WorldWideScience

Sample records for qm regions acceleration

  1. Systematic Quantum Mechanical Region Determination in QM/MM Simulation.

    Science.gov (United States)

    Karelina, Maria; Kulik, Heather J

    2017-02-14

    Hybrid quantum mechanical-molecular mechanical (QM/MM) simulations are widely used in enzyme simulation. Over ten convergence studies of QM/MM methods have revealed over the past several years that key energetic and structural properties approach asymptotic limits with only very large (ca. 500-1000 atom) QM regions. This slow convergence has been observed to be due in part to significant charge transfer between the core active site and the surrounding protein environment, which cannot be addressed by improvement of MM force fields or the embedding method employed within QM/MM. Given this slow convergence, it becomes essential to identify strategies for the most atom-economical determination of optimal QM regions and to gain insight into the crucial interactions captured only in large QM regions. Here, we extend and develop two methods for quantitative determination of QM regions. First, in the charge shift analysis (CSA) method, we probe the reorganization of electron density when core active site residues are removed completely, as determined by large-QM region QM/MM calculations. Second, we introduce the highly parallelizable Fukui shift analysis (FSA), which identifies how core/substrate frontier states are altered by the presence of an additional QM residue in smaller initial QM regions. We demonstrate that the FSA and CSA approaches are complementary and consistent on three test case enzymes: catechol O-methyltransferase, cytochrome P450cam, and hen eggwhite lysozyme. We also introduce validation strategies and test the sensitivities of the two methods to geometric structure, basis set size, and electronic structure methodology. Both methods represent promising approaches for the systematic, unbiased determination of quantum mechanical effects in enzymes and large systems that necessitate multiscale modeling.

  2. Condensed phase QM/MM simulations utilizing the exchange core functions to describe exchange repulsions at the QM boundary region

    International Nuclear Information System (INIS)

    Umino, Satoru; Takahashi, Hideaki; Morita, Akihiro

    2016-01-01

    In a recent work, we developed a method [H. Takahashi et al., J. Chem. Phys. 143, 084104 (2015)] referred to as exchange-core function (ECF) approach, to compute exchange repulsion E ex between solute and solvent in the framework of the quantum mechanical (QM)/molecular mechanical (MM) method. The ECF, represented with a Slater function, plays an essential role in determining E ex on the basis of the overlap model. In the work of Takahashi et al. [J. Chem. Phys. 143, 084104 (2015)], it was demonstrated that our approach is successful in computing the hydrogen bond energies of minimal QM/MM systems including a cationic QM solute. We provide in this paper the extension of the ECF approach to the free energy calculation in condensed phase QM/MM systems by combining the ECF and the QM/MM-ER approach [H. Takahashi et al., J. Chem. Phys. 121, 3989 (2004)]. By virtue of the theory of solutions in energy representation, the free energy contribution δμ ex from the exchange repulsion was naturally formulated. We found that the ECF approach in combination with QM/MM-ER gives a substantial improvement on the calculation of the hydration free energy of a hydronium ion. This can be attributed to the fact that the ECF reasonably realizes the contraction of the electron density of the cation due to the deficit of an electron.

  3. Condensed phase QM/MM simulations utilizing the exchange core functions to describe exchange repulsions at the QM boundary region

    Energy Technology Data Exchange (ETDEWEB)

    Umino, Satoru; Takahashi, Hideaki, E-mail: hideaki@m.tohoku.ac.jp; Morita, Akihiro [Department of Chemistry, Graduate School of Science, Tohoku University, Sendai, Miyagi 980-8578 (Japan)

    2016-08-28

    In a recent work, we developed a method [H. Takahashi et al., J. Chem. Phys. 143, 084104 (2015)] referred to as exchange-core function (ECF) approach, to compute exchange repulsion E{sub ex} between solute and solvent in the framework of the quantum mechanical (QM)/molecular mechanical (MM) method. The ECF, represented with a Slater function, plays an essential role in determining E{sub ex} on the basis of the overlap model. In the work of Takahashi et al. [J. Chem. Phys. 143, 084104 (2015)], it was demonstrated that our approach is successful in computing the hydrogen bond energies of minimal QM/MM systems including a cationic QM solute. We provide in this paper the extension of the ECF approach to the free energy calculation in condensed phase QM/MM systems by combining the ECF and the QM/MM-ER approach [H. Takahashi et al., J. Chem. Phys. 121, 3989 (2004)]. By virtue of the theory of solutions in energy representation, the free energy contribution δμ{sub ex} from the exchange repulsion was naturally formulated. We found that the ECF approach in combination with QM/MM-ER gives a substantial improvement on the calculation of the hydration free energy of a hydronium ion. This can be attributed to the fact that the ECF reasonably realizes the contraction of the electron density of the cation due to the deficit of an electron.

  4. Progresses in Ab Initio QM/MM Free Energy Simulations of Electrostatic Energies in Proteins: Accelerated QM/MM Studies of pKa, Redox Reactions and Solvation Free Energies

    Energy Technology Data Exchange (ETDEWEB)

    Kamerlin, Shina C. L.; Haranczyk, Maciej; Warshel, Arieh

    2009-03-01

    Hybrid quantum mechanical / molecular mechanical (QM/MM) approaches have been used to provide a general scheme for chemical reactions in proteins. However, such approaches still present a major challenge to computational chemists, not only because of the need for very large computer time in order to evaluate the QM energy but also because of the need for propercomputational sampling. This review focuses on the sampling issue in QM/MM evaluations of electrostatic energies in proteins. We chose this example since electrostatic energies play a major role in controlling the function of proteins and are key to the structure-function correlation of biological molecules. Thus, the correct treatment of electrostatics is essential for the accurate simulation of biological systems. Although we will be presenting here different types of QM/MM calculations of electrostatic energies (and related properties), our focus will be on pKa calculations. This reflects the fact that pKa of ionizable groups in proteins provide one of the most direct benchmarks for the accuracy of electrostatic models of macromolecules. While pKa calculations by semimacroscopic models have given reasonable results in many cases, existing attempts to perform pKa calculations using QM/MM-FEP have led to large discrepancies between calculated and experimental values. In this work, we accelerate our QM/MM calculations using an updated mean charge distribution and a classical reference potential. We examine both a surface residue (Asp3) of the bovine pancreatic trypsin inhibitor, as well as a residue buried in a hydrophobic pocket (Lys102) of the T4-lysozyme mutant. We demonstrate that by using this approach, we are able to reproduce the relevant sidechain pKas with an accuracy of 3 kcal/mol. This is well within the 7 kcal/mol energy difference observed in studies of enzymatic catalysis, and is thus sufficient accuracy to determine the main contributions to the catalytic energies of enzymes. We also provide an

  5. QM/MM hybrid calculation of biological macromolecules using a new interface program connecting QM and MM engines

    Energy Technology Data Exchange (ETDEWEB)

    Hagiwara, Yohsuke; Tateno, Masaru [Graduate School of Pure and Applied Sciences, University of Tsukuba, Tennodai 1-1-1, Tsukuba Science City, Ibaraki 305-8571 (Japan); Ohta, Takehiro [Center for Computational Sciences, University of Tsukuba, Tennodai 1-1-1, Tsukuba Science City, Ibaraki 305-8577 (Japan)], E-mail: tateno@ccs.tsukuba.ac.jp

    2009-02-11

    An interface program connecting a quantum mechanics (QM) calculation engine, GAMESS, and a molecular mechanics (MM) calculation engine, AMBER, has been developed for QM/MM hybrid calculations. A protein-DNA complex is used as a test system to investigate the following two types of QM/MM schemes. In a 'subtractive' scheme, electrostatic interactions between QM/MM regions are truncated in QM calculations; in an 'additive' scheme, long-range electrostatic interactions within a cut-off distance from QM regions are introduced into one-electron integration terms of a QM Hamiltonian. In these calculations, 338 atoms are assigned as QM atoms using Hartree-Fock (HF)/density functional theory (DFT) hybrid all-electron calculations. By comparing the results of the additive and subtractive schemes, it is found that electronic structures are perturbed significantly by the introduction of MM partial charges surrounding QM regions, suggesting that biological processes occurring in functional sites are modulated by the surrounding structures. This also indicates that the effects of long-range electrostatic interactions involved in the QM Hamiltonian are crucial for accurate descriptions of electronic structures of biological macromolecules.

  6. Structural analysis of recombinant human protein QM

    International Nuclear Information System (INIS)

    Gualberto, D.C.H.; Fernandes, J.L.; Silva, F.S.; Saraiva, K.W.; Affonso, R.; Pereira, L.M.; Silva, I.D.C.G.

    2012-01-01

    Full text: The ribosomal protein QM belongs to a family of ribosomal proteins, which is highly conserved from yeast to humans. The presence of the QM protein is necessary for joining the 60S and 40S subunits in a late step of the initiation of mRNA translation. Although the exact extra-ribosomal functions of QM are not yet fully understood, it has been identified as a putative tumor suppressor. This protein was reported to interact with the transcription factor c-Jun and thereby prevent c-Jun actives genes of the cellular growth. In this study, the human QM protein was expressed in bacterial system, in the soluble form and this structure was analyzed by Circular Dichroism and Fluorescence. The results of Circular Dichroism showed that this protein has less alpha helix than beta sheet, as described in the literature. QM protein does not contain a leucine zipper region; however the ion zinc is necessary for binding of QM to c-Jun. Then we analyzed the relationship between the removal of zinc ions and folding of protein. Preliminary results obtained by the technique Fluorescence showed a gradual increase in fluorescence with the addition of increasing concentration of EDTA. This suggests that the zinc is important in the tertiary structure of the protein. More studies are being made for better understand these results. (author)

  7. Southern California Regional Technology Acceleration Program

    Energy Technology Data Exchange (ETDEWEB)

    Ochoa, Rosibel [Univ. of California, San Diego, CA (United States). Jacobs School of Engineering; Rasochova, Lada [Univ. of California, San Diego, CA (United States). Rady School of Management

    2014-09-30

    UC San Diego and San Diego State University are partnering to address these deficiencies in the renewable energy space in the greater San Diego region, accelerating the movement of clean energy innovation from the university laboratory into the marketplace, building on the proven model of the William J. von Liebig Center’s (vLC’s) Proof of Concept (POC) program and virtualizing the effort to enable a more inclusive environment for energy innovation and expansion of the number of clean energy start-ups and/or technology licenses in greater California.

  8. The influence of zinc(II) on thioredoxin/glutathione disulfide exchange: QM/MM studies to explore how zinc(II) accelerates exchange in higher dielectric environments.

    Science.gov (United States)

    Kurian, Roby; Bruce, Mitchell R M; Bruce, Alice E; Amar, François G

    2015-08-01

    QM/MM studies were performed to explore the energetics of exchange reactions of glutathione disulfide (GSSG) and the active site of thioredoxin [Cys32-Gly33-Pro34-Cys35] with and without zinc(II), in vacuum and solvated models. The activation energy for exchange, in the absence of zinc, is 29.7 kcal mol(-1) for the solvated model. This is 3.3 kcal mol(-1) higher than the activation energy for exchange in the gas phase, due to ground state stabilization of the active site Cys-32 thiolate in a polar environment. In the presence of zinc, the activation energy for exchange is 4.9 kcal mol(-1) lower than in the absence of zinc (solvated models). The decrease in activation energy is attributed to stabilization of the charge-separated transition state, which has a 4-centered, cyclic arrangement of Zn-S-S-S with an estimated dipole moment of 4.2 D. A difference of 4.9 kcal mol(-1) in activation energy would translate to an increase in rate by a factor of about 4000 for zinc-assisted thiol-disulfide exchange. The calculations are consistent with previously reported experimental results, which indicate that metal-thiolate, disulfide exchange rates increase as a function of solvent dielectric. This trend is opposite to that observed for the influence of the dielectric environment on the rate of thiol-disulfide exchange in the absence of metal. The results suggest a dynamic role for zinc in thiol-disulfide exchange reactions, involving accessible cysteine sites on proteins, which may contribute to redox regulation and mechanistic pathways during oxidative stress.

  9. Quantum mechanics/coarse-grained molecular mechanics (QM/CG-MM).

    Science.gov (United States)

    Sinitskiy, Anton V; Voth, Gregory A

    2018-01-07

    Numerous molecular systems, including solutions, proteins, and composite materials, can be modeled using mixed-resolution representations, of which the quantum mechanics/molecular mechanics (QM/MM) approach has become the most widely used. However, the QM/MM approach often faces a number of challenges, including the high cost of repetitive QM computations, the slow sampling even for the MM part in those cases where a system under investigation has a complex dynamics, and a difficulty in providing a simple, qualitative interpretation of numerical results in terms of the influence of the molecular environment upon the active QM region. In this paper, we address these issues by combining QM/MM modeling with the methodology of "bottom-up" coarse-graining (CG) to provide the theoretical basis for a systematic quantum-mechanical/coarse-grained molecular mechanics (QM/CG-MM) mixed resolution approach. A derivation of the method is presented based on a combination of statistical mechanics and quantum mechanics, leading to an equation for the effective Hamiltonian of the QM part, a central concept in the QM/CG-MM theory. A detailed analysis of different contributions to the effective Hamiltonian from electrostatic, induction, dispersion, and exchange interactions between the QM part and the surroundings is provided, serving as a foundation for a potential hierarchy of QM/CG-MM methods varying in their accuracy and computational cost. A relationship of the QM/CG-MM methodology to other mixed resolution approaches is also discussed.

  10. Quantum mechanics/coarse-grained molecular mechanics (QM/CG-MM)

    Science.gov (United States)

    Sinitskiy, Anton V.; Voth, Gregory A.

    2018-01-01

    Numerous molecular systems, including solutions, proteins, and composite materials, can be modeled using mixed-resolution representations, of which the quantum mechanics/molecular mechanics (QM/MM) approach has become the most widely used. However, the QM/MM approach often faces a number of challenges, including the high cost of repetitive QM computations, the slow sampling even for the MM part in those cases where a system under investigation has a complex dynamics, and a difficulty in providing a simple, qualitative interpretation of numerical results in terms of the influence of the molecular environment upon the active QM region. In this paper, we address these issues by combining QM/MM modeling with the methodology of "bottom-up" coarse-graining (CG) to provide the theoretical basis for a systematic quantum-mechanical/coarse-grained molecular mechanics (QM/CG-MM) mixed resolution approach. A derivation of the method is presented based on a combination of statistical mechanics and quantum mechanics, leading to an equation for the effective Hamiltonian of the QM part, a central concept in the QM/CG-MM theory. A detailed analysis of different contributions to the effective Hamiltonian from electrostatic, induction, dispersion, and exchange interactions between the QM part and the surroundings is provided, serving as a foundation for a potential hierarchy of QM/CG-MM methods varying in their accuracy and computational cost. A relationship of the QM/CG-MM methodology to other mixed resolution approaches is also discussed.

  11. Cluster in the Auroral Acceleration Region

    Science.gov (United States)

    Pickett, Jolene S.; Fazakerley, Andrew N.; Marklund, Gorun; Dandouras, Iannis; Christopher, Ivar W.; Kistler, Lynn; Lucek, Elizabeth; Masson, Arnaud; Taylor, Matthew G.; Mutel, Robert L.; hide

    2010-01-01

    Due to a fortuitous evolution of the Cluster orbit, the Cluster spacecraft penetrated for the first time in its mission the heart of Earth's auroral acceleration region (AAR) in December 2009 and January 2010. During this time a special AAR campaign was carried out by the various Cluster instrument teams with special support from ESA and NASA facilities. We present some of the first multi-spacecraft observations of the waves, particles and fields made during that campaign. The Cluster spacecraft configuration during these AAR passages was such that it allowed us to explore the differences in the signatures of waves, particles, and fields on the various spacecraft in ways not possible with single spacecraft. For example, one spacecraft was more poleward than the other three (C2), one was at higher altitude (C1), and one of them (0) followed another (C4) through the AAR on approximately the same track but delayed by three minutes. Their separations were generally on the order of a few thousand km or less and occasionally two of them were lying along the same magnetic field line. We will show some of the first analyses of the data obtained during the AAR campaign, where upward and downward current regions, and the waves specifically associated with those regions, as well as the auroral cavities, were observed similarly and differently on the various spacecraft, helping us to explore the spatial, as well as the temporal, aspects of processes occurring in the AAR.

  12. Relative Free Energies for Hydration of Monovalent Ions from QM and QM/MM Simulations.

    Science.gov (United States)

    Lev, Bogdan; Roux, Benoît; Noskov, Sergei Yu

    2013-09-10

    Methods directly evaluating the hydration structure and thermodynamics of physiologically relevant cations (Na(+), K(+), Cl(-), etc.) have wide ranging applications in the fields of inorganic, physical, and biological chemistry. All-atom simulations based on accurate potential energy surfaces appear to offer a viable option for assessing the chemistry of ion solvation. Although MD and free energy simulations of ion solvation with classical force fields have proven their usefulness, a number of challenges still remain. One of them is the difficulty of force field benchmarking and validation against structural and thermodynamic data obtained for a condensed phase. Hybrid quantum mechanical/molecular mechanical (QM/MM) models combined with sampling algorithms have the potential to provide an accurate solvation model and to incorporate the effects from the surrounding, which is often missing in gas-phase ab initio computations. Herein, we report the results from QM/MM free energy simulations of Na(+)/K(+) and Cl(-)/Br(-) hydration where we simultaneously characterized the relative thermodynamics of ion solvation and changes in the solvation structure. The Flexible Inner Region Ensemble Separator (FIRES) method was used to impose a spatial separation between QM region and the outer sphere of solvent molecules treated with the CHARMM27 force field. FEP calculations based on QM/MM simulations utilizing the CHARMM/deMon2k interface were performed with different basis set combinations for K(+)/Na(+) and Cl(-)/Br(-) perturbations to establish the dependence of the computed free energies on the basis set level. The dependence of the computed relative free energies on the size of the QM and MM regions is discussed. The current methodology offers an accurate description of structural and thermodynamic aspects of the hydration of alkali and halide ions in neat solvents and can be used to obtain thermodynamic data on ion solvation in condensed phase along with underlying

  13. QM/MM free energy simulations: recent progress and challenges

    Science.gov (United States)

    Lu, Xiya; Fang, Dong; Ito, Shingo; Okamoto, Yuko; Ovchinnikov, Victor

    2016-01-01

    Due to the higher computational cost relative to pure molecular mechanical (MM) simulations, hybrid quantum mechanical/molecular mechanical (QM/MM) free energy simulations particularly require a careful consideration of balancing computational cost and accuracy. Here we review several recent developments in free energy methods most relevant to QM/MM simulations and discuss several topics motivated by these developments using simple but informative examples that involve processes in water. For chemical reactions, we highlight the value of invoking enhanced sampling technique (e.g., replica-exchange) in umbrella sampling calculations and the value of including collective environmental variables (e.g., hydration level) in metadynamics simulations; we also illustrate the sensitivity of string calculations, especially free energy along the path, to various parameters in the computation. Alchemical free energy simulations with a specific thermodynamic cycle are used to probe the effect of including the first solvation shell into the QM region when computing solvation free energies. For cases where high-level QM/MM potential functions are needed, we analyze two different approaches: the QM/MM-MFEP method of Yang and co-workers and perturbative correction to low-level QM/MM free energy results. For the examples analyzed here, both approaches seem productive although care needs to be exercised when analyzing the perturbative corrections. PMID:27563170

  14. Particle Acceleration in Multiple Dissipation Regions

    OpenAIRE

    Arzner, Kaspar; Vlahos, Loukas

    2004-01-01

    The sharp magnetic discontinuities which naturally appear in solar magnetic flux tubes driven by turbulent photospheric motions are associated with intense currents. \\citet{Par83} proposed that these currents can become unstable to a variety of microscopic processes, with the net result of dramatically enhanced resistivity and heating (nanoflares). The electric fields associated with such ``hot spots'' are also expected to enhance particle acceleration. We test this hypothesis by exact relati...

  15. A simple and effective solution to the constrained QM/MM simulations

    Science.gov (United States)

    Takahashi, Hideaki; Kambe, Hiroyuki; Morita, Akihiro

    2018-04-01

    It is a promising extension of the quantum mechanical/molecular mechanical (QM/MM) approach to incorporate the solvent molecules surrounding the QM solute into the QM region to ensure the adequate description of the electronic polarization of the solute. However, the solvent molecules in the QM region inevitably diffuse into the MM bulk during the QM/MM simulation. In this article, we developed a simple and efficient method, referred to as the "boundary constraint with correction (BCC)," to prevent the diffusion of the solvent water molecules by means of a constraint potential. The point of the BCC method is to compensate the error in a statistical property due to the bias potential by adding a correction term obtained through a set of QM/MM simulations. The BCC method is designed so that the effect of the bias potential completely vanishes when the QM solvent is identical with the MM solvent. Furthermore, the desirable conditions, that is, the continuities of energy and force and the conservations of energy and momentum, are fulfilled in principle. We applied the QM/MM-BCC method to a hydronium ion(H3O+) in aqueous solution to construct the radial distribution function (RDF) of the solvent around the solute. It was demonstrated that the correction term fairly compensated the error and led the RDF in good agreement with the result given by an ab initio molecular dynamics simulation.

  16. Current-voltage relationship in the auroral particle acceleration region

    Directory of Open Access Journals (Sweden)

    M. Morooka

    2004-11-01

    Full Text Available The current-voltage relationship in the auroral particle acceleration region has been studied statistically by the Akebono (EXOS-D satellite in terms of the charge carriers of the upward field-aligned current. The Akebono satellite often observed field-aligned currents which were significantly larger than the model value predicted by Knight (1973. We compared the upward field-aligned current estimated by three different methods, and found that low-energy electrons often play an important role as additional current carriers, together with the high-energy primary electrons which are expected from Knight's relation. Such additional currents have been observed especially at high and middle altitudes of the particle acceleration region. Some particular features of electron distribution functions, such as "cylindrical distribution functions" and "electron conics", have often been observed coinciding with the additional currents. They indicated time variability of the particle acceleration region. Therefore, we have concluded that the low-energy electrons within the "forbidden" region of electron phase space in the stationary model often contribute to charge carriers of the current because of the rapid time variability of the particle acceleration region. "Cylindrical distribution functions" are expected to be found below the time-varying potential difference. We statistically examined the locations of "cylindrical distribution function", and found that their altitudes are related to the location where the additional currents have been observed. This result is consistent with the idea that the low-energy electrons can also carry significant current when the acceleration region changes in time.

  17. Seismic acceleration map expected for Japanese central region

    International Nuclear Information System (INIS)

    Sugiyama, Takeshi; Maeda, Kouji; Ishii, Kiyoshi; Suzuki, Makoto.

    1990-01-01

    Since electric generating and supplying facilities scatter in large areas, the seismic acceleration map, which defines the anticipated earthquake ground motions in a broad region, is very useful information for the design of those facilities against large earthquakes. This paper describes the development of a seismic acceleration map for the Central Japanese Region by incorporating the analytical results based on historical earthquake records and active fault data using probability and statistics. In the region, there have occurred several destructive earthquakes; Anseitokai (1854, M = 8.4) and Tohnankai (1944, M = 7.9) earthquakes along the Nankai trough; Nohbi (1891, M = 8.0) and Fukui (1948, M = 7.1) earthquakes in inland ares. Some of the historical earthquake data were obtained by instrument last one hundred years, whereas others by literary descriptions for nearly 1,000 years. The active fault data, have been collected mainly from the surveys of fault topography and geology, and are considered to indicate the average seismic activity for the past million years. A proposed seismic acceleration map for the return period of 75 years, calculated on the free surface of base stratum, was estimated by the following way. The analytical result based on the historical earthquake records was adopted mainly, because the Japanese seismic design criteria have been developed based on them. The proposed seismic acceleration map was revised by including the result based on the active fault data for the areas, where historical earthquake records lack, and the result was smoothed to evaluate the final seismic acceleration map. (author)

  18. Efficient approach to obtain free energy gradient using QM/MM MD simulation

    International Nuclear Information System (INIS)

    Asada, Toshio; Koseki, Shiro; Ando, Kanta

    2015-01-01

    The efficient computational approach denoted as charge and atom dipole response kernel (CDRK) model to consider polarization effects of the quantum mechanical (QM) region is described using the charge response and the atom dipole response kernels for free energy gradient (FEG) calculations in the quantum mechanical/molecular mechanical (QM/MM) method. CDRK model can reasonably reproduce energies and also energy gradients of QM and MM atoms obtained by expensive QM/MM calculations in a drastically reduced computational time. This model is applied on the acylation reaction in hydrated trypsin-BPTI complex to optimize the reaction path on the free energy surface by means of FEG and the nudged elastic band (NEB) method

  19. Regional strategies for the accelerating global problem of groundwater depletion

    Science.gov (United States)

    Aeschbach-Hertig, Werner; Gleeson, Tom

    2012-12-01

    Groundwater--the world's largest freshwater resource--is critically important for irrigated agriculture and hence for global food security. Yet depletion is widespread in large groundwater systems in both semi-arid and humid regions of the world. Excessive extraction for irrigation where groundwater is slowly renewed is the main cause of the depletion, and climate change has the potential to exacerbate the problem in some regions. Globally aggregated groundwater depletion contributes to sea-level rise, and has accelerated markedly since the mid-twentieth century. But its impacts on water resources are more obvious at the regional scale, for example in agriculturally important parts of India, China and the United States. Food production in such regions can only be made sustainable in the long term if groundwater levels are stabilized. To this end, a transformation is required in how we value, manage and characterize groundwater systems. Technical approaches--such as water diversion, artificial groundwater recharge and efficient irrigation--have failed to balance regional groundwater budgets. They need to be complemented by more comprehensive strategies that are adapted to the specific social, economic, political and environmental settings of each region.

  20. Generation of auroral kilometric radiation and the structure of auroral acceleration region

    International Nuclear Information System (INIS)

    Lee, L.C.; Kan, J.R.; Wu, C.S.

    1980-01-01

    Generation of auroral kilometric radiation (AKR) in the auroral acceleration region is studied. It is shown that auroral kilometric radiation can be generated by the backscattered electrons trapped in the acceleration region via a cyclotron maser process. The parallel electric field in the acceleration region is required to be distributed over 1-2 Rsub(E). The observed AKR frequency spectrum can be used to estimate the altitude range of the auroral acceleration region. The altitudes of the lower and upper boundaries of the acceleration region determined from the AKR data are respectively approximately 2000 and approximately 9000 km. (author)

  1. QM/MM and classical molecular dynamics simulation of histidine-tagged peptide immobilization on nickel surface

    Energy Technology Data Exchange (ETDEWEB)

    Yang Zhenyu [State Key Laboratory of Nonlinear Mechanics (LNM), Institute of Mechanics, Chinese Academy of Sciences, Beijing 100080(China); Zhao Yapu [State Key Laboratory of Nonlinear Mechanics (LNM), Institute of Mechanics, Chinese Academy of Sciences, Beijing 100080 (China)]. E-mail: yzhao@lnm.imech.ac.cn

    2006-05-15

    The hybrid quantum mechanics (QM) and molecular mechanics (MM) method is employed to simulate the His-tagged peptide adsorption to ionized region of nickel surface. Based on the previous experiments, the peptide interaction with one Ni ion is considered. In the QM/MM calculation, the imidazoles on the side chain of the peptide and the metal ion with several neighboring water molecules are treated as QM part calculated by 'GAMESS', and the rest atoms are treated as MM part calculated by 'TINKER'. The integrated molecular orbital/molecular mechanics (IMOMM) method is used to deal with the QM part with the transitional metal. By using the QM/MM method, we optimize the structure of the synthetic peptide chelating with a Ni ion. Different chelate structures are considered. The geometry parameters of the QM subsystem we obtained by QM/MM calculation are consistent with the available experimental results. We also perform a classical molecular dynamics (MD) simulation with the experimental parameters for the synthetic peptide adsorption on a neutral Ni(1 0 0) surface. We find that half of the His-tags are almost parallel with the substrate, which enhance the binding strength. Peeling of the peptide from the Ni substrate is simulated in the aqueous solvent and in vacuum, respectively. The critical peeling forces in the two environments are obtained. The results show that the imidazole rings are attached to the substrate more tightly than other bases in this peptide.

  2. 76 FR 23543 - The Jobs and Innovation Accelerator Challenge; a Coordinated Initiative To Advance Regional...

    Science.gov (United States)

    2011-04-27

    ... Jobs and Innovation Accelerator Challenge; a Coordinated Initiative To Advance Regional Competitiveness... Federal resources to support regional innovation and sustainable economic prosperity. Knowing that regional innovation clusters provide a globally proven approach for developing economic prosperity, this...

  3. Accelerating transition dynamics in city regions: A qualitative modeling perspective

    NARCIS (Netherlands)

    P.J. Valkering (Pieter); Yücel, G. (Gönenç); Gebetsroither-Geringer, E. (Ernst); Markvica, K. (Karin); Meynaerts, E. (Erika); N. Frantzeskaki (Niki)

    2017-01-01

    textabstractIn this article, we take stock of the findings from conceptual and empirical work on the role of transition initiatives for accelerating transitions as input for modeling acceleration dynamics. We applied the qualitative modeling approach of causal loop diagrams to capture the dynamics

  4. Ion acceleration at the earth's bow shock: A review of observations in the upstream region

    International Nuclear Information System (INIS)

    Gosling, J.T.; Asbridge, J.R.; Bame, S.J.; Feldman, W.C.

    1979-01-01

    Positive ions are accelerated at or near the earth's bow shock and propagate into the upstream region. Two distinctly different population of these ions, distinguished by their greatly different spectral and angular widths, can be identified there. The type of ion population observed in the upstream region is strongly correlated with the presence or absence of long-period compresive waves in the solar wind. Very few ions are accelerated in the vicinity of the shock to energies much above about 100 keV. It is not yet clear whether the most energetic ions (i.e. those near 100 keV) are accelerated at the shock or in the broad disturbed region upstream from the shock. In either case stochastic acceleration by turbulent electrostatic fields seems to be the most viable candidate for the acceleration of the most energetic particles

  5. Ion acceleration at the earth's bow shock: a review of observations in the upstream region

    International Nuclear Information System (INIS)

    Gosling, J.T.; Asbridge, J.R.; Bame, S.J.; Feldman, W.C.

    1979-01-01

    Positive ions are accelerated at or near the earth's bow shock and propagate into the upstream region. Two distinctly different populations of these ions, distinguished by their greatly different spectral and angular widths, can be identified there. The type of ion population observed in the upstream region is strongly correlated with the presence or absence of long-period compressive waves in the solar wind. Very few ions are accelerated in the vicinity of the shock to energies much above about 100 keV. It is not yet clear whether the most energetic ions (i.e., those near 100 keV) are accelerated at the shock or in broad disturbed region upstream from the shock. In either case stochastic acceleration by turbulent electrostatic fields seems to be the most viable candidate for the acceleration of the most energetic particles

  6. Derivation of Reliable Geometries in QM Calculations of DNA Structures: Explicit Solvent QM/MM and Restrained Implicit Solvent QM Optimizations of G-Quadruplexes.

    Science.gov (United States)

    Gkionis, Konstantinos; Kruse, Holger; Šponer, Jiří

    2016-04-12

    Modern dispersion-corrected DFT methods have made it possible to perform reliable QM studies on complete nucleic acid (NA) building blocks having hundreds of atoms. Such calculations, although still limited to investigations of potential energy surfaces, enhance the portfolio of computational methods applicable to NAs and offer considerably more accurate intrinsic descriptions of NAs than standard MM. However, in practice such calculations are hampered by the use of implicit solvent environments and truncation of the systems. Conventional QM optimizations are spoiled by spurious intramolecular interactions and severe structural deformations. Here we compare two approaches designed to suppress such artifacts: partially restrained continuum solvent QM and explicit solvent QM/MM optimizations. We report geometry relaxations of a set of diverse double-quartet guanine quadruplex (GQ) DNA stems. Both methods provide neat structures without major artifacts. However, each one also has distinct weaknesses. In restrained optimizations, all errors in the target geometries (i.e., low-resolution X-ray and NMR structures) are transferred to the optimized geometries. In QM/MM, the initial solvent configuration causes some heterogeneity in the geometries. Nevertheless, both approaches represent a decisive step forward compared to conventional optimizations. We refine earlier computations that revealed sizable differences in the relative energies of GQ stems computed with AMBER MM and QM. We also explore the dependence of the QM/MM results on the applied computational protocol.

  7. Multiple environment single system quantum mechanical/molecular mechanical (MESS-QM/MM) calculations. 1. Estimation of polarization energies.

    Science.gov (United States)

    Sodt, Alexander J; Mei, Ye; König, Gerhard; Tao, Peng; Steele, Ryan P; Brooks, Bernard R; Shao, Yihan

    2015-03-05

    In combined quantum mechanical/molecular mechanical (QM/MM) free energy calculations, it is often advantageous to have a frozen geometry for the quantum mechanical (QM) region. For such multiple-environment single-system (MESS) cases, two schemes are proposed here for estimating the polarization energy: the first scheme, termed MESS-E, involves a Roothaan step extrapolation of the self-consistent field (SCF) energy; whereas the other scheme, termed MESS-H, employs a Newton-Raphson correction using an approximate inverse electronic Hessian of the QM region (which is constructed only once). Both schemes are extremely efficient, because the expensive Fock updates and SCF iterations in standard QM/MM calculations are completely avoided at each configuration. They produce reasonably accurate QM/MM polarization energies: MESS-E can predict the polarization energy within 0.25 kcal/mol in terms of the mean signed error for two of our test cases, solvated methanol and solvated β-alanine, using the M06-2X or ωB97X-D functionals; MESS-H can reproduce the polarization energy within 0.2 kcal/mol for these two cases and for the oxyluciferin-luciferase complex, if the approximate inverse electronic Hessians are constructed with sufficient accuracy.

  8. Accelerators

    CERN Multimedia

    CERN. Geneva

    2001-01-01

    The talk summarizes the principles of particle acceleration and addresses problems related to storage rings like LEP and LHC. Special emphasis will be given to orbit stability, long term stability of the particle motion, collective effects and synchrotron radiation.

  9. Nonlinear radiation generation processes in the auroral acceleration region

    Directory of Open Access Journals (Sweden)

    R. Pottelette

    2017-11-01

    Full Text Available It is known from laboratory plasma experiments that double layers (DLs radiate in the electromagnetic spectrum; but this is only known qualitatively. In these experiments, it was shown that the electron beam created on the high-potential side of a DL generates nonlinear structures which couple to electromagnetic waves and act as a sender antenna. In the Earth auroral region, observations performed by auroral spacecraft have shown that DLs occur naturally in the source region of intense radio emissions called auroral kilometric radiation (AKR. Very high time-, spatial-, and temporal-resolution measurements are needed in order to characterize waves and particle distributions in the vicinity of DLs, which are moving transient structures. We report observations from the FAST satellite of a localized large-amplitude parallel electric field (∼ 300 mV m−1 recorded at the edges of the auroral density cavity. In agreement with laboratory experiments, on the high-potential side of the DL, elementary radiation events are detected. They occur substantially above the local electron gyrofrequency and are associated with the presence of electron holes. The velocity of these nonlinear structures can be derived from the measurement of the Doppler-shifted AKR frequency spectrum above the electron gyrofrequency. The generated electron holes appear as the nonlinear evolution of electrostatic waves generated by the electron–electron two-stream instability because they propagate at about half the beam velocity. It is pointed out that, in the vicinity of a DL, the shape of the electron distribution gives rise to a significant power recorded in the left-hand polarized ordinary (LO mode.

  10. QM Automata: A New Class of Restricted Quantum Membrane Automata.

    Science.gov (United States)

    Giannakis, Konstantinos; Singh, Alexandros; Kastampolidou, Kalliopi; Papalitsas, Christos; Andronikos, Theodore

    2017-01-01

    The term "Unconventional Computing" describes the use of non-standard methods and models in computing. It is a recently established field, with many interesting and promising results. In this work we combine notions from quantum computing with aspects of membrane computing to define what we call QM automata. Specifically, we introduce a variant of quantum membrane automata that operate in accordance with the principles of quantum computing. We explore the functionality and capabilities of the QM automata through indicative examples. Finally we suggest future directions for research on QM automata.

  11. Economic impact of accelerated cleanup on regions surrounding the US DOE's major nuclear weapons sites

    International Nuclear Information System (INIS)

    Greenberg, M.; Solitare, L.; Frisch, M.; Lowrie, K.

    1999-01-01

    The regional economic impacts of the US Department of Energy's accelerated environmental cleanup plan are estimated for the major nuclear weapons sites in Colorado, Idaho, New Mexico, South Carolina, Tennessee, and Washington. The analysis shows that the impact falls heavily on the three relatively rural regions around the Savannah River (SC), Hanford (WA), and Idaho National Engineering and Environmental Laboratory (ID) sites. A less aggressive phase-down of environmental management funds and separate funds to invest in education and infrastructure in the regions helps buffer the impacts on jobs, personal income, and gross regional product. Policy options open to the federal and state and local governments are discussed

  12. QM/MM investigations of organic chemistry oriented questions.

    Science.gov (United States)

    Schmidt, Thomas C; Paasche, Alexander; Grebner, Christoph; Ansorg, Kay; Becker, Johannes; Lee, Wook; Engels, Bernd

    2014-01-01

    About 35 years after its first suggestion, QM/MM became the standard theoretical approach to investigate enzymatic structures and processes. The success is due to the ability of QM/MM to provide an accurate atomistic picture of enzymes and related processes. This picture can even be turned into a movie if nuclei-dynamics is taken into account to describe enzymatic processes. In the field of organic chemistry, QM/MM methods are used to a much lesser extent although almost all relevant processes happen in condensed matter or are influenced by complicated interactions between substrate and catalyst. There is less importance for theoretical organic chemistry since the influence of nonpolar solvents is rather weak and the effect of polar solvents can often be accurately described by continuum approaches. Catalytic processes (homogeneous and heterogeneous) can often be reduced to truncated model systems, which are so small that pure quantum-mechanical approaches can be employed. However, since QM/MM becomes more and more efficient due to the success in software and hardware developments, it is more and more used in theoretical organic chemistry to study effects which result from the molecular nature of the environment. It is shown by many examples discussed in this review that the influence can be tremendous, even for nonpolar reactions. The importance of environmental effects in theoretical spectroscopy was already known. Due to its benefits, QM/MM can be expected to experience ongoing growth for the next decade.In the present chapter we give an overview of QM/MM developments and their importance in theoretical organic chemistry, and review applications which give impressions of the possibilities and the importance of the relevant effects. Since there is already a bunch of excellent reviews dealing with QM/MM, we will discuss fundamental ingredients and developments of QM/MM very briefly with a focus on very recent progress. For the applications we follow a similar

  13. Extracting dimer structures from simulations of organic-based materials using QM/MM methods

    Energy Technology Data Exchange (ETDEWEB)

    Pérez-Jiménez, A.J., E-mail: aj.perez@ua.es; Sancho-García, J.C., E-mail: jc.sancho@ua.es

    2015-09-28

    Highlights: • DFT geometries of isolated dimers in organic crystals differ from experimental ones. • This can be corrected using QM/MM geometry optimizations. • The QM = B3LYP–D3(ZD)/cc-pVDZ and MM = GAFF combination works reasonably well. - Abstract: The functionality of weakly bound organic materials, either in Nanoelectronics or in Materials Science, is known to be strongly affected by their morphology. Theoretical predictions of the underlying structure–property relationships are frequently based on calculations performed on isolated dimers, but the optimized structure of the latter may significantly differ from experimental data even when dispersion-corrected methods are used for it. Here, we address this problem on two organic crystals, namely coronene and 5,6,11,12-tetrachlorotetracene, concluding that it is caused by the absence of the surrounding monomers present in the crystal, and that it can be efficiently cured when the dimer is embedded into a general Quantum Mechanics/Molecular Mechanics (QM/MM) geometry optimization scheme. We also investigate how the size of the MM region affects the results. These findings may be helpful for the simulation of the morphology of active materials in crystalline or glassy samples.

  14. Particle acceleration at corotating interaction regions in the three-dimensional heliosphere

    International Nuclear Information System (INIS)

    Desai, M.I.; Marsden, R.G.; Sanderson, T.R.; Balogh, A.; Forsyth, R.J.; Gosling, J.T.

    1998-01-01

    We have investigated the relationship between the energetic (∼1MeV) proton intensity (J) and the magnetic compression ratio (C) measured at the trailing edges of corotating interaction regions observed at Ulysses. In general, our results show that the proton intensity was well correlated with the compression ratio, provided that the seed intensity remained constant, consistent with predictions of the Fermi model. Specifically, our results indicate that particles were accelerated to above ∼1MeV in energy at or near the trailing edges of the compression regions observed in the midlatitude southern heliosphere, irrespective of whether the bounding reverse shocks were present or not. On the basis of this, we conclude that shock acceleration is probably not the only mechanism by which particles are accelerated to above ∼1MeV in energy at compression or interaction regions (CIRs). On the basis of magnetic field measurements obtained near the trailing edges of several midlatitude CIRs, we propose that particles could have been accelerated via the Fermi mechanism by being scattered back and forth across the trailing edges of the compression regions by large-amplitude Alfvacute en waves. Our results also show that the proton intensity was well correlated with the compression ratio during low solar activity periods but was essentially independent of C during periods of high solar activity. We suggest that the correlation between J and C was not observed during solar active periods because of significant variations in the seed intensity that result from sporadic contributions from transient solar events. In contrast, the correlation was observable during quiescent periods probably because contributions from transients had decreased dramatically, which allowed the CIRs to accelerate particles out of a seed population whose intensity remained relatively unperturbed. copyright 1998 American Geophysical Union

  15. ELECTROMAGNETIC AND THERMAL SIMULATIONS FOR THE SWITCH REGION OF A COMPACT PROTON ACCELERATOR

    International Nuclear Information System (INIS)

    Wang, L; Caporaso, G J; Sullivan, J S

    2007-01-01

    A compact proton accelerator for medical applications is being developed at Lawrence Livermore National Laboratory. The accelerator architecture is based on the dielectric wall accelerator (DWA) concept. One critical area to consider is the switch region. Electric field simulations and thermal calculations of the switch area were performed to help determine the operating limits of rmed SiC switches. Different geometries were considered for the field simulation including the shape of the thin Indium solder meniscus between the electrodes and SiC. Electric field simulations were also utilized to demonstrate how the field stress could be reduced. Both transient and steady steady-state thermal simulations were analyzed to find the average power capability of the switches

  16. Particle acceleration in solar active regions being in the state of self-organized criticality.

    Science.gov (United States)

    Vlahos, Loukas

    We review the recent observational results on flare initiation and particle acceleration in solar active regions. Elaborating a statistical approach to describe the spatiotemporally intermittent electric field structures formed inside a flaring solar active region, we investigate the efficiency of such structures in accelerating charged particles (electrons and protons). The large-scale magnetic configuration in the solar atmosphere responds to the strong turbulent flows that convey perturbations across the active region by initiating avalanche-type processes. The resulting unstable structures correspond to small-scale dissipation regions hosting strong electric fields. Previous research on particle acceleration in strongly turbulent plasmas provides a general framework for addressing such a problem. This framework combines various electromagnetic field configurations obtained by magnetohydrodynamical (MHD) or cellular automata (CA) simulations, or by employing a statistical description of the field’s strength and configuration with test particle simulations. We work on data-driven 3D magnetic field extrapolations, based on a self-organized criticality models (SOC). A relativistic test-particle simulation traces each particle’s guiding center within these configurations. Using the simulated particle-energy distributions we test our results against observations, in the framework of the collisional thick target model (CTTM) of solar hard X-ray (HXR) emission and compare our results with the current observations.

  17. F region electron density irregularity spectra near Auroral acceleration and shear regions

    International Nuclear Information System (INIS)

    Basu, S.; Basu, S.; MacKenzie, E.; Coley, W.R.; Hanson, W.B.; Lin, C.S.

    1984-01-01

    Spectral characteristics of auroral F region irregularities were studied by the use of high-resolution (approx.35 m) density measurements made by the retarding potential analyzer (RPA) on board the Atmosphere Explorer D (AE-D) satellite during two orbits when the satellite was traversing the high-latitude ionosphere in the evening sector. Coordinated DMSP passes provided synoptic coverage of auroral activity. The auroral energy input was estimated by intergrating the low-energy electron (LEE) data on AE-D. It was found that the one-dimensional in situ spectral index (p 1 ) of the irregularities at scale lengths of 1 values of approx.-3. This is interpreted as resulting from the effects of E region conductivity on the F region irregularity structure. The regions in between the precipitation structures, where presumably the E region conductivity was small, were generally associated with large shears in the horizontal E-W drifts and large velocities, as measured by the ion drift meter on board AE-D. The maximum drifts measured were approx.2 km s -1 , corresponding to an electric field of 100 mV m -1 . The large-velocity regions were also associated with substantial ion heating and electron density depletions. The largest shear magnitudes observed were approx.80 m s -1 km -1 , and the shear gradient scale lengths were approx.10 km, which was approximately the resolution of the ion drift meter data set used. The spectral characteristics of irregularities in the large, variable flow regions were very different, with p 1 being approx.-1

  18. Preoperative concurrent CBDCA chemotherapy and accelerated hyperfractionated radiotherapy for squamous cell carcinoma of the maxillary region

    International Nuclear Information System (INIS)

    Omura, Ken; Harada, Hiroyuki; Suzuki, Haruhiko; Takeuchi, Yosuke; Hatano, Kazuo; Togawa, Takashi

    2001-01-01

    Between 1994 and 2000, 28 patients with T3/T4 squamus cell carcinoma of the maxillary region (maxillary sinus, 22; maxillary gingiva, 4; maxillary bone, 1; buccal mucosa, 1) had accelerated hyperfractionated radiotherapy combined with simultaneous CBDCA chemotherapy preoperatively, at Chiba Cancer Center Hospital. The protocol consisted of combined therapy with accelerated hyperfractionated irradiation of 1.6 Gy, twice a day, to a total dose of 32.0-51.2 Gy and concurrent intra-arterial or intravenous infusion of CBDCA 20-30 mg/body/day for a cumulative total dose of 270-480 mg. After completion of the preoperative combined therapy, the clinical CR rate was 17.9%, and the good PR·CR rate was 32.1%. According to the initial findings and response to the combined therapy, all patients had maxillectomy (subtotal, 3; total, 16; extended, 9) 4 weeks after completion of the preoperative combined therapy. Postoperatively, the complete pathologic response (Ohboshi and Shimozato's classification, grade III and IV) rate was 28.6%. And the actuarial local control rate was 85.7%, with a mean follow-up of 46.2 months. Based on these results, we believe this preoperative therapy with CBDCA chemotherapy and accelerated hyperfractionated radiation is a significant choice as treatment for squamous cell cancer of the maxillary region. (author)

  19. Preoperative concurrent CBDCA chemotherapy and accelerated hyperfractionated radiotherapy for squamous cell carcinoma of the maxillary region

    Energy Technology Data Exchange (ETDEWEB)

    Omura, Ken; Harada, Hiroyuki [Tokyo Medical and Dental Univ. (Japan). Graduate School; Suzuki, Haruhiko; Takeuchi, Yosuke; Hatano, Kazuo; Togawa, Takashi

    2001-11-01

    Between 1994 and 2000, 28 patients with T3/T4 squamus cell carcinoma of the maxillary region (maxillary sinus, 22; maxillary gingiva, 4; maxillary bone, 1; buccal mucosa, 1) had accelerated hyperfractionated radiotherapy combined with simultaneous CBDCA chemotherapy preoperatively, at Chiba Cancer Center Hospital. The protocol consisted of combined therapy with accelerated hyperfractionated irradiation of 1.6 Gy, twice a day, to a total dose of 32.0-51.2 Gy and concurrent intra-arterial or intravenous infusion of CBDCA 20-30 mg/body/day for a cumulative total dose of 270-480 mg. After completion of the preoperative combined therapy, the clinical CR rate was 17.9%, and the good PR{center_dot}CR rate was 32.1%. According to the initial findings and response to the combined therapy, all patients had maxillectomy (subtotal, 3; total, 16; extended, 9) 4 weeks after completion of the preoperative combined therapy. Postoperatively, the complete pathologic response (Ohboshi and Shimozato's classification, grade III and IV) rate was 28.6%. And the actuarial local control rate was 85.7%, with a mean follow-up of 46.2 months. Based on these results, we believe this preoperative therapy with CBDCA chemotherapy and accelerated hyperfractionated radiation is a significant choice as treatment for squamous cell cancer of the maxillary region. (author)

  20. Combined quantum and molecular mechanics (QM/MM).

    Science.gov (United States)

    Friesner, Richard A

    2004-12-01

    We describe the current state of the art of mixed quantum mechanics/molecular mechanics (QM/MM) methodology, with a particular focus on modeling of enzymatic reactions. Over the past decade, the effectiveness of these methods has increased dramatically, based on improved quantum chemical methods, advances in the description of the QM/MM interface, and reductions in the cost/performance of computing hardware. Two examples of pharmaceutically relevant applications, cytochrome P450 and class C β-lactamase, are presented.: © 2004 Elsevier Ltd . All rights reserved.

  1. On the problem of completeness of QM: von Neumann against Einstein, Podolsky, and Rosen

    OpenAIRE

    Khrennikov, Andrei

    2008-01-01

    We performed a comparative analysis of the arguments of Einstein, Podolsky and Rosen -- EPR, 1935 (against the completeness of QM) and the theoretical formalism of QM (due to von Neumann, 1932). We found that the EPR considerations do not match at all with the von Neumann's theory. Thus EPR did not criticize the real theoretical model of QM. The root of EPR's paradoxical conclusion on incompleteness of QM is the misuse of von Neumann's projection postulate. EPR applied this postulate to obser...

  2. Ion beam dynamics in the acceleration region of the Vincy Cyclotron

    International Nuclear Information System (INIS)

    Tomic, S.; Samsonov, E.

    1998-01-01

    Modern concept of heavy ion cyclotrons assumes a tendency of decreasing the gaps between magnet poles, enabling better efficiency of the magnetic field circuit. This restricts possible solutions of acceleration structure and imposes the necessity of installing the dees in valleys of magnetic structures. This approach, which is accepted in the VINCY Cyclotron, requires a detailed study of the ion beam dynamics in the acceleration region. Consequently, we analyzed ion beams with eta = 1,05 and 0.25 in radial and axial phase space. Also, the energy spread in emittances and the influence of the first harmonic of the magnetic field on the radial betatron oscillations are discussed. The transformation of coherent into incoherent radial oscillations as well as the effect to radial off-centering on the beam vertical size at Walkinshaw resonance location, is pointed out (author)

  3. Trial of accelerator cells machining with high precision and high efficiency at Okayama region

    International Nuclear Information System (INIS)

    Yoshikawa, Mitsuo; Yoden, Hiroyuki; Yokomizo, Seiichi; Sumida, Tsuneto; Kunishida, Jun; Oshita, Isao

    2005-01-01

    In the framework of the project 'Promotion of Science and Technology in Regional Areas' by the Ministry of Education, Culture, Sports, Science and Technology, we have prepared a special apparatus for machining accelerator cells with a high precision and a high efficiency for the future linear collider. A machining with as small an error as 2 micrometers has been realized. Necessary time to finish one accelerator cell is reduced from 128 minutes to 34 minutes due to the suppression of the heating of the object at the machining. If newly developed one chuck method was employed, the precision and efficiency would be further improved. By cutting at both sides of the spindle, the necessary time for machining would be reduced by half. (author)

  4. Kinetic modeling of particle acceleration in a solar null point reconnection region

    DEFF Research Database (Denmark)

    Baumann, Gisela; Haugbølle, Troels; Nordlund, Åke

    2013-01-01

    The primary focus of this paper is on the particle acceleration mechanism in solar coronal 3D reconnection null-point regions. Starting from a potential field extrapolation of a SOHO magnetogram taken on 2002 November 16, we first performed MHD simulations with horizontal motions observed by SOHO...... particles and 3.5 billion grid cells of size 17.5\\,km --- these simulations offer a new opportunity to study particle acceleration in solar-like settings....... applied to the photospheric boundary of the computational box. After a build-up of electric current in the fan-plane of the null-point, a sub-section of the evolved MHD data was used as initial and boundary conditions for a kinetic particle-in-cell model of the plasma. We find that sub...

  5. Particle Acceleration in a Statistically Modeled Solar Active-Region Corona

    Science.gov (United States)

    Toutounzi, A.; Vlahos, L.; Isliker, H.; Dimitropoulou, M.; Anastasiadis, A.; Georgoulis, M.

    2013-09-01

    Elaborating a statistical approach to describe the spatiotemporally intermittent electric field structures formed inside a flaring solar active region, we investigate the efficiency of such structures in accelerating charged particles (electrons). The large-scale magnetic configuration in the solar atmosphere responds to the strong turbulent flows that convey perturbations across the active region by initiating avalanche-type processes. The resulting unstable structures correspond to small-scale dissipation regions hosting strong electric fields. Previous research on particle acceleration in strongly turbulent plasmas provides a general framework for addressing such a problem. This framework combines various electromagnetic field configurations obtained by magnetohydrodynamical (MHD) or cellular automata (CA) simulations, or by employing a statistical description of the field's strength and configuration with test particle simulations. Our objective is to complement previous work done on the subject. As in previous efforts, a set of three probability distribution functions describes our ad-hoc electromagnetic field configurations. In addition, we work on data-driven 3D magnetic field extrapolations. A collisional relativistic test-particle simulation traces each particle's guiding center within these configurations. We also find that an interplay between different electron populations (thermal/non-thermal, ambient/injected) in our simulations may also address, via a re-acceleration mechanism, the so called `number problem'. Using the simulated particle-energy distributions at different heights of the cylinder we test our results against observations, in the framework of the collisional thick target model (CTTM) of solar hard X-ray (HXR) emission. The above work is supported by the Hellenic National Space Weather Research Network (HNSWRN) via the THALIS Programme.

  6. Grid-Based Projector Augmented Wave (GPAW) Implementation of Quantum Mechanics/Molecular Mechanics (QM/MM) Electrostatic Embedding and Application to a Solvated Diplatinum Complex.

    Science.gov (United States)

    Dohn, A O; Jónsson, E Ö; Levi, G; Mortensen, J J; Lopez-Acevedo, O; Thygesen, K S; Jacobsen, K W; Ulstrup, J; Henriksen, N E; Møller, K B; Jónsson, H

    2017-12-12

    A multiscale density functional theory-quantum mechanics/molecular mechanics (DFT-QM/MM) scheme is presented, based on an efficient electrostatic coupling between the electronic density obtained from a grid-based projector augmented wave (GPAW) implementation of density functional theory and a classical potential energy function. The scheme is implemented in a general fashion and can be used with various choices for the descriptions of the QM or MM regions. Tests on H 2 O clusters, ranging from dimer to decamer show that no systematic energy errors are introduced by the coupling that exceeds the differences in the QM and MM descriptions. Over 1 ns of liquid water, Born-Oppenheimer QM/MM molecular dynamics (MD) are sampled combining 10 parallel simulations, showing consistent liquid water structure over the QM/MM border. The method is applied in extensive parallel MD simulations of an aqueous solution of the diplatinum [Pt 2 (P 2 O 5 H 2 ) 4 ] 4- complex (PtPOP), spanning a total time period of roughly half a nanosecond. An average Pt-Pt distance deviating only 0.01 Å from experimental results, and a ground-state Pt-Pt oscillation frequency deviating by <2% from experimental results were obtained. The simulations highlight a remarkable harmonicity of the Pt-Pt oscillation, while also showing clear signs of Pt-H hydrogen bonding and directional coordination of water molecules along the Pt-Pt axis of the complex.

  7. Report of the advisory group meeting on the establishment of regional ion accelerator centers and user networks

    International Nuclear Information System (INIS)

    1997-11-01

    In this report it is shown that ion accelerators have had a tremendous economic and technological impact on most developed countries, and are beginning to have a significant impact on developing countries. Through the formation of Accelerator Centers and User Networks (which may be national, regional or inter-regional) a mechanism will be outlined by which scientists and other users from developing countries can receive the necessary training and have available the necessary accelerator facilities to use these machines for economic improvement and technological development in their countries

  8. Electric potential structures of auroral acceleration region border from multi-spacecraft Cluster data

    Science.gov (United States)

    Sadeghi, S.; Emami, M. R.

    2018-04-01

    This paper studies an auroral event using data from three spacecraft of the Cluster mission, one inside and two at the poleward edge of the bottom of the Auroral Acceleration Region (AAR). The study reveals the three-dimensional profile of the region's poleward boundary, showing spatial segmentation of the electric potential structures and their decay in time. It also depicts localized magnetic field variations and field-aligned currents that appear to have remained stable for at least 80 s. Such observations became possible due to the fortuitous motion of the three spacecraft nearly parallel to each other and tangential to the AAR edge, so that the differences and variations can be seen when the spacecraft enter and exit the segmentations, hence revealing their position with respect to the AAR.

  9. Regional blood flow in the domestic fowl immediately following chronic acceleration

    International Nuclear Information System (INIS)

    Weidner, W.J.; Hoffman, L.F.; Clark, S.D.

    1982-01-01

    In order to examine the effects of chronic low G acceleration on blood flow distribution and cardiac output, chickens (N.10) were centrifuged at +2Gz for 30-61 d. Controls (N.12) were not centrifuged. The animals were anesthetized with sodium pentobarbital after removal from the centrifuge and surgically prepared in order to measure cardiac output and regional blood flows by the reference sample method with 85 Sr labeled microspheres (15 +/- 5 mum diam.). Both brachial arteries were cannulated to withdraw timed, paired blood samples at a known rate. The chest was opened and a cannula inserted into the left ventricle for administration of microspheres. Tissue samples were taken after completion of experimental procedures and their radioactivity was determined. The cardiac outputs in the two groups were not significantly different. Regional blood flows to the kidney, eyes, and skeletal muscle were significantly increased in the animals subjected to chronic +2Gz. While the mechanism by which these increases in blood flow occurred is not known, results indicate that chronic exposure to hyperdynamic gravitational fields can alter circulatory dynamics. We conclude that the cardiovascular system is directly involved in the process of adaptation to chronic positive acceleration

  10. Grid-Based Projector Augmented Wave (GPAW) Implementation of Quantum Mechanics/Molecular Mechanics (QM/MM) Electrostatic Embedding and Application to a Solvated Diplatinum Complex

    DEFF Research Database (Denmark)

    Dohn, A. O.; Jónsson, E. Ö.; Levi, Gianluca

    2017-01-01

    A multiscale density functional theory-quantum mechanics/molecular mechanics (DFT-QM/MM) scheme is presented, based on an efficient electrostatic coupling between the electronic density obtained from a grid-based projector augmented wave (GPAW) implementation of density functional theory...... and a classical potential energy function. The scheme is implemented in a general fashion and can be used with various choices for the descriptions of the QM or MM regions. Tests on H2O clusters, ranging from dimer to decamer show that no systematic energy errors are introduced by the coupling that exceeds...

  11. Associations between accelerated glacier mass wastage and increased summer temperature in coastal regions

    Science.gov (United States)

    Dyurgerov, M.; McCabe, G.J.

    2006-01-01

    Low-elevation glaciers in coastal regions of Alaska, the Canadian Arctic, individual ice caps around the Greenland ice sheet, and the Patagonia Ice Fields have an aggregate glacier area of about 332 ?? 103 km 2 and account for approximately 42% of all the glacier area outside the Greenland and Antarctic ice sheets. They have shown volume loss, especially since the end of the 1980s, increasing from about 45% in the 1960s to nearly 67% in 2003 of the total wastage from all glaciers on Earth outside those two largest ice sheets. Thus, a disproportionally large contribution of coastal glacier ablation to sea level rise is evident. We examine cumulative standardized departures (1961-2000 reference period) of glacier mass balances and air temperature data in these four coastal regions. Analyses indicate a strong association between increases in glacier volume losses and summer air temperature at regional and global scales. Increases in glacier volume losses in the coastal regions also coincide with an accelerated rate of ice discharge from outlet glaciers draining the Greenland and West Antarctic ice sheets. These processes imply further increases in sea level rise. ?? 2006 Regents of the University of Colorado.

  12. Density-Dependent Formulation of Dispersion-Repulsion Interactions in Hybrid Multiscale Quantum/Molecular Mechanics (QM/MM) Models

    DEFF Research Database (Denmark)

    Curutchet, Carles; Cupellini, Lorenzo; Kongsted, Jacob

    2018-01-01

    embedding approaches, respectively, nonelectrostatic dispersion and repulsion interactions are instead commonly described through classical potentials despite their quantum mechanical origin. Here we present an extension of the Tkatchenko-Scheffler semiempirical van der Waals (vdWTS) scheme aimed......Mixed multiscale quantum/molecular mechanics (QM/MM) models are widely used to explore the structure, reactivity, and electronic properties of complex chemical systems. Whereas such models typically include electrostatics and potentially polarization in so-called electrostatic and polarizable...... at describing dispersion and repulsion interactions between quantum and classical regions within a QM/MM polarizable embedding framework. Starting from the vdWTSexpression, we define a dispersion and a repulsion term, both of them density-dependent and consistently based on a Lennard-Jones-like potential. We...

  13. Source Population and Acceleration Location of Suprathermal Heavy Ions in Corotating Interaction Regions

    Energy Technology Data Exchange (ETDEWEB)

    Filwett, R. J.; Desai, M. I. [University of Texas at San Antonio, San Antonio, TX (United States); Dayeh, M. A.; Broiles, T. W. [Southwest Research Institute, San Antonio, TX (United States)

    2017-03-20

    We have analyzed the ∼20–320 keV nucleon{sup −1} suprathermal (ST) heavy ion abundances in 41 corotating interaction regions (CIRs) observed by the Wind spacecraft from 1995 January to 2008 December. Our results are: (1) the CIR Fe/CNO and NeS/CNO ratios vary with the sunspot number, with values being closer to average solar energetic particle event values during solar maxima and lower than nominal solar wind values during solar minima. The physical mechanism responsible for the depleted abundances during solar minimum remains an open question. (2) The Fe/CNO increases with energy in the 6 events that occurred during solar maximum, while no such trends are observed for the 35 events during solar minimum. (3) The Fe/CNO shows no correlation with the average solar wind speed. (4) The Fe/CNO is well correlated with the corresponding upstream ∼20–320 keV nucleon{sup −1} Fe/CNO and not with the solar wind Fe/O measured by ACE in 31 events. Using the correlations between the upstream ∼20–40 keV nucleon{sup −1} Fe/CNO and the ∼20–320 keV nucleon{sup −1} Fe/CNO in CIRs, we estimate that, on average, the ST particles traveled ∼2 au along the nominal Parker spiral field line, which corresponds to upper limits for the radial distance of the source or acceleration location of ∼1 au beyond Earth orbit. Our results are consistent with those obtained from recent surveys, and confirm that CIR ST heavy ions are accelerated more locally, and are at odds with the traditional viewpoint that CIR ions seen at 1 au are bulk solar wind ions accelerated between 3 and 5 au.

  14. Bat Accelerated Regions Identify a Bat Forelimb Specific Enhancer in the HoxD Locus.

    Directory of Open Access Journals (Sweden)

    Betty M Booker

    2016-03-01

    Full Text Available The molecular events leading to the development of the bat wing remain largely unknown, and are thought to be caused, in part, by changes in gene expression during limb development. These expression changes could be instigated by variations in gene regulatory enhancers. Here, we used a comparative genomics approach to identify regions that evolved rapidly in the bat ancestor, but are highly conserved in other vertebrates. We discovered 166 bat accelerated regions (BARs that overlap H3K27ac and p300 ChIP-seq peaks in developing mouse limbs. Using a mouse enhancer assay, we show that five Myotis lucifugus BARs drive gene expression in the developing mouse limb, with the majority showing differential enhancer activity compared to the mouse orthologous BAR sequences. These include BAR116, which is located telomeric to the HoxD cluster and had robust forelimb expression for the M. lucifugus sequence and no activity for the mouse sequence at embryonic day 12.5. Developing limb expression analysis of Hoxd10-Hoxd13 in Miniopterus natalensis bats showed a high-forelimb weak-hindlimb expression for Hoxd10-Hoxd11, similar to the expression trend observed for M. lucifugus BAR116 in mice, suggesting that it could be involved in the regulation of the bat HoxD complex. Combined, our results highlight novel regulatory regions that could be instrumental for the morphological differences leading to the development of the bat wing.

  15. Accelerating regional atrophy rates in the progression from normal aging to Alzheimer's disease

    Energy Technology Data Exchange (ETDEWEB)

    Sluimer, Jasper D. [VU University Medical Centre, Department of Diagnostic Radiology, Amsterdam (Netherlands); VU University Medical Centre, Alzheimer Centre, Amsterdam (Netherlands); VU University Medical Centre, Image Analysis Centre, Amsterdam (Netherlands); VU University Medical Centre, Department of Diagnostic Radiology and Alzheimer Centre, PO Box 7057, Amsterdam (Netherlands); Flier, Wiesje M. van der; Scheltens, Philip [VU University Medical Centre, Alzheimer Centre, Amsterdam (Netherlands); VU University Medical Centre, Department of Neurology, Amsterdam (Netherlands); Karas, Giorgos B.; Barkhof, Frederik [VU University Medical Centre, Department of Diagnostic Radiology, Amsterdam (Netherlands); VU University Medical Centre, Alzheimer Centre, Amsterdam (Netherlands); VU University Medical Centre, Image Analysis Centre, Amsterdam (Netherlands); Schijndel, Ronald van [VU University Medical Centre, Image Analysis Centre, Amsterdam (Netherlands); VU University Medical Centre, Department of Informatics, Amsterdam (Netherlands); Barnes, Josephine; Boyes, Richard G. [UCL, Institute of Neurology, Dementia Research Centre, London (United Kingdom); Cover, Keith S. [VU University Medical Centre, Department of Physics and Medical Technology, Amsterdam (Netherlands); Olabarriaga, Silvia D. [University of Amsterdam, Department of Clinical Epidemiology, Biostatistics and Bioinformatics, Academic Medical Centre, Amsterdam (Netherlands); Fox, Nick C. [VU University Medical Centre, Department of Neurology, Amsterdam (Netherlands); UCL, Institute of Neurology, Dementia Research Centre, London (United Kingdom); Vrenken, Hugo [VU University Medical Centre, Alzheimer Centre, Amsterdam (Netherlands); VU University Medical Centre, Image Analysis Centre, Amsterdam (Netherlands); VU University Medical Centre, Department of Physics and Medical Technology, Amsterdam (Netherlands)

    2009-12-15

    We investigated progression of atrophy in vivo, in Alzheimer's disease (AD), and mild cognitive impairment (MCI). We included 64 patients with AD, 44 with MCI and 34 controls with serial MRI examinations (interval 1.8 {+-} 0.7 years). A nonlinear registration algorithm (fluid) was used to calculate atrophy rates in six regions: frontal, medial temporal, temporal (extramedial), parietal, occipital lobes and insular cortex. In MCI, the highest atrophy rate was observed in the medial temporal lobe, comparable with AD. AD patients showed even higher atrophy rates in the extramedial temporal lobe. Additionally, atrophy rates in frontal, parietal and occipital lobes were increased. Cox proportional hazard models showed that all regional atrophy rates predicted conversion to AD. Hazard ratios varied between 2.6 (95% confidence interval (CI) = 1.1-6.2) for occipital atrophy and 15.8 (95% CI = 3.5-71.8) for medial temporal lobe atrophy. In conclusion, atrophy spreads through the brain with development of AD. MCI is marked by temporal lobe atrophy. In AD, atrophy rate in the extramedial temporal lobe was even higher. Moreover, atrophy rates also accelerated in parietal, frontal, insular and occipital lobes. Finally, in nondemented elderly, medial temporal lobe atrophy was most predictive of progression to AD, demonstrating the involvement of this region in the development of AD. (orig.)

  16. Accelerating regional atrophy rates in the progression from normal aging to Alzheimer's disease

    International Nuclear Information System (INIS)

    Sluimer, Jasper D.; Flier, Wiesje M. van der; Scheltens, Philip; Karas, Giorgos B.; Barkhof, Frederik; Schijndel, Ronald van; Barnes, Josephine; Boyes, Richard G.; Cover, Keith S.; Olabarriaga, Silvia D.; Fox, Nick C.; Vrenken, Hugo

    2009-01-01

    We investigated progression of atrophy in vivo, in Alzheimer's disease (AD), and mild cognitive impairment (MCI). We included 64 patients with AD, 44 with MCI and 34 controls with serial MRI examinations (interval 1.8 ± 0.7 years). A nonlinear registration algorithm (fluid) was used to calculate atrophy rates in six regions: frontal, medial temporal, temporal (extramedial), parietal, occipital lobes and insular cortex. In MCI, the highest atrophy rate was observed in the medial temporal lobe, comparable with AD. AD patients showed even higher atrophy rates in the extramedial temporal lobe. Additionally, atrophy rates in frontal, parietal and occipital lobes were increased. Cox proportional hazard models showed that all regional atrophy rates predicted conversion to AD. Hazard ratios varied between 2.6 (95% confidence interval (CI) = 1.1-6.2) for occipital atrophy and 15.8 (95% CI = 3.5-71.8) for medial temporal lobe atrophy. In conclusion, atrophy spreads through the brain with development of AD. MCI is marked by temporal lobe atrophy. In AD, atrophy rate in the extramedial temporal lobe was even higher. Moreover, atrophy rates also accelerated in parietal, frontal, insular and occipital lobes. Finally, in nondemented elderly, medial temporal lobe atrophy was most predictive of progression to AD, demonstrating the involvement of this region in the development of AD. (orig.)

  17. Density-Dependent Formulation of Dispersion-Repulsion Interactions in Hybrid Multiscale Quantum/Molecular Mechanics (QM/MM) Models.

    Science.gov (United States)

    Curutchet, Carles; Cupellini, Lorenzo; Kongsted, Jacob; Corni, Stefano; Frediani, Luca; Steindal, Arnfinn Hykkerud; Guido, Ciro A; Scalmani, Giovanni; Mennucci, Benedetta

    2018-03-13

    Mixed multiscale quantum/molecular mechanics (QM/MM) models are widely used to explore the structure, reactivity, and electronic properties of complex chemical systems. Whereas such models typically include electrostatics and potentially polarization in so-called electrostatic and polarizable embedding approaches, respectively, nonelectrostatic dispersion and repulsion interactions are instead commonly described through classical potentials despite their quantum mechanical origin. Here we present an extension of the Tkatchenko-Scheffler semiempirical van der Waals (vdW TS ) scheme aimed at describing dispersion and repulsion interactions between quantum and classical regions within a QM/MM polarizable embedding framework. Starting from the vdW TS expression, we define a dispersion and a repulsion term, both of them density-dependent and consistently based on a Lennard-Jones-like potential. We explore transferable atom type-based parametrization strategies for the MM parameters, based on either vdW TS calculations performed on isolated fragments or on a direct estimation of the parameters from atomic polarizabilities taken from a polarizable force field. We investigate the performance of the implementation by computing self-consistent interaction energies for the S22 benchmark set, designed to represent typical noncovalent interactions in biological systems, in both equilibrium and out-of-equilibrium geometries. Overall, our results suggest that the present implementation is a promising strategy to include dispersion and repulsion in multiscale QM/MM models incorporating their explicit dependence on the electronic density.

  18. Solvent Boundary Potentials for Hybrid QM/MM Computations Using Classical Drude Oscillators: A Fully Polarizable Model.

    Science.gov (United States)

    Boulanger, Eliot; Thiel, Walter

    2012-11-13

    Accurate quantum mechanical/molecular mechanical (QM/MM) treatments should account for MM polarization and properly include long-range electrostatic interactions. We report on a development that covers both these aspects. Our approach combines the classical Drude oscillator (DO) model for the electronic polarizability of the MM atoms with the generalized solvent boundary Potential (GSBP) and the solvated macromolecule boundary potential (SMBP). These boundary potentials (BP) are designed to capture the long-range effects of the outer region of a large system on its interior. They employ a finite difference approximation to the Poisson-Boltzmann equation for computing electrostatic interactions and take into account outer-region bulk solvent through a polarizable dielectric continuum (PDC). This approach thus leads to fully polarizable three-layer QM/MM-DO/BP methods. As the mutual responses of each of the subsystems have to be taken into account, we propose efficient schemes to converge the polarization of each layer simultaneously. For molecular dynamics (MD) simulations using GSBP, this is achieved by considering the MM polarizable model as a dynamical degree of freedom, and hence contributions from the boundary potential can be evaluated for a frozen state of polarization at every time step. For geometry optimizations using SMBP, we propose a dual self-consistent field approach for relaxing the Drude oscillators to their ideal positions and converging the QM wave function with the proper boundary potential. The chosen coupling schemes are evaluated with a test system consisting of a glycine molecule in a water ball. Both boundary potentials are capable of properly reproducing the gradients at the inner-region atoms and the Drude oscillators. We show that the effect of the Drude oscillators must be included in all terms of the boundary potentials to obtain accurate results and that the use of a high dielectric constant for the PDC does not lead to a polarization

  19. Multiscale Free Energy Simulations: An Efficient Method for Connecting Classical MD Simulations to QM or QM/MM Free Energies Using Non-Boltzmann Bennett Reweighting Schemes

    Science.gov (United States)

    2015-01-01

    The reliability of free energy simulations (FES) is limited by two factors: (a) the need for correct sampling and (b) the accuracy of the computational method employed. Classical methods (e.g., force fields) are typically used for FES and present a myriad of challenges, with parametrization being a principle one. On the other hand, parameter-free quantum mechanical (QM) methods tend to be too computationally expensive for adequate sampling. One widely used approach is a combination of methods, where the free energy difference between the two end states is computed by, e.g., molecular mechanics (MM), and the end states are corrected by more accurate methods, such as QM or hybrid QM/MM techniques. Here we report two new approaches that significantly improve the aforementioned scheme; with a focus on how to compute corrections between, e.g., the MM and the more accurate QM calculations. First, a molecular dynamics trajectory that properly samples relevant conformational degrees of freedom is generated. Next, potential energies of each trajectory frame are generated with a QM or QM/MM Hamiltonian. Free energy differences are then calculated based on the QM or QM/MM energies using either a non-Boltzmann Bennett approach (QM-NBB) or non-Boltzmann free energy perturbation (NB-FEP). Both approaches are applied to calculate relative and absolute solvation free energies in explicit and implicit solvent environments. Solvation free energy differences (relative and absolute) between ethane and methanol in explicit solvent are used as the initial test case for QM-NBB. Next, implicit solvent methods are employed in conjunction with both QM-NBB and NB-FEP to compute absolute solvation free energies for 21 compounds. These compounds range from small molecules such as ethane and methanol to fairly large, flexible solutes, such as triacetyl glycerol. Several technical aspects were investigated. Ultimately some best practices are suggested for improving methods that seek to connect

  20. Contribution to the central region study of the first cyclotron of the Rhone-Alpes accelerator system

    International Nuclear Information System (INIS)

    Khallouf, A.

    1986-01-01

    Some changes seemed necessary such as the structure of the central region in order to obtain good centring and good axial and radial stabilities for the different conditions of acceleration. The most simple calculations of the center of cyclotron already developed such as the acceleration in a constant electric field, but with enough regions to obtain a good precision have been resumed. As analytic tool a computer program calculates the trajectories of a charged particle given its characteristics and the conditions of injection, and the parameters of the system of acceleration and guiding. The program calculates orbit of the particle. A criterion of judgement to permit modifications of the hypothesis leading to the solution needed to obtain good working conditions for the cyclotron has been established [fr

  1. On acceleration of <1 MeV/n He ions in the corotating compression regions near 1 AU: STEREO observations

    Directory of Open Access Journals (Sweden)

    R. Bučík

    2009-09-01

    Full Text Available Observations of multi-MeV corotating interaction region (CIR ions are in general consistent with models of CIR shock acceleration and transport. The presence of suprathermal particles near 1 AU in unshocked compression regions is not adequately explained. Nonetheless, more recent works demonstrate that unshocked compression regions associated with CIRs near 1 AU could energize particles. In the energy range from ~0.1 to ~1 MeV/n we investigate CIR events observed in 2007–2008 by the STEREO A and B spacecraft. We treat the predictions of compression acceleration by comparing the observed ion intensities with the model parameters. These observations show that the ion intensity in CIR events with in-situ reverse shock is well organized by the parameters which characterize the compression region itself, like compression width, solar wind speed gradients and the total pressure. In turn, for CIR events with the absence of the shocks the model predictions are not fulfilled.

  2. Accelerated Educational Change; The Annual Western Regional Conference on Testing Problems (15th, San Francisco, California, May 6, 1966).

    Science.gov (United States)

    Educational Testing Service, Princeton, NJ.

    The 1966 meeting of the Western Regional Conference on Testing Problems dealt with accelerated educational change. The following speeches were presented: (1) "Access to Higher Education: Implications for Future Planning" by Richard Pearson; (2) "The Differentiated Youth: A Challenge to Traditional Institutions" by Joseph D. Lohman; (3) "Teaching…

  3. Genome sequencing and transcriptome analysis of Trichoderma reesei QM9978 strain reveals a distal chromosome translocation to be responsible for loss of vib1 expression and loss of cellulase induction.

    Science.gov (United States)

    Ivanova, Christa; Ramoni, Jonas; Aouam, Thiziri; Frischmann, Alexa; Seiboth, Bernhard; Baker, Scott E; Le Crom, Stéphane; Lemoine, Sophie; Margeot, Antoine; Bidard, Frédérique

    2017-01-01

    The hydrolysis of biomass to simple sugars used for the production of biofuels in biorefineries requires the action of cellulolytic enzyme mixtures. During the last 50 years, the ascomycete Trichoderma reesei , the main source of industrial cellulase and hemicellulase cocktails, has been subjected to several rounds of classical mutagenesis with the aim to obtain higher production levels. During these random genetic events, strains unable to produce cellulases were generated. Here, whole genome sequencing and transcriptomic analyses of the cellulase-negative strain QM9978 were used for the identification of mutations underlying this cellulase-negative phenotype. Sequence comparison of the cellulase-negative strain QM9978 to the reference strain QM6a identified a total of 43 mutations, of which 33 were located either close to or in coding regions. From those, we identified 23 single-nucleotide variants, nine InDels, and one translocation. The translocation occurred between chromosomes V and VII, is located upstream of the putative transcription factor vib1 , and abolishes its expression in QM9978 as detected during the transcriptomic analyses. Ectopic expression of vib1 under the control of its native promoter as well as overexpression of vib1 under the control of a strong constitutive promoter restored cellulase expression in QM9978, thus confirming that the translocation event is the reason for the cellulase-negative phenotype. Gene deletion of vib1 in the moderate producer strain QM9414 and in the high producer strain Rut-C30 reduced cellulase expression in both cases. Overexpression of vib1 in QM9414 and Rut-C30 had no effect on cellulase production, most likely because vib1 is already expressed at an optimal level under normal conditions. We were able to establish a link between a chromosomal translocation in QM9978 and the cellulase-negative phenotype of the strain. We identified the transcription factor vib1 as a key regulator of cellulases in T. reesei whose

  4. Common QA/QM Criteria for Multinational Vendor Inspection

    International Nuclear Information System (INIS)

    2014-01-01

    This VICWG document provides the 'Common QA/QM Criteria' which will be used in Multinational Vendor Inspection. The 'Common QA/QM Criteria' provides the basic consideration when performing the Vendor Inspection. These criteria has been developed in conformity with International Codes and Standards such as IAEA, ISO and so on that MDEP member countries adopted. The purpose of the VICWG is to establish areas of co-operation in the Vendor Inspection practices among MDEP member countries as described in the MDEP issue-specific Terms of Reference (ToR). As part of this, from the beginning, a survey was performed to understand and to identify areas of commonality and differences between regulatory practices of member countries in the area of vendor inspection. The VICWG also collaborated by performing Witnessed Inspections and Joint Inspections. Through these activities, it was recognized that member countries commonly apply the IAEA safety standard (GS-R-3) to the vendor inspection criteria, and almost ail European member countries apply the ISO standard (ISO9001). In the US, the NRC regulatory requirement in 10 CFR, Part 50, Appendix B is used. South Korea uses the same criteria as in the US. As a result of the information obtained, a comparison table between codes and standards (IAEAGS-R-3, ISO 9001:2008.10CFR50 Appendix Band ASME NQA-1) has been developed in order to inform the development of 'Common QA/QM Criteria'. The result is documented in Table 1, 'MDEP CORE QA/QM Requirement and Comparison between Codes and Standards'. In addition, each country's criteria were compared with the US 10CFR50 Appendix B as a template. Table 2 shows VICWG Survey on Quality Assurance Program Requirements. Through these activities above, we considered that the core requirements should be consistent with both IAEA safety standard and ISO standard, and considered that the common requirements in the US 10CFR50 Appendix B used to the survey

  5. Analysis of Peer Review Comments: QM Recommendations and Feedback Intervention Theory

    Science.gov (United States)

    Schwegler, Andria F.; Altman, Barbara W.

    2015-01-01

    Because feedback is a critical component of the continuous improvement cycle of the Quality Matters (QM) peer review process, the present research analyzed the feedback that peer reviewers provided to course developers after a voluntary, nonofficial QM peer review of online courses. Previous research reveals that the effects of feedback on…

  6. QM/MM Calculations with deMon2k

    Directory of Open Access Journals (Sweden)

    Dennis R. Salahub

    2015-03-01

    Full Text Available The density functional code deMon2k employs a fitted density throughout (Auxiliary Density Functional Theory, which offers a great speed advantage without sacrificing necessary accuracy. Powerful Quantum Mechanical/Molecular Mechanical (QM/MM approaches are reviewed. Following an overview of the basic features of deMon2k that make it efficient while retaining accuracy, three QM/MM implementations are compared and contrasted. In the first, deMon2k is interfaced with the CHARMM MM code (CHARMM-deMon2k; in the second MM is coded directly within the deMon2k software; and in the third the Chemistry in Ruby (Cuby wrapper is used to drive the calculations. Cuby is also used in the context of constrained-DFT/MM calculations. Each of these implementations is described briefly; pros and cons are discussed and a few recent applications are described briefly. Applications include solvated ions and biomolecules, polyglutamine peptides important in polyQ neurodegenerative diseases, copper monooxygenases and ultra-rapid electron transfer in cryptochromes.

  7. QM/MM Molecular Dynamics Studies of Metal Binding Proteins

    Directory of Open Access Journals (Sweden)

    Pietro Vidossich

    2014-07-01

    Full Text Available Mixed quantum-classical (quantum mechanical/molecular mechanical (QM/MM simulations have strongly contributed to providing insights into the understanding of several structural and mechanistic aspects of biological molecules. They played a particularly important role in metal binding proteins, where the electronic effects of transition metals have to be explicitly taken into account for the correct representation of the underlying biochemical process. In this review, after a brief description of the basic concepts of the QM/MM method, we provide an overview of its capabilities using selected examples taken from our work. Specifically, we will focus on heme peroxidases, metallo-β-lactamases, α-synuclein and ligase ribozymes to show how this approach is capable of describing the catalytic and/or structural role played by transition (Fe, Zn or Cu and main group (Mg metals. Applications will reveal how metal ions influence the formation and reduction of high redox intermediates in catalytic cycles and enhance drug metabolism, amyloidogenic aggregate formation and nucleic acid synthesis. In turn, it will become manifest that the protein frame directs and modulates the properties and reactivity of the metal ions.

  8. Final report on AFRIMETS.QM-K27: Determination of ethanol in aqueous matrix

    Science.gov (United States)

    Archer, Marcellé; Fernandes-Whaley, Maria; Visser, Ria; de Vos, Jayne; Prins, Sara; Rosso, Adriana; Ruiz de Arechavaleta, Mariana; Tahoun, Ibrahim; Kakoulides, Elias; Luvonga, Caleb; Muriira, Geoffrey; Naujalis, Evaldas; Zakaria, Osman Bin; Buzoianu, Mirella; Bebic, Jelena; Achour Mounir, Ben; Thanh, Ngo Huy

    2013-01-01

    From within AFRIMETS, the Regional Metrology Organization (RMO) for Africa, the RMO Key Comparison AFRIMETS.QM-K27 was coordinated by the National Metrology Institute of South Africa (NMISA) in 2011. Ten Metrology Institutes participated, comprising three AFRIMETS, two APMP, four EURAMET and one SIM participant. Participants were required to determine the forensic level concentration of two aqueous ethanol solutions that were gravimetrically prepared by the NMISA. Concentrations were expected to lie in the range of 0.1 mg/g to 5.0 mg/g. The accurate determination of ethanol content in aqueous medium is critical for regulatory forensic and trade purposes. The CCQM Organic Analysis Working Group has carried out several key comparisons (CCQM-K27 series) on the determination of ethanol in wine and aqueous matrices. Developing NMIs now had the opportunity to link to the earlier CCQM-K27 studies through the AFRIMETS.QM-K27 study. Gas chromatography coupled to flame ionisation or mass spectrometric detection was applied by eight of the participants, while three participants (including NMISA) applied titrimetry for the ethanol assay. The assigned reference value of the aqueous ethanol solutions was used to link AFRIMETS.QM-K27 to the CCQM-K27 key comparison reference value. The assigned reference values for AFRIMETS.QM-K27 Level 1 and Level 2 were (0.3249 ± 0.0021) mg/g (k = 2) and (4.6649 ± 0.0152) mg/g (k = 2), respectively. The reference values were determined using the purity-corrected gravimetric preparation values, while the standard uncertainty incorporated the gravimetric preparation and titrimetric homogeneity uncertainties. From previous CCQM-K27 studies, the expected spread (%CV) of higher order measurements of ethanol in aqueous medium is about 0.85% relative. In this study the CV for Level 1 is about 12% (10% with two outliers removed) and for Level 2 about 4%. Three of the ten laboratories submitted results within 1.5% of the gravimetric reference value for

  9. Regional alveolar partial pressure of oxygen measurement with parallel accelerated hyperpolarized gas MRI.

    Science.gov (United States)

    Kadlecek, Stephen; Hamedani, Hooman; Xu, Yinan; Emami, Kiarash; Xin, Yi; Ishii, Masaru; Rizi, Rahim

    2013-10-01

    Alveolar oxygen tension (Pao2) is sensitive to the interplay between local ventilation, perfusion, and alveolar-capillary membrane permeability, and thus reflects physiologic heterogeneity of healthy and diseased lung function. Several hyperpolarized helium ((3)He) magnetic resonance imaging (MRI)-based Pao2 mapping techniques have been reported, and considerable effort has gone toward reducing Pao2 measurement error. We present a new Pao2 imaging scheme, using parallel accelerated MRI, which significantly reduces measurement error. The proposed Pao2 mapping scheme was computer-simulated and was tested on both phantoms and five human subjects. Where possible, correspondence between actual local oxygen concentration and derived values was assessed for both bias (deviation from the true mean) and imaging artifact (deviation from the true spatial distribution). Phantom experiments demonstrated a significantly reduced coefficient of variation using the accelerated scheme. Simulation results support this observation and predict that correspondence between the true spatial distribution and the derived map is always superior using the accelerated scheme, although the improvement becomes less significant as the signal-to-noise ratio increases. Paired measurements in the human subjects, comparing accelerated and fully sampled schemes, show a reduced Pao2 distribution width for 41 of 46 slices. In contrast to proton MRI, acceleration of hyperpolarized imaging has no signal-to-noise penalty; its use in Pao2 measurement is therefore always beneficial. Comparison of multiple schemes shows that the benefit arises from a longer time-base during which oxygen-induced depolarization modifies the signal strength. Demonstration of the accelerated technique in human studies shows the feasibility of the method and suggests that measurement error is reduced here as well, particularly at low signal-to-noise levels. Copyright © 2013 AUR. Published by Elsevier Inc. All rights reserved.

  10. On the difference between additive and subtractive QM/MM calculations

    Science.gov (United States)

    Cao, Lili; Ryde, Ulf

    2018-04-01

    The combined quantum mechanical (QM) and molecular mechanical (MM) approach (QM/MM) is a popular method to study reactions in biochemical macromolecules. Even if the general procedure of using QM for a small, but interesting part of the system and MM for the rest is common to all approaches, the details of the implementations vary extensively, especially the treatment of the interface between the two systems. For example, QM/MM can use either additive or subtractive schemes, of which the former is often said to be preferable, although the two schemes are often mixed up with mechanical and electrostatic embedding. In this article, we clarify the similarities and differences of the two approaches. We show that inherently, the two approaches should be identical and in practice require the same sets of parameters. However, the subtractive scheme provides an opportunity to correct errors introduced by the truncation of the QM system, i.e. the link atoms, but such corrections require additional MM parameters for the QM system. We describe and test three types of link-atom correction, viz. for van der Waals, electrostatic and bonded interactions. The calculations show that electrostatic and bonded link-atom corrections often give rise to problems in the geometries and energies. The van der Waals link-atom corrections are quite small and give results similar to a pure additive QM/MM scheme. Therefore, both approaches can be recommended.

  11. On the Difference Between Additive and Subtractive QM/MM Calculations

    Directory of Open Access Journals (Sweden)

    Lili Cao

    2018-04-01

    Full Text Available The combined quantum mechanical (QM and molecular mechanical (MM approach (QM/MM is a popular method to study reactions in biochemical macromolecules. Even if the general procedure of using QM for a small, but interesting part of the system and MM for the rest is common to all approaches, the details of the implementations vary extensively, especially the treatment of the interface between the two systems. For example, QM/MM can use either additive or subtractive schemes, of which the former is often said to be preferable, although the two schemes are often mixed up with mechanical and electrostatic embedding. In this article, we clarify the similarities and differences of the two approaches. We show that inherently, the two approaches should be identical and in practice require the same sets of parameters. However, the subtractive scheme provides an opportunity to correct errors introduced by the truncation of the QM system, i.e., the link atoms, but such corrections require additional MM parameters for the QM system. We describe and test three types of link-atom correction, viz. for van der Waals, electrostatic, and bonded interactions. The calculations show that electrostatic and bonded link-atom corrections often give rise to problems in the geometries and energies. The van der Waals link-atom corrections are quite small and give results similar to a pure additive QM/MM scheme. Therefore, both approaches can be recommended.

  12. Ionospheric electron acceleration by electromagnetic waves near regions of plasma resonances

    International Nuclear Information System (INIS)

    Villalon, E.

    1989-01-01

    Electron acceleration by electromagnetic fields propagating in the inhomogeneous ionospheric plasma is investigated. It is found that high-amplitude short wavelength electrostatic waves are generated by the incident electromagnetic fields that penetrate the radio window. These waves can very efficiently transfer their energy to the electrons if the incident frequency is near the second harmonic of the cyclotron frequency

  13. Development and application of QM/MM methods to study the solvation effects and surfaces

    Energy Technology Data Exchange (ETDEWEB)

    Dibya, Pooja Arora [Iowa State Univ., Ames, IA (United States)

    2010-01-01

    Quantum mechanical (QM) calculations have the advantage of attaining high-level accuracy, however QM calculations become computationally inefficient as the size of the system grows. Solving complex molecular problems on large systems and ensembles by using quantum mechanics still poses a challenge in terms of the computational cost. Methods that are based on classical mechanics are an inexpensive alternative, but they lack accuracy. A good trade off between accuracy and efficiency is achieved by combining QM methods with molecular mechanics (MM) methods to use the robustness of the QM methods in terms of accuracy and the MM methods to minimize the computational cost. Two types of QM combined with MM (QM/MM) methods are the main focus of the present dissertation: the application and development of QM/MM methods for solvation studies and reactions on the Si(100) surface. The solvation studies were performed using a discreet solvation model that is largely based on first principles called the effective fragment potential method (EFP). The main idea of combining the EFP method with quantum mechanics is to accurately treat the solute-solvent and solvent-solvent interactions, such as electrostatic, polarization, dispersion and charge transfer, that are important in correctly calculating solvent effects on systems of interest. A second QM/MM method called SIMOMM (surface integrated molecular orbital molecular mechanics) is a hybrid QM/MM embedded cluster model that mimics the real surface.3 This method was employed to calculate the potential energy surfaces for reactions of atomic O on the Si(100) surface. The hybrid QM/MM method is a computationally inexpensive approach for studying reactions on larger surfaces in a reasonably accurate and efficient manner. This thesis is comprised of four chapters: Chapter 1 describes the general overview and motivation of the dissertation and gives a broad background of the computational methods that have been employed in this work

  14. SPECTRAL PROPERTIES OF LARGE GRADUAL SOLAR ENERGETIC PARTICLE EVENTS. II. SYSTEMATIC Q/M DEPENDENCE OF HEAVY ION SPECTRAL BREAKS

    Energy Technology Data Exchange (ETDEWEB)

    Desai, M. I.; Dayeh, M. A.; Ebert, R. W.; Schwadron, N. A. [Southwest Research Institute, 6220 Culebra Road, San Antonio, TX 78238 (United States); Mason, G. M. [Johns Hopkins University/Applied Physics Laboratory, Laurel, MD 20723 (United States); McComas, D. J. [Department of Astrophysical Sciences, Princeton University, NJ 08544 (United States); Li, G. [The Center for Space Plasma and Aeronomic Research (CSPAR), University of Alabama in Huntsville, Huntsville, AL 35756 (United States); Cohen, C. M. S.; Mewaldt, R. A. [California Institute of Technology, Pasadena, CA 91125 (United States); Smith, C. W., E-mail: mdesai@swri.edu [University of New Hampshire, 8 College Road, Durham NH 03824 (United States)

    2016-09-10

    We fit ∼0.1–500 MeV nucleon{sup −1} H–Fe spectra in 46 large solar energetic particle (SEP) events with the double power-law Band function to obtain a normalization constant, low- and high-energy parameters γ {sub a} and γ {sub b}, and break energy E {sub B}, and derive the low-energy spectral slope γ {sub 1}. We find that: (1) γ {sub a}, γ {sub 1}, and γ {sub b} are species-independent and the spectra steepen with increasing energy; (2) E {sub B} decreases systematically with decreasing Q/M scaling as (Q/M){sup α}; (3) α varies between ∼0.2–3 and is well correlated with the ∼0.16–0.23 MeV nucleon{sup −1} Fe/O; (4) in most events, α < 1.4, γ {sub b}– γ {sub a} > 3, and O E {sub B} increases with γ {sub b}– γ {sub a}; and (5) in many extreme events (associated with faster coronal mass ejections (CMEs) and GLEs), Fe/O and {sup 3}He/{sup 4}He ratios are enriched, α ≥ 1.4, γ {sub b}– γ {sub a} < 3, and E {sub B} decreases with γ {sub b}– γ {sub a}. The species-independence of γ {sub a}, γ {sub 1}, and γ {sub b} and the Q/M dependence of E {sub B} within an event and the α values suggest that double power-law SEP spectra occur due to diffusive acceleration by near-Sun CME shocks rather than scattering in interplanetary turbulence. Using γ {sub 1}, we infer that the average compression ratio for 33 near-Sun CME shocks is 2.49 ± 0.08. In most events, the Q/M dependence of E {sub B} is consistent with the equal diffusion coefficient condition and the variability in α is driven by differences in the near-shock wave intensity spectra, which are flatter than the Kolmogorov turbulence spectrum but weaker than the spectra for extreme events. In contrast, in extreme events, enhanced wave power enables faster CME shocks to accelerate impulsive suprathermal ions more efficiently than ambient coronal ions.

  15. Photoinjector optimization using a derivative-free, model-based trust-region algorithm for the Argonne Wakefield Accelerator

    Science.gov (United States)

    Neveu, N.; Larson, J.; Power, J. G.; Spentzouris, L.

    2017-07-01

    Model-based, derivative-free, trust-region algorithms are increasingly popular for optimizing computationally expensive numerical simulations. A strength of such methods is their efficient use of function evaluations. In this paper, we use one such algorithm to optimize the beam dynamics in two cases of interest at the Argonne Wakefield Accelerator (AWA) facility. First, we minimize the emittance of a 1 nC electron bunch produced by the AWA rf photocathode gun by adjusting three parameters: rf gun phase, solenoid strength, and laser radius. The algorithm converges to a set of parameters that yield an emittance of 1.08 μm. Second, we expand the number of optimization parameters to model the complete AWA rf photoinjector (the gun and six accelerating cavities) at 40 nC. The optimization algorithm is used in a Pareto study that compares the trade-off between emittance and bunch length for the AWA 70MeV photoinjector.

  16. Tuned and Balanced Redistributed Charge Scheme for Combined Quantum Mechanical and Molecular Mechanical (QM/MM) Methods and Fragment Methods: Tuning Based on the CM5 Charge Model.

    Science.gov (United States)

    Wang, Bo; Truhlar, Donald G

    2013-02-12

    Tuned and balanced redistributed charge schemes have been developed for modeling the electrostatic fields of bonds that are cut by a quantum mechanical-molecular mechanical boundary in combined quantum mechanical and molecular mechanical (QM/MM) methods. First, the charge is balanced by adjusting the charge on the MM boundary atom to conserve the total charge of the entire QM/MM system. In the balanced smeared redistributed charge (BSRC) scheme, the adjusted MM boundary charge is smeared with a smearing width of 1.0 Å and is distributed in equal portions to the midpoints of the bonds between the MM boundary atom and the MM atoms bonded to it; in the balanced redistributed charge-2 (BRC2) scheme, the adjusted MM boundary charge is distributed as point charges in equal portions to the MM atoms that are bonded to the MM boundary atom. The QM subsystem is capped by a fluorine atom that is tuned to reproduce the sum of partial atomic charges of the uncapped portion of the QM subsystem. The new aspect of the present study is a new way to carry out the tuning process; in particular, the CM5 charge model, rather than the Mulliken population analysis applied in previous studies, is used for tuning the capping atom that terminates the dangling bond of the QM region. The mean unsigned error (MUE) of the QM/MM deprotonation energy for a 15-system test suite of deprotonation reactions is 2.3 kcal/mol for the tuned BSRC scheme (TBSRC) and 2.4 kcal/mol for the tuned BRC2 scheme (TBRC2). As was the case for the original tuning method based on Mulliken charges, the new tuning method performs much better than using conventional hydrogen link atoms, which have an MUE on this test set of about 7 kcal/mol. However, the new scheme eliminates the need to use small basis sets, which can be problematic, and it allows one to be more consistent by tuning the parameters with whatever basis set is appropriate for applications. (Alternatively, since the tuning parameters and partial charges

  17. Effects of Absorbing Aerosols on Accelerated Melting of Snowpack in the Hindu-Kush-Himalayas-Tibetan Plateau Region

    Science.gov (United States)

    Lau, William K.; Kyu-Myong, Kim; Yasunari, Teppei; Gautam, Ritesh; Hsu, Christina

    2011-01-01

    The impacts of absorbing aerosol on melting of snowpack in the Hindu-Kush-Himalayas-Tibetan Plateau (HKHT) region are studied using in-situ, satellite observations, and GEOS-5 GCM. Based on atmospheric black carbon measurements from the Pyramid observation ( 5 km elevation) in Mt. Everest, we estimate that deposition of black carbon on snow surface will give rise to a reduction in snow surface albedo of 2- 5 %, and an increased annual runoff of 12-34% for a typical Tibetan glacier. Examination of satellite reflectivity and re-analysis data reveals signals of possible impacts of dust and black carbon in darkening the snow surface, and accelerating spring melting of snowpack in the HKHT, following a build-up of absorbing aerosols in the Indo-Gangetic Plain. Results from GCM experiments show that 8-10% increase in the rate of melting of snowpack over the western Himalayas and Tibetan Plateau can be attributed to the elevated-heat-pump (EHP) feedback effect, initiated from the absorption of solar radiation by dust and black carbon accumulated to great height ( 5 km) over the Indo-Gangetic Plain and Himalayas foothills in the pre-monsoon season (April-May). The accelerated melting of the snowpack is enabled by an EHP-induced atmosphere-land-snowpack positive feedback involving a) orographic forcing of the monsoon flow by the complex terrain, and thermal forcing of the HKHT region, leading to increased moisture, cloudiness and rainfall over the Himalayas foothills and northern India, b) warming of the upper troposphere over the Tibetan Plateau, and c) an snow albedo-temperature feedback initiated by a transfer of latent and sensible heat from a warmer atmosphere over the HKHT to the underlying snow surface. Results from ongoing modeling work to assess the relative roles of EHP vs. snow-darkening effects on accelerated melting of snowpack in HKHT region will also be discussed.

  18. Production of accelerated electrons near an electron source in the plasma resonance region

    International Nuclear Information System (INIS)

    Fedorov, V.A.

    1989-01-01

    Conditions of generation of plasma electrons accelerated and their characteristics in the vicinity of an electron source are determined. The electron source isolated electrically with infinitely conducting surface, being in unrestricted collisionless plasma ω 0 >>ν, where ω 0 - plasma frequency of nonperturbated plasma, ν - frequency of plasma electron collisions with other plasma particles, is considered. Spherically symmetric injection of electrons, which rates are simulated by ω frequency, occurs from the source surface. When describing phenomena in the vicinity of the electron source, one proceeds from the quasihydrodynamic equation set

  19. Extended representations of observables and states for a noncontextual reinterpretation of QM

    International Nuclear Information System (INIS)

    Garola, Claudio; Sozzo, Sandro

    2012-01-01

    A crucial and problematical feature of quantum mechanics (QM) is nonobjectivity of properties. The ESR model restores objectivity reinterpreting quantum probabilities as conditional on detection and embodying the mathematical formalism of QM into a broader noncontextual (hence local) framework. We propose here an improved presentation of the ESR model containing a more complete mathematical representation of the basic entities of the model. We also extend the model to mixtures showing that the mathematical representations of proper mixtures do not coincide with the mathematical representation of mixtures provided by QM, while the representation of improper mixtures does. This feature of the ESR model entails that some interpretative problems raising in QM when dealing with mixtures are avoided. From an empirical point of view, the predictions of the ESR model depend on some parameters which may be such that they are very close to the predictions of QM in most cases. But the nonstandard representation of proper mixtures allows us to propose the scheme of an experiment that could check whether the predictions of QM or the predictions of the ESR model are correct. (paper)

  20. Quantitative radioisotope measurements with the NSF-Arizona regional accelerator facility

    International Nuclear Information System (INIS)

    Zabel, T.H.; Damon, P.E.; Donahue, D.J.; Jull, A.J.T.

    1983-01-01

    Results of tests on the tandem accelerator mass spectrometer (TAMS) at the University of Arizona are presented. These results demonstrate: (a) measurements of 14 C/ 13 C ratios with precisions of a few percent can be made in a period of one to several hours; (b) measurements with precisions of 0.5% have been made in which the uncertainties were mainly statistical and in which contributions to the uncertainty of machine fluctuations were negligible; (c) precise measurements of the ratio of 14 C/ 13 C in samples of N.B.S. oxalic acid and of 1890 wood are consistent with the accepted value of that ratio; (d) the real signal from a 44,000 year old sample is equal to the background rate produced from a dead carbon sample. In addition, results of some measurements on archaeological samples are presented

  1. Accurate Calculation of Magnetic Fields in the End Regions of Superconducting Accelerator Magnets using the BEM-FEM Coupling Method

    CERN Document Server

    Kurz, S

    1999-01-01

    In this paper a new technique for the accurate calculation of magnetic fields in the end regions of superconducting accelerator magnets is presented. This method couples Boundary Elements (BEM) which discretize the surface of the iron yoke and Finite Elements (FEM) for the modelling of the nonlinear interior of the yoke. The BEM-FEM method is therefore specially suited for the calculation of 3-dimensional effects in the magnets, as the coils and the air regions do not have to be represented in the finite-element mesh and discretization errors only influence the calculation of the magnetization (reduced field) of the yoke. The method has been recently implemented into the CERN-ROXIE program package for the design and optimization of the LHC magnets. The field shape and multipole errors in the two-in-one LHC dipoles with its coil ends sticking out of the common iron yoke is presented.

  2. Active Site Dynamics in Substrate Hydrolysis Catalyzed by DapE Enzyme and Its Mutants from Hybrid QM/MM-Molecular Dynamics Simulation.

    Science.gov (United States)

    Dutta, Debodyuti; Mishra, Sabyashachi

    2017-07-27

    The mechanism of the catalytic hydrolysis of N-succinyl diaminopimelic acid (SDAP) by the microbial enzyme DapE in its wild-type (wt) form as well as three of its mutants (E134D, H67A, and H349A) is investigated employing a hybrid quantum mechanics/molecular mechanics (QM/MM) method coupled with molecular dynamics (MD) simulations, wherein the time evolution of the atoms of the QM and MM regions are obtained from the forces acting on the individual atoms. The free-energy profiles along the reaction coordinates of this multistep hydrolysis reaction process are explored using a combination of equilibrium and nonequilibrium (umbrella sampling) QM/MM-MD simulation techniques. In the enzyme-substrate complexes of wt-DapE and the E134D mutant, nucleophilic attack is found to be the rate-determining step involving a barrier of 15.3 and 21.5 kcal/mol, respectively, which satisfactorily explains the free energy of activation obtained from kinetic experiments in wt-DapE-SDAP (15.2 kcal/mol) and the 3 orders of magnitude decrease in the catalytic activity due to E134D mutation. The catalysis is found to be quenched in the H67A and H349A mutants of DapE due to conformational rearrangement in the active site induced by the absence of the active site His residues that prohibits activation of the catalytic water molecule.

  3. PREFACE: EmQM13: Emergent Quantum Mechanics 2013

    Science.gov (United States)

    2014-04-01

    These proceedings comprise the invited lectures of the second international symposium on Emergent Quantum Mechanics (EmQM13), which was held at the premises of the Austrian Academy of Sciences in Vienna, Austria, 3-6 October 2013. The symposium was held at the ''Theatersaal'' of the Academy of Sciences, and was devoted to the open exploration of emergent quantum mechanics, a possible ''deeper level theory'' that interconnects three fields of knowledge: emergence, the quantum, and information. Could there appear a revised image of physical reality from recognizing new links between emergence, the quantum, and information? Could a novel synthesis pave the way towards a 21st century, ''superclassical'' physics? The symposium provided a forum for discussing (i) important obstacles which need to be overcome as well as (ii) promising developments and research opportunities on the way towards emergent quantum mechanics. Contributions were invited that presented current advances in both standard as well as unconventional approaches to quantum mechanics. The EmQM13 symposium was co-organized by Gerhard Grössing (Austrian Institute for Nonlinear Studies (AINS), Vienna), and by Jan Walleczek (Fetzer Franklin Fund, USA, and Phenoscience Laboratories, Berlin). After a very successful first conference on the same topic in 2011, the new partnership between AINS and the Fetzer Franklin Fund in producing the EmQM13 symposium was able to further expand interest in the promise of emergent quantum mechanics. The symposium consisted of two parts, an opening evening addressing the general public, and the scientific program of the conference proper. The opening evening took place at the Great Ceremonial Hall (Grosser Festsaal) of the Austrian Academy of Sciences, and it presented talks and a panel discussion on ''The Future of Quantum Mechanics'' with three distinguished speakers: Stephen Adler (Princeton), Gerard 't Hooft (Utrecht) and Masanao Ozawa (Nagoya). The articles contained in

  4. Fractal supersymmetric QM, Geometric Probability and the Riemann Hypothesis

    CERN Document Server

    Castro, C

    2004-01-01

    The Riemann's hypothesis (RH) states that the nontrivial zeros of the Riemann zeta-function are of the form $ s_n =1/2+i\\lambda_n $. Earlier work on the RH based on supersymmetric QM, whose potential was related to the Gauss-Jacobi theta series, allows to provide the proper framework to construct the well defined algorithm to compute the probability to find a zero (an infinity of zeros) in the critical line. Geometric probability theory furnishes the answer to the very difficult question whether the probability that the RH is true is indeed equal to unity or not. To test the validity of this geometric probabilistic framework to compute the probability if the RH is true, we apply it directly to the the hyperbolic sine function $ \\sinh (s) $ case which obeys a trivial analog of the RH (the HSRH). Its zeros are equally spaced in the imaginary axis $ s_n = 0 + i n \\pi $. The geometric probability to find a zero (and an infinity of zeros) in the imaginary axis is exactly unity. We proceed with a fractal supersymme...

  5. Omics Analyses of Trichoderma reesei CBS999.97 and QM6a Indicate the Relevance of Female Fertility to Carbohydrate-Active Enzyme and Transporter Levels.

    Science.gov (United States)

    Tisch, Doris; Pomraning, Kyle R; Collett, James R; Freitag, Michael; Baker, Scott E; Chen, Chia-Ling; Hsu, Paul Wei-Che; Chuang, Yu Chien; Schuster, Andre; Dattenböck, Christoph; Stappler, Eva; Sulyok, Michael; Böhmdorfer, Stefan; Oberlerchner, Josua; Wang, Ting-Fang; Schmoll, Monika

    2017-11-15

    The filamentous fungus Trichoderma reesei is found predominantly in the tropics but also in more temperate regions, such as Europe, and is widely known as a producer of large amounts of plant cell wall-degrading enzymes. We sequenced the genome of the sexually competent isolate CBS999.97, which is phenotypically different from the female sterile strain QM6a but can cross sexually with QM6a. Transcriptome data for growth on cellulose showed that entire carbohydrate-active enzyme (CAZyme) families are consistently differentially regulated between these strains. We evaluated backcrossed strains of both mating types, which acquired female fertility from CBS999.97 but maintained a mostly QM6a genetic background, and we could thereby distinguish between the effects of strain background and female fertility or mating type. We found clear regulatory differences associated with female fertility and female sterility, including regulation of CAZyme and transporter genes. Analysis of carbon source utilization, transcriptomes, and secondary metabolites in these strains revealed that only a few changes in gene regulation are consistently correlated with different mating types. Different strain backgrounds (QM6a versus CBS999.97) resulted in the most significant alterations in the transcriptomes and in carbon source utilization, with decreased growth of CBS999.97 on several amino acids (for example proline or alanine), which further correlated with the downregulation of genes involved in the respective pathways. In combination, our findings support a role of fertility-associated processes in physiology and gene regulation and are of high relevance for the use of sexual crossing in combining the characteristics of two compatible strains or quantitative trait locus (QTL) analysis. IMPORTANCE Trichoderma reesei is a filamentous fungus with a high potential for secretion of plant cell wall-degrading enzymes. We sequenced the genome of the fully fertile field isolate CBS999.97 and

  6. Electron dynamics in complex environments with real-time time dependent density functional theory in a QM-MM framework

    International Nuclear Information System (INIS)

    Morzan, Uriel N.; Ramírez, Francisco F.; Scherlis, Damián A.; Oviedo, M. Belén; Sánchez, Cristián G.; Lebrero, Mariano C. González

    2014-01-01

    This article presents a time dependent density functional theory (TDDFT) implementation to propagate the Kohn-Sham equations in real time, including the effects of a molecular environment through a Quantum-Mechanics Molecular-Mechanics (QM-MM) hamiltonian. The code delivers an all-electron description employing Gaussian basis functions, and incorporates the Amber force-field in the QM-MM treatment. The most expensive parts of the computation, comprising the commutators between the hamiltonian and the density matrix—required to propagate the electron dynamics—, and the evaluation of the exchange-correlation energy, were migrated to the CUDA platform to run on graphics processing units, which remarkably accelerates the performance of the code. The method was validated by reproducing linear-response TDDFT results for the absorption spectra of several molecular species. Two different schemes were tested to propagate the quantum dynamics: (i) a leap-frog Verlet algorithm, and (ii) the Magnus expansion to first-order. These two approaches were confronted, to find that the Magnus scheme is more efficient by a factor of six in small molecules. Interestingly, the presence of iron was found to seriously limitate the length of the integration time step, due to the high frequencies associated with the core-electrons. This highlights the importance of pseudopotentials to alleviate the cost of the propagation of the inner states when heavy nuclei are present. Finally, the methodology was applied to investigate the shifts induced by the chemical environment on the most intense UV absorption bands of two model systems of general relevance: the formamide molecule in water solution, and the carboxy-heme group in Flavohemoglobin. In both cases, shifts of several nanometers are observed, consistently with the available experimental data

  7. Status of neutron cross sections of transactinium isotopes in the resonance region - linear accelerator measurements

    International Nuclear Information System (INIS)

    James, G.D.

    1976-01-01

    A review of the status of transactinium isotope cross sections in the resonance region and of resolved resonance parameters is given by summarising the work submitted by fourteen contributors and also by highlighting other work where notable progress has been made in our knowledge of neutron resonance phenomena. (author)

  8. Evolution of the solar wind acceleration region during 1990-1994

    International Nuclear Information System (INIS)

    Tokumaru, Munetoshi; Kondo, Tetsuro; Takaba, Hiroshi; Mori, Hirotaka; Tanaka, Takashi

    1996-01-01

    The single-station measurements of interplanetary scintillation (IPS) at 2GHz and 8GHz using the Kashima radio telescope are used to study the distribution of the solar wind velocity and density fluctuations near the sun. Wind velocities derived from our IPS data with the IPS co-spectrum method show a radial increase in the distance range between 10 and 30 Rs (solar radii). From the scintillation index analysis, it is found that the radial fall of density fluctuations in the solar wind is described by the power-law function. A series of Kashima IPS observations reveals that a pronounced change in velocity and turbulence level occurs at the polar region of the sun during 1990-1994. That is, the high-speed wind and the reduced-turbulence region develop there as the solar activity declines. This fact is consistent with the long-term evolution of the coronal magnetic structure inferred from He1083nm observations

  9. Advances in quantum and molecular mechanical (QM/MM) simulations for organic and enzymatic reactions.

    Science.gov (United States)

    Acevedo, Orlando; Jorgensen, William L

    2010-01-19

    Application of combined quantum and molecular mechanical (QM/MM) methods focuses on predicting activation barriers and the structures of stationary points for organic and enzymatic reactions. Characterization of the factors that stabilize transition structures in solution and in enzyme active sites provides a basis for design and optimization of catalysts. Continued technological advances allowed for expansion from prototypical cases to mechanistic studies featuring detailed enzyme and condensed-phase environments with full integration of the QM calculations and configurational sampling. This required improved algorithms featuring fast QM methods, advances in computing changes in free energies including free-energy perturbation (FEP) calculations, and enhanced configurational sampling. In particular, the present Account highlights development of the PDDG/PM3 semi-empirical QM method, computation of multi-dimensional potentials of mean force (PMF), incorporation of on-the-fly QM in Monte Carlo (MC) simulations, and a polynomial quadrature method for efficient modeling of proton-transfer reactions. The utility of this QM/MM/MC/FEP methodology is illustrated for a variety of organic reactions including substitution, decarboxylation, elimination, and pericyclic reactions. A comparison to experimental kinetic results on medium effects has verified the accuracy of the QM/MM approach in the full range of solvents from hydrocarbons to water to ionic liquids. Corresponding results from ab initio and density functional theory (DFT) methods with continuum-based treatments of solvation reveal deficiencies, particularly for protic solvents. Also summarized in this Account are three specific QM/MM applications to biomolecular systems: (1) a recent study that clarified the mechanism for the reaction of 2-pyrone derivatives catalyzed by macrophomate synthase as a tandem Michael-aldol sequence rather than a Diels-Alder reaction, (2) elucidation of the mechanism of action of fatty

  10. COROTATING INTERACTION REGION ASSOCIATED SUPRATHERMAL HELIUM ION ENHANCEMENTS AT 1 AU: EVIDENCE FOR LOCAL ACCELERATION AT THE COMPRESSION REGION TRAILING EDGE

    International Nuclear Information System (INIS)

    Ebert, R. W.; Dayeh, M. A.; Desai, M. I.; Mason, G. M.

    2012-01-01

    We examined the temporal profiles and peak intensities for 73 corotating interaction region (CIR)-associated suprathermal (∼0.1-8 MeV nucleon –1 ) helium (He) ion enhancements identified at STEREO-A, STEREO-B, and/or Advanced Composition Explorer between 2007 and 2010. We found that in most events the peak He intensity times were well organized by the CIR compression region trailing edge, regardless of whether or not a reverse shock was present. Out of these events, 19% had their 0.193 MeV nucleon –1 He intensities peak within 1 hr and 50% within 4.75 hr of the CIR trailing edge, the distribution having a 1σ value of 7.3 hr. Events with a 0.193 MeV nucleon –1 He intensity peak time within 1σ of the CIR trailing edge showed a positive correlation between the ∼0.1 and 0.8 MeV nucleon –1 He peak intensities and magnetic compression ratios in events both with and without a reverse shock. The peak intensities in all other events showed little to moderate correlation between these parameters. Our results provide evidence that some fraction of the CIR-associated –1 He intensity enhancements observed at 1 AU are locally driven. We suggest an extended source for the CIR-associated energetic particles observed at 1 AU where the –1 ions are accelerated locally at or near the CIR trailing edge, the intensities being proportional to the local compression ratio strength, while the >MeV particles are likely accelerated at CIR-driven shocks beyond Earth orbit.

  11. Load-Unload Response Ratio and Accelerating Moment/Energy Release Critical Region Scaling and Earthquake Prediction

    Science.gov (United States)

    Yin, X. C.; Mora, P.; Peng, K.; Wang, Y. C.; Weatherley, D.

    The main idea of the Load-Unload Response Ratio (LURR) is that when a system is stable, its response to loading corresponds to its response to unloading, whereas when the system is approaching an unstable state, the response to loading and unloading becomes quite different. High LURR values and observations of Accelerating Moment/Energy Release (AMR/AER) prior to large earthquakes have led different research groups to suggest intermediate-term earthquake prediction is possible and imply that the LURR and AMR/AER observations may have a similar physical origin. To study this possibility, we conducted a retrospective examination of several Australian and Chinese earthquakes with magnitudes ranging from 5.0 to 7.9, including Australia's deadly Newcastle earthquake and the devastating Tangshan earthquake. Both LURR values and best-fit power-law time-to-failure functions were computed using data within a range of distances from the epicenter. Like the best-fit power-law fits in AMR/AER, the LURR value was optimal using data within a certain epicentral distance implying a critical region for LURR. Furthermore, LURR critical region size scales with mainshock magnitude and is similar to the AMR/AER critical region size. These results suggest a common physical origin for both the AMR/AER and LURR observations. Further research may provide clues that yield an understanding of this mechanism and help lead to a solid foundation for intermediate-term earthquake prediction.

  12. Stormtime and Interplanetary Magnetic Field Drivers of Wave and Particle Acceleration Processes in the Magnetosphere-Ionosphere Transition Region

    Science.gov (United States)

    Hatch, Spencer Mark

    The magnetosphere-ionosphere (M-I) transition region is the several thousand-kilometer stretch between the cold, dense and variably resistive region of ionized atmospheric gases beginning tens of kilometers above the terrestrial surface, and the hot, tenuous, and conductive plasmas that interface with the solar wind at higher altitudes. The M-I transition region is therefore the site through which magnetospheric conditions, which are strongly susceptible to solar wind dynamics, are communicated to ionospheric plasmas, and vice versa. We systematically study the influence of geomagnetic storms on energy input, electron precipitation, and ion outflow in the M-I transition region, emphasizing the role of inertial Alfven waves both as a preferred mechanism for dynamic (instead of static) energy transfer and particle acceleration, and as a low-altitude manifestation of high-altitude interaction between the solar wind and the magnetosphere, as observed by the FAST satellite. Via superposed epoch analysis and high-latitude distributions derived as a function of storm phase, we show that storm main and recovery phase correspond to strong modulations of measures of Alfvenic activity in the vicinity of the cusp as well as premidnight. We demonstrate that storm main and recovery phases occur during 30% of the four-year period studied, but together account for more than 65% of global Alfvenic energy deposition and electron precipitation, and more than 70% of the coincident ion outflow. We compare observed interplanetary magnetic field (IMF) control of inertial Alfven wave activity with Lyon-Fedder-Mobarry global MHD simulations predicting that southward IMF conditions lead to generation of Alfvenic power in the magnetotail, and that duskward IMF conditions lead to enhanced prenoon Alfvenic power in the Northern Hemisphere. Observed and predicted prenoon Alfvenic power enhancements contrast with direct-entry precipitation, which is instead enhanced postnoon. This situation

  13. Failed Radiatively Accelerated Dusty Outflow Model of the Broad Line Region in Active Galactic Nuclei. I. Analytical Solution

    Energy Technology Data Exchange (ETDEWEB)

    Czerny, B.; Panda, S.; Wildy, C.; Sniegowska, M. [Center for Theoretical Physics, Polish Academy of Sciences, Al. Lotników 32/46, 02-668 Warsaw (Poland); Li, Yan-Rong; Wang, J.-M. [Key Laboratory for Particle Astrophysics, Institute of High Energy Physics, Chinese Academy of Sciences, 19B Yuquan Road, Beijing 100049 (China); Hryniewicz, K.; Sredzinska, J. [Copernicus Astronomical Center, Polish Academy of Sciences, Bartycka 18, 00-716 Warsaw (Poland); Karas, V., E-mail: bcz@cft.edu.pl [Astronomical Institute, Academy of Sciences, Bocni II 1401, CZ-141 00 Prague (Czech Republic)

    2017-09-10

    The physical origin of the broad line region in active galactic nuclei is still unclear despite many years of observational studies. The reason is that the region is unresolved, and the reverberation mapping results imply a complex velocity field. We adopt a theory-motivated approach to identify the principal mechanism responsible for this complex phenomenon. We consider the possibility that the role of dust is essential. We assume that the local radiation pressure acting on the dust in the accretion disk atmosphere launches the outflow of material, but higher above the disk the irradiation from the central parts causes dust evaporation and a subsequent fallback. This failed radiatively accelerated dusty outflow is expected to represent the material forming low ionization lines. In this paper we formulate simple analytical equations to describe the cloud motion, including the evaporation phase. The model is fully described just by the basic parameters of black hole mass, accretion rate, black hole spin, and viewing angle. We study how the spectral line generic profiles correspond to this dynamic. We show that the virial factor calculated from our model strongly depends on the black hole mass in the case of enhanced dust opacity, and thus it then correlates with the line width. This could explain why the virial factor measured in galaxies with pseudobulges differs from that obtained from objects with classical bulges, although the trend predicted by the current version of the model is opposite to the observed trend.

  14. Accelerator complex for a radioactive ion beam facility at ATLAS

    International Nuclear Information System (INIS)

    Nolen, J.A.

    1995-01-01

    Since the superconducting heavy ion linac ATLAS is an ideal post-accelerator for radioactive beams, plans are being developed for expansion of the facility with the addition of a driver accelerator, a production target/ion source combination, and a low q/m pre-accelerator for radioactive ions. A working group including staff from the ANL Physics Division and current ATLAS users are preparing a radioactive beam facility proposal. The present paper reviews the specifications of the accelerators required for the facility

  15. LINEAR ACCELERATOR

    Science.gov (United States)

    Christofilos, N.C.; Polk, I.J.

    1959-02-17

    Improvements in linear particle accelerators are described. A drift tube system for a linear ion accelerator reduces gap capacity between adjacent drift tube ends. This is accomplished by reducing the ratio of the diameter of the drift tube to the diameter of the resonant cavity. Concentration of magnetic field intensity at the longitudinal midpoint of the external sunface of each drift tube is reduced by increasing the external drift tube diameter at the longitudinal center region.

  16. Photodissociation dynamics of CH3C(O)SH in argon matrix: A QM/MM nonadiabatic dynamics simulation

    Science.gov (United States)

    Xia, Shu-Hua; Liu, Xiang-Yang; Fang, Qiu; Cui, Ganglong

    2015-11-01

    In this work, we have first employed the combined quantum mechanics/molecular mechanics (QM/MM) method to study the photodissociation mechanism of thioacetic acid CH3C(O)SH in the S1, T1, and S0 states in argon matrix. CH3C(O)SH is treated quantum mechanically using the complete active space self-consistent field and complete active space second-order perturbation theory methods; argon matrix is described classically using Lennard-Jones potentials. We find that the C-S bond fission is predominant due to its small barriers of ca. 3.0 and 1.0 kcal/mol in the S1 and T1 states. It completely suppresses the nearby C—C bond fission. After the bond fission, the S1 radical pair of CH3CO and SH can decay to the S0 and T1 states via internal conversion and intersystem crossing, respectively. In the S0 state, the radical pair can either recombine to form CH3C(O)SH or proceed to form molecular products of CH2CO and H2S. We have further employed our recently developed QM/MM generalized trajectory-based surface-hopping method to simulate the photodissociation dynamics of CH3C(O)SH. In 1 ps dynamics simulation, 56% trajectories stay at the Franck-Condon region; the S1 C—S bond fission takes place in the remaining 44% trajectories. Among all nonadiabatic transitions, the S1 → S0 internal conversion is major (55%) but the S1 → T1 intersystem crossing is still comparable and cannot be ignored, which accounts for 28%. Finally, we have found a radical channel generating the molecular products of CH2CO and H2S, which is complementary to the concerted molecular channel. The present work sets the stage for simulating photodissociation dynamics of similar thio-carbonyl systems in matrix.

  17. Stepwise catalytic mechanism via short-lived intermediate inferred from combined QM/MM MERP and PES calculations on retaining glycosyltransferase ppGalNAcT2.

    Science.gov (United States)

    Trnka, Tomáš; Kozmon, Stanislav; Tvaroška, Igor; Koča, Jaroslav

    2015-04-01

    The glycosylation of cell surface proteins plays a crucial role in a multitude of biological processes, such as cell adhesion and recognition. To understand the process of protein glycosylation, the reaction mechanisms of the participating enzymes need to be known. However, the reaction mechanism of retaining glycosyltransferases has not yet been sufficiently explained. Here we investigated the catalytic mechanism of human isoform 2 of the retaining glycosyltransferase polypeptide UDP-GalNAc transferase by coupling two different QM/MM-based approaches, namely a potential energy surface scan in two distance difference dimensions and a minimum energy reaction path optimisation using the Nudged Elastic Band method. Potential energy scan studies often suffer from inadequate sampling of reactive processes due to a predefined scan coordinate system. At the same time, path optimisation methods enable the sampling of a virtually unlimited number of dimensions, but their results cannot be unambiguously interpreted without knowledge of the potential energy surface. By combining these methods, we have been able to eliminate the most significant sources of potential errors inherent to each of these approaches. The structural model is based on the crystal structure of human isoform 2. In the QM/MM method, the QM region consists of 275 atoms, the remaining 5776 atoms were in the MM region. We found that ppGalNAcT2 catalyzes a same-face nucleophilic substitution with internal return (SNi). The optimized transition state for the reaction is 13.8 kcal/mol higher in energy than the reactant while the energy of the product complex is 6.7 kcal/mol lower. During the process of nucleophilic attack, a proton is synchronously transferred to the leaving phosphate. The presence of a short-lived metastable oxocarbenium intermediate is likely, as indicated by the reaction energy profiles obtained using high-level density functionals.

  18. Stepwise catalytic mechanism via short-lived intermediate inferred from combined QM/MM MERP and PES calculations on retaining glycosyltransferase ppGalNAcT2.

    Directory of Open Access Journals (Sweden)

    Tomáš Trnka

    2015-04-01

    Full Text Available The glycosylation of cell surface proteins plays a crucial role in a multitude of biological processes, such as cell adhesion and recognition. To understand the process of protein glycosylation, the reaction mechanisms of the participating enzymes need to be known. However, the reaction mechanism of retaining glycosyltransferases has not yet been sufficiently explained. Here we investigated the catalytic mechanism of human isoform 2 of the retaining glycosyltransferase polypeptide UDP-GalNAc transferase by coupling two different QM/MM-based approaches, namely a potential energy surface scan in two distance difference dimensions and a minimum energy reaction path optimisation using the Nudged Elastic Band method. Potential energy scan studies often suffer from inadequate sampling of reactive processes due to a predefined scan coordinate system. At the same time, path optimisation methods enable the sampling of a virtually unlimited number of dimensions, but their results cannot be unambiguously interpreted without knowledge of the potential energy surface. By combining these methods, we have been able to eliminate the most significant sources of potential errors inherent to each of these approaches. The structural model is based on the crystal structure of human isoform 2. In the QM/MM method, the QM region consists of 275 atoms, the remaining 5776 atoms were in the MM region. We found that ppGalNAcT2 catalyzes a same-face nucleophilic substitution with internal return (SNi. The optimized transition state for the reaction is 13.8 kcal/mol higher in energy than the reactant while the energy of the product complex is 6.7 kcal/mol lower. During the process of nucleophilic attack, a proton is synchronously transferred to the leaving phosphate. The presence of a short-lived metastable oxocarbenium intermediate is likely, as indicated by the reaction energy profiles obtained using high-level density functionals.

  19. Structural insight into RNA catalysis revealed by molecular dynamics simulations and QM/MM calculation

    Czech Academy of Sciences Publication Activity Database

    Banáš, P.; Walter, N.G.; Šponer, Jiří; Otyepka, Michal

    2009-01-01

    Roč. 26, č. 6 (2009), s. 816 ISSN 0739-1102. [The 17th Conversation . 16.06.2009-20.06.2009, Albany] Institutional research plan: CEZ:AV0Z50040507; CEZ:AV0Z50040702 Keywords : QM/MM * RNA Subject RIV: BO - Biophysics

  20. Final report of APMP.QM-S6: clenbuterol in porcine meat

    Science.gov (United States)

    Sin, D. W.-M.; Ho, C.; Yip, Y.-C.

    2016-01-01

    At the CCQM Organic Analysis Working Group (OAWG) Meeting held in April 2012 and the APMP TCQM Meeting held in November 2012, an APMP supplementary comparison (APMP.QM-S6) on the determination of clenbuterol in porcine meat was supported by the OAWG and APMP TCQM. This comparison was organized by the Government Laboratory, Hong Kong. In order to accommodate a wider participation, a pilot study (APMP.QM-P22) was run in parallel to APMP.QM-S6. This study provided the means for assessing the measurement capabilities for determination of low-polarity measurands in a procedure that requires extraction, clean-up, analytical separation, and selective detection in a food matrix. A total of 7 institutes registered for the supplementary comparison and 6 of them submitted their results. 4 results were included for SCRV calculation. All participating laboratories applied Isotope Dilution Liquid Chromatography-Tandem Mass Spectrometry (ID-LCMS/MS) technique with clenbuterol-d9 as internal standard spiked for quantitation in this programme. KEY WORDS FOR SEARCH APMP.QM-S6 and Clenbuterol Main text To reach the main text of this paper, click on Final Report. Note that this text is that which appears in Appendix B of the BIPM key comparison database kcdb.bipm.org/. The final report has been peer-reviewed and approved for publication by the CCQM, according to the provisions of the CIPM Mutual Recognition Arrangement (CIPM MRA).

  1. BUILDING A RELATIONSHIP WITH THE CUSTOMER: A CRM VERSUS A QM PERSPECTIVE

    Directory of Open Access Journals (Sweden)

    Sandru Ioana Maria Diana

    2009-05-01

    Full Text Available Customer relationship management (CRM and quality management (QM both define the customer as being the focus of all business activities. The question arises on how these two concepts work together. In the change defined environment, where getting ahead

  2. Pre-discovery detections and progenitor candidate for SPIRITS17qm in NGC 1365

    Science.gov (United States)

    Jencson, J. E.; Bond, H. E.; Adams, S. M.; Kasliwal, M. M.

    2018-04-01

    We report the detection of a pre-discovery outburst of SPIRITS17qm, discovered as part of the ongoing Spitzer InfraRed Intensive Transients Survey (SPIRITS) using the 3.6 and 4.5 micron imaging channels ([3.6] and [4.5]) of the Infrared Array Camera (IRAC) on the Spitzer Space Telescope (ATel #11575).

  3. Multiscale Treatment for the Molecular Mechanism of a Diels-Alder Reaction in Solution: A QM/MM-MD Study.

    Science.gov (United States)

    Soto-Delgado, Jorge; Tapia, Ricardo A; Torras, Juan

    2016-10-11

    Thermodynamics and the solvent role in the acceleration of the Diels-Alder reaction between cyclopentadiene (CPD) and methyl vinyl ketone (MVK) have been revisited. In this work we use an ab initio hybrid QM/MM-MD scheme combined with multiple steered molecular dynamics to extract the free energy pofile in water and methanol using the bidirectional Minh-Adib estimator. We obtain 18.7 kcal mol -1 and 20.8 kcal mol -1 free energy barrier for the reaction in water and methanol, respectively. This methodology reproduces experimental values with an absolute error of about 0.8 kcal mol -1 . The experimental difference between the activation free-energy barriers of water and methanol is also reproduced with an absolute error of about 0.1 kcal mol -1 . We explore the charge transfer evolution along reaction coordinates to characterize the electronic behavior for this reaction. It is shown that the solvent molecules around the reaction system produce a global polarization along the reaction coordinate which is consistent with the solvent polarity. The results highlight the role of hydrogen bonding formed in the transition state to stabilize the system charge reorganization in the reaction process.

  4. Report of the joint seminar on heavy-ion nuclear physics and nuclear chemistry in the energy region of tandem accelerators (II)

    International Nuclear Information System (INIS)

    1986-04-01

    A meeting of the second joint seminar on Heavy-Ion Nuclear Physics and Nuclear Chemistry in the Energy Region of Tandem Accelerators was held after an interval of two years at the Tokai Research Establishment of the JAERI, for three days from January 9 to 11, 1986. In the seminar, about 70 nuclear physicists and nuclear chemists of JAERI and other Institutes participated, and 38 papers were presented. These include general reviews and topical subjects which have been developed intensively in recent years, as well as the new results obtained by using the JAERI tandem accelerator. This report is a collection of the papers presented to the seminar. (author)

  5. Exploring the Inner Acceleration Region of Solar Wind: A Study Based on Coronagraphic UV and Visible Light Data

    Science.gov (United States)

    Bemporad, A.

    2017-09-01

    This work combined coronagraphic visible light (VL) and UV data to provide with an unprecedented view of the inner corona where the nascent solar wind is accelerated. The UV (H I Lyα) and VL (polarized brightness) images (reconstructed with SOHO/UVCS, LASCO, and Mauna Loa data) have been analyzed with the Doppler dimming technique to provide for the first time daily 2D images of the radial wind speed between 1 and 6 R ⊙ over 1 month of observations. Results show that both polar and equatorial regions are characterized at the base of the corona by plasma outflows at speeds > 100 km s-1. The plasma is then decelerated within ˜1.5 R ⊙ at the poles and ˜2.0 R ⊙ at the equator, where local minima of the expansion speeds are reached, and gently reaccelerated higher up, reaching speeds typical of fast and slow wind components. The mass flux is highly variable with latitude and time at the equator and more uniform and stable over the poles. The polar flow is asymmetric, with speeds above the south pole lower than those above the north pole. A correlation (anticorrelation) between the wind speed and its density is found below (above) ˜1.8 R ⊙. The 2D distribution of forces responsible for deceleration and reacceleration of solar wind is provided and interpreted in terms of Alfvén waves. These results provide a possible connection between small-scale outflows reported with other instruments at the base of the corona and bulk wind flows measured higher up.

  6. Using Directional Diffusion Coefficients for Nonlinear Diffusion Acceleration of the First Order SN Equations in Near-Void Regions

    Energy Technology Data Exchange (ETDEWEB)

    Schunert, Sebastian; Hammer, Hans; Lou, Jijie; Wang, Yaqi; Ortensi, Javier; Gleicher, Frederick; Baker, Benjamin; DeHart, Mark; Martineau, Richard

    2016-11-01

    The common definition of the diffusion coeffcient as the inverse of three times the transport cross section is not compat- ible with voids. Morel introduced a non-local tensor diffusion coeffcient that remains finite in voids[1]. It can be obtained by solving an auxiliary transport problem without scattering or fission. Larsen and Trahan successfully applied this diffusion coeffcient for enhancing the accuracy of diffusion solutions of very high temperature reactor (VHTR) problems that feature large, optically thin channels in the z-direction [2]. It is demonstrated that a significant reduction of error can be achieved in particular in the optically thin region. Along the same line of thought, non-local diffusion tensors are applied modeling the TREAT reactor confirming the findings of Larsen and Trahan [3]. Previous work of the authors have introduced a flexible Nonlinear-Diffusion Acceleration (NDA) method for the first order S N equations discretized with the discontinuous finite element method (DFEM), [4], [5], [6]. This NDA method uses a scalar diffusion coeffcient in the low-order system that is obtained as the flux weighted average of the inverse transport cross section. Hence, it su?ers from very large and potentially unbounded diffusion coeffcients in the low order problem. However, it was noted that the choice of the diffusion coeffcient does not influence consistency of the method at convergence and hence the di?usion coeffcient is essentially a free parameter. The choice of the di?usion coeffcient does, however, affect the convergence behavior of the nonlinear di?usion iterations. Within this work we use Morel’s non-local di?usion coef- ficient in the aforementioned NDA formulation in lieu of the flux weighted inverse of three times the transport cross section. The goal of this paper is to demonstrate that significant en- hancement of the spectral properties of NDA can be achieved in near void regions. For testing the spectral properties of the NDA

  7. Extrinsic and Intrinsic Brain Network Connectivity Maintains Cognition across the Lifespan Despite Accelerated Decay of Regional Brain Activation.

    Science.gov (United States)

    Tsvetanov, Kamen A; Henson, Richard N A; Tyler, Lorraine K; Razi, Adeel; Geerligs, Linda; Ham, Timothy E; Rowe, James B

    2016-03-16

    The maintenance of wellbeing across the lifespan depends on the preservation of cognitive function. We propose that successful cognitive aging is determined by interactions both within and between large-scale functional brain networks. Such connectivity can be estimated from task-free functional magnetic resonance imaging (fMRI), also known as resting-state fMRI (rs-fMRI). However, common correlational methods are confounded by age-related changes in the neurovascular signaling. To estimate network interactions at the neuronal rather than vascular level, we used generative models that specified both the neural interactions and a flexible neurovascular forward model. The networks' parameters were optimized to explain the spectral dynamics of rs-fMRI data in 602 healthy human adults from population-based cohorts who were approximately uniformly distributed between 18 and 88 years (www.cam-can.com). We assessed directed connectivity within and between three key large-scale networks: the salience network, dorsal attention network, and default mode network. We found that age influences connectivity both within and between these networks, over and above the effects on neurovascular coupling. Canonical correlation analysis revealed that the relationship between network connectivity and cognitive function was age-dependent: cognitive performance relied on neural dynamics more strongly in older adults. These effects were driven partly by reduced stability of neural activity within all networks, as expressed by an accelerated decay of neural information. Our findings suggest that the balance of excitatory connectivity between networks, and the stability of intrinsic neural representations within networks, changes with age. The cognitive function of older adults becomes increasingly dependent on these factors. Maintaining cognitive function is critical to successful aging. To study the neural basis of cognitive function across the lifespan, we studied a large population

  8. A QM/MM–Based Computational Investigation on the Catalytic Mechanism of Saccharopine Reductase

    OpenAIRE

    Almasi, Joel N.; Bushnell, Eric A.C.; Gauld, James W.

    2011-01-01

    Saccharopine reductase from Magnaporthe grisea, an NADPH-containing enzyme in the α-aminoadipate pathway, catalyses the formation of saccharopine, a precursor to L-lysine, from the substrates glutamate and α-aminoadipate-δ-semialdehyde. Its catalytic mechanism has been investigated using quantum mechanics/molecular mechanics (QM/MM) ONIOM-based approaches. In particular, the overall catalytic pathway has been elucidated and the effects of electron correlation and the anisotropic polar protein...

  9. A QM/MM refinement of an experimental DNA structure with metal-mediated base pairs.

    Science.gov (United States)

    Kumbhar, Sadhana; Johannsen, Silke; Sigel, Roland K O; Waller, Mark P; Müller, Jens

    2013-10-01

    A series of hybrid quantum mechanical/molecular mechanical (QM/MM) calculations was performed on models of a DNA duplex with artificial silver(I)-mediated imidazole base pairs. The optimized structures were compared to the original experimental NMR structure (Nat. Chem. 2 (2010) 229-234). The metal⋯metal distances are significantly shorter (~0.5Å) in the QM/MM model than in the original NMR structure. As a result, argentophilic interactions are feasible between the silver(I) ions of neighboring metal-mediated base pairs. Using the computationally determined metal⋯metal distances, a re-refined NMR solution structure of the DNA duplex was obtained. In this new NMR structure, all experimental constraints remain fulfilled. The new NMR structure shows less deviation from the regular B-type conformation than the original one. This investigation shows that the application of QM/MM models to generate additional constraints to be used during NMR structural refinements represents an elegant approach to obtaining high-resolution NMR structures. Copyright © 2013 Elsevier Inc. All rights reserved.

  10. Direct hydride shift mechanism and stereoselectivity of P450nor confirmed by QM/MM calculations.

    Science.gov (United States)

    Krámos, Balázs; Menyhárd, Dóra K; Oláh, Julianna

    2012-01-19

    Nitric oxide reductase (P450(nor)) found in Fusarium oxysporum catalyzes the reduction of nitric oxide to N(2)O in a multistep process. The reducing agent, NADH, is bound in the distal pocket of the enzyme, and direct hydride transfer occurs from NADH to the nitric oxide bound heme enzyme, forming intermediate I. Here we studied the possibility of hydride transfer from NADH to both the nitrogen and oxygen of the heme-bound nitric oxide, using quantum chemical and combined quantum mechanics/molecular mechanics (QM/MM) calculations, on two different protein models, representing both possible stereochemistries, a syn- and an anti-NADH arrangement. All calculations clearly favor hydride transfer to the nitrogen of nitric oxide, and the QM-only barrier and kinetic isotope effects are good agreement with the experimental values of intermediate I formation. We obtained higher barriers in the QM/MM calculations for both pathways, but hydride transfer to the nitrogen of nitric oxide is still clearly favored. The barriers obtained for the syn, Pro-R conformation of NADH are lower and show significantly less variation than the barriers obtained in the case of anti conformation. The effect of basis set and wide range of functionals on the obtained results are also discussed.

  11. Particle acceleration in regions of magnetic flux emergence: a statistical approach using test-particle- and MHD-simulations

    Science.gov (United States)

    Vlahos, Loukas; Archontis, Vasilis; Isliker, Heinz

    We consider 3D nonlinear MHD simulations of an emerging flux tube, from the convection zone into the corona, focusing on the coronal part of the simulations. We first analyze the statistical nature and spatial structure of the electric field, calculating histograms and making use of iso-contour visualizations. Then test-particle simulations are performed for electrons, in order to study heating and acceleration phenomena, as well as to determine HXR emission. This study is done by comparatively exploring quiet, turbulent explosive, and mildly explosive phases of the MHD simulations. Also, the importance of collisional and relativistic effects is assessed, and the role of the integration time is investigated. Particular aim of this project is to verify the quasi- linear assumptions made in standard transport models, and to identify possible transport effects that cannot be captured with the latter. In order to determine the relation of our results to Fermi acceleration and Fokker-Planck modeling, we determine the standard transport coefficients. After all, we find that the electric field of the MHD simulations must be downscaled in order to prevent an un-physically high degree of acceleration, and the value chosen for the scale factor strongly affects the results. In different MHD time-instances we find heating to take place, and acceleration that depends on the level of MHD turbulence. Also, acceleration appears to be a transient phenomenon, there is a kind of saturation effect, and the parallel dynamics clearly dominate the energetics. The HXR spectra are not yet really compatible with observations, we have though to further explore the scaling of the electric field and the integration times used.

  12. Investigation into the Use of the Concept Laser QM System as an In-Situ Research and Evaluation Tool

    Science.gov (United States)

    Bagg, Stacey

    2014-01-01

    The NASA Marshall Space Flight Center (MSFC) is using a Concept Laser Fusing (Cusing) M2 powder bed additive manufacturing system for the build of space flight prototypes and hardware. NASA MSFC is collecting and analyzing data from the M2 QM Meltpool and QM Coating systems for builds. This data is intended to aide in understanding of the powder-bed additive manufacturing process, and in the development of a thermal model for the process. The QM systems are marketed by Concept Laser GmbH as in-situ quality management modules. The QM Meltpool system uses both a high-speed near-IR camera and a photodiode to monitor the melt pool generated by the laser. The software determines from the camera images the size of the melt pool. The camera also measures the integrated intensity of the IR radiation, and the photodiode gives an intensity value based on the brightness of the melt pool. The QM coating system uses a high resolution optical camera to image the surface after each layer has been formed. The objective of this investigation was to determine the adequacy of the QM Meltpool system as a research instrument for in-situ measurement of melt pool size and temperature and its applicability to NASA's objectives in (1) Developing a process thermal model and (2) Quantifying feedback measurements with the intent of meeting quality requirements or specifications. Note that Concept Laser markets the system only as capable of giving an indication of changes between builds, not as an in-situ research and evaluation tool. A secondary objective of the investigation is to determine the adequacy of the QM Coating system as an in-situ layer-wise geometry and layer quality evaluation tool.

  13. Acceleration Test Method for Failure Prediction of the End Cap Contact Region of Sodium Cooled Fast Reactor Fuel Rod

    Energy Technology Data Exchange (ETDEWEB)

    Kim, Hyung-Kyu; Lee, Young-Ho; Lee, Hyun-Seung; Lee, Kang-Hee [Korea Atomic Energy Research Institute, Daejeon (Korea, Republic of)

    2017-05-15

    This paper reports the results of an acceleration test to predict the contact-induced failure that could occur at the cylinder-to-hole joint for the fuel rod of a sodium-cooled fast reactor (SFR). To incorporate the fuel life of the SFR currently under development at KAERI (around 35,000 h), the acceleration test method of reliability engineering was adopted in this work. A finite element method was used to evaluate the flow-induced vibration frequency and amplitude for the test parameter values. Five specimens were tested. The failure criterion during the life of the SFR fuel was applied. The S-N curve of the HT-9, the material of concern, was used to obtain the acceleration factor. As a result, a test time of 16.5 h was obtained for each specimen. It was concluded that the B{sub 0.004} life would be guaranteed for the SFR fuel rods with 99% confidence if no failure was observed at any of the contact surfaces of the five specimens.

  14. Accelerator physics studies on the effects from an asynchronous beam dump onto the LHC experimental region collimators

    CERN Document Server

    Lari, L; Boccone, V; Bruce, R; Cerutti, F; Rossi, A; Vlachoudis, V; Mereghetti, A; Faus-Golfe, A

    2012-01-01

    Asynchronous beam aborts at the LHC are estimated to occur on average once per year. Accelerator physics studies of asynchronous dumps have been performed at different beam energies and beta-stars. The loss patterns are analyzed in order to identify the losses in particular on the Phase 1 Tertiary Collimators (TCT), since their tungsten-based active jaw insert has a lower damage threshold than the carbon-based other LHC collimators. Settings of the tilt angle of the TCTs are discussed with the aim of reducing the thermal loads on the TCT themselves.

  15. Report of the joint seminar on solid state physics, atomic and molecular physics, and materials science in the energy region of tandem accelerators

    International Nuclear Information System (INIS)

    Kazumata, Yukio

    1993-01-01

    The joint seminar on Solid State Physics, Atomic and Molecular Physics and Materials Science in the Energy Region of Tandem Acceleration was held at Tokai Research Establishment of JAERI, for two days from January 22 to 23, 1991. About 60 physicists and material scientists participated and 18 papers were presented in this seminar. The topics presented in this seminar included lattice defects in semiconductors, ion-solid collisions, atomic collisions by high energy particles, radiation effects on high T c superconducting materials and FCC metals, radiation effects on materials of space and fusion reactors, uranium compounds and superlattice. (J.P.N.)

  16. Chemical Reactivity and Spectroscopy Explored From QM/MM Molecular Dynamics Simulations Using the LIO Code

    Directory of Open Access Journals (Sweden)

    Juan P. Marcolongo

    2018-03-01

    Full Text Available In this work we present the current advances in the development and the applications of LIO, a lab-made code designed for density functional theory calculations in graphical processing units (GPU, that can be coupled with different classical molecular dynamics engines. This code has been thoroughly optimized to perform efficient molecular dynamics simulations at the QM/MM DFT level, allowing for an exhaustive sampling of the configurational space. Selected examples are presented for the description of chemical reactivity in terms of free energy profiles, and also for the computation of optical properties, such as vibrational and electronic spectra in solvent and protein environments.

  17. Chemical reactivity and spectroscopy explored from QM/MM molecular dynamics simulations using the LIO code

    Science.gov (United States)

    Marcolongo, Juan P.; Zeida, Ari; Semelak, Jonathan A.; Foglia, Nicolás O.; Morzan, Uriel N.; Estrin, Dario A.; González Lebrero, Mariano C.; Scherlis, Damián A.

    2018-03-01

    In this work we present the current advances in the development and the applications of LIO, a lab-made code designed for density functional theory calculations in graphical processing units (GPU), that can be coupled with different classical molecular dynamics engines. This code has been thoroughly optimized to perform efficient molecular dynamics simulations at the QM/MM DFT level, allowing for an exhaustive sampling of the configurational space. Selected examples are presented for the description of chemical reactivity in terms of free energy profiles, and also for the computation of optical properties, such as vibrational and electronic spectra in solvent and protein environments.

  18. Cellulase production by two mutant strain of Trichoderma longibrachiatum Qm9414 and Rut C30

    International Nuclear Information System (INIS)

    Blanco, M.J.

    1991-01-01

    Native or pretreated biomass from Onopordum nervosum boiss, has been examined as candidate feedstock for cellulase production by two mutant strain of trichoderma longibrachiatum QM9414 and Rut C30. Batch cultivation methods were evaluated and compared with previous experiments using ball-milled, crystalline cellulose (Solka floc). Batch cultivation of T. longibrachiatum Rut C30 on 55% (W/V) acid pretreated O. nervosum biomass yielded enzyme productivities and activities comparable to those obtained on Solka floc. However, the overall enzyme production performance was lower than on Solka floc at comparable cellulose concentrations. This fact may be due to the accumulation of pretreated by products and lignin in the fermentor.(author)

  19. Combined quantum mechanics/molecular mechanics (QM/MM) simulations for protein-ligand complexes: free energies of binding of water molecules in influenza neuraminidase.

    Science.gov (United States)

    Woods, Christopher J; Shaw, Katherine E; Mulholland, Adrian J

    2015-01-22

    The applicability of combined quantum mechanics/molecular mechanics (QM/MM) methods for the calculation of absolute binding free energies of conserved water molecules in protein/ligand complexes is demonstrated. Here, we apply QM/MM Monte Carlo simulations to investigate binding of water molecules to influenza neuraminidase. We investigate five different complexes, including those with the drugs oseltamivir and peramivir. We investigate water molecules in two different environments, one more hydrophobic and one hydrophilic. We calculate the free-energy change for perturbation of a QM to MM representation of the bound water molecule. The calculations are performed at the BLYP/aVDZ (QM) and TIP4P (MM) levels of theory, which we have previously demonstrated to be consistent with one another for QM/MM modeling. The results show that the QM to MM perturbation is significant in both environments (greater than 1 kcal mol(-1)) and larger in the more hydrophilic site. Comparison with the same perturbation in bulk water shows that this makes a contribution to binding. The results quantify how electronic polarization differences in different environments affect binding affinity and also demonstrate that extensive, converged QM/MM free-energy simulations, with good levels of QM theory, are now practical for protein/ligand complexes.

  20. Isolation and identification of the immune-relevant ribosomal protein L10 (RPL10/QM-like gene) from the large yellow croaker Pseudosciaena crocea (Pisces: Sciaenidae).

    Science.gov (United States)

    Chen, X; Su, Y Q; Wang, J; Liu, M; Niu, S F; Zhong, S P; Qiu, F

    2012-10-15

    In order to investigate the immune role of ribosomal protein L10 (RPL10/QM-like gene) in marine fish, we challenged the large yellow croaker Pseudosciaena (= Larimichthys) crocea, the most important marine fish culture species in China, by injection with a mixture of the bacteria Vibrio harveyi and V. parahaemolyticus (3:1 in volume). Microarray analysis and real-time PCR were performed 24 and 48 h post-challenge to isolate and identify the QM-like gene from the gill P. crocea (designated PcQM). The expression level of the PcQM gene did not changed significantly at 24 h post-challenge, but was significantly downregulated at 48 h post-challenge, suggesting that the gene had an immune-modulatory effect in P. crocea. Full-length PcQM cDNA and genomic sequences were obtained by rapid amplification of cDNA ends (RACE)-PCR. The sequence of the PcQM gene clustered together with those of other QM-like genes from other aquatic organisms, indicating that the QM-like gene is highly conserved in teleosts.

  1. Can Accelerators Accelerate Learning?

    International Nuclear Information System (INIS)

    Santos, A. C. F.; Fonseca, P.; Coelho, L. F. S.

    2009-01-01

    The 'Young Talented' education program developed by the Brazilian State Funding Agency (FAPERJ)[1] makes it possible for high-schools students from public high schools to perform activities in scientific laboratories. In the Atomic and Molecular Physics Laboratory at Federal University of Rio de Janeiro (UFRJ), the students are confronted with modern research tools like the 1.7 MV ion accelerator. Being a user-friendly machine, the accelerator is easily manageable by the students, who can perform simple hands-on activities, stimulating interest in physics, and getting the students close to modern laboratory techniques.

  2. Can Accelerators Accelerate Learning?

    Science.gov (United States)

    Santos, A. C. F.; Fonseca, P.; Coelho, L. F. S.

    2009-03-01

    The 'Young Talented' education program developed by the Brazilian State Funding Agency (FAPERJ) [1] makes it possible for high-schools students from public high schools to perform activities in scientific laboratories. In the Atomic and Molecular Physics Laboratory at Federal University of Rio de Janeiro (UFRJ), the students are confronted with modern research tools like the 1.7 MV ion accelerator. Being a user-friendly machine, the accelerator is easily manageable by the students, who can perform simple hands-on activities, stimulating interest in physics, and getting the students close to modern laboratory techniques.

  3. FT-Raman and QM/MM study of the interaction between histamine and DNA

    International Nuclear Information System (INIS)

    Ruiz-Chica, A.J.; Soriano, A.; Tunon, I.; Sanchez-Jimenez, F.M.; Silla, E.; Ramirez, F.J.

    2006-01-01

    The interaction between histamine and highly polymerized calf-thymus DNA has been investigated using FT-Raman spectroscopy and the hybrid QM/MM (quantum mechanics/molecular mechanics) methodology. Raman spectra of solutions containing histamine and calf-thymus DNA, at different molar ratios, were recorded. Solutions were prepared at physiological settings of pH and ionic strength, using both natural and heavy water as the solvent. The analysis of the spectral changes on the DNA Raman spectra when adding different concentrations of histamine allowed us to identify the reactive sites of DNA and histamine, which were used to built two minor groove and one intercalated binding models. They were further used as starting points of the QM/MM theoretical study. However, minimal energy points were only reached for the two minor groove models. For each optimized structure, we calculated analytical force constants of histamine molecule in order to perform the vibrational dynamics. Normal mode descriptions allowed us to compare calculated wavenumbers for DNA-interacting histamine to those measured in the Raman spectra of DNA-histamine solutions

  4. QM/MM studies of cisplatin complexes with DNA dimer and octamer

    KAUST Repository

    Gkionis, Konstantinos

    2012-08-01

    Hybrid QM/MM calculations on adducts of cisplatin with DNA dimer and octamer are reported. Starting from the crystal structure of a cisplatin-DNA dimer complex and an NMR structure of a cisplatin-DNA octamer complex, several variants of the ONIOM approach are tested, all employing BHandH for the QM part and AMBER for MM. We demonstrate that a generic set of molecular mechanics parameters for description of Pt-coordination can be used within the subtractive ONIOM scheme without loss of accuracy, such that dedicated parameters for new platinum complexes may not be required. Comparison of optimised structures obtained with different strategies indicates that electrostatic embedding is vital for proper description of the complex, while inclusion of water molecules as explicit solvent further improves performance. The resulting DNA structural parameters are in good general agreement with the experimental structure obtained, particularly when the inherent variability in NMR-derived parameters is taken into account. © 2012 Elsevier B.V.

  5. QM/MM study of dislocation—hydrogen/helium interactions in α-Fe

    International Nuclear Information System (INIS)

    Zhao, Yi; Lu, Gang

    2011-01-01

    Impurities such as hydrogen (H) and helium (He) interact strongly with dislocations in metals. Using a multiscale quantum-mechanics/molecular-mechanics (QM/MM) approach, we have examined the interactions between the impurities (H and He) with dislocations (edge and screw) in α-Fe. The impurity trapping at the dislocation core is examined by calculating the impurity-dislocation binding energy and the impurity solution energy. We find that in general both H and He prefer the tetrahedral sites at the dislocation core, as well as in the bulk; the exceptions are due to deformed structures at the dislocation cores. Both H and He have a greater solution energy and binding energy to the edge dislocation than to the screw dislocation. The impurity pipe diffusion along the dislocation core is investigated using the QM/MM nudged-elastic-band method. We find that the diffusion barrier along the screw dislocation is lower than the bulk value for both H and He impurities. For the edge dislocation, although H has similar diffusion barriers as in the bulk, He has much higher diffusion energy barriers compared with the bulk. Finally we have examined the impurity effect on the dislocation mobility. We find that both H and He can lower the Peierls energy barrier for the screw dislocation significantly. The H enhanced dislocation mobility is consistent with experimental observations

  6. The Tūqmāq and the Ming China: The Tūqmāq and the Chinese Relations during the Ming Period (1394–1456

    Directory of Open Access Journals (Sweden)

    Kenzheakhmet N.

    2017-12-01

    Full Text Available Objective: Little is known about diplomatic relations between the Jūchīd Ulūs and Ming China (1368–1644, even though some evidence of early tributary trade relations exists. The first extant Chinese account about the country of Salai (Saray dates to around 1394, when accounts of diplomatic exchange between the Ming court and the Jūchīd Ulūs began to appear in the Ming shilu (The Veritable Records of the Ming. Research materials: This article analyzes the Ming shilu in order to understand the character of Chinese knowledge about the Jūchīd Ulūs during their years of contact between 1394 and 1456. Additional sources like geographic accounts and maps help define the extent of Chinese knowledge about the khanate, clarify the kinds of information that the Chinese sought and the reasons why, and measure the influence of cross-cultural contact on Ming Chinese understanding of the Jūchīd Ulūs. Results and novelty of the research: The Ming shilu suggests that at least by the end of the fourteenth and the early years of the fifteenth century, Salai (Saray became an integral, and possibly the most important, element in the name that the Ming court used for the country of the Jūchīd Ulūs. The Persian and Mongol historians used the term Tūqmāq and Togmog to refer to the Jūchīd Ulūs, while Ming Chinese historians used the term Tuohema to refer to the Jūchīd Ulūs or the whole Dasht-i Qipchāq, in post-Mongol Central Eurasia. The diplomatic contact between Ming China and the Tuohuma occurred through the Chinese system of tribute trade during the mid-fifteenth century. Under the reign of Yongle (1402–1424, Zhengtong (1435–1449, and Jingtai (1449–1457, the foundations for a flourishing relationship between Ming China and the Jūchīd Ulūs were established. At that time, the Chinese knew the Jūchīd Ulūs by the name Salai (Saray and Tuohuma (Tūqmāq. Despite the political turmoil that erupted after the fall of the Jūchīd Ul

  7. Effect of the Global Topology of the Interplanetary Magnetic Field on the Properties of Impulsive Acceleration Processes in Distant Regions of the Earth's Magnetospheric Tail

    International Nuclear Information System (INIS)

    Grigorenko, E.E.; Zelenyi, L.M.; Fedorov, A.O.; Sauvaud, J.-A.

    2005-01-01

    The paper is devoted to a statistical study of high-speed ion beams (beamlets) observed by the Interball-1 and Interball-2 satellites in the boundary region of the plasma sheet of the geomagnetic tail and in the high-latitude auroral regions of the Earth's magnetosphere. Beamlets result from nonlinear acceleration processes occurring in the current sheet in the distant regions of the geomagnetic tail. They propagate toward the Earth along the magnetic field lines and are detected in the boundary region of the plasma sheet and near the high-latitude boundary of the plasma sheet in the auroral region in the form of short (with a duration of 1-2 min) bursts of high-energy (with energies of about several tens of keV) ions. The sizes of the latitudinal zones where the beamlets are localized in the tail and in the auroral region are determined using the epoch superposition method. The relationship between the frequency of beamlet generation in the boundary region of the plasma sheet and the prehistory of the direction of the interplanetary magnetic field (the magnitude of a clock angle) is investigated. It was established that this direction exerts a global effect on the beamlet generation frequency; moreover, it was found that the beamlet generation frequency in the midnight local time sector of the tail and at the flanks depends differently on the direction of the interplanetary magnetic field. In the midnight sector, the beamlets are observed at almost all directions of the interplanetary field, whereas the frequency of their generation at the flanks is maximal only when the interplanetary magnetic field has a large y component

  8. Plasma accelerators

    International Nuclear Information System (INIS)

    Bingham, R.; Angelis, U. de; Johnston, T.W.

    1991-01-01

    Recently attention has focused on charged particle acceleration in a plasma by a fast, large amplitude, longitudinal electron plasma wave. The plasma beat wave and plasma wakefield accelerators are two efficient ways of producing ultra-high accelerating gradients. Starting with the plasma beat wave accelerator (PBWA) and laser wakefield accelerator (LWFA) schemes and the plasma wakefield accelerator (PWFA) steady progress has been made in theory, simulations and experiments. Computations are presented for the study of LWFA. (author)

  9. Linear Accelerators

    International Nuclear Information System (INIS)

    Vretenar, M

    2014-01-01

    The main features of radio-frequency linear accelerators are introduced, reviewing the different types of accelerating structures and presenting the main characteristics aspects of linac beam dynamics

  10. QM/MM studies on the excited-state relaxation mechanism of a semisynthetic dTPT3 base.

    Science.gov (United States)

    Guo, Wei-Wei; Zhang, Teng-Shuo; Fang, Wei-Hai; Cui, Ganglong

    2018-02-14

    Semisynthetic alphabets can potentially increase the genetic information stored in DNA through the formation of unusual base pairs. Recent experiments have shown that near-visible-light irradiation of the dTPT3 chromophore could lead to the formation of a reactive triplet state and of singlet oxygen in high quantum yields. However, the detailed excited-state relaxation paths that populate the lowest triplet state are unclear. Herein, we have for the first time employed the QM(MS-CASPT2//CASSCF)/MM method to explore the spectroscopic properties and excited-state relaxation mechanism of the aqueous dTPT3 chromophore. On the basis of the results, we have found that (1) the S 2 ( 1 ππ*) state of dTPT3 is the initially populated excited singlet state upon near-visible light irradiation; and (2) there are two efficient relaxation pathways to populate the lowest triplet state, i.e. T 1 ( 3 ππ*). In the first one, the S 2 ( 1 ππ*) system first decays to the S 1 ( 1 nπ*) state near the S 2 /S 1 conical intersection, which is followed by an efficient S 1 → T 1 intersystem crossing process at the S 1 /T 1 crossing point; in the second one, an efficient S 2 → T 2 intersystem crossing takes place first, and then, the T 2 ( 3 nπ*) system hops to the T 1 ( 3 ππ*) state through an internal conversion process at the T 2 /T 1 conical intersection. Moreover, an S 2 /S 1 /T 2 intersection region is found to play a vital role in the excited-state relaxation. These new mechanistic insights help in understanding the photophysics and photochemistry of unusual base pairs.

  11. Modelling chemical reactions by QM/MM calculations: the case of the tautomerization in fireflies bioluminescent systems

    Science.gov (United States)

    Berraud-Pache, Romain; Garcia-Iriepa, Cristina; Navizet, Isabelle

    2018-04-01

    In less than half a century, the hybrid QM/MM method has become one of the most used technique to model molecules embedded in a complex environment. A well-known application of the QM/MM method is for biological systems. Nowadays, one can understand how enzymatic reactions work or compute spectroscopic properties, like the wavelength of emission. Here, we have tackled the issue of modelling chemical reactions inside proteins. We have studied a bioluminescent system, fireflies, and deciphered if a keto-enol tautomerization is possible inside the protein. The two tautomers are candidates to be the emissive molecule of the bioluminescence but no outcome has been reached. One hypothesis is to consider a possible keto-enol tautomerization to treat this issue, as it has been already observed in water. A joint approach combining extensive MD simulations as well as computation of key intermediates like TS using QM/MM calculations is presented in this publication. We also emphasize the procedure and difficulties met during this approach in order to give a guide for this kind of chemical reactions using QM/MM methods.

  12. Modeling Chemical Reactions by QM/MM Calculations: The Case of the Tautomerization in Fireflies Bioluminescent Systems.

    Science.gov (United States)

    Berraud-Pache, Romain; Garcia-Iriepa, Cristina; Navizet, Isabelle

    2018-01-01

    In less than half a century, the hybrid QM/MM method has become one of the most used technique to model molecules embedded in a complex environment. A well-known application of the QM/MM method is for biological systems. Nowadays, one can understand how enzymatic reactions work or compute spectroscopic properties, like the wavelength of emission. Here, we have tackled the issue of modeling chemical reactions inside proteins. We have studied a bioluminescent system, fireflies, and deciphered if a keto-enol tautomerization is possible inside the protein. The two tautomers are candidates to be the emissive molecule of the bioluminescence but no outcome has been reached. One hypothesis is to consider a possible keto-enol tautomerization to treat this issue, as it has been already observed in water. A joint approach combining extensive MD simulations as well as computation of key intermediates like TS using QM/MM calculations is presented in this publication. We also emphasize the procedure and difficulties met during this approach in order to give a guide for this kind of chemical reactions using QM/MM methods.

  13. Accelerated construction of a regional DNA-barcode reference library: Caddisflies (Trichoptera) in the Great Smoky Mountains National Park

    Science.gov (United States)

    Zhou, X.; Robinson, J.L.; Geraci, C.J.; Parker, C.R.; Flint, O.S.; Etnier, D.A.; Ruiter, D.; DeWalt, R.E.; Jacobus, L.M.; Hebert, P.D.N.

    2011-01-01

    Deoxyribonucleic acid (DNA) barcoding is an effective tool for species identification and lifestage association in a wide range of animal taxa. We developed a strategy for rapid construction of a regional DNA-barcode reference library and used the caddisflies (Trichoptera) of the Great Smoky Mountains National Park (GSMNP) as a model. Nearly 1000 cytochrome c oxidase subunit I (COI) sequences, representing 209 caddisfly species previously recorded from GSMNP, were obtained from the global Trichoptera Barcode of Life campaign. Most of these sequences were collected from outside the GSMNP area. Another 645 COI sequences, representing 80 species, were obtained from specimens collected in a 3-d bioblitz (short-term, intense sampling program) in GSMNP. The joint collections provided barcode coverage for 212 species, 91% of the GSMNP fauna. Inclusion of samples from other localities greatly expedited construction of the regional DNA-barcode reference library. This strategy increased intraspecific divergence and decreased average distances to nearest neighboring species, but the DNA-barcode library was able to differentiate 93% of the GSMNP Trichoptera species examined. Global barcoding projects will aid construction of regional DNA-barcode libraries, but local surveys make crucial contributions to progress by contributing rare or endemic species and full-length barcodes generated from high-quality DNA. DNA taxonomy is not a goal of our present work, but the investigation of COI divergence patterns in caddisflies is providing new insights into broader biodiversity patterns in this group and has directed attention to various issues, ranging from the need to re-evaluate species taxonomy with integrated morphological and molecular evidence to the necessity of an appropriate interpretation of barcode analyses and its implications in understanding species diversity (in contrast to a simple claim for barcoding failure).

  14. GPU accelerated edge-region based level set evolution constrained by 2D gray-scale histogram.

    Science.gov (United States)

    Balla-Arabé, Souleymane; Gao, Xinbo; Wang, Bin

    2013-07-01

    Due to its intrinsic nature which allows to easily handle complex shapes and topological changes, the level set method (LSM) has been widely used in image segmentation. Nevertheless, LSM is computationally expensive, which limits its applications in real-time systems. For this purpose, we propose a new level set algorithm, which uses simultaneously edge, region, and 2D histogram information in order to efficiently segment objects of interest in a given scene. The computational complexity of the proposed LSM is greatly reduced by using the highly parallelizable lattice Boltzmann method (LBM) with a body force to solve the level set equation (LSE). The body force is the link with image data and is defined from the proposed LSE. The proposed LSM is then implemented using an NVIDIA graphics processing units to fully take advantage of the LBM local nature. The new algorithm is effective, robust against noise, independent to the initial contour, fast, and highly parallelizable. The edge and region information enable to detect objects with and without edges, and the 2D histogram information enable the effectiveness of the method in a noisy environment. Experimental results on synthetic and real images demonstrate subjectively and objectively the performance of the proposed method.

  15. A functional SNP in the regulatory region of the decay-accelerating factor gene associates with extraocular muscle pareses in myasthenia gravis

    KAUST Repository

    Heckmann, J M

    2009-08-13

    Complement activation in myasthenia gravis (MG) may damage muscle endplate and complement regulatory proteins such as decay-accelerating factor (DAF) or CD55 may be protective. We hypothesize that the increased prevalence of severe extraocular muscle (EOM) dysfunction among African MG subjects reported earlier may result from altered DAF expression. To test this hypothesis, we screened the DAF gene sequences relevant to the classical complement pathway and found an association between myasthenics with EOM paresis and the DAF regulatory region c.-198CG SNP (odds ratio8.6; P0.0003). This single nucleotide polymorphism (SNP) results in a twofold activation of a DAF 5?-flanking region luciferase reporter transfected into three different cell lines. Direct matching of the surrounding SNP sequence within the DAF regulatory region with the known transcription factor-binding sites suggests a loss of an Sp1-binding site. This was supported by the observation that the c.-198CG SNP did not show the normal lipopolysaccharide-induced DAF transcriptional upregulation in lymphoblasts from four patients. Our findings suggest that at critical periods during autoimmune MG, this SNP may result in inadequate DAF upregulation with consequent complement-mediated EOM damage. Susceptible individuals may benefit from anti-complement therapy in addition to immunosuppression. © 2010 Macmillan Publishers Limited. All rights reserved.

  16. Accelerator Service

    International Nuclear Information System (INIS)

    Champelovier, Y.; Ferrari, M.; Gardon, A.; Hadinger, G.; Martin, J.; Plantier, A.

    1998-01-01

    Since the cessation of the operation of hydrogen cluster accelerator in July 1996, four electrostatic accelerators were in operation and used by the peri-nuclear teams working in multidisciplinary collaborations. These are the 4 MV Van de Graaff accelerator, 2,5 MV Van de Graaff accelerator, 400 kV ion implanter as well as the 120 kV isotope separator

  17. Cellulase production by two mutant strain of Trichoderma longibranchiatum QM 9414 and Rut C30

    International Nuclear Information System (INIS)

    Blanco, M. J.

    1991-01-01

    Native or pretreated biomass from Onopordum nervosum Boiss, has been examined as candidate feedstock for cellulase production by two mutant strain of Trichoderma Ionqibrachiatum QM9414 and Rut C30. Batch cultivation methods were evaluated and compared with previous experiments using ball-milled, crystalline cellulose (Solka floc). Batch cultivation of T. Ionqibrachiatum Rut C30 on 5% (w/v) acid pretreated O. nervosum biomass yielded enzyme productivities and activities comparable to those obtained on Solka floc. However, the overall enzyme production performance was lower than on Solka floc at comparable cellulose concentrations. This fact may be due to the accumulation of pretreated by products and lignin in the ferment. (Author) 40 refs

  18. A polarizable QM/MM approach to the molecular dynamics of amide groups solvated in water

    Energy Technology Data Exchange (ETDEWEB)

    Schwörer, Magnus; Wichmann, Christoph; Tavan, Paul, E-mail: tavan@physik.uni-muenchen.de [Lehrstuhl für BioMolekulare Optik, Ludwig-Maximilians Universität München, Oettingenstr. 67, 80538 München (Germany)

    2016-03-21

    The infrared (IR) spectra of polypeptides are dominated by the so-called amide bands. Because they originate from the strongly polar and polarizable amide groups (AGs) making up the backbone, their spectral positions sensitively depend on the local electric fields. Aiming at accurate computations of these IR spectra by molecular dynamics (MD) simulations, which derive atomic forces from a hybrid quantum and molecular mechanics (QM/MM) Hamiltonian, here we consider the effects of solvation in bulk liquid water on the amide bands of the AG model compound N-methyl-acetamide (NMA). As QM approach to NMA we choose grid-based density functional theory (DFT). For the surrounding MM water, we develop, largely based on computations, a polarizable molecular mechanics (PMM) model potential called GP6P, which features six Gaussian electrostatic sources (one induced dipole, five static partial charge distributions) and, therefore, avoids spurious distortions of the DFT electron density in hybrid DFT/PMM simulations. Bulk liquid GP6P is shown to have favorable properties at the thermodynamic conditions of the parameterization and beyond. Lennard-Jones (LJ) parameters of the DFT fragment NMA are optimized by comparing radial distribution functions in the surrounding GP6P liquid with reference data obtained from a “first-principles” DFT-MD simulation. Finally, IR spectra of NMA in GP6P water are calculated from extended DFT/PMM-MD trajectories, in which the NMA is treated by three different DFT functionals (BP, BLYP, B3LYP). Method-specific frequency scaling factors are derived from DFT-MD simulations of isolated NMA. The DFT/PMM-MD simulations with GP6P and with the optimized LJ parameters then excellently predict the effects of aqueous solvation and deuteration observed in the IR spectra of NMA. As a result, the methods required to accurately compute such spectra by DFT/PMM-MD also for larger peptides in aqueous solution are now at hand.

  19. Determination of excited states of quantum systems by finite difference time domain method (FDTD) with supersymmetric quantum mechanics (SUSY-QM)

    Energy Technology Data Exchange (ETDEWEB)

    Sudiarta, I. Wayan; Angraini, Lily Maysari, E-mail: lilyangraini@unram.ac.id [Physics Study Program, University of Mataram, Jln. Majapahit 62 Mataram, NTB (Indonesia)

    2016-04-19

    We have applied the finite difference time domain (FDTD) method with the supersymmetric quantum mechanics (SUSY-QM) procedure to determine excited energies of one dimensional quantum systems. The theoretical basis of FDTD, SUSY-QM, a numerical algorithm and an illustrative example for a particle in a one dimensional square-well potential were given in this paper. It was shown that the numerical results were in excellent agreement with theoretical results. Numerical errors produced by the SUSY-QM procedure was due to errors in estimations of superpotentials and supersymmetric partner potentials.

  20. Patterns of Recurrence in Electively Irradiated Lymph Node Regions After Definitive Accelerated Intensity Modulated Radiation Therapy for Head and Neck Squamous Cell Carcinoma

    Energy Technology Data Exchange (ETDEWEB)

    Bosch, Sven van den, E-mail: sven.vandenbosch@radboudumc.nl; Dijkema, Tim; Verhoef, Lia C.G.; Zwijnenburg, Ellen M.; Janssens, Geert O.; Kaanders, Johannes H.A.M.

    2016-03-15

    Purpose: To provide a comprehensive risk assessment on the patterns of recurrence in electively irradiated lymph node regions after definitive radiation therapy for head and neck cancer. Methods and Materials: Two hundred sixty-four patients with stage cT2-4N0-2M0 squamous cell carcinoma of the oropharynx, larynx, or hypopharynx treated with accelerated intensity modulated radiation therapy between 2008 and 2012 were included. On the radiation therapy planning computed tomography (CT) scans from all patients, 1166 lymph nodes (short-axis diameter ≥5 mm) localized in the elective volume were identified and delineated. The exact sites of regional recurrences were reconstructed and projected on the initial radiation therapy planning CT scan by performing coregistration with diagnostic imaging of the recurrence. Results: The actuarial rate of recurrence in electively irradiated lymph node regions at 2 years was 5.1% (95% confidence interval 2.4%-7.8%). Volumetric analysis showed an increased risk of recurrence with increasing nodal volume. Receiver operating characteristic analysis demonstrated that the summed long- and short-axis diameter is a good alternative for laborious volume calculations, using ≥17 mm as cut-off (hazard ratio 17.8; 95% confidence interval 5.7-55.1; P<.001). Conclusions: An important risk factor was identified that can help clinicians in the pretreatment risk assessment of borderline-sized lymph nodes. Not overtly pathologic nodes with a summed diameter ≥17 mm may require a higher than elective radiation therapy dose. For low-risk elective regions (all nodes <17 mm), the safety of dose de-escalation below the traditional 45 to 50 Gy should be investigated.

  1. Future accelerators (?)

    Energy Technology Data Exchange (ETDEWEB)

    John Womersley

    2003-08-21

    I describe the future accelerator facilities that are currently foreseen for electroweak scale physics, neutrino physics, and nuclear structure. I will explore the physics justification for these machines, and suggest how the case for future accelerators can be made.

  2. Preface [EmQM15: 3. international symposium on emergent quantum mechanics

    International Nuclear Information System (INIS)

    2016-01-01

    These proceedings comprise the invited lectures of the third international symposium on Emergent Quantum Mechanics (EmQM15), which was held at the Vienna University of Technology in Vienna, Austria, 23-25 October 2015. The symposium convened at the Festsaal and the adjacent Boeckl-Saal of the Technical University, and was devoted to the open exploration of the quantum state as a reality. The resurgence of interest in ontological quantum theory, including both deterministic and indeterministic approaches, challenges long held assumptions and focuses on the following questions: Is the world local or nonlocal? What is the nature of quantum nonlocality? If nonlocal, i.e., superluminal, influences exist then why can't they be used for superluminal signaling and communication? How is the role of the scientific observer/agent to be accounted for in realistic approaches to quantum theory? How could recent developments in the field of space-time as an emergent phenomenon advance new insight at this research frontier? What new experiments might contribute to new understanding? These and related questions were addressed in the context also of a possible deeper level theory for quantum mechanics that interconnects three fields of knowledge: emergence, the quantum, and information. Could there appear a revised image of physical reality from recognizing new links between emergence, the quantum, and information? The symposium provided a forum for considering (i) current theoretical and conceptual obstacles which need to be overcome as well as (ii) promising developments and research opportunities on the way towards realistic quantum mechanics. Contributions were invited that present current advances in both standard as well as unconventional approaches. The EmQM15 symposium was co-organized by Gerhard Grössing (Austrian Institute for Nonlinear Studies (AINS), Vienna), and by Jan Walleczek (Fetzer Franklin Fund, USA, and Phenoscience Laboratories, Berlin). After two

  3. Field-Lines-Threaded Model for: (1) the Low Solar Corona; (2) Electrons in the Transition Region; and (3) Solar Energetic Particle Acceleration and Transport

    Science.gov (United States)

    Sokolov, I.; van der Holst, B.; Jin, M.; Gombosi, T. I.; Taktakishvili, A.; Khazanov, G. V.

    2013-12-01

    In numerical simulations of the solar corona, both for the ambient state and especially for dynamical processes the most computational resources are spent for maintaining the numerical solution in the Low Solar Corona and in the transition region, where the temperature gradients are very sharp and the magnetic field has a complicated topology. The degraded computational efficiency is caused by the need in a highest resolution as well as the use of the fully three-dimensional implicit solver for electron heat conduction. On the other hand, the physical nature of the processes involved is rather simple (which still does not facilitate the numerical methods) as long as the heat fluxes as well as slow plasma motional velocities are aligned with the magnetic field. The Alfven wave turbulence, which is often believed to be the main driver of the solar wind and the main source of the coronal heating, is characterized by the Poynting flux of the waves, which is also aligned with the magnetic field. Therefore, the plasma state in any point of the three-dimensional grid in the Low Solar Corona can be found by solving a set of one-dimensional equations for the magnetic field line ('thread'), which passes through this point and connects it to the chromosphere and to the global Solar Corona. In the present paper we describe an innovative computational technology based upon the use of the magnetic-field-line-threads to find the local solution. We present the development of the AWSoM code of the University of Michigan with the field-lines-threaded Low Solar Corona. In the transition region, where the essentially kinetic description of the electron energy fluxes is required, we solve the Fokker-Plank equation on the system of threads, to achieve the physically consistent description of chromosphere evaporation. The third application for the field-lines-treaded model is the Solar Energetic Particle (SEP) acceleration and transport. Being the natural extension of the Field

  4. KINETIKA FERMENTASI SELULOSA MURNI OLEH Trichoderma reesi QM 9414 MENJADI GLUKOSA DAN PENERAPANNYA PADA JERAMI PADI BEBAS LIGNIN [Kinetics of Pure Cellulose Fermentation by Trichoderma Reesei QM 9414 to Glucose and Its Application of on Lignin Free Rice Straw

    Directory of Open Access Journals (Sweden)

    M Iyan Sofyan

    2004-12-01

    Full Text Available The objectives of this research were: 1 to determine aeration rate and substrate concentration of pure cellulose to produce maximum glucose by Trichoderma reesei QM 9414 at 30 oC, and agitation 150 rpm; 2 to study the kinetics of pure cellulose fermentation by Trichoderma reesei QM 9414 to glucose and its implication upon fermentation of the lignin free rice straw. The experiment was arranged in factorial randomized complete design in three times replication. Treatments consisted of three levels of aeration (1,00 vvm; 1,5 vvm; 2,0 vvm and three levels of substrate concentration (0,75 ; 1,00 ; 1,25 % w/v. The results showed that at the exponential phase the average specific growth of Trichoderma reesei QM 9414 was 0,05374 hour-1, the maximum glucose product concentration of pure cellulose was 0.1644 gL-1,and the oxygen transfer was 0,0328 mg L-1 hour-1. According to t-test, the kinetics of pure cellulose fermentation model just the same as the lignin free rice straw fermentation.The enzymes produced by Trichoderma reesei QM 9414 in pure cellulose fermentation media followed the Michaelis-Menten model. The enzyme kinetic parameters were the maximum growth rate was 37x10-3 hour-1 and Michaelis-Menten constant was ½ maximum μ =17,5x10-3 hour-1. The volumetric oxygen transfer (KLa using rice straw was 0,0337 mg.hour-1. The value of KLa could be used for conversion from bioreactor at laboratory scale to commercial scale design.

  5. The Quality of the Embedding Potential Is Decisive for Minimal Quantum Region Size in Embedding Calculations

    DEFF Research Database (Denmark)

    Nåbo, Lina J; Olsen, Jógvan Magnus Haugaard; Martínez, Todd J

    2017-01-01

    correct description of the MM region, and that this enables the use of much smaller QM regions compared to fixed charge electrostatic embedding. Furthermore, absorption intensities converge very slowly with system size and inclusion of effective external field effects in the MM region through...

  6. Atomistic insight into the catalytic mechanism of glycosyltransferases by combined quantum mechanics/molecular mechanics (QM/MM) methods.

    Science.gov (United States)

    Tvaroška, Igor

    2015-02-11

    Glycosyltransferases catalyze the formation of glycosidic bonds by assisting the transfer of a sugar residue from donors to specific acceptor molecules. Although structural and kinetic data have provided insight into mechanistic strategies employed by these enzymes, molecular modeling studies are essential for the understanding of glycosyltransferase catalyzed reactions at the atomistic level. For such modeling, combined quantum mechanics/molecular mechanics (QM/MM) methods have emerged as crucial. These methods allow the modeling of enzymatic reactions by using quantum mechanical methods for the calculation of the electronic structure of the active site models and treating the remaining enzyme environment by faster molecular mechanics methods. Herein, the application of QM/MM methods to glycosyltransferase catalyzed reactions is reviewed, and the insight from modeling of glycosyl transfer into the mechanisms and transition states structures of both inverting and retaining glycosyltransferases are discussed. Copyright © 2014 Elsevier Ltd. All rights reserved.

  7. Energy analysis of four dimensional extended hyperbolic Scarf I plus three dimensional separable trigonometric noncentral potentials using SUSY QM approach

    International Nuclear Information System (INIS)

    Suparmi, A.; Cari, C.; Deta, U. A.; Handhika, J.

    2016-01-01

    The non-relativistic energies and wave functions of extended hyperbolic Scarf I plus separable non-central shape invariant potential in four dimensions are investigated using Supersymmetric Quantum Mechanics (SUSY QM) Approach. The three dimensional separable non-central shape invariant angular potential consists of trigonometric Scarf II, Manning Rosen and Poschl-Teller potentials. The four dimensional Schrodinger equation with separable shape invariant non-central potential is reduced into four one dimensional Schrodinger equations through variable separation method. By using SUSY QM, the non-relativistic energies and radial wave functions are obtained from radial Schrodinger equation, the orbital quantum numbers and angular wave functions are obtained from angular Schrodinger equations. The extended potential means there is perturbation terms in potential and cause the decrease in energy spectra of Scarf I potential. (paper)

  8. Incase of Same Region Treatment by using a Tomotherapy and a Linear Accelerator Absorbed Dose Evaluation of Normal Tissues and a Tumor

    International Nuclear Information System (INIS)

    Cheon, Geum Seong; Kim, Chang Uk; Kim, Hoi Nam; Heo, Gyeong Hun; Song, Jin Ho; Hong, Joo Yeong; Jeong, Jae Yong

    2010-01-01

    Treating same region with different modalities there is a limit to evaluate the total absorbed dose of normal tissues. The reason is that it does not support to communication each modalities yet. In this article, it evaluates absorbed dose of the patients who had been treated same region by a tomotherapy and a linear accelerator. After reconstructing anatomic structure with a anthropomorphic phantom, administrate 45 Gy to a tumor in linac plan system as well as prescribe 15 Gy in tomotherapy plan system for make an ideal treatment plan. After the plan which made by tomoplan system transfers to the oncentra plan system for reproduce plan under the same condition and realize total treatment plan with summation 45 Gy linac treatment plan. To evaluate the absorbed dose of two different modalities, do a comparative study both a simple summation dose values and integration dose values. Then compare and analyze absorbed dose of normal tissues and a tumor with the patients who had been exposured radiation by above two different modalities. The result of compared data, in case of minimum dose, there are big different dose values in spleen (12.4%). On the other hand, in case of the maximum dose, it reports big different in a small bowel (10.2%) and a cord (5.8%) in head and neck cancer patients, there presents that oral (20.3%), right lens (7.7%) in minimum dose value. About maximum dose, it represents that spinal (22.5), brain stem (12%), optic chiasm (8.9%), Rt lens (11.5%), mandible (8.1%), pituitary gland (6.2%). In case of Rt abdominal cancer patients, there represents big different minimum dose as Lt kidney (20.3%), stomach (8.1%) about pelvic cancer patients, it reports there are big different in minimum dose as a bladder (15.2%) as well as big different value in maximum dose as a small bowel (5.6%), a bladder (5.5%) in addition, making treatment plan it is able us to get. In case of comparing both simple summation absorbed dose and integration absorbed dose, the

  9. GPU Linear Algebra Libraries and GPGPU Programming for Accelerating MOPAC Semiempirical Quantum Chemistry Calculations.

    Science.gov (United States)

    Maia, Julio Daniel Carvalho; Urquiza Carvalho, Gabriel Aires; Mangueira, Carlos Peixoto; Santana, Sidney Ramos; Cabral, Lucidio Anjos Formiga; Rocha, Gerd B

    2012-09-11

    In this study, we present some modifications in the semiempirical quantum chemistry MOPAC2009 code that accelerate single-point energy calculations (1SCF) of medium-size (up to 2500 atoms) molecular systems using GPU coprocessors and multithreaded shared-memory CPUs. Our modifications consisted of using a combination of highly optimized linear algebra libraries for both CPU (LAPACK and BLAS from Intel MKL) and GPU (MAGMA and CUBLAS) to hasten time-consuming parts of MOPAC such as the pseudodiagonalization, full diagonalization, and density matrix assembling. We have shown that it is possible to obtain large speedups just by using CPU serial linear algebra libraries in the MOPAC code. As a special case, we show a speedup of up to 14 times for a methanol simulation box containing 2400 atoms and 4800 basis functions, with even greater gains in performance when using multithreaded CPUs (2.1 times in relation to the single-threaded CPU code using linear algebra libraries) and GPUs (3.8 times). This degree of acceleration opens new perspectives for modeling larger structures which appear in inorganic chemistry (such as zeolites and MOFs), biochemistry (such as polysaccharides, small proteins, and DNA fragments), and materials science (such as nanotubes and fullerenes). In addition, we believe that this parallel (GPU-GPU) MOPAC code will make it feasible to use semiempirical methods in lengthy molecular simulations using both hybrid QM/MM and QM/QM potentials.

  10. A QM/MM–Based Computational Investigation on the Catalytic Mechanism of Saccharopine Reductase

    Directory of Open Access Journals (Sweden)

    James W. Gauld

    2011-10-01

    Full Text Available Saccharopine reductase from Magnaporthe grisea, an NADPH-containing enzyme in the α-aminoadipate pathway, catalyses the formation of saccharopine, a precursor to L-lysine, from the substrates glutamate and α-aminoadipate-δ-semialdehyde. Its catalytic mechanism has been investigated using quantum mechanics/molecular mechanics (QM/MM ONIOM-based approaches. In particular, the overall catalytic pathway has been elucidated and the effects of electron correlation and the anisotropic polar protein environment have been examined via the use of the ONIOM(HF/6-31G(d:AMBER94 and ONIOM(MP2/6-31G(d//HF/6-31G(d:AMBER94 methods within the mechanical embedding formulism and ONIOM(MP2/6-31G(d//HF/6-31G(d:AMBER94 and ONIOM(MP2/6-311G(d,p//HF/6-31G(d:AMBER94 within the electronic embedding formulism. The results of the present study suggest that saccharopine reductase utilises a substrate-assisted catalytic pathway in which acid/base groups within the cosubstrates themselves facilitate the mechanistically required proton transfers. Thus, the enzyme appears to act most likely by binding the three required reactant molecules glutamate, α-aminoadipate-δ-semialdehyde and NADPH in a manner and polar environment conducive to reaction.

  11. Simulating chemical reactions in ionic liquids using QM/MM methodology.

    Science.gov (United States)

    Acevedo, Orlando

    2014-12-18

    The use of ionic liquids as a reaction medium for chemical reactions has dramatically increased in recent years due in large part to the numerous reported advances in catalysis and organic synthesis. In some extreme cases, ionic liquids have been shown to induce mechanistic changes relative to conventional solvents. Despite the large interest in the solvents, a clear understanding of the molecular factors behind their chemical impact is largely unknown. This feature article reviews our efforts developing and applying mixed quantum and molecular mechanical (QM/MM) methodology to elucidate the microscopic details of how these solvents operate to enhance rates and alter mechanisms for industrially and academically important reactions, e.g., Diels-Alder, Kemp eliminations, nucleophilic aromatic substitutions, and β-eliminations. Explicit solvent representation provided the medium dependence of the activation barriers and atomic-level characterization of the solute-solvent interactions responsible for the experimentally observed "ionic liquid effects". Technical advances are also discussed, including a linear-scaling pairwise electrostatic interaction alternative to Ewald sums, an efficient polynomial fitting method for modeling proton transfers, and the development of a custom ionic liquid OPLS-AA force field.

  12. Electrostatic accelerators

    OpenAIRE

    Hinterberger, F

    2006-01-01

    The principle of electrostatic accelerators is presented. We consider Cockcroft– Walton, Van de Graaff and Tandem Van de Graaff accelerators. We resume high voltage generators such as cascade generators, Van de Graaff band generators, Pelletron generators, Laddertron generators and Dynamitron generators. The speci c features of accelerating tubes, ion optics and methods of voltage stabilization are described. We discuss the characteristic beam properties and the variety of possible beams. We ...

  13. Electrostatic accelerators

    CERN Document Server

    Hinterberger, F

    2006-01-01

    The principle of electrostatic accelerators is presented. We consider Cockcroft– Walton, Van de Graaff and Tandem Van de Graaff accelerators. We resume high voltage generators such as cascade generators, Van de Graaff band generators, Pelletron generators, Laddertron generators and Dynamitron generators. The speci c features of accelerating tubes, ion optics and methods of voltage stabilization are described. We discuss the characteristic beam properties and the variety of possible beams. We sketch possible applications and the progress in the development of electrostatic accelerators.

  14. Accelerator development

    International Nuclear Information System (INIS)

    Anon.

    1975-01-01

    Because the use of accelerated heavy ions would provide many opportunities for new and important studies in nuclear physics and nuclear chemistry, as well as other disciplines, both the Chemistry and Physics Divisions are supporting the development of a heavy-ion accelerator. The design of greatest current interest includes a tandem accelerator with a terminal voltage of approximately 25 MV injecting into a linear accelerator with rf superconducting resonators. This combined accelerator facility would be capable of accelerating ions of masses ranging over the entire periodic table to an energy corresponding to approximately 10 MeV/nucleon. This approach, as compared to other concepts, has the advantages of lower construction costs, lower operating power, 100 percent duty factor, and high beam quality (good energy resolution, good timing resolution, small beam size, and small beam divergence). The included sections describe the concept of the proposed heavy-ion accelerator, and the development program aiming at: (1) investigation of the individual questions concerning the superconducting accelerating resonators; (2) construction and testing of prototype accelerator systems; and (3) search for economical solutions to engineering problems. (U.S.)

  15. Photodissociation dynamics of CH{sub 3}C(O)SH in argon matrix: A QM/MM nonadiabatic dynamics simulation

    Energy Technology Data Exchange (ETDEWEB)

    Xia, Shu-Hua; Liu, Xiang-Yang; Fang, Qiu; Cui, Ganglong, E-mail: ganglong.cui@bnu.edu.cn [Key Laboratory of Theoretical and Computational Photochemistry, Ministry of Education, College of Chemistry, Beijing Normal University, Beijing 100875 (China)

    2015-11-21

    In this work, we have first employed the combined quantum mechanics/molecular mechanics (QM/MM) method to study the photodissociation mechanism of thioacetic acid CH{sub 3}C(O)SH in the S{sub 1}, T{sub 1}, and S{sub 0} states in argon matrix. CH{sub 3}C(O)SH is treated quantum mechanically using the complete active space self-consistent field and complete active space second-order perturbation theory methods; argon matrix is described classically using Lennard-Jones potentials. We find that the C-S bond fission is predominant due to its small barriers of ca. 3.0 and 1.0 kcal/mol in the S{sub 1} and T{sub 1} states. It completely suppresses the nearby C—C bond fission. After the bond fission, the S{sub 1} radical pair of CH{sub 3}CO and SH can decay to the S{sub 0} and T{sub 1} states via internal conversion and intersystem crossing, respectively. In the S{sub 0} state, the radical pair can either recombine to form CH{sub 3}C(O)SH or proceed to form molecular products of CH{sub 2}CO and H{sub 2}S. We have further employed our recently developed QM/MM generalized trajectory-based surface-hopping method to simulate the photodissociation dynamics of CH{sub 3}C(O)SH. In 1 ps dynamics simulation, 56% trajectories stay at the Franck-Condon region; the S{sub 1} C—S bond fission takes place in the remaining 44% trajectories. Among all nonadiabatic transitions, the S{sub 1} → S{sub 0} internal conversion is major (55%) but the S{sub 1} → T{sub 1} intersystem crossing is still comparable and cannot be ignored, which accounts for 28%. Finally, we have found a radical channel generating the molecular products of CH{sub 2}CO and H{sub 2}S, which is complementary to the concerted molecular channel. The present work sets the stage for simulating photodissociation dynamics of similar thio-carbonyl systems in matrix.

  16. Inhibition of Mammalian 15-Lipoxygenase by Three Ebselen-like Drugs. A QM/MM and MM/PBSA Comparative Study.

    Science.gov (United States)

    Cebrián-Prats, Anna; Rovira, Tiffani; Saura, Patricia; González-Lafont, Àngels; Lluch, José M

    2017-12-28

    Ebselen is a potent competitive inhibitor of the active form of rabbit 15-lipoxygenase, an enzyme involved in many inflammatory diseases. Light-induced Z-to-E isomerization of the ebselen-like 2-(3-benzylidene)-3-oxo-2,3-dihydrobenzo[b]thiophene-7-carboxylic acid methyl ester (BODTCM) molecule was used to convert the weak (Z)-BOTDCM inhibitor into the (E)-isomer with much higher inhibitory capacity. In this study, the binding modes of ebselen, (E)-BOTDCM and (Z)-BOTDCM, have been analyzed to provide molecular insights on the inhibitory potency of ebselen and on the geometric-isomer specificity of (E)- and (Z)-BOTDCM inhibitors. The inhibitor-enzyme structures obtained from docking and molecular dynamics simulations as well as from QM/MM calculations show that the inhibitor molecules are not coordinated to the nonheme iron in the active site. Thermal motion allows ebselen and (E)-BOTDCM to visit a wide range of the configurational space competing with the polyunsaturated fatty acid for binding at the active site. Both molecules present similar MM/PBSA binding free energies. The energy penalty for the bigger geometric deformation undergone by (E)-BODTCM would explain its lower inhibitor potency. The (Z)-isomer is the weakest inhibitor because thermal motion moves it to a region very far from the first coordination sphere of Fe, where it could not compete with the fatty acid substrate.

  17. RECIRCULATING ACCELERATION

    International Nuclear Information System (INIS)

    BERG, J.S.; GARREN, A.A.; JOHNSTONE, C.

    2000-01-01

    This paper compares various types of recirculating accelerators, outlining the advantages and disadvantages of various approaches. The accelerators are characterized according to the types of arcs they use: whether there is a single arc for the entire recirculator or there are multiple arcs, and whether the arc(s) are isochronous or non-isochronous

  18. LIBO accelerates

    CERN Multimedia

    2002-01-01

    The prototype module of LIBO, a linear accelerator project designed for cancer therapy, has passed its first proton-beam acceleration test. In parallel a new version - LIBO-30 - is being developed, which promises to open up even more interesting avenues.

  19. Accelerating Inspire

    CERN Document Server

    AUTHOR|(CDS)2266999

    2017-01-01

    CERN has been involved in the dissemination of scientific results since its early days and has continuously updated the distribution channels. Currently, Inspire hosts catalogues of articles, authors, institutions, conferences, jobs, experiments, journals and more. Successful orientation among this amount of data requires comprehensive linking between the content. Inspire has lacked a system for linking experiments and articles together based on which accelerator they were conducted at. The purpose of this project has been to create such a system. Records for 156 accelerators were created and all 2913 experiments on Inspire were given corresponding MARC tags. Records of 18404 accelerator physics related bibliographic entries were also tagged with corresponding accelerator tags. Finally, as a part of the endeavour to broaden CERN's presence on Wikipedia, existing Wikipedia articles of accelerators were updated with short descriptions and links to Inspire. In total, 86 Wikipedia articles were updated. This repo...

  20. A functional SNP in the regulatory region of the decay-accelerating factor gene associates with extraocular muscle pareses in myasthenia gravis

    KAUST Repository

    Heckmann, J M; Uwimpuhwe, H; Ballo, R; Kaur, M; Bajic, Vladimir B.; Prince, S

    2009-01-01

    Complement activation in myasthenia gravis (MG) may damage muscle endplate and complement regulatory proteins such as decay-accelerating factor (DAF) or CD55 may be protective. We hypothesize that the increased prevalence of severe extraocular

  1. Electrostatic accelerator dielectrics

    International Nuclear Information System (INIS)

    Cooke, C.M.

    1989-05-01

    High voltage insulation problems in electrostatic accelerators are discussed. The aim of the analysis is to broaden the knowledge, highlight the characteristics of insulation technology and design strategies to improve use. The basic geometry of the insulation in accelerators is considered. A detailed description of each of the insulation regions is provided. The gas gap insulation of the terminal voltage is found to be sensitive to regions of high electric stress. In order to obtain satisfactory performance from solid support insulation, the attention is focused on the electric stress value and distribution. Potential subjects for discussion and further investigations are given

  2. A QM/MM study of the catalytic mechanism of nicotinamidase.

    Science.gov (United States)

    Sheng, Xiang; Liu, Yongjun

    2014-02-28

    Nicotinamidase (Pnc1) is a member of Zn-dependent amidohydrolases that hydrolyzes nicotinamide (NAM) to nicotinic acid (NA), which is a key step in the salvage pathway of NAD(+) biosynthesis. In this paper, the catalytic mechanism of Pnc1 has been investigated by using a combined quantum-mechanical/molecular-mechanical (QM/MM) approach based on the recently obtained crystal structure of Pnc1. The reaction pathway, the detail of each elementary step, the energetics of the whole catalytic cycle, and the roles of key residues and Zn-binding site are illuminated. Our calculation results indicate that the catalytic water molecule comes from the bulk solvent, which is then deprotonated by residue D8. D8 functions as a proton transfer station between C167 and NAM, while the activated C167 serves as the nucleophile. The residue K122 only plays a role in stabilizing intermediates and transition states. The oxyanion hole formed by the amide backbone nitrogen atoms of A163 and C167 has the function to stabilize the hydroxyl anion of nicotinamide. The Zn-binding site rather than a single Zn(2+) ion acts as a Lewis acid to influence the reaction. Two elementary steps, the activation of C167 in the deamination process and the decomposition of catalytic water in the hydrolysis process, correspond to the large energy barriers of 25.7 and 28.1 kcal mol(-1), respectively, meaning that both of them contribute a lot to the overall reaction barrier. Our results may provide useful information for the design of novel and efficient Pnc1 inhibitors and related biocatalytic applications.

  3. The catalytic mechanism of mouse renin studied with QM/MM calculations.

    Science.gov (United States)

    Brás, Natércia F; Ramos, Maria J; Fernandes, Pedro A

    2012-09-28

    Hypertension is a chronic condition that affects nearly 25% of adults worldwide. As the Renin-Angiotensin-Aldosterone System is implicated in the control of blood pressure and body fluid homeostasis, its combined blockage is an attractive therapeutic strategy currently in use for the treatment of several cardiovascular conditions. We have performed QM/MM calculations to study the mouse renin catalytic mechanism in atomistic detail, using the N-terminal His6-Asn14 segment of angiotensinogen as substrate. The enzymatic reaction (hydrolysis of the peptidic bond between residues in the 10th and 11th positions) occurs through a general acid/base mechanism and, surprisingly, it is characterized by three mechanistic steps: it begins with the creation of a first very stable tetrahedral gem-diol intermediate, followed by protonation of the peptidic bond nitrogen, giving rise to a second intermediate. In a final step the peptidic bond is completely cleaved and both gem-diol hydroxyl protons are transferred to the catalytic dyad (Asp32 and Asp215). The final reaction products are two separate peptides with carboxylic acid and amine extremities. The activation energy for the formation of the gem-diol intermediate was calculated as 23.68 kcal mol(-1), whereas for the other steps the values were 15.51 kcal mol(-1) and 14.40 kcal mol(-1), respectively. The rate limiting states were the reactants and the first transition state. The associated barrier (23.68 kcal mol(-1)) is close to the experimental values for the angiotensinogen substrate (19.6 kcal mol(-1)). We have also tested the influence of the density functional on the activation and reaction energies. All eight density functionals tested (B3LYP, B3LYP-D3, X3LYP, M06, B1B95, BMK, mPWB1K and B2PLYP) gave very similar results.

  4. Cellulase production by two mutant strain of Trichoderma longibrachiatum Qm9414 and Rut C30; Produccion de celulasas a partir de dos cepas hiperproductoras de trichoderma longibrachiatum Qm9414 y Rut C30

    Energy Technology Data Exchange (ETDEWEB)

    Blanco, M.J.

    1991-12-31

    Native or pretreated biomass from Onopordum nervosum boiss, has been examined as candidate feedstock for cellulase production by two mutant strain of trichoderma longibrachiatum QM9414 and Rut C30. Batch cultivation methods were evaluated and compared with previous experiments using ball-milled, crystalline cellulose (Solka floc). Batch cultivation of T. longibrachiatum Rut C30 on 55% (W/V) acid pretreated O. nervosum biomass yielded enzyme productivities and activities comparable to those obtained on Solka floc. However, the overall enzyme production performance was lower than on Solka floc at comparable cellulose concentrations. This fact may be due to the accumulation of pretreated by products and lignin in the fermentor.(author)

  5. Cellulase production by two mutant strain of Trichoderma longibrachiatum Qm9414 and Rut C30. Produccion de celulasas a partir de dos cepas hiperproductoras de trichoderma longibrachiatum Qm9414 y Rut C30

    Energy Technology Data Exchange (ETDEWEB)

    Blanco, M.J.

    1991-01-01

    Native or pretreated biomass from Onopordum nervosum boiss, has been examined as candidate feedstock for cellulase production by two mutant strain of trichoderma longibrachiatum QM9414 and Rut C30. Batch cultivation methods were evaluated and compared with previous experiments using ball-milled, crystalline cellulose (Solka floc). Batch cultivation of T. longibrachiatum Rut C30 on 55% (W/V) acid pretreated O. nervosum biomass yielded enzyme productivities and activities comparable to those obtained on Solka floc. However, the overall enzyme production performance was lower than on Solka floc at comparable cellulose concentrations. This fact may be due to the accumulation of pretreated by products and lignin in the fermentor.(author)

  6. FMIT accelerator

    International Nuclear Information System (INIS)

    Armstrong, D.D.

    1983-01-01

    A 35-MeV 100-mA cw linear accelerator is being designed by Los Alamos for use in the Fusion Materials Irradiation Test (FMIT) Facility. Essential to this program is the design, construction, and evaluation of performance of the accelerator's injector, low-energy beam transport, and radio-frequency quadrupole sections before they are shipped to the facility site. The installation and testing of some of these sections have begun as well as the testing of the rf, noninterceptive beam diagnostics, computer control, dc power, and vacuum systems. An overview of the accelerator systems and the performance to date is given

  7. Electron accelerator

    International Nuclear Information System (INIS)

    Abramyan.

    1981-01-01

    The USSR produces an electron accelerator family of a simple design powered straight from the mains. The specifications are given of accelerators ELITA-400, ELITA-3, ELT-2, TEUS-3 and RIUS-5 with maximum electron energies of 0.3 to 5 MeV, a mean power of 10 to 70 kW operating in both the pulsed and the continuous (TEUS-3) modes. Pulsed accelerators ELITA-400 and ELITA-3 and RIUS-5 in which TESLA resonance transformers are used are characterized by their compact size. (Ha)

  8. Comparative study of fast critical burner reactors and subcritical accelerator driven systems and the impact on transuranics inventory in a regional fuel cycle

    International Nuclear Information System (INIS)

    Romanello, V.; Salvatores, M.; Schwenk-Ferrero, A.; Gabrielli, F.; Maschek, W.; Vezzoni, B.

    2011-01-01

    Research highlights: → Double-strata fuel cycle has a potential to minimize transuranics mass in Europe. → European Minor Actinides legacy can be reduced down to 0 before the end of century. → 40% higher capacity needed to burn MA for fast critical reactor then for EFIT fleet. → Na cooled fast reactor cores with high content of MA and low CR have been assessed. → Fast critical and ADS-EFIT reactors show comparable MA transmutation performance. - Abstract: In the frame of Partitioning and Transmutation (P and T) strategies, many solutions have been proposed in order to burn transuranics (TRU) discharged from conventional thermal reactors in fast reactor systems. This is due to the favourable feature of neutron fission to capture cross section ratio in a fast neutron spectrum for most TRU. However the majority of studies performed use the Accelerator Driven Systems (ADS), due to their potential flexibility to utilize various fuel types, loaded with significant amounts of TRU having very different Minor Actinides (MA) over Pu ratios. Recently the potential of low conversion ratio critical fast reactors has been rediscovered, with very attractive burning capabilities. In the present paper the burning performances of two systems are directly compared: a sodium cooled critical fast reactor with a low conversion ratio, and the European lead cooled subcritical ADS-EFIT reactor loaded with fertile-free fuel. Comparison is done for characteristics of both the intrinsic core and the regional fuel cycle within a European double-strata scenario. Results of the simulations, obtained by use of French COSI6 code, show comparable performance and confirm that in a double strata fuel cycle the same goals could be achieved by deploying dedicated fast critical or ADS-EFIT type reactors. However the critical fast burner reactor fleet requires ∼30-40% higher installed power then the ADS-EFIT one. Therefore full comparative assessment and ranking can be done only by a

  9. Horizontal Accelerator

    Data.gov (United States)

    Federal Laboratory Consortium — The Horizontal Accelerator (HA) Facility is a versatile research tool available for use on projects requiring simulation of the crash environment. The HA Facility is...

  10. Acceleration theorems

    International Nuclear Information System (INIS)

    Palmer, R.

    1994-06-01

    Electromagnetic fields can be separated into near and far components. Near fields are extensions of static fields. They do not radiate, and they fall off more rapidly from a source than far fields. Near fields can accelerate particles, but the ratio of acceleration to source fields at a distance R, is always less than R/λ or 1, whichever is smaller. Far fields can be represented as sums of plane parallel, transversely polarized waves that travel at the velocity of light. A single such wave in a vacuum cannot give continuous acceleration, and it is shown that no sums of such waves can give net first order acceleration. This theorem is proven in three different ways; each method showing a different aspect of the situation

  11. Shielding experiments for accelerator facilities

    Energy Technology Data Exchange (ETDEWEB)

    Nakashima, Hiroshi; Tanaka, Susumu; Sakamoto, Yukio [Japan Atomic Energy Research Inst., Tokai, Ibaraki (Japan). Tokai Research Establishment] [and others

    2000-06-01

    A series of shielding experiments was carried out by using AVF cyclotron accelerator of TIARA at JAERI in order to validate shielding design methods for accelerator facilities in intermediate energy region. In this paper neutron transmission experiment through thick shields and radiation streaming experiment through a labyrinth are reported. (author)

  12. Shielding experiments for accelerator facilities

    International Nuclear Information System (INIS)

    Nakashima, Hiroshi; Tanaka, Susumu; Sakamoto, Yukio

    2000-01-01

    A series of shielding experiments was carried out by using AVF cyclotron accelerator of TIARA at JAERI in order to validate shielding design methods for accelerator facilities in intermediate energy region. In this paper neutron transmission experiment through thick shields and radiation streaming experiment through a labyrinth are reported. (author)

  13. MDEP Common Position CP-VICWG-01. Common Position: Establishment of Common QA/QM Criteria for the Multinational Vendor Inspection CP-VICWG-01

    International Nuclear Information System (INIS)

    2015-01-01

    This document provides a set of common positions for harmonizing inspection criteria called 'Common QA/QM Criteria' which will be used in Multinational Vendor Inspections. This document was prepared by the Vendor Inspection Co-operation Working Group (VICWG) of the Multinational Design Evaluation Program (MDEP). The 'Common QA/QM Criteria' provides the basic areas for consideration when performing Vendor Inspections. The criteria have been developed in conformity with International Codes and Standards such as IAEA, ISO, etc. that MDEP member countries have adopted

  14. How Many Conformations Need To Be Sampled To Obtain Converged QM/MM Energies? The Curse of Exponential Averaging.

    Science.gov (United States)

    Ryde, Ulf

    2017-11-14

    Combined quantum mechanical and molecular mechanical (QM/MM) calculations is a popular approach to study enzymatic reactions. They are often based on a set of minimized structures obtained on snapshots from a molecular dynamics simulation to include some dynamics of the enzyme. It has been much discussed how the individual energies should be combined to obtain a final estimate of the energy, but the current consensus seems to be to use an exponential average. Then, the question is how many snapshots are needed to reach a reliable estimate of the energy. In this paper, I show that the question can be easily be answered if it is assumed that the energies follow a Gaussian distribution. Then, the outcome can be simulated based on a single parameter, σ, the standard deviation of the QM/MM energies from the various snapshots, and the number of required snapshots can be estimated once the desired accuracy and confidence of the result has been specified. Results for various parameters are presented, and it is shown that many more snapshots are required than is normally assumed. The number can be reduced by employing a cumulant approximation to second order. It is shown that most convergence criteria work poorly, owing to the very bad conditioning of the exponential average when σ is large (more than ∼7 kJ/mol), because the energies that contribute most to the exponential average have a very low probability. On the other hand, σ serves as an excellent convergence criterion.

  15. Accelerator microanalysis

    International Nuclear Information System (INIS)

    Tuniz, C.

    1997-01-01

    Particle accelerators have been developed more than sixty years ago to investigate nuclear and atomic phenomena. A major shift toward applications of accelerators in the study of materials structure and composition in inter-disciplinary projects has been witnessed in the last two decades. The Australian Nuclear Science and Technology Organisation (ANSTO) has developed advanced research programs based on the use of particle and photon beams. Atmospheric pollution problems are investigated at the 3 MV Van de Graff accelerator using ion beam analysis techniques to detect toxic elements in aerosol particles. High temperature superconductor and semiconductor materials are characterised using the recoil of iodine and other heavy ions produced at ANTARES, the 10-MV Tandem accelerator. A heavy-ion microprobe is presently being developed at ANTARES to map elemental concentrations of specific elements with micro-size resolution. An Accelerator mass Spectrometry (AMS) system has been developed at ANSTO for the ultra-sensitive detection of Carbon-14, Iodine-129 and other long-lived radioisotopes. This AMS spectrometer is a key instrument for climate change studies and international safeguards. ANSTO is also managing the Australian Synchrotron Research program based on facilities developed at the Photon Factory (Japan) and at the Advanced Photon Source (USA). Advanced projects in biology, materials chemistry, structural condensed matter and other disciplines are being promoted by a consortium involving Australian universities and research institutions. This paper will review recent advances in the use of particle accelerators, with a particular emphasis on applications developed at ANSTO and related to problems of international concern, such as global environmental change, public health and nuclear proliferation

  16. Accelerator operations

    International Nuclear Information System (INIS)

    Anon.

    1980-01-01

    This section is concerned with the operation of both the tandem-linac system and the Dynamitron, two accelerators that are used for entirely different research. Developmental activities associated with the tandem and the Dynamitron are also treated here, but developmental activities associated with the superconducting linac are covered separately because this work is a program of technology development in its own right

  17. CNSTN Accelerator

    International Nuclear Information System (INIS)

    Habbassi, Afifa; Trabelsi, Adel

    2010-01-01

    This project give a big idea about the measurement of the linear accelerator in the CNSTN. During this work we control dose distribution for different product. For this characterisation we have to make an installation qualification ,operational qualification,performance qualification and of course for every step we have to control temperature and the dose ,even the distribution of the last one.

  18. Accelerators course

    CERN Multimedia

    CERN. Geneva HR-RFA; Métral, E

    2006-01-01

    1a) Introduction and motivation 1b) History and accelerator types 2) Transverse beam dynamics 3a) Longitudinal beam dynamics 3b) Figure of merit of a synchrotron/collider 3c) Beam control 4) Main limiting factors 5) Technical challenges

  19. Accelerator operations

    International Nuclear Information System (INIS)

    Anon.

    1979-01-01

    Operations of the SuperHILAC, the Bevatron/Bevalac, and the 184-inch Synchrocyclotron during the period from October 1977 to September 1978 are discussed. These include ion source development, accelerator facilities, the Heavy Ion Spectrometer System, and Bevelac biomedical operations

  20. Accelerator update

    International Nuclear Information System (INIS)

    Anon.

    1995-01-01

    When the Accelerator Conference, combined International High Energy and US Particle versions, held in Dallas in May, was initially scheduled, progress nearby for the US Superconducting Supercollider was high on the preliminary agenda. With the SSC voted down by Congress in October 1993, this was no longer the case. However the content of the meeting, in terms of both its deep implications for ambitious new projects and the breadth of its scope, showed that the worldwide particle accelerator field is far from being moribund. A traditional feature of such accelerator conferences is the multiplicity of parallel sessions. No one person can attend all sessions, so that delegates can follow completely different paths and emerge with totally different impressions. Despite this overload, and despite the SSC cancellation, the general picture is one of encouraging progress over a wide range of major new projects throughout the world. At the same time, spinoff from, and applications of, accelerators and accelerator technology are becoming increasingly important. Centrestage is now CERN's LHC proton-proton collider, where a test string of superconducting magnets is operating over long periods at the nominal LHC field of 8.36 tesla or more. The assignment of the underground areas in the existing 27- kilometre LEP tunnel is now quasidefinitive (see page 3). For CERN's existing big machine, the LEP electron-positron collider, ongoing work concentrates on boosting performance using improved optics and bunch trains. But the main objective is the LEP2 scheme using superconducting accelerating cavities to boost the beam energy (see page 6). After some initial teething problems, production and operation of these cavities appears to have been mastered, at least under test conditions. A highlight at CERN last year was the first run with lead ions (December 1994, page 15). Handling these heavy particles with systems originally designed for protons calls for ingenuity. The SPS

  1. Accelerator update

    Energy Technology Data Exchange (ETDEWEB)

    Anon.

    1995-09-15

    When the Accelerator Conference, combined International High Energy and US Particle versions, held in Dallas in May, was initially scheduled, progress nearby for the US Superconducting Supercollider was high on the preliminary agenda. With the SSC voted down by Congress in October 1993, this was no longer the case. However the content of the meeting, in terms of both its deep implications for ambitious new projects and the breadth of its scope, showed that the worldwide particle accelerator field is far from being moribund. A traditional feature of such accelerator conferences is the multiplicity of parallel sessions. No one person can attend all sessions, so that delegates can follow completely different paths and emerge with totally different impressions. Despite this overload, and despite the SSC cancellation, the general picture is one of encouraging progress over a wide range of major new projects throughout the world. At the same time, spinoff from, and applications of, accelerators and accelerator technology are becoming increasingly important. Centrestage is now CERN's LHC proton-proton collider, where a test string of superconducting magnets is operating over long periods at the nominal LHC field of 8.36 tesla or more. The assignment of the underground areas in the existing 27- kilometre LEP tunnel is now quasidefinitive (see page 3). For CERN's existing big machine, the LEP electron-positron collider, ongoing work concentrates on boosting performance using improved optics and bunch trains. But the main objective is the LEP2 scheme using superconducting accelerating cavities to boost the beam energy (see page 6). After some initial teething problems, production and operation of these cavities appears to have been mastered, at least under test conditions. A highlight at CERN last year was the first run with lead ions (December 1994, page 15). Handling these heavy particles with systems originally designed for protons calls for ingenuity. The SPS has managed

  2. Marker list: QM109927 [PGDBj Registered plant list, Marker list, QTL list, Plant DB link and Genome analysis methods[Archive

    Lifescience Database Archive (English)

    Full Text Available ulation VWP2 x VWP4 and pseudo-F2 population ... Chr12 ... 10.1007/s00438-005-1149-2 16021467 ... QM109927 Solanum lycopersicum Solanaceae L16L Others ATAGTGTCTACTTCAGGG CCATCAAACAGTTCTCT S. peruvianum pop

  3. Marker list: QM109928 [PGDBj Registered plant list, Marker list, QTL list, Plant DB link and Genome analysis methods[Archive

    Lifescience Database Archive (English)

    Full Text Available GATGGCGTT S. peruvianum population VWP2 x VWP4 and pseudo-F2 population ... Chr12 ... 10.1007/s00438-005-1149-2 16021467 ... QM109928 Solanum lycopersicum Solanaceae DH8R Others TAGAGAGACTATCCTTTA CACATTCAGT

  4. Marker list: QM357356 [PGDBj Registered plant list, Marker list, QTL list, Plant DB link and Genome analysis methods[Archive

    Lifescience Database Archive (English)

    Full Text Available QM357356 Solanum tuberosum Solanaceae toPt-437059 Others ... CIP703825 ... Chr10 ratio of tuber length to tuber... width trait and eye depth of tuber trait 1 10.1186/s12863-015-0213-0 26024857

  5. Marker list: QM183663 [PGDBj Registered plant list, Marker list, QTL list, Plant DB link and Genome analysis methods[Archive

    Lifescience Database Archive (English)

    Full Text Available CG GCTCCAACTTCAATGCCTGT Gold Ball Livingston x Yellow Pear|San Marzano x Gold Ball Livingston|T1693 x Yellow Pear ... chr11 fruit shape 1 10.1038/hdy.2013.45 23673388 ... QM183663 Solanum lycopersicum Solanaceae 11EP186 CAPS/dCAPS TGGAAGCTTTAAACTTGTCGTT

  6. Cellulase production by two mutant strain of Trichoderma longibranchiatum QM9414 and Rut C30; Produccion de celulasas a partir de dos cepas hiperproductoras de trichoderma longibranchiatum Qm9-41 4 y Rut C30

    Energy Technology Data Exchange (ETDEWEB)

    Blanco, M J

    1991-07-01

    Native or pretreated biomass from Onopordum nervosum Boiss, has been examined as candidate feedstock for cellulase production by two mutant strain of Trichoderma Ionqibrachiatum QM9414 and Rut C30. Batch cultivation methods were evaluated and compared with previous experiments using ball-milled, crystalline cellulose (Solka floc). Batch cultivation of T. Ionqibrachiatum Rut C30 on 5% (w/v) acid pretreated O. nervosum biomass yielded enzyme productivities and activities comparable to those obtained on Solka floc. However, the overall enzyme production performance was lower than on Solka floc at comparable cellulose concentrations. This fact may be due to the accumulation of pretreated by products and lignin in the ferment. (Author) 40 refs.

  7. Accelerating Value Creation with Accelerators

    DEFF Research Database (Denmark)

    Jonsson, Eythor Ivar

    2015-01-01

    and developing the best business ideas and support the due diligence process. Even universities are noticing that the learning experience of the action learning approach is an effective way to develop capabilities and change cultures. Accelerators related to what has historically been associated...

  8. Report of the third seminar on nuclear physics at the energy region of the JAERI tandem-booster accelerator February 27-28, 1992, Tokai, Japan

    International Nuclear Information System (INIS)

    Iwamoto, Akira; Oshima, Masumi; Ikezoe, Hiroshi; Nagame, Yuichiro; Shinohara, Nobuo

    1992-09-01

    A seminar on new experiments to be studied and new experimental apparatus suitable for the JAERI tandem-booster accelerator being under construction was held at Tokai Research Establishment of JAERI in the period from February 27 to 28, 1992. Sixty eight participants from universities and from JAERI attended to discuss the following items: 1. Physics at low temperature, 2. Nuclear structure at high spin and at high excitation energy, 3. Application of unstable beam and their spectroscopy, 4. Nuclear reaction at intermediate energy, 5. New facilities. (author)

  9. Cluster observations of particle acceleration up to supra-thermal energies in the cusp region related to low-frequency wave activity – possible implications for the substorm initiation process

    Czech Academy of Sciences Publication Activity Database

    Vogiatzis, I. I.; Sarris, T. E.; Sarris, E. T.; Santolík, Ondřej; Dandouras, I.; Robert, P.; Fritz, T. A.; Zong, Q.-G.; Zhang, H.

    2008-01-01

    Roč. 26, č. 3 (2008), s. 653-669 ISSN 0992-7689 R&D Projects: GA AV ČR IAA301120601 Grant - others:INTAS(XE) 03-51-4132; NASA Goddard Space Flight Center(US) NNX07AI24G; NASA Goddard Space Flight Center(US) NNG04GB98G; NSF(US) 0307319 Institutional research plan: CEZ:AV0Z30420517 Keywords : particle acceleration * cusp region * substorm initiation process Subject RIV: BL - Plasma and Gas Discharge Physics Impact factor: 1.660, year: 2008 http://www.ann-geophys.net/26/1665/2008/

  10. Laser acceleration

    Science.gov (United States)

    Tajima, T.; Nakajima, K.; Mourou, G.

    2017-02-01

    The fundamental idea of Laser Wakefield Acceleration (LWFA) is reviewed. An ultrafast intense laser pulse drives coherent wakefield with a relativistic amplitude robustly supported by the plasma. While the large amplitude of wakefields involves collective resonant oscillations of the eigenmode of the entire plasma electrons, the wake phase velocity ˜ c and ultrafastness of the laser pulse introduce the wake stability and rigidity. A large number of worldwide experiments show a rapid progress of this concept realization toward both the high-energy accelerator prospect and broad applications. The strong interest in this has been spurring and stimulating novel laser technologies, including the Chirped Pulse Amplification, the Thin Film Compression, the Coherent Amplification Network, and the Relativistic Mirror Compression. These in turn have created a conglomerate of novel science and technology with LWFA to form a new genre of high field science with many parameters of merit in this field increasing exponentially lately. This science has triggered a number of worldwide research centers and initiatives. Associated physics of ion acceleration, X-ray generation, and astrophysical processes of ultrahigh energy cosmic rays are reviewed. Applications such as X-ray free electron laser, cancer therapy, and radioisotope production etc. are considered. A new avenue of LWFA using nanomaterials is also emerging.

  11. Laser acceleration

    International Nuclear Information System (INIS)

    Tajima, T.; Nakajima, K.; Mourou, G.

    2017-01-01

    The fundamental idea of LaserWakefield Acceleration (LWFA) is reviewed. An ultrafast intense laser pulse drives coherent wakefield with a relativistic amplitude robustly supported by the plasma. While the large amplitude of wake fields involves collective resonant oscillations of the eigenmode of the entire plasma electrons, the wake phase velocity ∼ c and ultra fastness of the laser pulse introduce the wake stability and rigidity. A large number of worldwide experiments show a rapid progress of this concept realization toward both the high-energy accelerator prospect and broad applications. The strong interest in this has been spurring and stimulating novel laser technologies, including the Chirped Pulse Amplification, the Thin Film Compression, the Coherent Amplification Network, and the Relativistic Mirror Compression. These in turn have created a conglomerate of novel science and technology with LWFA to form a new genre of high field science with many parameters of merit in this field increasing exponentially lately. This science has triggered a number of worldwide research centers and initiatives. Associated physics of ion acceleration, X-ray generation, and astrophysical processes of ultrahigh energy cosmic rays are reviewed. Applications such as X-ray free electron laser, cancer therapy, and radioisotope production etc. are considered. A new avenue of LWFA using nano materials is also emerging.

  12. Accelerating networks

    International Nuclear Information System (INIS)

    Smith, David M D; Onnela, Jukka-Pekka; Johnson, Neil F

    2007-01-01

    Evolving out-of-equilibrium networks have been under intense scrutiny recently. In many real-world settings the number of links added per new node is not constant but depends on the time at which the node is introduced in the system. This simple idea gives rise to the concept of accelerating networks, for which we review an existing definition and-after finding it somewhat constrictive-offer a new definition. The new definition provided here views network acceleration as a time dependent property of a given system as opposed to being a property of the specific algorithm applied to grow the network. The definition also covers both unweighted and weighted networks. As time-stamped network data becomes increasingly available, the proposed measures may be easily applied to such empirical datasets. As a simple case study we apply the concepts to study the evolution of three different instances of Wikipedia, namely, those in English, German, and Japanese, and find that the networks undergo different acceleration regimes in their evolution

  13. Insights into the Lactonase Mechanism of Serum Paraoxonase 1 (PON1): Experimental and Quantum Mechanics/Molecular Mechanics (QM/MM) Studies.

    Science.gov (United States)

    Le, Quang Anh Tuan; Kim, Seonghoon; Chang, Rakwoo; Kim, Yong Hwan

    2015-07-30

    Serum paraoxonase 1 (PON1) is a versatile enzyme for the hydrolysis of various substrates (e.g., lactones, phosphotriesters) and for the formation of a promising chemical platform γ-valerolactone. Elucidation of the PON1-catalyzed lactonase reaction mechanism is very important for understanding the enzyme function and for engineering this enzyme for specific applications. Kinetic study and hybrid quantum mechanics/molecular mechanics (QM/MM) method were used to investigate the PON1-catalyzed lactonase reaction of γ-butyrolactone (GBL) and (R)-γ-valerolactone (GVL). The activation energies obtained from the QM/MM calculations were in good agreement with the experiments. Interestingly, the QM/MM energy barriers at MP2/3-21G(d,p) level for the lactonase of GVL and GBL were respectively 14.3-16.2 and 11.5-13.1 kcal/mol, consistent with the experimental values (15.57 and 14.73 kcal/mol derived from respective kcat values of 36.62 and 147.21 s(-1)). The QM/MM energy barriers at MP2/6-31G(d) and MP2/6-31G(d,p) levels were also in relatively good agreements with the experiments. Importantly, the difference in the QM/MM energy barriers at MP2 level with all investigated basis sets for the lactonase of GVL and GBL were in excellent agreement with the experiments (0.9-3.1 and 0.8 kcal/mol, respectively). A detailed mechanism for the PON1-catalyzed lactonase reaction was also proposed in this study.

  14. Theoretical study of electron transfer mechanism in biological systems with a QM (MRSCI+DFT)/MM method

    Energy Technology Data Exchange (ETDEWEB)

    Takada, Toshikazu [Research Program for Computational Science, RIKEN 2-1, Hirosawa, Wako, Saitama 351-0198 (Japan)

    2007-07-15

    The goal of this project is to understand the charge separation mechanisms in biological systems using the molecular orbital theories. Specially, the charge separation in the photosynthetic reaction center is focused on, since the efficiency in use of the solar energy is extraordinary and the reason for it is still kept unknown. Here, a QM/MM theoretical scheme is employed to take the effects of the surrounding proteins onto the pigments into account. To describe such excited electronic structures, a unified theory by MRSCI and DFT is newly invented. For atoms in the MM space, a new sampling method has also been created, based on the statistical physics. By using these theoretical framework, the excited and positively charged states of the special pair, that is, chlorophyll dimmer are planning to be calculated this year.

  15. Theoretical study of electron transfer mechanism in biological systems with a QM (MRSCI+DFT)/MM method

    International Nuclear Information System (INIS)

    Takada, Toshikazu

    2007-01-01

    The goal of this project is to understand the charge separation mechanisms in biological systems using the molecular orbital theories. Specially, the charge separation in the photosynthetic reaction center is focused on, since the efficiency in use of the solar energy is extraordinary and the reason for it is still kept unknown. Here, a QM/MM theoretical scheme is employed to take the effects of the surrounding proteins onto the pigments into account. To describe such excited electronic structures, a unified theory by MRSCI and DFT is newly invented. For atoms in the MM space, a new sampling method has also been created, based on the statistical physics. By using these theoretical framework, the excited and positively charged states of the special pair, that is, chlorophyll dimmer are planning to be calculated this year

  16. Structure and dynamics of solvated Ba(II) in dilute aqueous solution - an ab initio QM/MM MD approach

    International Nuclear Information System (INIS)

    Hofer, Thomas S.; Rode, Bernd M.; Randolf, Bernhard R.

    2005-01-01

    Structural properties of the hydrated Ba(II) ion have been investigated by ab initio quantum mechanical/molecular mechanical (QM/MM) molecular dynamics (MD) simulations at double zeta HF quantum mechanical level. The first shell coordination number was found to be 9.3, and several other structural parameters such as angular distribution functions, radial distribution functions and tilt- and θ-angle distributions allowed the full characterization of the hydration structure of the Ba(II) ion in dilute aqueous solution. Velocity autocorrelation functions were used to calculate librational and vibrational motions, ion-ligand motions as well as reorientation times. Different dynamical parameters such as water reorientation, mean ligand residence time, the number of ligand exchange processes and rate constants were also analyzed and the ligand exchange rate constant for the first shell was determined as k = 5.3 x 10 10 s -1

  17. Biosynthesis of the enzymes of the cellulase system by T. Reesei QM 9414 in the presence of sophorose

    Science.gov (United States)

    Gritzali, M.

    1982-12-01

    As conventional, nonrenewable energy sources are rapidly depleted and it was necessary to search for alternative sources of energy. It was increasingly apparent that biomass and waste are alternatives well worth exploring. The sources of biomass and wastes that considered for conversion to useful products are quite diverse, but the most abundant constituent of almost every type is cellulose. Cellulose is cleanly converted to soluble fermentable sugars enzymatically, and cellulose enzymes were isolated from a number of microbial sources. It is generally agreed that the most effective system of enzymes for the conversion of cellulose to glucose is produced by species of the imperfect fungus Trichoderma. The mutant organism Trichoderma reesei QM 9414 is among the best producers of high levels of enzymes; these are extracellular and have carbonhydrate covalently bound to the peptide. Trichoderma produces three types of enzymes which, in a sequential and cooperative manner, convert cellulose to soluble oligosaccharides and glucose.

  18. Advanced concepts for acceleration

    International Nuclear Information System (INIS)

    Keefe, D.

    1986-07-01

    Selected examples of advanced accelerator concepts are reviewed. Such plasma accelerators as plasma beat wave accelerator, plasma wake field accelerator, and plasma grating accelerator are discussed particularly as examples of concepts for accelerating relativistic electrons or positrons. Also covered are the pulsed electron-beam, pulsed laser accelerator, inverse Cherenkov accelerator, inverse free-electron laser, switched radial-line accelerators, and two-beam accelerator. Advanced concepts for ion acceleration discussed include the electron ring accelerator, excitation of waves on intense electron beams, and two-wave combinations

  19. Accelerators and the Accelerator Community

    Energy Technology Data Exchange (ETDEWEB)

    Malamud, Ernest; Sessler, Andrew

    2008-06-01

    In this paper, standing back--looking from afar--and adopting a historical perspective, the field of accelerator science is examined. How it grew, what are the forces that made it what it is, where it is now, and what it is likely to be in the future are the subjects explored. Clearly, a great deal of personal opinion is invoked in this process.

  20. Accelerators and the Accelerator Community

    International Nuclear Information System (INIS)

    Malamud, Ernest; Sessler, Andrew

    2008-01-01

    In this paper, standing back--looking from afar--and adopting a historical perspective, the field of accelerator science is examined. How it grew, what are the forces that made it what it is, where it is now, and what it is likely to be in the future are the subjects explored. Clearly, a great deal of personal opinion is invoked in this process

  1. Ring accelerators

    International Nuclear Information System (INIS)

    Gisler, G.; Faehl, R.

    1983-01-01

    We present two-dimensional simulations in (r-z) and r-theta) cylinderical geometries of imploding-liner-driven accelerators of rings of charged particles. We address issues of azimuthal and longitudinal stability of the rings. We discuss self-trapping designs in which beam injection and extraction is aided by means of external cusp fields. Our simulations are done with the 2-1/2-D particle-in-cell plasma simulation code CLINER, which combines collisionless, electromagnetic PIC capabilities with a quasi-MHD finite element package

  2. accelerating cavity

    CERN Multimedia

    On the inside of the cavity there is a layer of niobium. Operating at 4.2 degrees above absolute zero, the niobium is superconducting and carries an accelerating field of 6 million volts per metre with negligible losses. Each cavity has a surface of 6 m2. The niobium layer is only 1.2 microns thick, ten times thinner than a hair. Such a large area had never been coated to such a high accuracy. A speck of dust could ruin the performance of the whole cavity so the work had to be done in an extremely clean environment.

  3. Cosmic ray acceleration mechanisms

    International Nuclear Information System (INIS)

    Cesarsky, C.J.

    1982-09-01

    We present a brief summary of some of the most popular theories of cosmic ray acceleration: Fermi acceleration, its application to acceleration by shocks in a scattering medium, and impulsive acceleration by relativistic shocks

  4. Equipartitioning in linear accelerators

    International Nuclear Information System (INIS)

    Jameson, R.A.

    1982-01-01

    Emittance growth has long been a concern in linear accelerators, as has the idea that some kind of energy balance, or equipartitioning, between the degrees of freedom, would ameliorate the growth. M. Prome observed that the average transverse and longitudinal velocity spreads tend to equalize as current in the channel is increased, while the sum of the energy in the system stays nearly constant. However, only recently have we shown that an equipartitioning requirement on a bunched injected beam can indeed produce remarkably small emittance growth. The simple set of equations leading to this condition are outlined. At the same time, Hofmann has investigated collective instabilities in transported beams and has identified thresholds and regions in parameter space where instabilities occur. Evidence is presented that shows transport system boundaries to be quite accurate in computer simulations of accelerating systems. Discussed are preliminary results of efforts to design accelerators that avoid parameter regions where emittance is affected by the instabilities identified by Hofmann. These efforts suggest that other mechanisms are present. The complicated behavior of the RFQ linac in this framework also is shown

  5. Equipartitioning in linear accelerators

    International Nuclear Information System (INIS)

    Jameson, R.A.

    1981-01-01

    Emittance growth has long been a concern in linear accelerators, as has the idea that some kind of energy balance, or equipartitioning, between the degrees of freedom, would ameliorate the growth. M. Prome observed that the average transverse and longitudinal velocity spreads tend to equalize as current in the channel is increased, while the sum of the energy in the system stays nearly constant. However, only recently have we shown that an equipartitioning requirement on a bunched injected beam can indeed produce remarkably small emittance growth. The simple set of equations leading to this condition are outlined below. At the same time, Hofmann, using powerful analytical and computational methods, has investigated collective instabilities in transported beams and has identified thresholds and regions in parameter space where instabilities occur. This is an important generalization. Work that he will present at this conference shows that the results are essentially the same in r-z coordinates for transport systems, and evidence is presented that shows transport system boundaries to be quite accurate in computer simulations of accelerating systems also. Discussed are preliminary results of efforts to design accelerators that avoid parameter regions where emittance is affected by the instabilities identified by Hofmann. These efforts suggest that other mechanisms are present. The complicated behavior of the RFQ linac in this framework also is shown

  6. Measurements of dose on build-up region, surface dose and outlet dose by a 10 MeV Linear accelerator

    International Nuclear Information System (INIS)

    Souza, C.N. de; Khoury, H.J.

    1987-01-01

    The dose on buildup region and the surface dose for a 10 MeV photon beam from a linear acelerator (Mevatrom-74, Siemens) is studied. The influence of the tray of polycarbonate on the surface dose is determined. (M.A.C.) [pt

  7. ACFA and IPAC announce accelerator prizes

    CERN Multimedia

    CERN Bulletin

    2010-01-01

    Steve Myers, CERN's Director for Accelerators and Technology. The Asian Committee for Future Accelerators (ACFA) has joined forces with the first International Particle Accelerator Conference, IPAC’10, to award prizes for outstanding work in the field of accelerators. The conference replaces the regional conferences of the Americas, Europe and Asia and will be hosted by the three regions on a rotational basis (see CERN Courier). The ACFA/IPAC’10 Prizes Selection Committee, chaired by Won Namkung of Pohang Accelerator Laboratory, decided on the prizes and the names of the winners at a meeting on 20 January. The awards will be made during IPAC’10, which will be held in Kyoto on 23-28 May. Jie Wei. (Courtesy Tsinghua University.) Steve Myers, Director for Accelerators and Technology at CERN, receives an Achievement Prize for Outstanding Work in the Accelerator Field with no Age Limit “for his numerous outstanding contributions to the design, construction, commissio...

  8. Recent applications of a QM/MM scheme at the CASPT2//CASSCF/AMBER (or CHARMM) level of theory in photochemistry and photobiology

    International Nuclear Information System (INIS)

    Sinicropi, A; Basosi, R; Olivucci, M

    2008-01-01

    The excited-state properties of chemically different chromophores embedded in diverse protein environments or in solution can be nowadays correctly evaluated by means of a hybrid quantum mechanics/molecular mechanics (QM/MM) computational strategy based on multiconfigurational perturbation theory and complete-active-space-self-consistent-field geometry optimization. In particular, in this article we show how a QM/MM strategy has been recently developed in our laboratory and has been successfully applied to the investigation of the fluorescence of the green fluorescent protein (GFP) and how the same strategy (embedding the chromophores in methanol solution) has been combined with retrosynthetic analysis to design a prototype light-driven Z/E molecular switch featuring a single reactive double bond and the same electronic structure and photoisomerization mechanism of the chromophore of the visual pigment Rhodopsin

  9. Analytical Solution of Dirac Equation for q-Deformed Hyperbolic Manning-Rosen Potential in D Dimensions using SUSY QM and its Thermodynamics Application

    International Nuclear Information System (INIS)

    Cari, C; Suparmi, A; Yunianto, M; Pratiwi, B N

    2016-01-01

    The Dirac equation of q-deformed hyperbolic Manning Rosen potential in D dimension was solved by using Supersymmetric Quantum Mechanics (SUSY QM). The D dimensional relativistic energy spectra were obtained by using SUSY QM and shape invariant properties and D dimensional wave functions of q-deformed hyperbolic Manning Rosen potential were obtained by using the SUSY raising and lowering operators. In the nonrelativistic limit, the relativistic energy spectra for exact spin symmetry case reduced into nonrelativistic energy spectra and so for the wave functions. In the classical regime, the partition function, the vibrational specific heat, and the vibrational mean energy of some diatomic molecules were calculated from the non-relativistic energy spectra with the help of error function and imaginary error function. (paper)

  10. High-energy inverse free-electron laser accelerator

    International Nuclear Information System (INIS)

    Courant, E.D.; Pellegrini, C.; Zakowicz, W.

    1985-01-01

    We study the inverse free electron laser (IFEL) accelerator and show that it can accelerate electrons to the few hundred GeV region with average acceleration rates of the order of 200 meV/m. Several possible accelerating structures are analyzed, and the effect of synchrotron radiation losses is studied. The longitudinal phase stability of accelerated particles is also analyzed. A Hamiltonian description, which takes into account the dissipative features of the IFEL accelerator, is introduced to study perturbations from the resonant acceleration. Adiabatic invariants are obtained and used to estimate the change of the electron phase space density during the acceleration process

  11. Quantum-mechanical vs. semi-classical spectral-line widths and shifts from the line core in the non-impact region for the Ar-perturbed/ K-radiator system

    International Nuclear Information System (INIS)

    Kreye, W.C.

    2007-01-01

    New quantum-mechanical (QM) and semi-classical (SC) shifts (d's) and widths (HWHM's, w's) were measured from the line core of computed full spectral-line shapes for the Ar-perturbed/K-radiator system (K/Ar). The initial state of our model was based on a 4p 2 P 3/2,1/2 pseudo-potential for the K/Ar system, and the final state on a zero potential. The Fourier transform of the line shape formed the basis for the computations. Excellent agreement was found between the QM and SC values of d and of w in a high-pressure (P) non-impact region, which was characterized by a √P dependence of w and a P dependence of d. These agreements were shown to be another example of a correspondence between classical (SC) quantities and QM quantities in the limit of large quantum numbers. Typically at P=1x10 6 Torr and T=400 K, w QM =448 cm -1 and w SC =479 cm -1 , where the deviation from the mean is ±3.3%. Also, d QM =-3815 cm -1 and d SC =-3716 cm -1 , where the deviation from the mean is ±1.3%. A new general method was formulated which yielded a definite pressure P 0 , which was defined as an upper limit to the low-pressure impact approximation and a lower limit to the non-impact region

  12. Inverse Free Electron Laser accelerator

    International Nuclear Information System (INIS)

    Fisher, A.; Gallardo, J.; van Steenbergen, A.; Sandweiss, J.

    1992-09-01

    The study of the INVERSE FREE ELECTRON LASER, as a potential mode of electron acceleration, is being pursued at Brookhaven National Laboratory. Recent studies have focussed on the development of a low energy, high gradient, multi stage linear accelerator. The elementary ingredients for the IFEL interaction are the 50 MeV Linac e - beam and the 10 11 Watt CO 2 laser beam of BNL's Accelerator Test Facility (ATF), Center for Accelerator Physics (CAP) and a wiggler. The latter element is designed as a fast excitation unit making use of alternating stacks of Vanadium Permendur (VaP) ferromagnetic laminations, periodically interspersed with conductive, nonmagnetic laminations, which act as eddy current induced field reflectors. Wiggler parameters and field distribution data will be presented for a prototype wiggler in a constant period and in a ∼ 1.5 %/cm tapered period configuration. The CO 2 laser beam will be transported through the IFEL interaction region by means of a low loss, dielectric coated, rectangular waveguide. Short waveguide test sections have been constructed and have been tested using a low power cw CO 2 laser. Preliminary results of guide attenuation and mode selectivity will be given, together with a discussion of the optical issues for the IFEL accelerator. The IFEL design is supported by the development and use of 1D and 3D simulation programs. The results of simulation computations, including also wiggler errors, for a single module accelerator and for a multi-module accelerator will be presented

  13. TESLA accelerator installation

    International Nuclear Information System (INIS)

    Neskovic, N.; Ostojic, R.; Susini, A.; Milinkovic, Lj.; Ciric, D.; Dobrosavljevic, A.; Brajuskovic, B.; Cirkovic, S.; Bojovic, B.; Josipovic, M.

    1992-01-01

    The TESLA accelerator Installation is described. Its main parts are the VINCY Cyclotron, the multiply charged heavy-ion mVINIS Ion Source, and the negative light-ion pVINIS Ion Source. The Installation should be the principal installation of a regional center for basic and applied research in nuclear physics, atomic physics, surface physics and solid state physics, for production of radioisotopes, for research and therapy in nuclear medicine. The first extraction of the ion beam from the Cyclotron is planned for 1995. (R.P.) 3 refs.; 1 fig

  14. Sector ring accelerator ''RESATRON''

    International Nuclear Information System (INIS)

    Schwabe, E.

    1980-01-01

    Project of sector ring accelerator RESATRON is described. The curiosity of this accelerator is the second cycle of acceleration of the beam after stripping it on the foil. In such an accelerator heavy ions with a different ratio Z to A can be accelerated. (S.B.)

  15. Benchmarking Quantum Mechanics/Molecular Mechanics (QM/MM) Methods on the Thymidylate Synthase-Catalyzed Hydride Transfer.

    Science.gov (United States)

    Świderek, Katarzyna; Arafet, Kemel; Kohen, Amnon; Moliner, Vicent

    2017-03-14

    Given the ubiquity of hydride-transfer reactions in enzyme-catalyzed processes, identifying the appropriate computational method for evaluating such biological reactions is crucial to perform theoretical studies of these processes. In this paper, the hydride-transfer step catalyzed by thymidylate synthase (TSase) is studied by examining hybrid quantum mechanics/molecular mechanics (QM/MM) potentials via multiple semiempirical methods and the M06-2X hybrid density functional. Calculations of protium and tritium transfer in these reactions across a range of temperatures allowed calculation of the temperature dependence of kinetic isotope effects (KIE). Dynamics and quantum-tunneling effects are revealed to have little effect on the reaction rate, but are significant in determining the KIEs and their temperature dependence. A good agreement with experiments is found, especially when computed for RM1/MM simulations. The small temperature dependence of quantum tunneling corrections and the quasiclassical contribution term cancel each other, while the recrossing transmission coefficient seems to be temperature-independent over the interval of 5-40 °C.

  16. Theoretical investigation on the inclusion of TCDD with β-cyclodextrin by performing QM calculations and MD simulations

    International Nuclear Information System (INIS)

    Pan, Wenxiao; Zhang, Dongju; Zhan, Jinhua

    2011-01-01

    Highlights: → We study the inclusion mechanism of TCDD with β-CD by theoretical methods. → Clearly, the formation of inclusion complex is an energetically driven process. → The inclusion complex can be detected by IR and Raman techniques. → The results imply that β-CD may be used as a host molecule to enrich TCDD molecules. - Abstract: The rapid enrichment and detection of trace polychlorinated dibenzo-p-dioxins (PCDDs) and polychlorinated dibenzofurans (PCDFs) are currently challenging issues in the field of environmental science. In this paper, by performing quantum chemistry (QM) calculations and molecular dynamics (MD) simulations, we studied the inclusion complexation of 2,3,7,8-tetrachlorodibenzo-p-dioxin (TCDD), a representative PCDD molecule, with β-cyclodextrin (β-CD), one of the widely used compounds in supramolecular chemistry. The calculated results reveal that the stable inclusion complex can be formed in both the gas phase and solvent, which proposes that β-CD may serve as a potential substrate enriching TCDD. The calculated vibrational spectra indicate that the infrared (IR) and Raman spectroscopy may be suitable for the detection of β-CD-modified TCDD. The present theoretical results may be informative to environmental scientists who are devoting themselves to developing effective methods for detection and treatment of POPs.

  17. Comparative Theoretical Study of the Ring-Opening Polymerization of Caprolactam vs Caprolactone Using QM/MM Methods

    Energy Technology Data Exchange (ETDEWEB)

    Elsasser, Brigitta M.; Schoenen, Iris; Fels, Gregor

    2013-06-07

    Candida antarctica lipase B (CALB) efficiently catalyzes the ring-opening polymerization of lactones to high molecular weight products in good yield. In contrast, an efficient enzymatic synthesis of polyamides has so far not been described in the literature. This obvious difference in enzyme catalysis is the subject of our comparative study of the initial steps of a CALB catalyzed ring-opening polymerization of ε- caprolactone and ε-caprolactam. We have applied docking tools to generate the reactant state complex and performed quantum mechanical/molecular mechanical (QM/MM) calculations at the density functional theory (DFT) PBE0 level of theory to simulate the acylation of Ser105 by the lactone and the lactam, respectively, via the corresponding first tetrahedral intermediates. We could identify a decisive difference in the accessibility of the two substrates in the ring-opening to the respective acyl enzyme complex as the attack of ε-caprolactam is hindered because of an energetically disfavored proton transfer during this part of the catalytic reaction while ε-caprolactone is perfectly processed along the widely accepted pathway using the catalytic triade of Ser105, His224, and Asp187. Since the generation of an acylated Ser105 species is the crucial step of the polymerization procedure, our results give an explanation for the unsatisfactory enzymatic polyamide formation and opens up new possibilities for targeted rational catalyst redesign in hope of an experimentally useful CALB catalyzed polyamide synthesis.

  18. Substrate Recognition in the Escherichia coli Ammonia Channel AmtB: A QM/MM Investigation

    DEFF Research Database (Denmark)

    Nygaard, Thomas Pedersen; Alfonso-Prieto, M.; Peters, Günther H.J.

    2010-01-01

    understood. The present computational study addresses the importance of intermolecular interactions with respect to substrate recruitment and recognition by means of ab initio QM/MM simulations. On the basis of calculations with substrates NH3, NH4+, Na+, and K+ positioned at the periplasmic binding site (Am......1) and NH3 and NH4+ at intraluminal binding sites (Am1a/b), we conclude that D160 is the single most important residue for substrate recruitment, whereas cation-pi interactions to W148 and F107 are found to be less important. Regarding substrate recruitment and recognition, we find that only NH4......+ and K+ reach the Am1 site. However, NH4+ has the largest affinity for this site due to its better dehydration compensation, while charge stabilization effects favor the binding of NH4+ over NH3 (i.e., if NH3 would enter the Am1 site, it is likely to be protonated). Therefore, we conclude that the Am1...

  19. Multiperiodic accelerator structures for linear particle accelerators

    International Nuclear Information System (INIS)

    Tran, D.T.

    1975-01-01

    High efficiency linear accelerator structures, comprised of a succession of cylindrical resonant cavities for acceleration, are described. Coupling annular cavities are located at the periphery, each being coupled to two adjacent cylindrical cavities. (auth)

  20. Quantifying the mechanism of phosphate monoester hydrolysis in aqueous solution by evaluating the relevant ab initio QM/MM free-energy surfaces.

    Science.gov (United States)

    Plotnikov, Nikolay V; Prasad, B Ram; Chakrabarty, Suman; Chu, Zhen T; Warshel, Arieh

    2013-10-24

    Understanding the nature of the free-energy surfaces for phosphate hydrolysis is a prerequisite for understanding the corresponding key chemical reactions in biology. Here, the challenge has been to move to careful ab initio QM/MM (QM(ai)/MM) free-energy calculations, where obtaining converging results is very demanding and computationally expensive. This work describes such calculations, focusing on the free-energy surface for the hydrolysis of phosphate monoesters, paying special attention to the comparison between the one water (1W) and two water (2W) paths for the proton-transfer (PT) step. This issue has been explored before by energy minimization with implicit solvent models and by nonsystematic QM/MM energy minimization, as well as by nonsystematic free-energy mapping. However, no study has provided the needed reliable 2D (3D) surfaces that are necessary for reaching concrete conclusions. Here we report a systematic evaluation of the 2D (3D) free-energy maps for several relevant systems, comparing the results of QM(ai)/MM and QM(ai)/implicit solvent surfaces, and provide an advanced description of the relevant energetics. It is found that the 1W path for the hydrolysis of the methyl diphosphate (MDP) trianion is 6-9 kcal/mol higher than that the 2W path. This difference becomes slightly larger in the presence of the Mg(2+) ion because this ion reduces the pKa of the conjugated acid form of the phosphate oxygen that accepts the proton. Interestingly, the BLYP approach (which has been used extensively in some studies) gives a much smaller difference between the 1W and 2W activation barriers. At any rate, it is worth pointing out that the 2W transition state for the PT is not much higher that the common plateau that serves as the starting point of both the 1W and 2W PT paths. Thus, the calculated catalytic effects of proteins based on the 2W PT mechanistic model are not expected to be different from the catalytic effects predicted using the 1W PT mechanistic

  1. Measurement of deuteron-induced activation cross section for IFMIF accelerator structural materials in 22-40 MeV region

    International Nuclear Information System (INIS)

    Nakao, Makoto; Hori, Jun-ichi; Ochiai, Kentaro; Sato, Satoshi; Yamauchi, Michinori; Nishitani, Takeo; Ishioka, Noriko S.

    2004-01-01

    The activation cross-sections for the deuteron-induced reactions have been obtained for Al, Cu and W in 22-40 MeV regions and compared with previous experimental ones and the data in ACSELAM library. For 27 Mg, ACSELAM were smaller than the present result by a factor of 1.3-2.0. For 24 Na, ACSELAM resembled experimental values in shape but were lower than these by about 1 order. For 61 Cu, 64 Cu, 62 Zn and 63 Zn, the present results resembled other experimental data and ACSELAM in shape. In the case of 61 Cu and 62 Zn, ACSELAM became higher than the present results by a factor of 2-4. In the case of 64 Cu and 63 Zn, ACSELAM and the present results were in agreement within 40%. For 181 Re, 182m+g Re and 183 Re, the present data and the data in ACSELAM were about same shapes and in agreement within 30%. For 184m+g Re, 186 Re and 187 W, the data in ACSELAM were different from the present data about 1.5-7 times. (author)

  2. Study on ion radial acceleration in the region of virtual cathode formation on injection of relativistic electron beam into neutral gas

    International Nuclear Information System (INIS)

    Bystritskij, V.M.; Podkatov, V.I.; Chistyakov, S.A.; Yalovets, A.P.

    1982-01-01

    Results of numerical calculations and experimental investigations into different parameters of radial fluxes of deuterium ions and electrons performed in the region of virtual cathode formation when injecting a relativistic electron beam in low-pressure deuterium (10-100 μm Hg) are given. The calculations were carried out by the Monte-Carlo method within the framework of three models: Rostocker (Vsub(w) approximately equal to epsilonsub(e)/e), Olson (Vsub(w) approximately equal to (2-3)epsilonsub(e)/e) and Byistritcky (Vsub(w) approximately equal to 1.5 epsilonsub(e)/e) (where Vsub(w) - depth of a forming potential well, epsilonsub(e) - energy of beam electrons, e - electron charge). It is concluded on the basis of the comparative analysis of numerical and experimental results that there is no a deep stationary well with Vsub(w) approximately equal to (2-3)epsilonsub(e)/e, how this is postulated in the Olson model [ru

  3. Accelerators of atomic particles

    International Nuclear Information System (INIS)

    Sarancev, V.

    1975-01-01

    A brief survey is presented of accelerators and methods of accelerating elementary particles. The principle of collective accelerating of elementary particles is clarified and the problems are discussed of its realization. (B.S.)

  4. Laser-driven acceleration with Bessel beam

    International Nuclear Information System (INIS)

    Imasaki, Kazuo; Li, Dazhi

    2005-01-01

    A new approach of laser-driven acceleration with Bessel beam is described. Bessel beam, in contrast to the Gaussian beam, shows diffraction-free'' characteristics in its propagation, which implies potential in laser-driven acceleration. But a normal laser, even if the Bessel beam, laser can not accelerate charged particle efficiently because the difference of velocity between the particle and photon makes cyclic acceleration and deceleration phase. We proposed a Bessel beam truncated by a set of annular slits those makes several special regions in its travelling path, where the laser field becomes very weak and the accelerated particles are possible to receive no deceleration as they undergo decelerating phase. Thus, multistage acceleration is realizable with high gradient. In a numerical computation, we have shown the potential of multistage acceleration based on a three-stage model. (author)

  5. Chicago particle accelerator conference

    International Nuclear Information System (INIS)

    Southworth, Brian

    1989-01-01

    Naturally, emphasis at the Particle Accelerator Conference in Chicago in March was on work in the US, just as the newly instituted European Particle Accelerator Conference places emphasis on work in the 'old continent'. All will come together at the international conference in Japan in August. The proposed US Superconducting Supercollider (SSC) was highlighted in the opening talk at Chicago. Progress on this inchoate project to explore the TeV (1000 GeV) energy region by colliding 20 TeV proton beams was reported by the recently-appointed Director of the SSC Laboratory, Roy Schwitters. He reviewed the physics challenges and described progress and plans towards full authorization of construction.This year, the SSC conceptual design will be transformed into a 'site specific' report, now that the location at Waxahachie in Ellis County, Texas, has been selected. The Central Design Group, based in Berkeley for the past few years, will soon move to the Waxahachie region. The top management structure is taking shape and an International Advisory Committee is being formed

  6. Chicago particle accelerator conference

    Energy Technology Data Exchange (ETDEWEB)

    Southworth, Brian

    1989-06-15

    Naturally, emphasis at the Particle Accelerator Conference in Chicago in March was on work in the US, just as the newly instituted European Particle Accelerator Conference places emphasis on work in the 'old continent'. All will come together at the international conference in Japan in August. The proposed US Superconducting Supercollider (SSC) was highlighted in the opening talk at Chicago. Progress on this inchoate project to explore the TeV (1000 GeV) energy region by colliding 20 TeV proton beams was reported by the recently-appointed Director of the SSC Laboratory, Roy Schwitters. He reviewed the physics challenges and described progress and plans towards full authorization of construction.This year, the SSC conceptual design will be transformed into a 'site specific' report, now that the location at Waxahachie in Ellis County, Texas, has been selected. The Central Design Group, based in Berkeley for the past few years, will soon move to the Waxahachie region. The top management structure is taking shape and an International Advisory Committee is being formed.

  7. CERN-LHC accelerator superconducting magnet. Development and international cooperation

    International Nuclear Information System (INIS)

    Yamamoto, Akira; Nakamoto, Tatsushi; Sasaki, Ken-ichi

    2009-01-01

    CERN-LHC accelerator superconducting magnets and a cooperative work for interaction region quadrupole magnets are introduced. The accelerator commissioning and the incident happened during the commissioning in 2008 is also briefly discussed. (author)

  8. Cluster observations of particle acceleration up to supra-thermal energies in the cusp region related to low-frequency wave activity – possible implications for the substorm initiation process

    Directory of Open Access Journals (Sweden)

    T. A. Fritz

    2008-03-01

    Full Text Available The purpose of our study is to investigate the way particles are accelerated up to supra-thermal energies in the cusp diamagnetic cavities. For this reason we have examined a number of Cluster cusp crossings, originally identified by Zhang et al. (2005, for the years 2001 and 2002 using data from RAPID, STAFF, EFW, CIS, PEACE, and FGM experiments. In the present study we focus on two particular cusp crossings on 25 March 2002 and on 10 April 2002 which demonstrate in a clear way the general characteristics of the events in our survey. Both events exhibit very sharp spatial boundaries seen both in CNO (primarily single-charged oxygen of ionospheric origin based on CIS observations and H+ flux increases within the RAPID energy range with the magnetic field intensity being anti-correlated. Unlike the first event, the second one shows also a moderate electron flux increase. The fact that the duskward electric field Ey has relatively low values <5 mV/m while the local wave activity is very intense provides a strong indication that particle energization is caused primarily by wave-particle interactions. The wave power spectra and propagation parameters during these cusp events are examined in detail. It is concluded that the high ion fluxes and at the same time the presence or absence of any sign of energization in the electrons clearly shows that the particle acceleration depends on the wave power near the local particle gyrofrequency and on the persistence of the wave-particle interaction process before particles escape from cusp region. Furthermore, the continuous existence of energetic O+ ions suggests that energetic O+ populations are of spatial nature at least for the eight events that we have studied so far.

  9. Test accelerator for linear collider

    International Nuclear Information System (INIS)

    Takeda, S.; Akai, K.; Akemoto, M.; Araki, S.; Hayano, H.; Hugo, T.; Ishihara, N.; Kawamoto, T.; Kimura, Y.; Kobayashi, H.; Kubo, T.; Kurokawa, S.; Matsumoto, H.; Mizuno, H.; Odagiri, J.; Otake, Y.; Sakai, H.; Shidara, T.; Shintake, T.; Suetake, M.; Takashima, T.; Takata, K.; Takeuchi, Y.; Urakawa, J.; Yamamoto, N.; Yokoya, K.; Yoshida, M.; Yoshioka, M.; Yamaoka, Y.

    1989-01-01

    KEK has proposed to build Test Accelerator Facility (TAF) capable of producing a 2.5 GeV electron beam for the purpose of stimulating R ampersand D for linear collider in TeV region. The TAF consists of a 1.5 GeV S-band linear accelerator, 1.5 GeV damping ring and 1.0 GeV X-band linear accelerator. The TAF project will be carried forward in three phases. Through Phase-I and Phase-II, the S-band and X-band linacs will be constructed, and in Phase-III, the damping ring will be completed. The construction of TAF Phase-I has started, and the 0.2 GeV S-band injector linac has been almost completed. The Phase-I linac is composed of a 240 keV electron gun, subharmonic bunchers, prebunchers and traveling buncher followed by high-gradient accelerating structures. The SLAC 5045 klystrons are driven at 450 kV in order to obtain the rf-power of 100 MW in a 1 μs pulse duration. The rf-power from a pair of klystrons are combined into an accelerating structure. The accelerating gradient up to 100 MeV/m will be obtained in a 0.6 m long structure. 5 refs., 3 figs., 2 tabs

  10. Fringing-field effects in acceleration columns

    International Nuclear Information System (INIS)

    Yavor, M.I.; Weick, H.; Wollnik, H.

    1999-01-01

    Fringing-field effects in acceleration columns are investigated, based on the fringing-field integral method. Transfer matrices at the effective boundaries of the acceleration column are obtained, as well as the general transfer matrix of the region separating two homogeneous electrostatic fields with different field strengths. The accuracy of the fringing-field integral method is investigated

  11. X-ray crystallography and QM/MM investigation on the oligosaccharide synthesis mechanism of rice BGlu1 glycosynthases.

    Science.gov (United States)

    Wang, Jinhu; Pengthaisong, Salila; Cairns, James R Ketudat; Liu, Yongjun

    2013-02-01

    Nucleophile mutants of retaining β-glycosidase can act as glycosynthases to efficiently catalyze the synthesis of oligosaccharides. Previous studies proved that rice BGlu1 mutants E386G, E386S and E386A catalyze the oligosaccharide synthesis with different rates. The E386G mutant gave the fastest transglucosylation rate, which was approximately 3- and 19-fold faster than those of E386S and E386A. To account for the differences of their activities, in this paper, the X-ray crystal structures of BGlu1 mutants E386S and E386A were solved and compared with that of E386G mutant. However, they show quite similar active sites, which implies that their activities cannot be elucidated from the crystal structures alone. Therefore, a combined quantum mechanical/molecular mechanical (QM/MM) calculations were further performed. Our calculations reveal that the catalytic reaction follows a single-step mechanism, i.e., the extraction of proton by the acid/base, E176, and the formation of glycosidic bond are concerted. The energy barriers are calculated to be 19.9, 21.5 and 21.9kcal/mol for the mutants of E386G, E386S and E386A, respectively, which is consistent with the order of their experimental relative activities. But based on the calculated activation energies, 1.1kcal/mol energy difference may translate to nearly 100 fold rate difference. Although the rate limiting step in these mutants has not been established, considering the size of the product and the nature of the active site, it is likely that the product release, rather than chemistry, is rate limiting in these oligosaccharides synthesis catalyzed by BGlu1 mutants. Copyright © 2012 Elsevier B.V. All rights reserved.

  12. A QM/MM study of the reaction mechanism of (R)-hydroxynitrile lyases from Arabidopsis thaliana (AtHNL).

    Science.gov (United States)

    Zhu, Wenyou; Liu, Yongjun; Zhang, Rui

    2015-01-01

    Hydroxynitrile lyases (HNLs) catalyze the conversion of chiral cyanohydrins to hydrocyanic acid (HCN) and aldehyde or ketone. Hydroxynitrile lyase from Arabidopsis thaliana (AtHNL) is the first R-selective HNL enzyme containing an α/β-hydrolases fold. In this article, the catalytic mechanism of AtHNL was theoretically studied by using QM/MM approach based on the recently obtained crystal structure in 2012. Two computational models were constructed, and two possible reaction pathways were considered. In Path A, the calculation results indicate that the proton transfer from the hydroxyl group of cyanohydrin occurs firstly, and then the cleavage of C1-C2 bond and the rotation of the generated cyanide ion (CN(-)) follow, afterwards, CN(-) abstracts a proton from His236 via Ser81. The C1-C2 bond cleavage and the protonation of CN(-) correspond to comparable free energy barriers (12.1 vs. 12.2 kcal mol(-1)), suggesting that both of the two processes contribute a lot to rate-limiting. In Path B, the deprotonation of the hydroxyl group of cyanohydrin and the cleavage of C1-C2 bond take place in a concerted manner, which corresponds to the highest free energy barrier of 13.2 kcal mol(-1). The free energy barriers of Path A and B are very similar and basically agree well with the experimental value of HbHNL, a similar enzyme of AtHNL. Therefore, both of the two pathways are possible. In the reaction, the catalytic triad (His236, Ser81, and Asp208) acts as the general acid/base, and the generated CN(-) is stabilized by the hydroxyl group of Ser81 and the main-chain NH-groups of Ala13 and Phe82. © 2014 Wiley Periodicals, Inc.

  13. Accelerators of future generation

    International Nuclear Information System (INIS)

    Kolomenskij, A.A.

    1983-01-01

    A brief review of the prospects of development of various of types accelerator over next 10 to 15 years is given. The following directions are considered: superhign energy proton accelerators and storage rings, electron-positron colliding beams, heavy ion accelerators, medium energy, high-current proton accelerators superhigh power particle beams (electrons light- and heavy ions) for inertial fusion

  14. Future accelerator technology

    International Nuclear Information System (INIS)

    Sessler, A.M.

    1986-05-01

    A general discussion is presented of the acceleration of particles. Upon this foundation is built a categorization scheme into which all accelerators can be placed. Special attention is devoted to accelerators which employ a wake-field mechanism and a restricting theorem is examined. It is shown how the theorem may be circumvented. Comments are made on various acceleration schemes

  15. Efficient parallel implementations of QM/MM-REMD (quantum mechanical/molecular mechanics-replica-exchange MD) and umbrella sampling: isomerization of H2O2 in aqueous solution.

    Science.gov (United States)

    Fedorov, Dmitri G; Sugita, Yuji; Choi, Cheol Ho

    2013-07-03

    An efficient parallel implementation of QM/MM-based replica-exchange molecular dynamics (REMD) as well as umbrella samplings techniques was proposed by adopting the generalized distributed data interface (GDDI). Parallelization speed-up of 40.5 on 48 cores was achieved, making our QM/MM-MD engine a robust tool for studying complex chemical dynamics in solution. They were comparatively used to study the torsional isomerization of hydrogen peroxide in aqueous solution. All results by QM/MM-REMD and QM/MM umbrella sampling techniques yielded nearly identical potentials of mean force (PMFs) regardless of the particular QM theories for solute, showing that the overall dynamics are mainly determined by solvation. Although the entropic penalty of solvent rearrangements exists in cisoid conformers, it was found that both strong intermolecular hydrogen bonding and dipole-dipole interactions preferentially stabilize them in solution, reducing the torsional free-energy barrier at 0° by about 3 kcal/mol as compared to that in gas phase.

  16. OpenMP for Accelerators

    Energy Technology Data Exchange (ETDEWEB)

    Beyer, J C; Stotzer, E J; Hart, A; de Supinski, B R

    2011-03-15

    OpenMP [13] is the dominant programming model for shared-memory parallelism in C, C++ and Fortran due to its easy-to-use directive-based style, portability and broad support by compiler vendors. Similar characteristics are needed for a programming model for devices such as GPUs and DSPs that are gaining popularity to accelerate compute-intensive application regions. This paper presents extensions to OpenMP that provide that programming model. Our results demonstrate that a high-level programming model can provide accelerated performance comparable to hand-coded implementations in CUDA.

  17. Design of an electrostatic magnetic quadrupole accelerator

    International Nuclear Information System (INIS)

    Mizuno, M.; Ohara, Y.

    1993-01-01

    A new type of electrostatic acceleration system, electrostatic magnetic quadrupole (ESMQ) acceleration system, is proposed for efficient acceleration of negative ion beams. In this system, permanent magnets are buried in the acceleration electrodes so as to produce a quadrupole magnetic field in the electrode aperture region. Envelope simulation indicates that the quadrupole field can deflect electrons stripped from the negative ions. Beam envelope simulations for deuterium ions and electrons have been carried out using the beam envelope code TRACE. Electrons are largely divergent and most appear likely to hit downstream electrodes. Furthermore, maximum beam divergence of the deuterium ions is reduced to the focusing effect of the quadrupole magnetic field

  18. Adaptive switching of interaction potentials in the time domain: an extended Lagrangian approach tailored to transmute force field to QM/MM simulations and back.

    Science.gov (United States)

    Böckmann, Marcus; Doltsinis, Nikos L; Marx, Dominik

    2015-06-09

    An extended Lagrangian formalism that allows for a smooth transition between two different descriptions of interactions during a molecular dynamics simulation is presented. This time-adaptive method is particularly useful in the context of multiscale simulation as it provides a sound recipe to switch on demand between different hierarchical levels of theory, for instance between ab initio ("QM") and force field ("MM") descriptions of a given (sub)system in the course of a molecular dynamics simulation. The equations of motion can be integrated straightforwardly using the usual propagators, such as the Verlet algorithm. First test cases include a bath of harmonic oscillators, of which a subset is switched to a different force constant and/or equilibrium position, as well as an all-MM to QM/MM transition in a hydrogen-bonded water dimer. The method is then applied to a smectic 8AB8 liquid crystal and is shown to be able to switch dynamically a preselected 8AB8 molecule from an all-MM to a QM/MM description which involves partition boundaries through covalent bonds. These examples show that the extended Lagrangian approach is not only easy to implement into existing code but that it is also efficient and robust. The technique moreover provides easy access to a conserved energy quantity, also in cases when Nosé-Hoover chain thermostatting is used throughout dynamical switching. A simple quadratic driving potential proves to be sufficient to guarantee a smooth transition whose time scale can be easily tuned by varying the fictitious mass parameter associated with the auxiliary variable used to extend the Lagrangian. The method is general and can be applied to time-adaptive switching on demand between two different levels of theory within the framework of hybrid scale-bridging simulations.

  19. General base catalysis for cleavage by the active-site cytosine of the hepatitis delta virus ribozyme: QM/MM calculations establish chemical feasibility

    Czech Academy of Sciences Publication Activity Database

    Banáš, Pavel; Rulíšek, Lubomír; Hánošová, V.; Svozil, Daniel; Walter, N.G.; Šponer, Jiří; Otyepka, Michal

    2008-01-01

    Roč. 112, č. 35 (2008), s. 11177-11187 ISSN 1520-6106 R&D Projects: GA MŠk LC512; GA MŠk(CZ) LC06030; GA AV ČR(CZ) IAA400040802; GA AV ČR 1QS500040581 Grant - others:NIH(US) GM62357 Institutional research plan: CEZ:AV0Z40550506; CEZ:AV0Z50040507; CEZ:AV0Z50040702 Keywords : HDV ribozyme * catalysis * QM/MM calculations Subject RIV: CF - Physical ; Theoretical Chemistry Impact factor: 4.189, year: 2008

  20. Virtual gap dielectric wall accelerator

    Science.gov (United States)

    Caporaso, George James; Chen, Yu-Jiuan; Nelson, Scott; Sullivan, Jim; Hawkins, Steven A

    2013-11-05

    A virtual, moving accelerating gap is formed along an insulating tube in a dielectric wall accelerator (DWA) by locally controlling the conductivity of the tube. Localized voltage concentration is thus achieved by sequential activation of a variable resistive tube or stalk down the axis of an inductive voltage adder, producing a "virtual" traveling wave along the tube. The tube conductivity can be controlled at a desired location, which can be moved at a desired rate, by light illumination, or by photoconductive switches, or by other means. As a result, an impressed voltage along the tube appears predominantly over a local region, the virtual gap. By making the length of the tube large in comparison to the virtual gap length, the effective gain of the accelerator can be made very large.

  1. On the structure of acceleration in turbulence

    DEFF Research Database (Denmark)

    Liberzon, A.; Lüthi, B.; Holzner, M.

    2012-01-01

    Acceleration and spatial velocity gradients are obtained simultaneously in an isotropic turbulent flow via three dimensional particle tracking velocimetry. We observe two distinct populations of intense acceleration events: one in flow regions of strong strain and another in regions of strong...... vorticity. Geometrical alignments with respect to vorticity vector and to the strain eigenvectors, curvature of Lagrangian trajectories and of streamlines for total acceleration, and for its convective part, , are studied in detail. We discriminate the alignment features of total and convective acceleration...... statistics, which are genuine features of turbulent nature from those of kinematic nature. We find pronounced alignment of acceleration with vorticity. Similarly, and especially are predominantly aligned at 45°with the most stretching and compressing eigenvectors of the rate of the strain tensor...

  2. Pulsed electromagnetic acceleration

    Science.gov (United States)

    Jahn, R. G.; Vonjaskowsky, W. F.; Clark, K. E.

    1973-01-01

    Direct measurements of the power deposited in the anode of a multimegawatt MPD accelerator using thermocouples attached to a thin shell anode reveal a dramatic decrease in the fractional anode power from 50% at 200 KW input power to less than 10% at 20 MW power. The corresponding local power flux peak at a value of 10,000 W/sq cm at the lip of the anode exhaust orifice, a distribution traced to a corresponding peak in the local current density at the anode. A comparison of voltage-current characteristics and spectral photographs of the MPD discharge using quartz, boron nitride and plexiglas insulators with various mass injection configurations led to the identification of different voltage modes and regions of ablation free operation. The technique of piezoelectric impact pressure measurement in the MPD exhaust flow was refined to account for the effects due to probe yaw angle.

  3. 2014 CERN Accelerator Schools: Plasma Wake Acceleration

    CERN Multimedia

    2014-01-01

    A specialised school on Plasma Wake Acceleration will be held at CERN, Switzerland from 23-29 November, 2014.   This course will be of interest to staff and students in accelerator laboratories, university departments and companies working in or having an interest in the field of new acceleration techniques. Following introductory lectures on plasma and laser physics, the course will cover the different components of a plasma wake accelerator and plasma beam systems. An overview of the experimental studies, diagnostic tools and state of the art wake acceleration facilities, both present and planned, will complement the theoretical part. Topical seminars and a visit of CERN will complete the programme. Further information can be found at: http://cas.web.cern.ch/cas/PlasmaWake2014/CERN-advert.html http://indico.cern.ch/event/285444/

  4. Can tautomerization of the A·T Watson-Crick base pair via double proton transfer provoke point mutations during DNA replication? A comprehensive QM and QTAIM analysis.

    Science.gov (United States)

    Brovarets, Ol'ha O; Hovorun, Dmytro M

    2014-01-01

    Trying to answer the question posed in the title, we have carried out a detailed theoretical investigation of the biologically important mechanism of the tautomerization of the A·T Watson-Crick DNA base pair, information that is hard to establish experimentally. By combining theoretical investigations at the MP2 and density functional theory levels of QM theory with quantum theory of atoms in molecules analysis, the tautomerization of the A·T Watson-Crick base pair by the double proton transfer (DPT) was comprehensively studied in vacuo and in the continuum with a low dielectric constant (ϵ = 4) corresponding to a hydrophobic interfaces of protein-nucleic acid interactions. Based on the sweeps of the electron-topological, geometric, and energetic parameters, which describe the course of the tautomerization along its intrinsic reaction coordinate (IRC), it was proved that the A·T → A(∗)·T(∗) tautomerization through the DPT is a concerted (i.e. the pathway without an intermediate) and asynchronous (i.e. protons move with a time gap) process. The limiting stage of this phenomenon is the final PT along the N6H⋯O4 hydrogen bond (H-bond). The continuum with ϵ = 4 does not affect qualitatively the course of the tautomerization reaction: similar to that observed in vacuo, it proceeds via a concerted asynchronous process with the same structure of the transition state (TS). For the first time, the nine key points along the IRC of the A·T base pair tautomerization, which could be considered as electron-topological "fingerprints" of a concerted asynchronous process of the tautomerization via the DPT, have been identified and fully characterized. These nine key points have been used to define the reactant, TS, and product regions of the DPT in the A·T base pair. Considering the energy dependence of each of the three H-bonds, which stabilize the Watson-Crick and Löwdin's base pairs, along the IRC of the tautomerization, it was found that all these H

  5. [Detection of heterogeneity and evolution of subclones in t(8;21) AML by QM-FISH].

    Science.gov (United States)

    Wang, Ying-chan; Hu, Lin-ping; Lin, Dong; Li, Cheng-wen; Yuan, Tian; Jia, Yu-jiao; Tian, Zheng; Tang, Ke-jing; Wang, Min; Wang, Jian-xiang

    2013-10-01

    To explore the heterogeneous subclones in acute myeloid leukemia (AML) with t(8;21) by quantitative multicolor- fluorescence in situ hybridization (QM-FISH), and to figure out whether there is putative ancestral relationship among different subclones. Bacterial artificial chromosomes (BAC) clones that contain the targeted genes including AML1, ETO, WT1, p27 and c-kit were searched in the data base UCSC Genome Bioinformatics. Multicolor FISH probes were prepared by linking fluorescein labeled dUTP or dCTP to targeted genes by nick translation. Bone marrow mononuclear cells from t (8;21) AML patients are dropped on to the wet surface of glass slides after hypotonic treatment and fixation. After hybridization, the fluorescence signals were captured by Zeiss fluorescence microscope. The copy number of AML1, ETO, WT1, p27, c- kit and the AML1-ETO fusion gene in AML1-ETO positive cells was counted. The cells with same signals were defined as a subclone. Various subclones were recorded and their proportions were calculated, and their evolutionary relationship was deduced. The subclones in matched primary and relapsed samples were compared, the evolution of dominant clones were figured out and the genomic abnormality that is associated with relapse and drug resistance were speculated. In this study, 36 primary AML with t(8;21) cases and 1 relapsed case paired with the primary case were detected. In these 36 primary cases, 4 cases (11.1%) acquired additional AML1-ETO fusion signal, 3(8.3%) had additional AML1 signal, 4(11.1%) had additional ETO signal, 20(55.6%) had additional WT1 signal, 15(41.7%) had additional p27 signal and 14(38.9%) had additional c-kit signal. In addition, 10(27.8%) displayed AML1 signal deletion, and such an aberration represents statistic significance in male patients. It seems that male patients usually accompany AML1 signal deletion. Of 36 cases, 28(77.8 %) harbored at least 2 subclones (ranged from 2 to 10). According to the genetic signature of

  6. QM/MM Geometry Optimization on Extensive Free-Energy Surfaces for Examination of Enzymatic Reactions and Design of Novel Functional Properties of Proteins.

    Science.gov (United States)

    Hayashi, Shigehiko; Uchida, Yoshihiro; Hasegawa, Taisuke; Higashi, Masahiro; Kosugi, Takahiro; Kamiya, Motoshi

    2017-05-05

    Many remarkable molecular functions of proteins use their characteristic global and slow conformational dynamics through coupling of local chemical states in reaction centers with global conformational changes of proteins. To theoretically examine the functional processes of proteins in atomic detail, a methodology of quantum mechanical/molecular mechanical (QM/MM) free-energy geometry optimization is introduced. In the methodology, a geometry optimization of a local reaction center is performed with a quantum mechanical calculation on a free-energy surface constructed with conformational samples of the surrounding protein environment obtained by a molecular dynamics simulation with a molecular mechanics force field. Geometry optimizations on extensive free-energy surfaces by a QM/MM reweighting free-energy self-consistent field method designed to be variationally consistent and computationally efficient have enabled examinations of the multiscale molecular coupling of local chemical states with global protein conformational changes in functional processes and analysis and design of protein mutants with novel functional properties.

  7. Mechanistic Insights into Radical-Mediated Oxidation of Tryptophan from ab Initio Quantum Chemistry Calculations and QM/MM Molecular Dynamics Simulations.

    Science.gov (United States)

    Wood, Geoffrey P F; Sreedhara, Alavattam; Moore, Jamie M; Wang, John; Trout, Bernhardt L

    2016-05-12

    An assessment of the mechanisms of (•)OH and (•)OOH radical-mediated oxidation of tryptophan was performed using density functional theory calculations and ab initio plane-wave Quantum Mechanics/Molecular Mechanics (QM/MM) molecular dynamics simulations. For the (•)OH reactions, addition to the pyrrole ring at position 2 is the most favored site with a barrierless reaction in the gas phase. The subsequent degradation of this adduct through a H atom transfer to water was intermittently observed in aqueous-phase molecular dynamics simulations. For the (•)OOH reactions, addition to the pyrrole ring at position 2 is the most favored pathway, in contrast to the situation in the model system ethylene, where concerted addition to the double bond is preferred. From the (•)OOH position 2 adduct QM/MM simulations show that formation of oxy-3-indolanaline occurs readily in an aqueous environment. The observed transformation starts from an initial rupture of the O-O bond followed by a H atom transfer with the accompanying loss of an (•)OH radical to solution. Finally, classical molecular dynamics simulations were performed to equate observed differential oxidation rates of various tryptophan residues in monoclonal antibody fragments. It was found that simple parameters derived from simulation correlate well with the experimental data.

  8. High-powered pulsed-ion-beam acceleration and transport

    Energy Technology Data Exchange (ETDEWEB)

    Humphries, S. Jr.; Lockner, T.R.

    1981-11-01

    The state of research on intense ion beam acceleration and transport is reviewed. The limitations imposed on ion beam transport by space charge effects and methods available for neutralization are summarized. The general problem of ion beam neutralization in regions free of applied electric fields is treated. The physics of acceleration gaps is described. Finally, experiments on multi-stage ion acceleration are summarized.

  9. High-powered pulsed-ion-beam acceleration and transport

    International Nuclear Information System (INIS)

    Humphries, S. Jr.; Lockner, T.R.

    1981-11-01

    The state of research on intense ion beam acceleration and transport is reviewed. The limitations imposed on ion beam transport by space charge effects and methods available for neutralization are summarized. The general problem of ion beam neutralization in regions free of applied electric fields is treated. The physics of acceleration gaps is described. Finally, experiments on multi-stage ion acceleration are summarized

  10. Other people's accelerators

    Energy Technology Data Exchange (ETDEWEB)

    Anon.

    1987-06-15

    The first report from the Washington Accelerator Conference concentrated on news from the particle physics centres. But the bulk of the Conference covered the use of accelerators in other fields, underlining this valuable spinoff from particle physics.

  11. Improved plasma accelerator

    Science.gov (United States)

    Cheng, D. Y.

    1971-01-01

    Converging, coaxial accelerator electrode configuration operates in vacuum as plasma gun. Plasma forms by periodic injections of high pressure gas that is ionized by electrical discharges. Deflagration mode of discharge provides acceleration, and converging contours of plasma gun provide focusing.

  12. The electron accelerator Ridgetron

    International Nuclear Information System (INIS)

    Hayashizaki, N.; Hattori, T.; Odera, M.; Fujisawa, T.

    1999-01-01

    Many electron accelerators of DC or RF type have been widely used for electron beam irradiation (curing, crosslinking of polymers, sterilization of medical disposables, preservation of food, etc.). Regardless of the acceleration energy, the accelerators to be installed in industrial facilities, have to satisfy the requires of compact size, low power consumption and stable operation. The DC accelerator is realized very compact in the energy under 300 keV, however, it is large to prevent the discharge of an acceleration column in the energy over 300 keV. The RF electron accelerator Ridgetron has been developed to accelerate the continuous beam of the 0.5-10 MeV range in compact space. It is the first example as an electron accelerator incorporated a ridged RF cavity. A prototype system of final energy of 2.5 MeV has been studied to confirm the feasibility at present

  13. High brightness electron accelerator

    International Nuclear Information System (INIS)

    Sheffield, R.L.; Carlsten, B.E.; Young, L.M.

    1994-01-01

    A compact high brightness linear accelerator is provided for use, e.g., in a free electron laser. The accelerator has a first plurality of accelerating cavities having end walls with four coupling slots for accelerating electrons to high velocities in the absence of quadrupole fields. A second plurality of cavities receives the high velocity electrons for further acceleration, where each of the second cavities has end walls with two coupling slots for acceleration in the absence of dipole fields. The accelerator also includes a first cavity with an extended length to provide for phase matching the electron beam along the accelerating cavities. A solenoid is provided about the photocathode that emits the electrons, where the solenoid is configured to provide a substantially uniform magnetic field over the photocathode surface to minimize emittance of the electrons as the electrons enter the first cavity. 5 figs

  14. Unified accelerator libraries

    International Nuclear Information System (INIS)

    Malitsky, Nikolay; Talman, Richard

    1997-01-01

    A 'Universal Accelerator Libraries' (UAL) environment is described. Its purpose is to facilitate program modularity and inter-program and inter-process communication among heterogeneous programs. The goal ultimately is to facilitate model-based control of accelerators

  15. YEREVAN: Acceleration workshop

    International Nuclear Information System (INIS)

    Anon.

    1989-01-01

    Sponsored by the Yerevan Physics Institute in Armenia, a Workshop on New Methods of Charged Particle Acceleration in October near the Nor Amberd Cosmic Ray Station attracted participants from most major accelerator centres in the USSR and further afield

  16. San Francisco Accelerator Conference

    International Nuclear Information System (INIS)

    Southworth, Brian

    1991-01-01

    'Where are today's challenges in accelerator physics?' was the theme of the open session at the San Francisco meeting, the largest ever gathering of accelerator physicists and engineers

  17. Large tandem accelerators

    International Nuclear Information System (INIS)

    Jones, C.M.

    1976-01-01

    The increasing importance of energetic heavy ion beams in the study of atomic physics, nuclear physics, and materials science has partially or wholly motivated the construction of a new generation of tandem accelerators designed to operate at maximum terminal potentials in the range 14 to 30 MV. In addition, a number of older tandem accelerators are now being significantly upgraded to improve their heavy ion performance. Both of these developments have reemphasized the importance of negative heavy ion sources. The new large tandem accelerators are described, and the requirements placed on negative heavy ion source technology by these and other tandem accelerators used for the acceleration of heavy ions are discussed. First, a brief description is given of the large tandem accelerators which have been completed recently, are under construction, or are funded for construction, second, the motivation for construction of these accelerators is discussed, and last, criteria for negative ion sources for use with these accelerators are presented

  18. Vp x B acceleration

    International Nuclear Information System (INIS)

    Sugihara, Ryo.

    1987-05-01

    A unique particle acceleration by an electrostatic (ES) wave, a magnetosonic shock wave as well as an electromagnetic (EM) wave is reviewed. The principle of the acceleration is that when a charged particle is carried across an external magnetic field the charge feels a DC field (the Lorentz force) and is accelerated. The theory for the ES wave acceleration is experimentally verified thought it is semi-quantitative. The shock acceleration is extensively studied theoretically and in a particle simulation method and the application is extended to phenomena in interplanetary space. The EM wave acceleration is based on a trapping in a moving neutral sheet created by the wave magnetic field and the external magnetic field, and the particle can be accelerated indefinitely. A brief sketch on a slow-wave-structure for this acceleration will be given. (author)

  19. Accelerator-timing system

    International Nuclear Information System (INIS)

    Timmer, E.; Heine, E.

    1985-01-01

    Along the NIKHEF accelerator in Amsterdam (Netherlands), at several places a signal is needed for the sychronisation of all devices with the acceleration process. In this report, basic principles and arrangements of this timing system are described

  20. Linear accelerator: A concept

    Science.gov (United States)

    Mutzberg, J.

    1972-01-01

    Design is proposed for inexpensive accelerometer which would work by applying pressure to fluid during acceleration. Pressure is used to move shuttle, and shuttle movement is sensed and calibrated to give acceleration readings.

  1. Heavy ion accelerators

    International Nuclear Information System (INIS)

    Schmelzer, C.

    1974-01-01

    This review of the present state of work on heavy-ion accelerators pays particular attention to the requirements for nuclear research. It is divided into the following sections: single-particle versus collective acceleration, heavy-ion accelerators, beam quality, and a status report on the UNILAC facility. Among the topics considered are the recycling cyclotron, linacs with superconducting resonators, and acceleration to the GeV/nucleon range. (8 figures, 2 tables) (U.S.)

  2. Accelerators at school

    International Nuclear Information System (INIS)

    Anon.

    1986-01-01

    Latest subject covered by the CERN Accelerator School was 'Applied Geodesy of Particle Accelerators', which attracted an impressive number of outside participants to CERN for a week in April. Since the forerunners of today's particle accelerators were demonstrated over 50 years ago, the positioning of accelerator components has progressed from the laboratory bench-top to tunnels tens of kilometres long. Despite this phenomenal growth in size, sub-millimetre accuracy is still required

  3. Accelerators at school

    Energy Technology Data Exchange (ETDEWEB)

    Anon.

    1986-06-15

    Latest subject covered by the CERN Accelerator School was 'Applied Geodesy of Particle Accelerators', which attracted an impressive number of outside participants to CERN for a week in April. Since the forerunners of today's particle accelerators were demonstrated over 50 years ago, the positioning of accelerator components has progressed from the laboratory bench-top to tunnels tens of kilometres long. Despite this phenomenal growth in size, sub-millimetre accuracy is still required.

  4. Accelerators for Medicine

    CERN Multimedia

    CERN. Geneva

    2018-01-01

    This lecture will review the different applications of particle accelerators to the medical field, from cancer treatment with beams of accelerator-produced particles (photons, electrons, protons, ions and neutrons) to the generation of radioactive isotopes used in medical diagnostics, in cancer therapy and in the new domain of theragnostics. For each application will be outlined the state of the art, the potential, and the accelerator challenges to be faced to meet the increasing demand for therapeutic procedures based on accelerators.

  5. Large electrostatic accelerators

    International Nuclear Information System (INIS)

    Jones, C.M.

    1984-01-01

    The paper is divided into four parts: a discussion of the motivation for the construction of large electrostatic accelerators, a description and discussion of several large electrostatic accelerators which have been recently completed or are under construction, a description of several recent innovations which may be expected to improve the performance of large electrostatic accelerators in the future, and a description of an innovative new large electrostatic accelerator whose construction is scheduled to begin next year

  6. Particle beam accelerator

    International Nuclear Information System (INIS)

    Turner, N.L.

    1982-01-01

    A particle beam accelerator is described which has several electrodes that are selectively short circuited together synchronously with changes in the magnitude of a DC voltage applied to the accelerator. By this method a substantially constant voltage gradient is maintained along the length of the unshortened electrodes despite variations in the energy applied to the beam by the accelerator. The invention has particular application to accelerating ion beams that are implanted into semiconductor wafers. (U.K.)

  7. Superconducting accelerator technology

    International Nuclear Information System (INIS)

    Grunder, H.A.; Hartline, B.K.

    1986-01-01

    Modern and future accelerators for high energy and nuclear physics rely increasingly on superconducting components to achieve the required magnetic fields and accelerating fields. This paper presents a practical overview of the phenomenon of superconductivity, and describes the design issues and solutions associated with superconducting magnets and superconducting rf acceleration structures. Further development and application of superconducting components promises increased accelerator performance at reduced electric power cost

  8. Applications of particle accelerators

    International Nuclear Information System (INIS)

    Barbalat, O.

    1994-01-01

    Particle accelerators are now widely used in a variety of applications for scientific research, applied physics, medicine, industrial processing, while possible utilisation in power engineering is envisaged. Earlier presentations of this subject, given at previous CERN Accelerator School sessions have been updated with papers contributed to the first European Conference on Accelerators in Applied Research and Technology (ECAART) held in September 1989 in Frankfurt and to the Second European Particle Accelerator Conference in Nice in June 1990. (orig.)

  9. The CERN Accelerator School

    CERN Multimedia

    2016-01-01

    Introduction to accelerator physics The CERN Accelerator School: Introduction to Accelerator Physics, which should have taken place in Istanbul, Turkey, later this year has now been relocated to Budapest, Hungary.  Further details regarding the new hotel and dates will be made available as soon as possible on a new Indico site at the end of May.

  10. Angular Acceleration without Torque?

    Science.gov (United States)

    Kaufman, Richard D.

    2012-01-01

    Hardly. Just as Robert Johns qualitatively describes angular acceleration by an internal force in his article "Acceleration Without Force?" here we will extend the discussion to consider angular acceleration by an internal torque. As we will see, this internal torque is due to an internal force acting at a distance from an instantaneous center.

  11. Accelerators and Dinosaurs

    CERN Multimedia

    Turner, Michael Stanley

    2003-01-01

    Using naturally occuring particles on which to research might have made accelerators become extinct. But in fact, results from astrophysics have made accelerator physics even more important. Not only are accelerators used in hospitals but they are also being used to understand nature's inner workings by searching for Higgs bosons, CP violation, neutrino mass and dark matter (2 pages)

  12. Far field acceleration

    International Nuclear Information System (INIS)

    Fernow, R.C.

    1995-07-01

    Far fields are propagating electromagnetic waves far from their source, boundary surfaces, and free charges. The general principles governing the acceleration of charged particles by far fields are reviewed. A survey of proposed field configurations is given. The two most important schemes, Inverse Cerenkov acceleration and Inverse free electron laser acceleration, are discussed in detail

  13. Future HEP Accelerators: The US Perspective

    Energy Technology Data Exchange (ETDEWEB)

    Bhat, Pushpalatha [Fermilab; Shiltsev, Vladimir [Fermilab

    2015-11-02

    Accelerator technology has advanced tremendously since the introduction of accelerators in the 1930s, and particle accelerators have become indispensable instruments in high energy physics (HEP) research to probe Nature at smaller and smaller distances. At present, accelerator facilities can be classified into Energy Frontier colliders that enable direct discoveries and studies of high mass scale particles and Intensity Frontier accelerators for exploration of extremely rare processes, usually at relatively low energies. The near term strategies of the global energy frontier particle physics community are centered on fully exploiting the physics potential of the Large Hadron Collider (LHC) at CERN through its high-luminosity upgrade (HL-LHC), while the intensity frontier HEP research is focused on studies of neutrinos at the MW-scale beam power accelerator facilities, such as Fermilab Main Injector with the planned PIP-II SRF linac project. A number of next generation accelerator facilities have been proposed and are currently under consideration for the medium- and long-term future programs of accelerator-based HEP research. In this paper, we briefly review the post-LHC energy frontier options, both for lepton and hadron colliders in various regions of the world, as well as possible future intensity frontier accelerator facilities.

  14. Virtual Accelerator for Accelerator Optics Improvement

    CERN Document Server

    Yan Yi Ton; Decker, Franz Josef; Ecklund, Stanley; Irwin, John; Seeman, John; Sullivan, Michael K; Turner, J L; Wienands, Ulrich

    2005-01-01

    Through determination of all quadrupole strengths and sextupole feed-downs by fitting quantities derivable from precision orbit measurement, one can establish a virtual accelerator that matches the real accelerator optics. These quantities (the phase advances, the Green's functions, and the coupling eigen-plane ellipses tilt angles and axis ratios) are obtained by analyzing turn-by-turn Beam Position Monitor (BPM) data with a model-independent analysis (MIA). Instead of trying to identify magnet errors, a limited number of quadrupoles are chosen for optimized strength adjustment to improve the virtual accelerator optics and then applied to the real accelerator accordingly. These processes have been successfully applied to PEP-II rings for beta beating fixes, phase and working tune adjustments, and linear coupling reduction to improve PEP-II luminosity.

  15. The Accelerator Reliability Forum

    CERN Document Server

    Lüdeke, Andreas; Giachino, R

    2014-01-01

    A high reliability is a very important goal for most particle accelerators. The biennial Accelerator Reliability Workshop covers topics related to the design and operation of particle accelerators with a high reliability. In order to optimize the over-all reliability of an accelerator one needs to gather information on the reliability of many different subsystems. While a biennial workshop can serve as a platform for the exchange of such information, the authors aimed to provide a further channel to allow for a more timely communication: the Particle Accelerator Reliability Forum [1]. This contribution will describe the forum and advertise it’s usage in the community.

  16. Notes on Laser Acceleration

    International Nuclear Information System (INIS)

    Tajima, T.

    2008-01-01

    This note intends to motivate our effort toward the advent of new methods of particle acceleration, utilizing the fast rising laser technology. By illustrating the underlying principles in an intuitive manner and thus less jargon-clad fashion, we seek a direction in which we shall be able to properly control and harness the promise of laser acceleration. First we review the idea behind the laser wakefield. We then go on to examine ion acceleration by laser. We examine the sheath acceleration in particular and look for the future direction that allows orderly acceleration of ions in high energies

  17. Industrial Application of Accelerators

    CERN Multimedia

    CERN. Geneva

    2017-01-01

    At CERN, we are very familiar with large, high energy particle accelerators. However, in the world outside CERN, there are more than 35000 accelerators which are used for applications ranging from treating cancer, through making better electronics to removing harmful micro-organisms from food and water. These are responsible for around $0.5T of commerce each year. Almost all are less than 20 MeV and most use accelerator types that are somewhat different from what is at CERN. These lectures will describe some of the most common applications, some of the newer applications in development and the accelerator technology used for them. It will also show examples of where technology developed for particle physics is now being studied for these applications. Rob Edgecock is a Professor of Accelerator Science, with a particular interest in the medical applications of accelerators. He works jointly for the STFC Rutherford Appleton Laboratory and the International Institute for Accelerator Applications at the Univer...

  18. Industrial Application of Accelerators

    CERN Multimedia

    CERN. Geneva

    2017-01-01

    At CERN, we are very familiar with large, high energy particle accelerators. However, in the world outside CERN, there are more than 35000 accelerators which are used for applications ranging from treating cancer, through making better electronics to removing harmful micro-organisms from food and water. These are responsible for around $0.5T of commerce each year. Almost all are less than 20 MeV and most use accelerator types that are somewhat different from what is at CERN. These lectures will describe some of the most common applications, some of the newer applications in development and the accelerator technology used for them. It will also show examples of where technology developed for particle physics is now being studied for these applications. Rob Edgecock is a Professor of Accelerator Science, with a particular interest in the medical applications of accelerators. He works jointly for the STFC Rutherford Appleton Laboratory and the International Institute for Accelerator Applications at the Uni...

  19. Accelerations in Flight

    Science.gov (United States)

    Doolittle, J H

    1925-01-01

    This work on accelerometry was done at McCook Field for the purpose of continuing the work done by other investigators and obtaining the accelerations which occur when a high-speed pursuit airplane is subjected to the more common maneuvers. The accelerations obtained in suddenly pulling out of a dive with well-balanced elevators are shown to be within 3 or 4 per cent of the theoretically possible accelerations. The maximum acceleration which a pilot can withstand depends upon the length of time the acceleration is continued. It is shown that he experiences no difficulty under the instantaneous accelerations as high as 7.8 G., but when under accelerations in excess of 4.5 G., continued for several seconds, he quickly loses his faculties.

  20. Accelerators for energy

    International Nuclear Information System (INIS)

    Inoue, Makoto

    2000-01-01

    A particle accelerator is a device to consume energy but not to produce it. Then, the titled accelerator seems to mean an accelerator for using devices related to nuclear energy. For an accelerator combined to nuclear fissionable fuel, neutron sources are D-T type, (gamma, n) reaction using electron beam type spallation type, and so forth. At viewpoints of powers of incident beam and formed neutron, a spallation type source using high energy proton is told to be effective but others have some advantages by investigation on easy operability, easy construction, combustion with target, energy and directivity of neutron, and so forth. Here were discussed on an accelerator for research on accelerator driven energy system by dividing its researching steps, and on kind, energy, beam intensity, and so forth of an accelerator suitable for it. And, space electric charge effect at beam propagation direction controlled by beam intensity of cyclotron was also commented. (G.K.)

  1. Complex calculation and improvement of beam shaping and accelerating system of the ''Sokol'' small-size electrostatic accelerator

    International Nuclear Information System (INIS)

    Simonenko, A.V.; Pistryak, V.M.; Zats, A.V.; Levchenko, Yu.Z.; Kuz'menko, V.V.

    1987-01-01

    Features of charged particle accelerated beam shaping in the electrostatic part of the ''Sokol'' small-size accelerator are considered in complex taking into account the electrode real geometry. Effect of the extracting, accelerating electorde potential and accelerator total voltage on beam behaviour is investigated. A modified variation of the beam shaping system, allowing to decrease 2 times the required interval of accelerating electrode potential adjustment and to decrease the beam size in the starting acceleration region, is presented. It permits to simplify the construction and to improve accelerator operation. Comparison of experimental and calculational data on the beam in the improved accelerator variation is carried out. Effect of peripheral parts of accelerating tube electrodes on the beam is investigated

  2. Efficient Computational Research Protocol to Survey Free Energy Surface for Solution Chemical Reaction in the QM/MM Framework: The FEG-ER Methodology and Its Application to Isomerization Reaction of Glycine in Aqueous Solution.

    Science.gov (United States)

    Takenaka, Norio; Kitamura, Yukichi; Nagaoka, Masataka

    2016-03-03

    In solution chemical reaction, we often need to consider a multidimensional free energy (FE) surface (FES) which is analogous to a Born-Oppenheimer potential energy surface. To survey the FES, an efficient computational research protocol is proposed within the QM/MM framework; (i) we first obtain some stable states (or transition states) involved by optimizing their structures on the FES, in a stepwise fashion, finally using the free energy gradient (FEG) method, and then (ii) we directly obtain the FE differences among any arbitrary states on the FES, efficiently by employing the QM/MM method with energy representation (ER), i.e., the QM/MM-ER method. To validate the calculation accuracy and efficiency, we applied the above FEG-ER methodology to a typical isomerization reaction of glycine in aqueous solution, and reproduced quite satisfactorily the experimental value of the reaction FE. Further, it was found that the structural relaxation of the solute in the QM/MM force field is not negligible to estimate correctly the FES. We believe that the present research protocol should become prevailing as one computational strategy and will play promising and important roles in solution chemistry toward solution reaction ergodography.

  3. PONDEROMOTIVE ACCELERATION IN CORONAL LOOPS

    Energy Technology Data Exchange (ETDEWEB)

    Dahlburg, R. B.; Obenschain, K. [LCP and FD, Naval Research Laboratory, Washington, DC 20375 (United States); Laming, J. M. [Space Science Division, Naval Research Laboratory, Washington, DC 20375 (United States); Taylor, B. D. [AFRL Eglin AFB, Pensacola, FL 32542 (United States)

    2016-11-10

    Ponderomotive acceleration has been asserted to be a cause of the first ionization potential (FIP) effect, the well-known enhancement in abundance by a factor of 3–4 over photospheric values of elements in the solar corona with FIP less than about 10 eV. It is shown here by means of numerical simulations that ponderomotive acceleration occurs in solar coronal loops, with the appropriate magnitude and direction, as a “by-product” of coronal heating. The numerical simulations are performed with the HYPERION code, which solves the fully compressible three-dimensional magnetohydrodynamic equations including nonlinear thermal conduction and optically thin radiation. Numerical simulations of coronal loops with an axial magnetic field from 0.005 to 0.02 T and lengths from 25,000 to 75,000 km are presented. In the simulations the footpoints of the axial loop magnetic field are convected by random, large-scale motions. There is a continuous formation and dissipation of field-aligned current sheets, which act to heat the loop. As a consequence of coronal magnetic reconnection, small-scale, high-speed jets form. The familiar vortex quadrupoles form at reconnection sites. Between the magnetic footpoints and the corona the reconnection flow merges with the boundary flow. It is in this region that the ponderomotive acceleration occurs. Mirroring the character of the coronal reconnection, the ponderomotive acceleration is also found to be intermittent.

  4. PONDEROMOTIVE ACCELERATION IN CORONAL LOOPS

    International Nuclear Information System (INIS)

    Dahlburg, R. B.; Obenschain, K.; Laming, J. M.; Taylor, B. D.

    2016-01-01

    Ponderomotive acceleration has been asserted to be a cause of the first ionization potential (FIP) effect, the well-known enhancement in abundance by a factor of 3–4 over photospheric values of elements in the solar corona with FIP less than about 10 eV. It is shown here by means of numerical simulations that ponderomotive acceleration occurs in solar coronal loops, with the appropriate magnitude and direction, as a “by-product” of coronal heating. The numerical simulations are performed with the HYPERION code, which solves the fully compressible three-dimensional magnetohydrodynamic equations including nonlinear thermal conduction and optically thin radiation. Numerical simulations of coronal loops with an axial magnetic field from 0.005 to 0.02 T and lengths from 25,000 to 75,000 km are presented. In the simulations the footpoints of the axial loop magnetic field are convected by random, large-scale motions. There is a continuous formation and dissipation of field-aligned current sheets, which act to heat the loop. As a consequence of coronal magnetic reconnection, small-scale, high-speed jets form. The familiar vortex quadrupoles form at reconnection sites. Between the magnetic footpoints and the corona the reconnection flow merges with the boundary flow. It is in this region that the ponderomotive acceleration occurs. Mirroring the character of the coronal reconnection, the ponderomotive acceleration is also found to be intermittent.

  5. Vacuum electron acceleration by coherent dipole radiation

    International Nuclear Information System (INIS)

    Troha, A.L.; Van Meter, J.R.; Landahl, E.C.; Alvis, R.M.; Hartemann, F.V.; Troha, A.L.; Van Meter, J.R.; Landahl, E.C.; Alvis, R.M.; Li, K.; Luhmann, N.C. Jr.; Hartemann, F.V.; Unterberg, Z.A.; Kerman, A.K.

    1999-01-01

    The validity of the concept of laser-driven vacuum acceleration has been questioned, based on an extrapolation of the well-known Lawson-Woodward theorem, which stipulates that plane electromagnetic waves cannot accelerate charged particles in vacuum. To formally demonstrate that electrons can indeed be accelerated in vacuum by focusing or diffracting electromagnetic waves, the interaction between a point charge and coherent dipole radiation is studied in detail. The corresponding four-potential exactly satisfies both Maxwell's equations and the Lorentz gauge condition everywhere, and is analytically tractable. It is found that in the far-field region, where the field distribution closely approximates that of a plane wave, we recover the Lawson-Woodward result, while net acceleration is obtained in the near-field region. The scaling of the energy gain with wave-front curvature and wave amplitude is studied systematically. copyright 1999 The American Physical Society

  6. Particle-accelerator decommissioning

    International Nuclear Information System (INIS)

    Opelka, J.H.; Mundis, R.L.; Marmer, G.J.; Peterson, J.M.; Siskind, B.; Kikta, M.J.

    1979-12-01

    Generic considerations involved in decommissioning particle accelerators are examined. There are presently several hundred accelerators operating in the United States that can produce material containing nonnegligible residual radioactivity. Residual radioactivity after final shutdown is generally short-lived induced activity and is localized in hot spots around the beam line. The decommissioning options addressed are mothballing, entombment, dismantlement with interim storage, and dismantlement with disposal. The recycle of components or entire accelerators following dismantlement is a definite possibility and has occurred in the past. Accelerator components can be recycled either immediately at accelerator shutdown or following a period of storage, depending on the nature of induced activation. Considerations of cost, radioactive waste, and radiological health are presented for four prototypic accelerators. Prototypes considered range from small accelerators having minimal amounts of radioactive mmaterial to a very large accelerator having massive components containing nonnegligible amounts of induced activation. Archival information on past decommissionings is presented, and recommendations concerning regulations and accelerator design that will aid in the decommissioning of an accelerator are given

  7. An introduction to acceleration mechanisms

    International Nuclear Information System (INIS)

    Palmer, R.B.

    1987-05-01

    This paper discusses the acceleration of charged particles by electromagnetic fields, i.e., by fields that are produced by the motion of other charged particles driven by some power source. The mechanisms that are discussed include: Ponderamotive Forces, Acceleration, Plasma Beat Wave Acceleration, Inverse Free Electron Laser Acceleration, Inverse Cerenkov Acceleration, Gravity Acceleration, 2D Linac Acceleration and Conventional Iris Loaded Linac Structure Acceleration

  8. Quantum Accelerator Modes from the Farey Tree

    International Nuclear Information System (INIS)

    Buchleitner, A.; D'Arcy, M.B.; Fishman, S.; Gardiner, S.A.; Guarneri, I.; Ma, Z.-Y.; Rebuzzini, L.; Summy, G.S.

    2006-01-01

    We show that mode locking finds a purely quantum nondissipative counterpart in atom-optical quantum accelerator modes. These modes are formed by exposing cold atoms to periodic kicks in the direction of the gravitational field. They are anchored to generalized Arnol'd tongues, parameter regions where driven nonlinear classical systems exhibit mode locking. A hierarchy for the rational numbers known as the Farey tree provides an ordering of the Arnol'd tongues and hence of experimentally observed accelerator modes

  9. Unlimited ion acceleration by radiation pressure.

    Science.gov (United States)

    Bulanov, S V; Echkina, E Yu; Esirkepov, T Zh; Inovenkov, I N; Kando, M; Pegoraro, F; Korn, G

    2010-04-02

    The energy of ions accelerated by an intense electromagnetic wave in the radiation pressure dominated regime can be greatly enhanced due to a transverse expansion of a thin target. The expansion decreases the number of accelerated ions in the irradiated region resulting in an increase in the ion energy and in the ion longitudinal velocity. In the relativistic limit, the ions become phase locked with respect to the electromagnetic wave resulting in unlimited ion energy gain.

  10. Measurement of gravitational acceleration of antimatter

    International Nuclear Information System (INIS)

    Rouhani, S.

    1989-12-01

    The minute yet effective impact of gravitational potential in the central region of a long tube magnetic container of non-neutral plasmas can be utilized for the measurement of the gravitational acceleration of antimatter particles. The slight change in distribution of plasma particles along the gravitational field affects the internal electric field of the plasma, which in turn affects the frequency of the magnetron motion of its particles. Thus, a rather straightforward relation is established between the gravitational acceleration of the particles and their magnetron frequencies, which is measurable directly, determining the value of the gravitational acceleration. (author). 7 refs, 3 figs

  11. Resonant coupling applied to superconducting accelerator structures

    International Nuclear Information System (INIS)

    Potter, James M.; Krawczyk, Frank L.

    2013-01-01

    The concept of resonant coupling and the benefits that accrue from its application is well known in the world of room temperature coupled cavity linacs. Design studies show that it can be applied successfully between sections of conventional elliptical superconducting coupled cavity accelerator structures and internally to structures with spoked cavity resonators. The coupling mechanisms can be designed without creating problems with high field regions or multipactoring. The application of resonant coupling to superconducting accelerators eliminates the need for complex cryogenic mechanical tuners and reduces the time needed to bring a superconducting accelerator into operation.

  12. Ion acceleration in the plasma source sheath

    International Nuclear Information System (INIS)

    Birdsall, C.K.

    1986-01-01

    This note is a calculation of the potential drop for a planar plasma source, across the source sheath, into a uniform plasma region defined by vector E = 0 and/or perhaps ∂ 2 PHI/∂ x 2 = 0. The calculation complements that of Bohm who obtained the potential drop at the other end of a plasma, at a planar collector sheath. The result is a relation between the source ion flux and the source sheath potential drop and the accompanying ion acceleration. This planar source sheath ion acceleration mechanism (or that from a distributed source) can provide the pre-collector-sheath ion acceleration as found necessary by Bohm. 3 refs

  13. Turbulent energy generated by accelerations and shocks

    International Nuclear Information System (INIS)

    Mikaelian, K.O.

    1986-01-01

    The turbulent energy generated at the interface between two fluids undergoing a constant acceleration or a shock is calculated. Assuming linear density profiles in the mixed region we find E/sub turbulent//E/sub directed/ = 2.3A 2 % (constant acceleration) and 9.3A 2 % (shock), where A is the Atwood number. Diffusion models predict somewhat less turbulent energy and a density profile with a tail extending into the lower density fluid. Eddy sizes are approximately 27% (constant acceleration) and 17% (shock) of the mixing depth into the heavier fluid. 6 refs., 3 figs

  14. Accelerator and radiation physics

    CERN Document Server

    Basu, Samita; Nandy, Maitreyee

    2013-01-01

    "Accelerator and radiation physics" encompasses radiation shielding design and strategies for hadron therapy accelerators, neutron facilities and laser based accelerators. A fascinating article describes detailed transport theory and its application to radiation transport. Detailed information on planning and design of a very high energy proton accelerator can be obtained from the article on radiological safety of J-PARC. Besides safety for proton accelerators, the book provides information on radiological safety issues for electron synchrotron and prevention and preparedness for radiological emergencies. Different methods for neutron dosimetry including LET based monitoring, time of flight spectrometry, track detectors are documented alongwith newly measured experimental data on radiation interaction with dyes, polymers, bones and other materials. Design of deuteron accelerator, shielding in beam line hutches in synchrotron and 14 MeV neutron generator, various radiation detection methods, their characteriza...

  15. 2014 Accelerators meeting, Grenoble

    International Nuclear Information System (INIS)

    Lucotte, Arnaud; Lamy, Thierry; De Conto, Jean-Marie; Fontaine, Alain; Revol, Jean-Luc; Nadolski, Laurent S.; Kazamias, Sophie; Vretenar, Maurizio; Ferrando, Philippe; Laune, Bernard; Vedrine, Pierre

    2014-10-01

    The Accelerators meeting is organised every two years by the Accelerators division of the French Society of Physics (SFP). It brings together about 50 participants during a one-day meeting. The morning sessions are devoted to scientific presentations while the afternoon is dedicated to technical visits of facilities. This document brings together the available presentations (slides): 1 - Presentation of the Laboratory of subatomic physics and cosmology - LPSC-Grenoble (Lucotte, Arnaud; Lamy, Thierry); 2 - Presentation of the Accelerators division of the French Society of Physics (Fontaine, Alain; Revol, Jean-Luc); 3 - Presentation of Grenoble's master diplomas in Accelerator physics (Nadolski, Laurent S.); 4 - Presentation of Paris' master diplomas in big instruments (Kazamias, Sophie); 5 - Particle accelerators and European Union's projects (Vretenar, Maurizio); 6 - French research infrastructures (Ferrando, Philippe); 7 - Coordination of accelerators activity in France (Laune, Bernard; Vedrine, Pierre)

  16. Accelerator reliability workshop

    Energy Technology Data Exchange (ETDEWEB)

    Hardy, L; Duru, Ph; Koch, J M; Revol, J L; Van Vaerenbergh, P; Volpe, A M; Clugnet, K; Dely, A; Goodhew, D

    2002-07-01

    About 80 experts attended this workshop, which brought together all accelerator communities: accelerator driven systems, X-ray sources, medical and industrial accelerators, spallation sources projects (American and European), nuclear physics, etc. With newly proposed accelerator applications such as nuclear waste transmutation, replacement of nuclear power plants and others. Reliability has now become a number one priority for accelerator designers. Every part of an accelerator facility from cryogenic systems to data storage via RF systems are concerned by reliability. This aspect is now taken into account in the design/budget phase, especially for projects whose goal is to reach no more than 10 interruptions per year. This document gathers the slides but not the proceedings of the workshop.

  17. Accelerator reliability workshop

    International Nuclear Information System (INIS)

    Hardy, L.; Duru, Ph.; Koch, J.M.; Revol, J.L.; Van Vaerenbergh, P.; Volpe, A.M.; Clugnet, K.; Dely, A.; Goodhew, D.

    2002-01-01

    About 80 experts attended this workshop, which brought together all accelerator communities: accelerator driven systems, X-ray sources, medical and industrial accelerators, spallation sources projects (American and European), nuclear physics, etc. With newly proposed accelerator applications such as nuclear waste transmutation, replacement of nuclear power plants and others. Reliability has now become a number one priority for accelerator designers. Every part of an accelerator facility from cryogenic systems to data storage via RF systems are concerned by reliability. This aspect is now taken into account in the design/budget phase, especially for projects whose goal is to reach no more than 10 interruptions per year. This document gathers the slides but not the proceedings of the workshop

  18. Acceleration of radioactive ions

    International Nuclear Information System (INIS)

    Laxdal, R.E.

    2003-01-01

    There is an intense interest world-wide in the use of radioactive ion beams (RIBs) for experiment. In many existing or proposed facilities ions are produced or collected at source potential, ionized and re-accelerated. Within the past year three new ISOL based facilities have added dedicated post-accelerators to deliver accelerated RIBs to experiment. The paper gives an overview of RIB accelerators present and future, and explores the inherent features in the various acceleration methods with an emphasis on heavy ion linacs. The ISAC-I and ISAC-II post-accelerators are discussed as examples. Commissioning results and initial operating experience with ISAC-I will be presented

  19. Nuclear physics accelerator facilities

    International Nuclear Information System (INIS)

    1988-12-01

    This paper describes many of the nuclear physics heavy-ion accelerator facilities in the US and the research programs being conducted. The accelerators described are: Argonne National Laboratory--ATLAS; Brookhaven National Laboratory--Tandem/AGS Heavy Ion Facility; Brookhaven National Laboratory--Relativistic Heavy Ion Collider (RHIC) (Proposed); Continuous Electron Beam Accelerator Facility; Lawrence Berkeley Laboratory--Bevalac; Lawrence Berkeley Laboratory--88-Inch Cyclotron; Los Alamos National Laboratory--Clinton P. Anderson Meson Physics Facility (LAMPF); Massachusetts Institute of Technology--Bates Linear Accelerator Center; Oak Ridge National Laboratory--Holifield Heavy Ion Research Facility; Oak Ridge National Laboratory--Oak Ridge Electron Linear Accelerator; Stanford Linear Accelerator Center--Nuclear Physics Injector; Texas AandM University--Texas AandM Cyclotron; Triangle Universities Nuclear Laboratory (TUNL); University of Washington--Tandem/Superconducting Booster; and Yale University--Tandem Van de Graaff

  20. Japan Accelerator Conference

    International Nuclear Information System (INIS)

    Anon.

    1989-01-01

    At the international level, the high energy accelerator scene evolves rapidly and the International Conference on High Energy Accelerators is where its strong pulse can best be felt. This year, the Conference was held for the first time in Japan, with the 14th meeting in the series having been hosted in August by the Japanese KEK National Laboratory for High Energy Physics, Tsukuba. The venue was a recognition of the premier accelerator physics and technology status achieved by this diligent nation

  1. Accelerator shielding benchmark problems

    International Nuclear Information System (INIS)

    Hirayama, H.; Ban, S.; Nakamura, T.

    1993-01-01

    Accelerator shielding benchmark problems prepared by Working Group of Accelerator Shielding in the Research Committee on Radiation Behavior in the Atomic Energy Society of Japan were compiled by Radiation Safety Control Center of National Laboratory for High Energy Physics. Twenty-five accelerator shielding benchmark problems are presented for evaluating the calculational algorithm, the accuracy of computer codes and the nuclear data used in codes. (author)

  2. Plasma particle accelerators

    International Nuclear Information System (INIS)

    Dawson, J.M.

    1988-01-01

    The Superconducting Supercollider (SSC) will require an 87-kilometer accelerator ring to boost particles to 40 TeV. The SSC's size is due in part to the fact that its operating principle is the same one that has dominated accelerator design for 50 years: it guides particles by means of magnetic fields and propels them by strong electric fields. If one were to build an equally powerful but smaller accelerator, one would need to increase the strength of the guiding and propelling fields. Actually, however, conventional technology may not be able to provide significant increases in field strength. There are two reasons. First, the forces from magnetic fields are becoming greater than the structural forces that hold a magnetic material together; the magnets that produce these fields would themselves be torn apart. Second, the energy from electric fields is reaching the energies that bind electrons to atoms; it would tear electrons from nuclei in the accelerator's support structures. It is the electric field problem that plasma accelerators can overcome. Plasma particle accelerators are based on the principle that particles can be accelerated by the electric fields generated within a plasma. Because the plasma has already been ionized, plasma particle accelerators are not susceptible to electron dissociation. They can in theory sustain accelerating fields thousands of times stronger that conventional technologies. So far two methods for creating plasma waves for accelerators have been proposed and tested: the wakefield and the beat wave. Although promising electric fields have been produced, more research is necessary to determine whether plasma particle accelerators can compete with the existing accelerators. 7 figs

  3. Wake field accelerators

    International Nuclear Information System (INIS)

    Wilson, P.B.

    1986-02-01

    In a wake field accelerator a high current driving bunch injected into a structure or plasma produces intense induced fields, which are in turn used to accelerate a trailing charge or bunch. The basic concepts of wake field acceleration are described. Wake potentials for closed cavities and periodic structures are derived, as are wake potentials on a collinear path with a charge distribution. Cylindrically symmetric structures excited by a beam in the form of a ring are considered

  4. CONFERENCE: Computers and accelerators

    Energy Technology Data Exchange (ETDEWEB)

    Anon.

    1984-01-15

    In September of last year a Conference on 'Computers in Accelerator Design and Operation' was held in West Berlin attracting some 160 specialists including many from outside Europe. It was a Europhysics Conference, organized by the Hahn-Meitner Institute with Roman Zelazny as Conference Chairman, postponed from an earlier intended venue in Warsaw. The aim was to bring together specialists in the fields of accelerator design, computer control and accelerator operation.

  5. Japan Accelerator Conference

    Energy Technology Data Exchange (ETDEWEB)

    Anon.

    1989-11-15

    At the international level, the high energy accelerator scene evolves rapidly and the International Conference on High Energy Accelerators is where its strong pulse can best be felt. This year, the Conference was held for the first time in Japan, with the 14th meeting in the series having been hosted in August by the Japanese KEK National Laboratory for High Energy Physics, Tsukuba. The venue was a recognition of the premier accelerator physics and technology status achieved by this diligent nation.

  6. CERN Accelerator School

    International Nuclear Information System (INIS)

    Anon.

    1994-01-01

    The CERN Accelerator School (CAS) recently held its Advanced Accelerator Physics course in Greece on the island of Rhodes. Complementing the general course in Finland last year, this course was organized together with the University of Athens and NCSR. Demokritos. Accelerator specialists from Europe, CIS, Japan and USA followed two weeks of ''state-of-theart'' lectures designed to complete their education in the field

  7. Do SiO 2 and carbon-doped SiO 2 nanoparticles melt? Insights from QM/MD simulations and ramifications regarding carbon nanotube growth

    Science.gov (United States)

    Page, Alister J.; Chandrakumar, K. R. S.; Irle, Stephan; Morokuma, Keiji

    2011-05-01

    Quantum chemical molecular dynamics (QM/MD) simulations of pristine and carbon-doped SiO 2 nanoparticles have been performed between 1000 and 3000 K. At temperatures above 1600 K, pristine nanoparticle SiO 2 decomposes rapidly, primarily forming SiO. Similarly, carbon-doped nanoparticle SiO 2 decomposes at temperatures above 2000 K, primarily forming SiO and CO. Analysis of the physical states of these pristine and carbon-doped SiO 2 nanoparticles indicate that they remain in the solid phase throughout decomposition. This process is therefore one of sublimation, as the liquid phase is never entered. Ramifications of these observations with respect to presently debated mechanisms of carbon nanotube growth on SiO 2 nanoparticles will be discussed.

  8. Applying the accelerator

    Energy Technology Data Exchange (ETDEWEB)

    Barbalat, Oscar

    1989-12-15

    Originally developed as tools for frontier physics, particle accelerators provide valuable spinoff benefits in applied research and technology. These accelerator applications are the subject of a biennial meeting in Denton, Texas, but the increasing activity in this field resulted this year (5-9 September) in the first European Conference on Accelerators in Applied Research and Technology, organized by K. Bethge of Frankfurt's Goethe University. The meeting reflected a wide range of applications - ion beam analysis, exploitation of nuclear microbeams, accelerator mass spectrometry, applications of photonuclear reactions, ion beam processing, synchrotron radiation for semiconductor technology, specialized technology.

  9. Laser-driven accelerators

    International Nuclear Information System (INIS)

    Anon.

    1982-01-01

    Several devices for using laser fields have been proposed and they can be classified in three broad categories - 'far-field' accelerators (such as the principle of inverse free electron lasers), 'media' accelerators (which, for example, use the inverse Cherenkov effect or laser-controlled plasma waves), and 'near-field' accelerators (using a loaded guiding structure such as cavities or gratings). These different approaches come from the fact that a particle cannot be accelerated by the absorption of single photons (because of momentum conservation) and thus some other element has to intervene. (orig./HSI).

  10. Illinois Accelerator Research Center

    Science.gov (United States)

    Kroc, Thomas K.; Cooper, Charlie A.

    The Illinois Accelerator Research Center (IARC) hosts a new accelerator development program at Fermi National Accelerator Laboratory. IARC provides access to Fermi's state-of-the-art facilities and technologies for research, development and industrialization of particle accelerator technology. In addition to facilitating access to available existing Fermi infrastructure, the IARC Campus has a dedicated 36,000 ft2 Heavy Assembly Building (HAB) with all the infrastructure needed to develop, commission and operate new accelerators. Connected to the HAB is a 47,000 ft2 Office, Technology and Engineering (OTE) building, paid for by the state, that has office, meeting, and light technical space. The OTE building, which contains the Accelerator Physics Center, and nearby Accelerator and Technical divisions provide IARC collaborators with unique access to world class expertise in a wide array of accelerator technologies. At IARC scientists and engineers from Fermilab and academia work side by side with industrial partners to develop breakthroughs in accelerator science and translate them into applications for the nation's health, wealth and security.

  11. High Gradient Accelerator Research

    International Nuclear Information System (INIS)

    Temkin, Richard

    2016-01-01

    The goal of the MIT program of research on high gradient acceleration is the development of advanced acceleration concepts that lead to a practical and affordable next generation linear collider at the TeV energy level. Other applications, which are more near-term, include accelerators for materials processing; medicine; defense; mining; security; and inspection. The specific goals of the MIT program are: • Pioneering theoretical research on advanced structures for high gradient acceleration, including photonic structures and metamaterial structures; evaluation of the wakefields in these advanced structures • Experimental research to demonstrate the properties of advanced structures both in low-power microwave cold test and high-power, high-gradient test at megawatt power levels • Experimental research on microwave breakdown at high gradient including studies of breakdown phenomena induced by RF electric fields and RF magnetic fields; development of new diagnostics of the breakdown process • Theoretical research on the physics and engineering features of RF vacuum breakdown • Maintaining and improving the Haimson / MIT 17 GHz accelerator, the highest frequency operational accelerator in the world, a unique facility for accelerator research • Providing the Haimson / MIT 17 GHz accelerator facility as a facility for outside users • Active participation in the US DOE program of High Gradient Collaboration, including joint work with SLAC and with Los Alamos National Laboratory; participation of MIT students in research at the national laboratories • Training the next generation of Ph. D. students in the field of accelerator physics.

  12. Interacting with accelerators

    International Nuclear Information System (INIS)

    Dasgupta, S.

    1994-01-01

    Accelerators are research machines which produce energetic particle beam for use as projectiles to effect nuclear reactions. These machines along with their services and facilities may occupy very large areas. The man-machine interface of accelerators has evolved with technological changes in the computer industry and may be partitioned into three phases. The present paper traces the evolution of man-machine interface from the earliest accelerators to the present computerized systems incorporated in modern accelerators. It also discusses the advantages of incorporating expert system technology for assisting operators. (author). 8 ref

  13. FFAGS for muon acceleration

    International Nuclear Information System (INIS)

    Berg, J. Scott; Kahn, Stephen; Palmer, Robert; Trbojevic, Dejan; Johnstone, Carol; Keil, Eberhard; Aiba, Masamitsu; Machida, Shinji; Mori, Yoshiharu; Ogitsu, Toru; Ohmori, Chihiro; Sessler, Andrew; Koscielniak, Shane

    2003-01-01

    Due to their finite lifetime, muons must be accelerated very rapidly. It is challenging to make the magnets ramp fast enough to accelerate in a synchrotron, and accelerating in a linac is very expensive. One can use a recirculating accelerator (like CEBAF), but one needs a different arc for each turn, and this limits the number of turns one can use to accelerate, and therefore requires significant amounts of RF to achieve the desired energy gain. An alternative method for muon acceleration is using a fixed field alternating gradient (FFAG) accelerator. Such an accelerator has a very large energy acceptance (a factor of two or three), allowing one to use the same arc with a magnetic field that is constant over time. Thus, one can in principle make as many turns as one can tolerate due to muon decay, therefore reducing the RF cost without increasing the arc cost. This paper reviews the current status of research into the design of FFAGs for muon acceleration. Several current designs are described and compared. General design considerations are also discussed

  14. Accelerator-based BNCT.

    Science.gov (United States)

    Kreiner, A J; Baldo, M; Bergueiro, J R; Cartelli, D; Castell, W; Thatar Vento, V; Gomez Asoia, J; Mercuri, D; Padulo, J; Suarez Sandin, J C; Erhardt, J; Kesque, J M; Valda, A A; Debray, M E; Somacal, H R; Igarzabal, M; Minsky, D M; Herrera, M S; Capoulat, M E; Gonzalez, S J; del Grosso, M F; Gagetti, L; Suarez Anzorena, M; Gun, M; Carranza, O

    2014-06-01

    The activity in accelerator development for accelerator-based BNCT (AB-BNCT) both worldwide and in Argentina is described. Projects in Russia, UK, Italy, Japan, Israel, and Argentina to develop AB-BNCT around different types of accelerators are briefly presented. In particular, the present status and recent progress of the Argentine project will be reviewed. The topics will cover: intense ion sources, accelerator tubes, transport of intense beams, beam diagnostics, the (9)Be(d,n) reaction as a possible neutron source, Beam Shaping Assemblies (BSA), a treatment room, and treatment planning in realistic cases. © 2013 Elsevier Ltd. All rights reserved.

  15. Applying the accelerator

    International Nuclear Information System (INIS)

    Barbalat, Oscar

    1989-01-01

    Originally developed as tools for frontier physics, particle accelerators provide valuable spinoff benefits in applied research and technology. These accelerator applications are the subject of a biennial meeting in Denton, Texas, but the increasing activity in this field resulted this year (5-9 September) in the first European Conference on Accelerators in Applied Research and Technology, organized by K. Bethge of Frankfurt's Goethe University. The meeting reflected a wide range of applications - ion beam analysis, exploitation of nuclear microbeams, accelerator mass spectrometry, applications of photonuclear reactions, ion beam processing, synchrotron radiation for semiconductor technology, specialized technology

  16. Superconducting linear accelerator cryostat

    International Nuclear Information System (INIS)

    Ben-Zvi, I.; Elkonin, B.V.; Sokolowski, J.S.

    1984-01-01

    A large vertical cryostat for a superconducting linear accelerator using quarter wave resonators has been developed. The essential technical details, operational experience and performance are described. (author)

  17. Remote handling and accelerators

    International Nuclear Information System (INIS)

    Wilson, M.T.

    1983-01-01

    The high-current levels of contemporary and proposed accelerator facilities induce radiation levels into components, requiring consideration be given to maintenance techniques that reduce personnel exposure. Typical components involved include beamstops, targets, collimators, windows, and instrumentation that intercepts the direct beam. Also included are beam extraction, injection, splitting, and kicking regions, as well as purposeful spill areas where beam tails are trimmed and neutral particles are deposited. Scattered beam and secondary particles activate components all along a beamline such as vacuum pipes, magnets, and shielding. Maintenance techniques vary from hands-on to TV-viewed operation using state-of-the-art servomanipulators. Bottom- or side-entry casks are used with thimble-type target and diagnostic assemblies. Long-handled tools are operated from behind shadow shields. Swinging shield doors, unstacking block, and horizontally rolling shield roofs are all used to provide access. Common to all techniques is the need to make operations simple and to provide a means of seeing and reaching the area

  18. How Are Substrate Binding and Catalysis Affected by Mutating Glu127 and Arg161 in Prolyl-4-hydroxylase? A QM/MM and MD Study

    Science.gov (United States)

    Timmins, Amy; de Visser, Sam P.

    2017-01-01

    Prolyl-4-hydroxylase is a vital enzyme for human physiology involved in the biosynthesis of 4-hydroxyproline, an essential component for collagen formation. The enzyme performs a unique stereo- and regioselective hydroxylation at the C4 position of proline despite the fact that the C5 hydrogen atoms should be thermodynamically easier to abstract. To gain insight into the mechanism and find the origin of this regioselectivity, we have done a quantum mechanics/molecular mechanics (QM/MM) study on wildtype and mutant structures. In a previous study (Timmins et al., 2017) we identified several active site residues critical for substrate binding and positioning. In particular, the Glu127 and Arg161 were shown to form multiple hydrogen bonding and ion-dipole interactions with substrate and could thereby affect the regio- and stereoselectivity of the reaction. In this work, we decided to test that hypothesis and report a QM/MM and molecular dynamics (MD) study on prolyl-4-hydroxylase and several active site mutants where Glu127 or Arg161 are mutated for Asp, Gln, or Lys. Thus, the R161D and R161Q mutants give very high barriers for hydrogen atom abstraction from any proline C–H bond and therefore will be inactive. The R161K mutant, by contrast, sees the regio- and stereoselectivity of the reaction change but still is expected to hydroxylate proline at room temperature. By contrast, the Glu127 mutants E127D and E127Q show possible changes in regioselectivity with the former being more probable to react compared to the latter. PMID:29170737

  19. How Are Substrate Binding and Catalysis Affected by Mutating Glu127 and Arg161 in Prolyl-4-hydroxylase? A QM/MM and MD Study

    Directory of Open Access Journals (Sweden)

    Amy Timmins

    2017-11-01

    Full Text Available Prolyl-4-hydroxylase is a vital enzyme for human physiology involved in the biosynthesis of 4-hydroxyproline, an essential component for collagen formation. The enzyme performs a unique stereo- and regioselective hydroxylation at the C4 position of proline despite the fact that the C5 hydrogen atoms should be thermodynamically easier to abstract. To gain insight into the mechanism and find the origin of this regioselectivity, we have done a quantum mechanics/molecular mechanics (QM/MM study on wildtype and mutant structures. In a previous study (Timmins et al., 2017 we identified several active site residues critical for substrate binding and positioning. In particular, the Glu127 and Arg161 were shown to form multiple hydrogen bonding and ion-dipole interactions with substrate and could thereby affect the regio- and stereoselectivity of the reaction. In this work, we decided to test that hypothesis and report a QM/MM and molecular dynamics (MD study on prolyl-4-hydroxylase and several active site mutants where Glu127 or Arg161 are mutated for Asp, Gln, or Lys. Thus, the R161D and R161Q mutants give very high barriers for hydrogen atom abstraction from any proline C–H bond and therefore will be inactive. The R161K mutant, by contrast, sees the regio- and stereoselectivity of the reaction change but still is expected to hydroxylate proline at room temperature. By contrast, the Glu127 mutants E127D and E127Q show possible changes in regioselectivity with the former being more probable to react compared to the latter.

  20. High power laser exciter accelerators

    International Nuclear Information System (INIS)

    Martin, T.H.

    1975-01-01

    Recent developments in untriggered oil and water switching now permit the construction of compact, high energy density pulsed power sources for laser excitation. These accelerators, developed principally for electron beam fusion studies, appear adaptable to laser excitation and will provide electron beams of 10 13 to 10 14 W in the next several years. The accelerators proposed for e-beam fusion essentially concentrate the available power from the outside edge of a disk into the central region where the electron beam is formed. One of the main problem areas, that of power flow at the vacuum diode insulator, is greatly alleviated by the multiplicity of electron beams that are allowable for laser excitation. A proposal is made whereby the disk-shaped pulsed power sections are stacked vertically to form a series of radially flowing electron beams to excite the laser gas volume. (auth)

  1. Accelerator Modeling with MATLAB Accelerator Toolbox

    International Nuclear Information System (INIS)

    2002-01-01

    This paper introduces Accelerator Toolbox (AT)--a collection of tools to model storage rings and beam transport lines in the MATLAB environment. The objective is to illustrate the flexibility and efficiency of the AT-MATLAB framework. The paper discusses three examples of problems that are analyzed frequently in connection with ring-based synchrotron light sources

  2. Antibodies specific for hypervariable regions 3 to 5 of the feline immunodeficiency virus envelope glycoprotein are not solely responsible for vaccine-induced acceleration of challenge infection in cats

    NARCIS (Netherlands)

    W. Huisman (Willem); E.J.A. Schrauwen (Eefje); S.D. Pas (Suzan); J.A. Karlas (Jos); G.F. Rimmelzwaan (Guus); A.D.M.E. Osterhaus (Albert)

    2004-01-01

    textabstractIn a previous vaccination study in cats, the authors reported on accelerated feline immunodeficiency virus (FIV) replication upon challenge in animals vaccinated with a candidate envelope subunit vaccine. Plasma transfer studies as well as antibody profiles in vaccinated cats indicated a

  3. Acceleration of runaway electrons and Joule heating in solar flares

    Science.gov (United States)

    Holman, G. D.

    1985-01-01

    The electric field acceleration of electrons out of a thermal plasma and the simultaneous Joule heating of the plasma are studied. Acceleration and heating timescales are derived and compared, and upper limits are obtained on the acceleration volume and the rate at which electrons can be accelerated. These upper limits, determined by the maximum magnetic field strength observed in flaring regions, place stringent restrictions upon the acceleration process. The role of the plasma resistivity in these processes is examined, and possible sources of anomalous resistivity are summarized. The implications of these results for the microwave and hard X-ray emission from solar flares are examined.

  4. Santa Fe Accelerator Conference

    International Nuclear Information System (INIS)

    Anon.

    1983-01-01

    The 10th USA National Particle Accelerator Conference was hosted this year by the Los Alamos National Laboratory in Santa Fe from 21-23 March. It was a resounding success in emphasizing the ferment of activity in the accelerator field. About 900 people registered and about 500 papers were presented in invited and contributed talks and poster sessions

  5. Relativistic Shock Acceleration

    International Nuclear Information System (INIS)

    Duffy, P.; Downes, T.P.; Gallant, Y.A.; Kirk, J.G.

    1999-01-01

    In this paper we briefly review the basic theory of shock waves in relativistic hydrodynamics and magneto-hydrodynamics, emphasising some astrophysically interesting cases. We then present an overview of the theory of particle acceleration at such shocks describing the methods used to calculate the spectral indices of energetic particles. Recent results on acceleration at ultra-relativistic shocks are discussed. (author)

  6. CERN Accelerator School

    Energy Technology Data Exchange (ETDEWEB)

    Anon.

    1986-01-15

    The CERN Accelerator School (CAS) offers a regular course on general accelerator physics. The first basic course was given in September 1984 at Orsay, France, and last September the advanced course was jointly organized by CAS, Oxford's Nuclear Physics Laboratory and the Rutherford Appleton Laboratory, and held at The Queen's College, Oxford.

  7. Accelerator for nuclear transmutation

    International Nuclear Information System (INIS)

    Schapira, J.P.

    1984-01-01

    A review on nuclear transmutation of radioactive wastes using particle accelerators is given. Technical feasibility, nuclear data, costs of various projects are discussed. It appears that one high energy accelerator (1500 MeV, 300 mA proton) could probably handle the amount of actinides generated by the actual French nuclear program [fr

  8. Diagnostics for induction accelerators

    International Nuclear Information System (INIS)

    Fessenden, T.J.

    1996-04-01

    The induction accelerator was conceived by N. C. Christofilos and first realized as the Astron accelerator that operated at LLNL from the early 1960's to the end of 1975. This accelerator generated electron beams at energies near 6 MeV with typical currents of 600 Amperes in 400 ns pulses. The Advanced Test Accelerator (ATA) built at Livermore's Site 300 produced 10,000 Ampere beams with pulse widths of 70 ns at energies approaching 50 MeV. Several other electron and ion induction accelerators have been fabricated at LLNL and LBNL. This paper reviews the principal diagnostics developed through efforts by scientists at both laboratories for measuring the current, position, energy, and emittance of beams generated by these high current, short pulse accelerators. Many of these diagnostics are closely related to those developed for other accelerators. However, the very fast and intense current pulses often require special diagnostic techniques and considerations. The physics and design of the more unique diagnostics developed for electron induction accelerators are presented and discussed in detail

  9. Diagnostics for induction accelerators

    International Nuclear Information System (INIS)

    Fessenden, T.J.

    1997-01-01

    The induction accelerator was conceived by N. C. Christofilos and first realized as the Astron accelerator that operated at Lawrence Livermore National Laboratory (LLNL) from the early 1960s to the end of 1975. This accelerator generated electron beams at energies near 6 MeV with typical currents of 600 Amperes in 400-ns pulses. The Advanced Test Accelerator (ATA) built at Livermore close-quote s Site 300 produced 10,000-Ampere beams with pulse widths of 70 ns at energies approaching 50 MeV. Several other electron and ion induction accelerators have been fabricated at LLNL and Lawrence Berkeley National Laboratory (LBNL). This paper reviews the principal diagnostics developed through efforts by scientists at both laboratories for measuring the current, position, energy, and emittance of beams generated by these high-current, short-pulse accelerators. Many of these diagnostics are closely related to those developed for other accelerators. However, the very fast and intense current pulses often require special diagnostic techniques and considerations. The physics and design of the more unique diagnostics developed for electron induction accelerators are presented and discussed in detail. copyright 1997 American Institute of Physics

  10. Hamburg Accelerator Conference (2)

    Energy Technology Data Exchange (ETDEWEB)

    Wilson, Edmund J.N. [CERN Accelerator School (Switzerland)

    1992-11-15

    From 20-24 July, Hamburg welcomed the Fifteenth International Conference on High Energy Accelerators (HEACC). The HEACC Conference traditionally reviews the status of all major accelerator projects whether they are already running like clockwork, still in the construction phase, or waiting impatiently for financial approval.

  11. Charged particle accelerator

    International Nuclear Information System (INIS)

    Arakawa, Kazuo.

    1969-01-01

    An accelerator is disclosed having a device which permits the electrodes of an accelerator tube to be readily conditioned in an uncomplicated manner before commencing operation. In particle accelerators, it is necessary to condition the accelerator electrodes before a stable high voltage can be applied. Large current accelerators of the cockcroft-walton type require a complicated manual operation which entails applying to the electrodes a low voltage which is gradually increased to induce a vacuum discharge and then terminated. When the discharge attains an extremely low level, the voltage is again impressed and again raised to a high value in low current type accelerators, a high voltage power supply charges the electrodes once to induce discharge followed by reapplying the voltage when the vacuum discharge reaches a low level, according to which high voltage is automatically applied. This procedure, however, requires that the high voltage power supply be provided with a large internal resistance to limit the current to within several milliamps. The present invention connects a high voltage power supply and an accelerator tube through a discharge current limiting resistor wired in parallel with a switch. Initially, the switch is opened enabling the power supply to impress a voltage limited to a prescribed value by a suitably chosen resistor. Conditioning is effected by allowing the voltage between electrodes to increase and is followed by closing the switch through which high voltage is applied directly to the accelerator for operation. (K.J. Owens)

  12. Asia honours accelerator physicists

    CERN Multimedia

    2010-01-01

    "Steve Meyers of Cern and Jie Wei of Beijing's Tsinghua University are the first recipients of a new prize for particle physics. The pair were honoured for their contributions to numerous particle-accelerator projects - including Cern's Large Hadron Collider - by the Asian Committee for Future Accelerators (ACFA)..." (1 paragraph)

  13. Accelerators Beyond The Tevatron?

    Energy Technology Data Exchange (ETDEWEB)

    Lach, Joseph; /Fermilab

    2010-07-01

    Following the successful operation of the Fermilab superconducting accelerator three new higher energy accelerators were planned. They were the UNK in the Soviet Union, the LHC in Europe, and the SSC in the United States. All were expected to start producing physics about 1995. They did not. Why?

  14. CERN Accelerator School

    International Nuclear Information System (INIS)

    Anon.

    1986-01-01

    The CERN Accelerator School (CAS) offers a regular course on general accelerator physics. The first basic course was given in September 1984 at Orsay, France, and last September the advanced course was jointly organized by CAS, Oxford's Nuclear Physics Laboratory and the Rutherford Appleton Laboratory, and held at The Queen's College, Oxford

  15. Thoughts on accelerator tubes

    International Nuclear Information System (INIS)

    Larson, J.D.

    1978-01-01

    A brief, subjective review is given of mechanisms that may be limiting electrostatic accelerator tubes to present levels of performance. Suggestions are made for attacking these limitations with the purpose of stimulating the thinking of designers and users of electrostatic accelerators

  16. KEK digital accelerator

    Directory of Open Access Journals (Sweden)

    T. Iwashita

    2011-07-01

    Full Text Available The High Energy Accelerator Research Organization KEK digital accelerator (KEK-DA is a renovation of the KEK 500 MeV booster proton synchrotron, which was shut down in 2006. The existing 40 MeV drift tube linac and rf cavities have been replaced by an electron cyclotron resonance (ECR ion source embedded in a 200 kV high-voltage terminal and induction acceleration cells, respectively. A DA is, in principle, capable of accelerating any species of ion in all possible charge states. The KEK-DA is characterized by specific accelerator components such as a permanent magnet X-band ECR ion source, a low-energy transport line, an electrostatic injection kicker, an extraction septum magnet operated in air, combined-function main magnets, and an induction acceleration system. The induction acceleration method, integrating modern pulse power technology and state-of-art digital control, is crucial for the rapid-cycle KEK-DA. The key issues of beam dynamics associated with low-energy injection of heavy ions are beam loss caused by electron capture and stripping as results of the interaction with residual gas molecules and the closed orbit distortion resulting from relatively high remanent fields in the bending magnets. Attractive applications of this accelerator in materials and biological sciences are discussed.

  17. Thoughts of accelerator tubes

    International Nuclear Information System (INIS)

    Larson, J.D.

    1977-01-01

    A brief, subjective review is given of mechanisms that may be limiting electrostatic accelerator tubes to present levels of performance. Suggestions are made for attacking these limitations with the purpose of stimulating the thinking of designers and users of electrostatic accelerators

  18. Racetrack linear accelerators

    International Nuclear Information System (INIS)

    Rowe, C.H.; Wilton, M.S. de.

    1979-01-01

    An improved recirculating electron beam linear accelerator of the racetrack type is described. The system comprises a beam path of four straight legs with four Pretzel bending magnets at the end of each leg to direct the beam into the next leg of the beam path. At least one of the beam path legs includes a linear accelerator. (UK)

  19. Linear Accelerator (LINAC)

    Science.gov (United States)

    ... uses microwave technology (similar to that used for radar) to accelerate electrons in a part of the accelerator called the "wave guide," then allows ... risk of accidental exposure is extremely low. top of page This page was ... No Please type your comment or suggestion into the following text ...

  20. Hamburg Accelerator Conference (2)

    International Nuclear Information System (INIS)

    Wilson, Edmund J.N.

    1992-01-01

    From 20-24 July, Hamburg welcomed the Fifteenth International Conference on High Energy Accelerators (HEACC). The HEACC Conference traditionally reviews the status of all major accelerator projects whether they are already running like clockwork, still in the construction phase, or waiting impatiently for financial approval

  1. Optimization of accelerator control

    International Nuclear Information System (INIS)

    Vasiljev, N.D.; Mozin, I.V.; Shelekhov, V.A.; Efremov, D.V.

    1992-01-01

    Expensive exploitation of charged particle accelerators is inevitably concerned with requirements of effectively obtaining of the best characteristics of accelerated beams for physical experiments. One of these characteristics is intensity. Increase of intensity is hindered by a number of effects, concerned with the influence of the volume charge field on a particle motion dynamics in accelerator's chamber. However, ultimate intensity, determined by a volume charge, is almost not achieved for the most of the operating accelerators. This fact is caused by losses of particles during injection, at the initial stage of acceleration and during extraction. These losses are caused by deviations the optimal from real characteristics of the accelerating and magnetic system. This is due to a number of circumstances, including technological tolerances on structural elements of systems, influence of measuring and auxiliary equipment and beam consumers' installations, placed in the closed proximity to magnets, and instability in operation of technological systems of accelerator. Control task consists in compensation of deviations of characteristics of magnetic and electric fields by optimal selection of control actions. As for technical means, automatization of modern accelerators allows to solve optimal control problems in real time. Therefore, the report is devoted to optimal control methods and experimental results. (J.P.N.)

  2. Accelerator breeder concept

    International Nuclear Information System (INIS)

    Bartholomew, G.A.; Fraser, J.S.; Garvey, P.M.

    1978-10-01

    The principal components and functions of an accelerator breeder are described. The role of the accelerator breeder as a possible long-term fissile production support facility for CANDU (Canada Deuterium Uranium) thorium advanced fuel cycles and the Canadian research and development program leading to such a facility are outlined. (author)

  3. Semiconductor acceleration sensor

    Science.gov (United States)

    Ueyanagi, Katsumichi; Kobayashi, Mitsuo; Goto, Tomoaki

    1996-09-01

    This paper reports a practical semiconductor acceleration sensor especially suited for automotive air bag systems. The acceleration sensor includes four beams arranged in a swastika structure. Two piezoresistors are formed on each beam. These eight piezoresistors constitute a Wheatstone bridge. The swastika structure of the sensing elements, an upper glass plate and a lower glass plate exhibit the squeeze film effect which enhances air dumping, by which the constituent silicon is prevented from breakdown. The present acceleration sensor has the following features. The acceleration force component perpendicular to the sensing direction can be cancelled. The cross-axis sensitivity is less than 3 percent. And, the erroneous offset caused by the differences between the thermal expansion coefficients of the constituent materials can be canceled. The high aspect ratio configuration realized by plasma etching facilitates reducing the dimensions and improving the sensitivity of the acceleration sensor. The present acceleration sensor is 3.9 mm by 3.9 mm in area and 1.2 mm in thickness. The present acceleration sensor can measure from -50 to +50 G with sensitivity of 0.275 mV/G and with non-linearity of less than 1 percent. The acceleration sensor withstands shock of 3000 G.

  4. Molecular ion acceleration using tandem accelerator

    Energy Technology Data Exchange (ETDEWEB)

    Saito, Yuichi; Mizuhashi, Kiyoshi; Tajima, Satoshi [Japan Atomic Energy Research Inst., Takasaki, Gunma (Japan). Takasaki Radiation Chemistry Research Establishment

    1996-12-01

    In TIARA compound beam radiation system, cluster beams have been produced using 3 MV tandem accelerator (9SDH-2) to supply them to various radiation on injection experiments. Till now, productions of C{sub 2-8}, Si{sub 2-4} and O{sub 2} and their accelerations up to 6 MeV have been succeeded. This study aimed at production and acceleration of B{sub 2-4} and LiF. Anion clusters were produced using the conventional ion source of cesium sputter type. The proportions of atoms, molecules and clusters elicited from the ion source were varied depending on the material`s properties and the operating conditions of ion source such as sample temperature, sputter voltage and the shape of sample. The anion clusters were accelerated toward the high voltage terminal in the center of tandem accelerator, leading to cations through losing their electrons by the collision to N{sub 2} gas in a charge conversion cell at the terminal. Positively charged cluster ions could be obtained by modulating the pressure of N{sub 2} gas. Thus, B{sub 2} (64 nA), B{sub 3} (4.4 nA) and B{sub 4} (2.7 nA) have been produced and their maximum survival probabilities were higher than those of carbon or silicon clusters. In addition, the relationship between beam current and gas pressure was investigated for Bn (n = 2-4) and LiF. (M.N.)

  5. Plasma based accelerators

    Energy Technology Data Exchange (ETDEWEB)

    Caldwell, Allen [Max-Planck-Institut fuer Physik, Muenchen (Germany)

    2015-05-01

    The concept of laser-induced plasma wakefields as a technique to accelerate charged particles was introduced 35 years ago as a means to go beyond the accelerating gradients possible with metallic cavities supporting radio frequency electromagnetic fields. Significant developments in laser technology have made possible the pulse intensity needed to realize this concept, and rapid progress is now underway in the realization of laser-driven plasma wakefield acceleration. It has also been realized that similar accelerating gradients can be produced by particle beams propagating in plasmas, and experimental programs have also been undertaken to study this possibility. Positive results have been achieved with electron-driven plasma wakefields, and a demonstration experiment with proton-driven wakefields is under construction at CERN. The concepts behind these different schemes and their pros and cons are described, as well as the experimental results achieved. An outlook for future practical uses of plasma based accelerators will also be given.

  6. TIARA electrostatic accelerator facility

    International Nuclear Information System (INIS)

    Tajima, Satoshi; Takada, Isao; Mizuhashi, Kiyoshi; Uno, Sadanori; Ohkoshi, Kiyonori; Nakajima, Yoshinori; Saitoh, Yuichi; Ishii, Yasuyuki; Kamiya, Tomihiro

    1996-07-01

    In order to promote the Advanced Radiation Technology Project, Japan Atomic Energy Research Institute constructed TIARA facility composed of four ion accelerators at Takasaki Radiation Chemistry Research Establishment for the period from 1988 to 1993. A 3MV tandem accelerator and an AVF cycrotron were completed in 1991 as the first phase of the construction, and a 3MV single-ended accelerator and a 400kV ion implanter were completed in 1993 as the second phase. Three electrostatic accelerators, the tandem, the single-ended and the implanter, were installed in the Multiple-beam facility of TIARA and have been operated for various experiments with using single, dual and triple beams without any serious trouble. This report describes the constructive works, machine performances, control systems, safety systems and accessory equipments of the electrostatic accelerators. (author)

  7. 2016 Accelerators meeting

    International Nuclear Information System (INIS)

    Spiro, Michel; Revol, Jean-Luc; Biarrotte, Jean-Luc; Napoly, Olivier; Jardin, Pascal; Chautard, Frederic; Thomas, Jean Charles; Petit, Eric

    2016-09-01

    The Accelerators meeting is organised every two years by the Accelerators division of the French Society of Physics (SFP). It brings together about 50 participants during a one-day meeting. The morning sessions are devoted to scientific presentations while the afternoon is dedicated to technical visits of facilities. This document brings together the available presentations (slides): 1 - Presentation of the Ganil - Grand accelerateur national d'ions lourds/Big national heavy-ion accelerator, Caen (Jardin, Pascal); 2 - Presentation of the Accelerators division of the French Society of Physics (Revol, Jean-Luc); 3 - Forward-looking and Prospective view (Napoly, Olivier); 4 - Accelerators at the National Institute of Nuclear and particle physics, situation, Forward-looking and Prospective view (Biarrotte, Jean-Luc); 5 - GANIL-SPIRAL2, missions and goals (Thomas, Jean Charles); 6 - The SPIRAL2 project (Petit, Eric)

  8. Collinear wake field acceleration

    International Nuclear Information System (INIS)

    Bane, K.L.F.; Chen, P.; Wilson, P.B.

    1985-04-01

    In the Voss-Weiland scheme of wake field acceleration a high current, ring-shaped driving bunch is used to accelerate a low current beam following along on axis. In such a structure, the transformer ratio, i.e., the ratio of maximum voltage that can be gained by the on-axis beam and the voltage lost by the driving beam, can be large. In contrast, it has been observed that for an arrangement in which driving and driven bunches follow the same path, and where the current distribution of both bunches is gaussian, the transformer ratio is not normally greater than two. This paper explores some of the possibilities and limitations of a collinear acceleration scheme. In addition to its application to wake field acceleration in structures, this study is also of interest for the understanding of the plasma wake field accelerator. 11 refs., 4 figs

  9. Standing wave accelerating structures

    International Nuclear Information System (INIS)

    Zavadtsev, A.A.; Zverev, B.V.; Sobepin, N.P.

    1984-01-01

    Accelerating ELA structures are considered and chosen for applied purposes of special designation. Accelerating structures with the standing wave are considered most effective for small size ELA. Designs and results of experimental investigation of two new accelerating structures are described. These are structures of the ''ring'' type with a decreased number of excitinq oscillation types and strucuture with transverse rods with a twice smaller transverse size as compared with the biperiodical structure with internal connection resonators. The accelerating biperiodical structures of the conventional type by the fact that the whole structure is not a linear chain of connected resonators, but a ring one. Model tests have shown that the homogeneous structure with transverse rods (STR) at the frequency of 2.8 GHz in the regime of the standing wave has an effective shunt resistance equalling 23 MOhm/m. It is shown that the small transverse size of biperiodic STR makes its application in logging linear electron accelerators

  10. Performance of the FELIX accelerator

    International Nuclear Information System (INIS)

    Geer, C.A.J. van der; Bakker, R.J.; Meer, A.F.G. van der; Amersfoort, P.W. van; Gillespie, W.A.; Martin, P.F.

    1992-01-01

    The FELIX project (Free Electron Laser for Infrared eXperiments) involves the construction and operation of a rapidly tunable FEL users facility for the infrared based on a rf linear accelerator. Lasing was obtained in the summer of 1991. The spectral region already covered is between 16 and 110 μm to be extended to below 8 μm with an additional linac section. Measurement of several electron beam parameters along the beam line are presented. (author) 6 refs.; 7 figs

  11. Analyzing radial acceleration with a smartphone acceleration sensor

    Science.gov (United States)

    Vogt, Patrik; Kuhn, Jochen

    2013-03-01

    This paper continues the sequence of experiments using the acceleration sensor of smartphones (for description of the function and the use of the acceleration sensor, see Ref. 1) within this column, in this case for analyzing the radial acceleration.

  12. The electron stretcher accelerator ELSA

    International Nuclear Information System (INIS)

    Husmann, D.

    1989-01-01

    The electron stretcher accelerator, ELSA, provides unpolarized and polarized electron beams at energies between 0.5 and 3.5 GeV at high duty factor up to 99%. ELSA partly can serve also as a synchrotron radiation source in the vacuum ultra violet and X-ray region. ELSA is a circular accelerator of 165 m circumference. The Bonn 2.5 GeV Electron Synchrotron, which came into operation in 1967, is used as injector. To achieve the above-mentioned features, ELSA is operated in three different modes. 'Stretcher mode' is used at energies between 0.5 and 2.0 GeV. For a beam energy above 2.0 GeV, ELSA is operated in the 'post acceleration mode'. Where it is operated as a dedicated 'synchrotron radiation source', electrons are accumulated up to a limit of about 50 mA at 3.5 GeV. Dipole fields to obtain a closed orbit and quadrupole fields to get beam focusing are realized with help of two kinds of magnets, namely dipoles and quadrupoles. This structure provides radiation damping of the horizontal betatron oscillation needed for bean storage. It also allows a wade range variation of the optical working point of the machine. The ring contains 12 sextupoles, in addition to 32 quadrupoles and 24 dipoles, for correction of the optics and for extraction purposes. (N.K.)

  13. Injection and extraction techniques in circular accelerators

    International Nuclear Information System (INIS)

    Tang Jingyu

    2008-01-01

    Injection and extraction are usually the key systems in circular accelerators. They play important roles in transferring the beam from one stage acceleration to the other or to experimental stations. It is also in the injection and extraction regions where beam losses happen mostly. Due to the tight space and to reduce the perturbation to the circulating orbit, the devices are usually designed to meet special requirements such as compactness, small stray field, fast rise time or fall time, etc. Usual injection and extraction devices include septum magnets, kicker magnets, electrostatic deflectors, slow bump magnets and strippers. In spite of different accelerators and specification for the injection and extraction devices, many techniques are shared in the design and manufacturing. This paper gives a general review on the techniques employed in the major circular accelerators in China. (authors)

  14. Collective ion acceleration

    International Nuclear Information System (INIS)

    Godfrey, B.B.; Faehl, R.J.; Newberger, B.S.; Shanahan, W.R.; Thode, L.E.

    1977-01-01

    Progress achieved in the understanding and development of collective ion acceleration is presented. Extensive analytic and computational studies of slow cyclotron wave growth on an electron beam in a helix amplifier were performed. Research included precise determination of linear coupling between beam and helix, suppression of undesired transients and end effects, and two-dimensional simulations of wave growth in physically realizable systems. Electrostatic well depths produced exceed requirements for the Autoresonant Ion Acceleration feasibility experiment. Acceleration of test ions to modest energies in the troughs of such waves was also demonstrated. Smaller efforts were devoted to alternative acceleration mechanisms. Langmuir wave phase velocity in Converging Guide Acceleration was calculated as a function of the ratio of electron beam current to space-charge limiting current. A new collective acceleration approach, in which cyclotron wave phase velocity is varied by modulation of electron beam voltage, is proposed. Acceleration by traveling Virtual Cathode or Localized Pinch was considered, but appears less promising. In support of this research, fundamental investigations of beam propagation in evacuated waveguides, of nonneutral beam linear eigenmodes, and of beam stability were carried out. Several computer programs were developed or enhanced. Plans for future work are discussed

  15. Multicavity proton cyclotron accelerator

    Directory of Open Access Journals (Sweden)

    J. L. Hirshfield

    2002-08-01

    Full Text Available A mechanism for acceleration of protons is described, in which energy gain occurs near cyclotron resonance as protons drift through a sequence of rotating-mode TE_{111} cylindrical cavities in a strong nearly uniform axial magnetic field. Cavity resonance frequencies decrease in sequence from one another with a fixed frequency interval Δf between cavities, so that synchronism can be maintained between the rf fields and proton bunches injected at intervals of 1/Δf. An example is presented in which a 122 mA, 1 MeV proton beam is accelerated to 961 MeV using a cascade of eight cavities in an 8.1 T magnetic field, with the first cavity resonant at 120 MHz and with Δf=8 MHz. Average acceleration gradient exceeds 40 MV/m, average effective shunt impedance is 223 MΩ/m, but maximum surface field in the cavities does not exceed 7.2 MV/m. These features occur because protons make many orbital turns in each cavity and thus experience acceleration from each cavity field many times. Longitudinal and transverse stability appear to be intrinsic properties of the acceleration mechanism, and an example to illustrate this is presented. This acceleration concept could be developed into a proton accelerator for a high-power neutron spallation source, such as that required for transmutation of nuclear waste or driving a subcritical fission burner, provided a number of significant practical issues can be addressed.

  16. The miniature accelerator

    CERN Multimedia

    Antonella Del Rosso

    2015-01-01

    The image that most people have of CERN is of its enormous accelerators and their capacity to accelerate particles to extremely high energies. But thanks to some cutting-edge studies on beam dynamics and radiofrequency technology, along with innovative construction techniques, teams at CERN have now created the first module of a brand-new accelerator, which will be just 2 metres long. The potential uses of this miniature accelerator will include deployment in hospitals for the production of medical isotopes and the treatment of cancer. It’s a real David-and-Goliath story.   Serge Mathot, in charge of the construction of the "mini-RFQ", pictured with the first of the four modules that will make up the miniature accelerator. The miniature accelerator consists of a radiofrequency quadrupole (RFQ), a component found at the start of all proton accelerator chains around the world, from the smallest to the largest. The LHC is designed to produce very high-intensity beams ...

  17. Large electrostatic accelerators

    Energy Technology Data Exchange (ETDEWEB)

    Jones, C.M.

    1984-01-01

    The increasing importance of energetic heavy ion beams in the study of atomic physics, nuclear physics, and materials science has partially or wholly motivated the construction of a new generation of large electrostatic accelerators designed to operate at terminal potentials of 20 MV or above. In this paper, the author briefly discusses the status of these new accelerators and also discusses several recent technological advances which may be expected to further improve their performance. The paper is divided into four parts: (1) a discussion of the motivation for the construction of large electrostatic accelerators, (2) a description and discussion of several large electrostatic accelerators which have been recently completed or are under construction, (3) a description of several recent innovations which may be expected to improve the performance of large electrostatic accelerators in the future, and (4) a description of an innovative new large electrostatic accelerator whose construction is scheduled to begin next year. Due to time and space constraints, discussion is restricted to consideration of only tandem accelerators.

  18. Large electrostatic accelerators

    International Nuclear Information System (INIS)

    Jones, C.M.

    1984-01-01

    The increasing importance of energetic heavy ion beams in the study of atomic physics, nuclear physics, and materials science has partially or wholly motivated the construction of a new generation of large electrostatic accelerators designed to operate at terminal potentials of 20 MV or above. In this paper, the author briefly discusses the status of these new accelerators and also discusses several recent technological advances which may be expected to further improve their performance. The paper is divided into four parts: (1) a discussion of the motivation for the construction of large electrostatic accelerators, (2) a description and discussion of several large electrostatic accelerators which have been recently completed or are under construction, (3) a description of several recent innovations which may be expected to improve the performance of large electrostatic accelerators in the future, and (4) a description of an innovative new large electrostatic accelerator whose construction is scheduled to begin next year. Due to time and space constraints, discussion is restricted to consideration of only tandem accelerators

  19. Superconductivity and future accelerators

    International Nuclear Information System (INIS)

    Danby, G.T.; Jackson, J.W.

    1963-01-01

    For 50 years particle accelerators employing accelerating cavities and deflecting magnets have been developed at a prodigious rate. New accelerator concepts and hardware ensembles have yielded great improvements in performance and GeV/$. The great idea for collective acceleration resulting from intense auxiliary charged-particle beams or laser light may or may not be just around the corner. In its absence, superconductivity (SC) applied both to rf cavities and to magnets opened up the potential for very large accelerators without excessive energy consumption and with other economies, even with the cw operation desirable for colliding beams. HEP has aggressively pioneered this new technology: the Fermilab single ring 1 TeV accelerator - 2 TeV collider is near the testing stage. Brookhaven National Laboratory's high luminosity pp 2 ring 800 GeV CBA collider is well into construction. Other types of superconducting projects are in the planning stage with much background R and D accomplished. The next generation of hadron colliders under discussion involves perhaps a 20 TeV ring (or rings) with 40 TeV CM energy. This is a very large machine: even if the highest practical field B approx. 10T is used, the radius is 10x that of the Fermilab accelerator. An extreme effort to get maximum GeV/$ may be crucial even for serious consideration of funding

  20. Accelerator programme at CAT

    International Nuclear Information System (INIS)

    Ramamurthi, S.S.

    1991-01-01

    The Accelerator Programme at the Centre for Advanced Technology (CAT), Indore, has very broad based concept under which all types of accelerators are to be taken up for design and fabrication. This centre will be housing a wide variety of accelerators to serve as a common facility for the universities, national laboratories in addition to laboratories under the Department of Atomic Energy. In the first phase of the programme, a series of electron accelerators are designed and fabricated. They are synchrotron radiation sources of 450 MeV (INDUS-I) and of 2 GeV (INDUS-II), microtron upto energy of 20 MeV, linear accelerator upto 20 MeV, and DC Accelerator for industrial irradiation upto 750 KeV and 20 KW. A proton accelerator of 300 MeV with 20 MeV linac injector is also designed. CAT is also developing a strong base for support technologies like ultra high vacuum, radio frequency and microwaves, DC pulsed and superconducting magnets, power supplies and controls etc. These technologies are very useful for other industrial applications also. To develop user groups to utilise INDUS-II synchrotron radiation source, a batch production of rotating Anode X-ray generators with power supplies has been initiated. So also, the sputter ion pumps, electron guns, turbo molecular pumps are brought into batch production. (author)

  1. Accelerated cleanup risk reduction

    International Nuclear Information System (INIS)

    Knapp, R.B.; Aines, R.M.; Blake, R.G.; Copeland, A.B.; Newmark, R.L.; Tompson, A.F.B.

    1998-01-01

    There is no proven technology for remediating contaminant plume source regions in a heterogeneous subsurface. This project is an interdisciplinary effort to develop the requisite new technologies so that will be rapidly accepted by the remediation community. Our technology focus is hydrous pyrolysis/oxidation (HPO) which is a novel in situ thermal technique. We have expanded this core technology to leverage the action of steam injection and place an in situ microbial filter downstream to intercept and destroy the accelerated movement of contaminated groundwater. Most contaminant plume source regions, including the chlorinated solvent plume at LLNL, are in subsurface media characterized by a wide range in hydraulic conductivity. At LLNL, the main conduits for contaminant transport are buried stream channels composed of gravels and sands; these have a hydraulic conductivity in the range of 10 -1 to 10 -2 cm/s. Clay and silt units with a hydraulic conductivity of 10 -1 to 10 -6 cm/s bound these buried channels; these are barriers to groundwater movement and contain the highest contaminant concentrations in the source region. New remediation technologies are required because the current ones preferentially access the high conductivity units. HPO is an innovative process for the in situ destruction of contaminants in the entire subsurface. It operates by the injection of steam. We have demonstrated in laboratory experiments that many contaminants rapidly oxidize to harmless compounds at temperatures easily achieved by injecting steam, provided sufficient dissolved oxygen is present. One important challenge in a heterogeneous source region is getting heat, contaminants, and an oxidizing agent in the same place at the same time. We have used the NUFT computer program to simulate the cyclic injection of steam into a contaminated aquifer for design of a field demonstration. We used an 8 hour, steam/oxygen injection cycle followed by a 56 hour relaxation period in which the

  2. New accelerator ideas

    International Nuclear Information System (INIS)

    Anon.

    1985-01-01

    In the past, providing higher particle beam energies meant building bigger accelerators. It is now universally accepted that with the current generation of accelerator projects either under construction (such as LEP at CERN) or proposed (such as the Superconducting Super Collider in the US), conventional techniques are reaching their practical limit. With the growing awareness that progress in particle physics requires new methods to accelerate particles, workshops and study groups are being set up across the world to search for ideas for the machines of tomorrow

  3. The auroral electron accelerator

    International Nuclear Information System (INIS)

    Bryant, D.A.; Hall, D.S.

    1989-01-01

    A model of the auroral electron acceleration process is presented in which the electrons are accelerated resonantly by lower-hybrid waves. The essentially stochastic acceleration process is approximated for the purposes of computation by a deterministic model involving an empirically derived energy transfer function. The empirical function, which is consistent with all that is known of electron energization by lower-hybrid waves, allows many, possibly all, observed features of the electron distribution to be reproduced. It is suggested that the process occurs widely in both space and laboratory plasmas. (author)

  4. ACCELERATORS: School report

    Energy Technology Data Exchange (ETDEWEB)

    Anon.

    1987-12-15

    The expanded 1987 US Particle Accelerator School, held at Fermilab from 20 July to 14 August, included two two-week sessions. In the first, 101 students covered three university-style courses, listed as upper-division University of Chicago physics, covering the fundamentals of particle beams, magnetic optics and acceleration; relativistic electronics; and high energy storage rings. The 180 participants in the second session profited from 24 short courses presented by experts and covering a wide variety of topics in the physics and technology of particle accelerators.

  5. Hadron accelerators in medicine

    International Nuclear Information System (INIS)

    Amaldi, U.

    1996-01-01

    The application of hadron accelerators (protons and light ions) in cancer therapy is discussed. After a brief introduction on the rationale for the use of heavy charged particles in radiation therapy, a discussion is given on accelerator technology and beam delivery systems. Next, existing and planned facilities are briefly reviewed. The Italian Hadron-therapy Project is then described in some detail, with reference ro both the National Centre for Oncological Hadron-therapy and the design of different types of compact proton accelerators aimed at introducing proton therapy in a large umber of hospitals. (author)

  6. Maximum Acceleration Recording Circuit

    Science.gov (United States)

    Bozeman, Richard J., Jr.

    1995-01-01

    Coarsely digitized maximum levels recorded in blown fuses. Circuit feeds power to accelerometer and makes nonvolatile record of maximum level to which output of accelerometer rises during measurement interval. In comparison with inertia-type single-preset-trip-point mechanical maximum-acceleration-recording devices, circuit weighs less, occupies less space, and records accelerations within narrower bands of uncertainty. In comparison with prior electronic data-acquisition systems designed for same purpose, circuit simpler, less bulky, consumes less power, costs and analysis of data recorded in magnetic or electronic memory devices. Circuit used, for example, to record accelerations to which commodities subjected during transportation on trucks.

  7. ACCELERATORS: School prizes

    International Nuclear Information System (INIS)

    Anon.

    1987-01-01

    Dedicated to its goal of encouraging scientists and students to work in the field of particle accelerators, the US Particle Accelerator School (operating since 1981) has switched to a new format. Starting this year, it will offer in alternate years basic accelerator physics plus advanced subjects in both university and symposium styles over four weeks. Expanding the school from two to four weeks gives additional flexibility, and undergraduate participation should be encouraged by university credits being offered for particular courses. In the intervening years, the school will organize six-day topical courses

  8. Accelerator Toolbox for MATLAB

    International Nuclear Information System (INIS)

    Terebilo, Andrei

    2001-01-01

    This paper introduces Accelerator Toolbox (AT)--a collection of tools to model particle accelerators and beam transport lines in the MATLAB environment. At SSRL, it has become the modeling code of choice for the ongoing design and future operation of the SPEAR 3 synchrotron light source. AT was designed to take advantage of power and simplicity of MATLAB--commercially developed environment for technical computing and visualization. Many examples in this paper illustrate the advantages of the AT approach and contrast it with existing accelerator code frameworks

  9. RF linear accelerators

    CERN Document Server

    Wangler, Thomas P

    2008-01-01

    Thomas P. Wangler received his B.S. degree in physics from Michigan State University, and his Ph.D. degree in physics and astronomy from the University of Wisconsin. After postdoctoral appointments at the University of Wisconsin and Brookhaven National Laboratory, he joined the staff of Argonne National Laboratory in 1966, working in the fields of experimental high-energy physics and accelerator physics. He joined the Accelerator Technology Division at Los Alamos National Laboratory in 1979, where he specialized in high-current beam physics and linear accelerator design and technology. In 2007

  10. Auroral electron acceleration

    International Nuclear Information System (INIS)

    Bryant, D.A.

    1989-10-01

    Two theories of auroral electron acceleration are discussed. Part 1 examines the currently widely held view that the acceleration is an ordered process in a quasi-static electric field. It is suggested that, although there are many factors seeming to support this theory, the major qualifications and uncertainties that have been identified combine to cast serious doubt over its validity. Part 2 is devoted to a relatively new interpretation in terms of stochastic acceleration in turbulent electric fields. This second theory, which appears to account readily for most known features of the electron distribution function, is considered to provide a more promising approach to this central question in magnetospheric plasma physics. (author)

  11. New accelerator ideas

    Energy Technology Data Exchange (ETDEWEB)

    Anon.

    1985-05-15

    In the past, providing higher particle beam energies meant building bigger accelerators. It is now universally accepted that with the current generation of accelerator projects either under construction (such as LEP at CERN) or proposed (such as the Superconducting Super Collider in the US), conventional techniques are reaching their practical limit. With the growing awareness that progress in particle physics requires new methods to accelerate particles, workshops and study groups are being set up across the world to search for ideas for the machines of tomorrow.

  12. Advanced Accelerator Concepts

    Science.gov (United States)

    Siemann, Robert

    1998-04-01

    Current particle accelerators rely on conventional or superconducting radio frequency cavities to accelerate beams of protons or electrons for nuclear and particle research and for medical and materials science studies. New methods for achieving larger accelerating gradients have been proposed and are being studied. These include the use of high power lasers, laser driven plasmas, wake fields generated by intense low energy beams, and millimeter wavelength EM structures. The studies to date, and the prospects for practical applications of these new ideas will be discussed.

  13. Accelerators Spanish steps

    International Nuclear Information System (INIS)

    Anon.

    1988-01-01

    In September, the CERN Accelerator School (CAS) held its third General Accelerator Physics Course, the venue this time being Salamanca, the oldest university in Spain. Spain, which rejoined CERN in 1982, now has a vigorous and steadily growing high energy physics community making substantial contributions to physics detector development and successfully involving Spanish industry. However the embryonic accelerator community cannot yet generate an equivalent level of activity, and this important channel for introducing new high technology into industry has yet to be fully exploited

  14. Future Accelerators Seminar in Japan

    International Nuclear Information System (INIS)

    Anon.

    1984-01-01

    ICFA, the International Committee for Future Accelerators, was set up by the Particles and Fields Commission of the International Union of Pure and Applied Physics (IUPAP) in 1976. Its mandate was 'To organize workshops for the study of problems related to an international super-high energy accelerator complex (VBA) and to elaborate the framework of its construction and of its use. To organize meetings for the exchange of information on future plans of regional facilities and for the formulation of advice on joint studies and uses.' In the seven years of its existence (it first met in August 1977), ICFA has organized three workshops on the first topic — t w o on 'Possibilities and Limitations of Accelerators and Detectors' (Fermilab, 1978 and Les Diablerets, 1979) and one on 'Possibilities and Limitations for Superconducting Accelerator Magnets' (Protvino, 1981). At an ICFA meeting at Fermilab in August 1983, it was realized that the second topic had been somewhat neglected. It was therefore decided to postpone a fourth workshop scheduled at the Japanese National Laboratory for High Energy Physics (KEK) and to organize instead a Seminar on 'Future Perspectives in High Energy Physics' similar to that held in New Orleans in 1975, which had in fact led to the creation of ICFA.The Seminar (jointly hosted by the Institute of Nuclear Study of Tokyo University and KEK, with support from the Ministry of Education, Science and Culture, the Yamada Science Foundation and the Nishina Memorial Foundation) took place from 14-20 May. There were about a hundred participants, mostly senior scientists from Western and Eastern Europe, USA, USSR and Japan (including the Directors of almost all the major high energy physics Laboratories) and representatives from Australia, Canada, China, India, Mexico, South Korea and Vietnam

  15. Future Accelerators Seminar in Japan

    Energy Technology Data Exchange (ETDEWEB)

    Anon.

    1984-10-15

    ICFA, the International Committee for Future Accelerators, was set up by the Particles and Fields Commission of the International Union of Pure and Applied Physics (IUPAP) in 1976. Its mandate was 'To organize workshops for the study of problems related to an international super-high energy accelerator complex (VBA) and to elaborate the framework of its construction and of its use. To organize meetings for the exchange of information on future plans of regional facilities and for the formulation of advice on joint studies and uses.' In the seven years of its existence (it first met in August 1977), ICFA has organized three workshops on the first topic — t w o on 'Possibilities and Limitations of Accelerators and Detectors' (Fermilab, 1978 and Les Diablerets, 1979) and one on 'Possibilities and Limitations for Superconducting Accelerator Magnets' (Protvino, 1981). At an ICFA meeting at Fermilab in August 1983, it was realized that the second topic had been somewhat neglected. It was therefore decided to postpone a fourth workshop scheduled at the Japanese National Laboratory for High Energy Physics (KEK) and to organize instead a Seminar on 'Future Perspectives in High Energy Physics' similar to that held in New Orleans in 1975, which had in fact led to the creation of ICFA.The Seminar (jointly hosted by the Institute of Nuclear Study of Tokyo University and KEK, with support from the Ministry of Education, Science and Culture, the Yamada Science Foundation and the Nishina Memorial Foundation) took place from 14-20 May. There were about a hundred participants, mostly senior scientists from Western and Eastern Europe, USA, USSR and Japan (including the Directors of almost all the major high energy physics Laboratories) and representatives from Australia, Canada, China, India, Mexico, South Korea and Vietnam.

  16. Regionalism, Regionalization and Regional Development

    Directory of Open Access Journals (Sweden)

    Liviu C. Andrei

    2016-03-01

    Full Text Available Sustained development is a concept associating other concepts, in its turn, in the EU practice, e.g. regionalism, regionalizing and afferent policies, here including structural policies. This below text, dedicated to integration concepts, will limit on the other hand to regionalizing, otherwise an aspect typical to Europe and to the EU. On the other hand, two aspects come up to strengthen this field of ideas, i.e. the region (al-regionalism-(regional development triplet has either its own history or precise individual outline of terms.

  17. Joint International Accelerator School

    CERN Multimedia

    CERN Accelerator School

    2014-01-01

    The CERN and US Particle Accelerator Schools recently organised a Joint International Accelerator School on Beam Loss and Accelerator Protection, held at the Hyatt Regency Hotel, Newport Beach, California, USA from 5-14 November 2014. This Joint School was the 13th in a series of such schools, which started in 1985 and also involves the accelerator communities in Japan and Russia.   Photo courtesy of Alfonse Pham, Michigan State University.   The school attracted 58 participants representing 22 different nationalities, with around half from Europe and the other half from Asia and the Americas. The programme comprised 26 lectures, each of 90 minutes, and 13 hours of case study. The students were given homework each day and had an opportunity to sit a final exam, which counted towards university credit. Feedback from the participants was extremely positive, praising the expertise and enthusiasm of the lecturers, as well as the high standard and quality of their lectures. Initial dis...

  18. Future accelerators: physics issues

    International Nuclear Information System (INIS)

    Bjorken, J.D.

    1977-11-01

    High energy physics of the future using future accelerators is discussed. The proposed machines and instruments, physics issues and opportunities including brief sketches of outstanding recent results, and the way the proposed machines address these issues are considered. 42 references

  19. Compact particle accelerator

    Energy Technology Data Exchange (ETDEWEB)

    Elizondo-Decanini, Juan M.

    2017-08-29

    A compact particle accelerator having an input portion configured to receive power to produce particles for acceleration, where the input portion includes a switch, is provided. In a general embodiment, a vacuum tube receives particles produced from the input portion at a first end, and a plurality of wafer stacks are positioned serially along the vacuum tube. Each of the plurality of wafer stacks include a dielectric and metal-oxide pair, wherein each of the plurality of wafer stacks further accelerate the particles in the vacuum tube. A beam shaper coupled to a second end of the vacuum tube shapes the particles accelerated by the plurality of wafer stacks into a beam and an output portion outputs the beam.

  20. The accelerator breeder

    International Nuclear Information System (INIS)

    Johansson, E.

    1986-01-01

    Interactions of high-energy particles with atomic nuclei, in particular heavy ones, leads to a strong emission of neutrons. Preferably these high-energy particles are protons or deuterons obtained from a linear accelerator. The neutrons emitted are utilized in the conversion of U238 to Pu239 or of Th232 to U233. The above is the basis of the accelerator breeder, a concept studied abroad in many variants. No such breeder has, however, so far been built, but there exists vast practical experience on the neutron production and on the linear accelerator. Some of the variants mentioned are described in the report, after a presentation of general characteristics for the particle-nucleus interaction and for the linear accelerator. (author)

  1. Accelerate Water Quality Improvement

    Science.gov (United States)

    EPA is committed to accelerating water quality improvement and minimizing negative impacts to aquatic life from contaminants and other stressors in the Bay Delta Estuary by working with California Water Boards to strengthen water quality improvement plans.

  2. Rejuvenating CERN's Accelerators

    CERN Multimedia

    2004-01-01

    In the coming years and especially in 2005, CERN's accelerators are going to receive an extensive renovation programme to ensure they will perform reliably and effectively when the LHC comes into service.

  3. Wake field acceleration experiments

    International Nuclear Information System (INIS)

    Simpson, J.D.

    1988-01-01

    Where and how will wake field acceleration devices find use for other than, possibly, accelerators for high energy physics? I don't know that this can be responsibly answered at this time. What I can do is describe some recent results from an ongoing experimental program at Argonne which support the idea that wake field techniques and devices are potentially important for future accelerators. Perhaps this will spawn expanded interest and even new ideas for the use of this new technology. The Argonne program, and in particular the Advanced Accelerator Test Facility (AATF), has been reported in several fairly recent papers and reports. But because this is a substantially new audience for the subject, I will include a brief review of the program and the facility before describing experiments. 10 refs., 7 figs

  4. Accelerated test program

    Science.gov (United States)

    Ford, F. E.; Harkness, J. M.

    1977-01-01

    A brief discussion on the accelerated testing of batteries is given. The statistical analysis and the various aspects of the modeling that was done and the results attained from the model are also briefly discussed.

  5. SSC accelerator availability allocation

    International Nuclear Information System (INIS)

    Dixon, K.T.; Franciscovich, J.

    1991-03-01

    Superconducting Super Collider (SSC) operational availability is an area of major concern, judged by the Central Design Group to present such risk that use of modern engineering tools would be essential to program success. Experience has shown that as accelerator beam availability falls below about 80%, efficiency of physics experiments degrades rapidly due to inability to maintain adequate coincident accelerator and detector operation. For this reason, the SSC availability goal has been set at 80%, even though the Fermi National Accelerator Laboratory accelerator, with a fraction of the SSC's complexity, has only recently approached that level. This paper describes the allocation of the top-level goal to part-level reliability and maintainability requirements, and it gives the results of parameter sensitivity studies designed to help identify the best approach to achieve the needed system availability within funding and schedule constraints. 1 ref., 12 figs., 4 tabs

  6. IAE pulsed electrostatic accelerator

    International Nuclear Information System (INIS)

    Afanas'ev, V.P.; Ganzhelyuk, M.L.; Kozlov, L.D.; Koltypin, E.A.; Molchanov, Yu.D.; Otroshchenko, G.A.; Yan'kov, G.B.

    1976-01-01

    The modernized pulse electrostatic accelerator using the klystron ion grouping and the beam interruption system prior to acceleration is described. The accelerator is modernized in order to improve parameters of a current pulse and to decrease the background in the measurement room. The ion beam of needed dimensions is obtained with the help of a high-frequency source and a beam grouping and deflection system. The general view of the beam grouping and deflection system is shown. The ion beam forming process is considered in detail. The modernized electrostatic accelerator permits to obtain a pulse current with a pulse length of 1.5 ns and an amplitude of 1.5 - 2 μA. With the repetition frequency of 2 MHz, the average target current is about 6 μA

  7. Ionization front accelerator

    International Nuclear Information System (INIS)

    Olson, C.L.

    1975-01-01

    In a recently proposed linear collective accelerator, ions are accelerated in a steep, moving potential well created at the head of an intense relativistic electron beam. The steepness of the potential well and its motion are controlled by the external ionization of a suitable background gas. Calculations concerning optimum choices for the background gas and the ionization method are presented; a two-step photoionization process employing Cs vapor is proposed. In this process, a super-radiant light source is used to excite the gas, and a UV laser is used to photoionize the excited state. The appropriate line widths and coupled ionization growth rate equations are discussed. Parameter estimates are given for a feasibility experiment, for a 1 GeV proton accelerator, and for a heavy ion accelerator (50 MeV/nucleon uranium). (auth)

  8. HEAVY ION LINEAR ACCELERATOR

    Science.gov (United States)

    Van Atta, C.M.; Beringer, R.; Smith, L.

    1959-01-01

    A linear accelerator of heavy ions is described. The basic contributions of the invention consist of a method and apparatus for obtaining high energy particles of an element with an increased charge-to-mass ratio. The method comprises the steps of ionizing the atoms of an element, accelerating the resultant ions to an energy substantially equal to one Mev per nucleon, stripping orbital electrons from the accelerated ions by passing the ions through a curtain of elemental vapor disposed transversely of the path of the ions to provide a second charge-to-mass ratio, and finally accelerating the resultant stripped ions to a final energy of at least ten Mev per nucleon.

  9. Advances in electrostatic accelerators

    International Nuclear Information System (INIS)

    Wegner, H.E.

    1975-01-01

    Advances in the design and performance of electrostatic accelerators since 1969 are reviewed with special emphasis on the ''forefront'' accelerators that are currently leading in voltage capability. A comparison of the acceleration tube design offered by the National Electrostatics Corporation and the High Voltage Engineering Corporation is also made. Other methods of increasing heavy ion energy by means of dual foil stripping are discussed as well as the performance of a newly developed sputter ion source for the production of negative heavy ions with reliability and flexibility that greatly exceeds all other present systems. Finally, new developments in terms of both booster systems and very high voltage electrostatic accelerators (25 to 60 MV) are discussed. (U.S.)

  10. Iteration and accelerator dynamics

    International Nuclear Information System (INIS)

    Peggs, S.

    1987-10-01

    Four examples of iteration in accelerator dynamics are studied in this paper. The first three show how iterations of the simplest maps reproduce most of the significant nonlinear behavior in real accelerators. Each of these examples can be easily reproduced by the reader, at the minimal cost of writing only 20 or 40 lines of code. The fourth example outlines a general way to iteratively solve nonlinear difference equations, analytically or numerically

  11. High energy medical accelerators

    International Nuclear Information System (INIS)

    Mandrillon, P.

    1990-01-01

    The treatment of tumours with charged particles, ranging from protons to 'light ions' (carbon, oxygen, neon), has many advantages, but up to now has been little used because of the absence of facilities. After the successful pioneering work carried out with accelerators built for physics research, machines dedicated to this new radiotherapy are planned or already in construction. These high energy medical accelerators are presented in this paper. (author) 15 refs.; 14 figs.; 8 tabs

  12. Vancouver Accelerator Conference

    Energy Technology Data Exchange (ETDEWEB)

    Anon.

    1985-06-15

    Anyone who contends that particle physics is conducted in an ivory tower, not contributing to other fields of science or to humanity at large, should have attended the 1985 Particle Accelerator Conference in Vancouver. Over a thousand participants contributed 781 papers and only a fraction were actually related to accelerators for high energy physics. The majority of present developments are in the service of other fields of science, for alternative power sources, for medicine, for industrial applications, etc.

  13. A symmetrical rail accelerator

    International Nuclear Information System (INIS)

    Igenbergs, E.

    1991-01-01

    This paper reports on the symmetrical rail accelerator that has four rails, which are arranged symmetrically around the bore. The opposite rails have the same polarity and the adjacent rails the opposite polarity. In this configuration the radial force acting upon the individual rails is significantly smaller than in a conventional 2-rail configuration and a plasma armature is focussed towards the axis of the barrel. Experimental results indicate a higher efficiency compared to a conventional rail accelerator

  14. Ion optics for accelerators

    International Nuclear Information System (INIS)

    Enge, H.A.

    1974-01-01

    A review is given of ion-optic devices used in particle accelerators, including electrostatic lenses, magnetic quadrupoles, and deflecting magnets. Tube focusing in dc accelerators is also treated, and a novel scheme for shaping the electrodes to produce strong focusing is described. The concepts of emittance (phase space) and emittance conservation are briefly discussed. Chromatic and spatial aberrations are introduced, and it is shown how they can be calculated and sometimes substantially reduced. Some examples are given

  15. An active particle accelerator

    International Nuclear Information System (INIS)

    Goldman, T.

    1991-01-01

    Although a static charge is difficult to maintain on macroscopic particles, it is straightforward to construct a small object with a regularly oscillating electric dipole moment. For objects of a given size, one may then construct an accelerator by appropriately matching the frequency and separations of an external array of electrodes to this size. Physically feasible size ranges, an accelerator design, and possible applications of such systems are discussed. 8 refs., 9 figs

  16. Vancouver Accelerator Conference

    International Nuclear Information System (INIS)

    Anon.

    1985-01-01

    Anyone who contends that particle physics is conducted in an ivory tower, not contributing to other fields of science or to humanity at large, should have attended the 1985 Particle Accelerator Conference in Vancouver. Over a thousand participants contributed 781 papers and only a fraction were actually related to accelerators for high energy physics. The majority of present developments are in the service of other fields of science, for alternative power sources, for medicine, for industrial applications, etc

  17. CEBAF Accelerator Achievements

    International Nuclear Information System (INIS)

    Chao, Y C; Drury, M; Hovater, C; Hutton, A; Krafft, G A; Poelker, M; Reece, C; Tiefenback, M

    2011-01-01

    In the past decade, nuclear physics users of Jefferson Lab's Continuous Electron Beam Accelerator Facility (CEBAF) have benefited from accelerator physics advances and machine improvements. As of early 2011, CEBAF operates routinely at 6 GeV, with a 12 GeV upgrade underway. This article reports highlights of CEBAF's scientific and technological evolution in the areas of cryomodule refurbishment, RF control, polarized source development, beam transport for parity experiments, magnets and hysteresis handling, beam breakup, and helium refrigerator operational optimization.

  18. Collective field accelerator

    International Nuclear Information System (INIS)

    Luce, J.S.

    1978-01-01

    A collective field accelerator which operates with a vacuum diode and utilizes a grooved cathode and a dielectric anode that operates with a relativistic electron beam with a ν/γ of approx. 1, and a plurality of dielectric lenses having an axial magnetic field thereabout to focus the collectively accelerated electrons and ions which are ejected from the anode. The anode and lenses operate as unoptimized r-f cavities which modulate and focus the beam

  19. CEBAF: Accelerating cavities look good

    Energy Technology Data Exchange (ETDEWEB)

    Anon.

    1990-09-15

    The first assembled pairs of superconducting accelerating cavities from German supplier Interatom for the Continuous Electron Beam Accelerator Facility, Newport News, Virginia, have exceeded performance specifications.

  20. CEBAF: Accelerating cavities look good

    International Nuclear Information System (INIS)

    Anon.

    1990-01-01

    The first assembled pairs of superconducting accelerating cavities from German supplier Interatom for the Continuous Electron Beam Accelerator Facility, Newport News, Virginia, have exceeded performance specifications

  1. JAERI 20 MV tandem accelerator

    International Nuclear Information System (INIS)

    Tsukada, Kineo; Harada, Kichinosuke

    1977-01-01

    Accelerators have been developed as the experimental apparatuses for the studies on nuclei and elementary particles. One direction of the development is the acceleration of protons and electrons to more and more high energy, and another direction is the acceleration of heavy ions up to uranium to several MeV up to several hundreds MeV. However recently, accelerators are used as the useful tools for the studies in wider fields. There are electrostatic acceleration and high frequency acceleration in ion acceleration, and at present, super-large accelerators are high frequency acceleration type. In Japan Atomic Energy Research Institute, it was decided in 1975 to construct an electrostatic accelerator of tandem type in order to accelerate heavy ions. In case of the electrostatic acceleration, the construction is relatively simple, the acceleration of heavy ions is easy, the property of the ion beam is very good, and the energy is stable. Especially, the tandem type is convenient for obtaining high energy. The tandem accelerator of 20 MV terminal voltage was ordered from the National Electrostatics Corp., USA, and is expected to be completed in 1978. The significance of heavy ion acceleration in the development and research of atomic energy, tandem van de Graaff accelerators, the JAERI 20MV tandem accelerator, and the research project with this accelerator are described. (Kako, I.)

  2. APT accelerator technology

    International Nuclear Information System (INIS)

    Schneider, J. David

    1996-01-01

    The proposed accelerator production of tritium (APT) project requires an accelerator that provides a cw proton beam of 100 m A at 1300 MeV. Since the majority of the technical risk of a high-current cw (continuous-wave, 100% DF) accelerator resides in the low-energy section, Los Alamos is building a 20 MeV duplicate of the accelerator front end to confirm design codes, beam performance, and demonstrate operational reliability. We report on design details of this low-energy demonstration accelerator (LEDA) and discuss the integrated design of the full accelerator for the APT plant. LEDA's proton injector is under test and has produced more than 130 mA at 75 keV. Fabrication is proceeding on a 6.7- MeV, 8-meter-long RFQ, and detailed design is underway on coupled-cavity drift-tube linac (CCDTL) structures. In addition, detailed design and technology experiments are underway on medium-beta superconducting cavities to assess the feasibility of replacing the conventional (room-temperature copper) high-energy linac with a linac made of niobium superconducting RF cavities. (author)

  3. Laser wakefield acceleration

    International Nuclear Information System (INIS)

    Esarey, E.; Ting, A.; Sprangle, P.

    1989-01-01

    The laser wakefield accelerator (LWFA) is a novel plasma based electron acceleration scheme which utilizes a relativistic optical guiding mechanism for laser pulse propagation. In the LWFA, a short, high power, single frequency laser pulse is propagated through a plasma. As the laser pulse propagates, its radial and axial ponderomotive forces nonresonantly generate large amplitude plasma waves (wakefields) with a phase velocity equal to the group velocity of the pulse. A properly phased electron bunch may then be accelerated by the axial wakefield and focused by the transverse wakefield. Optical guiding of the laser pulse in the plasma is necessary in order to achieve high energies in a single stage of acceleration. At sufficiently high laser powers, optical guiding may be achieved through relativistic effects associated with the plasma electrons. Preliminary analysis indicates that this scheme may overcome some of the difficulties present in the plasma beat wave accelerator and in the plasma wakefield accelerator. Analytical and numerical calculations are presented which study both laser pulse propagation within a plasma as well as the subsequent generation of large amplitude plasma waves. In addition, the generation of large amplitude plasma waves in regimes where the plasma waves become highly nonlinear is examined

  4. Particle Accelerators for PET radionuclides

    DEFF Research Database (Denmark)

    Jensen, Mikael

    2012-01-01

    The requirements set for particle accelerators for production of radioactive isotopes for PET can easily be derived from first principles. The simple general need is for proton beams with energy in the region 10–20 MeV and current 20–100 microAmps. This is most reliably and cost-effectively achie......The requirements set for particle accelerators for production of radioactive isotopes for PET can easily be derived from first principles. The simple general need is for proton beams with energy in the region 10–20 MeV and current 20–100 microAmps. This is most reliably and cost......-effectively achieved by the well proven technology of the compact medical cyclotron, presently available from several companies. The main features of these cyclotrons are essential similar: resistive, sector focused iron magnets, internal negative ion sources and stripping extraction. The remaining differences between...... different manufacturers will be discussed the light of what is actually needed for a given PET site operation. Alternatives to the conventional cyclotron have been proposed and tested but have at present very limited use. These alternatives will be discussed, as well as the future possibilities of supplying...

  5. Photon acceleration in laser wakefield accelerators

    International Nuclear Information System (INIS)

    Trines, R. M. G. M.

    2007-01-01

    If the index of a refraction of a dispersive medium, such as a plasma, changes in time, it can be used to change the frequency of light propagating through the medium. This effect is called photon acceleration. It has been predicted in both theory and simulations, and also been demonstrated experimentally for the case of moving ionization fronts in gases (the so-called ionization blueshift) as well as for laser-driven wakefields.Here, we present studies of photon acceleration in laser-driven plasma wakefields. The unique spectral characteristics of this process will be discussed, to distinguish it from e.g. photon acceleration by ionization fronts, frequency domain interferometry or self-phase modulation. The dynamics of the photons in laser-wakefield interaction are studied through both regular particle-in-cell and wave-kinetic simulations. The latter approach provides a powerful, versatile, and easy-to-use method to track the propagation of individual spectral components, providing new insight into the physics of laser-plasma interaction. Theory, simulations and experimental results will be brought together to provide a full understanding of the dynamics of a laser pulse in its own wakefield.Even though the wave-kinetic approach mentioned above has mainly been developed for the description of laser-plasma interaction, it can be applied to a much wider range of fast wave-slow wave interaction processes: Langmuir waves-ion acoustic waves, drift waves-zonal flow, Rossby waves-zonal flow, or even photons-gravitational waves. Several recent results in these areas will be shown, often with surprising results

  6. Accelerator business in Japan expanding

    International Nuclear Information System (INIS)

    Anon.

    1992-01-01

    Accelerators have become to be used increasingly in Japan in such fields as medicine, physics research and industry. This has caused stiff competition for market share by the manufacturers of accelerators. Electron beam accelerators for industrial use provide an indispensable means for adding values to products, for example, electric cables with incombustible insulators. Linear accelerators for the nondestructive inspection of nuclear components have been widely installed at equipment manufacturing plants. Active efforts have been exerted to develop small synchrotron radiation accelerators for next generation electronic industry. Cyclotrons for producing short life radioisotopes for medical diagnosis and electron beam accelerators for radiation therapy are also used routinely. The suppliers of accelerators include the companies manufacturing heavy electric machinery, heavy machinery and the engineering division of steelmakers. Accelerator physics is being formed, but universities do not yet offer the course regarding accelerators. Accelerator use in Japan and the trend of accelerator manufacturers are reported. (K.I.)

  7. Beam transport through electrostatic accelerators and matching into post accelerators

    International Nuclear Information System (INIS)

    Larson, J.D.

    1986-01-01

    Ion beam transport through electrostatic acceleration is briefly reviewed. Topics discussed include injection, matching into the low-energy acceleration stage, matching from the terminal stripper into the high-energy stage, transport to a post accelerator, space charge, bunching isochronism, dispersion and charge selection. Beam transport plans for the proposed Vivitron accelerator are described. (orig.)

  8. Computer simulation of dynamic processes on accelerators

    International Nuclear Information System (INIS)

    Kol'ga, V.V.

    1979-01-01

    The problems of computer numerical investigation of motion of accelerated particles in accelerators and storages, an effect of different accelerator systems on the motion, determination of optimal characteristics of accelerated charged particle beams are considered. Various simulation representations are discussed which describe the accelerated particle dynamics, such as the enlarged particle method, the representation where a great number of discrete particle is substituted for a field of continuously distributed space charge, the method based on determination of averaged beam characteristics. The procedure is described of numerical studies involving the basic problems, viz. calculation of closed orbits, establishment of stability regions, investigation of resonance propagation determination of the phase stability region, evaluation of the space charge effect the problem of beam extraction. It is shown that most of such problems are reduced to solution of the Cauchy problem using a computer. The ballistic method which is applied to solution of the boundary value problem of beam extraction is considered. It is shown that introduction into the equation under study of additional members with the small positive regularization parameter is a general idea of the methods for regularization of noncorrect problems [ru

  9. A measurement of hadron production cross sections for the simulation of accelerator neutrino beams and a search for muon-neutrino to electron-neutrino oscillations in the Δm2 about equals 1-eV2 region

    Energy Technology Data Exchange (ETDEWEB)

    Schmitz, David W. [Columbia Univ., New York, NY (United States)

    2008-01-01

    A measurement of hadron production cross-sections for the simulation of accelerator neutrino beams and a search for muon neutrino to electron neutrino oscillations in the Δm2 ~ 1 eV2} region. This dissertation presents measurements from two different high energy physics experiments with a very strong connection: the Hadron Production (HARP) experiment located at CERN in Geneva, Switzerland, and the Mini Booster Neutrino Experiment (Mini-BooNE) located at Fermilab in Batavia, Illinois.

  10. Impulsive ion acceleration in earth's outer magnetosphere

    International Nuclear Information System (INIS)

    Baker, D.N.; Belian, R.D.

    1985-01-01

    Considerable observational evidence is found that ions are accelerated to high energies in the outer magnetosphere during geomagnetic disturbances. The acceleration often appears to be quite impulsive causing temporally brief (10's of seconds), very intense bursts of ions in the distant plasma sheet as well as in the near-tail region. These ion bursts extend in energy from 10's of keV to over 1 MeV and are closely associated with substorm expansive phase onsets. Although the very energetic ions are not of dominant importance for magnetotail plasma dynamics, they serve as an important tracer population. Their absolute intensity and brief temporal appearance bespeaks a strong and rapid acceleration process in the near-tail, very probably involving large induced electric fields substantially greater than those associated with cross-tail potential drops. Subsequent to their impulsive acceleration, these ions are injected into the outer trapping regions forming ion ''drift echo'' events, as well as streaming tailward away from their acceleration site in the near-earth plasma sheet. Most auroral ion acceleration processes occur (or are greatly enhanced) during the time that these global magnetospheric events are occurring in the magnetotail. A qualitative model relating energetic ion populations to near-tail magnetic reconnection at substorm onset followed by global redistribution is quite successful in explaining the primary observational features. Recent measurements of the elemental composition and charge-states have proven valuable for showing the source (solar wind or ionosphere) of the original plasma population from which the ions were accelerated

  11. Concurrent control system for the JAERI tandem accelerator

    International Nuclear Information System (INIS)

    Hanashima, S.; Shoji, T.; Horie, K.; Tsukihashi, Y.

    1992-01-01

    Concurrent processing with a multiprocessor system is introduced to the particle accelerator control system region. The control system is a good application in both logical and physical aspects. A renewal plan of the control system for the JAERI tandem accelerator is discussed. (author)

  12. ORNL pellet acceleration program

    International Nuclear Information System (INIS)

    Foster, C.A.; Milora, S.L.

    1978-01-01

    The Oak Ridge National Laboratory (ORNL) pellet fueling program is centered around developing equipment to accelerate large pellets of solidified hydrogen to high speeds. This equipment will be used to experimentally determine pellet-plasma interaction physics on contemporary tokamaks. The pellet experiments performed on the Oak Ridge Tokamak (ORMAK) indicated that much larger, faster pellets would be advantageous. In order to produce and accelerate pellets of the order of 1 to 6 mm in diameter, two apparatuses have been designed and are being constructed. The first will make H 2 pellets by extruding a filament of hydrogen and mechanically chopping it into pellets. The pellets formed will be mechanically accelerated with a high speed arbor to a speed of 950 m/sec. This technique may be extended to speeds up to 5000 m/sec, which makes it a prime candidate for a reactor fueling device. In the second technique, a hydrogen pellet will be formed, loaded into a miniature rifle, and accelerated by means of high pressure hydrogen gas. This technique should be capable of speeds of the order of 1000 m/sec. While this technique does not offer the high performance of the mechanical accelerator, its relative simplicity makes it attractive for near-term experiments

  13. Accelerator development at Bates

    International Nuclear Information System (INIS)

    Sargent, C.P.

    1983-01-01

    The past year has seen the completion of a major expansion of the Bates Accelerator Laboratory. A second experimental hall, South Hall, and several magnetic spectrometers have been constructed. The accelerator's maximum energy has been raised from 400 to 750 MeV by means of beam recirculation. A current two-year project for the fabrication of an additional RF transmitter plus a 30% increase in RF peak power capability will increase energy further to ca. 1 GeV. During the same period pulse-to-pulse beam sharing between the high-resolution spectrometer area and South Hall will become available. In January 1981 the Laboratory submitted their ''Proposal for a Long-Range Expansion Program'' to DOE-NSF. The proposed development consists of three stages. Stage I calls for the addition of a pulse stretcher ring to furnish a CW beam to the South Hall beam lines. Additional experimental space for internal target experiments and photon tagging research are also included. Stage II increases the accelerator energy to 2.1 GeV (at 140 microamps) by means of a five-pass head-to-tail recirculator. Stage III is, at this time, a plan rather than a proposal. It increases accelerator energy to 4 GeV by extending the accelerator length and power and adds another pulse stretcher ring and three new experimental areas for the higher energy work. This paper discusses each of these stages in detail and recommends their funding and scheduling

  14. High energy plasma accelerators

    International Nuclear Information System (INIS)

    Tajima, T.

    1985-05-01

    Colinear intense laser beams ω 0 , kappa 0 and ω 1 , kappa 1 shone on a plasma with frequency separation equal to the electron plasma frequency ω/sub pe/ are capable of creating a coherent large longitudinal electric field E/sub L/ = mc ω/sub pe//e of the order of 1GeV/cm for a plasma density of 10 18 cm -3 through the laser beat excitation of plasma oscillations. Accompanying favorable and deleterious physical effects using this process for a high energy beat-wave accelerator are discussed: the longitudinal dephasing, pump depletion, the transverse laser diffraction, plasma turbulence effects, self-steepening, self-focusing, etc. The basic equation, the driven nonlinear Schroedinger equation, is derived to describe this system. Advanced accelerator concepts to overcome some of these problems are proposed, including the plasma fiber accelerator of various variations. An advanced laser architecture suitable for the beat-wave accelerator is suggested. Accelerator physics issues such as the luminosity are discussed. Applications of the present process to the current drive in a plasma and to the excitation of collective oscillations within nuclei are also discussed

  15. Linear induction accelerators

    International Nuclear Information System (INIS)

    Briggs, R.J.

    1986-06-01

    The development of linear induction accelerators has been motivated by applications requiring high-pulsed currents of charged particles at voltages exceeding the capability of single-stage, diode-type accelerators and at currents too high for rf accelerators. In principle, one can accelerate charged particles to arbitrarily high voltages using a multi-stage induction machine, but the 50-MeV, 10-kA Advanced Test Accelerator (ATA) at LLNL is the highest voltage machine in existence at this time. The advent of magnetic pulse power systems makes sustained operation at high-repetition rates practical, and this capability for high-average power is very likely to open up many new applications of induction machines in the future. This paper surveys the US induction linac technology with primary emphasis on electron machines. A simplified description of how induction machines couple energy to the electron beam is given, to illustrate many of the general issues that bound the design space of induction linacs

  16. A Molecular Dynamics (MD and Quantum Mechanics/Molecular Mechanics (QM/MM Study on Ornithine Cyclodeaminase (OCD: A Tale of Two Iminiums

    Directory of Open Access Journals (Sweden)

    James W. Gauld

    2012-10-01

    Full Text Available Ornithine cyclodeaminase (OCD is an NAD+-dependent deaminase that is found in bacterial species such as Pseudomonas putida. Importantly, it catalyzes the direct conversion of the amino acid L-ornithine to L-proline. Using molecular dynamics (MD and a hybrid quantum mechanics/molecular mechanics (QM/MM method in the ONIOM formalism, the catalytic mechanism of OCD has been examined. The rate limiting step is calculated to be the initial step in the overall mechanism: hydride transfer from the L-ornithine’s Cα–H group to the NAD+ cofactor with concomitant formation of a Cα=NH2+ Schiff base with a barrier of 90.6 kJ mol−1. Importantly, no water is observed within the active site during the MD simulations suitably positioned to hydrolyze the Cα=NH2+ intermediate to form the corresponding carbonyl. Instead, the reaction proceeds via a non-hydrolytic mechanism involving direct nucleophilic attack of the δ-amine at the Cα-position. This is then followed by cleavage and loss of the α-NH2 group to give the Δ1-pyrroline-2-carboxylate that is subsequently reduced to L-proline.

  17. A Molecular Dynamics (MD) and Quantum Mechanics/Molecular Mechanics (QM/MM) Study on Ornithine Cyclodeaminase (OCD): A Tale of Two Iminiums

    Science.gov (United States)

    Ion, Bogdan F.; Bushnell, Eric A. C.; De Luna, Phil; Gauld, James W.

    2012-01-01

    Ornithine cyclodeaminase (OCD) is an NAD+-dependent deaminase that is found in bacterial species such as Pseudomonas putida. Importantly, it catalyzes the direct conversion of the amino acid L-ornithine to L-proline. Using molecular dynamics (MD) and a hybrid quantum mechanics/molecular mechanics (QM/MM) method in the ONIOM formalism, the catalytic mechanism of OCD has been examined. The rate limiting step is calculated to be the initial step in the overall mechanism: hydride transfer from the L-ornithine’s Cα–H group to the NAD+ cofactor with concomitant formation of a Cα=NH2 + Schiff base with a barrier of 90.6 kJ mol−1. Importantly, no water is observed within the active site during the MD simulations suitably positioned to hydrolyze the Cα=NH2 + intermediate to form the corresponding carbonyl. Instead, the reaction proceeds via a non-hydrolytic mechanism involving direct nucleophilic attack of the δ-amine at the Cα-position. This is then followed by cleavage and loss of the α-NH2 group to give the Δ1-pyrroline-2-carboxylate that is subsequently reduced to L-proline. PMID:23202934

  18. Final report on key comparison COOMET.QM-K36 (Project COOMET 540/UA/11) 'Electrolytic Conductivity 0,5 S/m'

    Science.gov (United States)

    Gavrilkin, V.; Prokopenko, L.; Bakovec, N.; Zolotorevich, E.; Suvorov, V.; Ovchinnikov, Yu; Pilishvili, T.; Buleishvili, M.; Zhasanbaeva, B.; Aytzhatova, G.; Ticona, G.; Vyskocil, L.

    2015-01-01

    The COOMET.QM-K36 key comparison 'Electrolytic conductivity: 0.5 S/m' is a comparison in the field of electrolytic conductivity measurements conducted by COOMET and carried out in 2012. It used a solution of KCl in water and the results are connected to those of the CCQM key comparison CCQM-K36.a through common participation of VNIIFTRI (Russia), SMU (Slovakia) and Ukrmetrteststandart (Ukraine). The purpose of this key comparison was to establish the equivalence of measurements of electrolytic conductivity performed at the National Metrology Institutes of COOMET member states for the value of 0.5 S/m. The results can be used to support the CMCs claims over the range of 0.1 S/m to 1.3 S/m. Main text. To reach the main text of this paper, click on Final Report. Note that this text is that which appears in Appendix B of the BIPM key comparison database kcdb.bipm.org/. The final report has been peer-reviewed and approved for publication by CCQM, according to the provisions of the CIPM Mutual Recognition Arrangement (CIPM MRA).

  19. Accelerators for atomic energy research

    International Nuclear Information System (INIS)

    Shibata, Tokushi

    1999-01-01

    The research and educational activities accomplished using accelerators for atomic energy research were studied. The studied items are research subjects, facility operation, the number of master theses and doctor theses on atomic energy research using accelerators and the future role of accelerators in atomic energy research. The strategy for promotion of the accelerator facility for atomic energy research is discussed. (author)

  20. Accelerators in Science and Technology

    CERN Document Server

    Kailas, S

    2002-01-01

    Accelerators built for basic research in frontier areas of science have become important and inevitable tools in many areas of science and technology. Accelerators are examples of science driven high technology development. Accelerators are used for a wide ranging applications, besides basic research. Accelerator based multidisciplinary research holds great promise

  1. Plasma-based accelerator structures

    International Nuclear Information System (INIS)

    Schroeder, Carl B.

    1999-01-01

    Plasma-based accelerators have the ability to sustain extremely large accelerating gradients, with possible high-energy physics applications. This dissertation further develops the theory of plasma-based accelerators by addressing three topics: the performance of a hollow plasma channel as an accelerating structure, the generation of ultrashort electron bunches, and the propagation of laser pulses is underdense plasmas

  2. The mean photon energy anti E{sub F} at the point of measurement determines the detector-specific radiation quality correction factor k{sub Q,M} in {sup 192}Ir brachytherapy dosimetry

    Energy Technology Data Exchange (ETDEWEB)

    Chofor, Ndimofor; Harder, Dietrich; Selbach, Hans-Joachim; Poppe, Bjoern [University of Oldenburg and Pius-Hospital Oldenburg (Germany). Medical Radiation Physics Group

    2016-11-01

    The application of various radiation detectors for brachytherapy dosimetry has motivated this study of the energy dependence of radiation quality correction factor k{sub Q,M}, the quotient of the detector responses under calibration conditions at a {sup 60}Co unit and under the given non-reference conditions at the point of measurement, M, occurring in photon brachytherapy. The investigated detectors comprise TLD, radiochromic film, ESR, Si diode, plastic scintillator and diamond crystal detectors as well as ionization chambers of various sizes, whose measured response-energy relationships, taken from the literature, served as input data. Brachytherapy photon fields were Monte-Carlo simulated for an ideal isotropic {sup 192}Ir point source, a model spherical {sup 192}Ir source with steel encapsulation and a commercial HDR GammaMed Plus source. The radial source distance was varied within cylindrical water phantoms with outer radii ranging from 10 to 30 cm and heights from 20 to 60 cm. By application of this semiempirical method - originally developed for teletherapy dosimetry - it has been shown that factor k{sub Q,M} is closely correlated with a single variable, the fluence-weighted mean photon energy anti E{sub F} at the point of measurement. The radial profiles of anti E{sub F} obtained with either the commercial {sup 192}Ir source or the two simplified source variants show little variation. The observed correlations between parameters k{sub Q,M} and anti E{sub F} are represented by fitting formulae for all investigated detectors, and further variation of the detector type is foreseen. The herewith established close correlation of radiation quality correction factor k{sub Q,M} with local mean photon energy anti E{sub F} can be regarded as a simple regularity, facilitating the practical application of correction factor k{sub Q,M} for in-phantom dosimetry around {sup 192}Ir brachytherapy sources. anti E{sub F} values can be assessed by Monte Carlo simulation or

  3. Acceleration of magnetized plasma rings

    International Nuclear Information System (INIS)

    Hartman, D.; Eddleman, J.; Hammer, J.H.

    1982-01-01

    One scheme is considered, acceleration of a ring between coaxial electrodes by a B/sub theta/ field as in a coaxial rail-gun. If the electrodes are conical, a ring accelerated towards the apex of the cone undergoes self-similar compression (focussing) during acceleration. Because the allowable acceleration force F/sub a/ = kappa U/sub m//R (kappa - 2 , the accelerating distance for conical electrodes is considerably shortened over that required for coaxial electrodes. In either case however, since the accelerating flux can expand as the ring moves, most of the accelerating field energy can be converted into kinetic energy of the ring leading to high efficiency

  4. Need for accelerating electrons

    International Nuclear Information System (INIS)

    Kerst, D.W.

    1987-01-01

    Photons for nuclear disintegration experiments were not abundantly available in the early days of nuclear physics, whereas accelerated ions led the way. When electrons could be accelerated into the 20--30 MeV range, they found application not only to nuclear disintegration of the elements of the periodic table but also to x-ray radiography and to deep therapy. Energies of interest for probing nuclear structure by electron scattering and for meson production followed soon after. The elementary nature of the electron has now made it a valuable tool for present day particle physics; and the synchrotron radiation, which is an obstacle for some accelerating processes, has become a much sought after source of photons for experiments at atomic structure energies

  5. Artificial seismic acceleration

    Science.gov (United States)

    Felzer, Karen R.; Page, Morgan T.; Michael, Andrew J.

    2015-01-01

    In their 2013 paper, Bouchon, Durand, Marsan, Karabulut, 3 and Schmittbuhl (BDMKS) claim to see significant accelerating seismicity before M 6.5 interplate mainshocks, but not before intraplate mainshocks, reflecting a preparatory process before large events. We concur with the finding of BDMKS that their interplate dataset has significantly more fore- shocks than their intraplate dataset; however, we disagree that the foreshocks are predictive of large events in particular. Acceleration in stacked foreshock sequences has been seen before and has been explained by the cascade model, in which earthquakes occasionally trigger aftershocks larger than themselves4. In this model, the time lags between the smaller mainshocks and larger aftershocks follow the inverse power law common to all aftershock sequences, creating an apparent acceleration when stacked (see Supplementary Information).

  6. Superconducting Accelerator Magnets

    CERN Document Server

    Mess, K H; Wolff, S

    1996-01-01

    The main topic of the book are the superconducting dipole and quadrupole magnets needed in high-energy accelerators and storage rings for protons, antiprotons or heavy ions. The basic principles of low-temperature superconductivity are outlined with special emphasis on the effects which are relevant for accelerator magnets. Properties and fabrication methods of practical superconductors are described. Analytical methods for field calculation and multipole expansion are presented for coils without and with iron yoke. The effect of yoke saturation and geometric distortions on field quality is studied. Persistent magnetization currents in the superconductor and eddy currents the copper part of the cable are analyzed in detail and their influence on field quality and magnet performance is investigated. Superconductor stability, quench origins and propagation and magnet protection are addressed. Some important concepts of accelerator physics are introduced which are needed to appreciate the demanding requirements ...

  7. Incineration by accelerator

    International Nuclear Information System (INIS)

    Cribier, M.; FIoni, G.; Legrain, R.; Lelievre, F.; Leray, S.; Pluquet, A.; Safa, H.; Spiro, M.; Terrien, Y.; Veyssiere, Ch.

    1997-01-01

    The use MOX fuel allows to hope a stabilization of plutonium production around 500 tons for the French park. In return, the flow of minor actinides is increased to several tons. INCA (INCineration by Accelerator), dedicated instrument, would allow to transmute several tons of americium, curium and neptunium. It could be able to reduce nuclear waste in the case of stopping nuclear energy use. This project needs: a protons accelerator of 1 GeV at high intensity ( 50 m A), a window separating the accelerator vacuum from the reactor, a spallation target able to produce 30 neutrons by incident proton, an incineration volume where a part of fast neutrons around the target are recovered, and a thermal part in periphery with flows at 2.10 15 n/cm 2 .s; a chemical separation of elements burning in thermal (americium) from the elements needing a flow of fast neutrons. (N.C.)

  8. Universality of accelerating change

    Science.gov (United States)

    Eliazar, Iddo; Shlesinger, Michael F.

    2018-03-01

    On large time scales the progress of human technology follows an exponential growth trend that is termed accelerating change. The exponential growth trend is commonly considered to be the amalgamated effect of consecutive technology revolutions - where the progress carried in by each technology revolution follows an S-curve, and where the aging of each technology revolution drives humanity to push for the next technology revolution. Thus, as a collective, mankind is the 'intelligent designer' of accelerating change. In this paper we establish that the exponential growth trend - and only this trend - emerges universally, on large time scales, from systems that combine together two elements: randomness and amalgamation. Hence, the universal generation of accelerating change can be attained by systems with no 'intelligent designer'.

  9. Future accelerators in Japan

    International Nuclear Information System (INIS)

    Toge, Nobu

    1993-01-01

    This paper presents a brief report on the present status of future accelerator projects at the National Laboratory for High Energy Physics (KEK), Japan. The KEK laboratory has been successfully operating the TRISTAN accelerator complex since 1986. It consists of a 2.5 GeV electron/positron linac, an 8 GeV Accumulation Ring (AR) and a 29 GeV Main Ring (MR). Concurrently with this operation, in response to recommendations by the Japanese High Energy Physics Committee, survey studies have been continued on new accelerator facilities at KEK. They have two major future projects, namely, the asymmetric e + e - B-factory based on TRISTAN (TRISTAN-II) and the Japan Linear Collider (JLC). The purpose of this paper is to outline those research activities and to present an update on their status

  10. Medical uses of accelerators

    International Nuclear Information System (INIS)

    Bradbury, J.N.

    1981-01-01

    A variety of particle accelerators have either potential or already demonstrated uses in connection with medically-related research, diagnosis, and treatment. For cancer radiotherapy, nuclear particles including protons, neutrons, heavy ions, and negative pi mesons have advantages compared to conventional radiations in terms of dose localization and/or biological effectiveness. Clinical evaluations of these particles are underway at a number of institutions. Accelerator-produced radionuclides are in widespread use for research and routine diagnostic purposes. Elemental analysis techniques with charged particles and neutrons are being applied to bone, blood, and other tissues. Finally, low-dose medical imaging can be accomplished with accelerated protons and heavy ions. The status and future of these programs are discussed

  11. JKJ accelerator timing system

    International Nuclear Information System (INIS)

    Ohmori, C.; Mori, Y.; Yoshii, M.; Yamamoto, M.

    2001-01-01

    The JKJ (JAERl-KEK Joint Project) accelerator complex consists of the linear accelerator, 3 GeV and 50 GeV synchrotrons. To minimize the beam loss during the beam transfer from the 3 GeV synchrotron to the 50 GeV one, the synchronization of the two RF system of the rings is very important. To reduce the background from the high and low momentum neutron, the neutron beam chopper will be employed. The 3 GeV RF will be also synchronized to the chopper timing when the beam goes to the neutron facility. The whole timing control system of these accelerators and chopper will be described. (author)

  12. Accelerators for therapy

    International Nuclear Information System (INIS)

    Pohlit, W.

    1994-01-01

    In the past decades circular and linear electron accelerators have been developed for clinical use in radiation therapy of tumors with the aim of achieving a high radiation dose in the tumor and as low as possible dose in the adjacent normal tissues. Today about one thousand accelerators are in medical use throughout the world and many hundred thousand patients are treated every day with accelerator-produced radiation. There exists, however, a large number of patients who cannot be treated satisfactorily in this way. New types of radiations such as neutrons, negative pions, protons and heavy ions were therefore tested recently. The clinical experience with these radiations and with new types of treatment procedures indicate that in future the use of a scanning beam of high energy protons might be optimal for the treatment of tumors. (orig.)

  13. Superconducting accelerator magnet design

    International Nuclear Information System (INIS)

    Wolff, S.

    1994-01-01

    Superconducting dipoles, quadrupoles and correction magnets are necessary to achieve the high magnetic fields required for big accelerators presently in construction or in the design phase. Different designs of superconducting accelerator magnets are described and the designs chosen at the big accelerator laboratories are presented. The most frequently used cosθ coil configuration is discussed in detail. Approaches for calculating the magnetic field quality including coil end fields are presented. Design details of the cables, coils, mechanical structures, yokes, helium vessels and cryostats including thermal radiation shields and support structures used in superconducting magnets are given. Necessary material properties are mentioned. Finally, the main results of magnetic field measurements and quench statistics are presented. (orig.)

  14. Accelerator technology in tokamaks

    International Nuclear Information System (INIS)

    Kustom, R.L.

    1977-01-01

    This article presents the similarities in the technology required for high energy accelerators and tokamak fusion devices. The tokamak devices and R and D programs described in the text represent only a fraction of the total fusion program. The technological barriers to producing successful, economical tokamak fusion power plants are as many as the plasma physics problems to be overcome. With the present emphasis on energy problems in this country and elsewhere, it is very likely that fusion technology related R and D programs will vigorously continue; and since high energy accelerator technology has so much in common with fusion technology, more scientists from the accelerator community are likely to be attracted to fusion problems

  15. Accelerating the culture change!

    Science.gov (United States)

    Klunk, S W; Panetta, J; Wooten, J

    1996-11-01

    Exide Electronics, a major supplier of uninterruptible power system equipment, embarked on a journey of changing a culture to improve quality, enhance customer responsiveness, and reduce costs. This case study examines the evolution of change over a period of seven years, with particular emphasis on the most recent years, 1992 through 1995. The article focuses on the Raleigh plant operations and describes how each succeeding year built on the successes and fixed the shortcomings of the prior years to accelerate the culture change, including corrective action and continuous improvement processes, organizational structures, expectations, goals, achievements, and pitfalls. The real challenge to changing the culture was structuring a dynamic approach to accelerate change! The presentation also examines how the evolutionary process itself can be created and accelerated through ongoing communication, regular feedback of progress and goals, constant evaluation and direction of the process, and measuring and paying for performance.

  16. Studies of accelerated compact toruses

    International Nuclear Information System (INIS)

    Hartman, C.W.; Eddleman, J.; Hammer, J.H.

    1983-01-01

    In an earlier publication we considered acceleration of plasma rings (Compact Torus). Several possible accelerator configurations were suggested and the possibility of focusing the accelerated rings was discussed. In this paper we consider one scheme, acceleration of a ring between coaxial electrodes by a B/sub theta/ field as in a coaxial rail-gun. If the electrodes are conical, a ring accelerated towards the apex of the cone undergoes self-similar compression (focusing) during acceleration. Because the allowable acceleration force, F/sub a/ = kappaU/sub m//R where (kappa - 2 , the accelerating distance for conical electrodes is considerably shortened over that required for coaxial electrodes. In either case, however, since the accelerating flux can expand as the ring moves, most of the accelerating field energy can be converted into kinetic energy of the ring leading to high efficiency

  17. Microelectromechanical acceleration-sensing apparatus

    Science.gov (United States)

    Lee, Robb M [Albuquerque, NM; Shul, Randy J [Albuquerque, NM; Polosky, Marc A [Albuquerque, NM; Hoke, Darren A [Albuquerque, NM; Vernon, George E [Rio Rancho, NM

    2006-12-12

    An acceleration-sensing apparatus is disclosed which includes a moveable shuttle (i.e. a suspended mass) and a latch for capturing and holding the shuttle when an acceleration event is sensed above a predetermined threshold level. The acceleration-sensing apparatus provides a switch closure upon sensing the acceleration event and remains latched in place thereafter. Examples of the acceleration-sensing apparatus are provided which are responsive to an acceleration component in a single direction (i.e. a single-sided device) or to two oppositely-directed acceleration components (i.e. a dual-sided device). A two-stage acceleration-sensing apparatus is also disclosed which can sense two acceleration events separated in time. The acceleration-sensing apparatus of the present invention has applications, for example, in an automotive airbag deployment system.

  18. Next generation of relativistic heavy ion accelerators

    International Nuclear Information System (INIS)

    Grunder, H.; Leemann, C.; Selph, F.

    1978-06-01

    Results are presented of exploratory and preliminary studies of a next generation of heavy ion accelerators. The conclusion is reached that useful luminosities are feasible in a colliding beam facility for relativistic heavy ions. Such an accelerator complex may be laid out in such a way as to provide extractebeams for fixed target operation, therefore allowing experimentation in an energy region overlapping with that presently available. These dual goals seem achievable without undue complications, or penalties with respect to cost and/or performance

  19. CERN: Accelerator school

    International Nuclear Information System (INIS)

    Anon.

    1993-01-01

    Full text: Jyvaskyla, a university town in central Finland, was the setting for last year's General Accelerator School organized by the CERN Accelerator School. Well over a hundred students - more than for some time - followed two weeks of lectures on a broad spectrum of accelerator topics, the first step en route to becoming the designers, builders and operators of the surprisingly large number of, accelerators of all kinds either built or planned throughout Europe and further afield. This was the fifth such school organized by CAS in a biennial cycle which alternates this introductory level with more advanced tuition. The next, advanced, school will be from 20 October - 1 November, hosted by Athens University on the Greek Island of Rhodes. (Application details will become available in Spring but would-be participants should already reserve the dates.) After Finland, the CAS caravan moved to Benalmadena near Malaga in Spain where, together with Seville University, they organized one of the joint US-CERN schools held every two years and focusing on frontier accelerator topics. This time the subject was electron-positron factories - machines for high luminosity experiments in phi, tau-charm, beauty and Z physics. Experts from both sides of the Atlantic and from Japan shared their knowledge with an equally representative audience and probed the many intensity related phenomena which must be mastered to reach design performance. A number of these topics will receive extended coverage in the next specialist CAS School which is a repeat - by public demand - of the highly successful radiofrequency course held in Oxford in 1991. This school will be in Capri, Italy, with the support of the University of Naples from 29 April to 5 May. Details and application forms are now available by e-mail (CASRF@CERNVM.CERN.CH), by fax (+41 22 7824836) or from Suzanne von Wartburg, CERN Accelerator School, 1211 Geneva 23, Switzerland

  20. Industrialization of Superconducting RF Accelerator Technology

    Science.gov (United States)

    Peiniger, Michael; Pekeler, Michael; Vogel, Hanspeter

    2012-01-01

    Superconducting RF (SRF) accelerator technology has basically existed for 50 years. It took about 20 years to conduct basic R&D and prototyping at universities and international institutes before the first superconducting accelerators were built, with industry supplying complete accelerator cavities. In parallel, the design of large scale accelerators using SRF was done worldwide. In order to build those accelerators, industry has been involved for 30 years in building the required cavities and/or accelerator modules in time and budget. To enable industry to supply these high tech components, technology transfer was made from the laboratories in the following three regions: the Americas, Asia and Europe. As will be shown, the manufacture of the SRF cavities is normally accomplished in industry whereas the cavity testing and module assembly are not performed in industry in most cases, yet. The story of industrialization is so far a story of customized projects. Therefore a real SRF accelerator product is not yet available in this market. License agreements and technology transfer between leading SRF laboratories and industry is a powerful tool for enabling industry to manufacture SRF components or turnkey superconducting accelerator modules for other laboratories and users with few or no capabilities in SRF technology. Despite all this, the SRF accelerator market today is still a small market. The manufacture and preparation of the components require a range of specialized knowledge, as well as complex and expensive manufacturing installations like for high precision machining, electron beam welding, chemical surface preparation and class ISO4 clean room assembly. Today, the involved industry in the US and Europe comprises medium-sized companies. In Japan, some big enterprises are involved. So far, roughly 2500 SRF cavities have been built by or ordered from industry worldwide. Another substantial step might come from the International Linear Collider (ILC) project

  1. Status report on the Karlsruhe prototype superconducting proton linerar accelerator

    International Nuclear Information System (INIS)

    Citron, A.

    1974-01-01

    A short intoduction about linear accelerators in general and the advantage of using superconducting resonators is given. Subsequently some basic efforts on r.f. superconductivity are recalled and the status of technology of surface preparations is reported. The status of the Karlsruhe accelerator is given. In the low energy region some difficulties caused by mechanical instabilities had to be overcome. Protons have been accelerated in this part. Model studies for the subsequent sections of the accelerator have been started and look promising. (author)

  2. Computer codes for beam dynamics analysis of cyclotronlike accelerators

    Science.gov (United States)

    Smirnov, V.

    2017-12-01

    Computer codes suitable for the study of beam dynamics in cyclotronlike (classical and isochronous cyclotrons, synchrocyclotrons, and fixed field alternating gradient) accelerators are reviewed. Computer modeling of cyclotron segments, such as the central zone, acceleration region, and extraction system is considered. The author does not claim to give a full and detailed description of the methods and algorithms used in the codes. Special attention is paid to the codes already proven and confirmed at the existing accelerating facilities. The description of the programs prepared in the worldwide known accelerator centers is provided. The basic features of the programs available to users and limitations of their applicability are described.

  3. Interfacing to accelerator instrumentation

    International Nuclear Information System (INIS)

    Shea, T.J.

    1995-01-01

    As the sensory system for an accelerator, the beam instrumentation provides a tremendous amount of diagnostic information. Access to this information can vary from periodic spot checks by operators to high bandwidth data acquisition during studies. In this paper, example applications will illustrate the requirements on interfaces between the control system and the instrumentation hardware. A survey of the major accelerator facilities will identify the most popular interface standards. The impact of developments such as isochronous protocols and embedded digital signal processing will also be discussed

  4. Acceleration of polarized particles

    International Nuclear Information System (INIS)

    Buon, J.

    1992-05-01

    The spin kinetics of polarized beams in circular accelerators is reviewed in the case of spin-1/2 particles (electrons and protons) with emphasis on the depolarization phenomena. The acceleration of polarized proton beams in synchrotrons is described together with the cures applied to reduce depolarization, including the use of 'Siberian Snakes'. The in-situ polarization of electrons in storage rings due to synchrotron radiation is studied as well as depolarization in presence of ring imperfections. The applications of electron polarization to accurately calibrate the rings in energy and to use polarized beams in colliding-beam experiments are reviewed. (author) 76 refs., 19 figs., 1 tab

  5. Spallator - accelerator breeder

    International Nuclear Information System (INIS)

    Steinberg, M.

    1985-01-01

    The concept involves the use of spallation neutrons produced by interaction of a high energy proton (1 to 2 GeV) from a linear accelerator (LINAC) with a heavy metal target (uranium). The principal spallator concept is based on generating fissile fuel for use in LWR nuclear power plants. The spallator functions in conjunction with a reprocessing plant to regenerate and produce the Pu-239 or U-233 for fabrication into fresh LWR reactor fuel elements. Advances in proton accelerator technology has provided a solid base for predicting performance and optimizing the design of a reliable, continuous wave, high-current LINAC required by a fissile fuel production machine

  6. Accelerated cyclic corrosion tests

    Directory of Open Access Journals (Sweden)

    Prošek T.

    2016-06-01

    Full Text Available Accelerated corrosion testing is indispensable for material selection, quality control and both initial and residual life time prediction for bare and painted metallic, polymeric, adhesive and other materials in atmospheric exposure conditions. The best known Neutral Salt Spray (NSS test provides unrealistic conditions and poor correlation to exposures in atmosphere. Modern cyclic accelerated corrosion tests include intermittent salt spray, wet and dry phases and eventually other technical phases. They are able to predict the material performance in service more correctly as documented on several examples. The use of NSS should thus be restricted for quality control.

  7. Remarks on stochastic acceleration

    International Nuclear Information System (INIS)

    Graeff, P.

    1982-12-01

    Stochastic acceleration and turbulent diffusion are strong turbulence problems since no expansion parameter exists. Hence the problem of finding rigorous results is of major interest both for checking approximations and for reference models. Since we have found a way of constructing such models in the turbulent diffusion case the question of the extension to stochastic acceleration now arises. The paper offers some possibilities illustrated by the case of 'stochastic free fall' which may be particularly interesting in the context of linear response theory. (orig.)

  8. Monoenergetic laser wakefield acceleration

    Directory of Open Access Journals (Sweden)

    N. E. Andreev

    2000-02-01

    Full Text Available Three dimensional test particle simulations are applied to optimization of the plasma-channeled laser wakefield accelerator (LWFA operating in a weakly nonlinear regime. Electron beam energy spread, emittance, and luminosity depend upon the proportion of the electron bunch size to the plasma wavelength. This proportion tends to improve with the laser wavelength increase. We simulate a prospective two-stage ∼1GeV LWFA with controlled energy spread and emittance. The input parameters correspond to realistic capabilities of the BNL Accelerator Test Facility that features a picosecond-terawatt CO_{2} laser and a high-brightness electron gun.

  9. High intensity hadron accelerators

    International Nuclear Information System (INIS)

    Teng, L.C.

    1989-05-01

    This rapporteur report consists mainly of two parts. Part I is an abridged review of the status of all High Intensity Hadron Accelerator projects in the world in semi-tabulated form for quick reference and comparison. Part II is a brief discussion of the salient features of the different technologies involved. The discussion is based mainly on my personal experiences and opinions, tempered, I hope, by the discussions I participated in in the various parallel sessions of the workshop. In addition, appended at the end is my evaluation and expression of the merits of high intensity hadron accelerators as research facilities for nuclear and particle physics

  10. Photocathodes in accelerator applications

    International Nuclear Information System (INIS)

    Fraser, J.S.; Sheffield, R.L.; Gray, E.R.; Giles, P.M.; Springer, R.W.; Loebs, V.A.

    1987-01-01

    Some electron accelerator applications require bursts of short pulses at high microscopic repetition rates and high peak brightness. A photocathode, illuminated by a mode-locked laser, is well suited to filling this need. The intrinsic brightness of a photoemitter beam is high; experiments are under way at Los Alamos to study the brightness of short bunches with high space charge after acceleration. A laser-illuminated Cs 3 Sb photoemitter is located in the first rf cavity of an injector linac. Diagnostics include a pepper-pot emittance analyzer, a magnetic spectrometer, and a streak camera

  11. "Light sail" acceleration reexamined.

    Science.gov (United States)

    Macchi, Andrea; Veghini, Silvia; Pegoraro, Francesco

    2009-08-21

    The dynamics of the acceleration of ultrathin foil targets by the radiation pressure of superintense, circularly polarized laser pulses is investigated by analytical modeling and particle-in-cell simulations. By addressing self-induced transparency and charge separation effects, it is shown that for "optimal" values of the foil thickness only a thin layer at the rear side is accelerated by radiation pressure. The simple "light sail" model gives a good estimate of the energy per nucleon, but overestimates the conversion efficiency of laser energy into monoenergetic ions.

  12. 'Light Sail' Acceleration Reexamined

    International Nuclear Information System (INIS)

    Macchi, Andrea; Veghini, Silvia; Pegoraro, Francesco

    2009-01-01

    The dynamics of the acceleration of ultrathin foil targets by the radiation pressure of superintense, circularly polarized laser pulses is investigated by analytical modeling and particle-in-cell simulations. By addressing self-induced transparency and charge separation effects, it is shown that for 'optimal' values of the foil thickness only a thin layer at the rear side is accelerated by radiation pressure. The simple 'light sail' model gives a good estimate of the energy per nucleon, but overestimates the conversion efficiency of laser energy into monoenergetic ions.

  13. Accelerating time to benefit

    DEFF Research Database (Denmark)

    Svejvig, Per; Geraldi, Joana; Grex, Sara

    Despite the ubiquitous pressure for speed, our approaches to accelerate projects remain constrained to the old-fashioned understanding of the project as a vehicle to deliver products and services, not value. This article explores an attempt to accelerate time to benefit. We describe and deconstruct...... of the time. Although all cases valued speed and speed to benefit, and implemented most practices proposed by the methodology, only three of the five projects were more successful in decreasing time to speed. Based on a multi-case study comparison between these five different projects and their respective...

  14. Plasma wave accelerator. II

    International Nuclear Information System (INIS)

    Mori, W.; Joshi, C.; Dawson, J.M.

    1982-01-01

    It was shown that the insertion of a cross magnetic field prevents the particles from getting out of phase with the electric field of the plasma wave in the beat wave accelerator scheme. Thus, using a CO 2 laser, n/sub c//n/sub e/ = (ω 0 /ω/sub p/) 2 approx. 35, and a 300 kG magnetic field, electrons can be (in principle) accelerated to 100 GeV in 2 meters. For comparison without the magnetic field, the same energies may be obtained in a n/sub c//n/sub e/ approx. 10 5 plasma over a distance of 100 meters

  15. An accelerator technology legacy

    International Nuclear Information System (INIS)

    Heighway, E.A.

    1994-01-01

    Accelerator technology has been a major beneficiary of the investment made over the last decade. It is the intention of this paper to provide the reader with a glimpse of the broad nature of those advances. Development has been on a broad front and this paper can highlight only a few of those. Two spin-off applications will be outlined -- a concept for a compact, active, beam probe for solar body exploration and the concept for an accelerator-driven transmutation system for energy production

  16. Nuclear data requirements for accelerator driven sub-critical systems

    Indian Academy of Sciences (India)

    The development of accelerator driven sub-critical systems (ADSS) require significant amount of new nuclear data in extended energy regions as well as for a variety of new materials. This paper reviews these perspectives in the Indian context.

  17. The physics of accelerator driven sub-critical reactors

    Indian Academy of Sciences (India)

    Accelerator driven systems (ADS) are attracting worldwide attention .... The region of interest (or the entire reactor core) is divided into a suitable number ..... have also presented the status of the theoretical and experimental activities being.

  18. Spectral flux of the p-7Li(C Q-M neutron source measured by proton recoil telescope

    Directory of Open Access Journals (Sweden)

    Simakov S.P.

    2010-10-01

    Full Text Available The cyclotron-based fast neutron source at NPI produces mono-energetic neutron fields up to 35 MeV neutron energy using the p + 7Li(carbon backing reactions. To be applied for activation cross-section measurements, not only the intensity of neutron peak, but also the contribution of low-energy continuum in the spectra must be well determined. Simulations of the spectral flux from present source at a position of irradiated samples were performed using CYRIC TOF-data validated in the present work against LA150h by calculations with the transport Monte Carlo code MCNPX. Simulated spectra were tested by absolute measurements using a proton-recoil telescope technique. The recoil-proton spectrometer consisted of a shielded scattering chamber with polyethylene and carbon radiators and the ΔE1-ΔE2-E telescope of silicon-surface detectors located to the neutron beam axis at 45° in the laboratory system. Si-detectors were handled by usual data acquisition system. Dead-time – and pulse-overlap losses of events were determined from the count rate of pulse generator registered during duty cycle of accelerator operation. The proton beam charge and data were taken in the list mode for later replay and analysis. The calculations for 7Li(p,n and 12C(p,n reactions reasonably reproduce CYRIC TOF neutron source spectra. The influence of neutron source set-up (proton beam dimensions, 7Li-foil, carbon stopper, cooling medium, target support/chamber and the geometry-arrangement of irradiated sample on the spectral flux is discussed in details.

  19. Effect of accelerating gap geometry on the beam breakup instability in linear induction accelerators

    International Nuclear Information System (INIS)

    Miller, R.B.; Marder, B.M.; Coleman, P.D.; Clark, R.E.

    1988-01-01

    The electron beam in a linear induction accelerator is generally susceptible to growth of the transverse beam breakup instability. In this paper we analyze a new technique for reducing the transverse coupling between the beam and the accelerating cavities, thereby reducing beam breakup growth. The basic idea is that the most worrisome cavity modes can be cutoff by a short section of coaxial transmission line inserted between the cavity structure and the accelerating gap region. We have used the three-dimensional simulation code SOS to analyze this problem. In brief, we find that the technique works, provided that the lowest TE mode cutoff frequency in the coaxial line is greater than the frequency of the most worrisome TM mode of the accelerating cavity

  20. Plasma acceleration, injection, and loss

    International Nuclear Information System (INIS)

    McIlwain, C.E.

    1988-01-01

    The sudden and dramatic acceleration of charged particles seems to be a universal phenomenon which occurs in plasmas occupying a wide range of spatial scales. These accelerations are typically accompanied by intrusions of the energized plasma into adjacent regions of space. A physical understanding of these processes can only be obtained by carefully coordinated experimental and theoretical studies which are designed to let nature display what is happening without imposing limitations associated with existing paradigms. Studies of the Earth's magnetosphere are hampered by the lack of adequate sampling in space and time. The feature matching technique of building magnetic and electric field models can help compensate for the extreme sparseness of experimental data but many future studies will still require large numbers of spacecraft placed in carefully coordinated orbits. History shows that magnetospheric research has sometimes faltered while various attractive conjectures were explored, but that direct observations play the role of a strict teacher who has little concern for the egos of scientists. Presumably this teacher will also discard the author's pet notion: that the ignition' of portions of the auroral shell in association with Earth flares results in the heating of ionospheric particles (and some particles of solar origin) that are then convected inward to form the ring current. The author, of course, hopes that at least some aspects of this notion will survive and will help lead the way to a better understanding of the Earth's neighborhood

  1. Accelerators in the sky

    International Nuclear Information System (INIS)

    Setti, G.

    1977-01-01

    The author surveys the large body of evidence showing that there are very efficient mechanisms capable of accelerating particles to high energies under very different astrophysical conditions. The circumstances whereby huge amounts of relativistic and ultrarelativistic particles such as one finds in a) cosmic rays, b) supernova remnants and c) radio galaxies and quasars are produced are considered. (Auth.)

  2. Heavy ion accelerator GANIL

    International Nuclear Information System (INIS)

    1975-04-01

    This article presents GANIL, a large national heavy ion accelerator. The broad problems of nuclear physics, atomic physics, astrophysics and physics of condensed media which can be approached and studied with this machine are discussed first, after which the final construction project is described. The project comprises a circular injector, a separated sector cyclotron up beam stripper, and a second separated cyclotron downstream [fr

  3. Accelerating with industry

    International Nuclear Information System (INIS)

    Southworth, Brian

    1992-01-01

    At the end of March, Berlin was the scene of the third biennial European Particle Accelerator Conference (EPAC). It carried the usual news from the front-line machines in the high energy physics Laboratories and reports on progress with the latest technologies

  4. Two-beam accelerator

    International Nuclear Information System (INIS)

    Sessler, A.M.; Hopkins, D.B.

    1986-06-01

    The Two-Beam Accelerator (TBA) consists of a long high-gradient accelerator structure (HGS) adjacent to an equal-length Free Electron Laser (FEL). In the FEL, a beam propagates through a long series of undulators. At regular intervals, waveguides couple microwave power out of the FEL into the HGS. To replenish energy given up by the FEL beam to the microwave field, induction accelerator units are placed periodically along the length of the FEL. In this manner it is expected to achieve gradients of more than 250 MV/m and thus have a serious option for a 1 TeV x 1 TeV linear collider. The state of present theoretical understanding of the TBA is presented with particular emphasis upon operation of the ''steady-state'' FEL, phase and amplitude control of the rf wave, and suppression of sideband instabilities. Experimental work has focused upon the development of a suitable HGS and the testing of this structure using the Electron Laser Facility (ELF). Description is given of a first test at ELF with a seven-cell 2π/3 mode structure which without preconditioning and with a not-very-good vacuum nevertheless at 35 GHz yielded an average accelerating gradient of 180 MV/m

  5. Hamburg Accelerator Conference

    Energy Technology Data Exchange (ETDEWEB)

    Wilson, Edmund J.N. [CERN Accelerator School (Switzerland)

    1992-10-15

    From 20-24 July, Hamburg welcomed the Fifteenth International Conference on High Energy Accelerators (HEACC). A natural highlight was the recent commissioning success of the HERA electron-proton collider at Hamburg's DESY Laboratory and its first high energy electron-proton collision data. This gave the meeting the feel of a family event celebrating a newborn.

  6. The Bevalac accelerator

    International Nuclear Information System (INIS)

    Dacal, A.

    1989-01-01

    Presented are the characteristics of the Bevatron and SuperHilac heavy ion accelerators in a very general manner. Some aspects of their application in the field of biological medicine and some of the interesting results obtained in experiments on nuclear physics are mentioned. (Author). 20 refs, 2 figs, 2 tabs

  7. Radioisotope Dating with Accelerators.

    Science.gov (United States)

    Muller, Richard A.

    1979-01-01

    Explains a new method of detecting radioactive isotopes by counting their accelerated ions rather than the atoms that decay during the counting period. This method increases the sensitivity by several orders of magnitude, and allows one to find the ages of much older and smaller samples. (GA)

  8. The CERN accelerator complex

    CERN Multimedia

    Mobs, Esma Anais

    2016-01-01

    The LHC is the last ring (dark blue line) in a complex chain of particle accelerators. The smaller machines are used in a chain to help boost the particles to their final energies and provide beams to a whole set of smaller experiments, which also aim to uncover the mysteries of the Universe.

  9. The CERN accelerator complex

    CERN Multimedia

    Christiane Lefèvre

    2008-01-01

    The LHC is the last ring (dark grey line) in a complex chain of particle accelerators. The smaller machines are used in a chain to help boost the particles to their final energies and provide beams to a whole set of smaller experiments, which also aim to uncover the mysteries of the Universe.

  10. Prospects for Accelerator Technology

    Science.gov (United States)

    Todd, Alan

    2011-02-01

    Accelerator technology today is a greater than US$5 billion per annum business. Development of higher-performance technology with improved reliability that delivers reduced system size and life cycle cost is expected to significantly increase the total accelerator technology market and open up new application sales. Potential future directions are identified and pitfalls in new market penetration are considered. Both of the present big market segments, medical radiation therapy units and semiconductor ion implanters, are approaching the "maturity" phase of their product cycles, where incremental development rather than paradigm shifts is the norm, but they should continue to dominate commercial sales for some time. It is anticipated that large discovery-science accelerators will continue to provide a specialty market beset by the unpredictable cycles resulting from the scale of the projects themselves, coupled with external political and economic drivers. Although fraught with differing market entry difficulties, the security and environmental markets, together with new, as yet unrealized, industrial material processing applications, are expected to provide the bulk of future commercial accelerator technology growth.

  11. Ion sources for accelerators

    International Nuclear Information System (INIS)

    Alton, G.D.

    1974-01-01

    A limited review of low charge sate positive and negative ion sources suitable for accelerator use is given. A brief discussion is also given of the concepts underlying the formation and extraction of ion beams. Particular emphasis is placed on the technology of ion sources which use solid elemental or molecular compounds to produce vapor for the ionization process

  12. BNL accelerator plans

    International Nuclear Information System (INIS)

    Lowenstein, D.I.

    1986-01-01

    The Brookhaven National Laboratory plan for high energy and heavy ion physics accelerator use for the next ten-year period is described. The two major initiatives are in the construction of the Relativistic Heavy Ion Collider and the upgrade of the Alternating Gradient Synchrotron to a ''Mini Kaon Factory''

  13. The CERN Accelerator School

    CERN Multimedia

    2016-01-01

    Introduction to accelerator physics This course will take place in Budapest, Hungary, from 2 to 14 October 2016. It is now open for registration and further information can be found at: http://cas.web.cern.ch/cas/Hungary2016/Hungary-advert.html and http://indico.cern.ch/event/532397/.

  14. Accelerating with industry

    Energy Technology Data Exchange (ETDEWEB)

    Southworth, Brian

    1992-06-15

    At the end of March, Berlin was the scene of the third biennial European Particle Accelerator Conference (EPAC). It carried the usual news from the front-line machines in the high energy physics Laboratories and reports on progress with the latest technologies.

  15. Accelerating News Issue 5

    CERN Document Server

    Szeberenyi, A

    2013-01-01

    In this spring issue, we look at developments towards higher luminosity and higher energy colliders. We report on the technology developed for the remote powering of the LHC magnets and studies of diagnostics based on higher order mode port signals. We also inform you about the main outcome of the TIARA survey on market needs for accelerator scientists.

  16. Next generation of accelerators

    International Nuclear Information System (INIS)

    Richter, B.

    1979-01-01

    Existing high-energy accelerators are reviewed, along with those under construction or being designed. Finally, some of the physics issues which go into setting machine parameters, and some of the features of the design of next generation electron and proton machines are discussed

  17. Cockroft Walton accelerator prototype

    International Nuclear Information System (INIS)

    Hutapea, Sumihar.

    1976-01-01

    Prototype of a Cockroft Walton generator using ceramic and plastic capacitors is discussed. Compared to the previous generator, the construction and components are much more improved. Pralon is used for the high voltage insulation column and plastic is used as a dielectric material for the high voltage capacitor. Cockroft Walton generator is used as a high tension supply for an accelerator. (author)

  18. Accelerated product development

    NARCIS (Netherlands)

    Langerak, F.; Seth, J.N.; Malhotra, N.K.

    2011-01-01

    Accelerated product development is a competitive strategy that seeks to reduce the development cycle time of new products. However, there has been little theoretical advancement and empirical model testing in the identification of the conditions under which cycle time reduction is appropriate, the

  19. The ATOMKI Accelerator Center

    International Nuclear Information System (INIS)

    Biri, S.; Kormany, Z.; Berzi, I.; Hunyadi, M.

    2009-01-01

    In 2009 a new division was established in our institute: the ATOMKI Accelerator Center (AAC). Before this time the facilities and staff of AAC belonged to other departments of the institute. The re-organization however, was necessary. It was understood that the translocation of all the accelerators into a centralized unit is advantageous in numerous fields. Here we just mention some of them. The submission of any instrumentation type proposal (EU or domestic) will be easier and has a higher chance to be supported. The organization and distribution of the beamtimes will be more equal and optimal. The usage of the maintenance and spare tools can became better and cheaper. The operating staff (cca. 20 person) can serve at more than one accelerator and the teams can help each other. The accelerator center actually became a fourth new basic unit of the institute besides the three traditional scientific divisions (see the Atomki homepage for the organization chart). The following six main facilities belong to the accelerator center: Cyclotron; VdG-5 accelerator; VdG-1 accelerator; ECR ion source; Isotope separator; Tandetron (under installation). In figure 1 the placements of these machines are shown in an artistic 3D map of the Atomki. The table 1 summarizes the main parameters of the accelerators. More detailed technical specification of the machines can be found in the new homepage of the center. In 2009 all the accelerators operated as scheduled, safely and without major breakdowns. After the experiences in the first months it can be concluded that the new center works well both for technical and human point of views. In the next sub-chapters the 2009 operation and development details of the individual accelerators are summarized. Cyclotron operation. The operation of the cyclotron in 2009 was concentrated to the usual 9 months; January, July and August were reserved for maintenance and holidays. The overall working time of the accelerator was 2009 hours; the time

  20. Wakeless triple soliton accelerator

    International Nuclear Information System (INIS)

    Mima, K.; Ohsuga, T.; Takabe, H.; Nishihara, K.; Tajima, T.; Zaidman, E.; Horton, W.

    1986-09-01

    We introduce and analyze the concept of a wakeless triple soliton accelerator in a plasma fiber. Under appropriate conditions the triple soliton with two electromagnetic and one electrostatic waves in the beat-wave resonance propagates with velocity c leaving no plasma wake behind, while the phase velocity of the electrostatic wave is made also c in the fiber

  1. Hamburg Accelerator Conference

    International Nuclear Information System (INIS)

    Wilson, Edmund J.N.

    1992-01-01

    From 20-24 July, Hamburg welcomed the Fifteenth International Conference on High Energy Accelerators (HEACC). A natural highlight was the recent commissioning success of the HERA electron-proton collider at Hamburg's DESY Laboratory and its first high energy electron-proton collision data. This gave the meeting the feel of a family event celebrating a newborn

  2. The CERN accelerator complex

    CERN Multimedia

    Haffner, Julie

    2013-01-01

    The LHC is the last ring (dark grey line) in a complex chain of particle accelerators. The smaller machines are used in a chain to help boost the particles to their final energies and provide beams to a whole set of smaller experiments, which also aim to uncover the mysteries of the Universe.

  3. Sources and acceleration efficiencies for energetic particles in the heliosphere

    International Nuclear Information System (INIS)

    Kucharek, H; Moebius, E

    2006-01-01

    Shocks at solar wind stream interaction regions, coronal mass ejections and magnetospheric obstacles have long been known for their intimate link with particle acceleration. Much enhanced capabilities to determine mass and charge composition at interplanetary shocks with ACE and SOHO have enabled us to identify sources and acceleration processes for the energetic particles. Both solar wind and interstellar pickup ions are substantial sources for particle acceleration in corotating interaction regions and at coronal mass ejections driven shocks and that flare particles are re-accelerated. Suprathermal distributions, such as pickup ions and pre-existing flare populations are accelerated much more efficiently than particles out of the solar wind. Recent results of the termination shock crossing by Voyager I and the scientific goals of the upcoming IBEX mission will be discussed

  4. Relativity and accelerator engineering

    International Nuclear Information System (INIS)

    Geloni, Gianluca; Kocharyan, Vitali; Saldin, Evgeni

    2017-09-01

    From a geometrical viewpoint, according to the theory of relativity, space and time constitute a four-dimensional continuum with pseudo-Euclidean structure. This has recently begun to be a practically important statement in accelerator physics. An X-ray Free Electron Laser (XFEL) is in fact the best, exciting example of an engineering system where improvements in accelerator technology makes it possible to develop ultrarelativistic macroscopic objects with an internal fine structure, and the theory of relativity plays an essential role in their description. An ultrarelativistic electron bunch modulated at nanometer-scale in XFELs has indeed a macroscopic finite-size of order of 10 μm. Its internal, collective structure is characterized in terms of a wave number vector. Here we will show that a four-dimensional geometrical approach, unusual in accelerator physics, is needed to solve problems involving the emission of radiation from an ultrarelativistic modulated electron beam accelerating along a curved trajectory. We will see that relativistic kinematics enters XFEL physics in a most fundamental way through the so-called Wigner rotation of the modulation wave number vector, which is closely associated to the relativity of simultaneity. If not taken into account, relativistic kinematics effects would lead to a strong qualitative disagreement between theory and experiments. In this paper, several examples of relativistic kinematics effects, which are important for current and future XFEL operation, are studied. The theory of relativity is applied by providing details of the clock synchronization procedure within the laboratory frame. This approach, exploited here but unusual in literature, is rather ''practical'', and should be acceptable to accelerator physicists.

  5. Menopause accelerates biological aging

    Science.gov (United States)

    Levine, Morgan E.; Lu, Ake T.; Chen, Brian H.; Hernandez, Dena G.; Singleton, Andrew B.; Ferrucci, Luigi; Bandinelli, Stefania; Salfati, Elias; Manson, JoAnn E.; Quach, Austin; Kusters, Cynthia D. J.; Kuh, Diana; Wong, Andrew; Teschendorff, Andrew E.; Widschwendter, Martin; Ritz, Beate R.; Absher, Devin; Assimes, Themistocles L.; Horvath, Steve

    2016-01-01

    Although epigenetic processes have been linked to aging and disease in other systems, it is not yet known whether they relate to reproductive aging. Recently, we developed a highly accurate epigenetic biomarker of age (known as the “epigenetic clock”), which is based on DNA methylation levels. Here we carry out an epigenetic clock analysis of blood, saliva, and buccal epithelium using data from four large studies: the Women's Health Initiative (n = 1,864); Invecchiare nel Chianti (n = 200); Parkinson's disease, Environment, and Genes (n = 256); and the United Kingdom Medical Research Council National Survey of Health and Development (n = 790). We find that increased epigenetic age acceleration in blood is significantly associated with earlier menopause (P = 0.00091), bilateral oophorectomy (P = 0.0018), and a longer time since menopause (P = 0.017). Conversely, epigenetic age acceleration in buccal epithelium and saliva do not relate to age at menopause; however, a higher epigenetic age in saliva is exhibited in women who undergo bilateral oophorectomy (P = 0.0079), while a lower epigenetic age in buccal epithelium was found for women who underwent menopausal hormone therapy (P = 0.00078). Using genetic data, we find evidence of coheritability between age at menopause and epigenetic age acceleration in blood. Using Mendelian randomization analysis, we find that two SNPs that are highly associated with age at menopause exhibit a significant association with epigenetic age acceleration. Overall, our Mendelian randomization approach and other lines of evidence suggest that menopause accelerates epigenetic aging of blood, but mechanistic studies will be needed to dissect cause-and-effect relationships further. PMID:27457926

  6. Relativity and accelerator engineering

    Energy Technology Data Exchange (ETDEWEB)

    Geloni, Gianluca [European XFEL GmbH, Schenefeld (Germany); Kocharyan, Vitali; Saldin, Evgeni [Deutsches Elektronen-Synchrotron (DESY), Hamburg (Germany)

    2017-09-15

    From a geometrical viewpoint, according to the theory of relativity, space and time constitute a four-dimensional continuum with pseudo-Euclidean structure. This has recently begun to be a practically important statement in accelerator physics. An X-ray Free Electron Laser (XFEL) is in fact the best, exciting example of an engineering system where improvements in accelerator technology makes it possible to develop ultrarelativistic macroscopic objects with an internal fine structure, and the theory of relativity plays an essential role in their description. An ultrarelativistic electron bunch modulated at nanometer-scale in XFELs has indeed a macroscopic finite-size of order of 10 μm. Its internal, collective structure is characterized in terms of a wave number vector. Here we will show that a four-dimensional geometrical approach, unusual in accelerator physics, is needed to solve problems involving the emission of radiation from an ultrarelativistic modulated electron beam accelerating along a curved trajectory. We will see that relativistic kinematics enters XFEL physics in a most fundamental way through the so-called Wigner rotation of the modulation wave number vector, which is closely associated to the relativity of simultaneity. If not taken into account, relativistic kinematics effects would lead to a strong qualitative disagreement between theory and experiments. In this paper, several examples of relativistic kinematics effects, which are important for current and future XFEL operation, are studied. The theory of relativity is applied by providing details of the clock synchronization procedure within the laboratory frame. This approach, exploited here but unusual in literature, is rather ''practical'', and should be acceptable to accelerator physicists.

  7. Spatially inhomogeneous acceleration of electrons in solar flares

    Science.gov (United States)

    Stackhouse, Duncan J.; Kontar, Eduard P.

    2018-04-01

    The imaging spectroscopy capabilities of the Reuven Ramaty high energy solar spectroscopic imager (RHESSI) enable the examination of the accelerated electron distribution throughout a solar flare region. In particular, it has been revealed that the energisation of these particles takes place over a region of finite size, sometimes resolved by RHESSI observations. In this paper, we present, for the first time, a spatially distributed acceleration model and investigate the role of inhomogeneous acceleration on the observed X-ray emission properties. We have modelled transport explicitly examining scatter-free and diffusive transport within the acceleration region and compare with the analytic leaky-box solution. The results show the importance of including this spatial variation when modelling electron acceleration in solar flares. The presence of an inhomogeneous, extended acceleration region produces a spectral index that is, in most cases, different from the simple leaky-box prediction. In particular, it results in a generally softer spectral index than predicted by the leaky-box solution, for both scatter-free and diffusive transport, and thus should be taken into account when modelling stochastic acceleration in solar flares.

  8. The continuous electron beam accelerator facility

    International Nuclear Information System (INIS)

    Grunder, H.A.

    1989-01-01

    Tunnel construction and accelerator component development, assembly, and testing are under way at the Continuous Electron Beam Accelerator Facility. CEBAF's 4-GeV, 200-μA superconducting recirculating accelerator will provide cw beam to simultaneous experiments in three end stations for studies of the nuclear many-body system, its quark substructure, and the strong and electroweak interactions governing this form of matter. Prototype accelerating cavities, assembled in cryostats and tested on site, continue to exceed performance specifications. An on-site liquid helium capability supports cryostat development and cavity testing. Major elements of the accelerator instrumentation and control hardware and software are in use in cryogenics, rf, and injector tests. Prototype rf systems have been operated and prototype klystrons have been ordered. The initial, 100-keV, room-temperature region of the 45-MeV injector is operational and meets specifications. CEBAF's end stations have been conceptually designed; experimental equipment conceptual designs will be completed in 1989. 2 refs., 5 figs., 2 tabs

  9. Acceleration of polarized proton beams

    International Nuclear Information System (INIS)

    Roser, T.

    1998-01-01

    The acceleration of polarized beams in circular accelerators is complicated by the numerous depolarizing spin resonances. Using a partial Siberian snake and a rf dipole that ensure stable adiabatic spin motion during acceleration has made it possible to accelerate polarized protons to 25 GeV at the Brookhaven AGS. Full Siberian snakes are being developed for RHIC to make the acceleration of polarized protons to 250 GeV possible. A similar scheme is being studied for the 800 GeV HERA proton accelerator

  10. Nonlinear dynamics in particle accelerators

    CERN Document Server

    Dilão, Rui

    1996-01-01

    This book is an introductory course to accelerator physics at the level of graduate students. It has been written for a large audience which includes users of accelerator facilities, accelerator physicists and engineers, and undergraduates aiming to learn the basic principles of construction, operation and applications of accelerators.The new concepts of dynamical systems developed in the last twenty years give the theoretical setting to analyse the stability of particle beams in accelerator. In this book a common language to both accelerator physics and dynamical systems is integrated and dev

  11. Unlimited Relativistic Shock Surfing Acceleration

    International Nuclear Information System (INIS)

    Ucer, D.; Shapiro, V. D.

    2001-01-01

    Nonrelativistic shock surfing acceleration at quasiperpendicular shocks is usually considered to be a preacceleration mechanism for slow pickup ions to initiate diffusive shock acceleration. In shock surfing, the particle accelerates along the shock front under the action of the convective electric field of the plasma flow. However, the particle also gains kinetic energy normal to the shock and eventually escapes downstream. We consider the case when ions are accelerated to relativistic velocities. In this case, the ions are likely to be trapped for infinitely long times, because the energy of bounce oscillations tends to decrease during acceleration. This suggests the possibility of unlimited acceleration by shock surfing

  12. Accelerator mass spectrometry at the Rossendorf 5 MV tandem accelerator

    International Nuclear Information System (INIS)

    Friedrich, M.; Buerger, W.; Curian, H.; Hartmann, B.; Hentschel, E.; Matthes, H.; Probst, W.; Seidel, M.; Turuc, S.; Hebert, D.; Rothe, T.; Stolz, W.

    1992-01-01

    The Rossendorf electrostatic accelerators (5 MV tandem accelerator and single ended 2 MV van de Graaff accelerator) are already used for ion beam analysis. The existing methods (RBS, PIXE, ERDA, NRA, nuclear microprobe and external beam) will be completed by introduction of Accelerator Mass Spectrometry (AMS). A short description of the Rossendorf AMS system is given and first experimental results are presented. (R.P.) 4 refs.; 6 figs

  13. SALOME: An Accelerator for the Practical Course in Accelerator Physics

    OpenAIRE

    Miltchev, Velizar; Riebesehl, Daniel; Roßbach, Jörg; Trunk, Maximilian; Stein, Oliver

    2014-01-01

    SALOME (Simple Accelerator for Learning Optics and the Manipulation of Electrons) is a short low energy linear electron accelerator built by the University of Hamburg. The goal of this project is to give the students the possibility to obtain hands-on experience with the basics of accelerator physics. In this contribution the layout of the device will be presented. The most important components of the accelerator will be discussed and an overview of the planned demonstration experiments will ...

  14. Mass spectrometry with accelerators.

    Science.gov (United States)

    Litherland, A E; Zhao, X-L; Kieser, W E

    2011-01-01

    As one in a series of articles on Canadian contributions to mass spectrometry, this review begins with an outline of the history of accelerator mass spectrometry (AMS), noting roles played by researchers at three Canadian AMS laboratories. After a description of the unique features of AMS, three examples, (14)C, (10)Be, and (129)I are given to illustrate the methods. The capabilities of mass spectrometry have been extended by the addition of atomic isobar selection, molecular isobar attenuation, further ion acceleration, followed by ion detection and ion identification at essentially zero dark current or ion flux. This has been accomplished by exploiting the techniques and accelerators of atomic and nuclear physics. In 1939, the first principles of AMS were established using a cyclotron. In 1977 the selection of isobars in the ion source was established when it was shown that the (14)N(-) ion was very unstable, or extremely difficult to create, making a tandem electrostatic accelerator highly suitable for assisting the mass spectrometric measurement of the rare long-lived radioactive isotope (14)C in the environment. This observation, together with the large attenuation of the molecular isobars (13)CH(-) and (12)CH 2(-) during tandem acceleration and the observed very low background contamination from the ion source, was found to facilitate the mass spectrometry of (14)C to at least a level of (14)C/C ~ 6 × 10(-16), the equivalent of a radiocarbon age of 60,000 years. Tandem Accelerator Mass Spectrometry, or AMS, has now made possible the accurate radiocarbon dating of milligram-sized carbon samples by ion counting as well as dating and tracing with many other long-lived radioactive isotopes such as (10)Be, (26)Al, (36)Cl, and (129)I. The difficulty of obtaining large anion currents with low electron affinities and the difficulties of isobar separation, especially for the heavier mass ions, has prompted the use of molecular anions and the search for alternative

  15. IFMIF accelerators design

    International Nuclear Information System (INIS)

    Mosnier, A.; Ratzinger, U.

    2008-01-01

    The IFMIF requirement for 250 mA current of deuteron beams at a nominal energy of 40 MeV is met by means of two identical continuous wave (CW) 175 MHz linear accelerators running in parallel, each delivering a 125 mA, 40 MeV deuteron beam to the common target. This approach allows to stay within the current capability of present RF linac technology while providing operational redundancy in case of failure of one of the linacs. Each linac comprises a sequence of acceleration and beam transport/matching stages. The ion source generates a 140 mA deuteron beam at 100 keV. A low energy beam transport (LEBT) transfers the deuteron beam from the source to a radio frequency quadrupole (RFQ) cavity. The RFQ bunches and accelerates the 125 mA beam to 5 MeV. The RFQ output beam is injected through a matching section into a drift-tube-linac (DTL) where it is accelerated to the final energy of 40 MeV. In the reference design, the final acceleration stage is a conventional Alvarez-type DTL with post-couplers operating at room temperature. Operation of both the RFQ and the DTL at the same relatively low frequency is essential for accelerating the high current deuteron beam with low beam loss. The primary concern of the IFMIF linacs is the minimization of beam losses, which could limit their availability and maintainability due to excessive activation of the linac and irradiation of the environment. A careful beam dynamics design is therefore needed from the source to the target to avoid the formation of particle halo that could finally be lost in the linac or transfer lines. A superconducting solution for the high energy portion of the linac using, for example, CH-structure or coaxial-type resonators, could offer some advantages, in particular the reduction of operational costs. Careful beam dynamics simulations and comparison tests with beam during the EVEDA phase are however necessary in order to fully assess the technical feasibility of such alternative solutions

  16. Trichoderma reesei xylanase 5 is defective in the reference strain QM6a but functional alleles are present in other wild-type strains.

    Science.gov (United States)

    Ramoni, Jonas; Marchetti-Deschmann, Martina; Seidl-Seiboth, Verena; Seiboth, Bernhard

    2017-05-01

    Trichoderma reesei is a paradigm for the regulation and industrial production of plant cell wall-degrading enzymes. Among these, five xylanases, including the glycoside hydrolase (GH) family 11 XYN1 and XYN2, the GH10 XYN3, and the GH30 XYN4 and XYN6, were described. By genome mining and transcriptome analysis, a further putative xylanase, encoded by xyn5, was identified. Analysis of xyn5 from the genome-sequenced reference strain T. reesei QM6a shows that it encodes a non-functional, truncated form of XYN5. However, non-truncated orthologues are present in other genome sequenced Trichoderma spp., and sequencing of xyn5 in other T. reesei wild-type isolates shows that they harbor a putative functional xyn5 allele. In silico analysis and 3D modeling revealed that the encoded XYN5 has significant structural similarities to xylanases of the GH11 family, including a GH-typical substrate binding groove and a carboxylate pair in the active site. The xyn5 of wild-type strain TUCIM1282 was recombinantly expressed in a T. reesei strain with a (hemi)cellulase-free background and the corresponding protein purified to apparent homogeneity. The pH and temperature optima and the kinetic parameters of the purified XYN5 were pH 4, 50 °C, and V max  = 2646 nkat/mg with a K m of 9.68 mg/ml. This functional xyn5 allele was used to replace the mutated version which led to an overall increase of the xylanolytic activity. These findings are of particular importance as GH11 xylanases are of high biotechnological relevance, and T. reesei is one of the main industrial producers of such lignocellulose-degrading enzymes.

  17. QM/MM Free Energy Simulations of Salicylic Acid Methyltransferase: Effects of Stabilization of TS-like Structures on Substrate Specificity

    Energy Technology Data Exchange (ETDEWEB)

    Yao, Jianzhuang [University of Tennessee, Knoxville (UTK); Xu, Qin [University of Tennessee, Knoxville (UTK); Chen, Feng [University of Tennessee, Knoxville (UTK); Guo, Hong [University of Tennessee, Knoxville (UTK)

    2010-01-01

    Salicylic acid methyltransferases (SAMTs) synthesize methyl salicylate (MeSA) using salicylate as the substrate. MeSA synthesized in plants may function as an airborne signal to activate the expression of defense-related genes and could also be a critical mobile signaling molecule that travels from the site of plant infection to establish systemic immunity in the induction of disease resistance. Here the results of QM/MM free energy simulations for the methyl transfer process in Clarkia breweri SAMT (CbSAMT) are reported to determine the origin of the substrate specificity of SAMTs. The free energy barrier for the methyl transfer from S-adenosyl-l-methionine (AdoMet) to 4-hydroxybenzoate in CbSAMT is found to be about 5 kcal/mol higher than that from AdoMet to salicylate, consistent with the experimental observations. It is suggested that the relatively high efficiency for the methylation of salicylate compared to 4-hydroxybenzoate is due, at least in part, to the reason that a part of the stabilization of the transition state (TS) configuration is already reflected in the reactant complex, presumably, through the binding. The results seem to indicate that the creation of the substrate complex (e.g., through mutagenesis and substrate modifications) with its structure closely resembling TS might be fruitful for improving the catalytic efficiency for some enzymes. The results show that the computer simulations may provide important insights into the origin of the substrate specificity for the SABATH family and could be used to help experimental efforts in generating engineered enzymes with altered substrate specificity.

  18. Activity-based protein profiling of secreted cellulolytic enzyme activity dynamics in Trichoderma reesei QM6a, NG14, and RUT-C30

    Energy Technology Data Exchange (ETDEWEB)

    Anderson, Lindsey N.; Culley, David E.; Hofstad, Beth A.; Chauvigne-Hines, Lacie M.; Zink, Erika M.; Purvine, Samuel O.; Smith, Richard D.; Callister, Stephen J.; Magnuson, Jon M.; Wright, Aaron T.

    2013-12-01

    Development of alternative, non-petroleum based sources of bioenergy that can be applied in the short-term find great promise in the use of highly abundant and renewable lignocellulosic plant biomass.1 This material obtained from different feedstocks, such as forest litter or agricultural residues, can yield liquid fuels and other chemical products through biorefinery processes.2 Biofuels are obtained from lignocellulosic materials by chemical pretreatment of the biomass, followed by enzymatic decomposition of cellulosic and hemicellulosic compounds into soluble sugars that are converted to desired chemical products via microbial metabolism and fermentation.3, 4 To release soluble sugars from polymeric cellulose multiple enzymes are required, including endoglucanase, exoglucanase, and β-glucosidase.5, 6 However, the enzymatic hydrolysis of cellulose into soluble sugars remains a significant limiting factor to the efficient and economically viable utilization of lignocellulosic biomass for transport fuels.7, 8 The primary industrial source of cellulose and hemicellulases is the mesophilic soft-rot fungus Trichoderma reesei,9 having widespread applications in food, feed, textile, pulp, and paper industries.10 The genome encodes 200 glycoside hydrolases, including 10 cellulolytic and 16 hemicellulolytic enzymes.11 The hypercellulolytic catabolite derepressed strain RUT-C30 was obtained through a three-step UV and chemical mutagenesis of the original T. reesei strain QM6a,12, 13 in which strains M7 and NG14 were intermediate, having higher cellulolytic activity than the parent strain but less activity and higher catabolite repression than RUT-C30.14 Numerous methods have been employed to optimize the secreted enzyme cocktail of T. reesei including cultivation conditions, operational parameters, and mutagenesis.3 However, creating an optimal and economical enzyme mixture for production-scale biofuels synthesis may take thousands of experiments to identify.

  19. Recent progress in particle accelerators

    International Nuclear Information System (INIS)

    Cole, F.T.; Mills, F.E.

    1988-01-01

    Many accelerators have also been built for medical radiography and therapy. Electron accelerators for this application are available commercially, using the electrons directly or bremsstrahlung photons. Neutrons produced by accelerator beams have also been used for therapy with considerable success, and several proton accelerators built for physics research have been adapted for direct therapy with protons. The first proton accelerator specifically for therapy is now being built. Separate from what might be called conventional accelerator technology, an entirely new field utilizing very highly pulsed power has been developed, and beams of short pulses of thousands or millions of amperes peak current in the MeV energy range are now available. These beams have important applications in high-energy particle acceleration, controlled fusion, industrial treatment of materials, and possibly in food preservation. All of these accelerators make use of external fields of acceleration. There is also vigorous research into new methods of acceleration, in many schemes making use of the intense accelerating fields, generated by laser beams or by plasma states of matter. This research has not as yet made traditional kinds of accelerators outmoded, but many workers hope that early in the next century there will be practical new acceleration methods making use of these very high fields. These developments are discussed in detail

  20. Acceleration of 14C beams in electrostatic accelerators

    International Nuclear Information System (INIS)

    Rowton, L.J.; Tesmer, J.R.

    1981-01-01

    Operational problems in the production and acceleration of 14 C beams for nuclear structure research in Los Alamos National Laboratory's Van de Graaff accelerators are discussed. Methods for the control of contamination in ion sources, accelerators and personnel are described. Sputter source target fabrication techniques and the relative beam production efficiencies of various types of bound particulate carbon sputter source targets are presented