the quotient of the detector responses under calibration conditions at a {sup 60}Co unit and under the given non-reference conditions at the point of measurement, M, occurring in photon brachytherapy. The investigated detectors comprise TLD, radiochromic film, ESR, Si diode, plastic scintillator and diamond crystal detectors as well as ionization chambers of various sizes, whose measured response-energy relationships, taken from the literature, served as input data. Brachytherapy photon fields were Monte-Carlo simulated for an ideal isotropic {sup 192}Ir point source, a model spherical {sup 192}Ir source with steel encapsulation and a commercial HDR GammaMed Plus source. The radial source distance was varied within cylindrical water phantoms with outer radii ranging from 10 to 30 cm and heights from 20 to 60 cm. By application of this semiempirical method - originally developed for teletherapy dosimetry - it has been shown that factor k{sub Q,M} is closely correlated with a single variable, the fluence-weighted mean photon energy anti E{sub F} at the point of measurement. The radial profiles of anti E{sub F} obtained with either the commercial {sup 192}Ir source or the two simplified source variants show little variation. The observed correlations between parameters k{sub Q,M} and anti E{sub F} are represented by fitting formulae for all investigated detectors, and further variation of the detector type is foreseen. The herewith established close correlation of radiation quality correction factor k{sub Q,M} with local mean photon energy anti E{sub F} can be regarded as a simple regularity, facilitating the practical application of correction factor k{sub Q,M} for in-phantom dosimetry around {sup 192}Ir brachytherapy sources. anti E{sub F} values can be assessed by Monte Carlo simulation or

Cellulase production by two mutant strain of Trichoderma longibrachiatum Qm9414 and Rut C30; Produccion de celulasas a partir de dos cepas hiperproductoras de trichoderma longibrachiatum Qm9414 y Rut C30

Energy Technology Data Exchange (ETDEWEB)

Blanco, M.J.

1991-12-31

Native or pretreated biomass from Onopordum nervosum boiss, has been examined as candidate feedstock for cellulase production by two mutant strain of trichoderma longibrachiatum QM9414 and Rut C30. Batch cultivation methods were evaluated and compared with previous experiments using ball-milled, crystalline cellulose (Solka floc). Batch cultivation of T. longibrachiatum Rut C30 on 55% (W/V) acid pretreated O. nervosum biomass yielded enzyme productivities and activities comparable to those obtained on Solka floc. However, the overall enzyme production performance was lower than on Solka floc at comparable cellulose concentrations. This fact may be due to the accumulation of pretreated by products and lignin in the fermentor.(author)

Cellulase production by two mutant strain of Trichoderma longibrachiatum Qm9414 and Rut C30. Produccion de celulasas a partir de dos cepas hiperproductoras de trichoderma longibrachiatum Qm9414 y Rut C30

Energy Technology Data Exchange (ETDEWEB)

Blanco, M.J.

1991-01-01

Native or pretreated biomass from Onopordum nervosum boiss, has been examined as candidate feedstock for cellulase production by two mutant strain of trichoderma longibrachiatum QM9414 and Rut C30. Batch cultivation methods were evaluated and compared with previous experiments using ball-milled, crystalline cellulose (Solka floc). Batch cultivation of T. longibrachiatum Rut C30 on 55% (W/V) acid pretreated O. nervosum biomass yielded enzyme productivities and activities comparable to those obtained on Solka floc. However, the overall enzyme production performance was lower than on Solka floc at comparable cellulose concentrations. This fact may be due to the accumulation of pretreated by products and lignin in the fermentor.(author)

The Tūqmāq and the Ming China: The Tūqmāq and the Chinese Relations during the Ming Period (1394–1456

Directory of Open Access Journals (Sweden)

Kenzheakhmet N.

2017-12-01

Full Text Available Objective: Little is known about diplomatic relations between the Jūchīd Ulūs and Ming China (1368–1644, even though some evidence of early tributary trade relations exists. The first extant Chinese account about the country of Salai (Saray dates to around 1394, when accounts of diplomatic exchange between the Ming court and the Jūchīd Ulūs began to appear in the Ming shilu (The Veritable Records of the Ming. Research materials: This article analyzes the Ming shilu in order to understand the character of Chinese knowledge about the Jūchīd Ulūs during their years of contact between 1394 and 1456. Additional sources like geographic accounts and maps help define the extent of Chinese knowledge about the khanate, clarify the kinds of information that the Chinese sought and the reasons why, and measure the influence of cross-cultural contact on Ming Chinese understanding of the Jūchīd Ulūs. Results and novelty of the research: The Ming shilu suggests that at least by the end of the fourteenth and the early years of the fifteenth century, Salai (Saray became an integral, and possibly the most important, element in the name that the Ming court used for the country of the Jūchīd Ulūs. The Persian and Mongol historians used the term Tūqmāq and Togmog to refer to the Jūchīd Ulūs, while Ming Chinese historians used the term Tuohema to refer to the Jūchīd Ulūs or the whole Dasht-i Qipchāq, in post-Mongol Central Eurasia. The diplomatic contact between Ming China and the Tuohuma occurred through the Chinese system of tribute trade during the mid-fifteenth century. Under the reign of Yongle (1402–1424, Zhengtong (1435–1449, and Jingtai (1449–1457, the foundations for a flourishing relationship between Ming China and the Jūchīd Ulūs were established. At that time, the Chinese knew the Jūchīd Ulūs by the name Salai (Saray and Tuohuma (Tūqmāq. Despite the political turmoil that erupted after the fall of the Jūchīd Ul

Chemical reactivity and spectroscopy explored from QM/MM molecular dynamics simulations using the LIO code

Science.gov (United States)

Marcolongo, Juan P.; Zeida, Ari; Semelak, Jonathan A.; Foglia, Nicolás O.; Morzan, Uriel N.; Estrin, Dario A.; González Lebrero, Mariano C.; Scherlis, Damián A.

2018-03-01

In this work we present the current advances in the development and the applications of LIO, a lab-made code designed for density functional theory calculations in graphical processing units (GPU), that can be coupled with different classical molecular dynamics engines. This code has been thoroughly optimized to perform efficient molecular dynamics simulations at the QM/MM DFT level, allowing for an exhaustive sampling of the configurational space. Selected examples are presented for the description of chemical reactivity in terms of free energy profiles, and also for the computation of optical properties, such as vibrational and electronic spectra in solvent and protein environments.

Preoperative concurrent CBDCA chemotherapy and accelerated hyperfractionated radiotherapy for squamous cell carcinoma of the maxillary region

Energy Technology Data Exchange (ETDEWEB)

Omura, Ken; Harada, Hiroyuki [Tokyo Medical and Dental Univ. (Japan). Graduate School; Suzuki, Haruhiko; Takeuchi, Yosuke; Hatano, Kazuo; Togawa, Takashi

2001-11-01

Between 1994 and 2000, 28 patients with T3/T4 squamus cell carcinoma of the maxillary region (maxillary sinus, 22; maxillary gingiva, 4; maxillary bone, 1; buccal mucosa, 1) had accelerated hyperfractionated radiotherapy combined with simultaneous CBDCA chemotherapy preoperatively, at Chiba Cancer Center Hospital. The protocol consisted of combined therapy with accelerated hyperfractionated irradiation of 1.6 Gy, twice a day, to a total dose of 32.0-51.2 Gy and concurrent intra-arterial or intravenous infusion of CBDCA 20-30 mg/body/day for a cumulative total dose of 270-480 mg. After completion of the preoperative combined therapy, the clinical CR rate was 17.9%, and the good PR{center_dot}CR rate was 32.1%. According to the initial findings and response to the combined therapy, all patients had maxillectomy (subtotal, 3; total, 16; extended, 9) 4 weeks after completion of the preoperative combined therapy. Postoperatively, the complete pathologic response (Ohboshi and Shimozato's classification, grade III and IV) rate was 28.6%. And the actuarial local control rate was 85.7%, with a mean follow-up of 46.2 months. Based on these results, we believe this preoperative therapy with CBDCA chemotherapy and accelerated hyperfractionated radiation is a significant choice as treatment for squamous cell cancer of the maxillary region. (author)

Electric potential structures of auroral acceleration region border from multi-spacecraft Cluster data

Science.gov (United States)

Sadeghi, S.; Emami, M. R.

2018-04-01

This paper studies an auroral event using data from three spacecraft of the Cluster mission, one inside and two at the poleward edge of the bottom of the Auroral Acceleration Region (AAR). The study reveals the three-dimensional profile of the region's poleward boundary, showing spatial segmentation of the electric potential structures and their decay in time. It also depicts localized magnetic field variations and field-aligned currents that appear to have remained stable for at least 80 s. Such observations became possible due to the fortuitous motion of the three spacecraft nearly parallel to each other and tangential to the AAR edge, so that the differences and variations can be seen when the spacecraft enter and exit the segmentations, hence revealing their position with respect to the AAR.

Chemical Reactivity and Spectroscopy Explored From QM/MM Molecular Dynamics Simulations Using the LIO Code

Directory of Open Access Journals (Sweden)

Juan P. Marcolongo

2018-03-01

Full Text Available In this work we present the current advances in the development and the applications of LIO, a lab-made code designed for density functional theory calculations in graphical processing units (GPU, that can be coupled with different classical molecular dynamics engines. This code has been thoroughly optimized to perform efficient molecular dynamics simulations at the QM/MM DFT level, allowing for an exhaustive sampling of the configurational space. Selected examples are presented for the description of chemical reactivity in terms of free energy profiles, and also for the computation of optical properties, such as vibrational and electronic spectra in solvent and protein environments.

Cellulase production by two mutant strain of Trichoderma longibrachiatum Qm9414 and Rut C30

International Nuclear Information System (INIS)

Blanco, M.J.

1991-01-01

Native or pretreated biomass from Onopordum nervosum boiss, has been examined as candidate feedstock for cellulase production by two mutant strain of trichoderma longibrachiatum QM9414 and Rut C30. Batch cultivation methods were evaluated and compared with previous experiments using ball-milled, crystalline cellulose (Solka floc). Batch cultivation of T. longibrachiatum Rut C30 on 55% (W/V) acid pretreated O. nervosum biomass yielded enzyme productivities and activities comparable to those obtained on Solka floc. However, the overall enzyme production performance was lower than on Solka floc at comparable cellulose concentrations. This fact may be due to the accumulation of pretreated by products and lignin in the fermentor.(author)

Associations between accelerated glacier mass wastage and increased summer temperature in coastal regions

Science.gov (United States)

Dyurgerov, M.; McCabe, G.J.

2006-01-01

Low-elevation glaciers in coastal regions of Alaska, the Canadian Arctic, individual ice caps around the Greenland ice sheet, and the Patagonia Ice Fields have an aggregate glacier area of about 332 ?? 103 km 2 and account for approximately 42% of all the glacier area outside the Greenland and Antarctic ice sheets. They have shown volume loss, especially since the end of the 1980s, increasing from about 45% in the 1960s to nearly 67% in 2003 of the total wastage from all glaciers on Earth outside those two largest ice sheets. Thus, a disproportionally large contribution of coastal glacier ablation to sea level rise is evident. We examine cumulative standardized departures (1961-2000 reference period) of glacier mass balances and air temperature data in these four coastal regions. Analyses indicate a strong association between increases in glacier volume losses and summer air temperature at regional and global scales. Increases in glacier volume losses in the coastal regions also coincide with an accelerated rate of ice discharge from outlet glaciers draining the Greenland and West Antarctic ice sheets. These processes imply further increases in sea level rise. ?? 2006 Regents of the University of Colorado.

Spatially inhomogeneous acceleration of electrons in solar flares

Science.gov (United States)

Stackhouse, Duncan J.; Kontar, Eduard P.

2018-04-01

The imaging spectroscopy capabilities of the Reuven Ramaty high energy solar spectroscopic imager (RHESSI) enable the examination of the accelerated electron distribution throughout a solar flare region. In particular, it has been revealed that the energisation of these particles takes place over a region of finite size, sometimes resolved by RHESSI observations. In this paper, we present, for the first time, a spatially distributed acceleration model and investigate the role of inhomogeneous acceleration on the observed X-ray emission properties. We have modelled transport explicitly examining scatter-free and diffusive transport within the acceleration region and compare with the analytic leaky-box solution. The results show the importance of including this spatial variation when modelling electron acceleration in solar flares. The presence of an inhomogeneous, extended acceleration region produces a spectral index that is, in most cases, different from the simple leaky-box prediction. In particular, it results in a generally softer spectral index than predicted by the leaky-box solution, for both scatter-free and diffusive transport, and thus should be taken into account when modelling stochastic acceleration in solar flares.

Particle Acceleration in Multiple Dissipation Regions

OpenAIRE

Arzner, Kaspar; Vlahos, Loukas

2004-01-01

The sharp magnetic discontinuities which naturally appear in solar magnetic flux tubes driven by turbulent photospheric motions are associated with intense currents. \\citet{Par83} proposed that these currents can become unstable to a variety of microscopic processes, with the net result of dramatically enhanced resistivity and heating (nanoflares). The electric fields associated with such ``hot spots'' are also expected to enhance particle acceleration. We test this hypothesis by exact relati...

ACFA and IPAC announce accelerator prizes

CERN Multimedia

CERN Bulletin

2010-01-01

Steve Myers, CERN's Director for Accelerators and Technology. The Asian Committee for Future Accelerators (ACFA) has joined forces with the first International Particle Accelerator Conference, IPAC’10, to award prizes for outstanding work in the field of accelerators. The conference replaces the regional conferences of the Americas, Europe and Asia and will be hosted by the three regions on a rotational basis (see CERN Courier). The ACFA/IPAC’10 Prizes Selection Committee, chaired by Won Namkung of Pohang Accelerator Laboratory, decided on the prizes and the names of the winners at a meeting on 20 January. The awards will be made during IPAC’10, which will be held in Kyoto on 23-28 May. Jie Wei. (Courtesy Tsinghua University.) Steve Myers, Director for Accelerators and Technology at CERN, receives an Achievement Prize for Outstanding Work in the Accelerator Field with no Age Limit “for his numerous outstanding contributions to the design, construction, commissio...

Electrostatic accelerator dielectrics

International Nuclear Information System (INIS)

Cooke, C.M.

1989-05-01

High voltage insulation problems in electrostatic accelerators are discussed. The aim of the analysis is to broaden the knowledge, highlight the characteristics of insulation technology and design strategies to improve use. The basic geometry of the insulation in accelerators is considered. A detailed description of each of the insulation regions is provided. The gas gap insulation of the terminal voltage is found to be sensitive to regions of high electric stress. In order to obtain satisfactory performance from solid support insulation, the attention is focused on the electric stress value and distribution. Potential subjects for discussion and further investigations are given

Mechanistic Insights into Radical-Mediated Oxidation of Tryptophan from ab Initio Quantum Chemistry Calculations and QM/MM Molecular Dynamics Simulations.

Science.gov (United States)

Wood, Geoffrey P F; Sreedhara, Alavattam; Moore, Jamie M; Wang, John; Trout, Bernhardt L

2016-05-12

An assessment of the mechanisms of (•)OH and (•)OOH radical-mediated oxidation of tryptophan was performed using density functional theory calculations and ab initio plane-wave Quantum Mechanics/Molecular Mechanics (QM/MM) molecular dynamics simulations. For the (•)OH reactions, addition to the pyrrole ring at position 2 is the most favored site with a barrierless reaction in the gas phase. The subsequent degradation of this adduct through a H atom transfer to water was intermittently observed in aqueous-phase molecular dynamics simulations. For the (•)OOH reactions, addition to the pyrrole ring at position 2 is the most favored pathway, in contrast to the situation in the model system ethylene, where concerted addition to the double bond is preferred. From the (•)OOH position 2 adduct QM/MM simulations show that formation of oxy-3-indolanaline occurs readily in an aqueous environment. The observed transformation starts from an initial rupture of the O-O bond followed by a H atom transfer with the accompanying loss of an (•)OH radical to solution. Finally, classical molecular dynamics simulations were performed to equate observed differential oxidation rates of various tryptophan residues in monoclonal antibody fragments. It was found that simple parameters derived from simulation correlate well with the experimental data.

Cellulase production by two mutant strain of Trichoderma longibranchiatum QM 9414 and Rut C30

International Nuclear Information System (INIS)

Blanco, M. J.

1991-01-01

Native or pretreated biomass from Onopordum nervosum Boiss, has been examined as candidate feedstock for cellulase production by two mutant strain of Trichoderma Ionqibrachiatum QM9414 and Rut C30. Batch cultivation methods were evaluated and compared with previous experiments using ball-milled, crystalline cellulose (Solka floc). Batch cultivation of T. Ionqibrachiatum Rut C30 on 5% (w/v) acid pretreated O. nervosum biomass yielded enzyme productivities and activities comparable to those obtained on Solka floc. However, the overall enzyme production performance was lower than on Solka floc at comparable cellulose concentrations. This fact may be due to the accumulation of pretreated by products and lignin in the ferment. (Author) 40 refs

Accelerating transition dynamics in city regions: A qualitative modeling perspective

NARCIS (Netherlands)

P.J. Valkering (Pieter); Yücel, G. (Gönenç); Gebetsroither-Geringer, E. (Ernst); Markvica, K. (Karin); Meynaerts, E. (Erika); N. Frantzeskaki (Niki)

2017-01-01

textabstractIn this article, we take stock of the findings from conceptual and empirical work on the role of transition initiatives for accelerating transitions as input for modeling acceleration dynamics. We applied the qualitative modeling approach of causal loop diagrams to capture the dynamics

Simulating chemical reactions in ionic liquids using QM/MM methodology.

Science.gov (United States)

Acevedo, Orlando

2014-12-18

The use of ionic liquids as a reaction medium for chemical reactions has dramatically increased in recent years due in large part to the numerous reported advances in catalysis and organic synthesis. In some extreme cases, ionic liquids have been shown to induce mechanistic changes relative to conventional solvents. Despite the large interest in the solvents, a clear understanding of the molecular factors behind their chemical impact is largely unknown. This feature article reviews our efforts developing and applying mixed quantum and molecular mechanical (QM/MM) methodology to elucidate the microscopic details of how these solvents operate to enhance rates and alter mechanisms for industrially and academically important reactions, e.g., Diels-Alder, Kemp eliminations, nucleophilic aromatic substitutions, and β-eliminations. Explicit solvent representation provided the medium dependence of the activation barriers and atomic-level characterization of the solute-solvent interactions responsible for the experimentally observed "ionic liquid effects". Technical advances are also discussed, including a linear-scaling pairwise electrostatic interaction alternative to Ewald sums, an efficient polynomial fitting method for modeling proton transfers, and the development of a custom ionic liquid OPLS-AA force field.

Effects of Absorbing Aerosols on Accelerated Melting of Snowpack in the Hindu-Kush-Himalayas-Tibetan Plateau Region

Science.gov (United States)

Lau, William K.; Kyu-Myong, Kim; Yasunari, Teppei; Gautam, Ritesh; Hsu, Christina

2011-01-01

The impacts of absorbing aerosol on melting of snowpack in the Hindu-Kush-Himalayas-Tibetan Plateau (HKHT) region are studied using in-situ, satellite observations, and GEOS-5 GCM. Based on atmospheric black carbon measurements from the Pyramid observation ( 5 km elevation) in Mt. Everest, we estimate that deposition of black carbon on snow surface will give rise to a reduction in snow surface albedo of 2- 5 %, and an increased annual runoff of 12-34% for a typical Tibetan glacier. Examination of satellite reflectivity and re-analysis data reveals signals of possible impacts of dust and black carbon in darkening the snow surface, and accelerating spring melting of snowpack in the HKHT, following a build-up of absorbing aerosols in the Indo-Gangetic Plain. Results from GCM experiments show that 8-10% increase in the rate of melting of snowpack over the western Himalayas and Tibetan Plateau can be attributed to the elevated-heat-pump (EHP) feedback effect, initiated from the absorption of solar radiation by dust and black carbon accumulated to great height ( 5 km) over the Indo-Gangetic Plain and Himalayas foothills in the pre-monsoon season (April-May). The accelerated melting of the snowpack is enabled by an EHP-induced atmosphere-land-snowpack positive feedback involving a) orographic forcing of the monsoon flow by the complex terrain, and thermal forcing of the HKHT region, leading to increased moisture, cloudiness and rainfall over the Himalayas foothills and northern India, b) warming of the upper troposphere over the Tibetan Plateau, and c) an snow albedo-temperature feedback initiated by a transfer of latent and sensible heat from a warmer atmosphere over the HKHT to the underlying snow surface. Results from ongoing modeling work to assess the relative roles of EHP vs. snow-darkening effects on accelerated melting of snowpack in HKHT region will also be discussed.

LINEAR ACCELERATOR

Science.gov (United States)

Christofilos, N.C.; Polk, I.J.

1959-02-17

Improvements in linear particle accelerators are described. A drift tube system for a linear ion accelerator reduces gap capacity between adjacent drift tube ends. This is accomplished by reducing the ratio of the diameter of the drift tube to the diameter of the resonant cavity. Concentration of magnetic field intensity at the longitudinal midpoint of the external sunface of each drift tube is reduced by increasing the external drift tube diameter at the longitudinal center region.

Cellulase production by two mutant strain of Trichoderma longibranchiatum QM9414 and Rut C30; Produccion de celulasas a partir de dos cepas hiperproductoras de trichoderma longibranchiatum Qm9-41 4 y Rut C30

Energy Technology Data Exchange (ETDEWEB)

Blanco, M J

1991-07-01

Native or pretreated biomass from Onopordum nervosum Boiss, has been examined as candidate feedstock for cellulase production by two mutant strain of Trichoderma Ionqibrachiatum QM9414 and Rut C30. Batch cultivation methods were evaluated and compared with previous experiments using ball-milled, crystalline cellulose (Solka floc). Batch cultivation of T. Ionqibrachiatum Rut C30 on 5% (w/v) acid pretreated O. nervosum biomass yielded enzyme productivities and activities comparable to those obtained on Solka floc. However, the overall enzyme production performance was lower than on Solka floc at comparable cellulose concentrations. This fact may be due to the accumulation of pretreated by products and lignin in the ferment. (Author) 40 refs.

Adaptive switching of interaction potentials in the time domain: an extended Lagrangian approach tailored to transmute force field to QM/MM simulations and back.

Science.gov (United States)

Böckmann, Marcus; Doltsinis, Nikos L; Marx, Dominik

2015-06-09

An extended Lagrangian formalism that allows for a smooth transition between two different descriptions of interactions during a molecular dynamics simulation is presented. This time-adaptive method is particularly useful in the context of multiscale simulation as it provides a sound recipe to switch on demand between different hierarchical levels of theory, for instance between ab initio ("QM") and force field ("MM") descriptions of a given (sub)system in the course of a molecular dynamics simulation. The equations of motion can be integrated straightforwardly using the usual propagators, such as the Verlet algorithm. First test cases include a bath of harmonic oscillators, of which a subset is switched to a different force constant and/or equilibrium position, as well as an all-MM to QM/MM transition in a hydrogen-bonded water dimer. The method is then applied to a smectic 8AB8 liquid crystal and is shown to be able to switch dynamically a preselected 8AB8 molecule from an all-MM to a QM/MM description which involves partition boundaries through covalent bonds. These examples show that the extended Lagrangian approach is not only easy to implement into existing code but that it is also efficient and robust. The technique moreover provides easy access to a conserved energy quantity, also in cases when Nosé-Hoover chain thermostatting is used throughout dynamical switching. A simple quadratic driving potential proves to be sufficient to guarantee a smooth transition whose time scale can be easily tuned by varying the fictitious mass parameter associated with the auxiliary variable used to extend the Lagrangian. The method is general and can be applied to time-adaptive switching on demand between two different levels of theory within the framework of hybrid scale-bridging simulations.

The influence of zinc(II) on thioredoxin/glutathione disulfide exchange: QM/MM studies to explore how zinc(II) accelerates exchange in higher dielectric environments.

Science.gov (United States)

Kurian, Roby; Bruce, Mitchell R M; Bruce, Alice E; Amar, François G

2015-08-01

QM/MM studies were performed to explore the energetics of exchange reactions of glutathione disulfide (GSSG) and the active site of thioredoxin [Cys32-Gly33-Pro34-Cys35] with and without zinc(II), in vacuum and solvated models. The activation energy for exchange, in the absence of zinc, is 29.7 kcal mol(-1) for the solvated model. This is 3.3 kcal mol(-1) higher than the activation energy for exchange in the gas phase, due to ground state stabilization of the active site Cys-32 thiolate in a polar environment. In the presence of zinc, the activation energy for exchange is 4.9 kcal mol(-1) lower than in the absence of zinc (solvated models). The decrease in activation energy is attributed to stabilization of the charge-separated transition state, which has a 4-centered, cyclic arrangement of Zn-S-S-S with an estimated dipole moment of 4.2 D. A difference of 4.9 kcal mol(-1) in activation energy would translate to an increase in rate by a factor of about 4000 for zinc-assisted thiol-disulfide exchange. The calculations are consistent with previously reported experimental results, which indicate that metal-thiolate, disulfide exchange rates increase as a function of solvent dielectric. This trend is opposite to that observed for the influence of the dielectric environment on the rate of thiol-disulfide exchange in the absence of metal. The results suggest a dynamic role for zinc in thiol-disulfide exchange reactions, involving accessible cysteine sites on proteins, which may contribute to redox regulation and mechanistic pathways during oxidative stress.

On the structure of acceleration in turbulence

DEFF Research Database (Denmark)

Liberzon, A.; Lüthi, B.; Holzner, M.

2012-01-01

Acceleration and spatial velocity gradients are obtained simultaneously in an isotropic turbulent flow via three dimensional particle tracking velocimetry. We observe two distinct populations of intense acceleration events: one in flow regions of strong strain and another in regions of strong...... vorticity. Geometrical alignments with respect to vorticity vector and to the strain eigenvectors, curvature of Lagrangian trajectories and of streamlines for total acceleration, and for its convective part, , are studied in detail. We discriminate the alignment features of total and convective acceleration...... statistics, which are genuine features of turbulent nature from those of kinematic nature. We find pronounced alignment of acceleration with vorticity. Similarly, and especially are predominantly aligned at 45°with the most stretching and compressing eigenvectors of the rate of the strain tensor...

Complex calculation and improvement of beam shaping and accelerating system of the ''Sokol'' small-size electrostatic accelerator

International Nuclear Information System (INIS)

Simonenko, A.V.; Pistryak, V.M.; Zats, A.V.; Levchenko, Yu.Z.; Kuz'menko, V.V.

1987-01-01

Features of charged particle accelerated beam shaping in the electrostatic part of the ''Sokol'' small-size accelerator are considered in complex taking into account the electrode real geometry. Effect of the extracting, accelerating electorde potential and accelerator total voltage on beam behaviour is investigated. A modified variation of the beam shaping system, allowing to decrease 2 times the required interval of accelerating electrode potential adjustment and to decrease the beam size in the starting acceleration region, is presented. It permits to simplify the construction and to improve accelerator operation. Comparison of experimental and calculational data on the beam in the improved accelerator variation is carried out. Effect of peripheral parts of accelerating tube electrodes on the beam is investigated

How Many Conformations Need To Be Sampled To Obtain Converged QM/MM Energies? The Curse of Exponential Averaging.

Science.gov (United States)

Ryde, Ulf

2017-11-14

Combined quantum mechanical and molecular mechanical (QM/MM) calculations is a popular approach to study enzymatic reactions. They are often based on a set of minimized structures obtained on snapshots from a molecular dynamics simulation to include some dynamics of the enzyme. It has been much discussed how the individual energies should be combined to obtain a final estimate of the energy, but the current consensus seems to be to use an exponential average. Then, the question is how many snapshots are needed to reach a reliable estimate of the energy. In this paper, I show that the question can be easily be answered if it is assumed that the energies follow a Gaussian distribution. Then, the outcome can be simulated based on a single parameter, σ, the standard deviation of the QM/MM energies from the various snapshots, and the number of required snapshots can be estimated once the desired accuracy and confidence of the result has been specified. Results for various parameters are presented, and it is shown that many more snapshots are required than is normally assumed. The number can be reduced by employing a cumulant approximation to second order. It is shown that most convergence criteria work poorly, owing to the very bad conditioning of the exponential average when σ is large (more than ∼7 kJ/mol), because the energies that contribute most to the exponential average have a very low probability. On the other hand, σ serves as an excellent convergence criterion.

The Auroral Field-aligned Acceleration - Cluster Results

Science.gov (United States)

Vaivads, A.; Cluster Auroral Team

The four Cluster satellites cross the auroral field lines at altitudes well above most of acceleration region. Thus, the orbit is appropriate for studies of the generator side of this region. We consider the energy transport towards the acceleration region and different mechanisms for generating the potential drop. Using data from Cluster we can also for the first time study the dynamics of the generator on a minute scale. We present data from a few auroral field crossings where Cluster are in conjunction with DMSP satellites. We use electric and magnetic field data to estimate electrostatic po- tential along the satellite orbit, Poynting flux as well as the presence of plasma waves. These we can compare with data from particle and wave instruments on Cluster and on low latitude satellites to try to make a consistent picture of the acceleration region formation in these cases. Preliminary results show close agreement both between in- tegrated potential values at Cluster and electron peak energies at DMSP as well as close agreement between the integrated Poynting flux values at Cluster and the elec- tron energy flux at DMSP. At the end we draw a parallels between auroral electron acceleration and electron acceleration at the magnetopause.

Accelerated Educational Change; The Annual Western Regional Conference on Testing Problems (15th, San Francisco, California, May 6, 1966).

Science.gov (United States)

Educational Testing Service, Princeton, NJ.

The 1966 meeting of the Western Regional Conference on Testing Problems dealt with accelerated educational change. The following speeches were presented: (1) "Access to Higher Education: Implications for Future Planning" by Richard Pearson; (2) "The Differentiated Youth: A Challenge to Traditional Institutions" by Joseph D. Lohman; (3) "Teaching…

High-energy inverse free-electron laser accelerator

International Nuclear Information System (INIS)

Courant, E.D.; Pellegrini, C.; Zakowicz, W.

1985-01-01

We study the inverse free electron laser (IFEL) accelerator and show that it can accelerate electrons to the few hundred GeV region with average acceleration rates of the order of 200 meV/m. Several possible accelerating structures are analyzed, and the effect of synchrotron radiation losses is studied. The longitudinal phase stability of accelerated particles is also analyzed. A Hamiltonian description, which takes into account the dissipative features of the IFEL accelerator, is introduced to study perturbations from the resonant acceleration. Adiabatic invariants are obtained and used to estimate the change of the electron phase space density during the acceleration process

A polarizable QM/MM approach to the molecular dynamics of amide groups solvated in water

Energy Technology Data Exchange (ETDEWEB)

Schwörer, Magnus; Wichmann, Christoph; Tavan, Paul, E-mail: tavan@physik.uni-muenchen.de [Lehrstuhl für BioMolekulare Optik, Ludwig-Maximilians Universität München, Oettingenstr. 67, 80538 München (Germany)

2016-03-21

The infrared (IR) spectra of polypeptides are dominated by the so-called amide bands. Because they originate from the strongly polar and polarizable amide groups (AGs) making up the backbone, their spectral positions sensitively depend on the local electric fields. Aiming at accurate computations of these IR spectra by molecular dynamics (MD) simulations, which derive atomic forces from a hybrid quantum and molecular mechanics (QM/MM) Hamiltonian, here we consider the effects of solvation in bulk liquid water on the amide bands of the AG model compound N-methyl-acetamide (NMA). As QM approach to NMA we choose grid-based density functional theory (DFT). For the surrounding MM water, we develop, largely based on computations, a polarizable molecular mechanics (PMM) model potential called GP6P, which features six Gaussian electrostatic sources (one induced dipole, five static partial charge distributions) and, therefore, avoids spurious distortions of the DFT electron density in hybrid DFT/PMM simulations. Bulk liquid GP6P is shown to have favorable properties at the thermodynamic conditions of the parameterization and beyond. Lennard-Jones (LJ) parameters of the DFT fragment NMA are optimized by comparing radial distribution functions in the surrounding GP6P liquid with reference data obtained from a “first-principles” DFT-MD simulation. Finally, IR spectra of NMA in GP6P water are calculated from extended DFT/PMM-MD trajectories, in which the NMA is treated by three different DFT functionals (BP, BLYP, B3LYP). Method-specific frequency scaling factors are derived from DFT-MD simulations of isolated NMA. The DFT/PMM-MD simulations with GP6P and with the optimized LJ parameters then excellently predict the effects of aqueous solvation and deuteration observed in the IR spectra of NMA. As a result, the methods required to accurately compute such spectra by DFT/PMM-MD also for larger peptides in aqueous solution are now at hand.

Source Population and Acceleration Location of Suprathermal Heavy Ions in Corotating Interaction Regions

Energy Technology Data Exchange (ETDEWEB)

Filwett, R. J.; Desai, M. I. [University of Texas at San Antonio, San Antonio, TX (United States); Dayeh, M. A.; Broiles, T. W. [Southwest Research Institute, San Antonio, TX (United States)

2017-03-20

We have analyzed the ∼20–320 keV nucleon{sup −1} suprathermal (ST) heavy ion abundances in 41 corotating interaction regions (CIRs) observed by the Wind spacecraft from 1995 January to 2008 December. Our results are: (1) the CIR Fe/CNO and NeS/CNO ratios vary with the sunspot number, with values being closer to average solar energetic particle event values during solar maxima and lower than nominal solar wind values during solar minima. The physical mechanism responsible for the depleted abundances during solar minimum remains an open question. (2) The Fe/CNO increases with energy in the 6 events that occurred during solar maximum, while no such trends are observed for the 35 events during solar minimum. (3) The Fe/CNO shows no correlation with the average solar wind speed. (4) The Fe/CNO is well correlated with the corresponding upstream ∼20–320 keV nucleon{sup −1} Fe/CNO and not with the solar wind Fe/O measured by ACE in 31 events. Using the correlations between the upstream ∼20–40 keV nucleon{sup −1} Fe/CNO and the ∼20–320 keV nucleon{sup −1} Fe/CNO in CIRs, we estimate that, on average, the ST particles traveled ∼2 au along the nominal Parker spiral field line, which corresponds to upper limits for the radial distance of the source or acceleration location of ∼1 au beyond Earth orbit. Our results are consistent with those obtained from recent surveys, and confirm that CIR ST heavy ions are accelerated more locally, and are at odds with the traditional viewpoint that CIR ions seen at 1 au are bulk solar wind ions accelerated between 3 and 5 au.

Shielding experiments for accelerator facilities

Energy Technology Data Exchange (ETDEWEB)

Nakashima, Hiroshi; Tanaka, Susumu; Sakamoto, Yukio [Japan Atomic Energy Research Inst., Tokai, Ibaraki (Japan). Tokai Research Establishment] [and others

2000-06-01

A series of shielding experiments was carried out by using AVF cyclotron accelerator of TIARA at JAERI in order to validate shielding design methods for accelerator facilities in intermediate energy region. In this paper neutron transmission experiment through thick shields and radiation streaming experiment through a labyrinth are reported. (author)

Shielding experiments for accelerator facilities

International Nuclear Information System (INIS)

Nakashima, Hiroshi; Tanaka, Susumu; Sakamoto, Yukio

2000-01-01

A series of shielding experiments was carried out by using AVF cyclotron accelerator of TIARA at JAERI in order to validate shielding design methods for accelerator facilities in intermediate energy region. In this paper neutron transmission experiment through thick shields and radiation streaming experiment through a labyrinth are reported. (author)

COROTATING INTERACTION REGION ASSOCIATED SUPRATHERMAL HELIUM ION ENHANCEMENTS AT 1 AU: EVIDENCE FOR LOCAL ACCELERATION AT THE COMPRESSION REGION TRAILING EDGE

International Nuclear Information System (INIS)

Ebert, R. W.; Dayeh, M. A.; Desai, M. I.; Mason, G. M.

2012-01-01

We examined the temporal profiles and peak intensities for 73 corotating interaction region (CIR)-associated suprathermal (∼0.1-8 MeV nucleon –1 ) helium (He) ion enhancements identified at STEREO-A, STEREO-B, and/or Advanced Composition Explorer between 2007 and 2010. We found that in most events the peak He intensity times were well organized by the CIR compression region trailing edge, regardless of whether or not a reverse shock was present. Out of these events, 19% had their 0.193 MeV nucleon –1 He intensities peak within 1 hr and 50% within 4.75 hr of the CIR trailing edge, the distribution having a 1σ value of 7.3 hr. Events with a 0.193 MeV nucleon –1 He intensity peak time within 1σ of the CIR trailing edge showed a positive correlation between the ∼0.1 and 0.8 MeV nucleon –1 He peak intensities and magnetic compression ratios in events both with and without a reverse shock. The peak intensities in all other events showed little to moderate correlation between these parameters. Our results provide evidence that some fraction of the CIR-associated –1 He intensity enhancements observed at 1 AU are locally driven. We suggest an extended source for the CIR-associated energetic particles observed at 1 AU where the –1 ions are accelerated locally at or near the CIR trailing edge, the intensities being proportional to the local compression ratio strength, while the >MeV particles are likely accelerated at CIR-driven shocks beyond Earth orbit.

Inhibition of Mammalian 15-Lipoxygenase by Three Ebselen-like Drugs. A QM/MM and MM/PBSA Comparative Study.

Science.gov (United States)

Cebrián-Prats, Anna; Rovira, Tiffani; Saura, Patricia; González-Lafont, Àngels; Lluch, José M

2017-12-28

Ebselen is a potent competitive inhibitor of the active form of rabbit 15-lipoxygenase, an enzyme involved in many inflammatory diseases. Light-induced Z-to-E isomerization of the ebselen-like 2-(3-benzylidene)-3-oxo-2,3-dihydrobenzo[b]thiophene-7-carboxylic acid methyl ester (BODTCM) molecule was used to convert the weak (Z)-BOTDCM inhibitor into the (E)-isomer with much higher inhibitory capacity. In this study, the binding modes of ebselen, (E)-BOTDCM and (Z)-BOTDCM, have been analyzed to provide molecular insights on the inhibitory potency of ebselen and on the geometric-isomer specificity of (E)- and (Z)-BOTDCM inhibitors. The inhibitor-enzyme structures obtained from docking and molecular dynamics simulations as well as from QM/MM calculations show that the inhibitor molecules are not coordinated to the nonheme iron in the active site. Thermal motion allows ebselen and (E)-BOTDCM to visit a wide range of the configurational space competing with the polyunsaturated fatty acid for binding at the active site. Both molecules present similar MM/PBSA binding free energies. The energy penalty for the bigger geometric deformation undergone by (E)-BODTCM would explain its lower inhibitor potency. The (Z)-isomer is the weakest inhibitor because thermal motion moves it to a region very far from the first coordination sphere of Fe, where it could not compete with the fatty acid substrate.

Photoinjector optimization using a derivative-free, model-based trust-region algorithm for the Argonne Wakefield Accelerator

Science.gov (United States)

Neveu, N.; Larson, J.; Power, J. G.; Spentzouris, L.

2017-07-01

Model-based, derivative-free, trust-region algorithms are increasingly popular for optimizing computationally expensive numerical simulations. A strength of such methods is their efficient use of function evaluations. In this paper, we use one such algorithm to optimize the beam dynamics in two cases of interest at the Argonne Wakefield Accelerator (AWA) facility. First, we minimize the emittance of a 1 nC electron bunch produced by the AWA rf photocathode gun by adjusting three parameters: rf gun phase, solenoid strength, and laser radius. The algorithm converges to a set of parameters that yield an emittance of 1.08 μm. Second, we expand the number of optimization parameters to model the complete AWA rf photoinjector (the gun and six accelerating cavities) at 40 nC. The optimization algorithm is used in a Pareto study that compares the trade-off between emittance and bunch length for the AWA 70MeV photoinjector.

Accelerating regional atrophy rates in the progression from normal aging to Alzheimer's disease

International Nuclear Information System (INIS)

Sluimer, Jasper D.; Flier, Wiesje M. van der; Scheltens, Philip; Karas, Giorgos B.; Barkhof, Frederik; Schijndel, Ronald van; Barnes, Josephine; Boyes, Richard G.; Cover, Keith S.; Olabarriaga, Silvia D.; Fox, Nick C.; Vrenken, Hugo

2009-01-01

We investigated progression of atrophy in vivo, in Alzheimer's disease (AD), and mild cognitive impairment (MCI). We included 64 patients with AD, 44 with MCI and 34 controls with serial MRI examinations (interval 1.8 ± 0.7 years). A nonlinear registration algorithm (fluid) was used to calculate atrophy rates in six regions: frontal, medial temporal, temporal (extramedial), parietal, occipital lobes and insular cortex. In MCI, the highest atrophy rate was observed in the medial temporal lobe, comparable with AD. AD patients showed even higher atrophy rates in the extramedial temporal lobe. Additionally, atrophy rates in frontal, parietal and occipital lobes were increased. Cox proportional hazard models showed that all regional atrophy rates predicted conversion to AD. Hazard ratios varied between 2.6 (95% confidence interval (CI) = 1.1-6.2) for occipital atrophy and 15.8 (95% CI = 3.5-71.8) for medial temporal lobe atrophy. In conclusion, atrophy spreads through the brain with development of AD. MCI is marked by temporal lobe atrophy. In AD, atrophy rate in the extramedial temporal lobe was even higher. Moreover, atrophy rates also accelerated in parietal, frontal, insular and occipital lobes. Finally, in nondemented elderly, medial temporal lobe atrophy was most predictive of progression to AD, demonstrating the involvement of this region in the development of AD. (orig.)

Target shape effects on monoenergetic GeV proton acceleration

Energy Technology Data Exchange (ETDEWEB)

Chen Min; Yu Tongpu; Pukhov, Alexander [Institut fuer Theoretische Physik I, Heinrich-Heine-Universitaet Duesseldorf, 40225 Duesseldorf (Germany); Sheng Zhengming, E-mail: pukhov@tp1.uni-duesseldorf.d [Department of Physics, Shanghai Jiao Tong University, Shanghai 200240 (China)

2010-04-15

When a circularly polarized laser pulse interacts with a foil target, there are three stages: pre-hole-boring, hole-boring and light sail acceleration. We study the electron and ion dynamics in the first stage and find the minimum foil thickness requirement for a given laser intensity. Based on this analysis, we propose using a shaped foil for ion acceleration, whose thickness varies transversely to match the laser intensity. Then, the target evolves into three regions: the acceleration, transparency and deformation regions. In the acceleration region, the target can be uniformly accelerated producing a mono-energetic and spatially collimated ion beam. Detailed numerical simulations are performed to check the feasibility and robustness of this scheme, such as the influence of shape factors and surface roughness. A GeV mono-energetic proton beam is observed in three-dimensional particle-in-cell simulations when a laser pulse with a focus intensity of 10{sup 22} W cm{sup -2} is used. The energy conversion efficiency of the laser pulse to the accelerated proton beam with the simulation parameters is more than 23%.

Target shape effects on monoenergetic GeV proton acceleration

International Nuclear Information System (INIS)

Chen Min; Yu Tongpu; Pukhov, Alexander; Sheng Zhengming

2010-01-01

When a circularly polarized laser pulse interacts with a foil target, there are three stages: pre-hole-boring, hole-boring and light sail acceleration. We study the electron and ion dynamics in the first stage and find the minimum foil thickness requirement for a given laser intensity. Based on this analysis, we propose using a shaped foil for ion acceleration, whose thickness varies transversely to match the laser intensity. Then, the target evolves into three regions: the acceleration, transparency and deformation regions. In the acceleration region, the target can be uniformly accelerated producing a mono-energetic and spatially collimated ion beam. Detailed numerical simulations are performed to check the feasibility and robustness of this scheme, such as the influence of shape factors and surface roughness. A GeV mono-energetic proton beam is observed in three-dimensional particle-in-cell simulations when a laser pulse with a focus intensity of 10 22 W cm -2 is used. The energy conversion efficiency of the laser pulse to the accelerated proton beam with the simulation parameters is more than 23%.

A multiscale quantum mechanics/electromagnetics method for device simulations.

Science.gov (United States)

Yam, ChiYung; Meng, Lingyi; Zhang, Yu; Chen, GuanHua

2015-04-07

Multiscale modeling has become a popular tool for research applying to different areas including materials science, microelectronics, biology, chemistry, etc. In this tutorial review, we describe a newly developed multiscale computational method, incorporating quantum mechanics into electronic device modeling with the electromagnetic environment included through classical electrodynamics. In the quantum mechanics/electromagnetics (QM/EM) method, the regions of the system where active electron scattering processes take place are treated quantum mechanically, while the surroundings are described by Maxwell's equations and a semiclassical drift-diffusion model. The QM model and the EM model are solved, respectively, in different regions of the system in a self-consistent manner. Potential distributions and current densities at the interface between QM and EM regions are employed as the boundary conditions for the quantum mechanical and electromagnetic simulations, respectively. The method is illustrated in the simulation of several realistic systems. In the case of junctionless field-effect transistors, transfer characteristics are obtained and a good agreement between experiments and simulations is achieved. Optical properties of a tandem photovoltaic cell are studied and the simulations demonstrate that multiple QM regions are coupled through the classical EM model. Finally, the study of a carbon nanotube-based molecular device shows the accuracy and efficiency of the QM/EM method.

Understanding the effects of electronic polarization and delocalization on charge-transport levels in oligoacene systems

KAUST Repository

Sutton, Christopher; Tummala, Naga Rajesh; Kemper, Travis; Aziz, Saadullah G.; Sears, John; Coropceanu, Veaceslav; Bredas, Jean-Luc

2017-01-01

Electronic polarization and charge delocalization are important aspects that affect the charge-transport levels in organic materials. Here, using a quantum mechanical/ embedded-charge (QM/EC) approach based on a combination of the long-range corrected omega B97X-D exchange-correlation functional (QM) and charge model 5 (CM5) point-charge model (EC), we evaluate the vertical detachment energies and polarization energies of various sizes of crystalline and amorphous anionic oligoacene clusters. Our results indicate that QM/EC calculations yield vertical detachment energies and polarization energies that compare well with the experimental values obtained from ultraviolet photoemission spectroscopy measurements. In order to understand the effect of charge delocalization on the transport levels, we considered crystalline naphthalene systems with QM regions including one or five-molecules. The results for these systems show that the delocalization and polarization effects are additive; therefore, allowing for electron delocalization by increasing the size of the QM region leads to the additional stabilization of the transport levels. Published by AIP Publishing.

Understanding the effects of electronic polarization and delocalization on charge-transport levels in oligoacene systems

KAUST Repository

Sutton, Christopher

2017-06-13

Electronic polarization and charge delocalization are important aspects that affect the charge-transport levels in organic materials. Here, using a quantum mechanical/ embedded-charge (QM/EC) approach based on a combination of the long-range corrected omega B97X-D exchange-correlation functional (QM) and charge model 5 (CM5) point-charge model (EC), we evaluate the vertical detachment energies and polarization energies of various sizes of crystalline and amorphous anionic oligoacene clusters. Our results indicate that QM/EC calculations yield vertical detachment energies and polarization energies that compare well with the experimental values obtained from ultraviolet photoemission spectroscopy measurements. In order to understand the effect of charge delocalization on the transport levels, we considered crystalline naphthalene systems with QM regions including one or five-molecules. The results for these systems show that the delocalization and polarization effects are additive; therefore, allowing for electron delocalization by increasing the size of the QM region leads to the additional stabilization of the transport levels. Published by AIP Publishing.

General base catalysis for cleavage by the active-site cytosine of the hepatitis delta virus ribozyme: QM/MM calculations establish chemical feasibility

Czech Academy of Sciences Publication Activity Database

Banáš, Pavel; Rulíšek, Lubomír; Hánošová, V.; Svozil, Daniel; Walter, N.G.; Šponer, Jiří; Otyepka, Michal

2008-01-01

Roč. 112, č. 35 (2008), s. 11177-11187 ISSN 1520-6106 R&D Projects: GA MŠk LC512; GA MŠk(CZ) LC06030; GA AV ČR(CZ) IAA400040802; GA AV ČR 1QS500040581 Grant - others:NIH(US) GM62357 Institutional research plan: CEZ:AV0Z40550506; CEZ:AV0Z50040507; CEZ:AV0Z50040702 Keywords : HDV ribozyme * catalysis * QM/MM calculations Subject RIV: CF - Physical ; Theoretical Chemistry Impact factor: 4.189, year: 2008

Theoretical study of electron transfer mechanism in biological systems with a QM (MRSCI+DFT)/MM method

Energy Technology Data Exchange (ETDEWEB)

Takada, Toshikazu [Research Program for Computational Science, RIKEN 2-1, Hirosawa, Wako, Saitama 351-0198 (Japan)

2007-07-15

The goal of this project is to understand the charge separation mechanisms in biological systems using the molecular orbital theories. Specially, the charge separation in the photosynthetic reaction center is focused on, since the efficiency in use of the solar energy is extraordinary and the reason for it is still kept unknown. Here, a QM/MM theoretical scheme is employed to take the effects of the surrounding proteins onto the pigments into account. To describe such excited electronic structures, a unified theory by MRSCI and DFT is newly invented. For atoms in the MM space, a new sampling method has also been created, based on the statistical physics. By using these theoretical framework, the excited and positively charged states of the special pair, that is, chlorophyll dimmer are planning to be calculated this year.

Theoretical study of electron transfer mechanism in biological systems with a QM (MRSCI+DFT)/MM method

International Nuclear Information System (INIS)

Takada, Toshikazu

2007-01-01

The goal of this project is to understand the charge separation mechanisms in biological systems using the molecular orbital theories. Specially, the charge separation in the photosynthetic reaction center is focused on, since the efficiency in use of the solar energy is extraordinary and the reason for it is still kept unknown. Here, a QM/MM theoretical scheme is employed to take the effects of the surrounding proteins onto the pigments into account. To describe such excited electronic structures, a unified theory by MRSCI and DFT is newly invented. For atoms in the MM space, a new sampling method has also been created, based on the statistical physics. By using these theoretical framework, the excited and positively charged states of the special pair, that is, chlorophyll dimmer are planning to be calculated this year

Laser-driven acceleration with Bessel beam

International Nuclear Information System (INIS)

Imasaki, Kazuo; Li, Dazhi

2005-01-01

A new approach of laser-driven acceleration with Bessel beam is described. Bessel beam, in contrast to the Gaussian beam, shows diffraction-free'' characteristics in its propagation, which implies potential in laser-driven acceleration. But a normal laser, even if the Bessel beam, laser can not accelerate charged particle efficiently because the difference of velocity between the particle and photon makes cyclic acceleration and deceleration phase. We proposed a Bessel beam truncated by a set of annular slits those makes several special regions in its travelling path, where the laser field becomes very weak and the accelerated particles are possible to receive no deceleration as they undergo decelerating phase. Thus, multistage acceleration is realizable with high gradient. In a numerical computation, we have shown the potential of multistage acceleration based on a three-stage model. (author)

Equipartitioning in linear accelerators

International Nuclear Information System (INIS)

Jameson, R.A.

1982-01-01

Emittance growth has long been a concern in linear accelerators, as has the idea that some kind of energy balance, or equipartitioning, between the degrees of freedom, would ameliorate the growth. M. Prome observed that the average transverse and longitudinal velocity spreads tend to equalize as current in the channel is increased, while the sum of the energy in the system stays nearly constant. However, only recently have we shown that an equipartitioning requirement on a bunched injected beam can indeed produce remarkably small emittance growth. The simple set of equations leading to this condition are outlined. At the same time, Hofmann has investigated collective instabilities in transported beams and has identified thresholds and regions in parameter space where instabilities occur. Evidence is presented that shows transport system boundaries to be quite accurate in computer simulations of accelerating systems. Discussed are preliminary results of efforts to design accelerators that avoid parameter regions where emittance is affected by the instabilities identified by Hofmann. These efforts suggest that other mechanisms are present. The complicated behavior of the RFQ linac in this framework also is shown

Effect of accelerating gap geometry on the beam breakup instability in linear induction accelerators

International Nuclear Information System (INIS)

Miller, R.B.; Marder, B.M.; Coleman, P.D.; Clark, R.E.

1988-01-01

The electron beam in a linear induction accelerator is generally susceptible to growth of the transverse beam breakup instability. In this paper we analyze a new technique for reducing the transverse coupling between the beam and the accelerating cavities, thereby reducing beam breakup growth. The basic idea is that the most worrisome cavity modes can be cutoff by a short section of coaxial transmission line inserted between the cavity structure and the accelerating gap region. We have used the three-dimensional simulation code SOS to analyze this problem. In brief, we find that the technique works, provided that the lowest TE mode cutoff frequency in the coaxial line is greater than the frequency of the most worrisome TM mode of the accelerating cavity

Report of the joint seminar on heavy-ion nuclear physics and nuclear chemistry in the energy region of tandem accelerators (II)

International Nuclear Information System (INIS)

1986-04-01

A meeting of the second joint seminar on Heavy-Ion Nuclear Physics and Nuclear Chemistry in the Energy Region of Tandem Accelerators was held after an interval of two years at the Tokai Research Establishment of the JAERI, for three days from January 9 to 11, 1986. In the seminar, about 70 nuclear physicists and nuclear chemists of JAERI and other Institutes participated, and 38 papers were presented. These include general reviews and topical subjects which have been developed intensively in recent years, as well as the new results obtained by using the JAERI tandem accelerator. This report is a collection of the papers presented to the seminar. (author)

Vacuum electron acceleration by coherent dipole radiation

International Nuclear Information System (INIS)

Troha, A.L.; Van Meter, J.R.; Landahl, E.C.; Alvis, R.M.; Hartemann, F.V.; Troha, A.L.; Van Meter, J.R.; Landahl, E.C.; Alvis, R.M.; Li, K.; Luhmann, N.C. Jr.; Hartemann, F.V.; Unterberg, Z.A.; Kerman, A.K.

1999-01-01

The validity of the concept of laser-driven vacuum acceleration has been questioned, based on an extrapolation of the well-known Lawson-Woodward theorem, which stipulates that plane electromagnetic waves cannot accelerate charged particles in vacuum. To formally demonstrate that electrons can indeed be accelerated in vacuum by focusing or diffracting electromagnetic waves, the interaction between a point charge and coherent dipole radiation is studied in detail. The corresponding four-potential exactly satisfies both Maxwell's equations and the Lorentz gauge condition everywhere, and is analytically tractable. It is found that in the far-field region, where the field distribution closely approximates that of a plane wave, we recover the Lawson-Woodward result, while net acceleration is obtained in the near-field region. The scaling of the energy gain with wave-front curvature and wave amplitude is studied systematically. copyright 1999 The American Physical Society

The formation of kappa-distribution accelerated electron populations in solar flares

Energy Technology Data Exchange (ETDEWEB)

Bian, Nicolas H.; Stackhouse, Duncan J.; Kontar, Eduard P. [School of Physics and Astronomy, University of Glasgow, Glasgow G12 8QQ (United Kingdom); Emslie, A. Gordon, E-mail: n.bian@physics.gla.ac.uk, E-mail: d.stackhouse.1@research.gla.ac.uk, E-mail: eduard@astro.gla.ac.uk, E-mail: emslieg@wku.edu [Department of Physics and Astronomy, Western Kentucky University, Bowling Green, KY 42101 (United States)

2014-12-01

Driven by recent RHESSI observations of confined loop-top hard X-ray sources in solar flares, we consider stochastic acceleration of electrons in the presence of Coulomb collisions. If electron escape from the acceleration region can be neglected, the electron distribution function is determined by a balance between diffusive acceleration and collisions. Such a scenario admits a stationary solution for the electron distribution function that takes the form of a kappa distribution. We show that the evolution toward this kappa distribution involves a 'wave front' propagating forward in velocity space, so that electrons of higher energy are accelerated later; the acceleration timescales with energy according to τ{sub acc} ∼ E {sup 3/2}. At sufficiently high energies escape from the finite-length acceleration region will eventually dominate. For such energies, the electron velocity distribution function is obtained by solving a time-dependent Fokker-Planck equation in the 'leaky-box' approximation. Solutions are obtained in the limit of a small escape rate from an acceleration region that can effectively be considered a thick target.

Fringing-field effects in acceleration columns

International Nuclear Information System (INIS)

Yavor, M.I.; Weick, H.; Wollnik, H.

1999-01-01

Fringing-field effects in acceleration columns are investigated, based on the fringing-field integral method. Transfer matrices at the effective boundaries of the acceleration column are obtained, as well as the general transfer matrix of the region separating two homogeneous electrostatic fields with different field strengths. The accuracy of the fringing-field integral method is investigated

Yoink: An interaction-based partitioning API.

Science.gov (United States)

Zheng, Min; Waller, Mark P

2018-05-15

Herein, we describe the implementation details of our interaction-based partitioning API (application programming interface) called Yoink for QM/MM modeling and fragment-based quantum chemistry studies. Interactions are detected by computing density descriptors such as reduced density gradient, density overlap regions indicator, and single exponential decay detector. Only molecules having an interaction with a user-definable QM core are added to the QM region of a hybrid QM/MM calculation. Moreover, a set of molecule pairs having density-based interactions within a molecular system can be computed in Yoink, and an interaction graph can then be constructed. Standard graph clustering methods can then be applied to construct fragments for further quantum chemical calculations. The Yoink API is licensed under Apache 2.0 and can be accessed via yoink.wallerlab.org. © 2018 Wiley Periodicals, Inc. © 2018 Wiley Periodicals, Inc.

Benchmarking Quantum Mechanics/Molecular Mechanics (QM/MM) Methods on the Thymidylate Synthase-Catalyzed Hydride Transfer.

Science.gov (United States)

Świderek, Katarzyna; Arafet, Kemel; Kohen, Amnon; Moliner, Vicent

2017-03-14

Given the ubiquity of hydride-transfer reactions in enzyme-catalyzed processes, identifying the appropriate computational method for evaluating such biological reactions is crucial to perform theoretical studies of these processes. In this paper, the hydride-transfer step catalyzed by thymidylate synthase (TSase) is studied by examining hybrid quantum mechanics/molecular mechanics (QM/MM) potentials via multiple semiempirical methods and the M06-2X hybrid density functional. Calculations of protium and tritium transfer in these reactions across a range of temperatures allowed calculation of the temperature dependence of kinetic isotope effects (KIE). Dynamics and quantum-tunneling effects are revealed to have little effect on the reaction rate, but are significant in determining the KIEs and their temperature dependence. A good agreement with experiments is found, especially when computed for RM1/MM simulations. The small temperature dependence of quantum tunneling corrections and the quasiclassical contribution term cancel each other, while the recrossing transmission coefficient seems to be temperature-independent over the interval of 5-40 °C.

High-powered pulsed-ion-beam acceleration and transport

Energy Technology Data Exchange (ETDEWEB)

Humphries, S. Jr.; Lockner, T.R.

1981-11-01

The state of research on intense ion beam acceleration and transport is reviewed. The limitations imposed on ion beam transport by space charge effects and methods available for neutralization are summarized. The general problem of ion beam neutralization in regions free of applied electric fields is treated. The physics of acceleration gaps is described. Finally, experiments on multi-stage ion acceleration are summarized.

High-powered pulsed-ion-beam acceleration and transport

International Nuclear Information System (INIS)

Humphries, S. Jr.; Lockner, T.R.

1981-11-01

The state of research on intense ion beam acceleration and transport is reviewed. The limitations imposed on ion beam transport by space charge effects and methods available for neutralization are summarized. The general problem of ion beam neutralization in regions free of applied electric fields is treated. The physics of acceleration gaps is described. Finally, experiments on multi-stage ion acceleration are summarized

Ultra-relativistic ion acceleration in the laser-plasma interactions

Energy Technology Data Exchange (ETDEWEB)

Huang Yongsheng; Wang Naiyan; Tang Xiuzhang; Shi Yijin [China Institute of Atomic Energy, Beijing 102413 (China); Xueqing Yan [Institute of Heavy Ion Physics, Peking University, Beijing 100871 (China)

2012-09-15

An analytical relativistic model is proposed to describe the relativistic ion acceleration in the interaction of ultra-intense laser pulses with thin-foil plasmas. It is found that there is a critical value of the ion momentum to make sure that the ions are trapped by the light sail and accelerated in the radiation pressure acceleration (RPA) region. If the initial ion momentum is smaller than the critical value, that is in the classical case of RPA, the potential has a deep well and traps the ions to be accelerated, as the same described before by simulation results [Eliasson et al., New J. Phys. 11, 073006 (2009)]. There is a new ion acceleration region different from RPA, called ultra-relativistic acceleration, if the ion momentum exceeds the critical value. In this case, ions will experience a potential downhill. The dependence of the ion momentum and the self-similar variable at the ion front on the acceleration time has been obtained. In the ultra-relativistic limit, the ion momentum at the ion front is proportional to t{sup 4/5}, where t is the acceleration time. In our analytical hydrodynamical model, it is naturally predicted that the ion distribution from RPA is not monoenergetic, although the phase-stable acceleration mechanism is effective. The critical conditions of the laser and plasma parameters which identify the two acceleration modes have been achieved.

Ultra-relativistic ion acceleration in the laser-plasma interactions

International Nuclear Information System (INIS)

Huang Yongsheng; Wang Naiyan; Tang Xiuzhang; Shi Yijin; Xueqing Yan

2012-01-01

An analytical relativistic model is proposed to describe the relativistic ion acceleration in the interaction of ultra-intense laser pulses with thin-foil plasmas. It is found that there is a critical value of the ion momentum to make sure that the ions are trapped by the light sail and accelerated in the radiation pressure acceleration (RPA) region. If the initial ion momentum is smaller than the critical value, that is in the classical case of RPA, the potential has a deep well and traps the ions to be accelerated, as the same described before by simulation results [Eliasson et al., New J. Phys. 11, 073006 (2009)]. There is a new ion acceleration region different from RPA, called ultra-relativistic acceleration, if the ion momentum exceeds the critical value. In this case, ions will experience a potential downhill. The dependence of the ion momentum and the self-similar variable at the ion front on the acceleration time has been obtained. In the ultra-relativistic limit, the ion momentum at the ion front is proportional to t 4/5 , where t is the acceleration time. In our analytical hydrodynamical model, it is naturally predicted that the ion distribution from RPA is not monoenergetic, although the phase-stable acceleration mechanism is effective. The critical conditions of the laser and plasma parameters which identify the two acceleration modes have been achieved.

Computer simulation of dynamic processes on accelerators

International Nuclear Information System (INIS)

Kol'ga, V.V.

1979-01-01

The problems of computer numerical investigation of motion of accelerated particles in accelerators and storages, an effect of different accelerator systems on the motion, determination of optimal characteristics of accelerated charged particle beams are considered. Various simulation representations are discussed which describe the accelerated particle dynamics, such as the enlarged particle method, the representation where a great number of discrete particle is substituted for a field of continuously distributed space charge, the method based on determination of averaged beam characteristics. The procedure is described of numerical studies involving the basic problems, viz. calculation of closed orbits, establishment of stability regions, investigation of resonance propagation determination of the phase stability region, evaluation of the space charge effect the problem of beam extraction. It is shown that most of such problems are reduced to solution of the Cauchy problem using a computer. The ballistic method which is applied to solution of the boundary value problem of beam extraction is considered. It is shown that introduction into the equation under study of additional members with the small positive regularization parameter is a general idea of the methods for regularization of noncorrect problems [ru

OpenMP for Accelerators

Energy Technology Data Exchange (ETDEWEB)

Beyer, J C; Stotzer, E J; Hart, A; de Supinski, B R

2011-03-15

OpenMP [13] is the dominant programming model for shared-memory parallelism in C, C++ and Fortran due to its easy-to-use directive-based style, portability and broad support by compiler vendors. Similar characteristics are needed for a programming model for devices such as GPUs and DSPs that are gaining popularity to accelerate compute-intensive application regions. This paper presents extensions to OpenMP that provide that programming model. Our results demonstrate that a high-level programming model can provide accelerated performance comparable to hand-coded implementations in CUDA.

Sources and acceleration efficiencies for energetic particles in the heliosphere

International Nuclear Information System (INIS)

Kucharek, H; Moebius, E

2006-01-01

Shocks at solar wind stream interaction regions, coronal mass ejections and magnetospheric obstacles have long been known for their intimate link with particle acceleration. Much enhanced capabilities to determine mass and charge composition at interplanetary shocks with ACE and SOHO have enabled us to identify sources and acceleration processes for the energetic particles. Both solar wind and interstellar pickup ions are substantial sources for particle acceleration in corotating interaction regions and at coronal mass ejections driven shocks and that flare particles are re-accelerated. Suprathermal distributions, such as pickup ions and pre-existing flare populations are accelerated much more efficiently than particles out of the solar wind. Recent results of the termination shock crossing by Voyager I and the scientific goals of the upcoming IBEX mission will be discussed

Exact and Optimal Quantum Mechanics/Molecular Mechanics Boundaries.

Science.gov (United States)

Sun, Qiming; Chan, Garnet Kin-Lic

2014-09-09

Motivated by recent work in density matrix embedding theory, we define exact link orbitals that capture all quantum mechanical (QM) effects across arbitrary quantum mechanics/molecular mechanics (QM/MM) boundaries. Exact link orbitals are rigorously defined from the full QM solution, and their number is equal to the number of orbitals in the primary QM region. Truncating the exact set yields a smaller set of link orbitals optimal with respect to reproducing the primary region density matrix. We use the optimal link orbitals to obtain insight into the limits of QM/MM boundary treatments. We further analyze the popular general hybrid orbital (GHO) QM/MM boundary across a test suite of molecules. We find that GHOs are often good proxies for the most important optimal link orbital, although there is little detailed correlation between the detailed GHO composition and optimal link orbital valence weights. The optimal theory shows that anions and cations cannot be described by a single link orbital. However, expanding to include the second most important optimal link orbital in the boundary recovers an accurate description. The second optimal link orbital takes the chemically intuitive form of a donor or acceptor orbital for charge redistribution, suggesting that optimal link orbitals can be used as interpretative tools for electron transfer. We further find that two optimal link orbitals are also sufficient for boundaries that cut across double bonds. Finally, we suggest how to construct "approximately" optimal link orbitals for practical QM/MM calculations.

CERN-LHC accelerator superconducting magnet. Development and international cooperation

International Nuclear Information System (INIS)

Yamamoto, Akira; Nakamoto, Tatsushi; Sasaki, Ken-ichi

2009-01-01

CERN-LHC accelerator superconducting magnets and a cooperative work for interaction region quadrupole magnets are introduced. The accelerator commissioning and the incident happened during the commissioning in 2008 is also briefly discussed. (author)

Concurrent control system for the JAERI tandem accelerator

International Nuclear Information System (INIS)

Hanashima, S.; Shoji, T.; Horie, K.; Tsukihashi, Y.

1992-01-01

Concurrent processing with a multiprocessor system is introduced to the particle accelerator control system region. The control system is a good application in both logical and physical aspects. A renewal plan of the control system for the JAERI tandem accelerator is discussed. (author)

Bat Accelerated Regions Identify a Bat Forelimb Specific Enhancer in the HoxD Locus.

Directory of Open Access Journals (Sweden)

Betty M Booker

2016-03-01

Full Text Available The molecular events leading to the development of the bat wing remain largely unknown, and are thought to be caused, in part, by changes in gene expression during limb development. These expression changes could be instigated by variations in gene regulatory enhancers. Here, we used a comparative genomics approach to identify regions that evolved rapidly in the bat ancestor, but are highly conserved in other vertebrates. We discovered 166 bat accelerated regions (BARs that overlap H3K27ac and p300 ChIP-seq peaks in developing mouse limbs. Using a mouse enhancer assay, we show that five Myotis lucifugus BARs drive gene expression in the developing mouse limb, with the majority showing differential enhancer activity compared to the mouse orthologous BAR sequences. These include BAR116, which is located telomeric to the HoxD cluster and had robust forelimb expression for the M. lucifugus sequence and no activity for the mouse sequence at embryonic day 12.5. Developing limb expression analysis of Hoxd10-Hoxd13 in Miniopterus natalensis bats showed a high-forelimb weak-hindlimb expression for Hoxd10-Hoxd11, similar to the expression trend observed for M. lucifugus BAR116 in mice, suggesting that it could be involved in the regulation of the bat HoxD complex. Combined, our results highlight novel regulatory regions that could be instrumental for the morphological differences leading to the development of the bat wing.

Measurement of gravitational acceleration of antimatter

International Nuclear Information System (INIS)

Rouhani, S.

1989-12-01

The minute yet effective impact of gravitational potential in the central region of a long tube magnetic container of non-neutral plasmas can be utilized for the measurement of the gravitational acceleration of antimatter particles. The slight change in distribution of plasma particles along the gravitational field affects the internal electric field of the plasma, which in turn affects the frequency of the magnetron motion of its particles. Thus, a rather straightforward relation is established between the gravitational acceleration of the particles and their magnetron frequencies, which is measurable directly, determining the value of the gravitational acceleration. (author). 7 refs, 3 figs

Future HEP Accelerators: The US Perspective

Energy Technology Data Exchange (ETDEWEB)

Bhat, Pushpalatha [Fermilab; Shiltsev, Vladimir [Fermilab

2015-11-02

Accelerator technology has advanced tremendously since the introduction of accelerators in the 1930s, and particle accelerators have become indispensable instruments in high energy physics (HEP) research to probe Nature at smaller and smaller distances. At present, accelerator facilities can be classified into Energy Frontier colliders that enable direct discoveries and studies of high mass scale particles and Intensity Frontier accelerators for exploration of extremely rare processes, usually at relatively low energies. The near term strategies of the global energy frontier particle physics community are centered on fully exploiting the physics potential of the Large Hadron Collider (LHC) at CERN through its high-luminosity upgrade (HL-LHC), while the intensity frontier HEP research is focused on studies of neutrinos at the MW-scale beam power accelerator facilities, such as Fermilab Main Injector with the planned PIP-II SRF linac project. A number of next generation accelerator facilities have been proposed and are currently under consideration for the medium- and long-term future programs of accelerator-based HEP research. In this paper, we briefly review the post-LHC energy frontier options, both for lepton and hadron colliders in various regions of the world, as well as possible future intensity frontier accelerator facilities.

Design of an electrostatic magnetic quadrupole accelerator

International Nuclear Information System (INIS)

Mizuno, M.; Ohara, Y.

1993-01-01

A new type of electrostatic acceleration system, electrostatic magnetic quadrupole (ESMQ) acceleration system, is proposed for efficient acceleration of negative ion beams. In this system, permanent magnets are buried in the acceleration electrodes so as to produce a quadrupole magnetic field in the electrode aperture region. Envelope simulation indicates that the quadrupole field can deflect electrons stripped from the negative ions. Beam envelope simulations for deuterium ions and electrons have been carried out using the beam envelope code TRACE. Electrons are largely divergent and most appear likely to hit downstream electrodes. Furthermore, maximum beam divergence of the deuterium ions is reduced to the focusing effect of the quadrupole magnetic field

The polarizable embedding coupled cluster method

DEFF Research Database (Denmark)

Sneskov, Kristian; Schwabe, Tobias; Kongsted, Jacob

2011-01-01

We formulate a new combined quantum mechanics/molecular mechanics (QM/MM) method based on a self-consistent polarizable embedding (PE) scheme. For the description of the QM region, we apply the popular coupled cluster (CC) method detailing the inclusion of electrostatic and polarization effects...

QM/MM studies on the excited-state relaxation mechanism of a semisynthetic dTPT3 base.

Science.gov (United States)

Guo, Wei-Wei; Zhang, Teng-Shuo; Fang, Wei-Hai; Cui, Ganglong

2018-02-14

Semisynthetic alphabets can potentially increase the genetic information stored in DNA through the formation of unusual base pairs. Recent experiments have shown that near-visible-light irradiation of the dTPT3 chromophore could lead to the formation of a reactive triplet state and of singlet oxygen in high quantum yields. However, the detailed excited-state relaxation paths that populate the lowest triplet state are unclear. Herein, we have for the first time employed the QM(MS-CASPT2//CASSCF)/MM method to explore the spectroscopic properties and excited-state relaxation mechanism of the aqueous dTPT3 chromophore. On the basis of the results, we have found that (1) the S 2 ( 1 ππ*) state of dTPT3 is the initially populated excited singlet state upon near-visible light irradiation; and (2) there are two efficient relaxation pathways to populate the lowest triplet state, i.e. T 1 ( 3 ππ*). In the first one, the S 2 ( 1 ππ*) system first decays to the S 1 ( 1 nπ*) state near the S 2 /S 1 conical intersection, which is followed by an efficient S 1 → T 1 intersystem crossing process at the S 1 /T 1 crossing point; in the second one, an efficient S 2 → T 2 intersystem crossing takes place first, and then, the T 2 ( 3 nπ*) system hops to the T 1 ( 3 ππ*) state through an internal conversion process at the T 2 /T 1 conical intersection. Moreover, an S 2 /S 1 /T 2 intersection region is found to play a vital role in the excited-state relaxation. These new mechanistic insights help in understanding the photophysics and photochemistry of unusual base pairs.

Impulsive ion acceleration in earth's outer magnetosphere

International Nuclear Information System (INIS)

Baker, D.N.; Belian, R.D.

1985-01-01

Considerable observational evidence is found that ions are accelerated to high energies in the outer magnetosphere during geomagnetic disturbances. The acceleration often appears to be quite impulsive causing temporally brief (10's of seconds), very intense bursts of ions in the distant plasma sheet as well as in the near-tail region. These ion bursts extend in energy from 10's of keV to over 1 MeV and are closely associated with substorm expansive phase onsets. Although the very energetic ions are not of dominant importance for magnetotail plasma dynamics, they serve as an important tracer population. Their absolute intensity and brief temporal appearance bespeaks a strong and rapid acceleration process in the near-tail, very probably involving large induced electric fields substantially greater than those associated with cross-tail potential drops. Subsequent to their impulsive acceleration, these ions are injected into the outer trapping regions forming ion ''drift echo'' events, as well as streaming tailward away from their acceleration site in the near-earth plasma sheet. Most auroral ion acceleration processes occur (or are greatly enhanced) during the time that these global magnetospheric events are occurring in the magnetotail. A qualitative model relating energetic ion populations to near-tail magnetic reconnection at substorm onset followed by global redistribution is quite successful in explaining the primary observational features. Recent measurements of the elemental composition and charge-states have proven valuable for showing the source (solar wind or ionosphere) of the original plasma population from which the ions were accelerated

Accelerating regional atrophy rates in the progression from normal aging to Alzheimer's disease

Energy Technology Data Exchange (ETDEWEB)

Sluimer, Jasper D. [VU University Medical Centre, Department of Diagnostic Radiology, Amsterdam (Netherlands); VU University Medical Centre, Alzheimer Centre, Amsterdam (Netherlands); VU University Medical Centre, Image Analysis Centre, Amsterdam (Netherlands); VU University Medical Centre, Department of Diagnostic Radiology and Alzheimer Centre, PO Box 7057, Amsterdam (Netherlands); Flier, Wiesje M. van der; Scheltens, Philip [VU University Medical Centre, Alzheimer Centre, Amsterdam (Netherlands); VU University Medical Centre, Department of Neurology, Amsterdam (Netherlands); Karas, Giorgos B.; Barkhof, Frederik [VU University Medical Centre, Department of Diagnostic Radiology, Amsterdam (Netherlands); VU University Medical Centre, Alzheimer Centre, Amsterdam (Netherlands); VU University Medical Centre, Image Analysis Centre, Amsterdam (Netherlands); Schijndel, Ronald van [VU University Medical Centre, Image Analysis Centre, Amsterdam (Netherlands); VU University Medical Centre, Department of Informatics, Amsterdam (Netherlands); Barnes, Josephine; Boyes, Richard G. [UCL, Institute of Neurology, Dementia Research Centre, London (United Kingdom); Cover, Keith S. [VU University Medical Centre, Department of Physics and Medical Technology, Amsterdam (Netherlands); Olabarriaga, Silvia D. [University of Amsterdam, Department of Clinical Epidemiology, Biostatistics and Bioinformatics, Academic Medical Centre, Amsterdam (Netherlands); Fox, Nick C. [VU University Medical Centre, Department of Neurology, Amsterdam (Netherlands); UCL, Institute of Neurology, Dementia Research Centre, London (United Kingdom); Vrenken, Hugo [VU University Medical Centre, Alzheimer Centre, Amsterdam (Netherlands); VU University Medical Centre, Image Analysis Centre, Amsterdam (Netherlands); VU University Medical Centre, Department of Physics and Medical Technology, Amsterdam (Netherlands)

2009-12-15

We investigated progression of atrophy in vivo, in Alzheimer's disease (AD), and mild cognitive impairment (MCI). We included 64 patients with AD, 44 with MCI and 34 controls with serial MRI examinations (interval 1.8 {+-} 0.7 years). A nonlinear registration algorithm (fluid) was used to calculate atrophy rates in six regions: frontal, medial temporal, temporal (extramedial), parietal, occipital lobes and insular cortex. In MCI, the highest atrophy rate was observed in the medial temporal lobe, comparable with AD. AD patients showed even higher atrophy rates in the extramedial temporal lobe. Additionally, atrophy rates in frontal, parietal and occipital lobes were increased. Cox proportional hazard models showed that all regional atrophy rates predicted conversion to AD. Hazard ratios varied between 2.6 (95% confidence interval (CI) = 1.1-6.2) for occipital atrophy and 15.8 (95% CI = 3.5-71.8) for medial temporal lobe atrophy. In conclusion, atrophy spreads through the brain with development of AD. MCI is marked by temporal lobe atrophy. In AD, atrophy rate in the extramedial temporal lobe was even higher. Moreover, atrophy rates also accelerated in parietal, frontal, insular and occipital lobes. Finally, in nondemented elderly, medial temporal lobe atrophy was most predictive of progression to AD, demonstrating the involvement of this region in the development of AD. (orig.)

Substrate Recognition in the Escherichia coli Ammonia Channel AmtB: A QM/MM Investigation

DEFF Research Database (Denmark)

Nygaard, Thomas Pedersen; Alfonso-Prieto, M.; Peters, Günther H.J.

2010-01-01

understood. The present computational study addresses the importance of intermolecular interactions with respect to substrate recruitment and recognition by means of ab initio QM/MM simulations. On the basis of calculations with substrates NH3, NH4+, Na+, and K+ positioned at the periplasmic binding site (Am......1) and NH3 and NH4+ at intraluminal binding sites (Am1a/b), we conclude that D160 is the single most important residue for substrate recruitment, whereas cation-pi interactions to W148 and F107 are found to be less important. Regarding substrate recruitment and recognition, we find that only NH4......+ and K+ reach the Am1 site. However, NH4+ has the largest affinity for this site due to its better dehydration compensation, while charge stabilization effects favor the binding of NH4+ over NH3 (i.e., if NH3 would enter the Am1 site, it is likely to be protonated). Therefore, we conclude that the Am1...

Free Energy Contribution Analysis Using Response Kernel Approximation: Insights into the Acylation Reaction of a Beta-Lactamase.

Science.gov (United States)

Asada, Toshio; Ando, Kanta; Bandyopadhyay, Pradipta; Koseki, Shiro

2016-09-08

A widely applicable free energy contribution analysis (FECA) method based on the quantum mechanical/molecular mechanical (QM/MM) approximation using response kernel approaches has been proposed to investigate the influences of environmental residues and/or atoms in the QM region on the free energy profile. This method can evaluate atomic contributions to the free energy along the reaction path including polarization effects on the QM region within a dramatically reduced computational time. The rate-limiting step in the deactivation of the β-lactam antibiotic cefalotin (CLS) by β-lactamase was studied using this method. The experimentally observed activation barrier was successfully reproduced by free energy perturbation calculations along the optimized reaction path that involved activation by the carboxylate moiety in CLS. It was found that the free energy profile in the QM region was slightly higher than the isolated energy and that two residues, Lys67 and Lys315, as well as water molecules deeply influenced the QM atoms associated with the bond alternation reaction in the acyl-enzyme intermediate. These facts suggested that the surrounding residues are favorable for the reactant complex and prevent the intermediate from being too stabilized to proceed to the following deacylation reaction. We have demonstrated that the free energy contribution analysis should be a useful method to investigate enzyme catalysis and to facilitate intelligent molecular design.

Regional alveolar partial pressure of oxygen measurement with parallel accelerated hyperpolarized gas MRI.

Science.gov (United States)

Kadlecek, Stephen; Hamedani, Hooman; Xu, Yinan; Emami, Kiarash; Xin, Yi; Ishii, Masaru; Rizi, Rahim

2013-10-01

Alveolar oxygen tension (Pao2) is sensitive to the interplay between local ventilation, perfusion, and alveolar-capillary membrane permeability, and thus reflects physiologic heterogeneity of healthy and diseased lung function. Several hyperpolarized helium ((3)He) magnetic resonance imaging (MRI)-based Pao2 mapping techniques have been reported, and considerable effort has gone toward reducing Pao2 measurement error. We present a new Pao2 imaging scheme, using parallel accelerated MRI, which significantly reduces measurement error. The proposed Pao2 mapping scheme was computer-simulated and was tested on both phantoms and five human subjects. Where possible, correspondence between actual local oxygen concentration and derived values was assessed for both bias (deviation from the true mean) and imaging artifact (deviation from the true spatial distribution). Phantom experiments demonstrated a significantly reduced coefficient of variation using the accelerated scheme. Simulation results support this observation and predict that correspondence between the true spatial distribution and the derived map is always superior using the accelerated scheme, although the improvement becomes less significant as the signal-to-noise ratio increases. Paired measurements in the human subjects, comparing accelerated and fully sampled schemes, show a reduced Pao2 distribution width for 41 of 46 slices. In contrast to proton MRI, acceleration of hyperpolarized imaging has no signal-to-noise penalty; its use in Pao2 measurement is therefore always beneficial. Comparison of multiple schemes shows that the benefit arises from a longer time-base during which oxygen-induced depolarization modifies the signal strength. Demonstration of the accelerated technique in human studies shows the feasibility of the method and suggests that measurement error is reduced here as well, particularly at low signal-to-noise levels. Copyright © 2013 AUR. Published by Elsevier Inc. All rights reserved.

A QM/MM study of the catalytic mechanism of nicotinamidase.

Science.gov (United States)

Sheng, Xiang; Liu, Yongjun

2014-02-28

Nicotinamidase (Pnc1) is a member of Zn-dependent amidohydrolases that hydrolyzes nicotinamide (NAM) to nicotinic acid (NA), which is a key step in the salvage pathway of NAD(+) biosynthesis. In this paper, the catalytic mechanism of Pnc1 has been investigated by using a combined quantum-mechanical/molecular-mechanical (QM/MM) approach based on the recently obtained crystal structure of Pnc1. The reaction pathway, the detail of each elementary step, the energetics of the whole catalytic cycle, and the roles of key residues and Zn-binding site are illuminated. Our calculation results indicate that the catalytic water molecule comes from the bulk solvent, which is then deprotonated by residue D8. D8 functions as a proton transfer station between C167 and NAM, while the activated C167 serves as the nucleophile. The residue K122 only plays a role in stabilizing intermediates and transition states. The oxyanion hole formed by the amide backbone nitrogen atoms of A163 and C167 has the function to stabilize the hydroxyl anion of nicotinamide. The Zn-binding site rather than a single Zn(2+) ion acts as a Lewis acid to influence the reaction. Two elementary steps, the activation of C167 in the deamination process and the decomposition of catalytic water in the hydrolysis process, correspond to the large energy barriers of 25.7 and 28.1 kcal mol(-1), respectively, meaning that both of them contribute a lot to the overall reaction barrier. Our results may provide useful information for the design of novel and efficient Pnc1 inhibitors and related biocatalytic applications.

Polarizable Density Embedding

DEFF Research Database (Denmark)

Olsen, Jógvan Magnus Haugaard; Steinmann, Casper; Ruud, Kenneth

2015-01-01

We present a new QM/QM/MM-based model for calculating molecular properties and excited states of solute-solvent systems. We denote this new approach the polarizable density embedding (PDE) model and it represents an extension of our previously developed polarizable embedding (PE) strategy. The PDE...... model is a focused computational approach in which a core region of the system studied is represented by a quantum-chemical method, whereas the environment is divided into two other regions: an inner and an outer region. Molecules belonging to the inner region are described by their exact densities...

Resonant coupling applied to superconducting accelerator structures

International Nuclear Information System (INIS)

Potter, James M.; Krawczyk, Frank L.

2013-01-01

The concept of resonant coupling and the benefits that accrue from its application is well known in the world of room temperature coupled cavity linacs. Design studies show that it can be applied successfully between sections of conventional elliptical superconducting coupled cavity accelerator structures and internally to structures with spoked cavity resonators. The coupling mechanisms can be designed without creating problems with high field regions or multipactoring. The application of resonant coupling to superconducting accelerators eliminates the need for complex cryogenic mechanical tuners and reduces the time needed to bring a superconducting accelerator into operation.

Turbulent energy generated by accelerations and shocks

International Nuclear Information System (INIS)

Mikaelian, K.O.

1986-01-01

The turbulent energy generated at the interface between two fluids undergoing a constant acceleration or a shock is calculated. Assuming linear density profiles in the mixed region we find E/sub turbulent//E/sub directed/ = 2.3A 2 % (constant acceleration) and 9.3A 2 % (shock), where A is the Atwood number. Diffusion models predict somewhat less turbulent energy and a density profile with a tail extending into the lower density fluid. Eddy sizes are approximately 27% (constant acceleration) and 17% (shock) of the mixing depth into the heavier fluid. 6 refs., 3 figs

Particle acceleration in the plasma fields near comet Halley

International Nuclear Information System (INIS)

Somogyi, A.J.; Erdoes, G.; Shapiro, V.D.; Shevchenko, V.I.

1990-01-01

Spacecraft VEGA-1 approached Halley comet to distances less than 10 million km in March 1986. It was equipped with devices capable to detect and measure the energies of charged particles (higher than 50 keV). After a survey of acceleration mechanisms the properties of the 50-800 keV charged particle fluxes observed in various regions around Halley comet are reported. In particular, the regions outside the cometary bow shock, the region between the bow shock and the cometopause, and inside the latter, especially in the magnetic pile-up region are considered. Possible mechanisms responsible for the accelerations of the particle fluxes described are discussed. (author) 73 refs.; 7 figs.; 3 tabs

A QM/MM–Based Computational Investigation on the Catalytic Mechanism of Saccharopine Reductase

Directory of Open Access Journals (Sweden)

James W. Gauld

2011-10-01

Full Text Available Saccharopine reductase from Magnaporthe grisea, an NADPH-containing enzyme in the α-aminoadipate pathway, catalyses the formation of saccharopine, a precursor to L-lysine, from the substrates glutamate and α-aminoadipate-δ-semialdehyde. Its catalytic mechanism has been investigated using quantum mechanics/molecular mechanics (QM/MM ONIOM-based approaches. In particular, the overall catalytic pathway has been elucidated and the effects of electron correlation and the anisotropic polar protein environment have been examined via the use of the ONIOM(HF/6-31G(d:AMBER94 and ONIOM(MP2/6-31G(d//HF/6-31G(d:AMBER94 methods within the mechanical embedding formulism and ONIOM(MP2/6-31G(d//HF/6-31G(d:AMBER94 and ONIOM(MP2/6-311G(d,p//HF/6-31G(d:AMBER94 within the electronic embedding formulism. The results of the present study suggest that saccharopine reductase utilises a substrate-assisted catalytic pathway in which acid/base groups within the cosubstrates themselves facilitate the mechanistically required proton transfers. Thus, the enzyme appears to act most likely by binding the three required reactant molecules glutamate, α-aminoadipate-δ-semialdehyde and NADPH in a manner and polar environment conducive to reaction.

JAERI tandem-accelerator and tandem-booster

Energy Technology Data Exchange (ETDEWEB)

Yoshida, Tadashi [Japan Atomic Energy Research Inst., Tokai, Ibaraki (Japan). Tokai Research Establishment

1998-03-01

In 1982, aiming at the new development of atomic energy research, the tandem accelerator of Japan Atomic Energy Research Institute (JAERI) was installed. In fiscal year 1993, the superconducting boosters which can increase the ion energy by up to 4 times were added, and the research in the region below 1000 MeV became possible. Those are electrostatic type accelerators which are easy to be used especially in basic research field, and are useful for future research. The tandem accelerator has been operated while maintaining the first class performance as the accelerator for various kinds of heavy ion beam. It has the special shape among electrostatic type accelerators, and is excellent in the easiness of control and stability. The main particulars of the tandem accelerator are shown. As for the ion sources of the tandem accelerator, three cesium sputter type ion sources are installed on two high voltage stands. The kinds of the ions which can be accelerated are mainly negative ions. As the improvement, electron cyclotron resonance (ECR) ion sources are expected to be adopted. As for the tandem boosters, the 1/4 wavelength type resonance hollow cylinder was adopted. The constitution of the tandem boosters is explained. The way of utilizing the tandem accelerator system and the aim for hereafter are reported. (K.I.)

The continuous electron beam accelerator facility

International Nuclear Information System (INIS)

Grunder, H.A.

1989-01-01

Tunnel construction and accelerator component development, assembly, and testing are under way at the Continuous Electron Beam Accelerator Facility. CEBAF's 4-GeV, 200-μA superconducting recirculating accelerator will provide cw beam to simultaneous experiments in three end stations for studies of the nuclear many-body system, its quark substructure, and the strong and electroweak interactions governing this form of matter. Prototype accelerating cavities, assembled in cryostats and tested on site, continue to exceed performance specifications. An on-site liquid helium capability supports cryostat development and cavity testing. Major elements of the accelerator instrumentation and control hardware and software are in use in cryogenics, rf, and injector tests. Prototype rf systems have been operated and prototype klystrons have been ordered. The initial, 100-keV, room-temperature region of the 45-MeV injector is operational and meets specifications. CEBAF's end stations have been conceptually designed; experimental equipment conceptual designs will be completed in 1989. 2 refs., 5 figs., 2 tabs

SuperB Progress Report for Accelerator

Energy Technology Data Exchange (ETDEWEB)

Biagini, M.E.; Boni, R.; Boscolo, M.; Buonomo, B.; Demma, T.; Drago, A.; Esposito, M.; Guiducci, S.; Mazzitelli, G.; Pellegrino, L.; Preger, M.A.; Raimondi, P.; Ricci, R.; Rotundo, U.; Sanelli, C.; Serio, M.; Stella, A.; Tomassini, S.; Zobov, M.; /Frascati; Bertsche, K.; Brachman, A.; /SLAC /Novosibirsk, IYF /INFN, Pisa /Pisa U. /Orsay, LAL /Annecy, LAPP /LPSC, Grenoble /IRFU, SPP, Saclay /DESY /Cockroft Inst. Accel. Sci. Tech. /U. Liverpool /CERN

2012-02-14

This report details the progress made in by the SuperB Project in the area of the Collider since the publication of the SuperB Conceptual Design Report in 2007 and the Proceedings of SuperB Workshop VI in Valencia in 2008. With this document we propose a new electron positron colliding beam accelerator to be built in Italy to study flavor physics in the B-meson system at an energy of 10 GeV in the center-of-mass. This facility is called a high luminosity B-factory with a project name 'SuperB'. This project builds on a long history of successful e+e- colliders built around the world, as illustrated in Figure 1.1. The key advances in the design of this accelerator come from recent successes at the DAFNE collider at INFN in Frascati, Italy, at PEP-II at SLAC in California, USA, and at KEKB at KEK in Tsukuba Japan, and from new concepts in beam manipulation at the interaction region (IP) called 'crab waist'. This new collider comprises of two colliding beam rings, one at 4.2 GeV and one at 6.7 GeV, a common interaction region, a new injection system at full beam energies, and one of the two beams longitudinally polarized at the IP. Most of the new accelerator techniques needed for this collider have been achieved at other recently completed accelerators including the new PETRA-3 light source at DESY in Hamburg (Germany) and the upgraded DAFNE collider at the INFN laboratory at Frascati (Italy), or during design studies of CLIC or the International Linear Collider (ILC). The project is to be designed and constructed by a worldwide collaboration of accelerator and engineering staff along with ties to industry. To save significant construction costs, many components from the PEP-II collider at SLAC will be recycled and used in this new accelerator. The interaction region will be designed in collaboration with the particle physics detector to guarantee successful mutual use. The accelerator collaboration will consist of several groups at present

Test accelerator for linear collider

International Nuclear Information System (INIS)

Takeda, S.; Akai, K.; Akemoto, M.; Araki, S.; Hayano, H.; Hugo, T.; Ishihara, N.; Kawamoto, T.; Kimura, Y.; Kobayashi, H.; Kubo, T.; Kurokawa, S.; Matsumoto, H.; Mizuno, H.; Odagiri, J.; Otake, Y.; Sakai, H.; Shidara, T.; Shintake, T.; Suetake, M.; Takashima, T.; Takata, K.; Takeuchi, Y.; Urakawa, J.; Yamamoto, N.; Yokoya, K.; Yoshida, M.; Yoshioka, M.; Yamaoka, Y.

1989-01-01

KEK has proposed to build Test Accelerator Facility (TAF) capable of producing a 2.5 GeV electron beam for the purpose of stimulating R ampersand D for linear collider in TeV region. The TAF consists of a 1.5 GeV S-band linear accelerator, 1.5 GeV damping ring and 1.0 GeV X-band linear accelerator. The TAF project will be carried forward in three phases. Through Phase-I and Phase-II, the S-band and X-band linacs will be constructed, and in Phase-III, the damping ring will be completed. The construction of TAF Phase-I has started, and the 0.2 GeV S-band injector linac has been almost completed. The Phase-I linac is composed of a 240 keV electron gun, subharmonic bunchers, prebunchers and traveling buncher followed by high-gradient accelerating structures. The SLAC 5045 klystrons are driven at 450 kV in order to obtain the rf-power of 100 MW in a 1 μs pulse duration. The rf-power from a pair of klystrons are combined into an accelerating structure. The accelerating gradient up to 100 MeV/m will be obtained in a 0.6 m long structure. 5 refs., 3 figs., 2 tabs

Structure and dynamics of solvated Ba(II) in dilute aqueous solution - an ab initio QM/MM MD approach

International Nuclear Information System (INIS)

Hofer, Thomas S.; Rode, Bernd M.; Randolf, Bernhard R.

2005-01-01

Structural properties of the hydrated Ba(II) ion have been investigated by ab initio quantum mechanical/molecular mechanical (QM/MM) molecular dynamics (MD) simulations at double zeta HF quantum mechanical level. The first shell coordination number was found to be 9.3, and several other structural parameters such as angular distribution functions, radial distribution functions and tilt- and θ-angle distributions allowed the full characterization of the hydration structure of the Ba(II) ion in dilute aqueous solution. Velocity autocorrelation functions were used to calculate librational and vibrational motions, ion-ligand motions as well as reorientation times. Different dynamical parameters such as water reorientation, mean ligand residence time, the number of ligand exchange processes and rate constants were also analyzed and the ligand exchange rate constant for the first shell was determined as k = 5.3 x 10 10 s -1

Equipartitioning in linear accelerators

International Nuclear Information System (INIS)

Jameson, R.A.

1981-01-01

Emittance growth has long been a concern in linear accelerators, as has the idea that some kind of energy balance, or equipartitioning, between the degrees of freedom, would ameliorate the growth. M. Prome observed that the average transverse and longitudinal velocity spreads tend to equalize as current in the channel is increased, while the sum of the energy in the system stays nearly constant. However, only recently have we shown that an equipartitioning requirement on a bunched injected beam can indeed produce remarkably small emittance growth. The simple set of equations leading to this condition are outlined below. At the same time, Hofmann, using powerful analytical and computational methods, has investigated collective instabilities in transported beams and has identified thresholds and regions in parameter space where instabilities occur. This is an important generalization. Work that he will present at this conference shows that the results are essentially the same in r-z coordinates for transport systems, and evidence is presented that shows transport system boundaries to be quite accurate in computer simulations of accelerating systems also. Discussed are preliminary results of efforts to design accelerators that avoid parameter regions where emittance is affected by the instabilities identified by Hofmann. These efforts suggest that other mechanisms are present. The complicated behavior of the RFQ linac in this framework also is shown

Efficient Strategy for the Calculation of Solvation Free Energies in Water and Chloroform at the Quantum Mechanical/Molecular Mechanical Level.

Science.gov (United States)

Wang, Meiting; Li, Pengfei; Jia, Xiangyu; Liu, Wei; Shao, Yihan; Hu, Wenxin; Zheng, Jun; Brooks, Bernard R; Mei, Ye

2017-10-23

The partitioning of solute molecules between immiscible solvents with significantly different polarities is of great importance. The polarization between the solute and solvent molecules plays an essential role in determining the solubility of the solute, which makes computational studies utilizing molecular mechanics (MM) rather difficult. In contrast, quantum mechanics (QM) can provide more reliable predictions. In this work, the partition coefficients of the side chain analogs of some amino acids between water and chloroform were computed. The QM solvation free energies were calculated indirectly via a series of MM states using the multistate Bennett acceptance ratio (MBAR) and the MM-to-QM corrections were applied at the two endpoints using thermodynamic perturbation (TP). Previously, it has been shown (Jia et al. J. Chem. Theory Comput. 2016, 12, 499-511) that this method provides the minimal variance in the results without running QM simulations. However, if there is insufficient overlap in phase space between the MM and QM Hamiltonians, this method fails. In this work, we propose, for the first time, a quantity termed the reweighting entropy that serves as a metric for the reliability of the TP calculations. If the reweighting entropy is below a certain threshold (0.65 for the solvation free energy calculations in this work), this MM-to-QM correction should be avoided and two alternative methods can be employed by either introducing a semiempirical state or conducting nonequilibrium simulations. However, the results show that the QM methods are not guaranteed to yield better results than the MM methods. Further improvement of the QM methods are imperative, especially the treatment of the van der Waals and the electrostatic interactions between the QM region and the MM region in the first shell. We also propose a scheme for the calculation of the van der Waals parameters for the solute molecules in nonaqueous solvent, which improves the quality of the

Load-Unload Response Ratio and Accelerating Moment/Energy Release Critical Region Scaling and Earthquake Prediction

Science.gov (United States)

Yin, X. C.; Mora, P.; Peng, K.; Wang, Y. C.; Weatherley, D.

The main idea of the Load-Unload Response Ratio (LURR) is that when a system is stable, its response to loading corresponds to its response to unloading, whereas when the system is approaching an unstable state, the response to loading and unloading becomes quite different. High LURR values and observations of Accelerating Moment/Energy Release (AMR/AER) prior to large earthquakes have led different research groups to suggest intermediate-term earthquake prediction is possible and imply that the LURR and AMR/AER observations may have a similar physical origin. To study this possibility, we conducted a retrospective examination of several Australian and Chinese earthquakes with magnitudes ranging from 5.0 to 7.9, including Australia's deadly Newcastle earthquake and the devastating Tangshan earthquake. Both LURR values and best-fit power-law time-to-failure functions were computed using data within a range of distances from the epicenter. Like the best-fit power-law fits in AMR/AER, the LURR value was optimal using data within a certain epicentral distance implying a critical region for LURR. Furthermore, LURR critical region size scales with mainshock magnitude and is similar to the AMR/AER critical region size. These results suggest a common physical origin for both the AMR/AER and LURR observations. Further research may provide clues that yield an understanding of this mechanism and help lead to a solid foundation for intermediate-term earthquake prediction.

Unlimited ion acceleration by radiation pressure.

Science.gov (United States)

Bulanov, S V; Echkina, E Yu; Esirkepov, T Zh; Inovenkov, I N; Kando, M; Pegoraro, F; Korn, G

2010-04-02

The energy of ions accelerated by an intense electromagnetic wave in the radiation pressure dominated regime can be greatly enhanced due to a transverse expansion of a thin target. The expansion decreases the number of accelerated ions in the irradiated region resulting in an increase in the ion energy and in the ion longitudinal velocity. In the relativistic limit, the ions become phase locked with respect to the electromagnetic wave resulting in unlimited ion energy gain.

Stormtime and Interplanetary Magnetic Field Drivers of Wave and Particle Acceleration Processes in the Magnetosphere-Ionosphere Transition Region

Science.gov (United States)

Hatch, Spencer Mark

The magnetosphere-ionosphere (M-I) transition region is the several thousand-kilometer stretch between the cold, dense and variably resistive region of ionized atmospheric gases beginning tens of kilometers above the terrestrial surface, and the hot, tenuous, and conductive plasmas that interface with the solar wind at higher altitudes. The M-I transition region is therefore the site through which magnetospheric conditions, which are strongly susceptible to solar wind dynamics, are communicated to ionospheric plasmas, and vice versa. We systematically study the influence of geomagnetic storms on energy input, electron precipitation, and ion outflow in the M-I transition region, emphasizing the role of inertial Alfven waves both as a preferred mechanism for dynamic (instead of static) energy transfer and particle acceleration, and as a low-altitude manifestation of high-altitude interaction between the solar wind and the magnetosphere, as observed by the FAST satellite. Via superposed epoch analysis and high-latitude distributions derived as a function of storm phase, we show that storm main and recovery phase correspond to strong modulations of measures of Alfvenic activity in the vicinity of the cusp as well as premidnight. We demonstrate that storm main and recovery phases occur during 30% of the four-year period studied, but together account for more than 65% of global Alfvenic energy deposition and electron precipitation, and more than 70% of the coincident ion outflow. We compare observed interplanetary magnetic field (IMF) control of inertial Alfven wave activity with Lyon-Fedder-Mobarry global MHD simulations predicting that southward IMF conditions lead to generation of Alfvenic power in the magnetotail, and that duskward IMF conditions lead to enhanced prenoon Alfvenic power in the Northern Hemisphere. Observed and predicted prenoon Alfvenic power enhancements contrast with direct-entry precipitation, which is instead enhanced postnoon. This situation

Virtual gap dielectric wall accelerator

Science.gov (United States)

Caporaso, George James; Chen, Yu-Jiuan; Nelson, Scott; Sullivan, Jim; Hawkins, Steven A

2013-11-05

A virtual, moving accelerating gap is formed along an insulating tube in a dielectric wall accelerator (DWA) by locally controlling the conductivity of the tube. Localized voltage concentration is thus achieved by sequential activation of a variable resistive tube or stalk down the axis of an inductive voltage adder, producing a "virtual" traveling wave along the tube. The tube conductivity can be controlled at a desired location, which can be moved at a desired rate, by light illumination, or by photoconductive switches, or by other means. As a result, an impressed voltage along the tube appears predominantly over a local region, the virtual gap. By making the length of the tube large in comparison to the virtual gap length, the effective gain of the accelerator can be made very large.

Inverse Free Electron Laser accelerator

International Nuclear Information System (INIS)

Fisher, A.; Gallardo, J.; van Steenbergen, A.; Sandweiss, J.

1992-09-01

The study of the INVERSE FREE ELECTRON LASER, as a potential mode of electron acceleration, is being pursued at Brookhaven National Laboratory. Recent studies have focussed on the development of a low energy, high gradient, multi stage linear accelerator. The elementary ingredients for the IFEL interaction are the 50 MeV Linac e - beam and the 10 11 Watt CO 2 laser beam of BNL's Accelerator Test Facility (ATF), Center for Accelerator Physics (CAP) and a wiggler. The latter element is designed as a fast excitation unit making use of alternating stacks of Vanadium Permendur (VaP) ferromagnetic laminations, periodically interspersed with conductive, nonmagnetic laminations, which act as eddy current induced field reflectors. Wiggler parameters and field distribution data will be presented for a prototype wiggler in a constant period and in a ∼ 1.5 %/cm tapered period configuration. The CO 2 laser beam will be transported through the IFEL interaction region by means of a low loss, dielectric coated, rectangular waveguide. Short waveguide test sections have been constructed and have been tested using a low power cw CO 2 laser. Preliminary results of guide attenuation and mode selectivity will be given, together with a discussion of the optical issues for the IFEL accelerator. The IFEL design is supported by the development and use of 1D and 3D simulation programs. The results of simulation computations, including also wiggler errors, for a single module accelerator and for a multi-module accelerator will be presented

How Are Substrate Binding and Catalysis Affected by Mutating Glu127 and Arg161 in Prolyl-4-hydroxylase? A QM/MM and MD Study

Science.gov (United States)

Timmins, Amy; de Visser, Sam P.

2017-01-01

Prolyl-4-hydroxylase is a vital enzyme for human physiology involved in the biosynthesis of 4-hydroxyproline, an essential component for collagen formation. The enzyme performs a unique stereo- and regioselective hydroxylation at the C4 position of proline despite the fact that the C5 hydrogen atoms should be thermodynamically easier to abstract. To gain insight into the mechanism and find the origin of this regioselectivity, we have done a quantum mechanics/molecular mechanics (QM/MM) study on wildtype and mutant structures. In a previous study (Timmins et al., 2017) we identified several active site residues critical for substrate binding and positioning. In particular, the Glu127 and Arg161 were shown to form multiple hydrogen bonding and ion-dipole interactions with substrate and could thereby affect the regio- and stereoselectivity of the reaction. In this work, we decided to test that hypothesis and report a QM/MM and molecular dynamics (MD) study on prolyl-4-hydroxylase and several active site mutants where Glu127 or Arg161 are mutated for Asp, Gln, or Lys. Thus, the R161D and R161Q mutants give very high barriers for hydrogen atom abstraction from any proline C–H bond and therefore will be inactive. The R161K mutant, by contrast, sees the regio- and stereoselectivity of the reaction change but still is expected to hydroxylate proline at room temperature. By contrast, the Glu127 mutants E127D and E127Q show possible changes in regioselectivity with the former being more probable to react compared to the latter. PMID:29170737

Status report on the Karlsruhe prototype superconducting proton linerar accelerator

International Nuclear Information System (INIS)

Citron, A.

1974-01-01

A short intoduction about linear accelerators in general and the advantage of using superconducting resonators is given. Subsequently some basic efforts on r.f. superconductivity are recalled and the status of technology of surface preparations is reported. The status of the Karlsruhe accelerator is given. In the low energy region some difficulties caused by mechanical instabilities had to be overcome. Protons have been accelerated in this part. Model studies for the subsequent sections of the accelerator have been started and look promising. (author)

F region electron density irregularity spectra near Auroral acceleration and shear regions

International Nuclear Information System (INIS)

Basu, S.; Basu, S.; MacKenzie, E.; Coley, W.R.; Hanson, W.B.; Lin, C.S.

1984-01-01

Spectral characteristics of auroral F region irregularities were studied by the use of high-resolution (approx.35 m) density measurements made by the retarding potential analyzer (RPA) on board the Atmosphere Explorer D (AE-D) satellite during two orbits when the satellite was traversing the high-latitude ionosphere in the evening sector. Coordinated DMSP passes provided synoptic coverage of auroral activity. The auroral energy input was estimated by intergrating the low-energy electron (LEE) data on AE-D. It was found that the one-dimensional in situ spectral index (p 1 ) of the irregularities at scale lengths of 1 values of approx.-3. This is interpreted as resulting from the effects of E region conductivity on the F region irregularity structure. The regions in between the precipitation structures, where presumably the E region conductivity was small, were generally associated with large shears in the horizontal E-W drifts and large velocities, as measured by the ion drift meter on board AE-D. The maximum drifts measured were approx.2 km s -1 , corresponding to an electric field of 100 mV m -1 . The large-velocity regions were also associated with substantial ion heating and electron density depletions. The largest shear magnitudes observed were approx.80 m s -1 km -1 , and the shear gradient scale lengths were approx.10 km, which was approximately the resolution of the ion drift meter data set used. The spectral characteristics of irregularities in the large, variable flow regions were very different, with p 1 being approx.-1

Electron acceleration by surface plasma waves in double metal surface structure

Science.gov (United States)

Liu, C. S.; Kumar, Gagan; Singh, D. B.; Tripathi, V. K.

2007-12-01

Two parallel metal sheets, separated by a vacuum region, support a surface plasma wave whose amplitude is maximum on the two parallel interfaces and minimum in the middle. This mode can be excited by a laser using a glass prism. An electron beam launched into the middle region experiences a longitudinal ponderomotive force due to the surface plasma wave and gets accelerated to velocities of the order of phase velocity of the surface wave. The scheme is viable to achieve beams of tens of keV energy. In the case of a surface plasma wave excited on a single metal-vacuum interface, the field gradient normal to the interface pushes the electrons away from the high field region, limiting the acceleration process. The acceleration energy thus achieved is in agreement with the experimental observations.

Transverse particle acceleration techniques using lasers and masers

International Nuclear Information System (INIS)

Schoen, N.C.

1983-01-01

The concept discussed herein uses an intense traveling electromagnetic wave, produced by a laser or maser source, to accelerate electrons in the Rayleigh region of a focused beam. Although the possibility of non-synchronous acceleration has been considered, very little analysis of potential device configurations has been reported. Computer simulations of the acceleration process indicate practical figure of merit values in the range of 100 MeV/m for achievable electric field strengths with current technology. The development of compact, high energy electron accelerators will provide an essential component for many new technologies. Such as high power free electron lasers, X-ray and VUV sources, and high power millimeter and microwave devices. Considerable effort has been directed toward studies of new concepts for electron acceleration, including inverse free electron lasers, GYRACS, and modified betatrons

Chicago particle accelerator conference

International Nuclear Information System (INIS)

Southworth, Brian

1989-01-01

Naturally, emphasis at the Particle Accelerator Conference in Chicago in March was on work in the US, just as the newly instituted European Particle Accelerator Conference places emphasis on work in the 'old continent'. All will come together at the international conference in Japan in August. The proposed US Superconducting Supercollider (SSC) was highlighted in the opening talk at Chicago. Progress on this inchoate project to explore the TeV (1000 GeV) energy region by colliding 20 TeV proton beams was reported by the recently-appointed Director of the SSC Laboratory, Roy Schwitters. He reviewed the physics challenges and described progress and plans towards full authorization of construction.This year, the SSC conceptual design will be transformed into a 'site specific' report, now that the location at Waxahachie in Ellis County, Texas, has been selected. The Central Design Group, based in Berkeley for the past few years, will soon move to the Waxahachie region. The top management structure is taking shape and an International Advisory Committee is being formed

Chicago particle accelerator conference

Energy Technology Data Exchange (ETDEWEB)

Southworth, Brian

1989-06-15

Naturally, emphasis at the Particle Accelerator Conference in Chicago in March was on work in the US, just as the newly instituted European Particle Accelerator Conference places emphasis on work in the 'old continent'. All will come together at the international conference in Japan in August. The proposed US Superconducting Supercollider (SSC) was highlighted in the opening talk at Chicago. Progress on this inchoate project to explore the TeV (1000 GeV) energy region by colliding 20 TeV proton beams was reported by the recently-appointed Director of the SSC Laboratory, Roy Schwitters. He reviewed the physics challenges and described progress and plans towards full authorization of construction.This year, the SSC conceptual design will be transformed into a 'site specific' report, now that the location at Waxahachie in Ellis County, Texas, has been selected. The Central Design Group, based in Berkeley for the past few years, will soon move to the Waxahachie region. The top management structure is taking shape and an International Advisory Committee is being formed.

Is there a future for high energy accelerators?

International Nuclear Information System (INIS)

Tigner, M.

1993-01-01

The question of continuing viability of high energy accelerators as instruments of fundamental physics is discussed. It is seen that the next decade in elementary CM energies beyond SSC may be achievable with accelerators that can be imagined now. Beyond that there is room for doubt that accelerators will be the instrument of choice. History teaches that there is a good likelihood that the present perspective on the matter will be much different when the results from the few TeV region of elementary collision energies are in hand

Ion acceleration in the plasma source sheath

International Nuclear Information System (INIS)

Birdsall, C.K.

1986-01-01

This note is a calculation of the potential drop for a planar plasma source, across the source sheath, into a uniform plasma region defined by vector E = 0 and/or perhaps ∂ 2 PHI/∂ x 2 = 0. The calculation complements that of Bohm who obtained the potential drop at the other end of a plasma, at a planar collector sheath. The result is a relation between the source ion flux and the source sheath potential drop and the accompanying ion acceleration. This planar source sheath ion acceleration mechanism (or that from a distributed source) can provide the pre-collector-sheath ion acceleration as found necessary by Bohm. 3 refs

Source Regions of the Interplanetary Magnetic Field and Variability in Heavy-Ion Elemental Composition in Gradual Solar Energetic Particle Events

Science.gov (United States)

Ko, Yuan-Kuen; Tylka, Allan J.; Ng, Chee K.; Wang, Yi-Ming; Dietrich, William F.

2013-01-01

Gradual solar energetic particle (SEP) events are those in which ions are accelerated to their observed energies by interactions with a shock driven by a fast coronal mass-ejection (CME). Previous studies have shown that much of the observed event-to-event variability can be understood in terms of shock speed and evolution in the shock-normal angle. But an equally important factor, particularly for the elemental composition, is the origin of the suprathermal seed particles upon which the shock acts. To tackle this issue, we (1) use observed solar-wind speed, magnetograms, and the PFSS model to map the Sun-L1 interplanetary magnetic field (IMF) line back to its source region on the Sun at the time of the SEP observations; and (2) then look for correlation between SEP composition (as measured by Wind and ACE at approx. 2-30 MeV/nucleon) and characteristics of the identified IMF-source regions. The study is based on 24 SEP events, identified as a statistically-significant increase in approx. 20 MeV protons and occurring in 1998 and 2003-2006, when the rate of newly-emergent solar magnetic flux and CMEs was lower than in solar-maximum years and the field-line tracing is therefore more likely to be successful. We find that the gradual SEP Fe/O is correlated with the field strength at the IMF-source, with the largest enhancements occurring when the footpoint field is strong, due to the nearby presence of an active region. In these cases, other elemental ratios show a strong charge-to-mass (q/M) ordering, at least on average, similar to that found in impulsive events. These results lead us to suggest that magnetic reconnection in footpoint regions near active regions bias the heavy-ion composition of suprathermal seed ions by processes qualitatively similar to those that produce larger heavy-ion enhancements in impulsive SEP events. To address potential technical concerns about our analysis, we also discuss efforts to exclude impulsive SEP events from our event sample.

Acceleration of runaway electrons and Joule heating in solar flares

Science.gov (United States)

Holman, G. D.

1985-01-01

The electric field acceleration of electrons out of a thermal plasma and the simultaneous Joule heating of the plasma are studied. Acceleration and heating timescales are derived and compared, and upper limits are obtained on the acceleration volume and the rate at which electrons can be accelerated. These upper limits, determined by the maximum magnetic field strength observed in flaring regions, place stringent restrictions upon the acceleration process. The role of the plasma resistivity in these processes is examined, and possible sources of anomalous resistivity are summarized. The implications of these results for the microwave and hard X-ray emission from solar flares are examined.

Collaboration tools for the global accelerator network Workshop Report

CERN Document Server

Agarwal, D; Olson, J

2002-01-01

The concept of a ''Global Accelerator Network'' (GAN) has been put forward as a means for inter-regional collaboration in the operation of internationally constructed and operated frontier accelerator facilities. A workshop was held to allow representatives of the accelerator community and of the collaboratory development community to meet and discuss collaboration tools for the GAN environment. This workshop, called the Collaboration Tools for the Global Accelerator Network (GAN) Workshop, was held on August 26, 2002 at Lawrence Berkeley National Laboratory. The goal was to provide input about collaboration tools in general and to provide a strawman for the GAN collaborative tools environment. The participants at the workshop represented accelerator physicists, high-energy physicists, operations, technology tool developers, and social scientists that study scientific collaboration.

Collaboration tools for the global accelerator network: Workshop Report

International Nuclear Information System (INIS)

Agarwal, Deborah; Olson, Gary; Olson, Judy

2002-01-01

The concept of a ''Global Accelerator Network'' (GAN) has been put forward as a means for inter-regional collaboration in the operation of internationally constructed and operated frontier accelerator facilities. A workshop was held to allow representatives of the accelerator community and of the collaboratory development community to meet and discuss collaboration tools for the GAN environment. This workshop, called the Collaboration Tools for the Global Accelerator Network (GAN) Workshop, was held on August 26, 2002 at Lawrence Berkeley National Laboratory. The goal was to provide input about collaboration tools in general and to provide a strawman for the GAN collaborative tools environment. The participants at the workshop represented accelerator physicists, high-energy physicists, operations, technology tool developers, and social scientists that study scientific collaboration

Quantum Accelerator Modes from the Farey Tree

International Nuclear Information System (INIS)

Buchleitner, A.; D'Arcy, M.B.; Fishman, S.; Gardiner, S.A.; Guarneri, I.; Ma, Z.-Y.; Rebuzzini, L.; Summy, G.S.

2006-01-01

We show that mode locking finds a purely quantum nondissipative counterpart in atom-optical quantum accelerator modes. These modes are formed by exposing cold atoms to periodic kicks in the direction of the gravitational field. They are anchored to generalized Arnol'd tongues, parameter regions where driven nonlinear classical systems exhibit mode locking. A hierarchy for the rational numbers known as the Farey tree provides an ordering of the Arnol'd tongues and hence of experimentally observed accelerator modes

Computer codes for beam dynamics analysis of cyclotronlike accelerators

Science.gov (United States)

Smirnov, V.

2017-12-01

Computer codes suitable for the study of beam dynamics in cyclotronlike (classical and isochronous cyclotrons, synchrocyclotrons, and fixed field alternating gradient) accelerators are reviewed. Computer modeling of cyclotron segments, such as the central zone, acceleration region, and extraction system is considered. The author does not claim to give a full and detailed description of the methods and algorithms used in the codes. Special attention is paid to the codes already proven and confirmed at the existing accelerating facilities. The description of the programs prepared in the worldwide known accelerator centers is provided. The basic features of the programs available to users and limitations of their applicability are described.

Injection and extraction techniques in circular accelerators

International Nuclear Information System (INIS)

Tang Jingyu

2008-01-01

Injection and extraction are usually the key systems in circular accelerators. They play important roles in transferring the beam from one stage acceleration to the other or to experimental stations. It is also in the injection and extraction regions where beam losses happen mostly. Due to the tight space and to reduce the perturbation to the circulating orbit, the devices are usually designed to meet special requirements such as compactness, small stray field, fast rise time or fall time, etc. Usual injection and extraction devices include septum magnets, kicker magnets, electrostatic deflectors, slow bump magnets and strippers. In spite of different accelerators and specification for the injection and extraction devices, many techniques are shared in the design and manufacturing. This paper gives a general review on the techniques employed in the major circular accelerators in China. (authors)

Accurate Calculation of Magnetic Fields in the End Regions of Superconducting Accelerator Magnets using the BEM-FEM Coupling Method

CERN Document Server

Kurz, S

1999-01-01

In this paper a new technique for the accurate calculation of magnetic fields in the end regions of superconducting accelerator magnets is presented. This method couples Boundary Elements (BEM) which discretize the surface of the iron yoke and Finite Elements (FEM) for the modelling of the nonlinear interior of the yoke. The BEM-FEM method is therefore specially suited for the calculation of 3-dimensional effects in the magnets, as the coils and the air regions do not have to be represented in the finite-element mesh and discretization errors only influence the calculation of the magnetization (reduced field) of the yoke. The method has been recently implemented into the CERN-ROXIE program package for the design and optimization of the LHC magnets. The field shape and multipole errors in the two-in-one LHC dipoles with its coil ends sticking out of the common iron yoke is presented.

How Are Substrate Binding and Catalysis Affected by Mutating Glu127 and Arg161 in Prolyl-4-hydroxylase? A QM/MM and MD Study

Directory of Open Access Journals (Sweden)

Amy Timmins

2017-11-01

Full Text Available Prolyl-4-hydroxylase is a vital enzyme for human physiology involved in the biosynthesis of 4-hydroxyproline, an essential component for collagen formation. The enzyme performs a unique stereo- and regioselective hydroxylation at the C4 position of proline despite the fact that the C5 hydrogen atoms should be thermodynamically easier to abstract. To gain insight into the mechanism and find the origin of this regioselectivity, we have done a quantum mechanics/molecular mechanics (QM/MM study on wildtype and mutant structures. In a previous study (Timmins et al., 2017 we identified several active site residues critical for substrate binding and positioning. In particular, the Glu127 and Arg161 were shown to form multiple hydrogen bonding and ion-dipole interactions with substrate and could thereby affect the regio- and stereoselectivity of the reaction. In this work, we decided to test that hypothesis and report a QM/MM and molecular dynamics (MD study on prolyl-4-hydroxylase and several active site mutants where Glu127 or Arg161 are mutated for Asp, Gln, or Lys. Thus, the R161D and R161Q mutants give very high barriers for hydrogen atom abstraction from any proline C–H bond and therefore will be inactive. The R161K mutant, by contrast, sees the regio- and stereoselectivity of the reaction change but still is expected to hydroxylate proline at room temperature. By contrast, the Glu127 mutants E127D and E127Q show possible changes in regioselectivity with the former being more probable to react compared to the latter.

Optical klystron FELs based on tandem electrostatic accelerators

International Nuclear Information System (INIS)

Gover, A.; Friedman, A.

1989-01-01

The operation of tandem electrostatic accelerator FELs in an optical klystron configuration makes it possible to take advantage of the high quality (low emittance and low energy spread) of the electron beam in electrostatic accelerators. With evolving microwiggler technology, state-of-the-art moderate energy (6-14-MeV) tandem electrostatic accelerators may be used for the development of highly coherent tunable radiation sources in the entire IR region. The authors present the general design considerations and the predicted operating characteristics of such devices and refer in specifics to a design of a 10-1000-μm FEL based on the parameters of a 5-6-MeV high current tandem accelerator. The operating wavelength of FELs is determined by the Doppler shift formula

An injector system of a NDZ-20 medical electron linear accelerator

International Nuclear Information System (INIS)

Wang Houwen; Lai Qiji; Zhu Yizhang; Yang Fangxin

1987-01-01

The structure and characteristic of an injector system of a NDZ-20 medical electron linear accelerator are described. A bombarded type of Pierce electron gun is used. There are pre-focusing coil, deflecting coil, steering coil and beam pulse lead cutting coil in drift tube region. They control electron beam efficiently for ARC, ADC and BLC of the accelerator. ARC and ADC can increase stability and reliability of the accelerator operation, and BLC improves energy spectrum of the back feed accelerator

Quasi-stable injection channels in a wakefield accelerator

CERN Document Server

Wiltshire-Turkay, Mara; Pukhov, Alexander

2016-01-01

Particle-driven plasma-wakefield acceleration is a promising alternative to conventional electron acceleration techniques, potentially allowing electron acceleration to energies orders of magnitude higher than can currently be achieved. In this work we investigate the dependence of the energy gain on the position at which electrons are injected into the wake. Test particle simulations show previously unobserved complex structure in the parameter space, with quasi-stable injection channels forming for particles injected in narrow regions away from the centre of the wake. The result is relevant to the planning and tuning of experiments making use of external injection.

Biosynthesis of the enzymes of the cellulase system by T. Reesei QM 9414 in the presence of sophorose

Science.gov (United States)

Gritzali, M.

1982-12-01

As conventional, nonrenewable energy sources are rapidly depleted and it was necessary to search for alternative sources of energy. It was increasingly apparent that biomass and waste are alternatives well worth exploring. The sources of biomass and wastes that considered for conversion to useful products are quite diverse, but the most abundant constituent of almost every type is cellulose. Cellulose is cleanly converted to soluble fermentable sugars enzymatically, and cellulose enzymes were isolated from a number of microbial sources. It is generally agreed that the most effective system of enzymes for the conversion of cellulose to glucose is produced by species of the imperfect fungus Trichoderma. The mutant organism Trichoderma reesei QM 9414 is among the best producers of high levels of enzymes; these are extracellular and have carbonhydrate covalently bound to the peptide. Trichoderma produces three types of enzymes which, in a sequential and cooperative manner, convert cellulose to soluble oligosaccharides and glucose.

INJECTION TO RAPID DIFFUSIVE SHOCK ACCELERATION AT PERPENDICULAR SHOCKS IN PARTIALLY IONIZED PLASMAS

Energy Technology Data Exchange (ETDEWEB)

Ohira, Yutaka, E-mail: ohira@phys.aoyama.ac.jp [Department of Physics and Mathematics, Aoyama Gakuin University, 5-10-1 Fuchinobe, Sagamihara 252-5258 (Japan)

2016-08-10

We present a three-dimensional hybrid simulation of a collisionless perpendicular shock in a partially ionized plasma for the first time. In this simulation, the shock velocity and upstream ionization fraction are v {sub sh} ≈ 1333 km s{sup −1} and f {sub i} ∼ 0.5, which are typical values for isolated young supernova remnants (SNRs) in the interstellar medium. We confirm previous two-dimensional simulation results showing that downstream hydrogen atoms leak into the upstream region and are accelerated by the pickup process in the upstream region, and large magnetic field fluctuations are generated both in the upstream and downstream regions. In addition, we find that the magnetic field fluctuations have three-dimensional structures and the leaking hydrogen atoms are injected into the diffusive shock acceleration (DSA) at the perpendicular shock after the pickup process. The observed DSA can be interpreted as shock drift acceleration with scattering. In this simulation, particles are accelerated to v ∼ 100 v {sub sh} ∼ 0.3 c within ∼100 gyroperiods. The acceleration timescale is faster than that of DSA in parallel shocks. Our simulation results suggest that SNRs can accelerate cosmic rays to 10{sup 15.5} eV (the knee) during the Sedov phase.

Induced activity in accelerator structures, air and water

CERN Document Server

Stevenson, Graham Roger

2001-01-01

A summary is given of several 'rules of thumb' which can be used to predict the formation and decay of radionuclides in the structure of accelerators together with the dose rates from the induced radioactivity. Models are also given for the activation of gases (air of the accelerator vault) and liquids (in particular cooling water), together with their transport front the activation region to the release point. (18 refs).

Induced activity in accelerator structures, air and water

International Nuclear Information System (INIS)

Stevenson, G.R.

2001-01-01

A summary is given of several 'rules of thumb' which can be used to predict the formation and decay of radionuclides in the structure of accelerators together with the dose rates from the induced radioactivity. Models are also given for the activation of gases (air of the accelerator vault) and liquids (in particular cooling water), together with their transport from the activation region to the release point. (author)

Next generation of relativistic heavy ion accelerators

International Nuclear Information System (INIS)

Grunder, H.; Leemann, C.; Selph, F.

1978-06-01

Results are presented of exploratory and preliminary studies of a next generation of heavy ion accelerators. The conclusion is reached that useful luminosities are feasible in a colliding beam facility for relativistic heavy ions. Such an accelerator complex may be laid out in such a way as to provide extractebeams for fixed target operation, therefore allowing experimentation in an energy region overlapping with that presently available. These dual goals seem achievable without undue complications, or penalties with respect to cost and/or performance

Huntington's disease accelerates epigenetic aging of human brain and disrupts DNA methylation levels.

Science.gov (United States)

Horvath, Steve; Langfelder, Peter; Kwak, Seung; Aaronson, Jeff; Rosinski, Jim; Vogt, Thomas F; Eszes, Marika; Faull, Richard L M; Curtis, Maurice A; Waldvogel, Henry J; Choi, Oi-Wa; Tung, Spencer; Vinters, Harry V; Coppola, Giovanni; Yang, X William

2016-07-01

Age of Huntington's disease (HD) motoric onset is strongly related to the number of CAG trinucleotide repeats in the huntingtin gene, suggesting that biological tissue age plays an important role in disease etiology. Recently, a DNA methylation based biomarker of tissue age has been advanced as an epigenetic aging clock. We sought to inquire if HD is associated with an accelerated epigenetic age. DNA methylation data was generated for 475 brain samples from various brain regions of 26 HD cases and 39 controls. Overall, brain regions from HD cases exhibit a significant epigenetic age acceleration effect (p=0.0012). A multivariate model analysis suggests that HD status increases biological age by 3.2 years. Accelerated epigenetic age can be observed in specific brain regions (frontal lobe, parietal lobe, and cingulate gyrus). After excluding controls, we observe a negative correlation (r=-0.41, p=5.5×10-8) between HD gene CAG repeat length and the epigenetic age of HD brain samples. Using correlation network analysis, we identify 11 co-methylation modules with a significant association with HD status across 3 broad cortical regions. In conclusion, HD is associated with an accelerated epigenetic age of specific brain regions and more broadly with substantial changes in brain methylation levels.

Focusing mechanisms in the Pulselac CU accelerator

International Nuclear Information System (INIS)

Johnson, D.J.; Lockner, T.R.

1986-06-01

The post-acceleration of a 400 keV, 10 kA proton beam by a 200 kV magnetically insulated gap is investigated. The deflection from self and applied E and B fields are measured and compared to calculated values. We find that the beam is inadequately space-charge neutralized without gas puffs in regions of applied-B field to allow efficient transport. The beam is also non-current neutralized in these regions leading to self-magnetic deflection. The applied-B field is used to focus the beam both directly as a solenoidal lens and indirectly by defining the equipotential surfaces in the accelerating gap. It is also pointed out how azimuthal asymmetries in the beam current density and cathode plasma cause beam self-field asymmetries that lead to emittance growth. 4 refs., 4 figs

Beam-front dynamics and ion acceleration in drifting intense relativistic electron beams

International Nuclear Information System (INIS)

Alexander, K.F.; Hintze, W.

1976-01-01

Collective ion acceleration at the injection of a relativistic electron beam into a low-pressure gas or a plasma is discussed and its strong dependence on the beam-front dynamics is shown. A simple one-dimensional model taking explicitly into account the motion and ionizing action of the ions in the beam-front region is developed for the calculation of the beam drift velocity. The obtained pressure dependence is in good agreement with experimental data. The energy distribution is shown of the ions accelerated in the moving potential well of the space charge region. Scaling laws for the beam-front dynamics and ion acceleration are derived. (J.U.)

Optimization and benchmarking of a perturbative Metropolis Monte Carlo quantum mechanics/molecular mechanics program.

Science.gov (United States)

Feldt, Jonas; Miranda, Sebastião; Pratas, Frederico; Roma, Nuno; Tomás, Pedro; Mata, Ricardo A

2017-12-28

In this work, we present an optimized perturbative quantum mechanics/molecular mechanics (QM/MM) method for use in Metropolis Monte Carlo simulations. The model adopted is particularly tailored for the simulation of molecular systems in solution but can be readily extended to other applications, such as catalysis in enzymatic environments. The electrostatic coupling between the QM and MM systems is simplified by applying perturbation theory to estimate the energy changes caused by a movement in the MM system. This approximation, together with the effective use of GPU acceleration, leads to a negligible added computational cost for the sampling of the environment. Benchmark calculations are carried out to evaluate the impact of the approximations applied and the overall computational performance.

The catalytic mechanism of mouse renin studied with QM/MM calculations.

Science.gov (United States)

Brás, Natércia F; Ramos, Maria J; Fernandes, Pedro A

2012-09-28

Hypertension is a chronic condition that affects nearly 25% of adults worldwide. As the Renin-Angiotensin-Aldosterone System is implicated in the control of blood pressure and body fluid homeostasis, its combined blockage is an attractive therapeutic strategy currently in use for the treatment of several cardiovascular conditions. We have performed QM/MM calculations to study the mouse renin catalytic mechanism in atomistic detail, using the N-terminal His6-Asn14 segment of angiotensinogen as substrate. The enzymatic reaction (hydrolysis of the peptidic bond between residues in the 10th and 11th positions) occurs through a general acid/base mechanism and, surprisingly, it is characterized by three mechanistic steps: it begins with the creation of a first very stable tetrahedral gem-diol intermediate, followed by protonation of the peptidic bond nitrogen, giving rise to a second intermediate. In a final step the peptidic bond is completely cleaved and both gem-diol hydroxyl protons are transferred to the catalytic dyad (Asp32 and Asp215). The final reaction products are two separate peptides with carboxylic acid and amine extremities. The activation energy for the formation of the gem-diol intermediate was calculated as 23.68 kcal mol(-1), whereas for the other steps the values were 15.51 kcal mol(-1) and 14.40 kcal mol(-1), respectively. The rate limiting states were the reactants and the first transition state. The associated barrier (23.68 kcal mol(-1)) is close to the experimental values for the angiotensinogen substrate (19.6 kcal mol(-1)). We have also tested the influence of the density functional on the activation and reaction energies. All eight density functionals tested (B3LYP, B3LYP-D3, X3LYP, M06, B1B95, BMK, mPWB1K and B2PLYP) gave very similar results.

TIME-DEPENDENT STOCHASTIC ACCELERATION MODEL FOR FERMI BUBBLES

Energy Technology Data Exchange (ETDEWEB)

Sasaki, Kento; Asano, Katsuaki; Terasawa, Toshio, E-mail: kentos@icrr.u-tokyo.ac.jp, E-mail: asanok@icrr.u-tokyo.ac.jp, E-mail: terasawa@icrr.u-tokyo.ac.jp [Institute for Cosmic Ray Research, The University of Tokyo, 5-1-5 Kashiwanoha, Kashiwa, Chiba 277-8582 (Japan)

2015-12-01

We study stochastic acceleration models for the Fermi bubbles. Turbulence is excited just behind the shock front via Kelvin–Helmholtz, Rayleigh–Taylor, or Richtmyer–Meshkov instabilities, and plasma particles are continuously accelerated by the interaction with the turbulence. The turbulence gradually decays as it goes away from the shock fronts. Adopting a phenomenological model for the stochastic acceleration, we explicitly solve the temporal evolution of the particle energy distribution in the turbulence. Our results show that the spatial distribution of high-energy particles is different from those for a steady solution. We also show that the contribution of electrons that escaped from the acceleration regions significantly softens the photon spectrum. The photon spectrum and surface brightness profile are reproduced by our models. If the escape efficiency is very high, the radio flux from the escaped low-energy electrons can be comparable to that of the WMAP haze. We also demonstrate hadronic models with the stochastic acceleration, but they are unlikely in the viewpoint of the energy budget.

Criticality calculations in reactor accelerator coupling experiment (Race)

International Nuclear Information System (INIS)

Reda, M.A.; Spaulding, R.; Hunt, A.; Harmon, J.F.; Beller, D.E.

2005-01-01

A Reactor Accelerator Coupling Experiment (RACE) is to be performed at the Idaho State University Idaho Accelerator Center (IAC). The electron accelerator is used to generate neutrons by inducing Bremsstrahlung photon-neutron reactions in a Tungsten- Copper target. This accelerator/target system produces a source of ∼1012 n/s, which can initiate fission reactions in the subcritical system. This coupling experiment between a 40-MeV electron accelerator and a subcritical system will allow us to predict and measure coupling efficiency, reactivity, and multiplication. In this paper, the results of the criticality and multiplication calculations, which were carried out using the Monte Carlo radiation transport code MCNPX, for different coupling design options are presented. The fuel plate arrangements and the surrounding tank dimensions have been optimized. Criticality using graphite instead of water for reflector/moderator outside of the core region has been studied. The RACE configuration at the IAC will have a criticality (k-effective) of about 0,92 and a multiplication of about 10. (authors)

Ionospheric electron acceleration by electromagnetic waves near regions of plasma resonances

International Nuclear Information System (INIS)

Villalon, E.

1989-01-01

Electron acceleration by electromagnetic fields propagating in the inhomogeneous ionospheric plasma is investigated. It is found that high-amplitude short wavelength electrostatic waves are generated by the incident electromagnetic fields that penetrate the radio window. These waves can very efficiently transfer their energy to the electrons if the incident frequency is near the second harmonic of the cyclotron frequency

Neutron Transport Methods for Accelerator-Driven Systems

International Nuclear Information System (INIS)

Nicholas Tsoulfanidis; Elmer Lewis

2005-01-01

The objective of this project has been to develop computational methods that will enable more effective analysis of Accelerator Driven Systems (ADS). The work is centered at the University of Missouri at Rolla, with a subcontract at Northwestern University, and close cooperation with the Nuclear Engineering Division at Argonne National Laboratory. The work has fallen into three categories. First, the treatment of the source for neutrons originating from the spallation target which drives the neutronics calculations of the ADS. Second, the generalization of the nodal variational method to treat the R-Z geometry configurations frequently needed for scoping calculations in Accelerator Driven Systems. Third, the treatment of void regions within variational nodal methods as needed to treat the accelerator beam tube

A monolithic relativistic electron beam source based on a dielectric laser accelerator structure

International Nuclear Information System (INIS)

McNeur, Josh; Carranza, Nestor; Travish, Gil; Yin Hairong; Yoder, Rodney

2012-01-01

Work towards a monolithic device capable of producing relativistic particle beams within a cubic-centimeter is detailed. We will discuss the Micro-Accelerator Platform (MAP), an optical laser powered dielectric accelerator as the main building block of this chip-scale source along with a field enhanced emitter and a region for sub-relativistic acceleration.

Electron acceleration by electromagnetic irradiation of a weakly-collisional plasma

International Nuclear Information System (INIS)

Karfidov, D.M.; Lukina, N.A.; Sergeychev, K.F.

1989-01-01

In this paper, electron acceleration is investigated experimentally in both a homogeneous and an inhomogeneous plasma. In the first case acceleration is produced by development of a parametric instability, while in the second case acceleration in a plasma resonance field is used. It is demonstrated that multiple electron passes through a resonant field will produce and accelerated electron energy spectrum characterized by the effective temperature. It is established that the electron replacement current flowing in the interaction region between the plasma and a spatially-limited microwave field excites ion-acoustic turbulence in plasma and also produces an anomalously low thermal conductivity and an anomalously high resistivity

A quantum-mechanics molecular-mechanics scheme for extended systems

International Nuclear Information System (INIS)

Hunt, Diego; Scherlis, Damián A; Sanchez, Veronica M

2016-01-01

We introduce and discuss a hybrid quantum-mechanics molecular-mechanics (QM-MM) approach for Car–Parrinello DFT simulations with pseudopotentials and planewaves basis, designed for the treatment of periodic systems. In this implementation the MM atoms are considered as additional QM ions having fractional charges of either sign, which provides conceptual and computational simplicity by exploiting the machinery already existing in planewave codes to deal with electrostatics in periodic boundary conditions. With this strategy, both the QM and MM regions are contained in the same supercell, which determines the periodicity for the whole system. Thus, while this method is not meant to compete with non-periodic QM-MM schemes able to handle extremely large but finite MM regions, it is shown that for periodic systems of a few hundred atoms, our approach provides substantial savings in computational times by treating classically a fraction of the particles. The performance and accuracy of the method is assessed through the study of energetic, structural, and dynamical aspects of the water dimer and of the aqueous bulk phase. Finally, the QM-MM scheme is applied to the computation of the vibrational spectra of water layers adsorbed at the TiO 2 anatase (1 0 1) solid–liquid interface. This investigation suggests that the inclusion of a second monolayer of H 2 O molecules is sufficient to induce on the first adsorbed layer, a vibrational dynamics similar to that taking place in the presence of an aqueous environment. The present QM-MM scheme appears as a very interesting tool to efficiently perform molecular dynamics simulations of complex condensed matter systems, from solutions to nanoconfined fluids to different kind of interfaces. (paper)

A quantum-mechanics molecular-mechanics scheme for extended systems.

Science.gov (United States)

Hunt, Diego; Sanchez, Veronica M; Scherlis, Damián A

2016-08-24

We introduce and discuss a hybrid quantum-mechanics molecular-mechanics (QM-MM) approach for Car-Parrinello DFT simulations with pseudopotentials and planewaves basis, designed for the treatment of periodic systems. In this implementation the MM atoms are considered as additional QM ions having fractional charges of either sign, which provides conceptual and computational simplicity by exploiting the machinery already existing in planewave codes to deal with electrostatics in periodic boundary conditions. With this strategy, both the QM and MM regions are contained in the same supercell, which determines the periodicity for the whole system. Thus, while this method is not meant to compete with non-periodic QM-MM schemes able to handle extremely large but finite MM regions, it is shown that for periodic systems of a few hundred atoms, our approach provides substantial savings in computational times by treating classically a fraction of the particles. The performance and accuracy of the method is assessed through the study of energetic, structural, and dynamical aspects of the water dimer and of the aqueous bulk phase. Finally, the QM-MM scheme is applied to the computation of the vibrational spectra of water layers adsorbed at the TiO2 anatase (1 0 1) solid-liquid interface. This investigation suggests that the inclusion of a second monolayer of H2O molecules is sufficient to induce on the first adsorbed layer, a vibrational dynamics similar to that taking place in the presence of an aqueous environment. The present QM-MM scheme appears as a very interesting tool to efficiently perform molecular dynamics simulations of complex condensed matter systems, from solutions to nanoconfined fluids to different kind of interfaces.

Energetic Electron Acceleration Observed by MMS in the Vicinity of an X-Line Crossing

Science.gov (United States)

Jaynes, A. N.; Turner, D. L.; Wilder, F. D.; Osmane, A.; Baker, D. N.; Blake, J. B.; Fennell, J. F.; Cohen, I. J.; Mauk, B. H.; Reeves, G. D.;

THE EFFECT OF COOLING ON PARTICLE TRAJECTORIES AND ACCELERATION IN RELATIVISTIC MAGNETIC RECONNECTION

Energy Technology Data Exchange (ETDEWEB)

Kagan, Daniel; Nakar, Ehud [Raymond and Beverly Sackler School of Physics and Astronomy, Tel Aviv University, Tel Aviv 69978 (Israel); Piran, Tsvi, E-mail: daniel.kagan@mail.huji.ac.il [Racah Institute of Physics, The Hebrew University, Jerusalem 91904 (Israel)

2016-12-20

The maximum synchrotron burnoff limit of 160 MeV represents a fundamental limit to radiation resulting from electromagnetic particle acceleration in one-zone ideal plasmas. In magnetic reconnection, however, particle acceleration and radiation are decoupled because the electric field is larger than the magnetic field in the diffusion region. We carry out two-dimensional particle-in-cell simulations to determine the extent to which magnetic reconnection can produce synchrotron radiation above the burnoff limit. We use the test particle comparison (TPC) method to isolate the effects of cooling by comparing the trajectories and acceleration efficiencies of test particles incident on such a reconnection region with and without cooling them. We find that the cooled and uncooled particle trajectories are typically similar during acceleration in the reconnection region, and derive an effective limit on particle acceleration that is inversely proportional to the average magnetic field experienced by the particle during acceleration. Using the calculated distribution of this average magnetic field as a function of uncooled final particle energy, we find analytically that cooling does not affect power-law particle energy spectra except at energies far above the synchrotron burnoff limit. Finally, we compare fully cooled and uncooled simulations of reconnection, confirming that the synchrotron burnoff limit does not produce a cutoff in the particle energy spectrum. Our results indicate that the TPC method accurately predicts the effects of cooling on particle acceleration in relativistic reconnection, and that, even far above the burnoff limit, the synchrotron energy of radiation produced in reconnection is not limited by cooling.

THE EFFECT OF COOLING ON PARTICLE TRAJECTORIES AND ACCELERATION IN RELATIVISTIC MAGNETIC RECONNECTION

International Nuclear Information System (INIS)

Kagan, Daniel; Nakar, Ehud; Piran, Tsvi

2016-01-01

The maximum synchrotron burnoff limit of 160 MeV represents a fundamental limit to radiation resulting from electromagnetic particle acceleration in one-zone ideal plasmas. In magnetic reconnection, however, particle acceleration and radiation are decoupled because the electric field is larger than the magnetic field in the diffusion region. We carry out two-dimensional particle-in-cell simulations to determine the extent to which magnetic reconnection can produce synchrotron radiation above the burnoff limit. We use the test particle comparison (TPC) method to isolate the effects of cooling by comparing the trajectories and acceleration efficiencies of test particles incident on such a reconnection region with and without cooling them. We find that the cooled and uncooled particle trajectories are typically similar during acceleration in the reconnection region, and derive an effective limit on particle acceleration that is inversely proportional to the average magnetic field experienced by the particle during acceleration. Using the calculated distribution of this average magnetic field as a function of uncooled final particle energy, we find analytically that cooling does not affect power-law particle energy spectra except at energies far above the synchrotron burnoff limit. Finally, we compare fully cooled and uncooled simulations of reconnection, confirming that the synchrotron burnoff limit does not produce a cutoff in the particle energy spectrum. Our results indicate that the TPC method accurately predicts the effects of cooling on particle acceleration in relativistic reconnection, and that, even far above the burnoff limit, the synchrotron energy of radiation produced in reconnection is not limited by cooling.

Auroral ion acceleration from lower hybrid solitary structures: A summary of sounding rocket observations

Science.gov (United States)

Lynch, K. A.; Arnoldy, R. L.; Kintner, P. M.; Schuck, P.; Bonnell, J. W.; Coffey, V.

In this paper we present a review of sounding rocket observations of the ion acceleration seen in nightside auroral zone lower hybrid solitary structures. Observations from Topaz3, Amicist, and Phaze2 are presented on various spatial scales, including the two-point measurements of the Amicist mission. From this collection of observations we will demonstrate the following characteristics of transverse acceleration of ions (TAI) in lower hybrid solitary structures (LHSS). The ion acceleration process is narrowly confined to 90° pitch angle, in spatially confined regions of up to a few hundred meters across B. The acceleration process does not affect the thermal core of the ambient distribution and does not directly create a measurable effect on the ambient ion population outside the LHSS themselves. This precludes observation with these data of any nonlinear feedback between the ion acceleration and the existence or evolution of the density irregularities on which these LHSS events grow. Within the LHSS region the acceleration process creates a high-energy tail beginning at a few times the thermal ion speed. The ion acceleration events are closely associated with localized wave events. Accelerated ions bursts are also seen without a concurrent observation of a localized wave event, for two possible reasons. In some cases, the pitch angles of the accelerated tail ions are elevated above perpendicular; that is, the acceleration occurred below the observer and the mirror force has begun to act upon the distribution, moving it upward from the source. In other cases, the accelerated ion structure is spatially larger than the wave event structure, and the observation catches only the ion event. The occurrence rate of these ion acceleration events is related to the ambient environment in two ways: its altitude dependence can be modeled with the parameter B2/ne, and it is highest in regions of intense VLF activity. The cumulative ion outflow from these LHSS TAI is

The classical limit in the framework of stochastic mechanics

International Nuclear Information System (INIS)

Claverie, P.

1976-01-01

Thorough qualitative understanding of microphysical phenomena is not really obtained by usual quantum mechanics (QM), whereas statistical mechanics (SM) appears able to bring in substantial conceptual progress. These conceptual improvements in a fringe area of quantum mechanics, namely the so-called transition region to classical mechanics, are described. The difficulties which appear in the framework of usual QM are surveyed and then it is shown how they would disappear in the framework of SM, provided that appropriate dynamical laws are found such that, by using them, SM actually gives the main results of QM (position and velocity probability distributions, mean values of energy, angular momentum, etc.)

Do SiO 2 and carbon-doped SiO 2 nanoparticles melt? Insights from QM/MD simulations and ramifications regarding carbon nanotube growth

Science.gov (United States)

Page, Alister J.; Chandrakumar, K. R. S.; Irle, Stephan; Morokuma, Keiji

2011-05-01

Quantum chemical molecular dynamics (QM/MD) simulations of pristine and carbon-doped SiO 2 nanoparticles have been performed between 1000 and 3000 K. At temperatures above 1600 K, pristine nanoparticle SiO 2 decomposes rapidly, primarily forming SiO. Similarly, carbon-doped nanoparticle SiO 2 decomposes at temperatures above 2000 K, primarily forming SiO and CO. Analysis of the physical states of these pristine and carbon-doped SiO 2 nanoparticles indicate that they remain in the solid phase throughout decomposition. This process is therefore one of sublimation, as the liquid phase is never entered. Ramifications of these observations with respect to presently debated mechanisms of carbon nanotube growth on SiO 2 nanoparticles will be discussed.

Particle acceleration and wave emissions associated with the formation of auroral cavities and enhancements

International Nuclear Information System (INIS)

Winglee, R.M.; Pritchett, P.L.; Dusenbery, P.B.

1988-01-01

Observations from DE 1 and electrostatic particle simulations are combined in an effort to provide a unified model for (nightside) auroral particle acceleration and wave emissions and their association with plasma cavities and enhancements. The observations show that enhanced electron precipitation during inverted-V events is associated with broadband electrostatic bursts (BEB), increased upward field-aligned currents, and density enhancements. These regions are flanked by return current regions where the density is depleted (i.e., by plasma cavities). Perpendicular acceleration of ambient plasma ions can occur in both upward and return current regions. It is shown through the simulations that these processes are integrally related and are not independent of each other. The free energy for the auroral particle acceleration can be provided by energetic ion beams in the plasma sheet boundary layer with nonzero perpendicular energy. The perpendicular energy allows charge separation between the beam ions and costreaming electrons to occur. The resultant space charge fields accelerate electrons on the same field lines as the costreaming electrons downward toward the ionosphere, without the beam ions actually propagating down to auroral altitudes. Ambient plasma electrons on adjacent field lines are accelerated upward, forming a return current

Electron Heating and Acceleration in a Reconnecting Magnetotail

Science.gov (United States)

El-Alaoui, M.; Zhou, M.; Lapenta, G.; Berchem, J.; Richard, R. L.; Schriver, D.; Walker, R. J.

2017-12-01

Electron heating and acceleration in the magnetotail have been investigated intensively. A major site for this process is the reconnection region. However, where and how the electrons are accelerated in a realistic three-dimensional X-line geometry is not fully understood. In this study, we employed a three-dimensional implicit particle-in-cell (iPIC3D) simulation and large-scale kinetic (LSK) simulation to address these problems. We modeled a magnetotail reconnection event observed by THEMIS in an iPIC3D simulation with initial and boundary conditions given by a global magnetohydrodynamic (MHD) simulation of Earth's magnetosphere. The iPIC3D simulation system includes the region of fast outflow emanating from the reconnection site that drives dipolarization fronts. We found that current sheet electrons exhibit elongated (cigar-shaped) velocity distributions with a higher parallel temperature. Using LSK we then followed millions of test electrons using the electromagnetic fields from iPIC3D. We found that magnetotail reconnection can generate power law spectra around the near-Earth X-line. A significant number of electrons with energies higher than 50 keV are produced. We identified several acceleration mechanisms at different locations that were responsible for energizing these electrons: non-adiabatic cross-tail drift, betatron and Fermi acceleration. Relative contributions to the energy gain of these high energy electrons from the different mechanisms will be discussed.

Experimental Study of an ion cyclon resonance accelerator presentation of his thesis

CERN Document Server

Ramsell, C T

1999-01-01

The Ion Cyclotron Resonance Accelerator (ICRA) uses the operating principles of cyclotrons and gyrotrons. The novel geometry of the ICRA allows an ion beam to drift axially while being accelerated in the azimuthal direction. Previous work on electron cyclotron resonance acceleration used waveguide modes to accelerate an electron beam [5]. This research extends cyclotron resonance acceleration to ions by using a high field superconducting magnet and an rf driven magnetron operating at a harmonic of the cyclotron frequency. The superconducting solenoid provides an axial magnetic field for radial confinement and an rf driven magnetron provides azimuthal electric fields for acceleration. The intent of the ICRA concept is to create an ion accelerator which is simple, compact, lightweight, and inexpensive. Furthermore, injection and extraction are inherently simple since the beam drifts through the acceleration region. However, use of this convenient geometry leads to an accelerated beam with a large energy spread....

Industrialization of Superconducting RF Accelerator Technology

Science.gov (United States)

Peiniger, Michael; Pekeler, Michael; Vogel, Hanspeter

2012-01-01

Superconducting RF (SRF) accelerator technology has basically existed for 50 years. It took about 20 years to conduct basic R&D and prototyping at universities and international institutes before the first superconducting accelerators were built, with industry supplying complete accelerator cavities. In parallel, the design of large scale accelerators using SRF was done worldwide. In order to build those accelerators, industry has been involved for 30 years in building the required cavities and/or accelerator modules in time and budget. To enable industry to supply these high tech components, technology transfer was made from the laboratories in the following three regions: the Americas, Asia and Europe. As will be shown, the manufacture of the SRF cavities is normally accomplished in industry whereas the cavity testing and module assembly are not performed in industry in most cases, yet. The story of industrialization is so far a story of customized projects. Therefore a real SRF accelerator product is not yet available in this market. License agreements and technology transfer between leading SRF laboratories and industry is a powerful tool for enabling industry to manufacture SRF components or turnkey superconducting accelerator modules for other laboratories and users with few or no capabilities in SRF technology. Despite all this, the SRF accelerator market today is still a small market. The manufacture and preparation of the components require a range of specialized knowledge, as well as complex and expensive manufacturing installations like for high precision machining, electron beam welding, chemical surface preparation and class ISO4 clean room assembly. Today, the involved industry in the US and Europe comprises medium-sized companies. In Japan, some big enterprises are involved. So far, roughly 2500 SRF cavities have been built by or ordered from industry worldwide. Another substantial step might come from the International Linear Collider (ILC) project

General classification of charged test particle circular orbits in Reissner-Nordstroem spacetime

Energy Technology Data Exchange (ETDEWEB)

Pugliese, D. [Silesian University in Opava, Institute of Physics, Faculty of Philosophy and Science, Opava (Czech Republic); Quevedo, H. [Universita di Roma ' ' La Sapienza' ' , Dipartimento di Fisica, ICRA, Rome (Italy); Icranet-Pescara, Pescara (Italy); Universidad Nacional Autonoma de Mexico, Instituto de Ciencias Nucleares, Mexico, DF (Mexico); Kazakh National University, Department of Theoretical and Nuclear Physics, Almaty (Kazakhstan); Ruffini, R. [Universita di Roma ' ' La Sapienza' ' , Dipartimento di Fisica, ICRA, Rome (Italy); Icranet-Pescara, Pescara (Italy)

2017-04-15

We investigate charged particles' circular motion in the gravitational field of a charged mass distribution described by the Reissner-Nordstroem spacetime. We introduce a set of independent parameters completely characterizing the different spatial regions in which circular motion is allowed. We provide a most complete classification of circular orbits for different sets of particle and source charge-to-mass ratios. We study both black holes and naked singularities and show that the behavior of charged particles depend drastically on the type of source. Our analysis shows in an alternative manner that the behavior of circular orbits can in principle be used to distinguish between black holes and naked singularities. From this analysis, special limiting values for the dimensionless charge of black hole and naked singularity emerge, namely, Q/M = 1/2, Q/M = √(13)/5 and Q/M = √(2/3) for the black hole case and Q/M = 1, Q/M = 5/(2√(6)), Q/M = 3√(6)/7, and finally Q/M = √(9/8) for the naked singularity case. Similarly and surprisingly, analogous limits emerge for the orbiting particles charge-to-mass ratio ε, for positive charges ε = 1, ε = 2 and ε = M/Q. These limits play an important role in the study of the coupled electromagnetic and gravitational interactions, and the investigation of the role of the charge in the gravitational collapse of compact objects. (orig.)

Cloning, periplasmic expression, purification and structural characterization of human ribosomal protein L10; Clonagem, expressao, purificacao e caracterizacao estrutural da proteina ribossomal L10 humana recombinante

Energy Technology Data Exchange (ETDEWEB)

Pereira, Larissa Miranda

2009-07-01

The ribosomal protein L10 (RP L10) is a strong candidate to be included in the class of tumor suppressor proteins. This protein, also denominated as QM, is known to participate in the binding of ribosomal subunits 60S and 40S and the translation of mRNAs. It has a molecular weight that varies between 24 and 26 kDa and an isoelectric point of (pI) 10.5. The sequence of the protein QM is highly conserved in mammals, plants, invertebrates, insects and yeast which indicates its critical functions in a cell. As a tumor suppressor, RP L10 has been studied in strains of Wilm's tumor (WT-1) and tumor cells in the stomach, where was observed a decrease in the amount of its mRNA. More recently, the RP L10 was found in low amounts in the early stages of prostate adenoma and showed some mutation in ovarian cancer, what indicates its role as a suppressor protein in the development of these diseases. It has also been described that this protein interacts with c-Jun and c-Yes inhibiting growth factors and consequently, cell division. This work has an important role on the establishment of soluble expression of QM to give base information for further studies on expression that aim to evaluate the specific regions where it acts binding the 60S and 40S ribosomal subunits and translation, as well as its binding to proto-oncogenes. The cDNA for QM protein was amplified by PCR and cloned into periplasmic expression vector p3SN8. The QM protein was expressed in E. coli BL21 (DE3) in the region of cytoplasm and periplasm, the best condition was obtained from the expression of the recombinant plasmid QM p1813{sub Q}M at 25 degree C or 30 degree C, the soluble protein was obtained with small amounts of contaminants. The assays of secondary structure showed that the QM protein is predominantly alpha-helix, but when it loses the folding, this condition changes and the protein is replaced by {beta}- sheet feature. (author)

Accelerated life testing effects on CMOS microcircuit characteristics

Science.gov (United States)

1980-01-01

The 250 C, 200C and 125C accelerated tests are described. The wear-out distributions from the 250 and 200 C tests were used to estimate the activation energy between the two test temperatures. The duration of the 125 C test was not sufficient to bring the test devices into the wear-out region. It was estimated that, for the most complex of the three devices types, the activation energy between 200 C and 125 C should be at least as high as that between 250 C and 200 C. The practicality of the use of high temperature for the accelerated life tests from the point of view of durability of equipment is assessed. Guidlines for the development of accelerated life-test conditions are proposed. The use of the silicon nitride overcoat to improve the high temperature accelerated life-test characteristics of CMOS microcircuits is described.

Plasma accelerators

International Nuclear Information System (INIS)

Bingham, R.; Angelis, U. de; Johnston, T.W.

1991-01-01

Recently attention has focused on charged particle acceleration in a plasma by a fast, large amplitude, longitudinal electron plasma wave. The plasma beat wave and plasma wakefield accelerators are two efficient ways of producing ultra-high accelerating gradients. Starting with the plasma beat wave accelerator (PBWA) and laser wakefield accelerator (LWFA) schemes and the plasma wakefield accelerator (PWFA) steady progress has been made in theory, simulations and experiments. Computations are presented for the study of LWFA. (author)

The physics of accelerator driven sub-critical reactors

Indian Academy of Sciences (India)

Accelerator driven systems (ADS) are attracting worldwide attention .... The region of interest (or the entire reactor core) is divided into a suitable number ..... have also presented the status of the theoretical and experimental activities being.

Causes of accelerating sea level on the East Coast of North America.

Science.gov (United States)

Davis, James L; Vinogradova, Nadya T

2017-05-28

The tide-gauge record from the North American East Coast reveals significant accelerations in sea level starting in the late twentieth century. The estimated post-1990 accelerations range from near zero to ∼0.3 mm yr -2 . We find that the observed sea level acceleration is well modeled using several processes: mass change in Greenland and Antarctica as measured by the Gravity Recovery and Climate Experiment satellites; ocean dynamic and steric variability provided by the GECCO2 ocean synthesis; and the inverted barometer effect. However, to achieve this fit requires estimation of an admittance for the dynamical and steric contribution, possibly due to the coarse resolution of this analysis or to simplifications associated with parameterization of bottom friction in the shallow coastal areas. The acceleration from ice loss alone is equivalent to a regional sea level rise in one century of 0.2 m in the north and 0.75 m in the south of this region.

Particle Accelerators for PET radionuclides

DEFF Research Database (Denmark)

Jensen, Mikael

2012-01-01

The requirements set for particle accelerators for production of radioactive isotopes for PET can easily be derived from first principles. The simple general need is for proton beams with energy in the region 10–20 MeV and current 20–100 microAmps. This is most reliably and cost-effectively achie......The requirements set for particle accelerators for production of radioactive isotopes for PET can easily be derived from first principles. The simple general need is for proton beams with energy in the region 10–20 MeV and current 20–100 microAmps. This is most reliably and cost......-effectively achieved by the well proven technology of the compact medical cyclotron, presently available from several companies. The main features of these cyclotrons are essential similar: resistive, sector focused iron magnets, internal negative ion sources and stripping extraction. The remaining differences between...... different manufacturers will be discussed the light of what is actually needed for a given PET site operation. Alternatives to the conventional cyclotron have been proposed and tested but have at present very limited use. These alternatives will be discussed, as well as the future possibilities of supplying...

TESLA accelerator installation

International Nuclear Information System (INIS)

Neskovic, N.; Ostojic, R.; Susini, A.; Milinkovic, Lj.; Ciric, D.; Dobrosavljevic, A.; Brajuskovic, B.; Cirkovic, S.; Bojovic, B.; Josipovic, M.

1992-01-01

The TESLA accelerator Installation is described. Its main parts are the VINCY Cyclotron, the multiply charged heavy-ion mVINIS Ion Source, and the negative light-ion pVINIS Ion Source. The Installation should be the principal installation of a regional center for basic and applied research in nuclear physics, atomic physics, surface physics and solid state physics, for production of radioisotopes, for research and therapy in nuclear medicine. The first extraction of the ion beam from the Cyclotron is planned for 1995. (R.P.) 3 refs.; 1 fig

First muon acceleration using a radio-frequency accelerator

Directory of Open Access Journals (Sweden)

S. Bae

2018-05-01

Full Text Available Muons have been accelerated by using a radio-frequency accelerator for the first time. Negative muonium atoms (Mu^{-}, which are bound states of positive muons (μ^{+} and two electrons, are generated from μ^{+}’s through the electron capture process in an aluminum degrader. The generated Mu^{-}’s are initially electrostatically accelerated and injected into a radio-frequency quadrupole linac (RFQ. In the RFQ, the Mu^{-}’s are accelerated to 89 keV. The accelerated Mu^{-}’s are identified by momentum measurement and time of flight. This compact muon linac opens the door to various muon accelerator applications including particle physics measurements and the construction of a transmission muon microscope.

Acceleration Modes and Transitions in Pulsed Plasma Accelerators

Science.gov (United States)

Polzin, Kurt A.; Greve, Christine M.

2018-01-01

Pulsed plasma accelerators typically operate by storing energy in a capacitor bank and then discharging this energy through a gas, ionizing and accelerating it through the Lorentz body force. Two plasma accelerator types employing this general scheme have typically been studied: the gas-fed pulsed plasma thruster and the quasi-steady magnetoplasmadynamic (MPD) accelerator. The gas-fed pulsed plasma accelerator is generally represented as a completely transient device discharging in approximately 1-10 microseconds. When the capacitor bank is discharged through the gas, a current sheet forms at the breech of the thruster and propagates forward under a j (current density) by B (magnetic field) body force, entraining propellant it encounters. This process is sometimes referred to as detonation-mode acceleration because the current sheet representation approximates that of a strong shock propagating through the gas. Acceleration of the initial current sheet ceases when either the current sheet reaches the end of the device and is ejected or when the current in the circuit reverses, striking a new current sheet at the breech and depriving the initial sheet of additional acceleration. In the quasi-steady MPD accelerator, the pulse is lengthened to approximately 1 millisecond or longer and maintained at an approximately constant level during discharge. The time over which the transient phenomena experienced during startup typically occur is short relative to the overall discharge time, which is now long enough for the plasma to assume a relatively steady-state configuration. The ionized gas flows through a stationary current channel in a manner that is sometimes referred to as the deflagration-mode of operation. The plasma experiences electromagnetic acceleration as it flows through the current channel towards the exit of the device. A device that had a short pulse length but appeared to operate in a plasma acceleration regime different from the gas-fed pulsed plasma

PONDEROMOTIVE ACCELERATION IN CORONAL LOOPS

International Nuclear Information System (INIS)

Dahlburg, R. B.; Obenschain, K.; Laming, J. M.; Taylor, B. D.

2016-01-01

Ponderomotive acceleration has been asserted to be a cause of the first ionization potential (FIP) effect, the well-known enhancement in abundance by a factor of 3–4 over photospheric values of elements in the solar corona with FIP less than about 10 eV. It is shown here by means of numerical simulations that ponderomotive acceleration occurs in solar coronal loops, with the appropriate magnitude and direction, as a “by-product” of coronal heating. The numerical simulations are performed with the HYPERION code, which solves the fully compressible three-dimensional magnetohydrodynamic equations including nonlinear thermal conduction and optically thin radiation. Numerical simulations of coronal loops with an axial magnetic field from 0.005 to 0.02 T and lengths from 25,000 to 75,000 km are presented. In the simulations the footpoints of the axial loop magnetic field are convected by random, large-scale motions. There is a continuous formation and dissipation of field-aligned current sheets, which act to heat the loop. As a consequence of coronal magnetic reconnection, small-scale, high-speed jets form. The familiar vortex quadrupoles form at reconnection sites. Between the magnetic footpoints and the corona the reconnection flow merges with the boundary flow. It is in this region that the ponderomotive acceleration occurs. Mirroring the character of the coronal reconnection, the ponderomotive acceleration is also found to be intermittent.

PONDEROMOTIVE ACCELERATION IN CORONAL LOOPS

Energy Technology Data Exchange (ETDEWEB)

Dahlburg, R. B.; Obenschain, K. [LCP and FD, Naval Research Laboratory, Washington, DC 20375 (United States); Laming, J. M. [Space Science Division, Naval Research Laboratory, Washington, DC 20375 (United States); Taylor, B. D. [AFRL Eglin AFB, Pensacola, FL 32542 (United States)

2016-11-10

Ponderomotive acceleration has been asserted to be a cause of the first ionization potential (FIP) effect, the well-known enhancement in abundance by a factor of 3–4 over photospheric values of elements in the solar corona with FIP less than about 10 eV. It is shown here by means of numerical simulations that ponderomotive acceleration occurs in solar coronal loops, with the appropriate magnitude and direction, as a “by-product” of coronal heating. The numerical simulations are performed with the HYPERION code, which solves the fully compressible three-dimensional magnetohydrodynamic equations including nonlinear thermal conduction and optically thin radiation. Numerical simulations of coronal loops with an axial magnetic field from 0.005 to 0.02 T and lengths from 25,000 to 75,000 km are presented. In the simulations the footpoints of the axial loop magnetic field are convected by random, large-scale motions. There is a continuous formation and dissipation of field-aligned current sheets, which act to heat the loop. As a consequence of coronal magnetic reconnection, small-scale, high-speed jets form. The familiar vortex quadrupoles form at reconnection sites. Between the magnetic footpoints and the corona the reconnection flow merges with the boundary flow. It is in this region that the ponderomotive acceleration occurs. Mirroring the character of the coronal reconnection, the ponderomotive acceleration is also found to be intermittent.

Accelerator development

International Nuclear Information System (INIS)

Anon.

1975-01-01

Because the use of accelerated heavy ions would provide many opportunities for new and important studies in nuclear physics and nuclear chemistry, as well as other disciplines, both the Chemistry and Physics Divisions are supporting the development of a heavy-ion accelerator. The design of greatest current interest includes a tandem accelerator with a terminal voltage of approximately 25 MV injecting into a linear accelerator with rf superconducting resonators. This combined accelerator facility would be capable of accelerating ions of masses ranging over the entire periodic table to an energy corresponding to approximately 10 MeV/nucleon. This approach, as compared to other concepts, has the advantages of lower construction costs, lower operating power, 100 percent duty factor, and high beam quality (good energy resolution, good timing resolution, small beam size, and small beam divergence). The included sections describe the concept of the proposed heavy-ion accelerator, and the development program aiming at: (1) investigation of the individual questions concerning the superconducting accelerating resonators; (2) construction and testing of prototype accelerator systems; and (3) search for economical solutions to engineering problems. (U.S.)

Accelerator Technology: Geodesy and Alignment for Particle Accelerators

CERN Document Server

Missiaen, D

2013-01-01

This document is part of Subvolume C 'Accelerators and Colliders' of Volume 21 'Elementary Particles' of Landolt-Börnstein - Group I 'Elementary Particles, Nuclei and Atoms'. It contains the the Section '8.9 Geodesy and Alignment for Particle Accelerators' of the Chapter '8 Accelerator Technology' with the content: 8.9 Geodesy and Alignment for Particle Accelerators 8.9.1 Introduction 8.9.2 Reference and Co-ordinate Systems 8.9.3 Definition of the Beam Line on the Accelerator Site 8.9.4 Geodetic Network 8.9.5 Tunnel Preliminary Works 8.9.6 The Alignment References 8.9.7 Alignment of Accelerator Components 8.9.8 Permanent Monitoring and Remote Alignment of Low Beta Quadrupoles 8.9.9 Alignment of Detector Components

Plasma Density Tapering for Laser Wakefield Acceleration of Electrons and Protons

International Nuclear Information System (INIS)

Ting, A.; Gordon, D.; Kaganovich, D.; Sprangle, P.; Helle, M.; Hafizi, B.

2010-01-01

Extended acceleration in a Laser Wakefield Accelerator can be achieved by tailoring the phase velocity of the accelerating plasma wave, either through profiling of the density of the plasma or direct manipulation of the phase velocity. Laser wakefield acceleration has also reached a maturity that proton acceleration by wakefield could be entertained provided we begin with protons that are substantially relativistic, ∼1 GeV. Several plasma density tapering schemes are discussed. The first scheme is called ''bucket jumping'' where the plasma density is abruptly returned to the original density after a conventional tapering to move the accelerating particles to a neighboring wakefield period (bucket). The second scheme is designed to specifically accelerate low energy protons by generating a nonlinear wakefield in a plasma region with close to critical density. The third scheme creates a periodic variation in the phase velocity by beating two intense laser beams with laser frequency difference equal to the plasma frequency. Discussions and case examples with simulations are presented where substantial acceleration of electrons or protons could be obtained.

Laser wakefield acceleration using wire produced double density ramps

Directory of Open Access Journals (Sweden)

M. Burza

2013-01-01

Full Text Available A novel approach to implement and control electron injection into the accelerating phase of a laser wakefield accelerator is presented. It utilizes a wire, which is introduced into the flow of a supersonic gas jet creating shock waves and three regions of differing plasma electron density. If tailored appropriately, the laser plasma interaction takes place in three stages: Laser self-compression, electron injection, and acceleration in the second plasma wave period. Compared to self-injection by wave breaking of a nonlinear plasma wave in a constant density plasma, this scheme increases beam charge by up to 1 order of magnitude in the quasimonoenergetic regime. Electron acceleration in the second plasma wave period reduces electron beam divergence by ≈25%, and the localized injection at the density downramps results in spectra with less than a few percent relative spread.

Present status on the ion collective acceleration and high-current beam transport in the Lebedev's Physical Institute USSR

International Nuclear Information System (INIS)

Kolomenskij, A.A.

1982-01-01

The results of investigations into the ion collective acceleration and transport of high-current electron beams (HCEB) in vacuum channels with dielectric walls (VCDW) are presented. The physical principle of transport is in the partial neutralization of spatial charge of electrons with ions escaped from the prewall plasma and the compression of the beam with its own magnetic field. A problem of obtaining the intensive beams of negative ions in diode with magnetic isolation is considered. The mechanism of ion acceleration in VCDW is considered. It is shown that there are two regions with different mechanisms of acceleration. In the first region (''plasma'') ion acceleration in the quasipotential HCEB field up to energy of the order of the electron energy takes place. In the second region (''beam'') the acceleration takes place in the wave fields that can be excited due to the mechanism of the two-beam type instability. The mechanism of ion acceleration in direct electron beams is considered. This mechanism is based on the concept of relaxation oscillations of the virtual cathode and corresponding the reconstruction of the spatial charge distribution

Particle Acceleration and Heating Processes at the Dayside Magnetopause

Science.gov (United States)

Berchem, J.; Lapenta, G.; Richard, R. L.; El-Alaoui, M.; Walker, R. J.; Schriver, D.

2017-12-01

It is well established that electrons and ions are accelerated and heated during magnetic reconnection at the dayside magnetopause. However, a detailed description of the actual physical mechanisms driving these processes and where they are operating is still incomplete. Many basic mechanisms are known to accelerate particles, including resonant wave-particle interactions as well as stochastic, Fermi, and betatron acceleration. In addition, acceleration and heating processes can occur over different scales. We have carried out kinetic simulations to investigate the mechanisms by which electrons and ions are accelerated and heated at the dayside magnetopause. The simulation model uses the results of global magnetohydrodynamic (MHD) simulations to set the initial state and the evolving boundary conditions of fully kinetic implicit particle-in-cell (iPic3D) simulations for different solar wind and interplanetary magnetic field conditions. This approach allows us to include large domains both in space and energy. In particular, some of these regional simulations include both the magnetopause and bow shock in the kinetic domain, encompassing range of particle energies from a few eV in the solar wind to keV in the magnetospheric boundary layer. We analyze the results of the iPic3D simulations by discussing wave spectra and particle velocity distribution functions observed in the different regions of the simulation domain, as well as using large-scale kinetic (LSK) computations to follow particles' time histories. We discuss the relevance of our results by comparing them with local observations by the MMS spacecraft.

From laser-plasma accelerators to femtosecond X-ray sources: study, development and applications

International Nuclear Information System (INIS)

Corde, S.

2012-01-01

During the relativistic interaction between a short and intense laser pulse and an underdense plasma, electrons can be injected and accelerated up to hundreds of MeV in an accelerating structure formed in the wake of the pulse: this is the so-called laser-plasma accelerator. One of the major perspectives for laser-plasma accelerators resides in the realization of compact sources of femtosecond x-ray beams. In this thesis, two x-ray sources was studied and developed. The betatron radiation, intrinsic to laser-plasma accelerators, comes from the transverse oscillations of electrons during their acceleration. Its characterization by photon counting revealed an x-ray beam containing 10"9 photons, with energies extending above 10 keV. We also developed an all-optical Compton source producing photons with energies up to hundreds of keV, based on the collision between a photon beam and an electron beam. The potential of these x-ray sources was highlighted by the realization of single shot phase contrast imaging of a biological sample. Then, we showed that the betatron x-ray radiation can be a powerful tool to study the physics of laser-plasma acceleration. We demonstrated the possibility to map the x-ray emission region, which gives a unique insight into the interaction, permitting us for example to locate the region where electrons are injected. The x-ray angular and spectral properties allow us to gain information on the transverse dynamics of electrons during their acceleration. (author)

15-year-activity of Electron Linear Accelerator Laboratory

International Nuclear Information System (INIS)

Karolczak, S.

1999-01-01

The purchase of the Russian Electron Linear Accelerator ELU-6E by Institute of Radiation Technique of Lodz Technical University in 1978 started the activity of the ELA Laboratory. The accelerator itself and many additional scientific equipment designed and built during past 15 years have became the basic investigation tool for the ITR now. The most important measuring systems based on electron beam as irradiation source are: pulse radiolysis system with detection in IR, UV and visible region of the spectra, radiation induced conductometry, Faraday chamber and computerized data acquisition and processing system

Inducible Alkylation of DNA by a Quinone Methide-Peptide Nucleic Acid Conjugate†

Science.gov (United States)

Liu, Yang; Rokita, Steven E.

2012-01-01

The reversibility of alkylation by a quinone methide intermediate (QM) avoids the irreversible consumption that plagues most reagents based on covalent chemistry and allows for site specific reaction that is controlled by the thermodynamics rather than kinetics of target association. This characteristic was originally examined with an oligonucleotide QM conjugate but broad application depends on alternative derivatives that are compatible with a cellular environment. Now, a peptide nucleic acid (PNA) derivative has been constructed and shown to exhibit an equivalent ability to delivery the reactive QM in a controlled manner. This new conjugate demonstrates high selectivity for a complementary sequence of DNA even when challenged with an alternative sequence containing a single T/T mismatch. Alkylation of non-complementary sequences is only possible when a template strand is present to co-localize the conjugate and its target. For efficient alkylation in this example, a single-stranded region of the target is required adjacent to the QM conjugate. Most importantly, the intrastrand self adducts formed between the PNA and its attached QM remained active and reversible over more than eight days in aqueous solution prior to reaction with a chosen target added subsequently. PMID:22243337

How Many Conformations of Enzymes Should Be Sampled for DFT/MM Calculations? A Case Study of Fluoroacetate Dehalogenase

Directory of Open Access Journals (Sweden)

Yanwei Li

2016-08-01

Full Text Available The quantum mechanics/molecular mechanics (QM/MM method (e.g., density functional theory (DFT/MM is important in elucidating enzymatic mechanisms. It is indispensable to study “multiple” conformations of enzymes to get unbiased energetic and structural results. One challenging problem, however, is to determine the minimum number of conformations for DFT/MM calculations. Here, we propose two convergence criteria, namely the Boltzmann-weighted average barrier and the disproportionate effect, to tentatively address this issue. The criteria were tested by defluorination reaction catalyzed by fluoroacetate dehalogenase. The results suggest that at least 20 conformations of enzymatic residues are required for convergence using DFT/MM calculations. We also tested the correlation of energy barriers between small QM regions and big QM regions. A roughly positive correlation was found. This kind of correlation has not been reported in the literature. The correlation inspires us to propose a protocol for more efficient sampling. This saves 50% of the computational cost in our current case.

2014 CERN Accelerator Schools: Plasma Wake Acceleration

CERN Multimedia

2014-01-01

A specialised school on Plasma Wake Acceleration will be held at CERN, Switzerland from 23-29 November, 2014.   This course will be of interest to staff and students in accelerator laboratories, university departments and companies working in or having an interest in the field of new acceleration techniques. Following introductory lectures on plasma and laser physics, the course will cover the different components of a plasma wake accelerator and plasma beam systems. An overview of the experimental studies, diagnostic tools and state of the art wake acceleration facilities, both present and planned, will complement the theoretical part. Topical seminars and a visit of CERN will complete the programme. Further information can be found at: http://cas.web.cern.ch/cas/PlasmaWake2014/CERN-advert.html http://indico.cern.ch/event/285444/

Acceleration and Precipitation of Electrons during Substorm Dipolarization Events

Science.gov (United States)

Ashour-Abdalla, Maha; Richard, Robert; Donovan, Eric; Zhou, Meng; Goldstein, Mevlyn; El-Alaoui, Mostafa; Schriver, David; Walker, Raymond

Observations and modeling have established that during geomagnetically disturbed times the Earth’s magnetotail goes through large scale changes that result in enhanced electron precipitation into the ionosphere and earthward propagating dipolarization fronts that contain highly energized plasma. Such events originate near reconnection regions in the magnetotail at about 20-30 R_E down tail. As the dipolarization fronts propagate earthward, strong acceleration of both ions and electrons occurs due to a combination of non-adiabatic and adiabatic (betatron and Fermi) acceleration, with particle energies reaching up to 100 keV within the dipolarization front. One consequence of the plasma transport that occurs during these events is direct electron precipitation into the ionosphere, which form auroral precipitation. Using global kinetic simulations along with spacecraft and ground-based data, causes of electron precipitation are determined during well-documented, disturbed events. It is found that precipitation of keV electrons in the pre-midnight sector at latitudes around 70(°) occur due to two distinct physical processes: (1) higher latitude (≥72(°) ) precipitation due to electrons that undergo relatively rapid non-adiabatic pitch angle scattering into the loss cone just earthward of the reconnection region at around 20 R_E downtail, and (2) lower latitude (≤72(°) ) precipitation due to electrons that are more gradually accelerated primarily parallel to the geomagnetic field during its bounce motion by Fermi acceleration and enter the loss cone much closer to the Earth at 10-15 R_E, somewhat tailward of the dipolarization front. As the dipolarization fronts propagate earthward, the electron precipitation shifts to lower latitudes and occurs over a wider region in the auroral ionosphere. Our results show a direct connection between electron acceleration in the magnetotail and electron precipitation in the ionosphere during disturbed times. The electron

Virtual Accelerator for Accelerator Optics Improvement

CERN Document Server

Yan Yi Ton; Decker, Franz Josef; Ecklund, Stanley; Irwin, John; Seeman, John; Sullivan, Michael K; Turner, J L; Wienands, Ulrich

2005-01-01

Through determination of all quadrupole strengths and sextupole feed-downs by fitting quantities derivable from precision orbit measurement, one can establish a virtual accelerator that matches the real accelerator optics. These quantities (the phase advances, the Green's functions, and the coupling eigen-plane ellipses tilt angles and axis ratios) are obtained by analyzing turn-by-turn Beam Position Monitor (BPM) data with a model-independent analysis (MIA). Instead of trying to identify magnet errors, a limited number of quadrupoles are chosen for optimized strength adjustment to improve the virtual accelerator optics and then applied to the real accelerator accordingly. These processes have been successfully applied to PEP-II rings for beta beating fixes, phase and working tune adjustments, and linear coupling reduction to improve PEP-II luminosity.

Heavy Ion Acceleration at J-PARC

Science.gov (United States)

SATO, Susumu

2018-02-01

J-PARC, the Japan Proton Accelerator Research Complex, is an accelerator, which provides a high-intensity proton beam. Recently as a very attractive project, the acceleration of heavy ions produced by supplementary ion sources, called J-PARC-HI, is seriously contemplated by domestic as well as international communities. The planned facility would accelerate heavy ions up to U92+ with a beam energy 20 AGeV ( of 6.2 AGeV). The highlight of the J-PARC-HI project is its very high beam rate up to 1011 Hz, which will enable the study of very rare events. Taking advantage of this high intensity, J-PARC-HI will carry out frontier studies of new and rare observables in this energy region: (i) nuclear medium modification of chiral property of vector mesons through low-mass di-lepton signal, (ii) QCD critical pointcharacterization through event-by-event fluctuation signals of particle production, (iii) systematic measurements related to the equation of state through collective flow signal or two-particle momentum correlation signal, or (iv) the search of hyper nuclei with multi strangeness including or exceeding S = 3. The current plan of J-PARC-HI aims to carrying out the first experimental measurements in 2025.

Unconditionally stable diffusion-acceleration of the transport equation

International Nuclear Information System (INIS)

Larsen, E.W.

1982-01-01

The standard iterative procedure for solving fixed-source discrete-ordinates problems converges very slowly for problems in optically large regions with scattering ratios c near unity. The diffusion-synthetic acceleration method has been proposed to make use of the fact that for this class of problems the diffusion equation is often an accurate approximation to the transport equation. However, stability difficulties have historically hampered the implementation of this method for general transport differencing schemes. In this article we discuss a recently developed procedure for obtaining unconditionally stable diffusion-synthetic acceleration methods for various transport differencing schemes. We motivate the analysis by first discussing the exact transport equation; then we illustrate the procedure by deriving a new stable acceleration method for the linear discontinuous transport differencing scheme. We also provide some numerical results

Unconditionally stable diffusion-acceleration of the transport equation

International Nuclear Information System (INIS)

Larson, E.W.

1982-01-01

The standard iterative procedure for solving fixed-source discrete-ordinates problems converges very slowly for problems in optically thick regions with scattering ratios c near unity. The diffusion-synthetic acceleration method has been proposed to make use of the fact that for this class of problems, the diffusion equation is often an accurate approximation to the transport equation. However, stability difficulties have historically hampered the implementation of this method for general transport differencing schemes. In this article we discuss a recently developed procedure for obtaining unconditionally stable diffusion-synthetic acceleration methods for various transport differencing schemes. We motivate the analysis by first discussing the exact transport equation; then we illustrate the procedure by deriving a new stable acceleration method for the linear discontinuous transport differencing scheme. We also provide some numerical results

Effects of Spatial Gradients on Electron Runaway Acceleration

Science.gov (United States)

MacNeice, Peter; Ljepojevic, N. N.

1996-01-01

The runaway process is known to accelerate electrons in many laboratory plasmas and has been suggested as an acceleration mechanism in some astrophysical plasmas, including solar flares. Current calculations of the electron velocity distributions resulting from the runaway process are greatly restricted because they impose spatial homogeneity on the distribution. We have computed runaway distributions which include consistent development of spatial gradients in the energetic tail. Our solution for the electron velocity distribution is presented as a function of distance along a finite length acceleration region, and is compared with the equivalent distribution for the infinitely long homogenous system (i.e., no spatial gradients), as considered in the existing literature. All these results are for the weak field regime. We also discuss the severe restrictiveness of this weak field assumption.

MODELING THE GAMMA-RAY EMISSION IN THE GALACTIC CENTER WITH A FADING COSMIC-RAY ACCELERATOR

Energy Technology Data Exchange (ETDEWEB)

Liu, Ruo-Yu; Wang, Xiang-Yu; Prosekin, Anton [Max-Planck-Institut für Kernphysik, D-69117 Heidelberg (Germany); Chang, Xiao-Chuan, E-mail: ruoyu@mpi-hd.mpg.de, E-mail: xywang@nju.edu.cn [School of Astronomy and Space Science, Nanjing University, Nanjing 210093 (China)

2016-12-20

Recent HESS observations of the ∼200 pc scale diffuse gamma-ray emission from the central molecular zone (CMZ) suggest the presence of a PeV cosmic-ray accelerator (PeVatron) located in the inner 10 pc region of the Galactic center. Interestingly, the gamma-ray spectrum of the point-like source (HESS J1745-290) in the Galactic center shows a cutoff at ∼10 TeV, implying a cutoff around 100 TeV in the cosmic-ray proton spectrum. Here we propose that the gamma-ray emission from the inner and the outer regions may be explained self-consistently by run-away protons from a single yet fading accelerator. In this model, gamma-rays from the CMZ region are produced by protons injected in the past, while gamma-rays from the inner region are produced by protons injected more recently. We suggest that the blast wave formed in a tidal disruption event (TDE) caused by the supermassive black hole (Sgr A*) could serve as such a fading accelerator. With typical parameters of the TDE blast wave, gamma-ray spectra of both the CMZ region and HESS J1745-290 can be reproduced simultaneously. Meanwhile, we find that the cosmic-ray energy density profile in the CMZ region may also be reproduced in the fading accelerator model when appropriate combinations of the particle injection history and the diffusion coefficient of cosmic rays are adopted.

Analyzing radial acceleration with a smartphone acceleration sensor

Science.gov (United States)

Vogt, Patrik; Kuhn, Jochen

2013-03-01

This paper continues the sequence of experiments using the acceleration sensor of smartphones (for description of the function and the use of the acceleration sensor, see Ref. 1) within this column, in this case for analyzing the radial acceleration.

Fast Fermi acceleration in the plasma sheet boundary layer

International Nuclear Information System (INIS)

Wu, C.S.; Lui, A.T.Y.

1989-01-01

A longstanding question in the field of magnetospheric physics is the source of the energetic particles which are commonly observed along the plasma sheet boundary layer (PSBL). Several models have been suggested for the acceleration of these particles. We suggest a means by which the fast Fermi acceleration mechanism [Wu, 1984] can accelerate electrons at the plasma sheet and perhaps account for some of the observations. We propose the following: A localized hydromagnetic disturbance propagating through the tail lobe region impinges upon the PSBL deforming it and displacing it in towards the central plasma sheet. The boundary layer can then act like a moving magnetic mirror. If the disturbance is propagating nearly perpendicular to the layer then its velocity projected parallel to the layer (and the magnetic field) can be very large resulting in significant acceleration of reflected particles. copyright American Geophysical Union 1989

High power laser exciter accelerators

International Nuclear Information System (INIS)

Martin, T.H.

1975-01-01

Recent developments in untriggered oil and water switching now permit the construction of compact, high energy density pulsed power sources for laser excitation. These accelerators, developed principally for electron beam fusion studies, appear adaptable to laser excitation and will provide electron beams of 10 13 to 10 14 W in the next several years. The accelerators proposed for e-beam fusion essentially concentrate the available power from the outside edge of a disk into the central region where the electron beam is formed. One of the main problem areas, that of power flow at the vacuum diode insulator, is greatly alleviated by the multiplicity of electron beams that are allowable for laser excitation. A proposal is made whereby the disk-shaped pulsed power sections are stacked vertically to form a series of radially flowing electron beams to excite the laser gas volume. (auth)

Particle acceleration in the interplanetary medium

International Nuclear Information System (INIS)

Engelmann, J.J.

1987-07-01

Variations in solar wind properties are dominated by a number of high speed streams. By interacting with the quiet wind, the fast streams give rise in the first case to a travelling shock wave, in the second case to a pair of forward and backward shock waves, by which the interaction region, corotating with the sun, is bounded. Two acceleration mechanisms are invoked to account for the energetic ion flux increases: 1) The first order Fermi process, whereby particles increase their energy by compression between converging magnetic scattering centers, located upstream and downstream of the shock. 2) The shock drift mechanism. The composition and the spectrum of the accelerated ions suggest that they probably originate from the suprathermal tail of the solar wind distribution [fr

Bridging the gap between high and low acceleration for planetary escape

Science.gov (United States)

Indrikis, Janis; Preble, Jeffrey C.

With the exception of the often time consuming analysis by numerical optimization, no single orbit transfer analysis technique exists that can be applied over a wide range of accelerations. Using the simple planetary escape (parabolic trajectory) mission some of the more common techniques are considered as the limiting bastions at the high and the extremely low acceleration regimes. The brachistochrone, the minimum time of flight path, is proposed as the technique to bridge the gap between the high and low acceleration regions, providing a smooth bridge over the entire acceleration spectrum. A smooth and continuous velocity requirement is established for the planetary escape mission. By using these results, it becomes possible to determine the effect of finite accelerations on mission performance and target propulsion and power system designs which are consistent with a desired mission objective.

Community Petascale Project for Accelerator Science and Simulation: Advancing Computational Science for Future Accelerators and Accelerator Technologies

Energy Technology Data Exchange (ETDEWEB)

Spentzouris, P.; /Fermilab; Cary, J.; /Tech-X, Boulder; McInnes, L.C.; /Argonne; Mori, W.; /UCLA; Ng, C.; /SLAC; Ng, E.; Ryne, R.; /LBL, Berkeley

2011-11-14

The design and performance optimization of particle accelerators are essential for the success of the DOE scientific program in the next decade. Particle accelerators are very complex systems whose accurate description involves a large number of degrees of freedom and requires the inclusion of many physics processes. Building on the success of the SciDAC-1 Accelerator Science and Technology project, the SciDAC-2 Community Petascale Project for Accelerator Science and Simulation (ComPASS) is developing a comprehensive set of interoperable components for beam dynamics, electromagnetics, electron cooling, and laser/plasma acceleration modelling. ComPASS is providing accelerator scientists the tools required to enable the necessary accelerator simulation paradigm shift from high-fidelity single physics process modeling (covered under SciDAC1) to high-fidelity multiphysics modeling. Our computational frameworks have been used to model the behavior of a large number of accelerators and accelerator R&D experiments, assisting both their design and performance optimization. As parallel computational applications, the ComPASS codes have been shown to make effective use of thousands of processors. ComPASS is in the first year of executing its plan to develop the next-generation HPC accelerator modeling tools. ComPASS aims to develop an integrated simulation environment that will utilize existing and new accelerator physics modules with petascale capabilities, by employing modern computing and solver technologies. The ComPASS vision is to deliver to accelerator scientists a virtual accelerator and virtual prototyping modeling environment, with the necessary multiphysics, multiscale capabilities. The plan for this development includes delivering accelerator modeling applications appropriate for each stage of the ComPASS software evolution. Such applications are already being used to address challenging problems in accelerator design and optimization. The ComPASS organization

Accelerator Service

International Nuclear Information System (INIS)

Champelovier, Y.; Ferrari, M.; Gardon, A.; Hadinger, G.; Martin, J.; Plantier, A.

1998-01-01

Since the cessation of the operation of hydrogen cluster accelerator in July 1996, four electrostatic accelerators were in operation and used by the peri-nuclear teams working in multidisciplinary collaborations. These are the 4 MV Van de Graaff accelerator, 2,5 MV Van de Graaff accelerator, 400 kV ion implanter as well as the 120 kV isotope separator

Searching for oscillations of atmospheric and accelerator neutrinos with GeNIUS

International Nuclear Information System (INIS)

Michael, Douglas G.

1994-01-01

A very large (17KT) fine-grained sampling calorimeter is discussed for use in studying contained events induced by atmospheric or accelerator neutrinos for the purpose of searching for neutrino oscillations. The ratio of neutral current to charged current events can be used to rule out a large region of the currently allowed parameter space with accelerator and atmospheric neutrinos providing complimentary measurements. ((orig.))

Surfing and drift acceleration at high mach number quasi-perpendicular shocks

International Nuclear Information System (INIS)

Amano, T.

2008-01-01

Electron acceleration in high Mach number collisionless shocks relevant to supernova remnant is discussed. By performing one- and two-dimensional particle-in-cell simulations of quasi-perpendicular shocks, we find that energetic electrons are quickly generated in the shock transition region through shock surfing and drift acceleration. The electron energization is strong enough to account for the observed injection at supernova remnant shocks. (author)

ELECTRON ACCELERATION BY MULTI-ISLAND COALESCENCE

International Nuclear Information System (INIS)

Oka, M.; Phan, T.-D.; Krucker, S.; Fujimoto, M.; Shinohara, I.

2010-01-01

Energetic electrons of up to tens of MeV are created during explosive phenomena in the solar corona. While many theoretical models consider magnetic reconnection as a possible way of generating energetic electrons, the precise roles of magnetic reconnection during acceleration and heating of electrons still remain unclear. Here, we show from two-dimensional particle-in-cell simulations that coalescence of magnetic islands that naturally form as a consequence of tearing mode instability and associated magnetic reconnection leads to efficient energization of electrons. The key process is the secondary magnetic reconnection at the merging points, or the 'anti-reconnection', which is, in a sense, driven by the converging outflows from the initial magnetic reconnection regions. By following the trajectories of the most energetic electrons, we found a variety of different acceleration mechanisms but the energization at the anti-reconnection is found to be the most important process. We discuss possible applications to the energetic electrons observed in the solar flares. We anticipate our results to be a starting point for more sophisticated models of particle acceleration during the explosive energy release phenomena.

Community petascale project for accelerator science and simulation: Advancing computational science for future accelerators and accelerator technologies

International Nuclear Information System (INIS)

Spentzouris, P.; Cary, J.; McInnes, L.C.; Mori, W.; Ng, C.; Ng, E.; Ryne, R.

2008-01-01

The design and performance optimization of particle accelerators are essential for the success of the DOE scientific program in the next decade. Particle accelerators are very complex systems whose accurate description involves a large number of degrees of freedom and requires the inclusion of many physics processes. Building on the success of the SciDAC-1 Accelerator Science and Technology project, the SciDAC-2 Community Petascale Project for Accelerator Science and Simulation (ComPASS) is developing a comprehensive set of interoperable components for beam dynamics, electromagnetics, electron cooling, and laser/plasma acceleration modelling. ComPASS is providing accelerator scientists the tools required to enable the necessary accelerator simulation paradigm shift from high-fidelity single physics process modeling (covered under SciDAC1) to high-fidelity multiphysics modeling. Our computational frameworks have been used to model the behavior of a large number of accelerators and accelerator R and D experiments, assisting both their design and performance optimization. As parallel computational applications, the ComPASS codes have been shown to make effective use of thousands of processors.

Advanced concepts for acceleration

International Nuclear Information System (INIS)

Keefe, D.

1986-07-01

Selected examples of advanced accelerator concepts are reviewed. Such plasma accelerators as plasma beat wave accelerator, plasma wake field accelerator, and plasma grating accelerator are discussed particularly as examples of concepts for accelerating relativistic electrons or positrons. Also covered are the pulsed electron-beam, pulsed laser accelerator, inverse Cherenkov accelerator, inverse free-electron laser, switched radial-line accelerators, and two-beam accelerator. Advanced concepts for ion acceleration discussed include the electron ring accelerator, excitation of waves on intense electron beams, and two-wave combinations

Theoretical investigation on the inclusion of TCDD with β-cyclodextrin by performing QM calculations and MD simulations

International Nuclear Information System (INIS)

Pan, Wenxiao; Zhang, Dongju; Zhan, Jinhua

2011-01-01

Highlights: → We study the inclusion mechanism of TCDD with β-CD by theoretical methods. → Clearly, the formation of inclusion complex is an energetically driven process. → The inclusion complex can be detected by IR and Raman techniques. → The results imply that β-CD may be used as a host molecule to enrich TCDD molecules. - Abstract: The rapid enrichment and detection of trace polychlorinated dibenzo-p-dioxins (PCDDs) and polychlorinated dibenzofurans (PCDFs) are currently challenging issues in the field of environmental science. In this paper, by performing quantum chemistry (QM) calculations and molecular dynamics (MD) simulations, we studied the inclusion complexation of 2,3,7,8-tetrachlorodibenzo-p-dioxin (TCDD), a representative PCDD molecule, with β-cyclodextrin (β-CD), one of the widely used compounds in supramolecular chemistry. The calculated results reveal that the stable inclusion complex can be formed in both the gas phase and solvent, which proposes that β-CD may serve as a potential substrate enriching TCDD. The calculated vibrational spectra indicate that the infrared (IR) and Raman spectroscopy may be suitable for the detection of β-CD-modified TCDD. The present theoretical results may be informative to environmental scientists who are devoting themselves to developing effective methods for detection and treatment of POPs.

Steady state ion acceleration by a circularly polarized laser pulse

International Nuclear Information System (INIS)

Zhang Xiaomei; Shen Baifei; Cang Yu; Li Xuemei; Jin Zhangying; Wang Fengchao

2007-01-01

The steady state ion acceleration at the front of a cold solid target by a circularly polarized flat-top laser pulse is studied with one-dimensional particle-in-cell (PIC) simulation. A model that ions are reflected by a steady laser-driven piston is used by comparing with the electrostatic shock acceleration. A stable profile with a double-flat-top structure in phase space forms after ions enter the undisturbed region of the target with a constant velocity

The generation of high fields for particle acceleration to very high energies

International Nuclear Information System (INIS)

1985-01-01

A Workshop organised by the CERN Accelerator School, the European Committee for Future Accelerators and the Istituto Nazionale di Fisica Nucleare was held at the Frascati laboratory of INFN during the last week of September 1984. Its purpose was to bring together an inter-disciplinary group of physicists to review ideas for the acceleration of particles to energies beyond those attainable in machines whose construction is underway, or is currently contemplated. These proceedings contain some of the material presented and discussed at the Workshop, comprising papers on topics such as: the free-electron-laser, the lasertron, wakefield accelerators, the laser excitation of droplet arrays, a switched-power linac, plasma beat-wave accelerators and the choice of basic parameters for linear colliders intended for the TeV energy region. (orig.)

Accelerating tube for the ''EG-1'' electrostatic accelerator

International Nuclear Information System (INIS)

Romanov, V.A.; Ivanov, V.V.; Krupnov, E.P.; Debin, V.K.; Dudkin, N.I.; Volodin, V.I.

1980-01-01

A design of an accelerating tube (AT) for an electrostatic accelerator of the EG-1 type is described. Primary consideration in the development of the AT has been given to increasing the electric strength of accelerating gaps, the vacuum conductivity and better insulator screening from charged particles. After AT vacuum and high-voltage ageing in the accelerator, a hydrogen ions beam of up to 80 μA has been produced. The beam was adequately shaped in the energy range from 1.8 to 5.0 MeV [ru

The physicochemical essence of the purine·pyrimidine transition mismatches with Watson-Crick geometry in DNA: A·C* versa A*·C. A QM and QTAIM atomistic understanding.

Science.gov (United States)

Brovarets', Ol'ha O; Hovorun, Dmytro M

2015-01-01

It was established for the first time by DFT and MP2 quantum-mechanical (QM) methods either in vacuum, so in the continuum with a low dielectric constant (ε = 4), typical for hydrophobic interfaces of specific protein-nucleic acid interactions, that the repertoire for the tautomerisation of the biologically important adenine · cytosine* (A · C*) mismatched DNA base pair, formed by the amino tautomer of the A and the imino mutagenic tautomer of the C, into the A*·C base mispair (∆G = 2.72 kcal mol(-1) obtained at the MP2 level of QM theory in the continuum with ε = 4), formed by the imino mutagenic tautomer of the A and the amino tautomer of the C, proceeds via the asynchronous concerted double proton transfer along two antiparallel H-bonds through the transition state (TSA · C* ↔ A* · C). The limiting stage of the A · C* → A* · C tautomerisation is the final proton transfer along the intermolecular N6H · · · N4 H-bond. It was found that the A · C*/A* · C DNA base mispairs with Watson-Crick geometry are associated by the N6H · · · N4/N4H · · · N6, N3H · · · N1/N1H · · · N3 and C2H · · · O2 H-bonds, respectively, while the TSA · C*↔ A* · C is joined by the N6-H-N4 covalent bridge and the N1H · · · N3 and C2H · · · O2 H-bonds. It was revealed that the A · C* ↔ A* · C tautomerisation is assisted by the true C2H · · · O2 H-bond, that in contrast to the two others conventional H-bonds exists along the entire intrinsic reaction coordinate (IRC) range herewith becoming stronger at the transition from vacuum to the continuum with ε = 4. To better understand the behavior of the intermolecular H-bonds and base mispairs along the IRC of the A · C* ↔ A* · C tautomerisation, the profiles of their electron-topological, energetical, geometrical, polar and charge characteristics are reported in this study. It was established based on the profiles of the H-bond energies that all three H-bonds are cooperative, mutually

Nuclear data requirements for accelerator driven sub-critical systems

Indian Academy of Sciences (India)

The development of accelerator driven sub-critical systems (ADSS) require significant amount of new nuclear data in extended energy regions as well as for a variety of new materials. This paper reviews these perspectives in the Indian context.

CAS CERN Accelerator School superconductivity in particle accelerators

International Nuclear Information System (INIS)

Turner, S.

1989-01-01

One of the objectives of the CERN Accelerator School is to run courses on specialised topics in the particle accelerator field. The present volume contains the proceedings of one such course, this time organized in conjunction with the Deutsches Elektronen Synchrotron (DESY) on the subject of superconductivity in particle accelerators. This course reflects the very considerable progress made over the last few years in the use of the technology for the magnet and radio-frequency systems of many large and small accelerators already in use or nearing completion, while also taking account of the development work now going on for future machines. The lectures cover the theory of superconductivity, cryogenics and accelerator magnets and cavities, while the seminars include superfluidity, superconductors, special magnets and the prospects for high-temperature superconductors. (orig.)

Cloning, periplasmic expression, purification and structural characterization of human ribosomal protein L10

International Nuclear Information System (INIS)

Pereira, Larissa Miranda

2009-01-01

The ribosomal protein L10 (RP L10) is a strong candidate to be included in the class of tumor suppressor proteins. This protein, also denominated as QM, is known to participate in the binding of ribosomal subunits 60S and 40S and the translation of mRNAs. It has a molecular weight that varies between 24 and 26 kDa and an isoelectric point of (pI) 10.5. The sequence of the protein QM is highly conserved in mammals, plants, invertebrates, insects and yeast which indicates its critical functions in a cell. As a tumor suppressor, RP L10 has been studied in strains of Wilm's tumor (WT-1) and tumor cells in the stomach, where was observed a decrease in the amount of its mRNA. More recently, the RP L10 was found in low amounts in the early stages of prostate adenoma and showed some mutation in ovarian cancer, what indicates its role as a suppressor protein in the development of these diseases. It has also been described that this protein interacts with c-Jun and c-Yes inhibiting growth factors and consequently, cell division. This work has an important role on the establishment of soluble expression of QM to give base information for further studies on expression that aim to evaluate the specific regions where it acts binding the 60S and 40S ribosomal subunits and translation, as well as its binding to proto-oncogenes. The cDNA for QM protein was amplified by PCR and cloned into periplasmic expression vector p3SN8. The QM protein was expressed in E. coli BL21 (DE3) in the region of cytoplasm and periplasm, the best condition was obtained from the expression of the recombinant plasmid QM p1813 Q M at 25 degree C or 30 degree C, the soluble protein was obtained with small amounts of contaminants. The assays of secondary structure showed that the QM protein is predominantly alpha-helix, but when it loses the folding, this condition changes and the protein is replaced by β- sheet feature. (author)

Study on the limiting acceleration rate in the VLEPP linear accelerator

International Nuclear Information System (INIS)

Balakin, V.E.; Brezhnev, O.N.; Zakhvatkin, M.N.

1987-01-01

To realize the design of colliding linear electron-positron beams it is necessary to solve the radical problem of production of accelerating structure with acceleration rate of approximately 100 MeV/m which can accelerate 10 12 particles in a bunch. Results of experimental studies of the limiting acceleration rate in the VLEPP accelerating structure are presented. Accelerating sections of different length were tested. When testing sections 29 cm long the acceleration rate of 55 MeV/m was attained, and for 1 m section the value reached 40 MeV/m. The maximum rate of acceleration (90 MeV/m) was attained when electric field intensity on the structure surface constituted more than 150 MV/m

A virtual linear accelerator for verification of treatment planning systems

International Nuclear Information System (INIS)

Wieslander, Elinore

2000-01-01

A virtual linear accelerator is implemented into a commercial pencil-beam-based treatment planning system (TPS) with the purpose of investigating the possibility of verifying the system using a Monte Carlo method. The characterization set for the TPS includes depth doses, profiles and output factors, which is generated by Monte Carlo simulations. The advantage of this method over conventional measurements is that variations in accelerator output are eliminated and more complicated geometries can be used to study the performance of a TPS. The difference between Monte Carlo simulated and TPS calculated profiles and depth doses in the characterization geometry is less than ±2% except for the build-up region. This is of the same order as previously reported results based on measurements. In an inhomogeneous, mediastinum-like case, the deviations between TPS and simulations are small in the unit-density regions. In low-density regions, the TPS overestimates the dose, and the overestimation increases with increasing energy from 3.5% for 6 MV to 9.5% for 18 MV. This result points out the widely known fact that the pencil beam concept does not handle changes in lateral electron transport, nor changes in scatter due to lateral inhomogeneities. It is concluded that verification of a pencil-beam-based TPS with a Monte Carlo based virtual accelerator is possible, which facilitates the verification procedure. (author)

Particle-accelerator decommissioning

International Nuclear Information System (INIS)

Opelka, J.H.; Mundis, R.L.; Marmer, G.J.; Peterson, J.M.; Siskind, B.; Kikta, M.J.

1979-12-01

Generic considerations involved in decommissioning particle accelerators are examined. There are presently several hundred accelerators operating in the United States that can produce material containing nonnegligible residual radioactivity. Residual radioactivity after final shutdown is generally short-lived induced activity and is localized in hot spots around the beam line. The decommissioning options addressed are mothballing, entombment, dismantlement with interim storage, and dismantlement with disposal. The recycle of components or entire accelerators following dismantlement is a definite possibility and has occurred in the past. Accelerator components can be recycled either immediately at accelerator shutdown or following a period of storage, depending on the nature of induced activation. Considerations of cost, radioactive waste, and radiological health are presented for four prototypic accelerators. Prototypes considered range from small accelerators having minimal amounts of radioactive mmaterial to a very large accelerator having massive components containing nonnegligible amounts of induced activation. Archival information on past decommissionings is presented, and recommendations concerning regulations and accelerator design that will aid in the decommissioning of an accelerator are given

Studies of the mirrortron ion accelerator concept and its application to heavy-ion drivers

International Nuclear Information System (INIS)

Post, R.F.; Schwager, L.A.; Dougless, S.R.; Jones, B.R.; Lambert, M.A.; Larson, D.L.

1991-01-01

The Mirrortron accelerator is a plasma-based ion accelerator concept that, when implemented, should permit both higher acceleration gradients and higher peak-current capabilities than is possible with conventional induction-type accelerators. Control over the acceleration and focussing of an accelerated beam should approach that achieved in vacuum-field-based ion accelerators. In the Mirrortron a low density (10 10 to 10 11 cm -3 ) ''hot electron'' plasma is confined by a long solenoidal magnetic field capped by ''mirrors''. Acceleration of prebunched ions is accomplished by activating a series of fast-pulsed mirror coils spaced along the acceleration tube. The hot electrons, being repelled by mirror action, leave the plasma ions behind to create a localized region of high electrical gradient (up to of order 100 MV/m). At the Laboratory an experiment and analyses to elucidate the concept and its scaling laws as applied to heavy-ion drivers are underway and will be described. 4 refs., 5 figs

On acceleration of plasmoids in magnetohydrodynamic simulations of magnetotail reconnection

International Nuclear Information System (INIS)

Scholer, M.; Hautz, R.

1991-01-01

The formation and acceleration of plasmoids is investigated by two-dimensional magnetohydrodynamic simulations. The initial equilibrium contains a plasma sheet with a northward magnetic field (B z ) component and a tailward pressure gradient. Reconnection is initiated by three different methods: Case A, a constant resistivity is applied everywhere and a tearing mode evolves, case B, a spatially localized resistivity is fixed in the near-Earth region, and case C, the resistivity is allowed to depend on the electrical current density. In case A, the authors obtain the same results as have been presented by Otto et al. (1990): the tearing instability releases the tension of the closed field lines so that the inherent pressure gradient of the two-dimensional system is not balanced anymore. The pressure gradient then sets the plasmoid into motion. Any sling-shot effect of open magnetic field lines is of minor importance. A completely different behavior has been found in cases B and C. In these cases the high-speed flow in the wedge-shaped region tailward of the near-Earth neutral line pushes against the detached plasmoid and drives it tailward. The ideal terms contributing to the acceleration are still only the pressure and the magnetic field term. However, in these cases the pressure is due to the dynamic pressure of the fast outflow from the reconnection region. The outflow in the wedge-shaped region on both sides of the neutral line is due to acceleration of plasma by tangential magnetic stresses at the slow mode shocks extending form the X line

Final report on key comparison COOMET.QM-K36 (Project COOMET 540/UA/11) 'Electrolytic Conductivity 0,5 S/m'

Science.gov (United States)

Gavrilkin, V.; Prokopenko, L.; Bakovec, N.; Zolotorevich, E.; Suvorov, V.; Ovchinnikov, Yu; Pilishvili, T.; Buleishvili, M.; Zhasanbaeva, B.; Aytzhatova, G.; Ticona, G.; Vyskocil, L.

2015-01-01

The COOMET.QM-K36 key comparison 'Electrolytic conductivity: 0.5 S/m' is a comparison in the field of electrolytic conductivity measurements conducted by COOMET and carried out in 2012. It used a solution of KCl in water and the results are connected to those of the CCQM key comparison CCQM-K36.a through common participation of VNIIFTRI (Russia), SMU (Slovakia) and Ukrmetrteststandart (Ukraine). The purpose of this key comparison was to establish the equivalence of measurements of electrolytic conductivity performed at the National Metrology Institutes of COOMET member states for the value of 0.5 S/m. The results can be used to support the CMCs claims over the range of 0.1 S/m to 1.3 S/m. Main text. To reach the main text of this paper, click on Final Report. Note that this text is that which appears in Appendix B of the BIPM key comparison database kcdb.bipm.org/. The final report has been peer-reviewed and approved for publication by CCQM, according to the provisions of the CIPM Mutual Recognition Arrangement (CIPM MRA).

Detection of the Acceleration Site in a Solar Flare

Science.gov (United States)

Fleishman, Gregory D.; Kontar, E. P.; Nita, G. M.; Gary, D. E.

2011-05-01

We report the observation of an unusual cold, tenuous solar flare (ApJL, v. 731, p. L19, 2011), which reveals itself via numerous and prominent non-thermal manifestations, while lacking any noticeable thermal emission signature. RHESSI hard X-rays and 0.1-18 GHz radio data from OVSA and Phoenix-2 show copious electron acceleration (1035 electrons per second above 10 keV) typical for GOES M-class flares with electrons energies up to 100 keV, but GOES temperatures not exceeding 6.1 MK. The HXR footpoints and coronal radio sources belong, supposedly, to a single magnetic loop, which departs strongly from the corresponding potential loop (obtained from a photospheric extrapolation) in agreement with the apparent need of a non-potential magnetic field structure to produce a flare. The imaging, temporal, and spectral characteristics of the flare have led us to a firm conclusion that the bulk of the microwave continuum emission from this flare was produced directly in the acceleration region. We found that the electron acceleration efficiency is very high in the flare, so almost all available thermal electrons are eventually accelerated. However, given a relatively small flaring volume and rather low thermal density at the flaring loop, the total energy release turned out to be insufficient for a significant heating of the coronal plasma or for a prominent chromospheric response giving rise to chromospheric evaporation. Some sort of stochastic acceleration process is needed to account for an approximately energy-independent lifetime of about 3 s for the electrons in the acceleration region. This work was supported in part by NSF grants AGS-0961867, AST-0908344, and NASA grants NNX10AF27G and NNX11AB49G to New Jersey Institute of Technology. This work was supported by a UK STFC rolling grant, STFC/PPARC Advanced Fellowship, and the Leverhulme Trust, UK. Financial support by the European Commission through the SOLAIRE and HESPE Networks is gratefully acknowledged.

A functional SNP in the regulatory region of the decay-accelerating factor gene associates with extraocular muscle pareses in myasthenia gravis

KAUST Repository

Heckmann, J M

2009-08-13

Complement activation in myasthenia gravis (MG) may damage muscle endplate and complement regulatory proteins such as decay-accelerating factor (DAF) or CD55 may be protective. We hypothesize that the increased prevalence of severe extraocular muscle (EOM) dysfunction among African MG subjects reported earlier may result from altered DAF expression. To test this hypothesis, we screened the DAF gene sequences relevant to the classical complement pathway and found an association between myasthenics with EOM paresis and the DAF regulatory region c.-198CG SNP (odds ratio8.6; P0.0003). This single nucleotide polymorphism (SNP) results in a twofold activation of a DAF 5?-flanking region luciferase reporter transfected into three different cell lines. Direct matching of the surrounding SNP sequence within the DAF regulatory region with the known transcription factor-binding sites suggests a loss of an Sp1-binding site. This was supported by the observation that the c.-198CG SNP did not show the normal lipopolysaccharide-induced DAF transcriptional upregulation in lymphoblasts from four patients. Our findings suggest that at critical periods during autoimmune MG, this SNP may result in inadequate DAF upregulation with consequent complement-mediated EOM damage. Susceptible individuals may benefit from anti-complement therapy in addition to immunosuppression. © 2010 Macmillan Publishers Limited. All rights reserved.

Source-to-accelerator quadrupole matching section for a compact linear accelerator

Science.gov (United States)

Seidl, P. A.; Persaud, A.; Ghiorso, W.; Ji, Q.; Waldron, W. L.; Lal, A.; Vinayakumar, K. B.; Schenkel, T.

2018-05-01

Recently, we presented a new approach for a compact radio-frequency (RF) accelerator structure and demonstrated the functionality of the individual components: acceleration units and focusing elements. In this paper, we combine these units to form a working accelerator structure: a matching section between the ion source extraction grids and the RF-acceleration unit and electrostatic focusing quadrupoles between successive acceleration units. The matching section consists of six electrostatic quadrupoles (ESQs) fabricated using 3D-printing techniques. The matching section enables us to capture more beam current and to match the beam envelope to conditions for stable transport in an acceleration lattice. We present data from an integrated accelerator consisting of the source, matching section, and an ESQ doublet sandwiched between two RF-acceleration units.

Electrostatic accelerators

CERN Document Server

Hinterberger, F

2006-01-01

The principle of electrostatic accelerators is presented. We consider Cockcroft– Walton, Van de Graaff and Tandem Van de Graaff accelerators. We resume high voltage generators such as cascade generators, Van de Graaff band generators, Pelletron generators, Laddertron generators and Dynamitron generators. The speci c features of accelerating tubes, ion optics and methods of voltage stabilization are described. We discuss the characteristic beam properties and the variety of possible beams. We sketch possible applications and the progress in the development of electrostatic accelerators.

Particle acceleration and production of energetic photons in SN1987A

Energy Technology Data Exchange (ETDEWEB)

Gaisser, T.K.; Stanev, Todor; Harding, Alice

1987-09-24

Young supernova remnants are likely to be bright sources of energetic photons and neutrinos through the collision of particles accelerated inside the remnant. Interactions of accelerated particles in the expanding envelope or in ambient radiation fields will also produce secondary photons and neutrinos at some level. If > 10/sup 39/ erg s/sup -1/ in protons above 10 TeV is injected into the target region, TeV photons from SN1987A could be observable with present detectors. Synchrotron X rays and ..gamma..-rays up to 10 MeV, generated by accelerated electrons, may well also be detectable. The authors discuss a pulsar wind model for acceleration of particles, and find that it would produce observable signals if the spin period of the pulsar is <10 ms.

Acceleration of 14C beams in electrostatic accelerators

International Nuclear Information System (INIS)

Rowton, L.J.; Tesmer, J.R.

1981-01-01

Operational problems in the production and acceleration of 14 C beams for nuclear structure research in Los Alamos National Laboratory's Van de Graaff accelerators are discussed. Methods for the control of contamination in ion sources, accelerators and personnel are described. Sputter source target fabrication techniques and the relative beam production efficiencies of various types of bound particulate carbon sputter source targets are presented

The Study of Non-Linear Acceleration of Particles during Substorms Using Multi-Scale Simulations

International Nuclear Information System (INIS)

Ashour-Abdalla, Maha

2011-01-01

To understand particle acceleration during magnetospheric substorms we must consider the problem on multple scales ranging from the large scale changes in the entire magnetosphere to the microphysics of wave particle interactions. In this paper we present two examples that demonstrate the complexity of substorm particle acceleration and its multi-scale nature. The first substorm provided us with an excellent example of ion acceleration. On March 1, 2008 four THEMIS spacecraft were in a line extending from 8 R E to 23 R E in the magnetotail during a very large substorm during which ions were accelerated to >500 keV. We used a combination of a global magnetohydrodynamic and large scale kinetic simulations to model the ion acceleration and found that the ions gained energy by non-adiabatic trajectories across the substorm electric field in a narrow region extending across the magnetotail between x = -10 R E and x = -15 R E . In this strip called the 'wall region' the ions move rapidly in azimuth and gain 100s of keV. In the second example we studied the acceleration of electrons associated with a pair of dipolarization fronts during a substorm on February 15, 2008. During this substorm three THEMIS spacecraft were grouped in the near-Earth magnetotail (x ∼-10 R E ) and observed electron acceleration of >100 keV accompanied by intense plasma waves. We used the MHD simulations and analytic theory to show that adiabatic motion (betatron and Fermi acceleration) was insufficient to account for the electron acceleration and that kinetic processes associated with the plasma waves were important.

Multiperiodic accelerator structures for linear particle accelerators

International Nuclear Information System (INIS)

Tran, D.T.

1975-01-01

High efficiency linear accelerator structures, comprised of a succession of cylindrical resonant cavities for acceleration, are described. Coupling annular cavities are located at the periphery, each being coupled to two adjacent cylindrical cavities. (auth)

Report of the joint seminar on solid state physics, atomic and molecular physics, and materials science in the energy region of tandem accelerators

International Nuclear Information System (INIS)

Kazumata, Yukio

1993-01-01

The joint seminar on Solid State Physics, Atomic and Molecular Physics and Materials Science in the Energy Region of Tandem Acceleration was held at Tokai Research Establishment of JAERI, for two days from January 22 to 23, 1991. About 60 physicists and material scientists participated and 18 papers were presented in this seminar. The topics presented in this seminar included lattice defects in semiconductors, ion-solid collisions, atomic collisions by high energy particles, radiation effects on high T c superconducting materials and FCC metals, radiation effects on materials of space and fusion reactors, uranium compounds and superlattice. (J.P.N.)

AVALIAÇÃO GENÉTICA DE PROGÊNIES DE MEIO-IRMÃOS DE Eucalyptus urophylla UTILIZANDO OS PROCEDIMENTOS REML/BLUP E E(QM

Directory of Open Access Journals (Sweden)

Maria das Graças de Barros Rocha

2006-10-01

Full Text Available Realizou-se avaliação genética em cinco testes de progênies de meio-irmãos de Eucalyptus urophylla S. T. Blake procedentes da Indonésia, com o uso dos procedimentos REML/BLUP (máxima verossimilhaça restrita/melhor predição linear não-viesada e pelo método dos quadrados mínimos E (QM. Os ensaios foram estabelecidos separadamente por procedência, sendo o delineamento experimental em blocos casualizados, com cinco repetições e parcelas lineares de seis plantas, no espaçamento 3,0 x 2,0 metros, em Guanhães, MG. Nos cinco testes avaliados aos 58 meses de idade, para a característica diâmetro à altura do peito (DAP, apresentaram valores dentro dos padrões da espécie, além de exibir variabilidade genética significativa, pelo teste F a 1% de probabilidade. Os coeficientes de variação genética aditiva apresentaram valores maiores no teste TP-71 originado de Wetar e no TP-68 originado de Alor, e nos outros testes apresentaram valores similares para a característica diâmetro à altura do peito (DAP. Os ganhos de seleção foram estimados na ordem de 12,8; 22,9; 9,5; 21,0 e 25,3% e tamanho efetivo populacional (Ne na ordem de 60,2; 58,0; 131,8; 167,9 e 224,1 para ao testes TP-67, TP-68, TP-69, TP-70 e TP-71 respectivamente. O ganho de seleção no Pomar de Sementes Clonal (PSC foi de 26,8 % com a seleção dos 21 indivíduos portadores dos maiores valores genéticos aditivos. Nos dois procedimentos, máxima verossimilhança restrita (REML e esperança de quadrados mínimos E(QM, os valores dos parâmetros genéticos foram semelhantes, exceto entre familias, em que o procedimento REML proporcionou valores mais elevados com acurácia superior a 70% em todas as populações, mostrando-se como ferramenta apropriada para esse fim.

Beam transport through electrostatic accelerators and matching into post accelerators

International Nuclear Information System (INIS)

Larson, J.D.

1986-01-01

Ion beam transport through electrostatic acceleration is briefly reviewed. Topics discussed include injection, matching into the low-energy acceleration stage, matching from the terminal stripper into the high-energy stage, transport to a post accelerator, space charge, bunching isochronism, dispersion and charge selection. Beam transport plans for the proposed Vivitron accelerator are described. (orig.)

Accelerator-driven transmutation reactor analysis code system (ATRAS)

Energy Technology Data Exchange (ETDEWEB)

Sasa, Toshinobu; Tsujimoto, Kazufumi; Takizuka, Takakazu; Takano, Hideki [Japan Atomic Energy Research Inst., Tokai, Ibaraki (Japan). Tokai Research Establishment

1999-03-01

JAERI is proceeding a design study of the hybrid type minor actinide transmutation system which mainly consist of an intense proton accelerator and a fast subcritical core. Neutronics and burnup characteristics of the accelerator-driven system is important from a view point of the maintenance of subcriticality and energy balance during the system operation. To determine those characteristics accurately, it is necessary to involve reactions at high-energy region, which are not treated on ordinary reactor analysis codes. The authors developed a code system named ATRAS to analyze the neutronics and burnup characteristics of accelerator-driven subcritical reactor systems. ATRAS has a function of burnup analysis taking account of the effect of spallation neutron source. ATRAS consists of a spallation analysis code, a neutron transport codes and a burnup analysis code. Utility programs for fuel exchange, pre-processing and post-processing are also incorporated. (author)

High-quality electron beam generation in a proton-driven hollow plasma wakefield accelerator

Science.gov (United States)

Li, Y.; Xia, G.; Lotov, K. V.; Sosedkin, A. P.; Hanahoe, K.; Mete-Apsimon, O.

2017-10-01

Simulations of proton-driven plasma wakefield accelerators have demonstrated substantially higher accelerating gradients compared to conventional accelerators and the viability of accelerating electrons to the energy frontier in a single plasma stage. However, due to the strong intrinsic transverse fields varying both radially and in time, the witness beam quality is still far from suitable for practical application in future colliders. Here we demonstrate the efficient acceleration of electrons in proton-driven wakefields in a hollow plasma channel. In this regime, the witness bunch is positioned in the region with a strong accelerating field, free from plasma electrons and ions. We show that the electron beam carrying the charge of about 10% of 1 TeV proton driver charge can be accelerated to 0.6 TeV with a preserved normalized emittance in a single channel of 700 m. This high-quality and high-charge beam may pave the way for the development of future plasma-based energy frontier colliders.

Electron Acceleration In Impulsive Solar Flares : extract of a thesis

CERN Document Server

Lenters, G T

1999-01-01

Impulsive solar flares generate a wide range of photon and particle emissions and hence provide an excellent backyard laboratory for studying particle acceleration processes in astrophysical plasmas. The source of the acceleration remains unidentified, but the basic observations are clear: (1) Hard X-ray and gamma-ray line emission occur simultaneously, indicating that electron and ion acceleration must occur simultaneously; (2) the electron and ion precipitation rates at the foot-points of the flare must be extremely large to account for the photon emission (∼1037 electrons s −1 and ∼1035 protons s−1, respectively), which means that replenishment of the acceleration region (which contains ≈1037 fully ionized hydrogen atoms) is a crucial issue; and (3) there are enhancements of the heavy ion abundances relative to normal coronal values. The basic model proposed assumes the generation of extremely low levels of magnetohydrodynamic (MHD) turb...

Novel applications of particle accelerators to radiotherapy

International Nuclear Information System (INIS)

Kreiner, A.J.; Burlon, A.A.; Universidad Nacional de San Martin, Villa Ballester

2002-01-01

Charged hadrons (protons and heavier ions) have very definite advantages over photons as far as radiotherapy applications are concerned. They allow for much better spatial dose localization due to their charge, relatively high mass and nature of the energy deposition process. In the frame of an attempt to promote the introduction of hadrontherapy in Argentina an external beam facility has been installed at our tandem accelerator TANDAR. The advantages of heavy ions can only be fully exploited for tumors of well defined localization. In certain types of malignancies, however, the region infiltrated by tumor cells is diffuse, with no sharp boundaries and with microscopic ramifications. In such cases (particularly in certain brain cancers) a more sophisticated scheme has been suggested called boron neutron capture therapy (BNCT). In this work, the use of the Tandar accelerator to produce neutrons for feasibility studies for BNCT through low-energy proton beams on a thick LiF target is being briefly described. Studies on the 13 C(d,n) reaction and a comparison with other neutron-producing reactions are also mentioned. Simulation work to optimize an accelerator-based neutron production target is discussed. A project is being prepared to develop a small proton accelerator in Argentina. Technical specifications of this machine are briefly discussed. (author)

Can Accelerators Accelerate Learning?

International Nuclear Information System (INIS)

Santos, A. C. F.; Fonseca, P.; Coelho, L. F. S.

2009-01-01

The 'Young Talented' education program developed by the Brazilian State Funding Agency (FAPERJ)[1] makes it possible for high-schools students from public high schools to perform activities in scientific laboratories. In the Atomic and Molecular Physics Laboratory at Federal University of Rio de Janeiro (UFRJ), the students are confronted with modern research tools like the 1.7 MV ion accelerator. Being a user-friendly machine, the accelerator is easily manageable by the students, who can perform simple hands-on activities, stimulating interest in physics, and getting the students close to modern laboratory techniques.

Can Accelerators Accelerate Learning?

Science.gov (United States)

Santos, A. C. F.; Fonseca, P.; Coelho, L. F. S.

2009-03-01

The 'Young Talented' education program developed by the Brazilian State Funding Agency (FAPERJ) [1] makes it possible for high-schools students from public high schools to perform activities in scientific laboratories. In the Atomic and Molecular Physics Laboratory at Federal University of Rio de Janeiro (UFRJ), the students are confronted with modern research tools like the 1.7 MV ion accelerator. Being a user-friendly machine, the accelerator is easily manageable by the students, who can perform simple hands-on activities, stimulating interest in physics, and getting the students close to modern laboratory techniques.

Bulk ion acceleration and particle heating during magnetic reconnection in a laboratory plasma

Energy Technology Data Exchange (ETDEWEB)

Yoo, Jongsoo; Yamada, Masaaki; Ji, Hantao; Jara-Almonte, Jonathan; Myers, Clayton E. [Center for Magnetic Self-Organization, Princeton Plasma Physics Laboratory, Princeton, New Jersey 08543 (United States)

2014-05-15

Bulk ion acceleration and particle heating during magnetic reconnection are studied in the collisionless plasma of the Magnetic Reconnection Experiment (MRX). The plasma is in the two-fluid regime, where the motion of the ions is decoupled from that of the electrons within the ion diffusion region. The reconnection process studied here is quasi-symmetric since plasma parameters such as the magnitude of the reconnecting magnetic field, the plasma density, and temperature are compatible on each side of the current sheet. Our experimental data show that the in-plane (Hall) electric field plays a key role in ion heating and acceleration. The electrostatic potential that produces the in-plane electric field is established by electrons that are accelerated near the electron diffusion region. The in-plane profile of this electrostatic potential shows a “well” structure along the direction normal to the reconnection current sheet. This well becomes deeper and wider downstream as its boundary expands along the separatrices where the in-plane electric field is strongest. Since the in-plane electric field is 3–4 times larger than the out-of-plane reconnection electric field, it is the primary source of energy for the unmagnetized ions. With regard to ion acceleration, the Hall electric field causes ions near separatrices to be ballistically accelerated toward the outflow direction. Ion heating occurs as the accelerated ions travel into the high pressure downstream region. This downstream ion heating cannot be explained by classical, unmagnetized transport theory; instead, we conclude that ions are heated by re-magnetization of ions in the reconnection exhaust and collisions. Two-dimensional (2-D) simulations with the global geometry similar to MRX demonstrate downstream ion thermalization by the above mechanisms. Electrons are also significantly heated during reconnection. The electron temperature sharply increases across the separatrices and peaks just outside of the

Calculation of beam injection and modes of acceleration for the JINR phasotron

International Nuclear Information System (INIS)

Vorozhtsov, S.B.; Dmitrievsky, V.P.

1981-01-01

On the basis of computer simulation of particles motion from the injection region up to the final radius of the accelerated proton beam behaviour together with different modes of the JINR high current synchrocyclotron operation is investigated. The THOUR modified computer code is used for calculations. The calculations have been performed with allowance for particle radial-phase motion and particle axial motion and although with beam collective effects. Beam dynamics during first turns of particles has been considered by integrating equations of motion. Tolerances for magnetic field structure in the region of first phase oscillation are obtained. Verifications of time dependences of accelerated voltage amplitude are performed. Time dependences of beam intensity (with and without account for space charge effect) and of mean magnetic field disturbance and the dependence of the separatrice dimension on the orbit radius of the accelerated beam are given. The conclusion is drawn on the correctness of the earlier appreciation of beam intensity equaling 40-45 mkA

Accelerations in Flight

Science.gov (United States)

Doolittle, J H

1925-01-01

This work on accelerometry was done at McCook Field for the purpose of continuing the work done by other investigators and obtaining the accelerations which occur when a high-speed pursuit airplane is subjected to the more common maneuvers. The accelerations obtained in suddenly pulling out of a dive with well-balanced elevators are shown to be within 3 or 4 per cent of the theoretically possible accelerations. The maximum acceleration which a pilot can withstand depends upon the length of time the acceleration is continued. It is shown that he experiences no difficulty under the instantaneous accelerations as high as 7.8 G., but when under accelerations in excess of 4.5 G., continued for several seconds, he quickly loses his faculties.

Theoretical Investigations of Plasma-Based Accelerators and Other Advanced Accelerator Concepts

International Nuclear Information System (INIS)

Shuets, G.

2004-01-01

Theoretical investigations of plasma-based accelerators and other advanced accelerator concepts. The focus of the work was on the development of plasma based and structure based accelerating concepts, including laser-plasma, plasma channel, and microwave driven plasma accelerators

Coaxial two-channel high-gradient dielectric wakefield accelerator

Directory of Open Access Journals (Sweden)

G. V. Sotnikov

2009-06-01

Full Text Available A new scheme for a dielectric wakefield accelerator is proposed that employs a cylindrical multizone dielectric structure configured as two concentric dielectric tubes with outer and inner vacuum channels for drive and accelerated bunches. Analytical and numerical studies have been carried out for such coaxial dielectric-loaded structures (CDS for high-gradient acceleration. An analytical theory of wakefield excitation by particle bunches in a multizone CDS has been formulated. Numerical calculations are presented for an example of a CDS using dielectric tubes with dielectric permittivity 5.7, having external diameters of 2.121 and 0.179 mm with inner diameters of 2.095 and 0.1 mm. An annular 5 GeV, 6 nC electron bunch with rms length of 0.035 mm energizes a wakefield on the structure axis having an accelerating gradient of ∼600  MeV/m with a transformer ratio ∼8∶1. The period of the accelerating field is ∼0.33  mm. If the width of the drive bunch channel is decreased, it is possible to obtain an accelerating gradient of >1  GeV/m while keeping the transformer ratio approximately the same. Full numerical simulations using a particle-in-cell code have confirmed results of the linear theory and furthermore have shown the important influence of the quenching wave that restricts the region of the wakefield to within several periods following the drive bunch. Numerical simulations for another example have shown nearly stable transport of drive and accelerated bunches through the CDS, using a short train of drive bunches.

Performance of the FELIX accelerator

International Nuclear Information System (INIS)

Geer, C.A.J. van der; Bakker, R.J.; Meer, A.F.G. van der; Amersfoort, P.W. van; Gillespie, W.A.; Martin, P.F.

1992-01-01

The FELIX project (Free Electron Laser for Infrared eXperiments) involves the construction and operation of a rapidly tunable FEL users facility for the infrared based on a rf linear accelerator. Lasing was obtained in the summer of 1991. The spectral region already covered is between 16 and 110 μm to be extended to below 8 μm with an additional linac section. Measurement of several electron beam parameters along the beam line are presented. (author) 6 refs.; 7 figs

The modification of the terminal electrostatic field of HI-13 tandem accelerator

International Nuclear Information System (INIS)

Li Tao; Guan Xialing

1993-01-01

The calculation of electrostatic field of terminal and its neighbour region for HI-13 tandem accelerator is made. The limit terminal voltage without tubes is evaluated. Using elliptical cross section in stead of circular ones for the first six equipotential rings, the electrostatic field of this region are modified

Turbulence, Magnetic Reconnection in Turbulent Fluids and Energetic Particle Acceleration

Science.gov (United States)

Lazarian, A.; Vlahos, L.; Kowal, G.; Yan, H.; Beresnyak, A.; de Gouveia Dal Pino, E. M.

2012-11-01

Turbulence is ubiquitous in astrophysics. It radically changes many astrophysical phenomena, in particular, the propagation and acceleration of cosmic rays. We present the modern understanding of compressible magnetohydrodynamic (MHD) turbulence, in particular its decomposition into Alfvén, slow and fast modes, discuss the density structure of turbulent subsonic and supersonic media, as well as other relevant regimes of astrophysical turbulence. All this information is essential for understanding the energetic particle acceleration that we discuss further in the review. For instance, we show how fast and slow modes accelerate energetic particles through the second order Fermi acceleration, while density fluctuations generate magnetic fields in pre-shock regions enabling the first order Fermi acceleration of high energy cosmic rays. Very importantly, however, the first order Fermi cosmic ray acceleration is also possible in sites of magnetic reconnection. In the presence of turbulence this reconnection gets fast and we present numerical evidence supporting the predictions of the Lazarian and Vishniac (Astrophys. J. 517:700-718, 1999) model of fast reconnection. The efficiency of this process suggests that magnetic reconnection can release substantial amounts of energy in short periods of time. As the particle tracing numerical simulations show that the particles can be efficiently accelerated during the reconnection, we argue that the process of magnetic reconnection may be much more important for particle acceleration than it is currently accepted. In particular, we discuss the acceleration arising from reconnection as a possible origin of the anomalous cosmic rays measured by Voyagers as well as the origin cosmic ray excess in the direction of Heliotail.

Large tandem accelerators

International Nuclear Information System (INIS)

Jones, C.M.

1976-01-01

The increasing importance of energetic heavy ion beams in the study of atomic physics, nuclear physics, and materials science has partially or wholly motivated the construction of a new generation of tandem accelerators designed to operate at maximum terminal potentials in the range 14 to 30 MV. In addition, a number of older tandem accelerators are now being significantly upgraded to improve their heavy ion performance. Both of these developments have reemphasized the importance of negative heavy ion sources. The new large tandem accelerators are described, and the requirements placed on negative heavy ion source technology by these and other tandem accelerators used for the acceleration of heavy ions are discussed. First, a brief description is given of the large tandem accelerators which have been completed recently, are under construction, or are funded for construction, second, the motivation for construction of these accelerators is discussed, and last, criteria for negative ion sources for use with these accelerators are presented

Recent progress in accelerator activities at Raja Ramanna Centre for Advanced Technology, Indore

International Nuclear Information System (INIS)

Gupta, P.D.

2013-01-01

Raja Ramanna Centre for Advanced Technology, Indore is a premier national institute engaged in R and D work in front-line areas of accelerator science, technology, and applications. The Centre has designed, developed, and commissioned two synchrotron radiation sources: Indus-1 and Indus-2, serving as national facilities. The Centre is pursuing various other accelerator activities viz. development of a high energy proton accelerator for a spallation neutron source, electron accelerators for food irradiation and industrial applications and free electron lasers (FEL) in THz and IR spectral region, study of innovative schemes of laser driven electron acceleration, and development of advanced technologies to support these activities such as superconducting RF (SCRF) technology, cryogenics, RF power, magnets, ultra high vacuum and control instrumentation. In this talk, an overview of the progress made in accelerator activities at Raja Ramanna Centre for Advanced Technology in recent years is be presented

First order and second order fermi acceleration of energetic charged particles by shock waves

International Nuclear Information System (INIS)

Webb, G.M.

1983-01-01

Steady state solutions of the cosmic ray transport equation describing first order Fermi acceleration of energetic charged particles at a plane shock (without losses) and second order Fermi acceleration in the downstream region of the shock are derived. The solutions for the isotropic part of the phase space distribution function are expressible as eigenfunction expansions, being superpositions of series of power law momentum spectra, with the power law indices being the roots of an eigenvalue equation. The above exact analytic solutions are for the case where the spatial diffusion coefficient kappa is independent of momentum. The solutions in general depend on the shock compression ratio, the modulation parameters V 1 L/kappa 1 , V 2 L/kappa 2 (V is the plasma velocity, kappa is the energetic particle diffusion coefficient, and L a characteristic length over which second order Fermi acceleration is effective) in the upstream and downstream regions of the shock, respectively, and also on a further dimensionless parameter, zeta, characterizing second order Fermi acceleration. In the limit as zeta→0 (no second order Fermi acceleration) the power law momentum spectrum characteristic of first order Fermi acceleration (depending only on the shock compression ratio) obtained previously is recovered. Perturbation solutions for the case where second order Fermi effects are small, and for realistic diffusion coefficients (kappainfinityp/sup a/, a>0, p = particle momentum), applicable at high momenta, are also obtained

Altitude Distribution of the Auroral Acceleration Potential Determined from Cluster Satellite Data at Different Heights

International Nuclear Information System (INIS)

Marklund, Goeran T.; Sadeghi, Soheil; Karlsson, Tomas; Lindqvist, Per-Arne; Nilsson, Hans; Forsyth, Colin; Fazakerley, Andrew; Lucek, Elizabeth A.; Pickett, Jolene

2011-01-01

Aurora, commonly seen in the polar sky, is a ubiquitous phenomenon occurring on Earth and other solar system planets. The colorful emissions are caused by electron beams hitting the upper atmosphere, after being accelerated by quasistatic electric fields at 1-2 R E altitudes, or by wave electric fields. Although aurora was studied by many past satellite missions, Cluster is the first to explore the auroral acceleration region with multiprobes. Here, Cluster data are used to determine the acceleration potential above the aurora and to address its stability in space and time. The derived potential comprises two upper, broad U-shaped potentials and a narrower S-shaped potential below, and is stable on a 5 min time scale. The scale size of the electric field relative to that of the current is shown to depend strongly on altitude within the acceleration region. To reveal these features was possible only by combining data from the two satellites.

Plasma particle accelerators

International Nuclear Information System (INIS)

Dawson, J.M.

1988-01-01

The Superconducting Supercollider (SSC) will require an 87-kilometer accelerator ring to boost particles to 40 TeV. The SSC's size is due in part to the fact that its operating principle is the same one that has dominated accelerator design for 50 years: it guides particles by means of magnetic fields and propels them by strong electric fields. If one were to build an equally powerful but smaller accelerator, one would need to increase the strength of the guiding and propelling fields. Actually, however, conventional technology may not be able to provide significant increases in field strength. There are two reasons. First, the forces from magnetic fields are becoming greater than the structural forces that hold a magnetic material together; the magnets that produce these fields would themselves be torn apart. Second, the energy from electric fields is reaching the energies that bind electrons to atoms; it would tear electrons from nuclei in the accelerator's support structures. It is the electric field problem that plasma accelerators can overcome. Plasma particle accelerators are based on the principle that particles can be accelerated by the electric fields generated within a plasma. Because the plasma has already been ionized, plasma particle accelerators are not susceptible to electron dissociation. They can in theory sustain accelerating fields thousands of times stronger that conventional technologies. So far two methods for creating plasma waves for accelerators have been proposed and tested: the wakefield and the beat wave. Although promising electric fields have been produced, more research is necessary to determine whether plasma particle accelerators can compete with the existing accelerators. 7 figs

A GPU-Accelerated Parameter Interpolation Thermodynamic Integration Free Energy Method.

Science.gov (United States)

Giese, Timothy J; York, Darrin M

2018-03-13

There has been a resurgence of interest in free energy methods motivated by the performance enhancements offered by molecular dynamics (MD) software written for specialized hardware, such as graphics processing units (GPUs). In this work, we exploit the properties of a parameter-interpolated thermodynamic integration (PI-TI) method to connect states by their molecular mechanical (MM) parameter values. This pathway is shown to be better behaved for Mg 2+ → Ca 2+ transformations than traditional linear alchemical pathways (with and without soft-core potentials). The PI-TI method has the practical advantage that no modification of the MD code is required to propagate the dynamics, and unlike with linear alchemical mixing, only one electrostatic evaluation is needed (e.g., single call to particle-mesh Ewald) leading to better performance. In the case of AMBER, this enables all the performance benefits of GPU-acceleration to be realized, in addition to unlocking the full spectrum of features available within the MD software, such as Hamiltonian replica exchange (HREM). The TI derivative evaluation can be accomplished efficiently in a post-processing step by reanalyzing the statistically independent trajectory frames in parallel for high throughput. We also show how one can evaluate the particle mesh Ewald contribution to the TI derivative evaluation without needing to perform two reciprocal space calculations. We apply the PI-TI method with HREM on GPUs in AMBER to predict p K a values in double stranded RNA molecules and make comparison with experiments. Convergence to under 0.25 units for these systems required 100 ns or more of sampling per window and coupling of windows with HREM. We find that MM charges derived from ab initio QM/MM fragment calculations improve the agreement between calculation and experimental results.

Particle acceleration and production of energetic photons in SN1987A

Science.gov (United States)

Gaisser, T. K.; Stanev, Todor; Harding, Alice

1987-01-01

A pulsar wind model for the acceleration of particles in SN1987A is discussed. The expected photon flux is investigated in terms of the spectrum of parent protons and electrons, the nature of the region in which they propagate after acceleration, and the magnetic field and radiation environment which determines the subsequent fate of produced photons. The model is found to produce observable signals if the spin period of the pulsar is 10 ms or less.

Molecular ion acceleration using tandem accelerator

Energy Technology Data Exchange (ETDEWEB)

Saito, Yuichi; Mizuhashi, Kiyoshi; Tajima, Satoshi [Japan Atomic Energy Research Inst., Takasaki, Gunma (Japan). Takasaki Radiation Chemistry Research Establishment

1996-12-01

In TIARA compound beam radiation system, cluster beams have been produced using 3 MV tandem accelerator (9SDH-2) to supply them to various radiation on injection experiments. Till now, productions of C{sub 2-8}, Si{sub 2-4} and O{sub 2} and their accelerations up to 6 MeV have been succeeded. This study aimed at production and acceleration of B{sub 2-4} and LiF. Anion clusters were produced using the conventional ion source of cesium sputter type. The proportions of atoms, molecules and clusters elicited from the ion source were varied depending on the material`s properties and the operating conditions of ion source such as sample temperature, sputter voltage and the shape of sample. The anion clusters were accelerated toward the high voltage terminal in the center of tandem accelerator, leading to cations through losing their electrons by the collision to N{sub 2} gas in a charge conversion cell at the terminal. Positively charged cluster ions could be obtained by modulating the pressure of N{sub 2} gas. Thus, B{sub 2} (64 nA), B{sub 3} (4.4 nA) and B{sub 4} (2.7 nA) have been produced and their maximum survival probabilities were higher than those of carbon or silicon clusters. In addition, the relationship between beam current and gas pressure was investigated for Bn (n = 2-4) and LiF. (M.N.)

TeV/m Nano-Accelerator: Current Status of CNT-Channeling Acceleration Experiment

Energy Technology Data Exchange (ETDEWEB)

Shin, Young Min [Northern Illinois U.; Lumpkin, Alex H. [Fermilab; Thangaraj, Jayakar Charles [Fermilab; Thurman-Keup, Randy Michael [Fermilab; Shiltsev, Vladimir D. [Fermilab

2014-09-17

Crystal channeling technology has offered various opportunities in the accelerator community with a viability of ultrahigh gradient (TV/m) acceleration for future HEP collider. The major challenge of channeling acceleration is that ultimate acceleration gradients might require a high power driver in the hard x-ray regime (~ 40 keV). This x-ray energy exceeds those for x-rays as of today, although x-ray lasers can efficiently excite solid plasma and accelerate particles inside a crystal channel. Moreover, only disposable crystal accelerators are possible at such high externally excited fields which would exceed the ionization thresholds destroying the atomic structure, so acceleration will take place only in a short time before full dissociation of the lattice. Carbon-based nanostructures have great potential with a wide range of flexibility and superior physical strength, which can be applied to channeling acceleration. This paper presents a beam- driven channeling acceleration concept with CNTs and discusses feasible experiments with the Advanced Superconducting Test Accelerator (ASTA) in Fermilab.

Particle acceleration in regions of magnetic flux emergence: a statistical approach using test-particle- and MHD-simulations

Science.gov (United States)

Vlahos, Loukas; Archontis, Vasilis; Isliker, Heinz

We consider 3D nonlinear MHD simulations of an emerging flux tube, from the convection zone into the corona, focusing on the coronal part of the simulations. We first analyze the statistical nature and spatial structure of the electric field, calculating histograms and making use of iso-contour visualizations. Then test-particle simulations are performed for electrons, in order to study heating and acceleration phenomena, as well as to determine HXR emission. This study is done by comparatively exploring quiet, turbulent explosive, and mildly explosive phases of the MHD simulations. Also, the importance of collisional and relativistic effects is assessed, and the role of the integration time is investigated. Particular aim of this project is to verify the quasi- linear assumptions made in standard transport models, and to identify possible transport effects that cannot be captured with the latter. In order to determine the relation of our results to Fermi acceleration and Fokker-Planck modeling, we determine the standard transport coefficients. After all, we find that the electric field of the MHD simulations must be downscaled in order to prevent an un-physically high degree of acceleration, and the value chosen for the scale factor strongly affects the results. In different MHD time-instances we find heating to take place, and acceleration that depends on the level of MHD turbulence. Also, acceleration appears to be a transient phenomenon, there is a kind of saturation effect, and the parallel dynamics clearly dominate the energetics. The HXR spectra are not yet really compatible with observations, we have though to further explore the scaling of the electric field and the integration times used.

Accelerator mass spectrometry at the Rossendorf 5 MV tandem accelerator

International Nuclear Information System (INIS)

Friedrich, M.; Buerger, W.; Curian, H.; Hartmann, B.; Hentschel, E.; Matthes, H.; Probst, W.; Seidel, M.; Turuc, S.; Hebert, D.; Rothe, T.; Stolz, W.

1992-01-01

The Rossendorf electrostatic accelerators (5 MV tandem accelerator and single ended 2 MV van de Graaff accelerator) are already used for ion beam analysis. The existing methods (RBS, PIXE, ERDA, NRA, nuclear microprobe and external beam) will be completed by introduction of Accelerator Mass Spectrometry (AMS). A short description of the Rossendorf AMS system is given and first experimental results are presented. (R.P.) 4 refs.; 6 figs

Truck acceleration behavior study and acceleration lane length recommendations for metered on-ramps

Directory of Open Access Journals (Sweden)

Guangchuan Yang

2016-10-01

Full Text Available This paper investigated the actual truck acceleration capability at metered on-ramps. Truck acceleration performance data were collected through a video-based data collection method. A piecewise constant acceleration model was employed to capture truck acceleration characteristics. It was found that the existing acceleration length will affect truck drivers’ acceleration behavior. At the taper type ramp that has limited acceleration distance, acceleration profile indicated a decreasing trend with distance. While for the ramp with an auxiliary lane that has sufficient acceleration distance, it was found that the acceleration behavior is to have a high acceleration rate in the beginning, then acceleration rate decrease with speed increase, and high acceleration rate again as drivers approach the merging area. Field data show that the truck acceleration performance data documented in the ITE’s (Institute of Transportation Engineers “Traffic Engineering Handbook” are much lower than the field collected data. Also, based on the regression analysis of speed versus distance profiles, it was found that the AASHTO’s (American Association of State Highway and Transportation Officials Green Book acceleration length design guidance is insufficient to accommodate trucks at metered on-ramps. The required acceleration lengths for medium and heavy trucks are approximately 1.3 and 1.6 times of the Green Book design guideline, respectively.

Ion Acceleration by Double Layers with Multi-Component Ion Species

Science.gov (United States)

Good, Timothy; Aguirre, Evan; Scime, Earl; West Virginia University Team

2017-10-01

Current-free double layers (CFDL) models have been proposed to explain observations of magnetic field-aligned ion acceleration in plasmas expanding into divergent magnetic field regions. More recently, experimental studies of the Bohm sheath criterion in multiple ion species plasma reveal an equilibration of Bohm speeds at the sheath-presheath boundary for a grounded plate in a multipole-confined filament discharge. We aim to test this ion velocity effect for CFDL acceleration. We report high resolution ion velocity distribution function (IVDF) measurements using laser induced fluorescence downstream of a CFDL in a helicon plasma. Combinations of argon-helium, argon-krypton, and argon-xenon gases are ionized and measurements of argon or xenon IVDFs are investigated to determine whether ion acceleration is enhanced (or diminished) by the presence of lighter (or heavier) ions in the mix. We find that the predominant effect is a reduction of ion acceleration consistent with increased drag arising from increased gas pressure under all conditions, including constant total gas pressure, equal plasma densities of different ions, and very different plasma densities of different ions. These results suggest that the physics responsible for acceleration of multiple ion species in simple sheaths is not responsible for the ion acceleration observed in these expanding plasmas. Department of Physics, Gettysburg College.

Accelerator-driven assembly for plutonium transformation (ADAPT)

Science.gov (United States)

Tuyle, Greorgy J. Van; Todosow, Michael; Powell, James; Schweitzer, Donald

1995-01-01

A particle accelerator-driven spallation target and corresponding blanket region are proposed for the ultimate disposition of weapons-grade plutonium being retired from excess nuclear weapons in the U.S. and Russia. The highly fissle plutonium is contained within .25 to .5 cm diameter silicon-carbide coated graphite beads, which are cooled by helium, within the slightly subcritical blanket region. Major advantages include very high one-pass burnup (over 90%), a high integrity waste form (the coated beads), and operation in a subcritical mode, thereby minimizing the vulnerability to the positive reativity feedbacks often associated with plutonium fuel.

Probing electron acceleration and x-ray emission in laser-plasma accelerators

International Nuclear Information System (INIS)

Thaury, C.; Ta Phuoc, K.; Corde, S.; Brijesh, P.; Lambert, G.; Malka, V.; Mangles, S. P. D.; Bloom, M. S.; Kneip, S.

2013-01-01

While laser-plasma accelerators have demonstrated a strong potential in the acceleration of electrons up to giga-electronvolt energies, few experimental tools for studying the acceleration physics have been developed. In this paper, we demonstrate a method for probing the acceleration process. A second laser beam, propagating perpendicular to the main beam, is focused on the gas jet few nanosecond before the main beam creates the accelerating plasma wave. This second beam is intense enough to ionize the gas and form a density depletion, which will locally inhibit the acceleration. The position of the density depletion is scanned along the interaction length to probe the electron injection and acceleration, and the betatron X-ray emission. To illustrate the potential of the method, the variation of the injection position with the plasma density is studied

Comparative Theoretical Study of the Ring-Opening Polymerization of Caprolactam vs Caprolactone Using QM/MM Methods

Energy Technology Data Exchange (ETDEWEB)

Elsasser, Brigitta M.; Schoenen, Iris; Fels, Gregor

2013-06-07

Candida antarctica lipase B (CALB) efficiently catalyzes the ring-opening polymerization of lactones to high molecular weight products in good yield. In contrast, an efficient enzymatic synthesis of polyamides has so far not been described in the literature. This obvious difference in enzyme catalysis is the subject of our comparative study of the initial steps of a CALB catalyzed ring-opening polymerization of ε- caprolactone and ε-caprolactam. We have applied docking tools to generate the reactant state complex and performed quantum mechanical/molecular mechanical (QM/MM) calculations at the density functional theory (DFT) PBE0 level of theory to simulate the acylation of Ser105 by the lactone and the lactam, respectively, via the corresponding first tetrahedral intermediates. We could identify a decisive difference in the accessibility of the two substrates in the ring-opening to the respective acyl enzyme complex as the attack of ε-caprolactam is hindered because of an energetically disfavored proton transfer during this part of the catalytic reaction while ε-caprolactone is perfectly processed along the widely accepted pathway using the catalytic triade of Ser105, His224, and Asp187. Since the generation of an acylated Ser105 species is the crucial step of the polymerization procedure, our results give an explanation for the unsatisfactory enzymatic polyamide formation and opens up new possibilities for targeted rational catalyst redesign in hope of an experimentally useful CALB catalyzed polyamide synthesis.

Quantitative radioisotope measurements with the NSF-Arizona regional accelerator facility

International Nuclear Information System (INIS)

Zabel, T.H.; Damon, P.E.; Donahue, D.J.; Jull, A.J.T.

1983-01-01

Results of tests on the tandem accelerator mass spectrometer (TAMS) at the University of Arizona are presented. These results demonstrate: (a) measurements of 14 C/ 13 C ratios with precisions of a few percent can be made in a period of one to several hours; (b) measurements with precisions of 0.5% have been made in which the uncertainties were mainly statistical and in which contributions to the uncertainty of machine fluctuations were negligible; (c) precise measurements of the ratio of 14 C/ 13 C in samples of N.B.S. oxalic acid and of 1890 wood are consistent with the accepted value of that ratio; (d) the real signal from a 44,000 year old sample is equal to the background rate produced from a dead carbon sample. In addition, results of some measurements on archaeological samples are presented

Microelectromechanical acceleration-sensing apparatus

Science.gov (United States)

Lee, Robb M [Albuquerque, NM; Shul, Randy J [Albuquerque, NM; Polosky, Marc A [Albuquerque, NM; Hoke, Darren A [Albuquerque, NM; Vernon, George E [Rio Rancho, NM

2006-12-12

An acceleration-sensing apparatus is disclosed which includes a moveable shuttle (i.e. a suspended mass) and a latch for capturing and holding the shuttle when an acceleration event is sensed above a predetermined threshold level. The acceleration-sensing apparatus provides a switch closure upon sensing the acceleration event and remains latched in place thereafter. Examples of the acceleration-sensing apparatus are provided which are responsive to an acceleration component in a single direction (i.e. a single-sided device) or to two oppositely-directed acceleration components (i.e. a dual-sided device). A two-stage acceleration-sensing apparatus is also disclosed which can sense two acceleration events separated in time. The acceleration-sensing apparatus of the present invention has applications, for example, in an automotive airbag deployment system.

Channel-accelerating gap interaction and beam acceleration and transport experiments with the recirculating linear accelerator (RLA)

International Nuclear Information System (INIS)

Mazarakis, M.G.; Smith, D.L.; Poukey, J.W.; Wagner, J.S.; Bennett, L.F.; Olson, W.R.; Turman, B.N.; Prestwich, K.R.; Wells, J.; Struve, K.

1992-01-01

The lifetime of the Ion Focusing Regime (IFR) channel following the pulsing of the post-accelerating gaps is critical for open-ended low energy devices. It dictates the number of allowable beam recirculations through the gaps. In the case of a closed racetrack configuration, it is significant but not as critical, since the presence of the electron beam focuses the ions and lengthens the lifetime of the ion channel. The authors have experimentally established that pulsing an accelerating gap perturbs the IFR channel. However for the parameters studied, the lifetime is long enough to allow at least four beam recirculations in a spiral device. In addition transparent grids of cusp fields positioned upstream and downstream from the gaps prevent them from perturbing the IFR channel. Experiments were performed with and without injected electron beams. For the experiments investigating the IFR channel interaction with the accelerating gap, the injector was removed and the beam line was extended downstream and upstream from the accelerating cavity. Only the first straight section of the RLA with one accelerating cavity (ET-2) was utilized. The acceleration and transport experiments were performed utilizing two injectors: first the low energy 1.3-MV Isolated Blumlein (IB) injector and most recently the new 4-MV 20-kA injector. Beams of 6--20 kA current were produced and successfully transported and accelerated through the ET-2 post-accelerating gap. For both injectors an apertured non-immersed ion-focused foilless diode was selected among various options. It is the simplest and easiest to operate and can be adjusted to provide variable beam impedance loads to the injector. The transport efficiencies were 90% for the low energy injector and 100% for the new 4-MV injector. The beam Gaussian profile and radius (5 mm) remain the same through acceleration. Experimental results will be presented and compared with numerical simulations

Possible future changes in South East Australian frost frequency: an inter-comparison of statistical downscaling approaches

Science.gov (United States)

Crimp, Steven; Jin, Huidong; Kokic, Philip; Bakar, Shuvo; Nicholls, Neville

2018-04-01

Anthropogenic climate change has already been shown to effect the frequency, intensity, spatial extent, duration and seasonality of extreme climate events. Understanding these changes is an important step in determining exposure, vulnerability and focus for adaptation. In an attempt to support adaptation decision-making we have examined statistical modelling techniques to improve the representation of global climate model (GCM) derived projections of minimum temperature extremes (frosts) in Australia. We examine the spatial changes in minimum temperature extreme metrics (e.g. monthly and seasonal frost frequency etc.), for a region exhibiting the strongest station trends in Australia, and compare these changes with minimum temperature extreme metrics derived from 10 GCMs, from the Coupled Model Inter-comparison Project Phase 5 (CMIP 5) datasets, and via statistical downscaling. We compare the observed trends with those derived from the "raw" GCM minimum temperature data as well as examine whether quantile matching (QM) or spatio-temporal (spTimerQM) modelling with Quantile Matching can be used to improve the correlation between observed and simulated extreme minimum temperatures. We demonstrate, that the spTimerQM modelling approach provides correlations with observed daily minimum temperatures for the period August to November of 0.22. This represents an almost fourfold improvement over either the "raw" GCM or QM results. The spTimerQM modelling approach also improves correlations with observed monthly frost frequency statistics to 0.84 as opposed to 0.37 and 0.81 for the "raw" GCM and QM results respectively. We apply the spatio-temporal model to examine future extreme minimum temperature projections for the period 2016 to 2048. The spTimerQM modelling results suggest the persistence of current levels of frost risk out to 2030, with the evidence of continuing decadal variation.

Accelerator reliability workshop

International Nuclear Information System (INIS)

Hardy, L.; Duru, Ph.; Koch, J.M.; Revol, J.L.; Van Vaerenbergh, P.; Volpe, A.M.; Clugnet, K.; Dely, A.; Goodhew, D.

2002-01-01

About 80 experts attended this workshop, which brought together all accelerator communities: accelerator driven systems, X-ray sources, medical and industrial accelerators, spallation sources projects (American and European), nuclear physics, etc. With newly proposed accelerator applications such as nuclear waste transmutation, replacement of nuclear power plants and others. Reliability has now become a number one priority for accelerator designers. Every part of an accelerator facility from cryogenic systems to data storage via RF systems are concerned by reliability. This aspect is now taken into account in the design/budget phase, especially for projects whose goal is to reach no more than 10 interruptions per year. This document gathers the slides but not the proceedings of the workshop

Accelerator reliability workshop

Energy Technology Data Exchange (ETDEWEB)

Hardy, L; Duru, Ph; Koch, J M; Revol, J L; Van Vaerenbergh, P; Volpe, A M; Clugnet, K; Dely, A; Goodhew, D

2002-07-01

About 80 experts attended this workshop, which brought together all accelerator communities: accelerator driven systems, X-ray sources, medical and industrial accelerators, spallation sources projects (American and European), nuclear physics, etc. With newly proposed accelerator applications such as nuclear waste transmutation, replacement of nuclear power plants and others. Reliability has now become a number one priority for accelerator designers. Every part of an accelerator facility from cryogenic systems to data storage via RF systems are concerned by reliability. This aspect is now taken into account in the design/budget phase, especially for projects whose goal is to reach no more than 10 interruptions per year. This document gathers the slides but not the proceedings of the workshop.

COLLISIONLESS SHOCKS IN A PARTIALLY IONIZED MEDIUM. III. EFFICIENT COSMIC RAY ACCELERATION

Energy Technology Data Exchange (ETDEWEB)

Morlino, G.; Blasi, P.; Bandiera, R.; Amato, E. [INAF-Osservatorio Astrofisico di Arcetri, Largo E. Fermi, 5, I-50125 Firenze (Italy); Caprioli, D. [Department of Astrophysical Sciences, Peyton Hall, Princeton University, Princeton, NJ 08544 (United States)

2013-05-10

In this paper, we present the first formulation of the theory of nonlinear particle acceleration in collisionless shocks in the presence of neutral hydrogen in the acceleration region. The dynamical reaction of the accelerated particles, the magnetic field amplification, and the magnetic dynamical effects on the shock are also included. The main new aspect of this study, however, consists of accounting for charge exchange and the ionization of a neutral hydrogen, which profoundly change the structure of the shock, as discussed in our previous work. This important dynamical effect of neutrals is mainly associated with the so-called neutral return flux, namely the return of hot neutrals from the downstream region to upstream, where they deposit energy and momentum through charge exchange and ionization. We also present the self-consistent calculation of Balmer line emission from the shock region and discuss how to use measurements of the anomalous width of the different components of the Balmer line to infer cosmic ray acceleration efficiency in supernova remnants showing Balmer emission: the broad Balmer line, which is due to charge exchange of hydrogen atoms with hot ions downstream of the shock, is shown to become narrower as a result of the energy drainage into cosmic rays, while the narrow Balmer line, due to charge exchange in the cosmic-ray-induced precursor, is shown to become broader. In addition to these two well-known components, the neutral return flux leads to the formation of a third component with an intermediate width: this too contains information on ongoing processes at the shock.

Electron Surfing Acceleration in Magnetic Reconnection

OpenAIRE

Hoshino, Masahiro

2005-01-01

We discuss that energetic electrons are generated near the X-type magnetic reconnection region due to a surfing acceleration mechanism. In a thin plasma sheet, the polarization electric fields pointing towards the neutral sheet are induced around the boundary between the lobe and plasma sheet in association with the Hall electric current. By using a particle-in-cell simulation, we demonstrate that the polarization electric fields are strongly enhanced in an externally driven reconnection syst...

Future accelerator technology

International Nuclear Information System (INIS)

Sessler, A.M.

1986-05-01

A general discussion is presented of the acceleration of particles. Upon this foundation is built a categorization scheme into which all accelerators can be placed. Special attention is devoted to accelerators which employ a wake-field mechanism and a restricting theorem is examined. It is shown how the theorem may be circumvented. Comments are made on various acceleration schemes

The electron stretcher accelerator ELSA

International Nuclear Information System (INIS)

Husmann, D.

1989-01-01

The electron stretcher accelerator, ELSA, provides unpolarized and polarized electron beams at energies between 0.5 and 3.5 GeV at high duty factor up to 99%. ELSA partly can serve also as a synchrotron radiation source in the vacuum ultra violet and X-ray region. ELSA is a circular accelerator of 165 m circumference. The Bonn 2.5 GeV Electron Synchrotron, which came into operation in 1967, is used as injector. To achieve the above-mentioned features, ELSA is operated in three different modes. 'Stretcher mode' is used at energies between 0.5 and 2.0 GeV. For a beam energy above 2.0 GeV, ELSA is operated in the 'post acceleration mode'. Where it is operated as a dedicated 'synchrotron radiation source', electrons are accumulated up to a limit of about 50 mA at 3.5 GeV. Dipole fields to obtain a closed orbit and quadrupole fields to get beam focusing are realized with help of two kinds of magnets, namely dipoles and quadrupoles. This structure provides radiation damping of the horizontal betatron oscillation needed for bean storage. It also allows a wade range variation of the optical working point of the machine. The ring contains 12 sextupoles, in addition to 32 quadrupoles and 24 dipoles, for correction of the optics and for extraction purposes. (N.K.)

Accelerating Inspire

CERN Document Server

AUTHOR|(CDS)2266999

2017-01-01

CERN has been involved in the dissemination of scientific results since its early days and has continuously updated the distribution channels. Currently, Inspire hosts catalogues of articles, authors, institutions, conferences, jobs, experiments, journals and more. Successful orientation among this amount of data requires comprehensive linking between the content. Inspire has lacked a system for linking experiments and articles together based on which accelerator they were conducted at. The purpose of this project has been to create such a system. Records for 156 accelerators were created and all 2913 experiments on Inspire were given corresponding MARC tags. Records of 18404 accelerator physics related bibliographic entries were also tagged with corresponding accelerator tags. Finally, as a part of the endeavour to broaden CERN's presence on Wikipedia, existing Wikipedia articles of accelerators were updated with short descriptions and links to Inspire. In total, 86 Wikipedia articles were updated. This repo...

Requirements of a proton beam accelerator for an accelerator-driven reactor

International Nuclear Information System (INIS)

Takahashi, H.; Zhao, Y.; Tsoupas, N.; An, Y.; Yamazaki, Y.

1997-01-01

When the authors first proposed an accelerator-driven reactor, the concept was opposed by physicists who had earlier used the accelerator for their physics experiments. This opposition arose because they had nuisance experiences in that the accelerator was not reliable, and very often disrupted their work as the accelerator shut down due to electric tripping. This paper discusses the requirements for the proton beam accelerator. It addresses how to solve the tripping problem and how to shape the proton beam

Nuclear Magnetic Shielding Constants from Quantum Mechanical/Molecular Mechanical Calculations Using Polarizable Embedding: Role of the Embedding Potential

DEFF Research Database (Denmark)

Steinmann, Casper; Olsen, Jógvan Magnus Haugaard; Kongsted, Jacob

2014-01-01

We present NMR shielding constants obtained through quantum mechanical/molecular mechanical (QM/MM) embedding calculations. Contrary to previous reports, we show that a relatively small QM region is sufficient, provided that a high-quality embedding potential is used. The calculated averaged NMR...... shielding constants of both acrolein and acetone solvated in water are based on a number of snapshots extracted from classical molecular dynamics simulations. We focus on the carbonyl chromophore in both molecules, which shows large solvation effects, and we study the convergence of shielding constants...

Particle acceleration and reconnection in the solar wind

Energy Technology Data Exchange (ETDEWEB)

Zank, G. P.; Hunana, P.; Mostafavi, P.; Le Roux, J. A.; Webb, G. M. [Center for Space Plasma and Aeronomic Research (CSPAR), University of Alabama, Huntsville, AL 35805 (United States); Department of Space Science, University of Alabama, Huntsville, AL 35899 (United States); Khabarova, O. [Heliophysical Laboratory, IZMIRAN, Troitsk, Moscow 142190 (Russian Federation); Cummings, A. C.; Stone, E. C. [California Institute of Technology, Mail Code 290-17, Pasadena, CA 91125 (United States); Decker, R. B. [Johns Hopkins University/Applied Physics Lab., Laurel, MD 20723-6099 (United States)

2016-03-25

An emerging paradigm for the dissipation of magnetic turbulence in the supersonic solar wind is via localized quasi-2D small-scale magnetic island reconnection processes. An advection-diffusion transport equation for a nearly isotropic particle distribution describes particle transport and energization in a region of interacting magnetic islands [1; 2]. The dominant charged particle energization processes are 1) the electric field induced by quasi-2D magnetic island merging, and 2) magnetic island contraction. The acceleration of charged particles in a “sea of magnetic islands” in a super-Alfvénic flow, and the energization of particles by combined diffusive shock acceleration (DSA) and downstream magnetic island reconnection processes are discussed.

SALOME: An Accelerator for the Practical Course in Accelerator Physics

OpenAIRE

Miltchev, Velizar; Riebesehl, Daniel; Roßbach, Jörg; Trunk, Maximilian; Stein, Oliver

2014-01-01

SALOME (Simple Accelerator for Learning Optics and the Manipulation of Electrons) is a short low energy linear electron accelerator built by the University of Hamburg. The goal of this project is to give the students the possibility to obtain hands-on experience with the basics of accelerator physics. In this contribution the layout of the device will be presented. The most important components of the accelerator will be discussed and an overview of the planned demonstration experiments will ...

Particle acceleration in explosive relativistic reconnection events and Crab Nebula gamma-ray flares

Science.gov (United States)

Lyutikov, Maxim; Komissarov, Serguei; Sironi, Lorenzo

2018-04-01

We develop a model of gamma-ray flares of the Crab Nebula resulting from the magnetic reconnection events in a highly magnetised relativistic plasma. We first discuss physical parameters of the Crab Nebula and review the theory of pulsar winds and termination shocks. We also review the principle points of particle acceleration in explosive reconnection events [Lyutikov et al., J. Plasma Phys., vol. 83(6), p. 635830601 (2017a); J. Plasma Phys., vol. 83(6), p. 635830602 (2017b)]. It is required that particles producing flares are accelerated in highly magnetised regions of the nebula. Flares originate from the poleward regions at the base of the Crab's polar outflow, where both the magnetisation and the magnetic field strength are sufficiently high. The post-termination shock flow develops macroscopic (not related to the plasma properties on the skin-depth scale) kink-type instabilities. The resulting large-scale magnetic stresses drive explosive reconnection events on the light-crossing time of the reconnection region. Flares are produced at the initial stage of the current sheet development, during the X-point collapse. The model has all the ingredients needed for Crab flares: natural formation of highly magnetised regions, explosive dynamics on the light travel time, development of high electric fields on macroscopic scales and acceleration of particles to energies well exceeding the average magnetic energy per particle.

Social-emotional characteristics of gifted accelerated and non-accelerated students in the Netherlands.

Science.gov (United States)

Hoogeveen, Lianne; van Hell, Janet G; Verhoeven, Ludo

2012-12-01

In the studies of acceleration conducted so far a multidimensional perspective has largely been neglected. No attempt has been made to relate social-emotional characteristics of accelerated versus non-accelerated students in perspective of environmental factors. In this study, social-emotional characteristics of accelerated gifted students in the Netherlands were examined in relation to personal and environmental factors. Self-concept and social contacts of accelerated (n = 148) and non-accelerated (n = 55) gifted students, aged 4 to 27 (M = 11.22, SD = 4.27) were measured. Self-concept and social contacts of accelerated and non-accelerated gifted students were measured using a questionnaire and a diary, and parents of these students evaluated their behavioural characteristics. Gender and birth order were studied as personal factors and grade, classroom, teachers' gender, teaching experience, and the quality of parent-school contact as environmental factors. The results showed minimal differences in the social-emotional characteristics of accelerated and non-accelerated gifted students. The few differences we found favoured the accelerated students. We also found that multiple grade skipping does not have negative effects on social-emotional characteristics, and that long-term effects of acceleration tend to be positive. As regards the possible modulation of personal and environmental factors, we merely found an impact of such factors in the non-accelerated group. The results of this study strongly suggest that social-emotional characteristics of accelerated gifted students and non-accelerated gifted students are largely similar. These results thus do not support worries expressed by teachers about the acceleration of gifted students. Our findings parallel the outcomes of earlier studies in the United States and Germany in that we observed that acceleration does not harm gifted students, not even in the case of multiple grade skipping. On the contrary, there is a

The miniature accelerator

CERN Multimedia

Antonella Del Rosso

2015-01-01

The image that most people have of CERN is of its enormous accelerators and their capacity to accelerate particles to extremely high energies. But thanks to some cutting-edge studies on beam dynamics and radiofrequency technology, along with innovative construction techniques, teams at CERN have now created the first module of a brand-new accelerator, which will be just 2 metres long. The potential uses of this miniature accelerator will include deployment in hospitals for the production of medical isotopes and the treatment of cancer. It’s a real David-and-Goliath story.   Serge Mathot, in charge of the construction of the "mini-RFQ", pictured with the first of the four modules that will make up the miniature accelerator. The miniature accelerator consists of a radiofrequency quadrupole (RFQ), a component found at the start of all proton accelerator chains around the world, from the smallest to the largest. The LHC is designed to produce very high-intensity beams ...

Accelerators for energy

International Nuclear Information System (INIS)

Inoue, Makoto

2000-01-01

A particle accelerator is a device to consume energy but not to produce it. Then, the titled accelerator seems to mean an accelerator for using devices related to nuclear energy. For an accelerator combined to nuclear fissionable fuel, neutron sources are D-T type, (gamma, n) reaction using electron beam type spallation type, and so forth. At viewpoints of powers of incident beam and formed neutron, a spallation type source using high energy proton is told to be effective but others have some advantages by investigation on easy operability, easy construction, combustion with target, energy and directivity of neutron, and so forth. Here were discussed on an accelerator for research on accelerator driven energy system by dividing its researching steps, and on kind, energy, beam intensity, and so forth of an accelerator suitable for it. And, space electric charge effect at beam propagation direction controlled by beam intensity of cyclotron was also commented. (G.K.)

Ionizing wave via high-power HF acceleration

OpenAIRE

Mishin, Evgeny; Pedersen, Todd

2010-01-01

Recent ionospheric modification experiments with the 3.6 MW transmitter at the High Frequency Active Auroral Research Program (HAARP) facility in Alaska led to discovery of artificial ionization descending from the nominal interaction altitude in the background F-region ionosphere by ~60 km. This paper presents a physical model of an ionizing wavefront created by suprathermal electrons accelerated by the HF-excited plasma turbulence.

SU-E-T-627: Failure Modes and Effect Analysis for Monthly Quality Assurance of Linear Accelerator

International Nuclear Information System (INIS)

Xie, J; Xiao, Y; Wang, J; Peng, J; Lu, S; Hu, W

2014-01-01

Purpose: To develop and implement a failure mode and effect analysis (FMEA) on routine monthly Quality Assurance (QA) tests (physical tests part) of linear accelerator. Methods: A systematic failure mode and effect analysis method was performed for monthly QA procedures. A detailed process tree of monthly QA was created and potential failure modes were defined. Each failure mode may have many influencing factors. For each factor, a risk probability number (RPN) was calculated from the product of probability of occurrence (O), the severity of effect (S), and detectability of the failure (D). The RPN scores are in a range of 1 to 1000, with higher scores indicating stronger correlation to a given influencing factor of a failure mode. Five medical physicists in our institution were responsible to discuss and to define the O, S, D values. Results: 15 possible failure modes were identified and all RPN scores of all influencing factors of these 15 failue modes were from 8 to 150, and the checklist of FMEA in monthly QA was drawn. The system showed consistent and accurate response to erroneous conditions. Conclusion: The influencing factors of RPN greater than 50 were considered as highly-correlated factors of a certain out-oftolerance monthly QA test. FMEA is a fast and flexible tool to develop an implement a quality management (QM) frame work of monthly QA, which improved the QA efficiency of our QA team. The FMEA work may incorporate more quantification and monitoring fuctions in future

Failed Radiatively Accelerated Dusty Outflow Model of the Broad Line Region in Active Galactic Nuclei. I. Analytical Solution

Energy Technology Data Exchange (ETDEWEB)

Czerny, B.; Panda, S.; Wildy, C.; Sniegowska, M. [Center for Theoretical Physics, Polish Academy of Sciences, Al. Lotników 32/46, 02-668 Warsaw (Poland); Li, Yan-Rong; Wang, J.-M. [Key Laboratory for Particle Astrophysics, Institute of High Energy Physics, Chinese Academy of Sciences, 19B Yuquan Road, Beijing 100049 (China); Hryniewicz, K.; Sredzinska, J. [Copernicus Astronomical Center, Polish Academy of Sciences, Bartycka 18, 00-716 Warsaw (Poland); Karas, V., E-mail: bcz@cft.edu.pl [Astronomical Institute, Academy of Sciences, Bocni II 1401, CZ-141 00 Prague (Czech Republic)

2017-09-10

The physical origin of the broad line region in active galactic nuclei is still unclear despite many years of observational studies. The reason is that the region is unresolved, and the reverberation mapping results imply a complex velocity field. We adopt a theory-motivated approach to identify the principal mechanism responsible for this complex phenomenon. We consider the possibility that the role of dust is essential. We assume that the local radiation pressure acting on the dust in the accretion disk atmosphere launches the outflow of material, but higher above the disk the irradiation from the central parts causes dust evaporation and a subsequent fallback. This failed radiatively accelerated dusty outflow is expected to represent the material forming low ionization lines. In this paper we formulate simple analytical equations to describe the cloud motion, including the evaporation phase. The model is fully described just by the basic parameters of black hole mass, accretion rate, black hole spin, and viewing angle. We study how the spectral line generic profiles correspond to this dynamic. We show that the virial factor calculated from our model strongly depends on the black hole mass in the case of enhanced dust opacity, and thus it then correlates with the line width. This could explain why the virial factor measured in galaxies with pseudobulges differs from that obtained from objects with classical bulges, although the trend predicted by the current version of the model is opposite to the observed trend.

Electrostatic accelerators

OpenAIRE

Hinterberger, F

2006-01-01

The principle of electrostatic accelerators is presented. We consider Cockcroft– Walton, Van de Graaff and Tandem Van de Graaff accelerators. We resume high voltage generators such as cascade generators, Van de Graaff band generators, Pelletron generators, Laddertron generators and Dynamitron generators. The speci c features of accelerating tubes, ion optics and methods of voltage stabilization are described. We discuss the characteristic beam properties and the variety of possible beams. We ...

Kr II laser-induced fluorescence for measuring plasma acceleration.

Science.gov (United States)

Hargus, W A; Azarnia, G M; Nakles, M R

2012-10-01

We present the application of laser-induced fluorescence of singly ionized krypton as a diagnostic technique for quantifying the electrostatic acceleration within the discharge of a laboratory cross-field plasma accelerator also known as a Hall effect thruster, which has heritage as spacecraft propulsion. The 728.98 nm Kr II transition from the metastable 5d(4)D(7/2) to the 5p(4)P(5/2)(∘) state was used for the measurement of laser-induced fluorescence within the plasma discharge. From these measurements, it is possible to measure velocity as krypton ions are accelerated from near rest to approximately 21 km/s (190 eV). Ion temperature and the ion velocity distributions may also be extracted from the fluorescence data since available hyperfine splitting data allow for the Kr II 5d(4)D(7/2)-5p(4)P(5/2)(∘) transition lineshape to be modeled. From the analysis, the fluorescence lineshape appears to be a reasonable estimate for the relatively broad ion velocity distributions. However, due to an apparent overlap of the ion creation and acceleration regions within the discharge, the distributed velocity distributions increase ion temperature determination uncertainty significantly. Using the most probable ion velocity as a representative, or characteristic, measure of the ion acceleration, overall propellant energy deposition, and effective electric fields may be calculated. With this diagnostic technique, it is possible to nonintrusively characterize the ion acceleration both within the discharge and in the plume.

Theoretical modelling of epigenetically modified DNA sequences [version 2; referees: 2 approved

Directory of Open Access Journals (Sweden)

Alexandra Teresa Pires Carvalho

2015-05-01

Full Text Available We report herein a set of calculations designed to examine the effects of epigenetic modifications on the structure of DNA. The incorporation of methyl, hydroxymethyl, formyl and carboxy substituents at the 5-position of cytosine is shown to hardly affect the geometry of CG base pairs, but to result in rather larger changes to hydrogen-bond and stacking binding energies, as predicted by dispersion-corrected density functional theory (DFT methods. The same modifications within double-stranded GCG and ACA trimers exhibit rather larger structural effects, when including the sugar-phosphate backbone as well as sodium counterions and implicit aqueous solvation. In particular, changes are observed in the buckle and propeller angles within base pairs and the slide and roll values of base pair steps, but these leave the overall helical shape of DNA essentially intact. The structures so obtained are useful as a benchmark of faster methods, including molecular mechanics (MM and hybrid quantum mechanics/molecular mechanics (QM/MM methods. We show that previously developed MM parameters satisfactorily reproduce the trimer structures, as do QM/MM calculations which treat bases with dispersion-corrected DFT and the sugar-phosphate backbone with AMBER. The latter are improved by inclusion of all six bases in the QM region, since a truncated model including only the central CG base pair in the QM region is considerably further from the DFT structure. This QM/MM method is then applied to a set of double-stranded DNA heptamers derived from a recent X-ray crystallographic study, whose size puts a DFT study beyond our current computational resources. These data show that still larger structural changes are observed than in base pairs or trimers, leading us to conclude that it is important to model epigenetic modifications within realistic molecular contexts.

Superconducting accelerator technology

International Nuclear Information System (INIS)

Grunder, H.A.; Hartline, B.K.

1986-01-01

Modern and future accelerators for high energy and nuclear physics rely increasingly on superconducting components to achieve the required magnetic fields and accelerating fields. This paper presents a practical overview of the phenomenon of superconductivity, and describes the design issues and solutions associated with superconducting magnets and superconducting rf acceleration structures. Further development and application of superconducting components promises increased accelerator performance at reduced electric power cost

Sector ring accelerator ''RESATRON''

International Nuclear Information System (INIS)

Schwabe, E.

1980-01-01

Project of sector ring accelerator RESATRON is described. The curiosity of this accelerator is the second cycle of acceleration of the beam after stripping it on the foil. In such an accelerator heavy ions with a different ratio Z to A can be accelerated. (S.B.)

Radio frequency focused interdigital linear accelerator

Science.gov (United States)

Swenson, Donald A.; Starling, W. Joel

2006-08-29

An interdigital (Wideroe) linear accelerator employing drift tubes, and associated support stems that couple to both the longitudinal and support stem electromagnetic fields of the linac, creating rf quadrupole fields along the axis of the linac to provide transverse focusing for the particle beam. Each drift tube comprises two separate electrodes operating at different electrical potentials as determined by cavity rf fields. Each electrode supports two fingers, pointing towards the opposite end of the drift tube, forming a four-finger geometry that produces an rf quadrupole field distribution along its axis. The fundamental periodicity of the structure is equal to one half of the particle wavelength .beta..lamda., where .beta. is the particle velocity in units of the velocity of light and .lamda. is the free space wavelength of the rf. Particles are accelerated in the gaps between drift tubes. The particle beam is focused in regions inside the drift tubes.

2014 Joint International Accelerator School: Beam Loss and Accelerator Protection

CERN Document Server

JAS - Joint US-CERN-Japan-Russia Accelerator School

2016-01-01

Many particle accelerators operate with very high beam power and very high energy stored in particle beams as well as in magnet systems. In the future, the beam power in high intensity accelerators will further increase. The protection of the accelerator equipment from the consequences of uncontrolled release of the energy is essential. This was the motivation for organizing a first school on beam losses and accelerator protection (in general referred to as machine protection). During the school the methods and technologies to identify, mitigate, monitor and manage the technical risks associated with the operation of accelerators with high-power beams or subsystems with large stored energy were presented. At the completion of the school the participants should have been able to understand the physical phenomena that can damage machine subsystems or interrupt operations and to analyze an accelerator facility to produce a register of technical risks and the corresponding risk mitigation and management strategie...

Particle acceleration in solar flares: observations versus numerical simulations

International Nuclear Information System (INIS)

Benz, A O; Grigis, P C; Battaglia, M

2006-01-01

Solar flares are generally agreed to be impulsive releases of magnetic energy. Reconnection in dilute plasma is the suggested trigger for the coronal phenomenon. It releases up to 10 26 J, accelerates up to 10 38 electrons and ions and must involve a volume that greatly exceeds the current sheet dimension. The Ramaty High-Energy Solar Spectroscopic Imager satellite can image a source in the corona that appears to contain the acceleration region and can separate it from other x-ray emissions. The new observations constrain the acceleration process by a quantitative relation between spectral index and flux. We present recent observational results and compare them with theoretical modelling by a stochastic process assuming transit-time damping of fast-mode waves, escape and replenishment. The observations can only be fitted if additional assumptions on trapping by an electric potential and possibly other processes such as isotropization and magnetic trapping are made

Linear Accelerators

International Nuclear Information System (INIS)

Vretenar, M

2014-01-01

The main features of radio-frequency linear accelerators are introduced, reviewing the different types of accelerating structures and presenting the main characteristics aspects of linac beam dynamics

Accelerator structure for a charged particle linear accelerator working in standing wave mode

International Nuclear Information System (INIS)

Tran, D.T.; Tronc, Dominique.

1977-01-01

Charged particle accelerators generally include a pre-grouping or pre-accelerating structure associated with the accelerator structure itself. But pre-grouping or pre-accelerating structures of known type (Patent application No. 70 39261 for example) present electric and dimensional characteristics that rule them out for accelerators working at high frequencies (C or X bands for example), since the distance separating the interaction spaces becomes very small in this case. The accelerator structure mentioned in this invention can be used to advantage for such accelerators [fr

Electron beam dynamics in the long-pulse, high-current DARHT-II linear induction accelerator

International Nuclear Information System (INIS)

Ekdahl, Carl A.; Abeyta, Epifanio O.; Aragon, Paul; Archuleta, Rita; Cook, Gerald; Dalmas, Dale; Esquibel, Kevin; Gallegos, Robert A.; Garnett, Robert; Harrison, James F.; Johnson, Jeffrey B.; Jacquez, Edward B.; Mccuistian, Brian T.; Montoya, Nicholas A.; Nath, Subrato; Nielsen, Kurt; Oro, David; Prichard, Benjamin; Rowton, Lawrence; Sanchez, Manolito; Scarpetti, Raymond; Schauer, Martin M.; Seitz, Gerald; Schulze, Martin; Bender, Howard A.; Broste, William B.; Carlson, Carl A.; Frayer, Daniel K.; Johnson, Douglas E.; Tom, C.Y.; Williams, John; Hughes, Thomas; Anaya, Richard; Caporaso, George; Chambers, Frank; Chen, Yu-Jiuan; Falabella, Steve; Guethlein, Gary; Raymond, Brett; Richardson, Roger; Trainham, C.; Watson, Jim; Weir, John; Genoni, Thomas; Toma, Carsten

2009-01-01

The DARHT-II linear induction accelerator (LIA) now accelerates 2-kA electron beams to more than 17 MeV. This LIA is unique in that the accelerated current pulse width is greater than 2 microseconds. This pulse has a flat-top region where the final electron kinetic energy varies by less than 1% for more than 1.5 microseconds. The long risetime of the 6-cell injector current pulse is 0.5 (micro)s, which can be scraped off in a beam-head cleanup zone before entering the 68-cell main accelerator. We discuss our experience with tuning this novel accelerator; and present data for the resulting beam transport and dynamics. We also present beam stability data, and relate these to previous stability experiments at lower current and energy.

Critical heat flux of forced convection boiling in an oscilating acceleration field. Pt. 1

International Nuclear Information System (INIS)

Otsuji, T.; Kurosawa, A.

1982-01-01

The influence of periodically varying acceleration on critical heat flux (CHF) of Freon-113 flowing upward in a uniformly heated vertical annular channel has been studied experimentally. The freon loop was oscillated vertically to determine the ratio of CHF in the oscillating acceleration field to the corresponding stationary value. The amplitude of inlet flow oscillation induced by variation of acceleration, which causes early CHF, is proportional to the acceleration amplitude. The dependence of inlet flow rate on the oscillating acceleration decreases with increasing inlet subcooling, and no oscillation of inlet flow is observed in the case of negative exit quality (subcooled boiling). Nevertheless the degradation of CHF is more remarkable in the low quality region. This result suggests the necessity to introduce an other mechanism of early CHF than flow oscillation. (orig.)

Development of bipolar pulse accelerator for intense pulsed ion beam acceleration

International Nuclear Information System (INIS)

Fujioka, Y.; Mitsui, C.; Kitamura, I.; Takahashi, T.; Masugata, K.; Tanoue, H.; Arai, K.

2003-01-01

To improve the purity of an intense pulsed ion beams a new type of pulsed ion beam accelerator named 'bipolar pulse accelerator (BPA)' was proposed. In the accelerator purity of the beam is expected. To confirm the principle of the accelerator experimental system was developed. The system utilizes B y type magnetically insulated acceleration gap and operated with single polar negative pulse. A coaxial gas puff plasma gun placed in the grounded anode was used as an ion source, and source plasma (nitrogen) of current density approx. = 25 A/cm 2 , duration approx. = 1.5 μs was injected into the acceleration gap. The ions are successfully accelerated from the grounded anode to the drift tube by applying negative pulse of voltage 180 kV, duration 60 ns to the drift tube. Pulsed ion beam of current density approx. = 40 A/cm 2 , duration approx. 60 ns was obtained at 42 mm downstream from the anode surface. (author)

2D electron density profile measurement in tokamak by laser-accelerated ion-beam probe.

Science.gov (United States)

Chen, Y H; Yang, X Y; Lin, C; Wang, L; Xu, M; Wang, X G; Xiao, C J

2014-11-01

A new concept of Heavy Ion Beam Probe (HIBP) diagnostic has been proposed, of which the key is to replace the electrostatic accelerator of traditional HIBP by a laser-driven ion accelerator. Due to the large energy spread of ions, the laser-accelerated HIBP can measure the two-dimensional (2D) electron density profile of tokamak plasma. In a preliminary simulation, a 2D density profile was reconstructed with a spatial resolution of about 2 cm, and with the error below 15% in the core region. Diagnostics of 2D density fluctuation is also discussed.

Study of electrostatic acceleration of H and D negative ion beams. Application to the 1 MeV SINGAP accelerator; Etude de l`acceleration electrostatique de faisceaux d`ions negatifs H / D de haute puissance. Application a l`accelerateur SINGAP de 1MeV

Energy Technology Data Exchange (ETDEWEB)

Bucalossi, J [Association Euratom-CEA Cadarache, 13 - Saint-Paul-lez-Durance (France). Dept. de Recherches sur la Fusion Controlee; [Paris-6 Univ., 75 (France)

1998-04-01

In the framework of the development of a neutral beam injection system for ITER (International Thermonuclear Experimental Reactor), the electrostatic acceleration of negative ion H/D beams up to an energy of 1 MeV has been studied. With the support of 3-D beam trajectory calculations, the limitations of the multi-aperture multi-grid acceleration concept, ITER reference concept, ar shown and the relevance of a new concept, called SINGAP, is demonstrated. In a SINGAP accelerator, beamlets are pre-accelerated with a classical triode multi-apertures system up to {approx} 50 keV. The pre-accelerated beamlets are then merged into a single beam and post-accelerated at high energy through a large SINGle APerture using one SINgle GAP. The optics of one pre-accelerated beamlet has been studied on the INCA triode accelerator at the Ecole Polytechnique. A diagnostic has been developed to measure the emittance of the pre-accelerated beamlet. A diagnostic has been developed to measure the emittance of the pre-accelerated beamlet. Values of {approx} 0.03{pi}.mrad.cm for the effective normalized emittance and {approx} 12 mrad for the minimal beam divergence have been found (Hbeams). Besides, the effects of co-extracted electrons and pressure in the transport region on the beam optics are shown and experiment is compared to beam numerical simulation. On the Cadarache 1 MeV, 100 mA, D- SINGAP accelerator, beams of 1 s pulse were produced at a level of 900 keV (without observing breakdowns between electrodes). SINGAP optics has been investigated using an infrared calorimetric beam profile diagnostic (2-D) and a neutral beam profile diagnostic (1-D). The control of the beam optics is very satisfying: a divergence of {approx} 10 mrad has been measured, and 3-D simulations and experimentation are in good agreement. (author) 117 refs.

KEK digital accelerator

Directory of Open Access Journals (Sweden)

T. Iwashita

2011-07-01

Full Text Available The High Energy Accelerator Research Organization KEK digital accelerator (KEK-DA is a renovation of the KEK 500 MeV booster proton synchrotron, which was shut down in 2006. The existing 40 MeV drift tube linac and rf cavities have been replaced by an electron cyclotron resonance (ECR ion source embedded in a 200 kV high-voltage terminal and induction acceleration cells, respectively. A DA is, in principle, capable of accelerating any species of ion in all possible charge states. The KEK-DA is characterized by specific accelerator components such as a permanent magnet X-band ECR ion source, a low-energy transport line, an electrostatic injection kicker, an extraction septum magnet operated in air, combined-function main magnets, and an induction acceleration system. The induction acceleration method, integrating modern pulse power technology and state-of-art digital control, is crucial for the rapid-cycle KEK-DA. The key issues of beam dynamics associated with low-energy injection of heavy ions are beam loss caused by electron capture and stripping as results of the interaction with residual gas molecules and the closed orbit distortion resulting from relatively high remanent fields in the bending magnets. Attractive applications of this accelerator in materials and biological sciences are discussed.

Semiconductor acceleration sensor

Science.gov (United States)

Ueyanagi, Katsumichi; Kobayashi, Mitsuo; Goto, Tomoaki

1996-09-01

This paper reports a practical semiconductor acceleration sensor especially suited for automotive air bag systems. The acceleration sensor includes four beams arranged in a swastika structure. Two piezoresistors are formed on each beam. These eight piezoresistors constitute a Wheatstone bridge. The swastika structure of the sensing elements, an upper glass plate and a lower glass plate exhibit the squeeze film effect which enhances air dumping, by which the constituent silicon is prevented from breakdown. The present acceleration sensor has the following features. The acceleration force component perpendicular to the sensing direction can be cancelled. The cross-axis sensitivity is less than 3 percent. And, the erroneous offset caused by the differences between the thermal expansion coefficients of the constituent materials can be canceled. The high aspect ratio configuration realized by plasma etching facilitates reducing the dimensions and improving the sensitivity of the acceleration sensor. The present acceleration sensor is 3.9 mm by 3.9 mm in area and 1.2 mm in thickness. The present acceleration sensor can measure from -50 to +50 G with sensitivity of 0.275 mV/G and with non-linearity of less than 1 percent. The acceleration sensor withstands shock of 3000 G.

Large electrostatic accelerators

Energy Technology Data Exchange (ETDEWEB)

Jones, C.M.

1984-01-01

The increasing importance of energetic heavy ion beams in the study of atomic physics, nuclear physics, and materials science has partially or wholly motivated the construction of a new generation of large electrostatic accelerators designed to operate at terminal potentials of 20 MV or above. In this paper, the author briefly discusses the status of these new accelerators and also discusses several recent technological advances which may be expected to further improve their performance. The paper is divided into four parts: (1) a discussion of the motivation for the construction of large electrostatic accelerators, (2) a description and discussion of several large electrostatic accelerators which have been recently completed or are under construction, (3) a description of several recent innovations which may be expected to improve the performance of large electrostatic accelerators in the future, and (4) a description of an innovative new large electrostatic accelerator whose construction is scheduled to begin next year. Due to time and space constraints, discussion is restricted to consideration of only tandem accelerators.

Large electrostatic accelerators

International Nuclear Information System (INIS)

Jones, C.M.

1984-01-01

The increasing importance of energetic heavy ion beams in the study of atomic physics, nuclear physics, and materials science has partially or wholly motivated the construction of a new generation of large electrostatic accelerators designed to operate at terminal potentials of 20 MV or above. In this paper, the author briefly discusses the status of these new accelerators and also discusses several recent technological advances which may be expected to further improve their performance. The paper is divided into four parts: (1) a discussion of the motivation for the construction of large electrostatic accelerators, (2) a description and discussion of several large electrostatic accelerators which have been recently completed or are under construction, (3) a description of several recent innovations which may be expected to improve the performance of large electrostatic accelerators in the future, and (4) a description of an innovative new large electrostatic accelerator whose construction is scheduled to begin next year. Due to time and space constraints, discussion is restricted to consideration of only tandem accelerators

CERN Accelerator School: Registration open for Advanced Accelerator Physics course

CERN Multimedia

2015-01-01

Registration is now open for the CERN Accelerator School’s Advanced Accelerator Physics course to be held in Warsaw, Poland from 27 September to 9 October 2015.   The course will be of interest to physicists and engineers who wish to extend their knowledge of accelerator physics. The programme offers core lectures on accelerator physics in the mornings and a practical course with hands-on tuition in the afternoons.  Further information can be found at: http://cas.web.cern.ch/cas/Poland2015/Warsaw-advert.html http://indico.cern.ch/event/361988/

CERN Accelerator School: Registration open for Advanced Accelerator Physics course

CERN Multimedia

2015-01-01

Registration is now open for the CERN Accelerator School’s Advanced Accelerator Physics course to be held in Warsaw, Poland from 27 September to 9 October 2015.   The course will be of interest to physicists and engineers who wish to extend their knowledge of Accelerator Physics. The programme offers core lectures on accelerator physics in the mornings and a practical course with hands-on tuition in the afternoons.  Further information can be found at: http://cas.web.cern.ch/cas/Poland2015/Warsaw-advert.html http://indico.cern.ch/event/361988/

Non-thermal electron acceleration in low Mach number collisionless shocks. II. Firehose-mediated Fermi acceleration and its dependence on pre-shock conditions

Energy Technology Data Exchange (ETDEWEB)

Guo, Xinyi; Narayan, Ramesh [Harvard-Smithsonian Center for Astrophysics, 60 Garden Street, Cambridge, MA 02138 (United States); Sironi, Lorenzo [NASA Einstein Postdoctoral Fellow. (United States)

2014-12-10

Electron acceleration to non-thermal energies is known to occur in low Mach number (M{sub s} ≲ 5) shocks in galaxy clusters and solar flares, but the electron acceleration mechanism remains poorly understood. Using two-dimensional (2D) particle-in-cell (PIC) plasma simulations, we showed in Paper I that electrons are efficiently accelerated in low Mach number (M{sub s} = 3) quasi-perpendicular shocks via a Fermi-like process. The electrons bounce between the upstream region and the shock front, with each reflection at the shock resulting in energy gain via shock drift acceleration. The upstream scattering is provided by oblique magnetic waves that are self-generated by the electrons escaping ahead of the shock. In the present work, we employ additional 2D PIC simulations to address the nature of the upstream oblique waves. We find that the waves are generated by the shock-reflected electrons via the firehose instability, which is driven by an anisotropy in the electron velocity distribution. We systematically explore how the efficiency of wave generation and of electron acceleration depend on the magnetic field obliquity, the flow magnetization (or equivalently, the plasma beta), and the upstream electron temperature. We find that the mechanism works for shocks with high plasma beta (≳ 20) at nearly all magnetic field obliquities, and for electron temperatures in the range relevant for galaxy clusters. Our findings offer a natural solution to the conflict between the bright radio synchrotron emission observed from the outskirts of galaxy clusters and the low electron acceleration efficiency usually expected in low Mach number shocks.

The Technique for the Numerical Tolerances Estimations in the Construction of Compensated Accelerating Structures

CERN Document Server

Paramonov, V V

2004-01-01

The requirements to the cells manufacturing precision and tining in the multi-cells accelerating structures construction came from the required accelerating field uniformity, based on the beam dynamics demands. The standard deviation of the field distribution depends on accelerating and coupling modes frequencies deviations, stop-band width and coupling coefficient deviations. These deviations can be determined from 3D fields distribution for accelerating and coupling modes and the cells surface displacements. With modern software it can be done separately for every specified part of the cell surface. Finally, the cell surface displacements are defined from the cell dimensions deviations. This technique allows both to define qualitatively the critical regions and to optimize quantitatively the tolerances definition.

Future Accelerators Seminar in Japan

Energy Technology Data Exchange (ETDEWEB)

Anon.

1984-10-15

ICFA, the International Committee for Future Accelerators, was set up by the Particles and Fields Commission of the International Union of Pure and Applied Physics (IUPAP) in 1976. Its mandate was 'To organize workshops for the study of problems related to an international super-high energy accelerator complex (VBA) and to elaborate the framework of its construction and of its use. To organize meetings for the exchange of information on future plans of regional facilities and for the formulation of advice on joint studies and uses.' In the seven years of its existence (it first met in August 1977), ICFA has organized three workshops on the first topic — t w o on 'Possibilities and Limitations of Accelerators and Detectors' (Fermilab, 1978 and Les Diablerets, 1979) and one on 'Possibilities and Limitations for Superconducting Accelerator Magnets' (Protvino, 1981). At an ICFA meeting at Fermilab in August 1983, it was realized that the second topic had been somewhat neglected. It was therefore decided to postpone a fourth workshop scheduled at the Japanese National Laboratory for High Energy Physics (KEK) and to organize instead a Seminar on 'Future Perspectives in High Energy Physics' similar to that held in New Orleans in 1975, which had in fact led to the creation of ICFA.The Seminar (jointly hosted by the Institute of Nuclear Study of Tokyo University and KEK, with support from the Ministry of Education, Science and Culture, the Yamada Science Foundation and the Nishina Memorial Foundation) took place from 14-20 May. There were about a hundred participants, mostly senior scientists from Western and Eastern Europe, USA, USSR and Japan (including the Directors of almost all the major high energy physics Laboratories) and representatives from Australia, Canada, China, India, Mexico, South Korea and Vietnam.

Future Accelerators Seminar in Japan

International Nuclear Information System (INIS)

Anon.

1984-01-01

ICFA, the International Committee for Future Accelerators, was set up by the Particles and Fields Commission of the International Union of Pure and Applied Physics (IUPAP) in 1976. Its mandate was 'To organize workshops for the study of problems related to an international super-high energy accelerator complex (VBA) and to elaborate the framework of its construction and of its use. To organize meetings for the exchange of information on future plans of regional facilities and for the formulation of advice on joint studies and uses.' In the seven years of its existence (it first met in August 1977), ICFA has organized three workshops on the first topic — t w o on 'Possibilities and Limitations of Accelerators and Detectors' (Fermilab, 1978 and Les Diablerets, 1979) and one on 'Possibilities and Limitations for Superconducting Accelerator Magnets' (Protvino, 1981). At an ICFA meeting at Fermilab in August 1983, it was realized that the second topic had been somewhat neglected. It was therefore decided to postpone a fourth workshop scheduled at the Japanese National Laboratory for High Energy Physics (KEK) and to organize instead a Seminar on 'Future Perspectives in High Energy Physics' similar to that held in New Orleans in 1975, which had in fact led to the creation of ICFA.The Seminar (jointly hosted by the Institute of Nuclear Study of Tokyo University and KEK, with support from the Ministry of Education, Science and Culture, the Yamada Science Foundation and the Nishina Memorial Foundation) took place from 14-20 May. There were about a hundred participants, mostly senior scientists from Western and Eastern Europe, USA, USSR and Japan (including the Directors of almost all the major high energy physics Laboratories) and representatives from Australia, Canada, China, India, Mexico, South Korea and Vietnam

Heavy ion accelerators

International Nuclear Information System (INIS)

Schmelzer, C.

1974-01-01

This review of the present state of work on heavy-ion accelerators pays particular attention to the requirements for nuclear research. It is divided into the following sections: single-particle versus collective acceleration, heavy-ion accelerators, beam quality, and a status report on the UNILAC facility. Among the topics considered are the recycling cyclotron, linacs with superconducting resonators, and acceleration to the GeV/nucleon range. (8 figures, 2 tables) (U.S.)

Accelerators at school

Energy Technology Data Exchange (ETDEWEB)

Anon.

1986-06-15

Latest subject covered by the CERN Accelerator School was 'Applied Geodesy of Particle Accelerators', which attracted an impressive number of outside participants to CERN for a week in April. Since the forerunners of today's particle accelerators were demonstrated over 50 years ago, the positioning of accelerator components has progressed from the laboratory bench-top to tunnels tens of kilometres long. Despite this phenomenal growth in size, sub-millimetre accuracy is still required.

Acceleration theorems

International Nuclear Information System (INIS)

Palmer, R.

1994-06-01

Electromagnetic fields can be separated into near and far components. Near fields are extensions of static fields. They do not radiate, and they fall off more rapidly from a source than far fields. Near fields can accelerate particles, but the ratio of acceleration to source fields at a distance R, is always less than R/λ or 1, whichever is smaller. Far fields can be represented as sums of plane parallel, transversely polarized waves that travel at the velocity of light. A single such wave in a vacuum cannot give continuous acceleration, and it is shown that no sums of such waves can give net first order acceleration. This theorem is proven in three different ways; each method showing a different aspect of the situation

Cosmic ray acceleration mechanisms

International Nuclear Information System (INIS)

Cesarsky, C.J.

1982-09-01

We present a brief summary of some of the most popular theories of cosmic ray acceleration: Fermi acceleration, its application to acceleration by shocks in a scattering medium, and impulsive acceleration by relativistic shocks

Using Supra-Arcade Downflows as Probes of Particle Acceleration in Solar Flares

Science.gov (United States)

Savage, Sabrina

2012-01-01

Extracting information from coronal features above flares has become more reliable with the availability of increasingly higher spatial- and temporal-resolution data in recent decades. We are now able to sufficiently probe the region high above long-duration flaring active regions where reconnection is expected to be continually occurring. Flows in the supra-arcade region, first observed with Yohkoh/SXT, have been theorized to be associated with newly-reconnected outflowing loops. High resolution data appears to confirm these assertions. Assuming that these flows are indeed reconnection outflows, then the detection of those directed toward the solar surface (i.e. downflowing) should be associated with particle acceleration between the current sheet and the loop footpoints rooted in the chromosphere. RHESSI observations of highly energetic particles with respect to downflow detections could potentially constrain electron acceleration models. We provide measurements of these supra-arcade downflows (SADs) in relation to reconnection model parameters and present preliminary findings comparing the downflow timings with high-energy RHESSI lightcurves.

Using Supra-Arcade Downflows as Probes of Electron Acceleration During Solar Flares

Science.gov (United States)

Savage, Sabrina L.

2011-01-01

Extracting information from coronal features above flares has become more reliable with the availability of increasingly higher spatial and temporal-resolution data in recent decades. We are now able to sufficiently probe the region high above long-duration flaring active regions where reconnection is expected to be continually occurring. Flows in the supra-arcade region, first observed with Yohkoh/SXT, have been theorized to be associated with newly-reconnected outflowing loops. High resolution data appears to confirm these assertions. Assuming that these flows are indeed reconnection outflows, then the detection of those directed toward the solar surface (i.e. downflowing) should be associated with particle acceleration between the current sheet and the loop footpoints rooted in the chromosphere. RHESSI observations of highly energetic particles with respect to downflow detections could potentially constrain electron acceleration models. I will discuss measurements of these supra-arcade downflows (SADs) in relation to reconnection model parameters and present preliminary findings comparing the downflow timings with high-energy RHESSI lightcurves.

FERMILAB ACCELERATOR R&D PROGRAM TOWARDS INTENSITY FRONTIER ACCELERATORS : STATUS AND PROGRESS

Energy Technology Data Exchange (ETDEWEB)

Shiltsev, Vladimir [Fermilab

2016-11-15

The 2014 P5 report indicated the accelerator-based neutrino and rare decay physics research as a centrepiece of the US domestic HEP program at Fermilab. Operation, upgrade and development of the accelerators for the near- term and longer-term particle physics program at the Intensity Frontier face formidable challenges. Here we discuss key elements of the accelerator physics and technology R&D program toward future multi-MW proton accelerators and present its status and progress. INTENSITY FRONTIER ACCELERATORS

Accelerators at school

International Nuclear Information System (INIS)

Anon.

1986-01-01

Latest subject covered by the CERN Accelerator School was 'Applied Geodesy of Particle Accelerators', which attracted an impressive number of outside participants to CERN for a week in April. Since the forerunners of today's particle accelerators were demonstrated over 50 years ago, the positioning of accelerator components has progressed from the laboratory bench-top to tunnels tens of kilometres long. Despite this phenomenal growth in size, sub-millimetre accuracy is still required

Particle beam accelerator

International Nuclear Information System (INIS)

Turner, N.L.

1982-01-01

A particle beam accelerator is described which has several electrodes that are selectively short circuited together synchronously with changes in the magnitude of a DC voltage applied to the accelerator. By this method a substantially constant voltage gradient is maintained along the length of the unshortened electrodes despite variations in the energy applied to the beam by the accelerator. The invention has particular application to accelerating ion beams that are implanted into semiconductor wafers. (U.K.)

Large electrostatic accelerators

International Nuclear Information System (INIS)

Jones, C.M.

1984-01-01

The paper is divided into four parts: a discussion of the motivation for the construction of large electrostatic accelerators, a description and discussion of several large electrostatic accelerators which have been recently completed or are under construction, a description of several recent innovations which may be expected to improve the performance of large electrostatic accelerators in the future, and a description of an innovative new large electrostatic accelerator whose construction is scheduled to begin next year

14 MV pelletron accelerator and superconducting ECR ion source

International Nuclear Information System (INIS)

Gupta, A.K.

2015-01-01

The BARC-TIFR 14UD Pelletron Accelerator at Mumbai has completed more than two and a half decade of successful operation. The accelerator is primarily used for basic research in the fields of nuclear, atomic and molecular, condensed matter physics and material science. The application areas include accelerator mass spectrometry, production of track-etch membranes, radioisotopes production, radiation damage studies and secondary neutron production for cross section measurement etc. Over the years, numerous developmental activities have been carried out in-house that have resulted in improving the overall performance and uptime of the accelerator and has also made possible to initiate variety of application oriented programmes. Since the SF 6 pressure vessels have been in operation for about 29 years, a comprehensive refurbishment and retrofitting work is carried out to comply with the safety recommendations. Recently, the beam trials were conducted with 18 GHz superconducting ECR (Electron Cyclotron Resonance) Ion Source system at Van-de-Graaff as per BARC Safety Council permission. Various ion beams with different charge states were extracted and mass analyzed and the beam quality was measured by recording their transverse emittance in situ. Experimental measurements pertaining to projectile X-rays Spectroscopy were carried out using variety of ion beams at variable energies. The superconducting Linac booster provides additional acceleration to the ions from Pelletron injector up to A ∼60 region with E∼5 MeV/A. In order to cover the entire mass range of the elements across the periodic table, an ECR based heavy ion accelerator was initiated under plan project. This heavy ion accelerator essentially comprises of a superconducting ECR ion source, room temperature RFQ (Radio Frequency Quadrupole) followed by superconducting Niobium resonators as accelerating elements. This talk will provide an overview of the developmental activities and the safety features

JAERI 20 MV tandem accelerator

International Nuclear Information System (INIS)

Tsukada, Kineo; Harada, Kichinosuke

1977-01-01

Accelerators have been developed as the experimental apparatuses for the studies on nuclei and elementary particles. One direction of the development is the acceleration of protons and electrons to more and more high energy, and another direction is the acceleration of heavy ions up to uranium to several MeV up to several hundreds MeV. However recently, accelerators are used as the useful tools for the studies in wider fields. There are electrostatic acceleration and high frequency acceleration in ion acceleration, and at present, super-large accelerators are high frequency acceleration type. In Japan Atomic Energy Research Institute, it was decided in 1975 to construct an electrostatic accelerator of tandem type in order to accelerate heavy ions. In case of the electrostatic acceleration, the construction is relatively simple, the acceleration of heavy ions is easy, the property of the ion beam is very good, and the energy is stable. Especially, the tandem type is convenient for obtaining high energy. The tandem accelerator of 20 MV terminal voltage was ordered from the National Electrostatics Corp., USA, and is expected to be completed in 1978. The significance of heavy ion acceleration in the development and research of atomic energy, tandem van de Graaff accelerators, the JAERI 20MV tandem accelerator, and the research project with this accelerator are described. (Kako, I.)

Treating electrostatics with Wolf summation in combined quantum mechanical and molecular mechanical simulations.

Science.gov (United States)

Ojeda-May, Pedro; Pu, Jingzhi

2015-11-07

The Wolf summation approach [D. Wolf et al., J. Chem. Phys. 110, 8254 (1999)], in the damped shifted force (DSF) formalism [C. J. Fennell and J. D. Gezelter, J. Chem. Phys. 124, 234104 (2006)], is extended for treating electrostatics in combined quantum mechanical and molecular mechanical (QM/MM) molecular dynamics simulations. In this development, we split the QM/MM electrostatic potential energy function into the conventional Coulomb r(-1) term and a term that contains the DSF contribution. The former is handled by the standard machinery of cutoff-based QM/MM simulations whereas the latter is incorporated into the QM/MM interaction Hamiltonian as a Fock matrix correction. We tested the resulting QM/MM-DSF method for two solution-phase reactions, i.e., the association of ammonium and chloride ions and a symmetric SN2 reaction in which a methyl group is exchanged between two chloride ions. The performance of the QM/MM-DSF method was assessed by comparing the potential of mean force (PMF) profiles with those from the QM/MM-Ewald and QM/MM-isotropic periodic sum (IPS) methods, both of which include long-range electrostatics explicitly. For ion association, the QM/MM-DSF method successfully eliminates the artificial free energy drift observed in the QM/MM-Cutoff simulations, in a remarkable agreement with the two long-range-containing methods. For the SN2 reaction, the free energy of activation obtained by the QM/MM-DSF method agrees well with both the QM/MM-Ewald and QM/MM-IPS results. The latter, however, requires a greater cutoff distance than QM/MM-DSF for a proper convergence of the PMF. Avoiding time-consuming lattice summation, the QM/MM-DSF method yields a 55% reduction in computational cost compared with the QM/MM-Ewald method. These results suggest that, in addition to QM/MM-IPS, the QM/MM-DSF method may serve as another efficient and accurate alternative to QM/MM-Ewald for treating electrostatics in condensed-phase simulations of chemical reactions.

An introduction to acceleration mechanisms

International Nuclear Information System (INIS)

Palmer, R.B.

1987-05-01

This paper discusses the acceleration of charged particles by electromagnetic fields, i.e., by fields that are produced by the motion of other charged particles driven by some power source. The mechanisms that are discussed include: Ponderamotive Forces, Acceleration, Plasma Beat Wave Acceleration, Inverse Free Electron Laser Acceleration, Inverse Cerenkov Acceleration, Gravity Acceleration, 2D Linac Acceleration and Conventional Iris Loaded Linac Structure Acceleration

Mechanisms of force production during linear accelerations in bluegill sunfish Lepomis macrochirus

Science.gov (United States)

Tytell, Eric D.; Wise, Tyler N.; Boden, Alexandra L.; Sanders, Erin K.; Schwalbe, Margot A. B.

2016-11-01

In nature, fish rarely swim steadily. Although unsteady behaviors are common, we know little about how fish change their swimming kinematics for routine accelerations, and how these changes affect the fluid dynamic forces and the wake produced. To study force production during acceleration, particle image velocimetry was used to quantify the wake of bluegill sunfish Lepomis macrochirus and to estimate the pressure field during linear accelerations and steady swimming. We separated "steady" and "unsteady" trials and quantified the forward acceleration using inertial measurement units. Compared to steady sequences, unsteady sequences had larger accelerations and higher body amplitudes. The wake consisted of single vortices shed during each tail movement (a '2S' wake). The structure did not change during acceleration, but the circulation of the vortices increased, resulting in larger forces. A fish swimming unsteadily produced significantly more force than the same fish swimming steadily, even when the accelerations were the same. This increase is likely due to increased added mass during unsteady swimming, as a result of the larger body amplitude. Pressure estimates suggest that the increase in force is correlated with more low pressure regions on the anterior body. This work was supported by ARO W911NF-14-1-0494 and NSF RCN-PLS 1062052.

CAS CERN Accelerator School second advanced accelerator physics course

International Nuclear Information System (INIS)

Turner, S.

1989-01-01

The advanced course on general accelerator physics given in West Berlin closely followed that organised by the CERN Accelerator School at Oxford in September 1985 and whose proceedings were published as CERN Yellow Report 87-03 (1987). However, certain subjects were treated in a different way, improved or extended, while some new ones were introduced and it is all of these which are included in the present proceedings. The lectures include particle-photon interactions, high-brilliance lattices and single/multiple Touschek effect, while the seminars are on the major accelerators presently under construction or proposed for the near future, applications of synchrotron radiation, free-electron lasers, cosmic accelerators and crystal beams. Also included are errata, and addenda to some of the lectures, of CERN 87-03. (orig.)

2014 CERN Accelerator Schools: Beam Loss and Accelerator Protection

CERN Multimedia

2014-01-01

The US-CERN-JAPAN-RUSSIA Joint International Accelerator School is organising a course on Beam Loss and Accelerator Protection to be held in Newport Beach, California, USA from 5-14 November, 2014.    This school is intended for physicists and engineers who are or may be engaged in the design, construction, and/or operation of accelerators with high power photon or particle beams and/or accelerator sub-systems with large stored energy. Application deadlines are 15 August and 4 September. Further information on this Joint School can be found at: http://cas.web.cern.ch/cas/JAS/Newport%20Beach%202014/NPBadvert.html http://indico.cern.ch/event/287647/ http://uspas.fnal.gov/programs/JAS/JAS14.shtml

Vp x B acceleration

International Nuclear Information System (INIS)

Sugihara, Ryo.

1987-05-01

A unique particle acceleration by an electrostatic (ES) wave, a magnetosonic shock wave as well as an electromagnetic (EM) wave is reviewed. The principle of the acceleration is that when a charged particle is carried across an external magnetic field the charge feels a DC field (the Lorentz force) and is accelerated. The theory for the ES wave acceleration is experimentally verified thought it is semi-quantitative. The shock acceleration is extensively studied theoretically and in a particle simulation method and the application is extended to phenomena in interplanetary space. The EM wave acceleration is based on a trapping in a moving neutral sheet created by the wave magnetic field and the external magnetic field, and the particle can be accelerated indefinitely. A brief sketch on a slow-wave-structure for this acceleration will be given. (author)

Acceleration of polarized proton in high energy accelerators

International Nuclear Information System (INIS)

Lee, S.Y.

1991-01-01

In low to medium energy accelerators, betatron tune jumps and vertical orbit harmonic correction methods have been used to overcome the intrinsic and imperfection resonances. At high energy accelerators, snakes are needed to preserve polarization. The author analyzes the effects of snake resonances, snake imperfections, and overlapping resonances on spin depolarization. He discusses also results of recent snake experiments at the IUCF Cooler Ring. The snake can overcome various kinds of spin depolarization resonances. These experiments pointed out further that partial snake can be used to cure the imperfection resonances in low to medium energy accelerators

Collective ion acceleration

International Nuclear Information System (INIS)

Godfrey, B.B.; Faehl, R.J.; Newberger, B.S.; Shanahan, W.R.; Thode, L.E.

1977-01-01

Progress achieved in the understanding and development of collective ion acceleration is presented. Extensive analytic and computational studies of slow cyclotron wave growth on an electron beam in a helix amplifier were performed. Research included precise determination of linear coupling between beam and helix, suppression of undesired transients and end effects, and two-dimensional simulations of wave growth in physically realizable systems. Electrostatic well depths produced exceed requirements for the Autoresonant Ion Acceleration feasibility experiment. Acceleration of test ions to modest energies in the troughs of such waves was also demonstrated. Smaller efforts were devoted to alternative acceleration mechanisms. Langmuir wave phase velocity in Converging Guide Acceleration was calculated as a function of the ratio of electron beam current to space-charge limiting current. A new collective acceleration approach, in which cyclotron wave phase velocity is varied by modulation of electron beam voltage, is proposed. Acceleration by traveling Virtual Cathode or Localized Pinch was considered, but appears less promising. In support of this research, fundamental investigations of beam propagation in evacuated waveguides, of nonneutral beam linear eigenmodes, and of beam stability were carried out. Several computer programs were developed or enhanced. Plans for future work are discussed

Accelerators for Medicine

CERN Multimedia

CERN. Geneva

2018-01-01

This lecture will review the different applications of particle accelerators to the medical field, from cancer treatment with beams of accelerator-produced particles (photons, electrons, protons, ions and neutrons) to the generation of radioactive isotopes used in medical diagnostics, in cancer therapy and in the new domain of theragnostics. For each application will be outlined the state of the art, the potential, and the accelerator challenges to be faced to meet the increasing demand for therapeutic procedures based on accelerators.

Accelerator mass spectrometry of heavy elements: /sup 36/Cl to /sup 205/Pb

Energy Technology Data Exchange (ETDEWEB)

Henning, W

1987-08-25

Measurements are discussed in which the technique of accelerator mass spectrometry was applied to problems involving heavy radioisotopes. These measurements, which depend on the ion energies that can be reached with the new heavy-ion accelerator facilities, were performed at the Argonne tandem linac accelerator system (ATLAS) and at the UNILAC accelerator at GSI. The topics include a discussion of measurements of long nuclear lifetimes, of radioisotope detection of interest to solar neutrino experiments, and of a determination of the /sup 41/Ca concentration in natural samples of terrestrial origin by making use of isotopic pre-enrichment in an isotope separator. A long-known method of isobar separation, employing a gas-filled magnetic field region, has been revived for some of these measurements and its characteristics and advantages are briefly reviewed.

Gyrokinetic electron acceleration in the force-free corona with anomalous resistivity

OpenAIRE

Arzner, Kaspar; Vlahos, Loukas

2006-01-01

We numerically explore electron acceleration and coronal heating by dissipative electric fields. Electrons are traced in linear force-free magnetic fields extrapolated from SOHO/MDI magnetograms, endowed with anomalous resistivity ($\\eta$) in localized dissipation regions where the magnetic twist $\

Status report of pelletron accelerator and ECR based heavy ion accelerator programme

International Nuclear Information System (INIS)

Gupta, A.K.

2015-01-01

The BARC-TIFR Pelletron Accelerator is completing twenty seven years of round-the-clock operation, serving diverse users from institutions within and outside DAE. Over the years, various developmental activities and application oriented programs have been initiated at Pelletron Accelerator Facility, resulting into enhanced utilization of the accelerator. We have also been pursuing an ECR based heavy ion accelerator programme under XII th Plan, consisting of an 18 GHz superconducting ECR (Electron Cyclotron Resonance) ion source and a room temperature RFQ (Radio Frequency Quadrupole) followed by low and high beta superconducting niobium resonator cavities. This talk will provide the current status of Pelletron Accelerator and the progress made towards the ECR based heavy ion accelerator program at BARC. (author)

COMPETITIVENESS IN REGIONAL DEVELOPMENT

Directory of Open Access Journals (Sweden)

ELENA MĂDĂLINA OPRIȚESCU

2012-12-01

Full Text Available The development and diversification of the economic activities, the stimulation of investments both in the public sector, but mainly in the private one, the reduction of unemployment, the improvement of living standards are just some of the concepts aimed at by the regional development. The main method which can lead to a balanced development of the regions is financing them differentially so that the underdeveloped regions would obtain proportionally more funds that the developed ones. At a region level, the main objective is represented by the more accelerated growth of the less developed regions, in an effort to diminish the inter-regional and intra-regional development disparities. A key role is played by the sustainable economic growth concept, while also analyzing the competitiveness at a regional level, as well as the main development factors.

[Quality management (TQM) in public health-care (PHC): principles for cost-performance calculations and cost reductions with better quality].

Science.gov (United States)

Bergholz, W

2008-11-01

In many high-tech industries, quality management (QM) has enabled improvements of quality by a factor of 100 or more, in combination with significant cost reductions. Compared to this, the application of QM methods in health care is in its initial stages. It is anticipated that stringent process management, embedded in an effective QM system will lead to significant improvements in health care in general and in the German public health service in particular. Process management is an ideal platform for controlling in the health care sector, and it will significantly improve the leverage of controlling to bring down costs. Best practice sharing in industry has led to quantum leap improvements. Process management will enable best practice sharing also in the public health service, in spite of the highly diverse portfolio of services that the public health service offers in different German regions. Finally, it is emphasised that "technical" QM, e.g., on the basis of the ISO 9001 standard is not sufficient to reach excellence. It is necessary to integrate soft factors, such as patient or employee satisfaction, and leadership quality into the system. The EFQM model for excellence can serve as proven tool to reach this goal.

Acceleration parameters for fluid physics with accelerating bodies

CSIR Research Space (South Africa)

Gledhill, Irvy MA

2016-06-01

Full Text Available to an acceleration parameter that appears to be new in fluid physics, but is known in cosmology. A selection of cases for rectilinear acceleration has been chosen to illustrate the point that this parameter alone does not govern regimes of flow about significantly...

Illinois Accelerator Research Center

Science.gov (United States)

Kroc, Thomas K.; Cooper, Charlie A.

The Illinois Accelerator Research Center (IARC) hosts a new accelerator development program at Fermi National Accelerator Laboratory. IARC provides access to Fermi's state-of-the-art facilities and technologies for research, development and industrialization of particle accelerator technology. In addition to facilitating access to available existing Fermi infrastructure, the IARC Campus has a dedicated 36,000 ft2 Heavy Assembly Building (HAB) with all the infrastructure needed to develop, commission and operate new accelerators. Connected to the HAB is a 47,000 ft2 Office, Technology and Engineering (OTE) building, paid for by the state, that has office, meeting, and light technical space. The OTE building, which contains the Accelerator Physics Center, and nearby Accelerator and Technical divisions provide IARC collaborators with unique access to world class expertise in a wide array of accelerator technologies. At IARC scientists and engineers from Fermilab and academia work side by side with industrial partners to develop breakthroughs in accelerator science and translate them into applications for the nation's health, wealth and security.

FFAGS for muon acceleration

International Nuclear Information System (INIS)

Berg, J. Scott; Kahn, Stephen; Palmer, Robert; Trbojevic, Dejan; Johnstone, Carol; Keil, Eberhard; Aiba, Masamitsu; Machida, Shinji; Mori, Yoshiharu; Ogitsu, Toru; Ohmori, Chihiro; Sessler, Andrew; Koscielniak, Shane

2003-01-01

Due to their finite lifetime, muons must be accelerated very rapidly. It is challenging to make the magnets ramp fast enough to accelerate in a synchrotron, and accelerating in a linac is very expensive. One can use a recirculating accelerator (like CEBAF), but one needs a different arc for each turn, and this limits the number of turns one can use to accelerate, and therefore requires significant amounts of RF to achieve the desired energy gain. An alternative method for muon acceleration is using a fixed field alternating gradient (FFAG) accelerator. Such an accelerator has a very large energy acceptance (a factor of two or three), allowing one to use the same arc with a magnetic field that is constant over time. Thus, one can in principle make as many turns as one can tolerate due to muon decay, therefore reducing the RF cost without increasing the arc cost. This paper reviews the current status of research into the design of FFAGs for muon acceleration. Several current designs are described and compared. General design considerations are also discussed

Accelerated degradation of the D2 protein of photosystem II under ultraviolet radiation

International Nuclear Information System (INIS)

Jansen, M.A.K.; Edelman, M.; Greenberg, B.M.; Gaba, V.

1996-01-01

The D2 protein of photosystem II is relatively stable in vivo under photosynthetic active radiation, but its degradation accelerates under UVB radiation. Little is known about accelerated D2 protein degradation. We characterized wavelength dependence and sensitivity toward photosystem II inhibitors. The in vivo D2 degradation spectrum resembles the pattern for the rapidly turning over D1 protein of photosystem II, with rates being maximal in the UVB region. We propose that D2 degradation, like D1 degradation, is activated by distinct photosensitizers in the UVB and visible regions of the spectrum. In both wavelength regions, photosystem II inhibitors that are known to be targeted to the D1 protein affect D2 degradation. This suggests that degradation of the two proteins is coupled, D2 degradation being influenced by events occurring at the Q B niche on the D1 protein. (Author)

The electron accelerator Ridgetron

International Nuclear Information System (INIS)

Hayashizaki, N.; Hattori, T.; Odera, M.; Fujisawa, T.

1999-01-01

Many electron accelerators of DC or RF type have been widely used for electron beam irradiation (curing, crosslinking of polymers, sterilization of medical disposables, preservation of food, etc.). Regardless of the acceleration energy, the accelerators to be installed in industrial facilities, have to satisfy the requires of compact size, low power consumption and stable operation. The DC accelerator is realized very compact in the energy under 300 keV, however, it is large to prevent the discharge of an acceleration column in the energy over 300 keV. The RF electron accelerator Ridgetron has been developed to accelerate the continuous beam of the 0.5-10 MeV range in compact space. It is the first example as an electron accelerator incorporated a ridged RF cavity. A prototype system of final energy of 2.5 MeV has been studied to confirm the feasibility at present

High brightness electron accelerator

International Nuclear Information System (INIS)

Sheffield, R.L.; Carlsten, B.E.; Young, L.M.

1994-01-01

A compact high brightness linear accelerator is provided for use, e.g., in a free electron laser. The accelerator has a first plurality of accelerating cavities having end walls with four coupling slots for accelerating electrons to high velocities in the absence of quadrupole fields. A second plurality of cavities receives the high velocity electrons for further acceleration, where each of the second cavities has end walls with two coupling slots for acceleration in the absence of dipole fields. The accelerator also includes a first cavity with an extended length to provide for phase matching the electron beam along the accelerating cavities. A solenoid is provided about the photocathode that emits the electrons, where the solenoid is configured to provide a substantially uniform magnetic field over the photocathode surface to minimize emittance of the electrons as the electrons enter the first cavity. 5 figs

Present-day status of the synchrophasotron as a nuclear accelerator

International Nuclear Information System (INIS)

Baldin, A.M.; Beznogikh, Yu.D.; Donets, E.D.; Issinsky, I.B.; Makarov, L.G.; Monchinsky, V.A.; Popov, V.A.; Semenyushkin, I.N.; Sikolenko, V.F.; Volkov, V.I.; Zinoviev, L.P.

1981-01-01

The accelerator has been adapted to a new region of research, that of relativistic nuclear physics. Most of the experiments performed with the Synchrophasotron pertain to particle energies of about 4 GeV/u, but some have been carried out at 4.2 Gev/u. 9 refs

Excited baryon program at the Bonn electron stretcher accelerator ELSA

International Nuclear Information System (INIS)

Menze, D.

1989-01-01

The Bonn electron stretcher accelerator ELSA is the first of a new generation of continuous beam machines in the GeV region. It is qualified for experiments with tagged photons and with polarized electrons on polarized nucleons to investigate the electromagnetic properties of excited baryon resonances

Fast neutron scintillation spectrometer in a heavy ion accelerator

International Nuclear Information System (INIS)

Blinov, M.V.; Gavrilov, B.P.; Ivannikova, L.L.; Kozulin, Eh.M.; Mozhaev, A.N.; Tyurin, G.P.

1984-01-01

Scintillation fast neutron spectrometer in a heavy ion accelerator is described in short. The spectrometer is used to measure characteristics of neutrons emitted in heavy ion interaction with different nuclei. Experiment was performed on the base of particle flight from 0.7 up to 2 m. Within the angle range of 0-150 deg. The technique is based on recording of two-dimensional neutron spectra obtained due to combination of the time-of-flight method and the method of recoil proton energy detection. Two measuring channels were used in the spectrometer. Each channel comprise both amplitude and time tracks. Detector on the base microchannel plates (MCP) generated a signal in passing the next ion bunch was used in order to obtain the time mark. Data from the scintillation block are recorded with respect to three parameters: recoil proton amplitude, time of neutron or γ-quantum arrival in respect of MCP-sensor pulse. Apparatus is carried out within the CAMAC standard. The spectrometer calibration within the 1-20 MeV neutron range was conducted in the Van-de-Graaf accelerator, and for higher energies - with the use of lightguides. Spectrometer time resolution for neutron energies of 0.5-50 MeV constituted 1.5-1.8 ns. The above measuring of neutron spectra from 1 /H2C+ 181 Ta and sup(20, 22)Ne+sup(181)Ta reaction have revealed a possibility of the experiment organization in heavy ion accelerators in the presence of strong neutron and γ-fields. Organization of multi-dimensional analysis combining two methods allows one to separate accelerator cycle, a region of the most reliable information, free of a low-energy gamma background and limited both by a dynamic threshold and a region of permissible energy values

Longitudinal differentiation in Melipona mandacaia (Hymenoptera, Meliponini) chromosomes.

Science.gov (United States)

Rocha, M P; Cruz, M P; Fernandes, A; Waldschmidt, A M; Silva-Júnior, J C; Pompolo, S G

2003-01-01

Melipona mandacaia is a stingless bee endemic to northeast Brasil. We describe the M. mandacaia karyotype using C-banding technique. fluorochrome staining and treatment with restriction enzymes and discuss the position of this species in the context of the phylogeny of the genus. Melipona mandacaia has 2n = 18 (14 SM + 2 M + 2 A). Heterochromatin was detected in the pericentromeric region of pairs 1, 2 and 8 and in the form of small blocks in the remaining pairs. Staining with base-specific fluorochromes showed that this heterochromatin was rich AT (QM and DAPI), except in the region corresponding to the NOR which was rich GC (CMA3) and was cleaved by the HaeIII enzyme. Melipona mandacaia is a member of Group I Melipona. Treatment with DraI/Giemsa discloses a larger number of bands than treatment with DraI/QM. Pre-cleavage with DraI gave rise to a larger number of bands following QM staining; a circumstance evidently due to a removal of the DNA-protein complex that prevented the association of the fluorochrome with AT-rich DNA. The results highlight the complex nature of heterochromatin.

THE COMPLETE, TEMPERATURE-RESOLVED EXPERIMENTAL SPECTRUM OF VINYL CYANIDE (H2CCHCN) BETWEEN 210 AND 270 GHz

International Nuclear Information System (INIS)

Fortman, Sarah M.; Neese, Christopher F.; De Lucia, Frank C.; Medvedev, Ivan R.

2011-01-01

The results of an experimental approach to the identification and characterization of the astrophysical weed vinyl cyanide in the 210-270 GHz region are reported. This approach is based on spectrally complete, intensity-calibrated spectra taken at more than 400 different temperatures in the 210-270 GHz region and is used to produce catalogs in the usual astrophysical format: line frequency, line strength, and lower state energy. As in our earlier study of ethyl cyanide, we also include the results of a frequency point-by-point analysis, which is especially well suited for characterizing weak lines and blended lines in crowded spectra. This study shows substantial incompleteness in the quantum-mechanical (QM) models used to calculate astrophysical catalogs, primarily due to their omission of many low-lying vibrational states of vinyl cyanide, but also due to the exclusion of perturbed rotational transitions. Unlike ethyl cyanide, the QM catalogs for vinyl cyanide include analyses of perturbed excited vibrational states, whose modeling is more challenging. Accordingly, we include an empirical study of the frequency accuracy of these QM models. We observe modest frequency differences for some vibrationally excited lines.

Analytic energy gradient of excited electronic state within TDDFT/MMpol framework: Benchmark tests and parallel implementation.

Science.gov (United States)

Zeng, Qiao; Liang, WanZhen

2015-10-07

The time-dependent density functional theory (TDDFT) has become the most popular method to calculate the electronic excitation energies, describe the excited-state properties, and perform the excited-state geometric optimization of medium and large-size molecules due to the implementation of analytic excited-state energy gradient and Hessian in many electronic structure software packages. To describe the molecules in condensed phase, one usually adopts the computationally efficient hybrid Quantum Mechanics/Molecular Mechanics (QM/MM) models. Here, we extend our previous work on the energy gradient of TDDFT/MM excited state to account for the mutual polarization effects between QM and MM regions, which is believed to hold a crucial position in the potential energy surface of molecular systems when the photoexcitation-induced charge rearrangement in the QM region is drastic. The implementation of a simple polarizable TDDFT/MM (TDDFT/MMpol) model in Q-Chem/CHARMM interface with both the linear response and the state-specific features has been realized. Several benchmark tests and preliminary applications are exhibited to confirm our implementation and assess the effects of different treatment of environmental polarization on the excited-state properties, and the efficiency of parallel implementation is demonstrated as well.

Body acceleration distribution and O2 uptake in humans during running and jumping

Science.gov (United States)

Bhattacharya, A.; Mccutcheon, E. P.; Shvartz, E.; Greenleaf, J. E.

1980-01-01

The distribution of body acceleration and associated oxygen uptake and heart rate responses are investigated in treadmill running and trampoline jumping. Accelerations in the +Gz direction were measured at the lateral ankle, lumbosacral region and forehead of eight young men during level treadmill walking and running at four speeds and trampoline jumping at four heights, together with corresponding oxygen uptake and heart rate. With increasing treadmill speed, peak acceleration at the ankle is found always to exceed that at the back and forehead, and acceleration profiles with higher frequency components than those observed during jumping are observed. Acceleration levels are found to be more uniformly distributed with increasing height in jumping, although comparable oxygen uptake and heat rates are obtained. Results indicate that the magnitude of the biomechanical stimuli is greater in trampoline jumping than in running, which finding could be of use in the design of procedures to avert deconditioning in persons exposed to weightlessness.

Multipactor Physics, Acceleration, and Breakdown in Dielectric-Loaded Accelerating Structures

International Nuclear Information System (INIS)

Fischer, Richard P.; Gold, Steven H.

2016-01-01

The objective of this 3-year program is to study the physics issues associated with rf acceleration in dielectric-loaded accelerating (DLA) structures, with a focus on the key issue of multipactor loading, which has been found to cause very significant rf power loss in DLA structures whenever the rf pulsewidth exceeds the multipactor risetime (~10 ns). The experiments are carried out in the X-band magnicon laboratory at the Naval Research Laboratory (NRL) in collaboration with Argonne National Laboratory (ANL) and Euclid Techlabs LLC, who develop the test structures with support from the DoE SBIR program. There are two main elements in the research program: (1) high-power tests of DLA structures using the magnicon output (20 MW @11.4 GHz), and (2) tests of electron acceleration in DLA structures using relativistic electrons from a compact X-band accelerator. The work during this period has focused on a study of the use of an axial magnetic field to suppress multipactor in DLA structures, with several new high power tests carried out at NRL, and on preparation of the accelerator for the electron acceleration experiments.

Charged particle accelerator

International Nuclear Information System (INIS)

Arakawa, Kazuo.

1969-01-01

An accelerator is disclosed having a device which permits the electrodes of an accelerator tube to be readily conditioned in an uncomplicated manner before commencing operation. In particle accelerators, it is necessary to condition the accelerator electrodes before a stable high voltage can be applied. Large current accelerators of the cockcroft-walton type require a complicated manual operation which entails applying to the electrodes a low voltage which is gradually increased to induce a vacuum discharge and then terminated. When the discharge attains an extremely low level, the voltage is again impressed and again raised to a high value in low current type accelerators, a high voltage power supply charges the electrodes once to induce discharge followed by reapplying the voltage when the vacuum discharge reaches a low level, according to which high voltage is automatically applied. This procedure, however, requires that the high voltage power supply be provided with a large internal resistance to limit the current to within several milliamps. The present invention connects a high voltage power supply and an accelerator tube through a discharge current limiting resistor wired in parallel with a switch. Initially, the switch is opened enabling the power supply to impress a voltage limited to a prescribed value by a suitably chosen resistor. Conditioning is effected by allowing the voltage between electrodes to increase and is followed by closing the switch through which high voltage is applied directly to the accelerator for operation. (K.J. Owens)

CAS CERN Accelerator School: Advanced accelerator physics. Proceedings. Vol. 2

International Nuclear Information System (INIS)

Turner, S.

1987-01-01

This advanced course on general accelerator physics is the second of the biennial series given by the CERN Accelerator School and follows on from the first basic course given at Gif-sur-Yvette, Paris, in 1984. Stress is placed on the mathematical tools of Hamiltonian mechanics and the Vlasov and Fokker-Planck equations, which are widely used in accelerator theory. The main topics treated in this present work include: nonlinear resonances, chromaticity, motion in longitudinal phase space, growth and control of longitudinal and transverse beam emittance, space-charge effects and polarization. The seminar programme treats some specific accelerator techniques, devices, projects and future possibilities. (orig.)

Electron accelerator

International Nuclear Information System (INIS)

Abramyan.

1981-01-01

The USSR produces an electron accelerator family of a simple design powered straight from the mains. The specifications are given of accelerators ELITA-400, ELITA-3, ELT-2, TEUS-3 and RIUS-5 with maximum electron energies of 0.3 to 5 MeV, a mean power of 10 to 70 kW operating in both the pulsed and the continuous (TEUS-3) modes. Pulsed accelerators ELITA-400 and ELITA-3 and RIUS-5 in which TESLA resonance transformers are used are characterized by their compact size. (Ha)

Future accelerators (?)

Energy Technology Data Exchange (ETDEWEB)

John Womersley

2003-08-21

I describe the future accelerator facilities that are currently foreseen for electroweak scale physics, neutrino physics, and nuclear structure. I will explore the physics justification for these machines, and suggest how the case for future accelerators can be made.

Laser-driven accelerators

International Nuclear Information System (INIS)

Anon.

1982-01-01

Several devices for using laser fields have been proposed and they can be classified in three broad categories - 'far-field' accelerators (such as the principle of inverse free electron lasers), 'media' accelerators (which, for example, use the inverse Cherenkov effect or laser-controlled plasma waves), and 'near-field' accelerators (using a loaded guiding structure such as cavities or gratings). These different approaches come from the fact that a particle cannot be accelerated by the absorption of single photons (because of momentum conservation) and thus some other element has to intervene. (orig./HSI).

Interacting with accelerators

International Nuclear Information System (INIS)

Dasgupta, S.

1994-01-01

Accelerators are research machines which produce energetic particle beam for use as projectiles to effect nuclear reactions. These machines along with their services and facilities may occupy very large areas. The man-machine interface of accelerators has evolved with technological changes in the computer industry and may be partitioned into three phases. The present paper traces the evolution of man-machine interface from the earliest accelerators to the present computerized systems incorporated in modern accelerators. It also discusses the advantages of incorporating expert system technology for assisting operators. (author). 8 ref

LIBO accelerates

CERN Multimedia

2002-01-01

The prototype module of LIBO, a linear accelerator project designed for cancer therapy, has passed its first proton-beam acceleration test. In parallel a new version - LIBO-30 - is being developed, which promises to open up even more interesting avenues.

Slow positron beam production by a 14 MeV C.W. electron accelerator

Science.gov (United States)

Begemann, M.; Gräff, G.; Herminghaus, H.; Kalinowsky, H.; Ley, R.

1982-10-01

A 14 MeV c.w. electron accelerator is used for pair production in a tungsten target of 0.7 radiation lengths thickness. A small fraction of the positrons is thermalized and diffuses out of the surface ofsurface of a well annealed tungsten foil coated with MgO which is positioned immediately behind the target. The slow positrons are extracted from the target region and magnetically guided over a distance of 10 m onto a channelplate multiplier at the end of an S-shaped solenoid. The positrons are identified by their annihilation radiation using two NaI-detectors. The intensity of the slow positrons is proportional to the accelerator electron beam current. The maximum intensity of 2.2 × 10 5 slow positrons per second reaching thedetector at an accelerator current of 15 μA was limited by the power deposited in the uncooled target. The energy of the positrons is concentrated in a small region at about 1 eV and clearly demonstrates the emission of thermal positrons.

Slow positron beam production by a 14 MeV c.w. electron accelerator

International Nuclear Information System (INIS)

Begemann, M.; Graeff, G.; Herminghaus, H.; Kalinowsky, H.; Ley, R.

1982-01-01

A 14 MeV c.w. electron accelerator is used for pair production in a tungsten target of 0.7 radiation lengths thickness. A small fraction of the positrons is thermalized and diffuses out of the surface of a well annealed tungsten foil coated with MgO which is positioned immediately behind the target. The slow positrons are extracted from the target region and magnetically guided over a distance of 10 m onto a channelplate multiplier at the end of an S-shaped solenoid. The positrons are identified by their annihilation radiation using two Nal-detectors. The intensity of the slow positrons is proportional to the accelerator electron beam current. The maximum intensity of 2.2 x 10 5 slow positrons per second reaching the detector at an accelerator current of 15 μA was limited by the power deposited in the uncooled target. The energy of the positrons is concentrated in a small region at about 1 eV and clearly demonstrates the emission of thermal positrons. (orig.)

2016 Accelerators meeting

International Nuclear Information System (INIS)

Spiro, Michel; Revol, Jean-Luc; Biarrotte, Jean-Luc; Napoly, Olivier; Jardin, Pascal; Chautard, Frederic; Thomas, Jean Charles; Petit, Eric

2016-09-01

The Accelerators meeting is organised every two years by the Accelerators division of the French Society of Physics (SFP). It brings together about 50 participants during a one-day meeting. The morning sessions are devoted to scientific presentations while the afternoon is dedicated to technical visits of facilities. This document brings together the available presentations (slides): 1 - Presentation of the Ganil - Grand accelerateur national d'ions lourds/Big national heavy-ion accelerator, Caen (Jardin, Pascal); 2 - Presentation of the Accelerators division of the French Society of Physics (Revol, Jean-Luc); 3 - Forward-looking and Prospective view (Napoly, Olivier); 4 - Accelerators at the National Institute of Nuclear and particle physics, situation, Forward-looking and Prospective view (Biarrotte, Jean-Luc); 5 - GANIL-SPIRAL2, missions and goals (Thomas, Jean Charles); 6 - The SPIRAL2 project (Petit, Eric)

Acceleration of radioactive ions

International Nuclear Information System (INIS)

Laxdal, R.E.

2003-01-01

There is an intense interest world-wide in the use of radioactive ion beams (RIBs) for experiment. In many existing or proposed facilities ions are produced or collected at source potential, ionized and re-accelerated. Within the past year three new ISOL based facilities have added dedicated post-accelerators to deliver accelerated RIBs to experiment. The paper gives an overview of RIB accelerators present and future, and explores the inherent features in the various acceleration methods with an emphasis on heavy ion linacs. The ISAC-I and ISAC-II post-accelerators are discussed as examples. Commissioning results and initial operating experience with ISAC-I will be presented

Far field acceleration

International Nuclear Information System (INIS)

Fernow, R.C.

1995-07-01

Far fields are propagating electromagnetic waves far from their source, boundary surfaces, and free charges. The general principles governing the acceleration of charged particles by far fields are reviewed. A survey of proposed field configurations is given. The two most important schemes, Inverse Cerenkov acceleration and Inverse free electron laser acceleration, are discussed in detail

Accelerating field step-up transformer in wake-field accelerators

International Nuclear Information System (INIS)

Chojnacki, E.; Gai, W.; Schoessow, P.; Simpson, J.

1991-01-01

In the wake-field scheme of particle acceleration, a short, intense drive bunch of electrons passes through a slow-wave structure, leaving behind high rf power in its wake field. The axial accelerating electric field associated with the rf can be quite large, > 100 MeV/m, and is used to accelerate a much less intense ''witness'' beam to eventual energies > 1 TeV. The rf power is deposited predominantly in the fundamental mode of the structure, which, for dielectric-lined waveguide as used at Argonne, is the TM 01 mode. In all likelihood on the field amplitude will be limited only by rf breakdown of the dielectric material, the limit of which is currently unknown in the short time duration, high frequency regime of wake-field acceleration operation. To obtain such strong electric fields with given wake-field rf power, the dimensions of the dielectric-lined waveguide have to be fairly small, OD of the order of a cm and ID of a few mm, and this gives rise to the generation of strong deflection modes with beam misalignment. While a scheme exists to damp such deflection modes on a bunch-to-bunch time scale, head-tail beam deflection could still be a problem and BNS damping as well as FODO focusing are incomplete cures. Presented here are details of a scheme by which the rf power is generated by in a large-diameter wake-field tube, where deflection mode generation by the intense drive beam is tolerable, and then fed into a small-diameter acceleration tube where the less intense witness beam is accelerated by the greatly enhanced axial electric field. The witness beam generates little deflection-mode power itself, even in the small acceleration tube, thus a final high-quality, high-energy electron beam is produced

A Molecular Dynamics (MD) and Quantum Mechanics/Molecular Mechanics (QM/MM) Study on Ornithine Cyclodeaminase (OCD): A Tale of Two Iminiums

Science.gov (United States)

Ion, Bogdan F.; Bushnell, Eric A. C.; De Luna, Phil; Gauld, James W.

2012-01-01

Ornithine cyclodeaminase (OCD) is an NAD+-dependent deaminase that is found in bacterial species such as Pseudomonas putida. Importantly, it catalyzes the direct conversion of the amino acid L-ornithine to L-proline. Using molecular dynamics (MD) and a hybrid quantum mechanics/molecular mechanics (QM/MM) method in the ONIOM formalism, the catalytic mechanism of OCD has been examined. The rate limiting step is calculated to be the initial step in the overall mechanism: hydride transfer from the L-ornithine’s Cα–H group to the NAD+ cofactor with concomitant formation of a Cα=NH2 + Schiff base with a barrier of 90.6 kJ mol−1. Importantly, no water is observed within the active site during the MD simulations suitably positioned to hydrolyze the Cα=NH2 + intermediate to form the corresponding carbonyl. Instead, the reaction proceeds via a non-hydrolytic mechanism involving direct nucleophilic attack of the δ-amine at the Cα-position. This is then followed by cleavage and loss of the α-NH2 group to give the Δ1-pyrroline-2-carboxylate that is subsequently reduced to L-proline. PMID:23202934

A Molecular Dynamics (MD and Quantum Mechanics/Molecular Mechanics (QM/MM Study on Ornithine Cyclodeaminase (OCD: A Tale of Two Iminiums

Directory of Open Access Journals (Sweden)

James W. Gauld

2012-10-01

Full Text Available Ornithine cyclodeaminase (OCD is an NAD+-dependent deaminase that is found in bacterial species such as Pseudomonas putida. Importantly, it catalyzes the direct conversion of the amino acid L-ornithine to L-proline. Using molecular dynamics (MD and a hybrid quantum mechanics/molecular mechanics (QM/MM method in the ONIOM formalism, the catalytic mechanism of OCD has been examined. The rate limiting step is calculated to be the initial step in the overall mechanism: hydride transfer from the L-ornithine’s Cα–H group to the NAD+ cofactor with concomitant formation of a Cα=NH2+ Schiff base with a barrier of 90.6 kJ mol−1. Importantly, no water is observed within the active site during the MD simulations suitably positioned to hydrolyze the Cα=NH2+ intermediate to form the corresponding carbonyl. Instead, the reaction proceeds via a non-hydrolytic mechanism involving direct nucleophilic attack of the δ-amine at the Cα-position. This is then followed by cleavage and loss of the α-NH2 group to give the Δ1-pyrroline-2-carboxylate that is subsequently reduced to L-proline.

APT accelerator technology

International Nuclear Information System (INIS)

Schneider, J. David

1996-01-01

The proposed accelerator production of tritium (APT) project requires an accelerator that provides a cw proton beam of 100 m A at 1300 MeV. Since the majority of the technical risk of a high-current cw (continuous-wave, 100% DF) accelerator resides in the low-energy section, Los Alamos is building a 20 MeV duplicate of the accelerator front end to confirm design codes, beam performance, and demonstrate operational reliability. We report on design details of this low-energy demonstration accelerator (LEDA) and discuss the integrated design of the full accelerator for the APT plant. LEDA's proton injector is under test and has produced more than 130 mA at 75 keV. Fabrication is proceeding on a 6.7- MeV, 8-meter-long RFQ, and detailed design is underway on coupled-cavity drift-tube linac (CCDTL) structures. In addition, detailed design and technology experiments are underway on medium-beta superconducting cavities to assess the feasibility of replacing the conventional (room-temperature copper) high-energy linac with a linac made of niobium superconducting RF cavities. (author)

Accelerators and Dinosaurs

CERN Multimedia

Turner, Michael Stanley

2003-01-01

Using naturally occuring particles on which to research might have made accelerators become extinct. But in fact, results from astrophysics have made accelerator physics even more important. Not only are accelerators used in hospitals but they are also being used to understand nature's inner workings by searching for Higgs bosons, CP violation, neutrino mass and dark matter (2 pages)

GYROSURFING ACCELERATION OF IONS IN FRONT OF EARTH's QUASI-PARALLEL BOW SHOCK

International Nuclear Information System (INIS)

Kis, Arpad; Lemperger, Istvan; Wesztergom, Viktor; Agapitov, Oleksiy; Krasnoselskikh, Vladimir; Khotyaintsev, Yuri V.; Dandouras, Iannis

2013-01-01

It is well known that shocks in space plasmas can accelerate particles to high energies. However, many details of the shock acceleration mechanism are still unknown. A critical element of shock acceleration is the injection problem; i.e., the presence of the so called seed particle population that is needed for the acceleration to work efficiently. In our case study, we present for the first time observational evidence of gyroresonant surfing acceleration in front of Earth's quasi-parallel bow shock resulting in the appearance of the long-suspected seed particle population. For our analysis, we use simultaneous multi-spacecraft measurements provided by the Cluster spacecraft ion (CIS), magnetic (FGM), and electric field and wave instrument (EFW) during a time period of large inter-spacecraft separation distance. The spacecraft were moving toward the bow shock and were situated in the foreshock region. The results show that the gyroresonance surfing acceleration takes place as a consequence of interaction between circularly polarized monochromatic (or quasi-monochromatic) transversal electromagnetic plasma waves and short large amplitude magnetic structures (SLAMSs). The magnetic mirror force of the SLAMS provides the resonant conditions for the ions trapped by the waves and results in the acceleration of ions. Since wave packets with circular polarization and different kinds of magnetic structures are very commonly observed in front of Earth's quasi-parallel bow shock, the gyroresonant surfing acceleration proves to be an important particle injection mechanism. We also show that seed ions are accelerated directly from the solar wind ion population.

Unlimited Energy Gain in the Laser-Driven Radiation Pressure Dominant Acceleration of Ions

OpenAIRE

Bulanov, S. V.; Echkina, E. Yu.; Esirkepov, T. Zh.; Inovenkov, I. N.; Kando, M.; Pegoraro, F.; Korn, G.

2009-01-01

The energy of the ions accelerated by an intense electromagnetic wave in the radiation pressure dominated regime can be greatly enhanced due to a transverse expansion of a thin target. The expansion decreases the number of accelerated ions in the irradiated region increasing the energy and the longitudinal velocity of remaining ions. In the relativistic limit, the ions become phase-locked with respect to the electromagnetic wave resulting in the unlimited ion energy gain. This effect and the ...

Accelerator business in Japan expanding

International Nuclear Information System (INIS)

Anon.

1992-01-01

Accelerators have become to be used increasingly in Japan in such fields as medicine, physics research and industry. This has caused stiff competition for market share by the manufacturers of accelerators. Electron beam accelerators for industrial use provide an indispensable means for adding values to products, for example, electric cables with incombustible insulators. Linear accelerators for the nondestructive inspection of nuclear components have been widely installed at equipment manufacturing plants. Active efforts have been exerted to develop small synchrotron radiation accelerators for next generation electronic industry. Cyclotrons for producing short life radioisotopes for medical diagnosis and electron beam accelerators for radiation therapy are also used routinely. The suppliers of accelerators include the companies manufacturing heavy electric machinery, heavy machinery and the engineering division of steelmakers. Accelerator physics is being formed, but universities do not yet offer the course regarding accelerators. Accelerator use in Japan and the trend of accelerator manufacturers are reported. (K.I.)

Acceleration of a trailing positron bunch in a plasma wakefield accelerator

International Nuclear Information System (INIS)

Doche, A.; Beekman, C.; Corde, S.

2017-01-01

High gradients of energy gain and high energy efficiency are necessary parameters for compact, cost-efficient and high-energy particle colliders. Plasma Wakefield Accelerators (PWFA) offer both, making them attractive candidates for next-generation colliders. Here in these devices, a charge-density plasma wave is excited by an ultra-relativistic bunch of charged particles (the drive bunch). The energy in the wave can be extracted by a second bunch (the trailing bunch), as this bunch propagates in the wake of the drive bunch. While a trailing electron bunch was accelerated in a plasma with more than a gigaelectronvolt of energy gain, accelerating a trailing positron bunch in a plasma is much more challenging as the plasma response can be asymmetric for positrons and electrons. We report the demonstration of the energy gain by a distinct trailing positron bunch in a plasma wakefield accelerator, spanning nonlinear to quasi-linear regimes, and unveil the beam loading process underlying the accelerator energy efficiency. A positron bunch is used to drive the plasma wake in the experiment, though the quasi-linear wake structure could as easily be formed by an electron bunch or a laser driver. Finally, the results thus mark the first acceleration of a distinct positron bunch in plasma-based particle accelerators.

Accelerator microanalysis

International Nuclear Information System (INIS)

Tuniz, C.

1997-01-01

Particle accelerators have been developed more than sixty years ago to investigate nuclear and atomic phenomena. A major shift toward applications of accelerators in the study of materials structure and composition in inter-disciplinary projects has been witnessed in the last two decades. The Australian Nuclear Science and Technology Organisation (ANSTO) has developed advanced research programs based on the use of particle and photon beams. Atmospheric pollution problems are investigated at the 3 MV Van de Graff accelerator using ion beam analysis techniques to detect toxic elements in aerosol particles. High temperature superconductor and semiconductor materials are characterised using the recoil of iodine and other heavy ions produced at ANTARES, the 10-MV Tandem accelerator. A heavy-ion microprobe is presently being developed at ANTARES to map elemental concentrations of specific elements with micro-size resolution. An Accelerator mass Spectrometry (AMS) system has been developed at ANSTO for the ultra-sensitive detection of Carbon-14, Iodine-129 and other long-lived radioisotopes. This AMS spectrometer is a key instrument for climate change studies and international safeguards. ANSTO is also managing the Australian Synchrotron Research program based on facilities developed at the Photon Factory (Japan) and at the Advanced Photon Source (USA). Advanced projects in biology, materials chemistry, structural condensed matter and other disciplines are being promoted by a consortium involving Australian universities and research institutions. This paper will review recent advances in the use of particle accelerators, with a particular emphasis on applications developed at ANSTO and related to problems of international concern, such as global environmental change, public health and nuclear proliferation

Fabrication and Characterization of Woodpile Structures for Direct Laser Acceleration

Energy Technology Data Exchange (ETDEWEB)

McGuinness, C.; Colby, E.; England, R.J.; Ng, J.; Noble, R.J.; /SLAC; Peralta, E.; Soong, K.; /Stanford U., Ginzton Lab.; Spencer, J.; Walz, D.; /SLAC; Byer, R.L.; /Stanford U., Ginzton Lab.

2010-08-26

An eight and nine layer three dimensional photonic crystal with a defect designed specifically for accelerator applications has been fabricated. The structures were fabricated using a combination of nanofabrication techniques, including low pressure chemical vapor deposition, optical lithography, and chemical mechanical polishing. Limits imposed by the optical lithography set the minimum feature size to 400 nm, corresponding to a structure with a bandgap centered at 4.26 {micro}m. Reflection spectroscopy reveal a peak in reflectivity about the predicted region, and good agreement with simulation is shown. The eight and nine layer structures will be aligned and bonded together to form the complete seventeen layer woodpile accelerator structure.

Accelerator-based BNCT.

Science.gov (United States)