WorldWideScience

Sample records for psti restriction enzyme

  1. Increasing Genome Sampling and Improving SNP Genotyping for Genotyping-by-Sequencing with New Combinations of Restriction Enzymes.

    Science.gov (United States)

    Fu, Yong-Bi; Peterson, Gregory W; Dong, Yibo

    2016-04-07

    Genotyping-by-sequencing (GBS) has emerged as a useful genomic approach for exploring genome-wide genetic variation. However, GBS commonly samples a genome unevenly and can generate a substantial amount of missing data. These technical features would limit the power of various GBS-based genetic and genomic analyses. Here we present software called IgCoverage for in silico evaluation of genomic coverage through GBS with an individual or pair of restriction enzymes on one sequenced genome, and report a new set of 21 restriction enzyme combinations that can be applied to enhance GBS applications. These enzyme combinations were developed through an application of IgCoverage on 22 plant, animal, and fungus species with sequenced genomes, and some of them were empirically evaluated with different runs of Illumina MiSeq sequencing in 12 plant species. The in silico analysis of 22 organisms revealed up to eight times more genome coverage for the new combinations consisted of pairing four- or five-cutter restriction enzymes than the commonly used enzyme combination PstI + MspI. The empirical evaluation of the new enzyme combination (HinfI + HpyCH4IV) in 12 plant species showed 1.7-6 times more genome coverage than PstI + MspI, and 2.3 times more genome coverage in dicots than monocots. Also, the SNP genotyping in 12 Arabidopsis and 12 rice plants revealed that HinfI + HpyCH4IV generated 7 and 1.3 times more SNPs (with 0-16.7% missing observations) than PstI + MspI, respectively. These findings demonstrate that these novel enzyme combinations can be utilized to increase genome sampling and improve SNP genotyping in various GBS applications. Copyright © 2016 Fu et al.

  2. Increasing Genome Sampling and Improving SNP Genotyping for Genotyping-by-Sequencing with New Combinations of Restriction Enzymes

    Directory of Open Access Journals (Sweden)

    Yong-Bi Fu

    2016-04-01

    Full Text Available Genotyping-by-sequencing (GBS has emerged as a useful genomic approach for exploring genome-wide genetic variation. However, GBS commonly samples a genome unevenly and can generate a substantial amount of missing data. These technical features would limit the power of various GBS-based genetic and genomic analyses. Here we present software called IgCoverage for in silico evaluation of genomic coverage through GBS with an individual or pair of restriction enzymes on one sequenced genome, and report a new set of 21 restriction enzyme combinations that can be applied to enhance GBS applications. These enzyme combinations were developed through an application of IgCoverage on 22 plant, animal, and fungus species with sequenced genomes, and some of them were empirically evaluated with different runs of Illumina MiSeq sequencing in 12 plant species. The in silico analysis of 22 organisms revealed up to eight times more genome coverage for the new combinations consisted of pairing four- or five-cutter restriction enzymes than the commonly used enzyme combination PstI + MspI. The empirical evaluation of the new enzyme combination (HinfI + HpyCH4IV in 12 plant species showed 1.7–6 times more genome coverage than PstI + MspI, and 2.3 times more genome coverage in dicots than monocots. Also, the SNP genotyping in 12 Arabidopsis and 12 rice plants revealed that HinfI + HpyCH4IV generated 7 and 1.3 times more SNPs (with 0–16.7% missing observations than PstI + MspI, respectively. These findings demonstrate that these novel enzyme combinations can be utilized to increase genome sampling and improve SNP genotyping in various GBS applications.

  3. CHROMOSOME BANDING IN CRUSTACEA. I. KARYOTYPE, Ag-NORs, C BANDING AND TREATMENT WITH EcoRI, PstI and KpnI RESTRICTION ENDONUCLEASES IN Artemia franciscana

    Directory of Open Access Journals (Sweden)

    Ingrid Vilar Accioly

    2014-08-01

    Full Text Available Características cariotípicas do microcrustáceo Artemia franciscana Kellog, 1906, introduzida nas salinas do litoral nordeste do Brasil, na década de 70, foram investigadas através de coloração convencional, bandamento C, endonucleases de restrição (EcoRI, PstI e KpnI e Ag-NORs. O cariótipo consiste de 42 cromossomos, onde se individualiza sobre alguns pares a presença de constrições secundárias. Grandes blocos heterocromáticos encontram-se distribuídos nas porções teloméricas da maioria dos cromossomos. A digestão com PstI e KpnI revelou um padrão similar ao obtido pelo bandamento C. Preparações tratadas com EcoRI apresentam digestão das regiões heterocromáticas indicando a presença de sítios de restrição nestas regiões. Ag-NORs múltiplas estão associadas a blocos heterocromáticos. Os dados apresentados representam passo inicial para identificação de possíveis modificações ocorridas após o isolamento geográfico desta amostra, assim como no entendimento das modificações evolutivas ocorridas no cariótipo deste grupo. Palavras-chave: bandamento cromossômico, camarão de água salgada, citogenética de crustáceos. DOI: http://dx.doi.org/10.18561/2179-5746/biotaamazonia.v4n2p15-19

  4. Phylogenetic relationships among cultivated Allium species from restriction enzyme analysis of the chloroplast genome.

    Science.gov (United States)

    Havey, M J

    1991-06-01

    The genus Allium contains many economically important species, including the bulb onion, chive, garlic, Japanese bunching onion, and leek. Phylogenetic relationships among the cultivated alliums are not well understood, and taxonomic classifications are based on relatively few morphological characters. Chloroplast DNA is highly conserved and useful in determining phylogenetic relationships. The size of the chloroplast genome of Allium cepa was estimated at 140 kb and restriction enzyme sites were mapped for KpnI, PstI, PvuII, SalI, XbaI, and XhoI. Variability at restriction enzyme sites in the chloroplast DNA was studied for at least three accessions of each of six cultivated, old-world Allium species. Of 189 restriction enzyme sites detected with 12 enzymes, 15 mutations were identified and used to estimate phylogenetic relationships. Cladistic analysis based on Wagner and Dollo parsimony resulted in a single, most-parsimonious tree of 16 steps and supported division of the species into sections. Allium species in section Porrum were distinguished from species in sections Cepa and Phyllodolon. Two species in section Rhiziridium, A. schoenoprasum and A. tuberosum, differed by five mutations and were placed in separate lineages. Allium cepa and A. fistulosum shared the loss of a restriction enzyme site and were phylogenetically closer to each other than to A. schoenoprasum. This study demonstrates the usefulness of restriction enzyme site analysis of the chloroplast genome in the elucidation of phylogenetic relationships in Allium.

  5. Restriction Enzyme Mapping: A Simple Student Practical.

    Science.gov (United States)

    Higgins, Stephen J.; And Others

    1990-01-01

    An experiment that uses the recombinant plasmid pX1108 to illustrate restriction mapping is described. The experiment involves three restriction enzymes and employs single and double restriction enzyme digestions. A list of needed materials, procedures, safety precautions, results, and discussion are included. (KR)

  6. Restriction mapping of Cucurbitae pepo L. chloroplast DNA Pstl 9.8 ...

    African Journals Online (AJOL)

    A fine map of the PstI 9.8 kb fragment was developed using SalI, BamHI and EcoRI restriction enzymes.Two transcripts of 1.4and 2.6 kbs of ORF 2280 of squash plastid DNA were detected in fruits but not in the leaves of Early Prolific cultivar using a heterologous PstI 1.2 kb tomato plastid DNA probe internal to ORF 2280.

  7. Biomolecular computers with multiple restriction enzymes

    Directory of Open Access Journals (Sweden)

    Sebastian Sakowski

    2017-10-01

    Full Text Available Abstract The development of conventional, silicon-based computers has several limitations, including some related to the Heisenberg uncertainty principle and the von Neumann “bottleneck”. Biomolecular computers based on DNA and proteins are largely free of these disadvantages and, along with quantum computers, are reasonable alternatives to their conventional counterparts in some applications. The idea of a DNA computer proposed by Ehud Shapiro’s group at the Weizmann Institute of Science was developed using one restriction enzyme as hardware and DNA fragments (the transition molecules as software and input/output signals. This computer represented a two-state two-symbol finite automaton that was subsequently extended by using two restriction enzymes. In this paper, we propose the idea of a multistate biomolecular computer with multiple commercially available restriction enzymes as hardware. Additionally, an algorithmic method for the construction of transition molecules in the DNA computer based on the use of multiple restriction enzymes is presented. We use this method to construct multistate, biomolecular, nondeterministic finite automata with four commercially available restriction enzymes as hardware. We also describe an experimental applicaton of this theoretical model to a biomolecular finite automaton made of four endonucleases.

  8. Biomolecular computers with multiple restriction enzymes.

    Science.gov (United States)

    Sakowski, Sebastian; Krasinski, Tadeusz; Waldmajer, Jacek; Sarnik, Joanna; Blasiak, Janusz; Poplawski, Tomasz

    2017-01-01

    The development of conventional, silicon-based computers has several limitations, including some related to the Heisenberg uncertainty principle and the von Neumann "bottleneck". Biomolecular computers based on DNA and proteins are largely free of these disadvantages and, along with quantum computers, are reasonable alternatives to their conventional counterparts in some applications. The idea of a DNA computer proposed by Ehud Shapiro's group at the Weizmann Institute of Science was developed using one restriction enzyme as hardware and DNA fragments (the transition molecules) as software and input/output signals. This computer represented a two-state two-symbol finite automaton that was subsequently extended by using two restriction enzymes. In this paper, we propose the idea of a multistate biomolecular computer with multiple commercially available restriction enzymes as hardware. Additionally, an algorithmic method for the construction of transition molecules in the DNA computer based on the use of multiple restriction enzymes is presented. We use this method to construct multistate, biomolecular, nondeterministic finite automata with four commercially available restriction enzymes as hardware. We also describe an experimental applicaton of this theoretical model to a biomolecular finite automaton made of four endonucleases.

  9. Type I restriction enzymes and their relatives.

    Science.gov (United States)

    Loenen, Wil A M; Dryden, David T F; Raleigh, Elisabeth A; Wilson, Geoffrey G

    2014-01-01

    Type I restriction enzymes (REases) are large pentameric proteins with separate restriction (R), methylation (M) and DNA sequence-recognition (S) subunits. They were the first REases to be discovered and purified, but unlike the enormously useful Type II REases, they have yet to find a place in the enzymatic toolbox of molecular biologists. Type I enzymes have been difficult to characterize, but this is changing as genome analysis reveals their genes, and methylome analysis reveals their recognition sequences. Several Type I REases have been studied in detail and what has been learned about them invites greater attention. In this article, we discuss aspects of the biochemistry, biology and regulation of Type I REases, and of the mechanisms that bacteriophages and plasmids have evolved to evade them. Type I REases have a remarkable ability to change sequence specificity by domain shuffling and rearrangements. We summarize the classic experiments and observations that led to this discovery, and we discuss how this ability depends on the modular organizations of the enzymes and of their S subunits. Finally, we describe examples of Type II restriction-modification systems that have features in common with Type I enzymes, with emphasis on the varied Type IIG enzymes.

  10. Polimorfismo no gene GH1-PstI associado a características corporais de linhagens de tilápia-do-nilo Polymorphism in the GH1-PstI gene associated to corporal characteristics in Nile tilapia strains

    Directory of Open Access Journals (Sweden)

    Danielly Veloso Blanck

    2009-06-01

    Full Text Available O objetivo deste trabalho foi determinar a associação de polimorfismos no gene do hormônio crescimento GH1 às características corporais, em linhagens de tilápia-do-nilo (Oreochromis niloticus. Foram coletados fragmentos da nadadeira caudal de exemplares das linhagens, aos cinco meses de idade, para as análises de "polymerase chain reaction-restriction fragment lenght polymorphism" (PCR-RFLP. Foram realizadas as seguintes mensurações: comprimento total, comprimento padrão, altura, largura e comprimento da cabeça. Realizou-se a amplificação de um fragmento com 652 pb do gene GH1, com subsequente restrição com a enzima PstI. Para a análise de associação do marcador molecular com as características quantitativas, utilizou-se o procedimento GLM do SAS. O polimorfismo descrito para o íntron 1, do gene GH1 da tilápia-do-nilo, apresentou correlação significativa com o comprimento total, comprimento padrão, altura e largura corporal. Foi verificado que o genótipo PstI+/- está associado ao melhor crescimento, independentemente da linhagem. A associação verificada pode ter ocorrido em razão do efeito direto da regulação do próprio gene GH.The objective of this study was to determine the association polymorphisms in growth hormone gene GH1 with the corporal characteristics in Nile tilapia (Oreochromis niloticus strains. Fragments of the caudal fin were collected from 5-month old fishes for analysis by polymerase chain reaction - restriction fragment length polymorphism (PCR-RFLP. The following measurements were accomplished: total length, standard length, height, width, and head length. A fragment with 652 bp of the GH1 gene was amplified with subsequent restriction with the enzyme PstI. For the analysis of the association of the molecular marker with the quantitative traits the SAS GLM procedure was used. The polymorphism described for the intron 1 of the GH1 gene of Nile tilapia had significant correlation with total length

  11. Engineered calcium-precipitable restriction enzyme.

    Science.gov (United States)

    Hendrix, Josephina; Read, Timothy; Lalonde, Jean-Francois; Jensen, Phillip K; Heymann, William; Lovelace, Elijah; Zimmermann, Sarah A; Brasino, Michael; Rokicki, Joseph; Dowell, Robin D

    2014-12-19

    We have developed a simple system for tagging and purifying proteins. Recent experiments have demonstrated that RTX (Repeat in Toxin) motifs from the adenylate cyclase toxin gene (CyaA) of B. pertussis undergo a conformational change upon binding calcium, resulting in precipitation of fused proteins and making this method a viable alternative for bioseparation. We have designed an iGEM Biobrick comprised of an RTX tag that can be easily fused to any protein of interest. In this paper, we detail the process of creating an RTX tagged version of the restriction enzyme EcoRI and describe a method for expression and purification of the functional enzyme.

  12. Analysis of restriction enzyme-induced DNA double-strand breaks in Chinese hamster ovary cells by pulsed-field gel electrophoresis: implications for chromosome damage.

    Science.gov (United States)

    Ager, D D; Phillips, J W; Columna, E A; Winegar, R A; Morgan, W F

    1991-11-01

    Restriction enzymes can be electroporated into mammalian cells, and the induced DNA double-strand breaks can lead to aberrations in metaphase chromosomes. Chinese hamster ovary cells were electroporated with PstI, which generates 3' cohesive-end breaks, PvuII, which generates blunt-end breaks, or XbaI, which generates 5' cohesive-end breaks. Although all three restriction enzymes induced similar numbers of aberrant metaphase cells, PvuII was dramatically more effective at inducing both exchange-type and deletion-type chromosome aberrations. Our cytogenetic studies also indicated that enzymes are active within cells for only a short time. We used pulsed-field gel electrophoresis to investigate (i) how long it takes for enzymes to cleave DNA after electroporation into cells, (ii) how long enzymes are active in the cells, and (iii) how the DNA double-strand breaks induced are related to the aberrations observed in metaphase chromosomes. At the same concentrations used in the cytogenetic studies, all enzymes were active within 10 min of electroporation. PstI and PvuII showed a distinct peak in break formation at 20 min, whereas XbaI showed a gradual increase in break frequency over time. Another increase in the number of breaks observed with all three enzymes at 2 and 3 h after electroporation was probably due to nonspecific DNA degradation in a subpopulation of enzyme-damaged cells that lysed after enzyme exposure. Break frequency and chromosome aberration frequency were inversely related: The blunt-end cutter PvuII gave rise to the most aberrations but the fewest breaks, suggesting that it is the type of break rather than the break frequency that is important for chromosome aberration formation.

  13. Programmable DNA-Guided Artificial Restriction Enzymes.

    Science.gov (United States)

    Enghiad, Behnam; Zhao, Huimin

    2017-05-19

    Restriction enzymes are essential tools for recombinant DNA technology that have revolutionized modern biological research. However, they have limited sequence specificity and availability. Here we report a Pyrococcus furiosus Argonaute (PfAgo) based platform for generating artificial restriction enzymes (AREs) capable of recognizing and cleaving DNA sequences at virtually any arbitrary site and generating defined sticky ends of varying length. Short DNA guides are used to direct PfAgo to target sites for cleavage at high temperatures (>87 °C) followed by reannealing of the cleaved single stranded DNAs. We used this platform to generate over 18 AREs for DNA fingerprinting and molecular cloning of PCR-amplified or genomic DNAs. These AREs work as efficiently as their naturally occurring counterparts, and some of them even do not have any naturally occurring counterparts, demonstrating easy programmability, generality, versatility, and high efficiency for this new technology.

  14. Restriction Enzymes in Microbiology, Biotechnology and Biochemistry

    Directory of Open Access Journals (Sweden)

    Geoffrey G. Wilson

    2012-12-01

    Full Text Available Since their discovery in the nineteen-seventies, a collection of simple enzymes termed Type II restriction endonucleases, made by microbes to ward off viral infections, have transformed molecular biology, spawned the multi-billion dollar Biotechnology industry, and yielded fundamental insights into the biochemistry of life, health and disease. In this article we describe how these enzymes were discovered, and we review their properties, organizations and genetics. We summarize current ideas about the mechanism underlying their remarkable ability to recognize and bind to specific base pair sequences in DNA, and we discuss why these ideas might not be correct. We conclude by proposing an alternative explanation for sequence-recognition that resolves certain inconsistencies and provides, in our view, a more satisfactory account of the mechanism.

  15. Mechanistic insights into type III restriction enzymes.

    Science.gov (United States)

    Raghavendra, Nidhanapati K; Bheemanaik, Shivakumara; Rao, Desirazu N

    2012-01-01

    Type III restriction-modification (R-M) enzymes need to interact with two separate unmethylated DNA sequences in indirectly repeated, head-to-head orientations for efficient cleavage to occur at a defined location next to only one of the two sites. However, cleavage of sites that are not in head-to-head orientation have been observed to occur under certain reaction conditions in vitro. ATP hydrolysis is required for the long-distance communication between the sites prior to cleavage. Type III R-M enzymes comprise two subunits, Res and Mod that form a homodimeric Mod2 and a heterotetrameric Res2Mod2 complex. The Mod subunit in M2 or R2M2 complex recognizes and methylates DNA while the Res subunit in R2M2 complex is responsible for ATP hydrolysis, DNA translocation and cleavage. A vast majority of biochemical studies on Type III R-M enzymes have been undertaken using two closely related enzymes, EcoP1I and EcoP15I. Divergent opinions about how the long-distance interaction between the recognition sites exist and at least three mechanistic models based on 1D- diffusion and/or 3D- DNA looping have been proposed.

  16. A User-Friendly Method for Teaching Restriction Enzyme Mapping.

    Science.gov (United States)

    Ehrman, Patrick

    1990-01-01

    Presented is a teaching progression that enhances learning through low-cost, manipulative transparencies. Discussed is instruction about restriction enzymes, plasmids, cutting plasmids, plasmid maps, recording data, and mapping restriction sites. Mapping wheels for student use is included. (CW)

  17. How restriction enzymes became the workhorses of molecular biology.

    Science.gov (United States)

    Roberts, Richard J

    2005-04-26

    Restriction enzymes have proved to be invaluable for the physical mapping of DNA. They offer unparalleled opportunities for diagnosing DNA sequence content and are used in fields as disparate as criminal forensics and basic research. In fact, without restriction enzymes, the biotechnology industry would certainly not have flourished as it has. The first experiments demonstrating the utility of restriction enzymes were carried out by Danna and Nathans and reported in 1971. This pioneering study set the stage for the modern practice of molecular biology in which restriction enzymes are ubiquitous tools, although they are often taken for granted.

  18. Type I restriction endonucleases are true catalytic enzymes.

    Science.gov (United States)

    Bianco, Piero R; Xu, Cuiling; Chi, Min

    2009-06-01

    Type I restriction endonucleases are intriguing, multifunctional complexes that restrict DNA randomly, at sites distant from the target sequence. Restriction at distant sites is facilitated by ATP hydrolysis-dependent, translocation of double-stranded DNA towards the stationary enzyme bound at the recognition sequence. Following restriction, the enzymes are thought to remain associated with the DNA at the target site, hydrolyzing copious amounts of ATP. As a result, for the past 35 years type I restriction endonucleases could only be loosely classified as enzymes since they functioned stoichiometrically relative to DNA. To further understand enzyme mechanism, a detailed analysis of DNA cleavage by the EcoR124I holoenzyme was done. We demonstrate for the first time that type I restriction endonucleases are not stoichiometric but are instead catalytic with respect to DNA. Further, the mechanism involves formation of a dimer of holoenzymes, with each monomer bound to a target sequence and, following cleavage, each dissociates in an intact form to bind and restrict subsequent DNA molecules. Therefore, type I restriction endonucleases, like their type II counterparts, are true enzymes. The conclusion that type I restriction enzymes are catalytic relative to DNA has important implications for the in vivo function of these previously enigmatic enzymes.

  19. The other face of restriction: modification-dependent enzymes.

    Science.gov (United States)

    Loenen, Wil A M; Raleigh, Elisabeth A

    2014-01-01

    The 1952 observation of host-induced non-hereditary variation in bacteriophages by Salvador Luria and Mary Human led to the discovery in the 1960s of modifying enzymes that glucosylate hydroxymethylcytosine in T-even phages and of genes encoding corresponding host activities that restrict non-glucosylated phage DNA: rglA and rglB (restricts glucoseless phage). In the 1980's, appreciation of the biological scope of these activities was dramatically expanded with the demonstration that plant and animal DNA was also sensitive to restriction in cloning experiments. The rgl genes were renamed mcrA and mcrBC (modified cytosine restriction). The new class of modification-dependent restriction enzymes was named Type IV, as distinct from the familiar modification-blocked Types I-III. A third Escherichia coli enzyme, mrr (modified DNA rejection and restriction) recognizes both methylcytosine and methyladenine. In recent years, the universe of modification-dependent enzymes has expanded greatly. Technical advances allow use of Type IV enzymes to study epigenetic mechanisms in mammals and plants. Type IV enzymes recognize modified DNA with low sequence selectivity and have emerged many times independently during evolution. Here, we review biochemical and structural data on these proteins, the resurgent interest in Type IV enzymes as tools for epigenetic research and the evolutionary pressures on these systems.

  20. Using shotgun sequence data to find active restriction enzyme genes

    Science.gov (United States)

    Zheng, Yu; Posfai, Janos; Morgan, Richard D.; Vincze, Tamas; Roberts, Richard J.

    2009-01-01

    Whole genome shotgun sequence analysis has become the standard method for beginning to determine a genome sequence. The preparation of the shotgun sequence clones is, in fact, a biological experiment. It determines which segments of the genome can be cloned into Escherichia coli and which cannot. By analyzing the complete set of sequences from such an experiment, it is possible to identify genes lethal to E. coli. Among this set are genes encoding restriction enzymes which, when active in E. coli, lead to cell death by cleaving the E. coli genome at the restriction enzyme recognition sites. By analyzing shotgun sequence data sets we show that this is a reliable method to detect active restriction enzyme genes in newly sequenced genomes, thereby facilitating functional annotation. Active restriction enzyme genes have been identified, and their activity demonstrated biochemically, in the sequenced genomes of Methanocaldococcus jannaschii, Bacillus cereus ATCC 10987 and Methylococcus capsulatus. PMID:18988632

  1. Revised selection criteria for candidate restriction enzymes in genome walking.

    Science.gov (United States)

    Taheri, Ali; Robinson, Stephen J; Parkin, Isobel; Gruber, Margaret Y

    2012-01-01

    A new method to improve the efficiency of flanking sequence identification by genome walking was developed based on an expanded, sequential list of criteria for selecting candidate enzymes, plus several other optimization steps. These criteria include: step (1) initially choosing the most appropriate restriction enzyme according to the average fragment size produced by each enzyme determined using in silico digestion of genomic DNA, step (2) evaluating the in silico frequency of fragment size distribution between individual chromosomes, step (3) selecting those enzymes that generate fragments with the majority between 100 bp and 3,000 bp, step (4) weighing the advantages and disadvantages of blunt-end sites vs. cohesive-end sites, step (5) elimination of methylation sensitive enzymes with methylation-insensitive isoschizomers, and step (6) elimination of enzymes with recognition sites within the binary vector sequence (T-DNA and plasmid backbone). Step (7) includes the selection of a second restriction enzyme with highest number of recognition sites within regions not covered by the first restriction enzyme. Step (8) considers primer and adapter sequence optimization, selecting the best adapter-primer pairs according to their hairpin/dimers and secondary structure. In step (9), the efficiency of genomic library development was improved by column-filtration of digested DNA to remove restriction enzyme and phosphatase enzyme, and most important, to remove small genomic fragments (enzymes, NsiI and NdeI, fit these criteria for the Arabidopsis thaliana genome. Their efficiency was assessed using 54 T(3) lines from an Arabidopsis SK enhancer population. Over 70% success rate was achieved in amplifying the flanking sequences of these lines. This strategy was also tested with Brachypodium distachyon to demonstrate its applicability to other larger genomes.

  2. Restriction enzyme body doubles and PCR cloning: on the general use of type IIs restriction enzymes for cloning.

    Science.gov (United States)

    Tóth, Eszter; Huszár, Krisztina; Bencsura, Petra; Kulcsár, Péter István; Vodicska, Barbara; Nyeste, Antal; Welker, Zsombor; Tóth, Szilvia; Welker, Ervin

    2014-01-01

    The procedure described here allows the cloning of PCR fragments containing a recognition site of the restriction endonuclease (Type IIP) used for cloning in the sequence of the insert. A Type IIS endonuclease--a Body Double of the Type IIP enzyme--is used to generate the same protruding palindrome. Thus, the insert can be cloned to the Type IIP site of the vector without digesting the PCR product with the same Type IIP enzyme. We achieve this by incorporating the recognition site of a Type IIS restriction enzyme that cleaves the DNA outside of its recognition site in the PCR primer in such a way that the cutting positions straddle the desired overhang sequence. Digestion of the PCR product by the Body Double generates the required overhang. Hitherto the use of Type IIS restriction enzymes in cloning reactions has only been used for special applications, the approach presented here makes Type IIS enzymes as useful as Type IIP enzymes for general cloning purposes. To assist in finding Body Double enzymes, we summarised the available Type IIS enzymes which are potentially useful for Body Double cloning and created an online program (http://group.szbk.u-szeged.hu/welkergr/body_double/index.html) for the selection of suitable Body Double enzymes and the design of the appropriate primers.

  3. SNP-RFLPing: restriction enzyme mining for SNPs in genomes

    Directory of Open Access Journals (Sweden)

    Cheng Yu-Huei

    2006-02-01

    Full Text Available Abstract Background The restriction fragment length polymorphism (RFLP is a common laboratory method for the genotyping of single nucleotide polymorphisms (SNPs. Here, we describe a web-based software, named SNP-RFLPing, which provides the restriction enzyme for RFLP assays on a batch of SNPs and genes from the human, rat, and mouse genomes. Results Three user-friendly inputs are included: 1 NCBI dbSNP "rs" or "ss" IDs; 2 NCBI Entrez gene ID and HUGO gene name; 3 any formats of SNP-in-sequence, are allowed to perform the SNP-RFLPing assay. These inputs are auto-programmed to SNP-containing sequences and their complementary sequences for the selection of restriction enzymes. All SNPs with available RFLP restriction enzymes of each input genes are provided even if many SNPs exist. The SNP-RFLPing analysis provides the SNP contig position, heterozygosity, function, protein residue, and amino acid position for cSNPs, as well as commercial and non-commercial restriction enzymes. Conclusion This web-based software solves the input format problems in similar softwares and greatly simplifies the procedure for providing the RFLP enzyme. Mixed free forms of input data are friendly to users who perform the SNP-RFLPing assay. SNP-RFLPing offers a time-saving application for association studies in personalized medicine and is freely available at http://bio.kuas.edu.tw/snp-rflp/.

  4. Cleavage and protection of locked nucleic acid-modified DNA by restriction endonucleases

    DEFF Research Database (Denmark)

    Crouzier, Lucile; Dubois, Camille; Wengel, Jesper

    2012-01-01

    Locked nucleic acid (LNA) is one of the most prominent nucleic acid analogues reported so far. We herein for the first time report cleavage by restriction endonuclease of LNA-modified DNA oligonucleotides. The experiments revealed that RsaI is an efficient enzyme capable of recognizing and cleaving...... LNA-modified DNA oligonucleotides. Furthermore, introduction of LNA nucleotides protects against cleavage by the restriction endonucleases PvuII, PstI, SacI, KpnI and EcoRI....

  5. Sequence specific inhibition of DNA restriction enzyme cleavage by PNA

    DEFF Research Database (Denmark)

    Nielsen, P.E.; Egholm, M.; Berg, R.H.

    1993-01-01

    Plasmids containing double-stranded 10-mer PNA (peptide nucleic acid chimera) targets proximally flanked by two restriction enzyme sites were challenged with the complementary PNA or PNAs having one or two mismatches, and the effect on the restriction enzyme cleavage of the flanking sites...... was assayed. The following PNAs were used: T10-LysNH2, T5CT4-LysNH2 and T2CT2CT4-LysNH2 and the corresponding targets cloned into pUC 19 were flanked by BamH1, Sal1 or Pstl sites, respectively. In all cases it was found that complete inhibition of restriction enzyme cleavage was obtained...

  6. REBASE--enzymes and genes for DNA restriction and modification.

    Science.gov (United States)

    Roberts, Richard J; Vincze, Tamas; Posfai, Janos; Macelis, Dana

    2007-01-01

    REBASE is a comprehensive database of information about restriction enzymes, DNA methyltransferases and related proteins involved in the biological process of restriction-modification. It contains fully referenced information about recognition and cleavage sites, isoschizomers, neoschizomers, commercial availability, methylation sensitivity, crystal and sequence data. Experimentally characterized homing endonucleases are also included. All newly sequenced genomes are analyzed for the presence of putative restriction systems and these data are included within the REBASE. The contents or REBASE may be browsed from the web (http://rebase.neb.com/rebase/rebase.ftp.html) and selected compilations can be downloaded by ftp (ftp.neb.com). Additionally, monthly updates can be requested via email.

  7. Distribution, abundance and properties of restriction enzymes On ...

    African Journals Online (AJOL)

    There is high demand for modified starch globally for both food and industrial uses because of its ability to. withstand processing conditions such as extreme temperature, diverse pH, high shear stress and freeze-thaw. variations. The study described the distribution, abundance and properties of restriction enzymes on ...

  8. distribution, abundance and properties of restriction enzymes on ...

    African Journals Online (AJOL)

    was to describe the distribution, abundance and properties of natural restriction enzymes that have cutting sites on cassava genomic DNA of granule-bound starch synthase I and II. MATERIALS AND METHODS. Location of the Study. The study was conducted at the Central. Biotechnology Laboratory, International. Institute ...

  9. Type III restriction-modification enzymes: a historical perspective.

    Science.gov (United States)

    Rao, Desirazu N; Dryden, David T F; Bheemanaik, Shivakumara

    2014-01-01

    Restriction endonucleases interact with DNA at specific sites leading to cleavage of DNA. Bacterial DNA is protected from restriction endonuclease cleavage by modifying the DNA using a DNA methyltransferase. Based on their molecular structure, sequence recognition, cleavage position and cofactor requirements, restriction-modification (R-M) systems are classified into four groups. Type III R-M enzymes need to interact with two separate unmethylated DNA sequences in inversely repeated head-to-head orientations for efficient cleavage to occur at a defined location (25-27 bp downstream of one of the recognition sites). Like the Type I R-M enzymes, Type III R-M enzymes possess a sequence-specific ATPase activity for DNA cleavage. ATP hydrolysis is required for the long-distance communication between the sites before cleavage. Different models, based on 1D diffusion and/or 3D-DNA looping, exist to explain how the long-distance interaction between the two recognition sites takes place. Type III R-M systems are found in most sequenced bacteria. Genome sequencing of many pathogenic bacteria also shows the presence of a number of phase-variable Type III R-M systems, which play a role in virulence. A growing number of these enzymes are being subjected to biochemical and genetic studies, which, when combined with ongoing structural analyses, promise to provide details for mechanisms of DNA recognition and catalysis.

  10. Cleavage of mispaired heteroduplex DNA substrates by numerous restriction enzymes.

    Science.gov (United States)

    Langhans, Mark T; Palladino, Michael J

    2009-01-01

    The utility of restriction endonucleases as a tool in molecular biology is in large part due to the high degree of specificity with which they cleave well-characterized DNA recognition sequences. The specificity of restriction endonucleases is not absolute, yet many commonly used assays of biological phenomena and contemporary molecular biology techniques rely on the premise that restriction enzymes will cleave only perfect cognate recognition sites. In vitro, mispaired heteroduplex DNAs are commonly formed, especially subsequent to polymerase chain reaction amplification. We investigated a panel of restriction endonucleases to determine their ability to cleave mispaired heteroduplex DNA substrates. Two straightforward, non-radioactive assays are used to evaluate mispaired heteroduplex DNA cleavage: a PCR amplification method and an oligonucleotide-based assay. These assays demonstrated that most restriction endonucleases are capable of site-specific double-strand cleavage with heteroduplex mispaired DNA substrates, however, certain mispaired substrates do effectively abrogate cleavage to undetectable levels. These data are consistent with mispaired substrate cleavage previously reported for Eco RI and, importantly, extend our knowledge of mispaired heteroduplex substrate cleavage to 13 additional enzymes.

  11. Endonuclease specificity and sequence dependence of type IIS restriction enzymes.

    Directory of Open Access Journals (Sweden)

    Sverker Lundin

    Full Text Available Restriction enzymes that recognize specific sequences but cleave unknown sequence outside the recognition site are extensively utilized tools in molecular biology. Despite this, systematic functional categorization of cleavage performance has largely been lacking. We established a simple and automatable model system to assay cleavage distance variation (termed slippage and the sequence dependence thereof. We coupled this to massively parallel sequencing in order to provide sensitive and accurate measurement. With this system 14 enzymes were assayed (AcuI, BbvI, BpmI, BpuEI, BseRI, BsgI, Eco57I, Eco57MI, EcoP15I, FauI, FokI, GsuI, MmeI and SmuI. We report significant variation of slippage ranging from 1-54%, variations in sequence context dependence, as well as variation between isoschizomers. We believe this largely overlooked property of enzymes with shifted cleavage would benefit from further large scale classification and engineering efforts seeking to improve performance. The gained insights of in-vitro performance may also aid the in-vivo understanding of these enzymes.

  12. Endonuclease specificity and sequence dependence of type IIS restriction enzymes.

    Science.gov (United States)

    Lundin, Sverker; Jemt, Anders; Terje-Hegge, Finn; Foam, Napoleon; Pettersson, Erik; Käller, Max; Wirta, Valtteri; Lexow, Preben; Lundeberg, Joakim

    2015-01-01

    Restriction enzymes that recognize specific sequences but cleave unknown sequence outside the recognition site are extensively utilized tools in molecular biology. Despite this, systematic functional categorization of cleavage performance has largely been lacking. We established a simple and automatable model system to assay cleavage distance variation (termed slippage) and the sequence dependence thereof. We coupled this to massively parallel sequencing in order to provide sensitive and accurate measurement. With this system 14 enzymes were assayed (AcuI, BbvI, BpmI, BpuEI, BseRI, BsgI, Eco57I, Eco57MI, EcoP15I, FauI, FokI, GsuI, MmeI and SmuI). We report significant variation of slippage ranging from 1-54%, variations in sequence context dependence, as well as variation between isoschizomers. We believe this largely overlooked property of enzymes with shifted cleavage would benefit from further large scale classification and engineering efforts seeking to improve performance. The gained insights of in-vitro performance may also aid the in-vivo understanding of these enzymes.

  13. Restriction enzyme analysis of plasmids from Haemophilus influenzae.

    Science.gov (United States)

    Harkess, N K; Murray, M L

    1978-05-01

    Examination of Haemophilus influenzae strains isolated in New Orleans revealed ampicillin-resistant strains with plasmids of size classes not previously detected in North America. The molecular weight of plasmids in five ampicillin-resistant strains ranged from 0.8 x 10(6) daltons (0.8 Mdal) to 36 Mdal. The molecular weights of the plasmids were determined by sucrose gradient centrifugation, electron microscopy, and agarose gel electrophoresis. Plasmids of the previously detected 30-Mdal size class were found in three of the five ampicillin-resistant strains. Restriction enzyme analysis is consistent with a close relationship between these three 30-Mdal plasmids. Of the two remaining ampicillin-resistant strains, one contained a single plasmid of 36 Mdal and the other contained two plasmids of 0.8 and 2.3 Mdal.

  14. UPDATING HIGH SCHOOL TEACHERS ON GEL ELETROPHORESIS AND RESTRICTION ENZYMES

    Directory of Open Access Journals (Sweden)

    V.S. Barbuto,

    2007-05-01

    Full Text Available The current evolution of the science and technology generated a demand in the teachers' formation that needs constant updating. In that sense, CBME has been elaborating courses and workshops to update teachers of Sciences and Biology involving current themes.  The activities on  Molecular  Biotechnology were elaborated, especially on restriction enzymes and gel electrophoresis.  Thirty-seven teachers of public schools participated in the activities. Firstly, it was made an experiment demonstrating the digestion of a plasmidial DNA by two restriction enzymes (DraI  and  EcoRI, with the subsequent application in gel, in order to elucidate the electrophoresis technique. After the demonstration, simple and practical exercises were distributed  to the teachers to simulate those processes using paper ribbons and charts,  being  concluded with an exercise of a paternity test. A questionnaire was applied as an evaluation tool and from the teachers' answers it was observed, among other data, that 100%  of the teachers classified the activities as interesting, 43% classified the thematic as actual, 22% defined it as appropriate to their school reality and 19% pointed it as a subject on which they have doubts. Also, it was observed that the teachers felt confident dealing with the most specific subjects, when relating it with the daily events and visualizing a possibility of didactic transposition of those themes.

  15. Detection of possible restriction sites for type II restriction enzymes in DNA sequences.

    Science.gov (United States)

    Gagniuc, P; Cimponeriu, D; Ionescu-Tîrgovişte, C; Mihai, Andrada; Stavarachi, Monica; Mihai, T; Gavrilă, L

    2011-01-01

    In order to make a step forward in the knowledge of the mechanism operating in complex polygenic disorders such as diabetes and obesity, this paper proposes a new algorithm (PRSD -possible restriction site detection) and its implementation in Applied Genetics software. This software can be used for in silico detection of potential (hidden) recognition sites for endonucleases and for nucleotide repeats identification. The recognition sites for endonucleases may result from hidden sequences through deletion or insertion of a specific number of nucleotides. Tests were conducted on DNA sequences downloaded from NCBI servers using specific recognition sites for common type II restriction enzymes introduced in the software database (n = 126). Each possible recognition site indicated by the PRSD algorithm implemented in Applied Genetics was checked and confirmed by NEBcutter V2.0 and Webcutter 2.0 software. In the sequence NG_008724.1 (which includes 63632 nucleotides) we found a high number of potential restriction sites for ECO R1 that may be produced by deletion (n = 43 sites) or insertion (n = 591 sites) of one nucleotide. The second module of Applied Genetics has been designed to find simple repeats sizes with a real future in understanding the role of SNPs (Single Nucleotide Polymorphisms) in the pathogenesis of the complex metabolic disorders. We have tested the presence of simple repetitive sequences in five DNA sequence. The software indicated exact position of each repeats detected in the tested sequences. Future development of Applied Genetics can provide an alternative for powerful tools used to search for restriction sites or repetitive sequences or to improve genotyping methods.

  16. The first discovery of RNA interference by RNA restriction enzymes to inhibit protein synthesis.

    Science.gov (United States)

    Inouye, Masayori

    2017-01-15

    In this article, I review how an RNA restriction enzyme, a highly sequence-specific endoribonuclease, was for the first time discovered in 2003 and how the concept of RNA interference using RNA restriction enzymes or mRNA interferases has been developed. Copyright © 2016 Elsevier B.V. All rights reserved.

  17. Updating rDNA restriction enzyme maps of Tetrahymena reveals four new intron-containing species

    DEFF Research Database (Denmark)

    Nielsen, Henrik; Simon, E M; Engberg, J

    1985-01-01

    The extrachromosomal rDNA molecules from a number of Tetrahymena strains were characterized by restriction enzyme mapping using three different restriction enzymes combined with gel blotting and hybridization analysis. Strains from four out of six recently described species were found to contain...

  18. Cleavage and protection of locked nucleic acid-modified DNA by restriction endonucleases.

    Science.gov (United States)

    Crouzier, Lucile; Dubois, Camille; Wengel, Jesper; Veedu, Rakesh N

    2012-07-15

    Locked nucleic acid (LNA) is one of the most prominent nucleic acid analogues reported so far. We herein for the first time report cleavage by restriction endonuclease of LNA-modified DNA oligonucleotides. The experiments revealed that RsaI is an efficient enzyme capable of recognizing and cleaving LNA-modified DNA oligonucleotides. Furthermore, introduction of LNA nucleotides protects against cleavage by the restriction endonucleases PvuII, PstI, SacI, KpnI and EcoRI. Copyright © 2012 Elsevier Ltd. All rights reserved.

  19. Determining if DNA Stained with a Cyanine Dye Can Be Digested with Restriction Enzymes.

    Science.gov (United States)

    Maschmann, April; Masters, Cody; Davison, Melissa; Lallman, Joshua; Thompson, Drew; Kounovsky-Shafer, Kristy L

    2018-02-02

    Visualization of DNA for fluorescence microscopy utilizes a variety of dyes such as cyanine dyes. These dyes are utilized due to their high affinity and sensitivity for DNA. In order to determine if the DNA molecules are full length after the completion of the experiment, a method is required to determine if the stained molecules are full length by digesting DNA with restriction enzymes. However, stained DNA may inhibit the enzymes, so a method is needed to determine what enzymes one could use for fluorochrome stained DNA. In this method, DNA is stained with a cyanine dye overnight to allow the dye and DNA to equilibrate. Next, stained DNA is digested with a restriction enzyme, loaded into a gel and electrophoresed. The experimental DNA digest bands are compared to an in silico digest to determine the restriction enzyme activity. If there is the same number of bands as expected, then the reaction is complete. More bands than expected indicate partial digestion and less bands indicate incomplete digestion. The advantage of this method is its simplicity and it uses equipment that a scientist would need for a restriction enzyme assay and gel electrophoresis. A limitation of this method is that the enzymes available to most scientists are commercially available enzymes; however, any restriction enzymes could be used.

  20. Determination of restriction enzyme activity when cutting DNA labeled with the TOTO dye family.

    Science.gov (United States)

    Maschmann, April; Kounovsky-Shafer, Kristy L

    2017-06-03

    Optical mapping, a single DNA molecule genome analysis platform that can determine methylation profiles, uses fluorescently labeled DNA molecules that are elongated on the surface and digested with a restriction enzyme to produce a barcode of that molecule. Understanding how the cyanine fluorochromes affect enzyme activity can lead to other fluorochromes used in the optical mapping system. The effects of restriction digestion on fluorochrome labeled DNA (Ethidium Bromide, DAPI, H33258, EthD-1, TOTO-1) have been analyzed previously. However, TOTO-1 is a part of a family of cyanine fluorochromes (YOYO-1, TOTO-1, BOBO-1, POPO-1, YOYO-3, TOTO-3, BOBO-3, and POPO-3) and the rest of the fluorochromes have not been examined in terms of their effects on restriction digestion. In order to determine if the other dyes in the TOTO-1 family inhibit restriction enzymes in the same way as TOTO-1, lambda DNA was stained with a dye from the TOTO family and digested. The restriction enzyme activity in regards to each dye, as well as each restriction enzyme, was compared to determine the extent of digestion. YOYO-1, TOTO-1, and POPO-1 fluorochromes inhibited ScaI-HF, PmlI, and EcoRI restriction enzymes. Additionally, the mobility of labeled DNA fragments in an agarose gel changed depending on which dye was intercalated.

  1. Structure and operation of the DNA-translocating type I DNA restriction enzymes

    OpenAIRE

    Kennaway, Christopher K.; Taylor, James E.; Song, Chun Feng; Potrzebowski, Wojciech; Nicholson, William; White, John H.; Swiderska, Anna; Obarska-Kosinska, Agnieszka; Callow, Philip; Cooper, Laurie P.; Roberts, Gareth A.; Artero, Jean-Baptiste; Bujnicki, Janusz M.; Trinick, John; Kneale, G. Geoff

    2012-01-01

    Type I DNA restriction/modification (RM) enzymes are molecular machines found in the majority of bacterial species. Their early discovery paved the way for the development of genetic engineering. They control (restrict) the influx of foreign DNA via horizontal gene transfer into the bacterium while maintaining sequence-specific methylation (modification) of host DNA. The endonuclease reaction of these enzymes on unmethylated DNA is preceded by bidirectional translocation of thousands of base ...

  2. Comparison of restriction enzymes for pulsed-field gel electrophoresis typing of Moraxella catarrhalis.

    Science.gov (United States)

    Marti, Sara; Puig, Carmen; Domenech, Arnau; Liñares, Josefina; Ardanuy, Carmen

    2013-07-01

    NotI, the most prevalent restriction enzyme used for typing Moraxella catarrhalis, failed to digest genomic DNA from respiratory samples. An improved pulsed-field gel electrophoresis (PFGE) methodology determined SpeI as the best choice for typing this bacterial species, with a good restriction of clinical samples and a good clustering correlation with NotI.

  3. msgbsR: An R package for analysing methylation-sensitive restriction enzyme sequencing data.

    Science.gov (United States)

    Mayne, Benjamin T; Leemaqz, Shalem Y; Buckberry, Sam; Rodriguez Lopez, Carlos M; Roberts, Claire T; Bianco-Miotto, Tina; Breen, James

    2018-02-01

    Genotyping-by-sequencing (GBS) or restriction-site associated DNA marker sequencing (RAD-seq) is a practical and cost-effective method for analysing large genomes from high diversity species. This method of sequencing, coupled with methylation-sensitive enzymes (often referred to as methylation-sensitive restriction enzyme sequencing or MRE-seq), is an effective tool to study DNA methylation in parts of the genome that are inaccessible in other sequencing techniques or are not annotated in microarray technologies. Current software tools do not fulfil all methylation-sensitive restriction sequencing assays for determining differences in DNA methylation between samples. To fill this computational need, we present msgbsR, an R package that contains tools for the analysis of methylation-sensitive restriction enzyme sequencing experiments. msgbsR can be used to identify and quantify read counts at methylated sites directly from alignment files (BAM files) and enables verification of restriction enzyme cut sites with the correct recognition sequence of the individual enzyme. In addition, msgbsR assesses DNA methylation based on read coverage, similar to RNA sequencing experiments, rather than methylation proportion and is a useful tool in analysing differential methylation on large populations. The package is fully documented and available freely online as a Bioconductor package ( https://bioconductor.org/packages/release/bioc/html/msgbsR.html ).

  4. Effect of early nutrient restriction on broiler chickens. 2. Performance and digestive enzyme activities.

    Science.gov (United States)

    Palo, P E; Sell, J L; Piquer, F J; Vilaseca, L; Soto-Salanova, M F

    1995-09-01

    An experiment was conducted to determine the effect of two early nutrient restriction programs on performance, selected characteristics of the gastrointestinal tract (GIT), and activities of digestive enzymes of broiler chickens. Three hundred and sixty male broiler (Ross x Ross) chicks kept in floor pens were assigned to three groups. The control group (C) was given ad libitum access to feed from 1 to 48 d of age. Another group was restricted from 11 to 14 d (R4) of age to an energy intake of .74 x BW.67 kcal ME/d, and a third group was restricted from 7 to 14 d (R7) of age to an energy intake of 1.5 x BW.67 kcal ME/d. Then, both restricted groups were given ad libitum access to feed through 48 d. Body weight and feed intake were determined weekly and selected carcass characteristics were measured at 48 d of age. Broilers also were sampled at 7, 14, 21, and 42 d of age to obtain data on components of the GIT (proventriculus, gizzard, pancreas, and small intestine) and activities of selected digestive enzymes. Feed-restricted groups were lighter in body weight (P body. Restricted groups had reduced (P organs and activities of digestive enzymes, suggesting a functional adaptation to feed restriction.

  5. Expression and purification of the modification-dependent restriction enzyme BisI and its homologous enzymes.

    Science.gov (United States)

    Xu, Shuang-Yong; Klein, Pernelle; Degtyarev, Sergey Kh; Roberts, Richard J

    2016-06-29

    The methylation-dependent restriction endonuclease (REase) BisI (G(m5)C ↓ NGC) is found in Bacillus subtilis T30. We expressed and purified the BisI endonuclease and 34 BisI homologs identified in bacterial genomes. 23 of these BisI homologs are active based on digestion of (m5)C-modified substrates. Two major specificities were found among these BisI family enzymes: Group I enzymes cut GCNGC containing two to four (m5)C in the two strands, or hemi-methylated sites containing two (m5)C in one strand; Group II enzymes only cut GCNGC sites containing three to four (m5)C, while one enzyme requires all four cytosines to be modified for cleavage. Another homolog, Esp638I cleaves GCS ↓ SGC (relaxed specificity RCN ↓ NGY, containing at least four (m5)C). Two BisI homologs show degenerate specificity cleaving unmodified DNA. Many homologs are small proteins ranging from 150 to 190 amino acid (aa) residues, but some homologs associated with mobile genetic elements are larger and contain an extra C-terminal domain. More than 156 BisI homologs are found in >60 bacterial genera, indicating that these enzymes are widespread in bacteria. They may play an important biological function in restricting pre-modified phage DNA.

  6. Structure and operation of the DNA-translocating type I DNA restriction enzymes.

    Science.gov (United States)

    Kennaway, Christopher K; Taylor, James E; Song, Chun Feng; Potrzebowski, Wojciech; Nicholson, William; White, John H; Swiderska, Anna; Obarska-Kosinska, Agnieszka; Callow, Philip; Cooper, Laurie P; Roberts, Gareth A; Artero, Jean-Baptiste; Bujnicki, Janusz M; Trinick, John; Kneale, G Geoff; Dryden, David T F

    2012-01-01

    Type I DNA restriction/modification (RM) enzymes are molecular machines found in the majority of bacterial species. Their early discovery paved the way for the development of genetic engineering. They control (restrict) the influx of foreign DNA via horizontal gene transfer into the bacterium while maintaining sequence-specific methylation (modification) of host DNA. The endonuclease reaction of these enzymes on unmethylated DNA is preceded by bidirectional translocation of thousands of base pairs of DNA toward the enzyme. We present the structures of two type I RM enzymes, EcoKI and EcoR124I, derived using electron microscopy (EM), small-angle scattering (neutron and X-ray), and detailed molecular modeling. DNA binding triggers a large contraction of the open form of the enzyme to a compact form. The path followed by DNA through the complexes is revealed by using a DNA mimic anti-restriction protein. The structures reveal an evolutionary link between type I RM enzymes and type II RM enzymes.

  7. Comparison of epidemic and endemic group G streptococci by restriction enzyme analysis.

    Science.gov (United States)

    Martin, N J; Kaplan, E L; Gerber, M A; Menegus, M A; Randolph, M; Bell, K; Cleary, P P

    1990-01-01

    Restriction enzyme profiles of group G beta-hemolytic streptococci associated with a point source outbreak and an outbreak of sporadic pharyngitis in two different communities were compared. To asses the epidemiologic utility of this approach for studying group G streptococci, DNA fingerprints of strains responsible for a point source outbreak of pharyngitis associated with the consumption of contaminated food were compared with DNA fingerprints of pharyngeal isolates from children with pharyngitis seen at a pediatric practice during a 6-month period. In each epidemiologic situation, a single strain characterized by a unique restriction enzyme pattern predominated. The results are compatible with the conclusion that human infections could be limited to a few strains of group G streptococci which have the capacity to spread through a given population. The restriction enzyme profiles proved to be a highly specific and precise means of evaluating strain relatedness and of providing further understanding of the epidemiology of group G streptococcal infections. Images PMID:2172291

  8. Highlights of the DNA cutters: a short history of the restriction enzymes.

    Science.gov (United States)

    Loenen, Wil A M; Dryden, David T F; Raleigh, Elisabeth A; Wilson, Geoffrey G; Murray, Noreen E

    2014-01-01

    In the early 1950's, 'host-controlled variation in bacterial viruses' was reported as a non-hereditary phenomenon: one cycle of viral growth on certain bacterial hosts affected the ability of progeny virus to grow on other hosts by either restricting or enlarging their host range. Unlike mutation, this change was reversible, and one cycle of growth in the previous host returned the virus to its original form. These simple observations heralded the discovery of the endonuclease and methyltransferase activities of what are now termed Type I, II, III and IV DNA restriction-modification systems. The Type II restriction enzymes (e.g. EcoRI) gave rise to recombinant DNA technology that has transformed molecular biology and medicine. This review traces the discovery of restriction enzymes and their continuing impact on molecular biology and medicine.

  9. Gene expression of regulatory enzymes involved in the intermediate metabolism of sheep subjected to feed restriction.

    Science.gov (United States)

    van Harten, S; Brito, R; Almeida, A M; Scanlon, T; Kilminster, T; Milton, J; Greeff, J; Oldham, C; Cardoso, L A

    2013-03-01

    The effect of feed restriction on gene expression of regulatory enzymes of intermediary metabolism was studied in two sheep breeds (Australian Merino and Dorper) subjected to two nutritional treatments: feed restriction (85% of daily maintenance requirements) and control (ad libitum feeding), during 42 days. The experimental animals (ram lambs) were divided into four groups, n = 5 (Australian Merino control (MC), Australian Merino Restriction (MR), Dorper control (DC) and Dorper Restriction (DR)). After the trial, animals were sacrificed and samples were taken from liver tissue to quantify glucose levels and gene expression of relevant intermediary metabolism enzymes (phosphofructokinase (PFK), pyruvate kinase (PK), phosphoenolpyruvate carboxykinase, fructose 1,6-bisphosphatase, glucose-6-phosphatase, glycogen synthase (GS), fatty acid synthase (FAS), glutamate dehydrogenase (GDH) and carbamoyl phosphate synthase (CPS)) through real-time PCR. During the experimental period, the MR animals lost 12.6% in BW compared with 5.3% lost by the Dorper lambs. MC and DC rams gained, respectively, 8.8% and 14% during the same period. Within the Dorper breed, restricted feed animals revealed a significant decrease over controls in the transcription of PFK (1.95-fold) and PK (2.26-fold), both glycolytic enzymes. The gluconeogenesis showed no change in the feed restricted animals of both breeds. DR feed group presented a significant decrease over the homologous Merino sheep group on GS. In both experimental breeds, FAS mRNA expression was decreased in restricted feed groups. GDH expression was decreased only in the DR animals (1.84-fold) indicating a reduced catabolism of amino acids in these animals. Finally, CPS was significantly (P enzymes and hepatic glucose production of Dorper sheep to feed restriction concurring with the BW results in the experimental groups.

  10. Recombinant plasmids for encoding restriction enzymes DpnI and DpnII of streptococcus pneumontae

    Science.gov (United States)

    Lacks, Sanford A.

    1990-01-01

    Chromosomal DNA cassettes containing genes encoding either the DpnI or DpnII restriction endonucleases from Streptococcus pneumoniae are cloned into a streptococcal vector, pLS101. Large amounts of the restriction enzymes are produced by cells containing the multicopy plasmids, pLS202 and pLS207, and their derivatives pLS201, pLS211, pLS217, pLS251 and pLS252.

  11. Recombinant plasmids for encoding restriction enzymes DpnI and DpnII of Streptococcus pneumontae

    Science.gov (United States)

    Lacks, S.A.

    1990-10-02

    Chromosomal DNA cassettes containing genes encoding either the DpnI or DpnII restriction endonucleases from Streptococcus pneumoniae are cloned into a streptococcal vector, pLS101. Large amounts of the restriction enzymes are produced by cells containing the multicopy plasmids, pLS202 and pLS207, and their derivatives pLS201, pLS211, pLS217, pLS251 and pLS252. 9 figs.

  12. Site accessibility tailors DNA cleavage by restriction enzymes in DNA confined monolayers.

    Science.gov (United States)

    Rotella, Chiara; Doni, Giovanni; Bosco, Alessandro; Castronovo, Matteo; De Vita, Alessandro; Casalis, Loredana; Pavan, Giovanni M; Parisse, Pietro

    2017-05-18

    Density-tunable nanografted monolayers (NAMs) of short oligonucleotide sequences on gold surfaces show novel properties that make them suitable for advanced biosensing applications, and in particular to study the effects of crowding and confinement on biomolecular interactions. Here, combining atomic force microscopy nanolithography, topography measurements and coarse-grained molecular dynamics simulations, we investigated restriction enzyme reaction mechanisms within confined DNA brushes highlighting the role played by the DNA sequence conformation and restriction site position along the chain, respectively, in determining the accessibility of the enzyme, and its consequent cleavage efficiency.

  13. A new multiplexing single molecule technique for measuring restriction enzyme activity

    Science.gov (United States)

    Harbottle, Allison; Cavanaugh, Jillian; Gordon, Wendy; Loparo, Joseph; Price, Allen

    2012-02-01

    We present a new multiplexing single molecule method for observing the cleavage of DNAs by restriction enzymes. DNAs are attached to a surface at one end using a biotin-streptavidin link and to a micro bead at the other end via a digoxigenin-antidigoxigenin link. The DNAs are stretched by applying a flow. After introduction of the restriction enzyme, the exact time of cleavage of individual DNAs is recorded with video microscopy. We can image hundreds to thousands of DNAs in a single experiment. We are using our technique to search for the signature of facilitated diffusion in the measured rate dependence on ionic strength.

  14. Simple and rapid human papillomavirus genotyping method by restriction fragment length polymorphism analysis with two restriction enzymes.

    Science.gov (United States)

    Chen, Linghan; Watanabe, Ken; Haruyama, Takahiro; Kobayashi, Nobuyuki

    2013-07-01

    Cervical cancer, the third most common cancer that affects women worldwide, is caused by the human papillomavirus (HPV) and is treatable when detected at an early stage. To date, more than 100 different HPV types have been described, and the development of simple, low-cost, and accurate methods to distinguish HPV genotypes is highly warranted. In this study, an HPV genotyping assay based on polymerase chain reaction (PCR) was evaluated. This method involved the use of MY09/11 primers followed by restriction fragment length polymorphism (RFLP) analysis with the restriction enzymes HpyCH4V and NlaIII. Cervical specimens preserved using CytoRich Blue fluid were collected from 1,134 female volunteers for HPV detection, and 1,111 valid samples were amplified using PCR. The PCR method was sensitive enough to detect 25 copies of HPV18, and three copies of HPV16. Out of 202 PCR-positive samples, HPV genotypes were determined in 189 samples (93.6%) by this RFLP method. Results were then evaluated further by capillary sequencing method. Concordant results between the two tests were as high as 96.0%. Thirteen samples, which tested negative with RFLP, were verified as non-specific amplifications with PCR. In conclusion, this PCR-RFLP method using restriction enzymes HpyCH4V and NlaIII is simple, non-labor intensive, and is applicable for the inexpensive determination of HPV genotypes in clinical samples. Copyright © 2013 Wiley Periodicals, Inc.

  15. Correspondence between radioactive and functional methods in the quality control of DNA restriction and modifying enzymes

    DEFF Research Database (Denmark)

    Trujillo, L E; Pupo, E; Miranda, F

    1996-01-01

    We evaluated the use of two radiolabeled lambda DNA/Hpa II substrates to detect 5'-->3', 3'-->5' single and double stranded DNA dependent exonuclease and phosphatase activities found as contaminants in restriction and modifying enzyme preparations. Looking for the meaning of the radioactive assay...

  16. The interaction of the Eco R1 restriction enzyme E.coli with nucleotides

    Energy Technology Data Exchange (ETDEWEB)

    Hollis, Donald F. [Univ. of California, Berkeley, CA (United States)

    1979-11-01

    The Eco R1 restriction enzyme can be shown to be inhibited by nucleotides which correspond to any part of its known site of phosphodiesterase activity. A series of di-, tetra-, and hexa-nucleotide fragments were synthesized and their effect on the activity of the enzyme upon superhelical Co1 E1 DNA studied. The inhibition caused by the individual mononucleotides were also studied. In general all the nucleotide fragments showed some form of interaction with the enzyme system. Tetranucleotides were stronger inhibitors than dinucleotides, which in turn were stronger inhibitors than the mononucleotides. Within each category of inhibitors, those containing the phosphodiester bond which is acted upon by the enzyme were the strongest inhibitors. Only those fragments which were consistent with the enzymes site of activity showed competitive inhibition kinetics. Nucleotides which do not fit within the site of phosphodiesterase activity show non-competitive inhibition kinetics.

  17. Time-resolved fluorescence studies of nucleotide flipping by restriction enzymes.

    Science.gov (United States)

    Neely, Robert K; Tamulaitis, Gintautas; Chen, Kai; Kubala, Marta; Siksnys, Virginijus; Jones, Anita C

    2009-11-01

    Restriction enzymes Ecl18kI, PspGI and EcoRII-C, specific for interrupted 5-bp target sequences, flip the central base pair of these sequences into their protein pockets to facilitate sequence recognition and adjust the DNA cleavage pattern. We have used time-resolved fluorescence spectroscopy of 2-aminopurine-labelled DNA in complex with each of these enzymes in solution to explore the nucleotide flipping mechanism and to obtain a detailed picture of the molecular environment of the extrahelical bases. We also report the first study of the 7-bp cutter, PfoI, whose recognition sequence (T/CCNGGA) overlaps with that of the Ecl18kI-type enzymes, and for which the crystal structure is unknown. The time-resolved fluorescence experiments reveal that PfoI also uses base flipping as part of its DNA recognition mechanism and that the extrahelical bases are captured by PfoI in binding pockets whose structures are quite different to those of the structurally characterized enzymes Ecl18kI, PspGI and EcoRII-C. The fluorescence decay parameters of all the enzyme-DNA complexes are interpreted to provide insight into the mechanisms used by these four restriction enzymes to flip and recognize bases and the relationship between nucleotide flipping and DNA cleavage.

  18. Structural insights into DNA sequence recognition by Type ISP restriction-modification enzymes.

    Science.gov (United States)

    Kulkarni, Manasi; Nirwan, Neha; van Aelst, Kara; Szczelkun, Mark D; Saikrishnan, Kayarat

    2016-05-19

    Engineering restriction enzymes with new sequence specificity has been an unaccomplished challenge, presumably because of the complexity of target recognition. Here we report detailed analyses of target recognition by Type ISP restriction-modification enzymes. We determined the structure of the Type ISP enzyme LlaGI bound to its target and compared it with the previously reported structure of a close homologue that binds to a distinct target, LlaBIII. The comparison revealed that, although the two enzymes use almost a similar set of structural elements for target recognition, the residues that read the bases vary. Change in specificity resulted not only from appropriate substitution of amino acids that contacted the bases but also from new contacts made by positionally distinct residues directly or through a water bridge. Sequence analyses of 552 Type ISP enzymes showed that the structural elements involved in target recognition of LlaGI and LlaBIII were structurally well-conserved but sequentially less-conserved. In addition, the residue positions within these structural elements were under strong evolutionary constraint, highlighting the functional importance of these regions. The comparative study helped decipher a partial consensus code for target recognition by Type ISP enzymes. © The Author(s) 2016. Published by Oxford University Press on behalf of Nucleic Acids Research.

  19. Real-time observation of DNA looping dynamics of type IIE restriction enzymes NaeI and NarI

    NARCIS (Netherlands)

    van den Broek, B.; Vanzi, F.; Normanno, D.; Pavone, F. S.; Wuite, G.J.L.

    2006-01-01

    Many restriction enzymes require binding of two copies of a recognition sequence for DNA cleavage, thereby introducing a loop in the DNA. We investigated looping dynamics of Type IIE restriction enzymes NaeI and NarI by tracking the Brownian motion of single tethered DNA molecules. DNA containing

  20. Restriction fragment length polymorphism of rRNA genes for molecular typing of members of the family Legionellaceae

    DEFF Research Database (Denmark)

    Bangsborg, J M; Gerner-Smidt, P; Colding, H

    1995-01-01

    with four restriction enzymes (HindIII, NciI, ClaI, and PstI). Fifty-eight clinical and environmental L. pneumophila strains including geographically unrelated as well as epidemiologically connected isolates were investigated. Epidemiologically related strains had the same ribotypes independent...... of the combinations of enzymes used. Some strains belonging to the same serogroup were assigned to different ribotypes, and some ribotypes contained members of different serogroups, indicating, as others have found, that serogroup and genotype are not always related. The discriminatory power of the method...... was estimated by calculating an index of discrimination (ID) for individual enzymes and combinations thereof. The combined result with all four enzymes was highly discriminatory (ID = 0.97), but results for three enzymes also yielded ID values acceptable for epidemiological purposes. In addition, the testing...

  1. Polyphosphate present in DNA preparations from fungal species of Collectotrichum inhibits restriction endonucleases and other enzymes

    Science.gov (United States)

    Rodriguez, R.J.

    1993-01-01

    During the development of a procedure for the isolation of total genomic DNA from filamentous fungi (Rodriguez, R. J., and Yoder, 0. C., Exp. Mycol. 15, 232-242, 1991) a cell fraction was isolated which inhibited the digestion of DNA by restriction enzymes. After elimination of DNA, RNA, proteins, and lipids, the active compound was purified by gel filtration to yield a single fraction capable of complete inhibition of restriction enzyme activity. The inhibitor did not absorb uv light above 220 nm, and was resistant to alkali and acid at 25°C and to temperatures as high as 100°C. More extensive analyses demonstrated that the inhibitor was also capable of inhibiting T4 DNA ligase and TaqI DNA polymerase, but not DNase or RNase. Chemical analyses indicated that the inhibitor was devoid of carbohydrates, proteins, lipids, and nucleic acids but rich in phosphorus. A combination of nuclear magnetic resonance, metachromatic shift of toluidine blue, and gel filtration indicated that the inhibitor was a polyphosphate (polyP) containing approximately 60 phosphate molecules. The mechanism of inhibition appeared to involve complexing of polyP to the enzymatic proteins. All species of Colletotrichum analyzed produced polyP equivalent in chain length and concentration. A modification to the original DNA extraction procedure is described which eliminates polyP and reduces the time necessary to obtain DNA of sufficient purity for restriction enzyme digestion and TaqI polymerase amplification.

  2. Genome modifications in plant cells by custom-made restriction enzymes.

    Science.gov (United States)

    Tzfira, Tzvi; Weinthal, Dan; Marton, Ira; Zeevi, Vardit; Zuker, Amir; Vainstein, Alexander

    2012-05-01

    Genome editing, i.e. the ability to mutagenize, insert, delete and replace sequences, in living cells is a powerful and highly desirable method that could potentially revolutionize plant basic research and applied biotechnology. Indeed, various research groups from academia and industry are in a race to devise methods and develop tools that will enable not only site-specific mutagenesis but also controlled foreign DNA integration and replacement of native and transgene sequences by foreign DNA, in living plant cells. In recent years, much of the progress seen in gene targeting in plant cells has been attributed to the development of zinc finger nucleases and other novel restriction enzymes for use as molecular DNA scissors. The induction of double-strand breaks at specific genomic locations by zinc finger nucleases and other novel restriction enzymes results in a wide variety of genetic changes, which range from gene addition to the replacement, deletion and site-specific mutagenesis of endogenous and heterologous genes in living plant cells. In this review, we discuss the principles and tools for restriction enzyme-mediated gene targeting in plant cells, as well as their current and prospective use for gene targeting in model and crop plants. © 2012 The Authors. Plant Biotechnology Journal © 2012 Society for Experimental Biology, Association of Applied Biologists and Blackwell Publishing Ltd.

  3. From Agrobacterium to viral vectors: genome modification of plant cells by rare cutting restriction enzymes.

    Science.gov (United States)

    Marton, Ira; Honig, Arik; Omid, Ayelet; De Costa, Noam; Marhevka, Elena; Cohen, Barry; Zuker, Amir; Vainstein, Alexander

    2013-01-01

    Researchers and biotechnologists require methods to accurately modify the genome of higher eukaryotic cells. Such modifications include, but are not limited to, site-specific mutagenesis, site-specific insertion of foreign DNA, and replacement and deletion of native sequences. Accurate genome modifications in plant species have been rather limited, with only a handful of plant species and genes being modified through the use of early genome-editing techniques. The development of rare-cutting restriction enzymes as a tool for the induction of site-specific genomic double-strand breaks and their introduction as a reliable tool for genome modification in animals, animal cells and human cell lines have paved the way for the adaptation of rare-cutting restriction enzymes to genome editing in plant cells. Indeed, the number of plant species and genes which have been successfully edited using zinc finger nucleases (ZFNs), transcription activator-like effector nucleases (TALENs) and engineered homing endonucleases is on the rise. In our review, we discuss the basics of rare-cutting restriction enzyme-mediated genome-editing technology with an emphasis on its application in plant species.

  4. Preliminary neutron scattering studies of the Type I restriction-modification enzyme M.Ahdl

    Energy Technology Data Exchange (ETDEWEB)

    Callow, Philip [Deuteration Laboratory, ILL, Grenoble, France/Keele University (United Kingdom)]. E-mail: callow@ill.fr; Timmins, Peter [Large Scale Structures Group, ILL, Grenoble (France); Kneale, Geoff [Biophysics Laboratories, Portsmouth University (United Kingdom)

    2006-11-15

    Type I restriction-modification (R-M) systems encode multisubunit/multidomain enzymes. Two genes (M and S) are required to form the 160 kDa methyltransferase that methylates a specific base within the recognition sequence and protects DNA from cleavage by the endonuclease. Small angle neutron scattering (SANS) revealed an unusually large structural change in the EcoR124I methyltransferase following DNA binding; this involves a major repositioning of the subunits of the enzyme, resulting in a 60 A reduction in the dimensions of the enzyme on forming a complex with DNA. The related methyltransferase M.Ahdl, with stoichiometry M{sub 2}S{sub 2} has been prepared in two protonated/deuterated states (S and M subunits protonated, S deuterated and M protonated) for which SANS data have been collected in a number of H:D solvent contrasts. The contrast match point of the selectively deuterated enzyme confirms the successful reconstitution of the enzyme with deuterated S subunits. Ab initio shape determination using this contrast matched data is in progress to determine the subunit organization of M.Ahdl and the large change in structure that occurs on DNA binding.

  5. Overcoming Intrinsic Restriction Enzyme Barriers Enhances Transformation Efficiency in Arthrospira platensis C1.

    Science.gov (United States)

    Jeamton, Wattana; Dulsawat, Sudarat; Tanticharoen, Morakot; Vonshak, Avigad; Cheevadhanarak, Supapon

    2017-04-01

    The development of a reliable genetic transformation system for Arthrospira platensis has been a long-term goal, mainly for those trying either to improve its performance in large-scale cultivation systems or to enhance its value as food and feed additives. However, so far, most of the attempts to develop such a transformation system have had limited success. In this study, an efficient and stable transformation system for A. platensis C1 was successfully developed. Based on electroporation and transposon techniques, exogenous DNA could be transferred to and stably maintained in the A. platensis C1 genome. Most strains of Arthrospira possess strong restriction barriers, hampering the development of a gene transfer system for this group of cyanobacteria. By using a type I restriction inhibitor and liposomes to protect the DNA from nuclease digestion, the transformation efficiency was significantly improved. The transformants were able to grow on a selective medium for more than eight passages, and the transformed DNA could be detected from the stable transformants. We propose that the intrinsic endonuclease enzymes, particularly the type I restriction enzyme, in A. platensis C1 play an important role in the transformation efficiency of this industrial important cyanobacterium. © The Author 2017. Published by Oxford University Press on behalf of Japanese Society of Plant Physiologists. All rights reserved. For permissions, please email: journals.permissions@oup.com.

  6. REBASE--a database for DNA restriction and modification: enzymes, genes and genomes.

    Science.gov (United States)

    Roberts, Richard J; Vincze, Tamas; Posfai, Janos; Macelis, Dana

    2015-01-01

    REBASE is a comprehensive and fully curated database of information about the components of restriction-modification (RM) systems. It contains fully referenced information about recognition and cleavage sites for both restriction enzymes and methyltransferases as well as commercial availability, methylation sensitivity, crystal and sequence data. All genomes that are completely sequenced are analyzed for RM system components, and with the advent of PacBio sequencing, the recognition sequences of DNA methyltransferases (MTases) are appearing rapidly. Thus, Type I and Type III systems can now be characterized in terms of recognition specificity merely by DNA sequencing. The contents of REBASE may be browsed from the web http://rebase.neb.com and selected compilations can be downloaded by FTP (ftp.neb.com). Monthly updates are also available via email. © The Author(s) 2014. Published by Oxford University Press on behalf of Nucleic Acids Research.

  7. Increasing Genome Sampling and Improving SNP Genotyping for Genotyping-by-Sequencing with New Combinations of Restriction Enzymes

    National Research Council Canada - National Science Library

    Fu, Yong-Bi; Peterson, Gregory W; Dong, Yibo

    2016-01-01

    .... Here we present software called IgCoverage for in silico evaluation of genomic coverage through GBS with an individual or pair of restriction enzymes on one sequenced genome, and report a new set...

  8. Electrochemical biosensor modified with dsDNA monolayer for restriction enzyme activity determination.

    Science.gov (United States)

    Zajda, Joanna; Górski, Łukasz; Malinowska, Elżbieta

    2016-06-01

    A simple and cost effective method for the determination of restriction endonuclease activity is presented. dsDNA immobilized at a gold electrode surface is used as the enzymatic substrate, and an external cationic redox probe is employed in voltammetric measurements for analytical signal generation. The assessment of enzyme activity is based on a decrease of a current signal derived from reduction of methylene blue which is present in the sample solution. For this reason, the covalent attachment of the label molecule is not required which significantly reduces costs of the analysis and simplifies the entire determination procedure. The influence of buffer components on utilized dsDNA/MCH monolayer stability and integrity is also verified. Electrochemical impedance spectroscopy measurements reveal that due to pinhole formation during enzyme activity measurement the presence of any surfactants should be avoided. Additionally, it is shown that the sensitivity of the electrochemical biosensor can be tuned by changing the restriction site location along the DNA length. Under optimal conditions the proposed biosensor exhibits a linear response toward PvuII activity within a range from 0.25 to 1.50 U/μL. Copyright © 2016 Elsevier B.V. All rights reserved.

  9. Maternal protein restriction affects gene expression and enzyme activity of intestinal disaccharidases in adult rat offspring

    Energy Technology Data Exchange (ETDEWEB)

    Pinheiro, D.F.; Pacheco, P.D.G.; Alvarenga, P.V.; Buratini, J. Jr; Castilho, A.C.S.; Lima, P.F.; Sartori, D.R.S.; Vicentini-Paulino, M.L.M. [Departamento de Fisiologia, Instituto de Biociências, Universidade Estadual Paulista, Botucatu, SP (Brazil)

    2013-03-15

    This study investigated the consequences of intrauterine protein restriction on the gastrointestinal tract and particularly on the gene expression and activity of intestinal disaccharidases in the adult offspring. Wistar rat dams were fed isocaloric diets containing 6% protein (restricted, n = 8) or 17% protein (control, n = 8) throughout gestation. Male offspring (n = 5-8 in each group) were evaluated at 3 or 16 weeks of age. Maternal protein restriction during pregnancy produced offspring with growth restriction from birth (5.7 ± 0.1 vs 6.3 ± 0.1 g; mean ± SE) to weaning (42.4 ± 1.3 vs 49.1 ± 1.6 g), although at 16 weeks of age their body weight was similar to control (421.7 ± 8.9 and 428.5 ± 8.5 g). Maternal protein restriction also increased lactase activity in the proximal (0.23 ± 0.02 vs 0.15 ± 0.02), medial (0.30 ± 0.06 vs 0.14 ± 0.01) and distal (0.43 ± 0.07 vs 0.07 ± 0.02 U·g{sup -1}·min{sup -1}) small intestine, and mRNA lactase abundance in the proximal intestine (7.96 ± 1.11 vs 2.38 ± 0.47 relative units) of 3-week-old offspring rats. In addition, maternal protein restriction increased sucrase activity (1.20 ± 0.02 vs 0.91 ± 0.02 U·g{sup -1}·min{sup -1}) and sucrase mRNA abundance (4.48 ± 0.51 vs 1.95 ± 0.17 relative units) in the duodenum of 16-week-old rats. In conclusion, the present study shows for the first time that intrauterine protein restriction affects gene expression of intestinal enzymes in offspring.

  10. Golden gate shuffling: a one-pot DNA shuffling method based on type IIs restriction enzymes.

    Directory of Open Access Journals (Sweden)

    Carola Engler

    Full Text Available We have developed a protocol to assemble in one step and one tube at least nine separate DNA fragments together into an acceptor vector, with 90% of recombinant clones obtained containing the desired construct. This protocol is based on the use of type IIs restriction enzymes and is performed by simply subjecting a mix of 10 undigested input plasmids (nine insert plasmids and the acceptor vector to a restriction-ligation and transforming the resulting mix in competent cells. The efficiency of this protocol allows generating libraries of recombinant genes by combining in one reaction several fragment sets prepared from different parental templates. As an example, we have applied this strategy for shuffling of trypsinogen from three parental templates (bovine cationic trypsinogen, bovine anionic trypsinogen and human cationic trypsinogen each divided in 9 separate modules. We show that one round of shuffling using the 27 trypsinogen entry plasmids can easily produce the 19,683 different possible combinations in one single restriction-ligation and that expression screening of a subset of the library allows identification of variants that can lead to higher expression levels of trypsin activity. This protocol, that we call 'Golden Gate shuffling', is robust, simple and efficient, can be performed with templates that have no homology, and can be combined with other shuffling protocols in order to introduce any variation in any part of a given gene.

  11. Recycling of protein subunits during DNA translocation and cleavage by Type I restriction-modification enzymes.

    Science.gov (United States)

    Simons, Michelle; Szczelkun, Mark D

    2011-09-01

    The Type I restriction-modification enzymes comprise three protein subunits; HsdS and HsdM that form a methyltransferase (MTase) and HsdR that associates with the MTase and catalyses Adenosine-5'-triphosphate (ATP)-dependent DNA translocation and cleavage. Here, we examine whether the MTase and HsdR components can 'turnover' in vitro, i.e. whether they can catalyse translocation and cleavage events on one DNA molecule, dissociate and then re-bind a second DNA molecule. Translocation termination by both EcoKI and EcoR124I leads to HsdR dissociation from linear DNA but not from circular DNA. Following DNA cleavage, the HsdR subunits appear unable to dissociate even though the DNA is linear, suggesting a tight interaction with the cleaved product. The MTases of EcoKI and EcoAI can dissociate from DNA following either translocation or cleavage and can initiate reactions on new DNA molecules as long as free HsdR molecules are available. In contrast, the MTase of EcoR124I does not turnover and additional cleavage of circular DNA is not observed by inclusion of RecBCD, a helicase-nuclease that degrades the linear DNA product resulting from Type I cleavage. Roles for Type I restriction endonuclease subunit dynamics in restriction alleviation in the cell are discussed.

  12. Translocation-coupled DNA cleavage by the Type ISP restriction-modification enzymes.

    Science.gov (United States)

    Chand, Mahesh K; Nirwan, Neha; Diffin, Fiona M; van Aelst, Kara; Kulkarni, Manasi; Pernstich, Christian; Szczelkun, Mark D; Saikrishnan, Kayarat

    2015-11-01

    Production of endonucleolytic double-strand DNA breaks requires separate strand cleavage events. Although catalytic mechanisms for simple, dimeric endonucleases are known, there are many complex nuclease machines that are poorly understood. Here we studied the single polypeptide Type ISP restriction-modification (RM) enzymes, which cleave random DNA between distant target sites when two enzymes collide after convergent ATP-driven translocation. We report the 2.7-Å resolution X-ray crystal structure of a Type ISP enzyme-DNA complex, revealing that both the helicase-like ATPase and nuclease are located upstream of the direction of translocation, an observation inconsistent with simple nuclease-domain dimerization. Using single-molecule and biochemical techniques, we demonstrate that each ATPase remodels its DNA-protein complex and translocates along DNA without looping it, leading to a collision complex in which the nuclease domains are distal. Sequencing of the products of single cleavage events suggests a previously undescribed endonuclease model, where multiple, stochastic strand-nicking events combine to produce DNA scission.

  13. Krebs cycle enzymes from livers of old mice are differentially regulated by caloric restriction.

    Science.gov (United States)

    Hagopian, Kevork; Ramsey, Jon J; Weindruch, Richard

    2004-08-01

    Krebs cycle enzyme activities and levels of five metabolites were determined from livers of old mice (30 months) maintained either on control or on long-term caloric restriction (CR) diets (28 months). In CR mice, the cycle was divided into two major blocks, the first containing citrate synthase, aconitase and NAD-dependent isocitrate dehydrogenase which showed decreased activities, while the second block, containing the remaining enzymes, displayed increased activity (except for fumarase, which was unchanged). CR also resulted in decreased levels of citrate, glutamate and alpha-ketoglutarate, increased levels of malate, and unchanged levels of aspartate. The alpha-ketoglutarate/glutamate and malate/alpha-ketoglutarate ratios were higher in CR, in parallel with previously reported increases with CR in pyruvate carboxylase activity and glucagon levels, respectively. The results indicate that long-term CR induces a differential regulation of Krebs cycle in old mice and this regulation may be the result of changes in gene expression levels, as well as a complex interplay between enzymes, hormones and other effectors. Truncation of Krebs cycle by CR may be an important adaptation to utilize available substrates for the gluconeogenesis necessary to sustain glycolytic tissues, such as brain.

  14. Genome Filtering Using Methylation- Sensitive Restriction Enzymes with Six Base Pair Recognition Sites

    Directory of Open Access Journals (Sweden)

    John P. Fellers

    2008-11-01

    Full Text Available The large fraction of repetitive DNA in many plant genomes has complicated all aspects of DNA sequencing and assembly, and thus techniques that enrich for genes and low-copy sequences have been employed to isolate gene space. Methyl-sensitive restriction enzymes, with six base pair recognition sites, were evaluated on genomic DNA of the bread wheat ‘Chinese Spring’ as a different approach to enrich for genes. I, I, I, and II were used to digest wheat genomic DNA and fragments ranging from 400 bp to 2.0 kb were cloned and unidirectionally sequenced. All four enzymes provided some level of enrichment for gene space; however, II and I reduced the number of clones with repeat elements to just 16.2 and 19.1%, respectively. II and I were also effective in enrichment in corn and tobacco. Corn libraries made with II and I had 58.7 and 71.2%, respectively, of the clones with significant expressed sequence tag (EST alignments, while tobacco libraries made with the same enzymes had 51.7 and 65.3%, respectively. With the development of ultra-throughput sequencing technologies, this technique provides an opportunity to rapidly and efficiently obtain sequencing from gene-rich regions.

  15. Enzyme activities in parotid saliva of patients with the restrictive type of anorexia nervosa.

    Science.gov (United States)

    Paszynska, Elzbieta; Slopien, Agnieszka; Dmitrzak-Weglarz, Monika; Hannig, Christian

    2017-04-01

    In patients with anorexia nervosa (AN) specific signs may occur in the oral cavity, but there are conflicting reports about their significance, especially concerning changes in salivary composition. The aim of this clinical study was to evaluate the resting parotid flow rate (PFR) and the activity of the following enzymes in parotid saliva: amylase, aspartate amino transferase (AST), lysozyme, peroxidase, serine and acidic proteases in the acute phase of the restrictive type of AN and to compare the findings with those in healthy controls. Forty-one subjects participated (20 patients with AN, 21 matched healthy controls), parotid saliva was collected using a modified Lashley cap at rest. Enzyme activities were measured with fluorimetric and photometric assays. The unstimulated PFR was significantly lower than in the controls, lysozyme and AST activity was significantly lower, and amylase showed a high inter-individual variability. A positive correlation for amylase and lysozyme and negative ones for lysozyme and BMI, lysozyme and IBW%, serine protease and salivary flow were observed. The reduced PFR and enzyme activities levels suggest that AN does not only affect the quantity of the saliva but also its quality and, its biological functions. The results obtained should help to provide a better understanding of the effect of AN disease on the pathogenesis of at least some oral diseases. Further research is needed on any possible role of reduced lysozyme and transaminase activity in maintaining oral protection against external toxic agents and bacteria. Copyright © 2016 Elsevier Ltd. All rights reserved.

  16. An efficient method for multiple site-directed mutagenesis using type IIs restriction enzymes.

    Science.gov (United States)

    Zhang, Zhiqiang; Xu, Kun; Xin, Ying; Zhang, Zhiying

    2015-05-01

    Site-directed mutagenesis (SDM) methods are very important in modern molecular biology, biochemistry, and protein engineering. Here, we present a novel SDM method that can be used for multiple mutation generation using type IIs restriction enzymes. This approach is faster and more convenient than the overlap polymerase chain reaction (PCR) method due to its having fewer reaction steps and being cheaper than, but as convenient as, enzymatic assembly. We illustrate the usefulness of our method by introducing three mutations into the bacterial Streptococcus thermophilus Cas9 (bStCas9) gene, converting the humanized S. thermophilus Cas9 (hStCas9) gene into nuclease dead or H847A nickase mutants and generating sunnyTALEN mutagenesis from a wild-type TALEN backbone. Copyright © 2015 Elsevier Inc. All rights reserved.

  17. DNA cleavage by Type ISP Restriction-Modification enzymes is initially targeted to the 3'-5' strand.

    Science.gov (United States)

    van Aelst, Kara; Šišáková, Eva; Szczelkun, Mark D

    2013-01-01

    The mechanism by which a double-stranded DNA break is produced following collision of two translocating Type I Restriction-Modification enzymes is not fully understood. Here, we demonstrate that the related Type ISP Restriction-Modification enzymes LlaGI and LlaBIII can cooperate to cleave DNA following convergent translocation and collision. When one of these enzymes is a mutant protein that lacks endonuclease activity, DNA cleavage of the 3'-5' strand relative to the wild-type enzyme still occurs, with the same kinetics and at the same collision loci as for a reaction between two wild-type enzymes. The DNA nicking activity of the wild-type enzyme is still activated by a protein variant entirely lacking the Mrr nuclease domain and by a helicase mutant that cannot translocate. However, the helicase mutant cannot cleave the DNA despite the presence of an intact nuclease domain. Cleavage by the wild-type enzyme is not activated by unrelated protein roadblocks. We suggest that the nuclease activity of the Type ISP enzymes is activated following collision with another Type ISP enzyme and requires adenosine triphosphate binding/hydrolysis but, surprisingly, does not require interaction between the nuclease domains. Following the initial rapid endonuclease activity, additional DNA cleavage events then occur more slowly, leading to further processing of the initial double-stranded DNA break.

  18. Characterizing restriction enzyme-associated loci in historic ragweed (Ambrosia artemisiifolia) voucher specimens using custom-designed RNA probes

    DEFF Research Database (Denmark)

    Sanchez Barreiro, Fatima; Garrett Vieira, Filipe Jorge; Martin, Michael David

    2017-01-01

    Population genetic studies of non-model organisms frequently employ reduced representation library (RRL) methodologies, many of which rely on protocols in which genomic DNA is digested by one or more restriction enzymes. However, because high molecular weight DNA is recommended for these protocols......, samples with degraded DNA are generally unsuitable for RRL methods. Given that ancient and historic specimens can provide key temporal perspectives to evolutionary questions, we explored how custom-designed RNA probes could enrich for RRL loci (Restriction Enzyme-Associated Loci baits, or REALbaits...

  19. Altering the selection capabilities of common cloning vectors via restriction enzyme mediated gene disruption

    Science.gov (United States)

    2013-01-01

    Background The cloning of gene sequences forms the basis for many molecular biological studies. One important step in the cloning process is the isolation of bacterial transformants carrying vector DNA. This involves a vector-encoded selectable marker gene, which in most cases, confers resistance to an antibiotic. However, there are a number of circumstances in which a different selectable marker is required or may be preferable. Such situations can include restrictions to host strain choice, two phase cloning experiments and mutagenesis experiments, issues that result in additional unnecessary cloning steps, in which the DNA needs to be subcloned into a vector with a suitable selectable marker. Results We have used restriction enzyme mediated gene disruption to modify the selectable marker gene of a given vector by cloning a different selectable marker gene into the original marker present in that vector. Cloning a new selectable marker into a pre-existing marker was found to change the selection phenotype conferred by that vector, which we were able to demonstrate using multiple commonly used vectors and multiple resistance markers. This methodology was also successfully applied not only to cloning vectors, but also to expression vectors while keeping the expression characteristics of the vector unaltered. Conclusions Changing the selectable marker of a given vector has a number of advantages and applications. This rapid and efficient method could be used for co-expression of recombinant proteins, optimisation of two phase cloning procedures, as well as multiple genetic manipulations within the same host strain without the need to remove a pre-existing selectable marker in a previously genetically modified strain. PMID:23497512

  20. Fusaric Acid Production in Fusarium oxysporum Transformants Generated by Restriction Enzyme-Mediated Integration Procedure

    Directory of Open Access Journals (Sweden)

    Theresa Lee

    2013-12-01

    Full Text Available Fusaric acid (FA is a mycotoxin produced by Fusarium species. Its toxicity is relatively low but often associated with other mycotoxins, thus enhancing total toxicity. To date, biosynthetic genes or enzymes for FA have not been identified in F. oxysporum. In order to explore the genetic element(s for FA biosynthesis, restriction enzyme mediated integration (REMI procedure as an insertional mutagenesis was employed using FA producing-F. oxysporum strains. Genetic transformation of two F. oxysporum strains by REMI yielded more than 7,100 transformants with efficiency of average 3.2 transformants/μg DNA. To develop a screening system using phytotoxicity of FA, eleven various grains and vegetable seeds were tested for germination in cultures containing FA: Kimchi cabbage seed was selected as the most sensitive host. Screening for FA non-producer of F. oxysporum was done by growing each fungal REMI transformant in Czapek-Dox broth for 3 weeks at 25oC then observing if the Kimchi cabbage seeds germinated in the culture filtrate. Of more than 5,000 REMI transformants screened, fifty-three made the seeds germinated, indicating that they produced little or fewer FA. Among them, twenty-six were analyzed for FA production by HPLC and two turned out to produce less than 1% of FA produced by a wild type strain. Sequencing of genomic DNA regions (252 bp flanking the vector insertion site revealed an uncharacterized genomic region homologous (93% to the F. fujikuroi genome. Further study is necessary to determine if the vector insertion sites in FA-deficient mutants are associated with FA production.

  1. Use of primer selection and restriction enzymes to assess bacterial community diversity in an agricultural soil used for potato production via terminal restriction fragment length polymorphism.

    Science.gov (United States)

    Fortuna, Ann-Marie; Marsh, Terence L; Honeycutt, C Wayne; Halteman, William A

    2011-08-01

    Terminal restriction fragment length polymorphism (T-RFLP) can be used to assess how land use management changes the dominant members of bacterial communities. We compared T-RFLP profiles obtained via amplification with forward primers (27, 63F) each coupled with the fluorescently labeled reverse primer (1392R) and multiple restriction enzymes to determine the best combination for interrogating soil bacterial populations in an agricultural soil used for potato production. Both primer pairs provide nearly universal recognition of a 1,400-bp sequence of the bacterial domain in the V(1)-V(3) region of the 16S ribosomal RNA (rRNA) gene relative to known sequences. Labeling the reverse primer allowed for direct comparison of each forward primer and the terminal restriction fragments' relative migration units obtained with each primer pair and restriction enzyme. Redundancy analysis (RDA) and nested multivariate analysis of variance (MANOVA) were used to assess the effects of primer pair and choice of restriction enzyme on the measured relative migration units. Our research indicates that the 63F-1392R amplimer pair provides a more complete description with respect to the bacterial communities present in this potato (Solanum tuberosum L.)-barley (Hordeum vulgare L.) rotation over seeded to crimson clover (Trifolium praense L.). Domain-specific 16S rRNA gene primers are rigorously tested to determine their ability to amplify across a target region of the gene. Yet, variability within or between T-RFLP profiles can result from factors independent of the primer pair. Therefore, researchers should use RDA and MANOVA analyses to evaluate the effects that additional laboratory and environmental variables have on bacterial diversity.

  2. DNA sequencing analysis of several G6PD variants previously defined by PCR-restriction enzyme analysis

    Directory of Open Access Journals (Sweden)

    Gerardo Vaca

    2006-01-01

    Full Text Available Results of a corroborative DNA sequencing analysis for five glucose-6-phosphate dehydrogenase (G6PD mutations previously defined by PCR-restriction enzyme analysis are presented. The suitability for performing DNA sequencing analysis is discussed along with the importance of selecting the proper PCR-REA strategy in order to define the presence of a specific mutation .

  3. Fast conversion of scFv to Fab antibodies using type IIs restriction enzymes.

    Science.gov (United States)

    Sanmark, Hanna; Huovinen, Tuomas; Matikka, Tero; Pettersson, Tiina; Lahti, Maria; Lamminmäki, Urpo

    2015-11-01

    Single chain variable fragment (scFv) antibody libraries are widely used for developing novel bioaffinity reagents, although Fab or IgG molecules are the preferred antibody formats in many final applications. Therefore, rapid conversion methods for combining multiple DNA fragments are needed to attach constant domains to the scFv derived variable domains. In this study we describe a fast and easy cloning method for the conversion of single framework scFv fragments to Fab fragments using type IIS restriction enzymes. All cloning steps excluding plating of the Fab transformants can be done in 96 well plates and the procedure can be completed in one working day. The concept was tested by converting 69 scFv clones into Fab format on 96 well plates, which resulted in 93% success rate. The method is particularly useful as a high-throughput tool for the conversion of the chosen scFv clones into Fab molecules in order to analyze them as early as possible, as the conversion can significantly affect the binding properties of the chosen clones. Copyright © 2015 Elsevier B.V. All rights reserved.

  4. FN-Identify: Novel Restriction Enzymes-Based Method for Bacterial Identification in Absence of Genome Sequencing.

    Science.gov (United States)

    Awad, Mohamed; Ouda, Osama; El-Refy, Ali; El-Feky, Fawzy A; Mosa, Kareem A; Helmy, Mohamed

    2015-01-01

    Sequencing and restriction analysis of genes like 16S rRNA and HSP60 are intensively used for molecular identification in the microbial communities. With aid of the rapid progress in bioinformatics, genome sequencing became the method of choice for bacterial identification. However, the genome sequencing technology is still out of reach in the developing countries. In this paper, we propose FN-Identify, a sequencing-free method for bacterial identification. FN-Identify exploits the gene sequences data available in GenBank and other databases and the two algorithms that we developed, CreateScheme and GeneIdentify, to create a restriction enzyme-based identification scheme. FN-Identify was tested using three different and diverse bacterial populations (members of Lactobacillus, Pseudomonas, and Mycobacterium groups) in an in silico analysis using restriction enzymes and sequences of 16S rRNA gene. The analysis of the restriction maps of the members of three groups using the fragment numbers information only or along with fragments sizes successfully identified all of the members of the three groups using a minimum of four and maximum of eight restriction enzymes. Our results demonstrate the utility and accuracy of FN-Identify method and its two algorithms as an alternative method that uses the standard microbiology laboratories techniques when the genome sequencing is not available.

  5. FN-Identify: Novel Restriction Enzymes-Based Method for Bacterial Identification in Absence of Genome Sequencing

    Directory of Open Access Journals (Sweden)

    Mohamed Awad

    2015-01-01

    Full Text Available Sequencing and restriction analysis of genes like 16S rRNA and HSP60 are intensively used for molecular identification in the microbial communities. With aid of the rapid progress in bioinformatics, genome sequencing became the method of choice for bacterial identification. However, the genome sequencing technology is still out of reach in the developing countries. In this paper, we propose FN-Identify, a sequencing-free method for bacterial identification. FN-Identify exploits the gene sequences data available in GenBank and other databases and the two algorithms that we developed, CreateScheme and GeneIdentify, to create a restriction enzyme-based identification scheme. FN-Identify was tested using three different and diverse bacterial populations (members of Lactobacillus, Pseudomonas, and Mycobacterium groups in an in silico analysis using restriction enzymes and sequences of 16S rRNA gene. The analysis of the restriction maps of the members of three groups using the fragment numbers information only or along with fragments sizes successfully identified all of the members of the three groups using a minimum of four and maximum of eight restriction enzymes. Our results demonstrate the utility and accuracy of FN-Identify method and its two algorithms as an alternative method that uses the standard microbiology laboratories techniques when the genome sequencing is not available.

  6. Interdomain communication in the endonuclease/motor subunit of type I restriction-modification enzyme EcoR124I.

    Science.gov (United States)

    Sinha, Dhiraj; Shamayeva, Katsiaryna; Ramasubramani, Vyas; Řeha, David; Bialevich, Vitali; Khabiri, Morteza; Guzanová, Alena; Milbar, Niv; Weiserová, Marie; Csefalvay, Eva; Carey, Jannette; Ettrich, Rüdiger

    2014-07-01

    Restriction-modification systems protect bacteria from foreign DNA. Type I restriction-modification enzymes are multifunctional heteromeric complexes with DNA-cleavage and ATP-dependent DNA translocation activities located on endonuclease/motor subunit HsdR. The recent structure of the first intact motor subunit of the type I restriction enzyme from plasmid EcoR124I suggested a mechanism by which stalled translocation triggers DNA cleavage via a lysine residue on the endonuclease domain that contacts ATP bound between the two helicase domains. In the present work, molecular dynamics simulations are used to explore this proposal. Molecular dynamics simulations suggest that the Lys-ATP contact alternates with a contact with a nearby loop housing the conserved QxxxY motif that had been implicated in DNA cleavage. This model is tested here using in vivo and in vitro experiments. The results indicate how local interactions are transduced to domain motions within the endonuclease/motor subunit.

  7. Differential dependence on DNA ligase of type II restriction enzymes: a practical way toward ligase-free DNA automaton.

    Science.gov (United States)

    Chen, Peng; Li, Jing; Zhao, Jian; He, Lin; Zhang, Zhizhou

    2007-02-16

    DNA computing study is a new paradigm in computer science and biological computing fields. As one of DNA computing approaches, DNA automaton is composed of the hardware, input DNA molecule and state transition molecules. By now restriction enzymes are key hardware for DNA computing automaton. It has been found that DNA computing efficiency may be independent on DNA ligases when type IIS restriction enzymes like FokI are used as hardware. In this study, we compared FokI with four other distinct enzymes HgaI, BsmFI, BbsI, and BseMII, and found their differential independence on T4 DNA ligase when performing automaton reactions. Since DNA automaton is a potential powerful tool to tackle gene relationship in genomic network scale, the feasible ligase-free DNA automaton may set an initial base to develop functional DNA automata for various DNA technology development and implications in genetics study in the near future.

  8. Random Tagging Genotyping by Sequencing (rtGBS, an Unbiased Approach to Locate Restriction Enzyme Sites across the Target Genome.

    Directory of Open Access Journals (Sweden)

    Elena Hilario

    Full Text Available Genotyping by sequencing (GBS is a restriction enzyme based targeted approach developed to reduce the genome complexity and discover genetic markers when a priori sequence information is unavailable. Sufficient coverage at each locus is essential to distinguish heterozygous from homozygous sites accurately. The number of GBS samples able to be pooled in one sequencing lane is limited by the number of restriction sites present in the genome and the read depth required at each site per sample for accurate calling of single-nucleotide polymorphisms. Loci bias was observed using a slight modification of the Elshire et al.some restriction enzyme sites were represented in higher proportions while others were poorly represented or absent. This bias could be due to the quality of genomic DNA, the endonuclease and ligase reaction efficiency, the distance between restriction sites, the preferential amplification of small library restriction fragments, or bias towards cluster formation of small amplicons during the sequencing process. To overcome these issues, we have developed a GBS method based on randomly tagging genomic DNA (rtGBS. By randomly landing on the genome, we can, with less bias, find restriction sites that are far apart, and undetected by the standard GBS (stdGBS method. The study comprises two types of biological replicates: six different kiwifruit plants and two independent DNA extractions per plant; and three types of technical replicates: four samples of each DNA extraction, stdGBS vs. rtGBS methods, and two independent library amplifications, each sequenced in separate lanes. A statistically significant unbiased distribution of restriction fragment size by rtGBS showed that this method targeted 49% (39,145 of BamH I sites shared with the reference genome, compared to only 14% (11,513 by stdGBS.

  9. Functional analysis of MmeI from methanol utilizer Methylophilus methylotrophus, a subtype IIC restriction-modification enzyme related to type I enzymes.

    Science.gov (United States)

    Nakonieczna, Joanna; Kaczorowski, Tadeusz; Obarska-Kosinska, Agnieszka; Bujnicki, Janusz M

    2009-01-01

    MmeI from Methylophilus methylotrophus belongs to the type II restriction-modification enzymes. It recognizes an asymmetric DNA sequence, 5'-TCCRAC-3' (R indicates G or A), and cuts both strands at fixed positions downstream of the specific site. This particular feature has been exploited in transcript profiling of complex genomes (using serial analysis of gene expression technology). We have shown previously that the endonucleolytic activity of MmeI is strongly dependent on the presence of S-adenosyl-l-methionine (J. Nakonieczna, J. W. Zmijewski, B. Banecki, and A. J. Podhajska, Mol. Biotechnol. 37:127-135, 2007), which puts MmeI in subtype IIG. The same cofactor is used by MmeI as a methyl group donor for modification of an adenine in the upper strand of the recognition site to N(6)-methyladenine. Both enzymatic activities reside in a single polypeptide (919 amino acids [aa]), which puts MmeI also in subtype IIC of the restriction-modification systems. Based on a molecular model, generated with the use of bioinformatic tools and validated by site-directed mutagenesis, we were able to localize three functional domains in the structure of the MmeI enzyme: (i) the N-terminal portion containing the endonucleolytic domain with the catalytic Mg2+-binding motif D(70)-X(9)-EXK(82), characteristic for the PD-(D/E)XK superfamily of nucleases; (ii) a central portion (aa 310 to 610) containing nine sequence motifs conserved among N(6)-adenine gamma-class DNA methyltransferases; (iii) the C-terminal portion (aa 610 to 919) containing a putative target recognition domain. Interestingly, all three domains showed highest similarity to the corresponding elements of type I enzymes rather than to classical type II enzymes. We have found that MmeI variants deficient in restriction activity (D70A, E80A, and K82A) can bind and methylate specific nucleotide sequence. This suggests that domains of MmeI responsible for DNA restriction and modification can act independently. Moreover, we

  10. Increasing Genome Sampling and Improving SNP Genotyping for Genotyping-by-Sequencing with New Combinations of Restriction Enzymes

    OpenAIRE

    Yong-Bi Fu; Gregory W. Peterson; Yibo Dong

    2016-01-01

    Genotyping-by-sequencing (GBS) has emerged as a useful genomic approach for exploring genome-wide genetic variation. However, GBS commonly samples a genome unevenly and can generate a substantial amount of missing data. These technical features would limit the power of various GBS-based genetic and genomic analyses. Here we present software called IgCoverage for in silico evaluation of genomic coverage through GBS with an individual or pair of restriction enzymes on one sequenced genome, and ...

  11. Distribution of hsp65 PCR-Restriction Enzyme Analysis Patterns among Mycobacterium avium Complex Isolates in Thailand▿

    OpenAIRE

    Prammananan, Therdsak; Phunpruch, Saranya; Tingtoy, Nipa; Srimuang, Somboon; Chaiprasert, Angkana

    2006-01-01

    A total of 227 clinical Mycobacterium avium complex isolates from Thailand were differentiated into species and types by using PCR-restriction enzyme analysis of hsp65. The distribution of types showed the predominance of M. avium I (77%) in blood specimens, whereas M. intracellulare I was more commonly found in pulmonary specimens (44.2%). In addition, infections with M. avium were more likely to be found in younger adults (20 to 39 years old), while infections with M. intracellulare were mo...

  12. Multiplexed and Sensitive DNA Methylation Testing Using Methylation-Sensitive Restriction Enzymes "MSRE-qPCR".

    Science.gov (United States)

    Beikircher, Gabriel; Pulverer, Walter; Hofner, Manuela; Noehammer, Christa; Weinhaeusel, Andreas

    2018-01-01

    DNA methylation is a chemically stable key-player in epigenetics. In the vertebrate genome the 5-methyl cytosine (5mC) has been found almost exclusively in the CpG dinucleotide context. CpG dinucleotides are enriched in CpG islands very frequently located within or close to gene promoters. Analyses of DNA methylation changes in human diagnostics have been conducted classically using methylation-sensitive restriction enzymes (MSRE). Since the discovery of bisulfite conversion-based sequencing and PCR assays, MSRE-based PCR assays have been less frequently used, although especially in the field of cancer epigenetics MSRE-based genome-wide discovery and targeted screening applications have been and are still performed successfully. Even though epigenome-wide discovery of altered DNA methylation patterns has found its way into various fields of human disease and molecular genetics research, the validation of findings upon discovery is still a bottleneck. Usually several multiples of 10 up to 100 candidate biomarkers from discovery have to be confirmed or are of interest for further work. In particular, bisulfite PCR assays are often limited in the number of candidates which can be analyzed, due to their low multiplexing capability, especially, if only small amounts of DNA are available from for example clinical specimens. In clinical research and diagnostics a similar situation arises for the analyses of cell-free DNA (cfDNA) in body fluids or circulating tumor cells (CTCs). Although tissue- or disease- (e.g., cancer) specific DNA methylation patterns can be deduced very efficiently in a genome-wide manner if around 100 ng of DNA are available, confirming these candidates and selecting target-sequences for studying methylation changes in liquid biopsies using cfDNA or CTCs remains a big challenge. Along these lines we have developed MSRE-qPCR and introduce here method details, which have been found very suitable for the efficient confirmation and testing of DNA

  13. Structure of 5-hydroxymethylcytosine-specific restriction enzyme, AbaSI, in complex with DNA

    Energy Technology Data Exchange (ETDEWEB)

    Horton, John R.; Borgaro, Janine G.; Griggs, Rose M.; Quimby, Aine; Guan, Shengxi; Zhang, Xing; Wilson, Geoffrey G.; Zheng, Yu; Zhu, Zhenyu; Cheng, Xiaodong (Emory-MED); (NE Biolabs)

    2014-07-03

    AbaSI, a member of the PvuRts1I-family of modification-dependent restriction endonucleases, cleaves DNA containing 5-hydroxymethylctosine (5hmC) and glucosylated 5hmC (g5hmC), but not DNA containing unmodified cytosine. AbaSI has been used as a tool for mapping the genomic locations of 5hmC, an important epigenetic modification in the DNA of higher organisms. Here we report the crystal structures of AbaSI in the presence and absence of DNA. These structures provide considerable, although incomplete, insight into how this enzyme acts. AbaSI appears to be mainly a homodimer in solution, but interacts with DNA in our structures as a homotetramer. Each AbaSI subunit comprises an N-terminal, Vsr-like, cleavage domain containing a single catalytic site, and a C-terminal, SRA-like, 5hmC-binding domain. Two N-terminal helices mediate most of the homodimer interface. Dimerization brings together the two catalytic sites required for double-strand cleavage, and separates the 5hmC binding-domains by ~ 70 Å, consistent with the known activity of AbaSI which cleaves DNA optimally between symmetrically modified cytosines ~ 22 bp apart. The eukaryotic SET and RING-associated (SRA) domains bind to DNA containing 5-methylcytosine (5mC) in the hemi-methylated CpG sequence. They make contacts in both the major and minor DNA grooves, and flip the modified cytosine out of the helix into a conserved binding pocket. In contrast, the SRA-like domain of AbaSI, which has no sequence specificity, contacts only the minor DNA groove, and in our current structures the 5hmC remains intra-helical. A conserved, binding pocket is nevertheless present in this domain, suitable for accommodating 5hmC and g5hmC. We consider it likely, therefore, that base-flipping is part of the recognition and cleavage mechanism of AbaSI, but that our structures represent an earlier, pre-flipped stage, prior to actual recognition.

  14. ICRPfinder: a fast pattern design algorithm for coding sequences and its application in finding potential restriction enzyme recognition sites

    Directory of Open Access Journals (Sweden)

    Stafford Phillip

    2009-09-01

    Full Text Available Abstract Background Restriction enzymes can produce easily definable segments from DNA sequences by using a variety of cut patterns. There are, however, no software tools that can aid in gene building -- that is, modifying wild-type DNA sequences to express the same wild-type amino acid sequences but with enhanced codons, specific cut sites, unique post-translational modifications, and other engineered-in components for recombinant applications. A fast DNA pattern design algorithm, ICRPfinder, is provided in this paper and applied to find or create potential recognition sites in target coding sequences. Results ICRPfinder is applied to find or create restriction enzyme recognition sites by introducing silent mutations. The algorithm is shown capable of mapping existing cut-sites but importantly it also can generate specified new unique cut-sites within a specified region that are guaranteed not to be present elsewhere in the DNA sequence. Conclusion ICRPfinder is a powerful tool for finding or creating specific DNA patterns in a given target coding sequence. ICRPfinder finds or creates patterns, which can include restriction enzyme recognition sites, without changing the translated protein sequence. ICRPfinder is a browser-based JavaScript application and it can run on any platform, in on-line or off-line mode.

  15. [THE EFFECT OF DIETARY RESTRICTION DURING DEVELOPMENT OF DROSOPHILA MELANOGASTER ON THE ACTIVITY OF ANTIOXIDANT SYSTEM ENZYMES].

    Science.gov (United States)

    Zabuga, O G; Koliada, A K; Kukharskyy, V M; Bazhynova, A I; Vaiserman, A M

    2015-01-01

    In the previous study we demonstrated that dietary restriction only at the development stage of Drosophila melanogaster may impact the life span of adult flies. It was important that we didn't use qualitative (restriction of proteins or other macro- or microelements) and not a calorie restriction as well, but quantitative dietary restriction that was the proportional reduction of all food components in the larval medium. In the situations when the larvae were reared in the medium types, that contained protein and carbohydrate components in concentrations of 90-10% of food components compared to the standard one (100%), the males were characterised with the significant increase in the maximum life span. The average life span was also increased, but only in those male individuals that developed in the medium types, that contained 50% and 60% of food components compared to controls. Such an effect we haven't detected in the female flies. To study the biochemical changes associated with the physiological effects we have determined the activity of the antioxidant enzymes--superoxide dismutase (SOD) and catalase. In the male flies the 50% dietary restriction implemented during the development has led to the significant increase in a SOD and catalase activity. Also the flies of both sexes reared in the medium with the 50% of food components have been characterised with the reduction in the accumulation of glycation end products. According to these results, we suggest that the changes in the activity of antioxidant enzymes may play a role in the increase of the flies life span caused by the dietary restriction during the development.

  16. Dissociation from DNA of Type III Restriction-Modification enzymes during helicase-dependent motion and following endonuclease activity.

    Science.gov (United States)

    Tóth, Júlia; van Aelst, Kara; Salmons, Hannah; Szczelkun, Mark D

    2012-08-01

    DNA cleavage by the Type III Restriction-Modification (RM) enzymes requires the binding of a pair of RM enzymes at two distant, inversely orientated recognition sequences followed by helicase-catalysed ATP hydrolysis and long-range communication. Here we addressed the dissociation from DNA of these enzymes at two stages: during long-range communication and following DNA cleavage. First, we demonstrated that a communicating species can be trapped in a DNA domain without a recognition site, with a non-specific DNA association lifetime of ∼ 200 s. If free DNA ends were present the lifetime became too short to measure, confirming that ends accelerate dissociation. Secondly, we observed that Type III RM enzymes can dissociate upon DNA cleavage and go on to cleave further DNA molecules (they can 'turnover', albeit inefficiently). The relationship between the observed cleavage rate and enzyme concentration indicated independent binding of each site and a requirement for simultaneous interaction of at least two enzymes per DNA to achieve cleavage. In light of various mechanisms for helicase-driven motion on DNA, we suggest these results are most consistent with a thermally driven random 1D search model (i.e. 'DNA sliding').

  17. Enzyme

    Science.gov (United States)

    Enzymes are complex proteins that cause a specific chemical change in all parts of the body. For ... use them. Blood clotting is another example of enzymes at work. Enzymes are needed for all body ...

  18. [The rapid specific characterization of clinical isolates of the genus Mycobacterium by the polymerase chain reaction and restriction enzyme analysis].

    Science.gov (United States)

    Cuende, J I; Jaime, M L; Gómez, M T; Del Campo, F; Alba, A; Pérez de Diego, I J

    1995-02-18

    Typing at species level of Mycobacterium is usually performed by microbiological and biochemical methods that require a long time and/or sufficient amount of bacteria. Molecular biology can avoid these problems using different techniques. A colony growth of the following mycobacteria has been analyzed: M. tuberculosis, M. kansasii, M. avium, M. intracellulare, M. gordonae, M. phlei, M. aurum, M. fortuitum, M. flavescens, M. marinum, M. xenopi, M. nonchromogenicum, M. terrae and M. chelonei. Strains were grown in Löwenstein-Jensen medium. DNA was obtained by proteolytic digestion and fenol extraction. The 16S rRNA gen was amplified by polymerase chain reaction (PCR) and the amplification was digested by HaeIII, HpaII, RsaI and AluI restriction enzymes. Restriction fragment patterns were analyzed by agarose gel electrophoresis and UV transillumination. The combination of the patterns obtained with HpaII and RsaI was sufficient to generate 13 different combined ones. The patterns of M. intracellulare and M. avium were the same. PCR and restriction enzyme analysis is an useful method for typing at species level of clinical isolates of mycobacteria.

  19. Rational Design of Thermally Stable Novel Biocatalytic Nanomaterials: Enzyme Stability in Restricted Spatial Dimensions

    Science.gov (United States)

    Mudhivarthi, Vamsi K.

    Enzyme stability is of intense interest in bio-materials science as biocatalysts, and as sensing platforms. This is essentially because the unique properties of DNA, RNA, PAA can be coupled with the interesting and novel properties of proteins to produce systems with unprecedented control over their properties. In this article, the very first examples of enzyme/NA/inorganic hybrid nanomaterials and enzyme-Polyacrylic acid conjugates will be presented. The basic principles of design, synthesis and control of properties of these hybrid materials will be presented first, and this will be followed by a discussion of selected examples from our recent research findings. Data show that key properties of biological catalysts are improved by the inorganic framework especially when the catalyst is co-embedded with DNA. Several examples of such studies with various enzymes and proteins, including horseradish peroxidase (HRP), glucose oxidase (GO), cytochrome c (Cyt c), met-hemoglobin (Hb) and met-myoglobin (Mb) will be discussed. Additionally, key insights obtained by the standard methods of materials science including XRD, SEM and TEM as well as biochemical, calorimetric and spectroscopic methods will be discussed. Furthermore, improved structure and enhanced activities of the biocatalysts in specific cases will be demonstrated along with the potential stabilization mechanisms. Our hypothesis is that nucleic acids provide an excellent control over the enzyme-solid interactions as well as rational assembly of nanomaterials. These novel nanobiohybrid materials may aid in engineering more effective synthetic materials for gene-delivery, RNA-delivery and drug delivery applications.

  20. Structural basis for catalytically restrictive dynamics of a high-energy enzyme state

    Science.gov (United States)

    Kovermann, Michael; Ådén, Jörgen; Grundström, Christin; Elisabeth Sauer-Eriksson, A.; Sauer, Uwe H.; Wolf-Watz, Magnus

    2015-07-01

    An emerging paradigm in enzymology is that transient high-energy structural states play crucial roles in enzymatic reaction cycles. Generally, these high-energy or `invisible' states cannot be studied directly at atomic resolution using existing structural and spectroscopic techniques owing to their low populations or short residence times. Here we report the direct NMR-based detection of the molecular topology and conformational dynamics of a catalytically indispensable high-energy state of an adenylate kinase variant. On the basis of matching energy barriers for conformational dynamics and catalytic turnover, it was found that the enzyme's catalytic activity is governed by its dynamic interconversion between the high-energy state and a ground state structure that was determined by X-ray crystallography. Our results show that it is possible to rationally tune enzymes' conformational dynamics and hence their catalytic power--a key aspect in rational design of enzymes catalysing novel reactions.

  1. Phylogenomics and sequence-structure-function relationships in the GmrSD family of Type IV restriction enzymes.

    Science.gov (United States)

    Machnicka, Magdalena A; Kaminska, Katarzyna H; Dunin-Horkawicz, Stanislaw; Bujnicki, Janusz M

    2015-10-23

    GmrSD is a modification-dependent restriction endonuclease that specifically targets and cleaves glucosylated hydroxymethylcytosine (glc-HMC) modified DNA. It is encoded either as two separate single-domain GmrS and GmrD proteins or as a single protein carrying both domains. Previous studies suggested that GmrS acts as endonuclease and NTPase whereas GmrD binds DNA. In this work we applied homology detection, sequence conservation analysis, fold recognition and homology modeling methods to study sequence-structure-function relationships in the GmrSD restriction endonucleases family. We also analyzed the phylogeny and genomic context of the family members. Results of our comparative genomics study show that GmrS exhibits similarity to proteins from the ParB/Srx fold which can have both NTPase and nuclease activity. In contrast to the previous studies though, we attribute the nuclease activity also to GmrD as we found it to contain the HNH endonuclease motif. We revealed residues potentially important for structure and function in both domains. Moreover, we found that GmrSD systems exist predominantly as a fused, double-domain form rather than as a heterodimer and that their homologs are often encoded in regions enriched in defense and gene mobility-related elements. Finally, phylogenetic reconstructions of GmrS and GmrD domains revealed that they coevolved and only few GmrSD systems appear to be assembled from distantly related GmrS and GmrD components. Our study provides insight into sequence-structure-function relationships in the yet poorly characterized family of Type IV restriction enzymes. Comparative genomics allowed to propose possible role of GmrD domain in the function of the GmrSD enzyme and possible active sites of both GmrS and GmrD domains. Presented results can guide further experimental characterization of these enzymes.

  2. Transcript profiling of the ruminant liver indicates a unique program of transcriptional regulation of ketogenic enzymes during food restriction.

    Science.gov (United States)

    Doelman, John; Cao, Honghe; Purdie, Norman G; Kim, Julie J M; Swanson, Kendall C; Osborne, Vernon R; Tey, Jasper; Ali, Ayesha; Feng, Zeny; Karrow, Niel A; Cant, John P

    2012-09-01

    Ruminants absorb little glucose and rely on hepatic gluconeogenesis and ketogenesis in the fed state to convert short-chain fatty acids produced during digestion into glucose and ketone bodies, respectively. In contrast to the non-ruminant response, fluxes through gluconeogenic and ketogenic pathways decrease during food restriction. Transcriptional regulation responsible for these unique food restriction responses has not been established. To determine the hepatic transcriptional response of ruminants to an acute drop in dietary nutrient supply, 102 yearling heifers were assigned to either ad libitum feeding or 24 h of food withdrawal in a randomized block design. Liver biopsies were obtained for microarray and quantitative real-time PCR analyses of gene expression. Plasma concentrations of non-esterified fatty acids were higher in food restricted heifers, while levels of β-hydroxybutyrate, triacylglycerol, and glucose were decreased. Despite a decline in substrate supply and a lower hepatic production of glucose, expression of the key gluconeogenic enzymes pyruvate carboxylase, phosphoenolpyruvate carboxykinase and fructose-1,6-bisphosphatase was upregulated as in non-ruminants. Downregulation of cholesterolgenic genes and upregulation of fatty acid oxidative genes were consistent with SREBP-2 and PPARα control, respectively. Ketogenesis from short-chain fatty acids was downregulated, contrary to the non-ruminant response to food restriction. Short-chain fatty acids may exert transcriptional control in the ruminant liver similar to that demonstrated in the large intestine of non-ruminants. Copyright © 2012 Elsevier Inc. All rights reserved.

  3. Inquiry-Based Experiments for Large-Scale Introduction to PCR and Restriction Enzyme Digests

    Science.gov (United States)

    Johanson, Kelly E.; Watt, Terry J.

    2015-01-01

    Polymerase chain reaction and restriction endonuclease digest are important techniques that should be included in all Biochemistry and Molecular Biology laboratory curriculums. These techniques are frequently taught at an advanced level, requiring many hours of student and faculty time. Here we present two inquiry-based experiments that are…

  4. Sequence-specific protection of duplex DNA against restriction and methylation enzymes by pseudocomplementary PNAs

    DEFF Research Database (Denmark)

    Izvolsky, K I; Demidov, V V; Nielsen, P E

    2000-01-01

    I restriction endonuclease and dam methylase. The pcPNA-assisted protection against enzymatic methylation is more efficient when the PNA-binding site embodies the methylase-recognition site rather than overlaps it. We conclude that pcPNAs may provide the robust tools allowing to sequence-specifically manipulate...... DNA duplexes in a virtually sequence-unrestricted manner....

  5. Comparison of the accuracy and mechanism of data mining identification of the intestinal microbiota with 7 restriction enzymes.

    Science.gov (United States)

    Kobayashi, Toshio; Fujiwara, Kenji

    2013-01-01

    The intestinal microbiota compositions of 92 Japanese men were identified following consumption of identical meals for 3 days, and collected feces were analyzed through terminal restriction fragment length polymorphism. The obtained operational taxonomic units (OTUs) and subjects' smoking and drinking habits, which had 2 nominal partitions, yes or no, were analyzed by Data mining software. Identification of subjects for each habit was successfully performed and reported previously, but the identification accuracy was closely dependent on the species of the applied restriction enzymes for PCR. For the sake of better selection of enzymes and understanding the mechanisms of Data mining analysis, 516f-BslI and 516f-HaeIII, 27f-MspI and 27f-AluI and 35f-HhaI, 35f-MspI and 35f-AluI, altogether 7 enzymes, were examined comparatively. Data mining analysis provides a Decision tree for identification of subjects and their dividing pathways that is produced using a limited number of OTUs, which affects the accuracy of the results. The present report discusses not only a global comparison of accuracies for characteristics, but also the detailed mechanisms that result in better or worse results and the practical roles and functions of OTUs. The OTU at the 1st step of the constructed Decision tree was the most important for any identification, and for all cases, the combination of subsequent OTUs, which formed later in the Decision tree, was also unignorable. Detailed dividing pathways were traced and compared for the 7 enzymes and the future supporting ideas were provided for better Data mining analysis of the human intestinal microbiota.

  6. Re-evaluating the kinetics of ATP hydrolysis during initiation of DNA sliding by Type III restriction enzymes.

    Science.gov (United States)

    Tóth, Júlia; Bollins, Jack; Szczelkun, Mark D

    2015-12-15

    DNA cleavage by the Type III restriction enzymes requires long-range protein communication between recognition sites facilitated by thermally-driven 1D diffusion. This 'DNA sliding' is initiated by hydrolysis of multiple ATPs catalysed by a helicase-like domain. Two distinct ATPase phases were observed using short oligoduplex substrates; the rapid consumption of ∼10 ATPs coupled to a protein conformation switch followed by a slower phase, the duration of which was dictated by the rate of dissociation from the recognition site. Here, we show that the second ATPase phase is both variable and only observable when DNA ends are proximal to the recognition site. On DNA with sites more distant from the ends, a single ATPase phase coupled to the conformation switch was observed and subsequent site dissociation required little or no further ATP hydrolysis. The overall DNA dissociation kinetics (encompassing site release, DNA sliding and escape via a DNA end) were not influenced by the second phase. Although the data simplifies the ATP hydrolysis scheme for Type III restriction enzymes, questions remain as to why multiple ATPs are hydrolysed to prepare for DNA sliding. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.

  7. The restriction enzyme SgrAI: structure solution via combination of poor MIRAS and MR phases

    Energy Technology Data Exchange (ETDEWEB)

    Dunten, Pete W., E-mail: pete@slac.stanford.edu [Stanford Synchrotron Radiation Laboratory, Stanford University, Menlo Park, CA 94025 (United States); Little, Elizabeth J.; Horton, Nancy C. [Department of Biochemistry and Molecular Biophysics, University of Arizona, Tucson, AZ 85721 (United States); Stanford Synchrotron Radiation Laboratory, Stanford University, Menlo Park, CA 94025 (United States)

    2009-04-01

    Phase information from both MIRAS and MR was used to produce an interpretable electron-density map of the novel type II restriction endonuclease SgrAI bound to DNA. The MR solution corrected an instructive error in the initially chosen averaging transformation. Uninterpretable electron-density maps were obtained using either MIRAS phases or MR phases in attempts to determine the structure of the type II restriction endonuclease SgrAI bound to DNA. While neither solution strategy was particularly promising (map correlation coefficients of 0.29 and 0.22 with the final model, respectively, for the MIRAS and MR phases and Phaser Z scores of 4.0 and 4.3 for the rotation and translation searches), phase combination followed by density modification gave a readily interpretable map. MR with a distantly related model located a dimer in the asymmetric unit and provided the correct transformation to use in averaging electron density between SgrAI subunits. MIRAS data sets with low substitution and MR solutions from only distantly related models should not be ignored, as poor-quality starting phases can be significantly improved. The bootstrapping strategy employed to improve the initial MIRAS phases is described.

  8. Restriction enzyme digestion analysis of PCR-amplified DNA of Blastocystis hominis isolates.

    Science.gov (United States)

    Init, I; Foead, A L; Fong, M Y; Yamazaki, H; Rohela, M; Yong, H S; Mak, J W

    2007-11-01

    Genomic DNA of Blastocystis isolates released into 0.1% Triton X-100 was suitable for amplification and yielded similar results as the genomic DNA extracted with standard kit. The specific B. hominis primers (BH1: GCT TAT CTG GTT GAT CCT GCC AGT and BH2: TGA TCC TTC CGC AGG TTC ACC TAC A) successfully produced the PCR product of about 1,770 bp with all the 7 Blastocystis isolates tested. The restriction fragment length polymorphism (RFLP) patterns yielded by 13 out of 25 restriction endonucleases showed that the 7 isolates could be grouped into 4 subgroups: subgroup-1 consisted of isolate C; subgroup-2 of isolates H4 and H7; subgroup-3 of isolates KP1, Y51 and M12; and subgroup-4 of isolate 27805. The differences between subgroups manifested as clear-cut RFLP patterns. A common band of 230 bp was revealed by Eco R1 in all the Blastocystis isolates tested. The band of about 180 bp was revealed by Alu I, differentiated symptomatic from asymptomatic isolates of this parasite, and might indicate the pathogenicity of this parasite.

  9. Pattern analysis approach reveals restriction enzyme cutting abnormalities and other cDNA library construction artifacts using raw EST data

    Directory of Open Access Journals (Sweden)

    Zhou Sun

    2012-05-01

    Full Text Available Abstract Background Expressed Sequence Tag (EST sequences are widely used in applications such as genome annotation, gene discovery and gene expression studies. However, some of GenBank dbEST sequences have proven to be “unclean”. Identification of cDNA termini/ends and their structures in raw ESTs not only facilitates data quality control and accurate delineation of transcription ends, but also furthers our understanding of the potential sources of data abnormalities/errors present in the wet-lab procedures for cDNA library construction. Results After analyzing a total of 309,976 raw Pinus taeda ESTs, we uncovered many distinct variations of cDNA termini, some of which prove to be good indicators of wet-lab artifacts, and characterized each raw EST by its cDNA terminus structure patterns. In contrast to the expected patterns, many ESTs displayed complex and/or abnormal patterns that represent potential wet-lab errors such as: a failure of one or both of the restriction enzymes to cut the plasmid vector; a failure of the restriction enzymes to cut the vector at the correct positions; the insertion of two cDNA inserts into a single vector; the insertion of multiple and/or concatenated adapters/linkers; the presence of 3′-end terminal structures in designated 5′-end sequences or vice versa; and so on. With a close examination of these artifacts, many problematic ESTs that have been deposited into public databases by conventional bioinformatics pipelines or tools could be cleaned or filtered by our methodology. We developed a software tool for Abnormality Filtering and Sequence Trimming for ESTs (AFST, http://code.google.com/p/afst/ using a pattern analysis approach. To compare AFST with other pipelines that submitted ESTs into dbEST, we reprocessed 230,783 Pinus taeda and 38,709 Arachis hypogaea GenBank ESTs. We found 7.4% of Pinus taeda and 29.2% of Arachis hypogaea GenBank ESTs are “unclean” or abnormal, all of which could be cleaned

  10. Mitochondrial DNA variation in chinook salmon and chum salmon detected by restriction enzyme analysis of polymerase chain reaction products

    Science.gov (United States)

    Cronin, M.; Spearman, R.; Wilmot, R.; Patton, J.; Bickman, J.

    1993-01-01

    We analyze intraspecific mitochondrial DNA variation in chinook salmon from drainages in the Yukon River, the Kenai River, and Oregon and California rivers; and chum salmon from the Yukon River and vancouver Island, and Washington rivers. For each species, three different portions of the mtDNA molecule were amplified seperately using the polymerase chain reaction and then digested with at least 19 restrictions enzymes. Intraspecific sequence divergences between haplotypes were less than 0.01 base subsitution per nucleotide. Nine chum salmon haplotypes were identified. Yukon River chum salmon stocks displayed more haplotypes (8) occurred in all areas. Seven chinook salmon haplotypes were identified. Four haplotypes occurred in the Yukon and Kenai rviers and four occured in the Oregon/California, with only one haplotype shared between the regions. Sample sizes were too small to quantify the degree of stock seperation among drainages, but the patterns of variation that we observed suggest utility of the technique in genetic stock identification.

  11. Short Communication: Subtyping of Mycobacterium kansasii by PCR-Restriction Enzyme Analysis of the hsp65 Gene

    Directory of Open Access Journals (Sweden)

    Zofia Bakuła

    2013-01-01

    Full Text Available Mycobacterium kansasii is one of the most common causes of pulmonary disease resulting from nontuberculous mycobacteria (NTM. It is also the most frequently isolated NTM species from clinical specimens in Poland. The aim of this study was to investigate the distribution of M. kansasii subtypes among patients suspected of having pulmonary NTM disease. Fifty clinical isolates of M. kansasii recovered from as many patients with suspected mycobacterial lung disease between 2000 and 2010 in Poland were genotyped by PCR-restriction enzyme analysis (PCR-REA of partial hsp65 gene. Mycobacterium kansasii subtype I was the only genotype to be identified among the isolates, both disease-associated and non-disease-associated. Isolation of M. kansasii subtype I from clinical specimens may be indicative of infection but may also merely represent colonization.

  12. Characterizing restriction enzyme-associated loci in historic ragweed (Ambrosia artemisiifolia) voucher specimens using custom-designed RNA probes.

    Science.gov (United States)

    Sánchez Barreiro, Fátima; Vieira, Filipe G; Martin, Michael D; Haile, James; Gilbert, M Thomas P; Wales, Nathan

    2017-03-01

    Population genetic studies of nonmodel organisms frequently employ reduced representation library (RRL) methodologies, many of which rely on protocols in which genomic DNA is digested by one or more restriction enzymes. However, because high molecular weight DNA is recommended for these protocols, samples with degraded DNA are generally unsuitable for RRL methods. Given that ancient and historic specimens can provide key temporal perspectives to evolutionary questions, we explored how custom-designed RNA probes could enrich for RRL loci (Restriction Enzyme-Associated Loci baits, or REALbaits). Starting with genotyping-by-sequencing (GBS) data generated on modern common ragweed (Ambrosia artemisiifolia L.) specimens, we designed 20 000 RNA probes to target well-characterized genomic loci in herbarium voucher specimens dating from 1835 to 1913. Compared to shotgun sequencing, we observed enrichment of the targeted loci at 19- to 151-fold. Using our GBS capture pipeline on a data set of 38 herbarium samples, we discovered 22 813 SNPs, providing sufficient genomic resolution to distinguish geographic populations. For these samples, we found that dilution of REALbaits to 10% of their original concentration still yielded sufficient data for downstream analyses and that a sequencing depth of ~7m reads was sufficient to characterize most loci without wasting sequencing capacity. In addition, we observed that targeted loci had highly variable rates of success, which we primarily attribute to similarity between loci, a trait that ultimately interferes with unambiguous read mapping. Our findings can help researchers design capture experiments for RRL loci, thereby providing an efficient means to integrate samples with degraded DNA into existing RRL data sets. © 2016 John Wiley & Sons Ltd.

  13. A novel whole genome amplification method using type IIS restriction enzymes to create overhangs with random sequences.

    Science.gov (United States)

    Pan, Xiaoming; Wan, Baihui; Li, Chunchuan; Liu, Yu; Wang, Jing; Mou, Haijin; Liang, Xingguo

    2014-08-20

    Ligation-mediated polymerase chain reaction (LM-PCR) is a whole genome amplification (WGA) method, for which genomic DNA is cleaved into numerous fragments and then all of the fragments are amplified by PCR after attaching a universal end sequence. However, the self-ligation of these fragments could happen and may cause biased amplification and restriction of its application. To decrease the self-ligation probability, here we use type IIS restriction enzymes to digest genomic DNA into fragments with 4-5nt long overhangs with random sequences. After ligation to an adapter with random end sequences to above fragments, PCR is carried out and almost all present DNA sequences are amplified. In this study, whole genome of Vibrio parahaemolyticus was amplified and the amplification efficiency was evaluated by quantitative PCR. The results suggested that our approach could provide sufficient genomic DNA with good quality to meet requirements of various genetic analyses. Copyright © 2014. Published by Elsevier B.V.

  14. Differentiating Taenia solium and Taenia saginata Infections by Simple Hematoxylin-Eosin Staining and PCR-Restriction Enzyme Analysis

    Science.gov (United States)

    Mayta, H.; Talley, A.; Gilman, R. H.; Jimenez, J.; Verastegui, M.; Ruiz, M.; Garcia, H. H.; Gonzalez, A. E.

    2000-01-01

    Species-specific identification of human tapeworm infections is important for public health purposes, because prompt identification of Taenia solium carriers may prevent further human cysticercosis infections (a major cause of acquired epilepsy). Two practical methods for the differentiation of cestode proglottids, (i) routine embedding, sectioning, and hematoxylin-eosin (HE) staining and (ii) PCR with restriction enzyme analysis (PCR-REA), were tested on samples from 40 individuals infected with T. solium (n = 34) or Taenia saginata (n = 6). Microscopic examination of HE staining of sections from 24 cases, in which conserved proglottids were recovered, clearly revealed differences in the number of uterine branches. Distinct restriction patterns for T. solium and T. saginata were observed when the PCR products containing the ribosomal 5.8S gene plus internal transcribed spacer regions were digested with either AluI, DdeI, or MboI. Both HE histology and PCR-REA are useful techniques for differentiating T. solium from T. saginata. Importantly, both techniques can be used in zones of endemicity. HE histology is inexpensive and is currently available in most regions of endemicity, and PCR-REA can be performed in most hospital centers already performing PCR without additional equipment or the use of radioactive material. PMID:10618076

  15. Genomic-based restriction enzyme selection for specific detection of Piscirickettsia salmonis by 16S rDNA PCR-RFLP

    Directory of Open Access Journals (Sweden)

    Dinka eMandakovic

    2016-05-01

    Full Text Available The gram negative facultative bacterium P. salmonis is the etiological agent of Salmonid Rickettsial Septicaemia (SRS, a severe disease that causes important economic losses in the global salmon farmer industry. Despite efforts to control this disease, the high frequency of new epizootic events indicate that the vaccine and antibiotics treatments have limited effectiveness, therefore the preventive and diagnostic approaches must be improved. A comparison of several methodologies for SRS diagnostic indicate differences in their specificity and its capacity to detect other bacteria coexisting with P. salmonis in culture media (contamination and fish samples (coinfection, aspects relevant for research, vaccine development and clinical diagnostic. By computer-simulation analyses, we identified a group of restriction enzymes that generate unique P. salmonis 16S rDNA band patterns, distinguishable from all other bacteria. From this information, we designed and developed a PCR-RFLP (Polymerase Chain Reaction - Restriction Fragment Length Polymorphism assay, which was validated using 16S rDNA universal primers and restriction enzyme PmaCI for the amplification and digestion, respectively. Experimental validation was performed by comparing the restriction pattern of P. salmonis with the restriction patterns generated by bacteria that cohabit with P. salmonis (fish bacterial isolates and culture media contaminants. Our results indicate that the restriction enzyme selection pipeline was suitable to design a more specific, sensible, faster and cheaper assay than the currently used P. salmonis detection methodologies.

  16. Rapid restriction enzyme-free cloning of PCR products: a high-throughput method applicable for library construction.

    Directory of Open Access Journals (Sweden)

    Vijay K Chaudhary

    Full Text Available Herein, we describe a novel cloning strategy for PCR-amplified DNA which employs the type IIs restriction endonuclease BsaI to create a linearized vector with four base-long 5'-overhangs, and T4 DNA polymerase treatment of the insert in presence of a single dNTP to create vector-compatible four base-long overhangs. Notably, the insert preparation does not require any restriction enzyme treatment. The BsaI sites in the vector are oriented in such a manner that upon digestion with BsaI, a stuffer sequence along with both BsaI recognition sequences is removed. The sequence of the four base-long overhangs produced by BsaI cleavage were designed to be non-palindromic, non-compatible to each other. Therefore, only ligation of an insert carrying compatible ends allows directional cloning of the insert to the vector to generate a recombinant without recreating the BsaI sites. We also developed rapid protocols for insert preparation and cloning, by which the entire process from PCR to transformation can be completed in 6-8 h and DNA fragments ranging in size from 200 to 2200 bp can be cloned with equal efficiencies. One protocol uses a single tube for insert preparation if amplification is performed using polymerases with low 3'-exonuclease activity. The other protocol is compatible with any thermostable polymerase, including those with high 3'-exonuclease activity, and does not significantly increase the time required for cloning. The suitability of this method for high-throughput cloning was demonstrated by cloning batches of 24 PCR products with nearly 100% efficiency. The cloning strategy is also suitable for high efficiency cloning and was used to construct large libraries comprising more than 108 clones/µg vector. Additionally, based on this strategy, a variety of vectors were constructed for the expression of proteins in E. coli, enabling large number of different clones to be rapidly generated.

  17. A restriction enzyme-powered autonomous DNA walking machine: its application for a highly sensitive electrochemiluminescence assay of DNA

    Science.gov (United States)

    Chen, Ying; Xiang, Yun; Yuan, Ruo; Chai, Yaqin

    2014-12-01

    The construction of a restriction enzyme (Nt.AlwI)-powered DNA walking machine and its application for highly sensitive detection of DNA are described. DNA nanostructure tracks containing four overhang sequences with electrochemiluminescence (ECL) labels and complementary to the walker (target DNA) are self-assembled on the sensing electrode. The walker hybridizes with the complementary sequences on the tracks and forms specific recognition sites for Nt.AlwI, which cleaves the overhang sequences, releases the ECL labels and enables directional movement of the walker along the tracks. The formation of the nanostructure tracks and the Nt.AlwI-assisted cleavage of the overhang sequences in the presence of the walker are verified by using polyacrylamide gel electrophoresis analysis and cyclic voltammetry. The successive movement of the walker on the nanostructure tracks leads to continuous removal of massive ECL labels from the sensing electrode, which results in a significantly amplified suppression of the ECL emission for highly sensitive detection of sequence-specific DNA down to 0.19 pM. Results show that this DNA walking machine can also offer single-base mismatch discrimination capability. The successful application of the DNA walking machine for sequence-specific DNA detection can thus offer new opportunities for molecular machines in biosensing applications.The construction of a restriction enzyme (Nt.AlwI)-powered DNA walking machine and its application for highly sensitive detection of DNA are described. DNA nanostructure tracks containing four overhang sequences with electrochemiluminescence (ECL) labels and complementary to the walker (target DNA) are self-assembled on the sensing electrode. The walker hybridizes with the complementary sequences on the tracks and forms specific recognition sites for Nt.AlwI, which cleaves the overhang sequences, releases the ECL labels and enables directional movement of the walker along the tracks. The formation of the

  18. The role of the methyltransferase domain of bifunctional restriction enzyme RM.BpuSI in cleavage activity.

    Directory of Open Access Journals (Sweden)

    Arthur Sarrade-Loucheur

    Full Text Available Restriction enzyme (REase RM.BpuSI can be described as a Type IIS/C/G REase for its cleavage site outside of the recognition sequence (Type IIS, bifunctional polypeptide possessing both methyltransferase (MTase and endonuclease activities (Type IIC and endonuclease activity stimulated by S-adenosyl-L-methionine (SAM (Type IIG. The stimulatory effect of SAM on cleavage activity presents a major paradox: a co-factor of the MTase activity that renders the substrate unsusceptible to cleavage enhances the cleavage activity. Here we show that the RM.BpuSI MTase activity modifies both cleavage substrate and product only when they are unmethylated. The MTase activity is, however, much lower than that of M1.BpuSI and is thought not to be the major MTase for host DNA protection. SAM and sinefungin (SIN increase the Vmax of the RM.BpuSI cleavage activity with a proportional change in Km, suggesting the presence of an energetically more favorable pathway is taken. We further showed that RM.BpuSI undergoes substantial conformational changes in the presence of Ca(2+, SIN, cleavage substrate and/or product. Distinct conformers are inferred as the pre-cleavage/cleavage state (in the presence of Ca(2+, substrate or both and MTase state (in the presence of SIN and substrate, SIN and product or product alone. Interestingly, RM.BpuSI adopts a unique conformation when only SIN is present. This SIN-bound state is inferred as a branch point for cleavage and MTase activity and an intermediate to an energetically favorable pathway for cleavage, probably through increasing the binding affinity of the substrate to the enzyme under cleavage conditions. Mutation of a SAM-binding residue resulted in altered conformational changes in the presence of substrate or Ca(2+ and eliminated cleavage activity. The present study underscores the role of the MTase domain as facilitator of efficient cleavage activity for RM.BpuSI.

  19. Random amplified polymorphic DNA and restriction enzyme analysis of PCR amplified rDNA in taxonomy: Two identification techniques for food-borne yeasts

    NARCIS (Netherlands)

    Baleiras Couto, M.M.; Vogels, J.T.W.E.; Hofstra, H.; Veld, J.H.J. Huis in't; Vossen, J.M.B.M. van der

    1995-01-01

    The random amplified polymorphic DNA (RAPD) assay and the restriction enzyme analysis of PCR amplified rDNA are compared for the identification of the common spoilage yeasts Zygosaccharomyces bailii, Z. rouxii, Saccharomyces cerevisiae, Candida valida and C. lipolytica. Both techniques proved to be

  20. Moderate dietary sodium restriction added to angiotensin converting enzyme inhibition compared with dual blockade in lowering proteinuria and blood pressure : randomised controlled trial

    NARCIS (Netherlands)

    Slagman, Maartje C. J.; Waanders, Femke; Hemmelder, Marc H.; Woittiez, Arend-Jan; Janssen, Wilbert M. T.; Lambers Heerspink, Hiddo J.; Navis, Gerjan; Laverman, Gozewijn D.

    2011-01-01

    Objective To compare the effects on proteinuria and blood pressure of addition of dietary sodium restriction or angiotensin receptor blockade at maximum dose, or their combination, in patients with non-diabetic nephropathy receiving background treatment with angiotensin converting enzyme (ACE)

  1. Use of PCR-RFLP (Polymerase Chain Reaction - Restricted Fragment Length Polymorphism in the gene of the enzyme Stearoyl-CoA-Desaturase in Bubalus bubalis

    Directory of Open Access Journals (Sweden)

    H. Tonhati

    2010-02-01

    Full Text Available The milk is an important food because it contents Conjugated Linoleic Acids (CLA. These fatty acids are synthesized in mammary gland under action of the enzyme Stearoyl CoA-Desaturase (SCD and have showed some positive effects in human disease prevention and treatments. A variation of CLA in milk fat exists and can be partially explained by the different levels of expression of SCD. The aim was to study part of the encoding regions of SCD´s gene using PCR-RFLP (Polymerase Chain Reaction-Restriction Fragment Length Polymorphism. Genomic DNA was extracted from lactating Murrah females. After this, PCR reactions were made by using primers Z43D1 that encloses exon I, II and intron I. The fragments amplified are composed by 938 pb. Then, RFLP techniques were applied in the fragments using the restriction enzymes Pst I and Sma I. The enzyme Pst I has generated fragments of 788pb and 150bp and the Sma I has generated fragments of 693pb and 245pb. All the animals showed the same migration standard for both enzymes, characterizing a genetic monomorphism for this region of SCD gene. The analysis determined that there aren’t genetic differences between these animals in the studied regions by using Pst I and Sma I enzymes.

  2. Cloning and analysis of a bifunctional methyltransferase/restriction endonuclease TspGWI, the prototype of a Thermus sp. enzyme family

    Directory of Open Access Journals (Sweden)

    Zylicz-Stachula Agnieszka

    2009-05-01

    Full Text Available Abstract Background Restriction-modification systems are a diverse class of enzymes. They are classified into four major types: I, II, III and IV. We have previously proposed the existence of a Thermus sp. enzyme family, which belongs to type II restriction endonucleases (REases, however, it features also some characteristics of types I and III. Members include related thermophilic endonucleases: TspGWI, TaqII, TspDTI, and Tth111II. Results Here we describe cloning, mutagenesis and analysis of the prototype TspGWI enzyme that recognises the 5'-ACGGA-3' site and cleaves 11/9 nt downstream. We cloned, expressed, and mutagenised the tspgwi gene and investigated the properties of its product, the bifunctional TspGWI restriction/modification enzyme. Since TspGWI does not cleave DNA completely, a cloning method was devised, based on amino acid sequencing of internal proteolytic fragments. The deduced amino acid sequence of the enzyme shares significant sequence similarity with another representative of the Thermus sp. family – TaqII. Interestingly, these enzymes recognise similar, yet different sequences in the DNA. Both enzymes cleave DNA at the same distance, but differ in their ability to cleave single sites and in the requirement of S-adenosylmethionine as an allosteric activator for cleavage. Both the restriction endonuclease (REase and methyltransferase (MTase activities of wild type (wt TspGWI (either recombinant or isolated from Thermus sp. are dependent on the presence of divalent cations. Conclusion TspGWI is a bifunctional protein comprising a tandem arrangement of Type I-like domains; particularly noticeable is the central HsdM-like module comprising a helical domain and a highly conserved S-adenosylmethionine-binding/catalytic MTase domain, containing DPAVGTG and NPPY motifs. TspGWI also possesses an N-terminal PD-(D/EXK nuclease domain related to the corresponding domains in HsdR subunits, but lacks the ATP-dependent translocase module

  3. Cloning and analysis of a bifunctional methyltransferase/restriction endonuclease TspGWI, the prototype of a Thermus sp. enzyme family.

    Science.gov (United States)

    Zylicz-Stachula, Agnieszka; Bujnicki, Janusz M; Skowron, Piotr M

    2009-05-29

    Restriction-modification systems are a diverse class of enzymes. They are classified into four major types: I, II, III and IV. We have previously proposed the existence of a Thermus sp. enzyme family, which belongs to type II restriction endonucleases (REases), however, it features also some characteristics of types I and III. Members include related thermophilic endonucleases: TspGWI, TaqII, TspDTI, and Tth111II. Here we describe cloning, mutagenesis and analysis of the prototype TspGWI enzyme that recognises the 5'-ACGGA-3' site and cleaves 11/9 nt downstream. We cloned, expressed, and mutagenised the tspgwi gene and investigated the properties of its product, the bifunctional TspGWI restriction/modification enzyme. Since TspGWI does not cleave DNA completely, a cloning method was devised, based on amino acid sequencing of internal proteolytic fragments. The deduced amino acid sequence of the enzyme shares significant sequence similarity with another representative of the Thermus sp. family - TaqII. Interestingly, these enzymes recognise similar, yet different sequences in the DNA. Both enzymes cleave DNA at the same distance, but differ in their ability to cleave single sites and in the requirement of S-adenosylmethionine as an allosteric activator for cleavage. Both the restriction endonuclease (REase) and methyltransferase (MTase) activities of wild type (wt) TspGWI (either recombinant or isolated from Thermus sp.) are dependent on the presence of divalent cations. TspGWI is a bifunctional protein comprising a tandem arrangement of Type I-like domains; particularly noticeable is the central HsdM-like module comprising a helical domain and a highly conserved S-adenosylmethionine-binding/catalytic MTase domain, containing DPAVGTG and NPPY motifs. TspGWI also possesses an N-terminal PD-(D/E)XK nuclease domain related to the corresponding domains in HsdR subunits, but lacks the ATP-dependent translocase module of the HsdR subunit and the additional domains that

  4. Restriction enzyme improves the efficiency of genetic transformations in Moniliophthora perniciosa, the causal agent of witches’ broom disease in Theobroma cacao

    OpenAIRE

    Francis Julio Fagundes Lopes; Marisa Vieira de Queiroz; Juliana de Oliveira Lima; Viviane Aline Oliveira Silva; Elza Fernandes Araújo

    2008-01-01

    The presence of restriction enzymes in the transformation mixture improved the efficiency of transformation in Moniliophthora perniciosa. The influence of the vector shape (linear or circular), the patterns of plasmid integration in genomic sites and the influence of the promoter used to express the gene marker were also analyzed. The addition of BamHI or NotI increased the number of transformants by 3-10-fold and 3-fold, respectively, over the control without added enzyme. The use of pre-lin...

  5. In silico enhanced restriction enzyme based methylation analysis of the human glioblastoma genome using Agilent 244K CpG Island microarrays

    Directory of Open Access Journals (Sweden)

    Anh Tran

    2010-01-01

    Full Text Available Genome wide methylation profiling of gliomas is likely to provide important clues to improving treatment outcomes. Restriction enzyme based approaches have been widely utilized for methylation profiling of cancer genomes and will continue to have importance in combination with higher density microarrays. With the availability of the human genome sequence and microarray probe sequences, these approaches can be readily characterized and optimized via in silico modeling. We adapted the previously described HpaII/MspI based Methylation Sensitive Restriction Enzyme (MSRE assay for use with two-color Agilent 244K CpG island microarrays. In this assay, fragmented genomic DNA is digested in separate reactions with isoschizomeric HpaII (methylation-sensitive and MspI (methylation-insensitive restriction enzymes. Using in silico hybridization, we found that genomic fragmentation with BfaI was superior to MseI, providing a maximum effective coverage of 22,362 CpG islands in the human genome. In addition, we confirmed the presence of an internal control group of fragments lacking HpaII/MspI sites which enable separation of methylated and unmethylated fragments. We used this method on genomic DNA isolated from normal brain, U87MG cells, and a glioblastoma patient tumor sample and confirmed selected differentially methylated CpG islands using bisulfite sequencing. Along with additional validation points, we performed a receiver operating characteristics (ROC analysis to determine the optimal threshold (p ≤ 0.001. Based on this threshold, we identified ~2400 CpG islands common to all three samples and 145 CpG islands unique to glioblastoma. These data provide more general guidance to individuals seeking to maximize effective coverage using restriction enzyme based methylation profiling approaches.

  6. Effects of realimentation after nutrient restriction during mid- to late gestation on pancreatic digestive enzymes, serum insulin and glucose levels, and insulin-containing cell cluster morphology.

    Science.gov (United States)

    Keomanivong, F E; Camacho, L E; Lemley, C O; Kuemper, E A; Yunusova, R D; Borowicz, P P; Kirsch, J D; Vonnahme, K A; Caton, J S; Swanson, K C

    2017-06-01

    This study examined effects of stage of gestation and nutrient restriction with subsequent realimentation on maternal and foetal bovine pancreatic function. Dietary treatments were assigned on day 30 of pregnancy and included: control (CON; 100% requirements; n = 18) and restricted (R; 60% requirements; n = 30). On day 85, cows were slaughtered (CON, n = 6; R, n = 6), remained on control (CC; n = 12) and restricted (RR; n = 12), or realimented to control (RC; n = 11). On day 140, cows were slaughtered (CC, n = 6; RR, n = 6; RC, n = 5), remained on control (CCC, n = 6; RCC, n = 5) or realimented to control (RRC, n = 6). On day 254, the remaining cows were slaughtered and serum samples were collected from the maternal jugular vein and umbilical cord to determine insulin and glucose concentrations. Pancreases from cows and foetuses were removed, weighed, and subsampled for enzyme and histological analysis. As gestation progressed, maternal pancreatic α-amylase activity decreased and serum insulin concentrations increased (p ≤ 0.03). Foetal pancreatic trypsin activity increased (p enzymes are influenced by nutrient restriction and there is a potential for programming of increased foetal digestive enzyme production resulting from previous maternal nutrient restriction. Journal of Animal Physiology and Animal Nutrition © 2016 Blackwell Verlag GmbH.

  7. Identification and characterization of CbeI, a novel thermostable restriction enzyme from Caldicellulosiruptor bescii DSM 6725 and a member of a new subfamily of HaeIII-like enzymes.

    Science.gov (United States)

    Chung, Dae-Hwan; Huddleston, Jennifer R; Farkas, Joel; Westpheling, Janet

    2011-11-01

    Potent HaeIII-like DNA restriction activity was detected in cell-free extracts of Caldicellulosiruptor bescii DSM 6725 using plasmid DNA isolated from Escherichia coli as substrate. Incubation of the plasmid DNA in vitro with HaeIII methyltransferase protected it from cleavage by HaeIII nuclease as well as cell-free extracts of C. bescii. The gene encoding the putative restriction enzyme was cloned and expressed in E. coli with a His-tag at the C-terminus. The purified protein was 38 kDa as predicted by the 981-bp nucleic acid sequence, was optimally active at temperatures between 75°C and 85°C, and was stable for more than 1 week when stored at 35°C. The cleavage sequence was determined to be 5'-GG/CC-3', indicating that CbeI is an isoschizomer of HaeIII. A search of the C. bescii genome sequence revealed the presence of both a HaeIII-like restriction endonuclease (Athe 2438) and DNA methyltransferase (Athe 2437). Preliminary analysis of other Caldicellulosiruptor species suggested that this restriction/modification activity is widespread in this genus. A phylogenetic analysis based on sequence alignment and conserved motif searches identified features of CbeI distinct from other members of this group and classified CbeI as a member of a novel subfamily of HaeIII-like enzymes.

  8. Applying Data Mining to Classify Age by Intestinal Microbiota in 92 Healthy Men Using a Combination of Several Restriction Enzymes for T-RFLP Experiments.

    Science.gov (United States)

    Kobayashi, Toshio; Osaki, Takako; Oikawa, Shinya

    2014-01-01

    The composition of the intestinal microbiota was measured following consumption of identical meals for 3 days in 92 Japanese men, and terminal restriction fragment length polymorphism (T-RFLP) was used to analyze their feces. The obtained operational taxonomic units (OTUs) and the subjects' ages were classified by using Data mining (DM) software that compared these data with continuous data and for 5 partitions for age divided at 5 years intervals between the ages of 30 and 50. The DM provided Decision trees in which the selected OTUs were closely related to the ages of the subjects. DM was also used to compare the OTUs from the T-RFLP data with seven restriction enzymes (two enzymes of 516f-BslI and 516f-HaeIII, two enzymes of 27f-MspI and 27f-AluI, three enzymes of 35f-HhaI, 35f-MspI and 35f-AluI) and their various combinations. The OTUs delivered from the five enzyme-digested partitions were analyzed to classify their age clusters. For use in future DM processing, we discussed the enzymes that were effective for accurate classification. We selected two OTUs (HA624 and HA995) that were useful for classifying the subject's ages. Depending on the 16S rRNA sequences of the OTUs, Ruminicoccus obeum clones 1-4 were present in 18 of 36 bacterial candidates in the older age group-related OTU (HA624). On the other hand, Ruminicoccus obeum clones 1-33 were present in 65 of 269 candidates in the younger age group-related OUT (HA995).

  9. The Synergistic Effect of Dietary Calcium Restriction and Exhaustive Exercise on the Antioxioxidant Enzyme System in Rat Heart

    OpenAIRE

    Hiromi, MIYAZAKI; Shuji, OH-ISHI; Tomomi, OOKAWARA; Kasumigaura Hospital, Tokyo Medical University; Department of Biochemistry, Hyogo College of Medicine; Research Center of Health, Physical Fitness and Sports, Nagoya University; Institute of Health and Sport Sciences, University of Tsukuba; Department of Hygiene, Kyorin University

    2000-01-01

    The purpose of the current study was to elucidate whether dietary calcium restriction enhances exercise-induced oxidative stress in rat heart. Twenty-four male Wistar rats were assigned randomly to either the control (C) or the calcium-restricted (1 month)(R) rats. Each group was subdivided into non-exercised (CR, RR) or acutely exercised (CE, RE) groups. The level of thiobarbituric acid-reactive substances (TBARS), a marker of lipid peroxidation, was significantly greater in the RR rats than...

  10. Influence of nutrient restriction and melatonin supplementation of pregnant ewes on maternal and fetal pancreatic digestive enzymes and insulin-containing clusters.

    Science.gov (United States)

    Keomanivong, F E; Lemley, C O; Camacho, L E; Yunusova, R; Borowicz, P P; Caton, J S; Meyer, A M; Vonnahme, K A; Swanson, K C

    2016-03-01

    Primiparous ewes (n=32) were assigned to dietary treatments in a 2×2 factorial arrangement to determine effects of nutrient restriction and melatonin supplementation on maternal and fetal pancreatic weight, digestive enzyme activity, concentration of insulin-containing clusters and plasma insulin concentrations. Treatments consisted of nutrient intake with 60% (RES) or 100% (ADQ) of requirements and melatonin supplementation at 0 (CON) or 5 mg/day (MEL). Treatments began on day 50 of gestation and continued until day 130. On day 130, blood was collected under general anesthesia from the uterine artery, uterine vein, umbilical artery and umbilical vein for plasma insulin analysis. Ewes were then euthanized and the pancreas removed from the ewe and fetus, trimmed of mesentery and fat, weighed and snap-frozen until enzyme analysis. In addition, samples of pancreatic tissue were fixed in 10% formalin solution for histological examination including quantitative characterization of size and distribution of insulin-containing cell clusters. Nutrient restriction decreased (P⩽0.001) maternal pancreatic mass (g) and α-amylase activity (U/g, kU/pancreas, U/kg BW). Ewes supplemented with melatonin had increased pancreatic mass (P=0.03) and α-amylase content (kU/pancreas and U/kg BW). Melatonin supplementation decreased (P=0.002) maternal pancreatic insulin-positive tissue area (relative to section of tissue), and size of the largest insulin-containing cell cluster (P=0.04). Nutrient restriction decreased pancreatic insulin-positive tissue area (P=0.03) and percent of large (32 001 to 512 000 µm2) and giant (⩾512 001 µm2) insulin-containing cell clusters (P=0.04) in the fetus. Insulin concentrations in plasma from the uterine vein, umbilical artery and umbilical vein were greater (P⩽0.01) in animals receiving 100% requirements. When comparing ewes to fetuses, ewes had a greater percentage of medium insulin-containing cell clusters (2001 to 32 000 µm2) while fetuses

  11. Comparison of time-restricted and ad libitum self-feeding on the growth, feeding behavior and daily digestive enzyme profiles of Atlantic salmon

    Science.gov (United States)

    Shi, Ce; Liu, Ying; Yi, Mengmeng; Zheng, Jimeng; Tian, Huiqin; Du, Yishuai; Li, Xian; Sun, Guoxiang

    2017-07-01

    Although it has been hypothesized that a predictable feeding regime in animals allows physiological variables to be adjusted to maximize nutrient utilization and, hence, better growth performance, the assumption has rarely been tested. This study compares the effects of time-restricted versus free access self-feeding on the growth, feeding behavior and daily digestive enzyme rhythms of Atlantic salmon ( Salmo salar). In an experiment that lasted 6 weeks, fish (109.9 g) were divided into two groups: group 1 had free access to a self-feeder (FA); group 2 received three meals per day (2 h per meal) at dawn, midday and dusk via a time-restricted self-feeder (TR). At the end of the experiment, the fish were sampled every 3 h over a 24-h period. The results showed that the TR fish quickly synchronized their feeding behavior to the feeding window and their blood glucose showed a significant postprandial increase, while FA fish displayed no statistically significant rhythms ( P>0.05). Pepsin activity of TR fish also showed a significant daily rhythm ( P0.05). In conclusion, the study failed to confirm a link between the entrainment of daily digestive enzyme profiles and growth performance, with the TR group showing comparatively poor blood glucose regulation.

  12. Use of T-RFLP and seven restriction enzymes to compare the faecal microbiota of obese and lean Japanese healthy men.

    Science.gov (United States)

    Kobayashi, T; Osaki, T; Oikawa, S

    2015-01-01

    The composition of the intestinal microbiota of 92 healthy Japanese men was measured following consumption of identical meals for 3 days; terminal restriction fragment length polymorphisms were then used to analyse the DNA content of their faeces. The obtained operational taxonomic units (OTUs) were further analysed using seven restriction enzymes: 516f-BslI and -HaeIII, 27f-MspI and -AluI, and 35f-HhaI, -MspI and -AluI. Subjects were classified by their body mass index (BMI) as lean (25.0). OTUs were then analysed using data mining software. Pearson correlation coefficients on data mining results indicated only a weak relationship between BMI and OTU diversity. Specific OTUs attributed to lean and obese subjects were further examined by data mining with six groups of enzymes and closely related accession numbers for lean and obese subjects were successfully narrowed down. 16S rRNA sequences showed Bacillus spp., Erysipelothrix spp. and Holdemania spp. to be present among 30 bacterial candidates related to the lean group. Fifteen candidates were classified Firmicutes, one was classified as Chloroflexi, and the others were not classified. 45 Microbacteriaceae, 11 uncultured Actinobacterium, and 3 other families were present among the 119 candidate OTUs related to obesity. We conclude that the presence of Firmicutes and Actinobacteria may be related to the BMI of the subject.

  13. DNA of a circular minichromosome linearized by restriction enzymes or other reagents is resistant to further cleavage: an influence of chromatin topology on the accessibility of DNA.

    Science.gov (United States)

    Kumala, Sławomir; Hadj-Sahraoui, Yasmina; Rzeszowska-Wolny, Joanna; Hancock, Ronald

    2012-10-01

    The accessibility of DNA in chromatin is an essential factor in regulating its activities. We studied the accessibility of the DNA in a ∼170 kb circular minichromosome to DNA-cleaving reagents using pulsed-field gel electrophoresis and fibre-fluorescence in situ hybridization on combed DNA molecules. Only one of several potential sites in the minichromosome DNA was accessible to restriction enzymes in permeabilized cells, and in growing cells only a single site at an essentially random position was cut by poisoned topoisomerase II, neocarzinostatin and γ-radiation, which have multiple potential cleavage sites; further sites were then inaccessible in the linearized minichromosomes. Sequential exposure to combinations of these reagents also resulted in cleavage at only a single site. Minichromosome DNA containing single-strand breaks created by a nicking endonuclease to relax any unconstrained superhelicity was also cut at only a single position by a restriction enzyme. Further sites became accessible after ≥95% of histones H2A, H2B and H1, and most non-histone proteins were extracted. These observations suggest that a global rearrangement of the three-dimensional packing and interactions of nucleosomes occurs when a circular minichromosome is linearized and results in its DNA becoming inaccessible to probes.

  14. Characterization of the restriction enzyme-like endonuclease encoded by the Entamoeba histolytica non-long terminal repeat retrotransposon EhLINE1.

    Science.gov (United States)

    Yadav, Vijay Pal; Mandal, Prabhat Kumar; Rao, Desirazu N; Bhattacharya, Sudha

    2009-12-01

    The genome of the human pathogen Entamoeba histolytica, a primitive protist, contains non-long terminal repeat retrotransposable elements called EhLINEs. These encode reverse transcriptase and endonuclease required for retrotransposition. The endonuclease shows sequence similarity with bacterial restriction endonucleases. Here we report the salient enzymatic features of one such endonuclease. The kinetics of an EhLINE1-encoded endonuclease catalyzed reaction, determined under steady-state and single-turnover conditions, revealed a significant burst phase followed by a slower steady-state phase, indicating that release of product could be the slower step in this reaction. For circular supercoiled DNA the K(m) was 2.6 x 10(-8) M and the k(cat) was 1.6 x 10(-2) sec(-1). For linear E. histolytica DNA substrate the K(m) and k(cat) values were 1.3 x 10(-8) M and 2.2 x 10(-4) sec(-1) respectively. Single-turnover reaction kinetics suggested a noncooperative mode of hydrolysis. The enzyme behaved as a monomer. While Mg(2+) was required for activity, 60% activity was seen with Mn(2+) and none with other divalent metal ions. Substitution of PDX(12-14)D (a metal-binding motif) with PAX(12-14)D caused local conformational change in the protein tertiary structure, which could contribute to reduced enzyme activity in the mutated protein. The protein underwent conformational change upon the addition of DNA, which is consistent with the known behavior of restriction endonucleases. The similarities with bacterial restriction endonucleases suggest that the EhLINE1-encoded endonuclease was possibly acquired from bacteria through horizontal gene transfer. The loss of strict sequence specificity for nicking may have been subsequently selected to facilitate spread of the retrotransposon to intergenic regions of the E. histolytica genome.

  15. Growth hormone genotyping by MspI restriction enzyme and PCR-RFLP method in Aceh cattle breed at Indrapuri District, Aceh Province, Indonesia

    Directory of Open Access Journals (Sweden)

    WIDYA PINTAKA BAYU PUTRA

    2014-04-01

    Full Text Available Putra WPB, Hartatik T, Sumadi. 2014. Growth hormone genotyping by MspI restriction enzyme and PCR-RFLP method in Aceh cattle breed at Indrapuri District, Aceh Province, Indonesia. Biodiversitas 15: 1-5. The objective of this research was to identify growth hormone (GH gene in Aceh cattle at Indrapuri’s Breeding and Forage Centre (IBFC of Aceh Cattle. Fourty one cattle consisting of 21 male and 20 female cattle were used in this study. Polymerase Chain Reaction (PCR - Restriction Fragment Length Polymorphism (RFLP and sequencing method was used to detect MspI site on GH gene. Based on the sequencing, it can be concluded that all cattle were monomorphic. The frequency of TT genotype and T allele were 1.00 relatively. The transition of C (cytosine into T (thymine on 1549 position caused the lost of restriction site. The insertion of T and G (guanine on 1542 and 1552 position caused the length of GH gene were 329 bp in Aceh cattle.

  16. Structure, Mechanism, and Specificity of a Eukaryal tRNA Restriction Enzyme Involved in Self-Nonself Discrimination

    Directory of Open Access Journals (Sweden)

    Anupam K. Chakravarty

    2014-04-01

    Full Text Available tRNA restriction by anticodon nucleases underlies cellular stress responses and self-nonself discrimination in a wide range of taxa. Anticodon breakage inhibits protein synthesis, which, in turn, results in growth arrest or cell death. The eukaryal ribotoxin PaT secreted by Pichia acaciae inhibits growth of Saccharomyces cerevisiae via cleavage of tRNAGln(UUG. We find that recombinant PaT incises a synthetic tRNAGln(UUG stem-loop RNA by transesterification at a single site 3′ of the wobble uridine, yielding 2′,3′-cyclic phosphate and 5′-OH ends. Incision is suppressed by replacement of the wobble nucleobase with adenine or guanine. The crystal structure of PaT reveals a distinctive fold and active site, essential components of which are demonstrated by mutagenesis. Pichia acaciae evades self-toxicity via a distinctive intracellular immunity protein, ImmPaT, which binds PaT and blocks nuclease activity. Our results highlight the evolutionary diversity of tRNA restriction and immunity systems.

  17. Hemolysis, Elevated Liver Enzymes, and Low Platelets, Severe Fetal Growth Restriction, Postpartum Subarachnoid Hemorrhage, and Craniotomy: A Rare Case Report and Systematic Review.

    Science.gov (United States)

    Rezai, Shadi; Faye, Justin; Hughes, Alexander; Cheung, Mon-Lai; Cohen, Joel R; Kaia, Judy A; Fuller, Paul N; Henderson, Cassandra E

    2017-01-01

    Introduction . Hemolysis, elevated liver enzymes, and low platelets (HELLP) syndrome is a relatively uncommon but traumatic condition occurring in the later stage of pregnancy as a complication of severe preeclampsia or eclampsia. Prompt brain computed tomography (CT) or magnetic resonance imaging (MRI) and a multidisciplinary management approach are required to improve perinatal outcome. Case . A 37-year-old, Gravida 6, Para 1-0-4-1, Hispanic female with a history of chronic hypertension presented at 26 weeks and 6 days of gestational age. She was noted to have hemolysis, elevated liver enzymes, and low platelets (HELLP) syndrome accompanied by fetal growth restriction (FGR), during ultrasound evaluation, warranting premature delivery. The infant was delivered in stable condition suffering no permanent neurological deficit. Conclusion . HELLP syndrome is an uncommon and traumatic obstetric event which can lead to neurological deficits if not managed in a responsive and rapid manner. The central aggravating factor seems to be hypertension induced preeclamptic or eclamptic episode and complications thereof. The syndrome itself is manifested by hemolytic anemia, increased liver enzymes, and decreasing platelet counts with a majority of neurological defects resulting from hemorrhagic stroke or subarachnoid hemorrhage (SAH). To minimize adverse perinatal outcomes, obstetric management of this medical complication must include rapid clinical assessment, diagnostic examination, and neurosurgery consultation.

  18. Hemolysis, Elevated Liver Enzymes, and Low Platelets, Severe Fetal Growth Restriction, Postpartum Subarachnoid Hemorrhage, and Craniotomy: A Rare Case Report and Systematic Review

    Directory of Open Access Journals (Sweden)

    Shadi Rezai

    2017-01-01

    Full Text Available Introduction. Hemolysis, elevated liver enzymes, and low platelets (HELLP syndrome is a relatively uncommon but traumatic condition occurring in the later stage of pregnancy as a complication of severe preeclampsia or eclampsia. Prompt brain computed tomography (CT or magnetic resonance imaging (MRI and a multidisciplinary management approach are required to improve perinatal outcome. Case. A 37-year-old, Gravida 6, Para 1-0-4-1, Hispanic female with a history of chronic hypertension presented at 26 weeks and 6 days of gestational age. She was noted to have hemolysis, elevated liver enzymes, and low platelets (HELLP syndrome accompanied by fetal growth restriction (FGR, during ultrasound evaluation, warranting premature delivery. The infant was delivered in stable condition suffering no permanent neurological deficit. Conclusion. HELLP syndrome is an uncommon and traumatic obstetric event which can lead to neurological deficits if not managed in a responsive and rapid manner. The central aggravating factor seems to be hypertension induced preeclamptic or eclamptic episode and complications thereof. The syndrome itself is manifested by hemolytic anemia, increased liver enzymes, and decreasing platelet counts with a majority of neurological defects resulting from hemorrhagic stroke or subarachnoid hemorrhage (SAH. To minimize adverse perinatal outcomes, obstetric management of this medical complication must include rapid clinical assessment, diagnostic examination, and neurosurgery consultation.

  19. Fusion of GFP to the M.EcoKI DNA methyltransferase produces a new probe of Type I DNA restriction and modification enzymes

    Energy Technology Data Exchange (ETDEWEB)

    Chen, Kai; Roberts, Gareth A.; Stephanou, Augoustinos S.; Cooper, Laurie P.; White, John H. [School of Chemistry, University of Edinburgh, The King' s Buildings, Edinburgh, EH9 3JJ (United Kingdom); Dryden, David T.F., E-mail: david.dryden@ed.ac.uk [School of Chemistry, University of Edinburgh, The King' s Buildings, Edinburgh, EH9 3JJ (United Kingdom)

    2010-07-23

    Research highlights: {yields} Successful fusion of GFP to M.EcoKI DNA methyltransferase. {yields} GFP located at C-terminal of sequence specificity subunit does not later enzyme activity. {yields} FRET confirms structural model of M.EcoKI bound to DNA. -- Abstract: We describe the fusion of enhanced green fluorescent protein to the C-terminus of the HsdS DNA sequence-specificity subunit of the Type I DNA modification methyltransferase M.EcoKI. The fusion expresses well in vivo and assembles with the two HsdM modification subunits. The fusion protein functions as a sequence-specific DNA methyltransferase protecting DNA against digestion by the EcoKI restriction endonuclease. The purified enzyme shows Foerster resonance energy transfer to fluorescently-labelled DNA duplexes containing the target sequence and to fluorescently-labelled ocr protein, a DNA mimic that binds to the M.EcoKI enzyme. Distances determined from the energy transfer experiments corroborate the structural model of M.EcoKI.

  20. Mapping DNA cleavage by the Type ISP restriction-modification enzymes following long-range communication between DNA sites in different orientations.

    Science.gov (United States)

    van Aelst, Kara; Saikrishnan, Kayarat; Szczelkun, Mark D

    2015-12-02

    The prokaryotic Type ISP restriction-modification enzymes are single-chain proteins comprising an Mrr-family nuclease, a superfamily 2 helicase-like ATPase, a coupler domain, a methyltransferase, and a DNA-recognition domain. Upon recognising an unmodified DNA target site, the helicase-like domain hydrolyzes ATP to cause site release (remodeling activity) and to then drive downstream translocation consuming 1-2 ATP per base pair (motor activity). On an invading foreign DNA, double-strand breaks are introduced at random wherever two translocating enzymes form a so-called collision complex following long-range communication between a pair of target sites in inverted (head-to-head) repeat. Paradoxically, structural models for collision suggest that the nuclease domains are too far apart (>30 bp) to dimerise and produce a double-strand DNA break using just two strand-cleavage events. Here, we examined the organisation of different collision complexes and how these lead to nuclease activation. We mapped DNA cleavage when a translocating enzyme collides with a static enzyme bound to its site. By following communication between sites in both head-to-head and head-to-tail orientations, we could show that motor activity leads to activation of the nuclease domains via distant interactions of the helicase or MTase-TRD. Direct nuclease dimerization is not required. To help explain the observed cleavage patterns, we also used exonuclease footprinting to demonstrate that individual Type ISP domains can swing off the DNA. This study lends further support to a model where DNA breaks are generated by multiple random nicks due to mobility of a collision complex with an overall DNA-binding footprint of ∼30 bp. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.

  1. Short-term calorie restriction feminizes the mRNA profiles of drug metabolizing enzymes and transporters in livers of mice.

    Science.gov (United States)

    Fu, Zidong Donna; Klaassen, Curtis D

    2014-01-01

    Calorie restriction (CR) is one of the most effective anti-aging interventions in mammals. A modern theory suggests that aging results from a decline in detoxification capabilities and thus accumulation of damaged macromolecules. The present study aimed to determine how short-term CR alters mRNA profiles of genes that encode metabolism and detoxification machinery in the liver. Male C57BL/6 mice were fed CR (0, 15, 30, or 40%) diets for one month, followed by mRNA quantification of 98 xenobiotic processing genes (XPGs) in the liver, including 7 uptake transporters, 39 phase-I enzymes, 37 phase-II enzymes, 10 efflux transporters, and 5 transcription factors. In general, 15% CR did not alter mRNAs of most XPGs, whereas 30 and 40% CR altered over half of the XPGs (32 increased and 29 decreased). CR up-regulated some phase-I enzymes (fold increase), such as Cyp4a14 (12), Por (2.3), Nqo1 (1.4), Fmo2 (5.4), and Fmo3 (346), and numerous number of phase-II enzymes, such as Sult1a1 (1.2), Sult1d1 (2.0), Sult1e1 (33), Sult3a1 (2.2), Gsta4 (1.3), Gstm2 (1.3), Gstm3 (1.7), and Mgst3 (2.2). CR feminized the mRNA profiles of 32 XPGs in livers of male mice. For instance, CR decreased the male-predominantly expressed Oatp1a1 (97%) and increased the female-predominantly expressed Oatp1a4 (11). In conclusion, short-term CR alters the mRNA levels of over half of the 98 XPGs quantified in livers of male mice, and over half of these alterations appear to be due to feminization of the liver. Copyright © 2013 Elsevier Inc. All rights reserved.

  2. Mapping DNA cleavage by the Type ISP restriction-modification enzymes following long-range communication between DNA sites in different orientations

    Science.gov (United States)

    van Aelst, Kara; Saikrishnan, Kayarat; Szczelkun, Mark D.

    2015-01-01

    The prokaryotic Type ISP restriction-modification enzymes are single-chain proteins comprising an Mrr-family nuclease, a superfamily 2 helicase-like ATPase, a coupler domain, a methyltransferase, and a DNA-recognition domain. Upon recognising an unmodified DNA target site, the helicase-like domain hydrolyzes ATP to cause site release (remodeling activity) and to then drive downstream translocation consuming 1–2 ATP per base pair (motor activity). On an invading foreign DNA, double-strand breaks are introduced at random wherever two translocating enzymes form a so-called collision complex following long-range communication between a pair of target sites in inverted (head-to-head) repeat. Paradoxically, structural models for collision suggest that the nuclease domains are too far apart (>30 bp) to dimerise and produce a double-strand DNA break using just two strand-cleavage events. Here, we examined the organisation of different collision complexes and how these lead to nuclease activation. We mapped DNA cleavage when a translocating enzyme collides with a static enzyme bound to its site. By following communication between sites in both head-to-head and head-to-tail orientations, we could show that motor activity leads to activation of the nuclease domains via distant interactions of the helicase or MTase-TRD. Direct nuclease dimerization is not required. To help explain the observed cleavage patterns, we also used exonuclease footprinting to demonstrate that individual Type ISP domains can swing off the DNA. This study lends further support to a model where DNA breaks are generated by multiple random nicks due to mobility of a collision complex with an overall DNA-binding footprint of ∼30 bp. PMID:26507855

  3. Diagnosis of mitochondrial encephalomyopathy, lactic acidosis, and stroke-like episodes in a Chinese family by PCR/restriction enzyme analysis

    Science.gov (United States)

    Lam, C W; Jain, K; Chan, K Y; Silva, D K; Chan, Y W; Wong, L J C

    1995-01-01

    The clinical presentation and the biochemical and molecular genetic findings are described in a 13 year old Chinese boy with MELAS (mitochondrial encephalomyopathy, lactic acidosis, and stroke-like episodes). The diagnosis was initially suspected because of the characteristic clinical features and the strong family history of convulsions. Using polymerase chain reaction—restriction enzyme analysis, the heteroplasmic nt3243 A→G mutation in mtDNA of peripheral blood leucocytes and a muscle sample was demonstrated. The oligosymptomatic relatives were then screened by this method and the degree of heteroplasmy was analysed. This appears to be the first report of a MELAS family in Hong Kong with this described mutation. Molecular genetic techniques are advantageous in the diagnosis of MELAS. Images PMID:16696023

  4. Use of Single-enzyme PCR-restriction Digestion Barcode Targeting the Internal Transcribed Spacers (ITS rDNA) to Identify Dermatophyte Species.

    Science.gov (United States)

    Rezaei-Matehkolaei, A; Makimura, K; Shidfar, Mr; Zaini, F; Eshraghian, Mr; Jalalizand, N; Nouripour-Sisakht, S; Hosseinpour, L; Mirhendi, H

    2012-01-01

    Dermatophytes are the most common causative agents of superficial mycoses. Species identification of these fungi is important from therapeutic and epidemiological point of wive. Traditional approaches for identification of dermatophytes at the species level, relying on macroscopic and microscopic features of the colonies, usually are time-consuming and unreliable in many circumstances. Recently a broad varieties of rapid and accurate DNA-based techniques were successfuly utilized for species delineation of dermatophytes. The ITS1-5.8S-ITS2 region of rDNA from various reference strains of dermatophyte species were amplified using the universal fungal primers ITS1 and ITS4.The PCR products were digested by a single restriction enzyme, MvaI. The enzyme was evaluated in both in silico and practical PCR-RFLP assay to find the exact differentiating restriction profiles for each species. To validate the standardized PCR-RFLP system, all tested strains were subjected to sequencing and sequence analysis. The obtained RFLP patterns were specific for many species including T. interdigitale, T. rubrum, T. violaceum, M. persicolor, M. audouinii, M. nanum (A. obtusum) and E. floccosum but were similar for some closely related species such as M. canis / M. ferrugineum. Sequencing of the ITS1-5.8S-ITS2 fragment from all type strains affirmed the RFLP findings. It was practically revealed that the ITS-PCR followed by MvaI-RFLP is a useful and reliable schema for identification and differentiation of several pathogenic species and can be used for rapid screening of even closely related species of dermatophytes in clinical and epidemiological settings.

  5. Effect of L-arginine supplementation on the hepatic phosphatidylinositol 3-kinase signaling pathway and gluconeogenic enzymes in early intrauterine growth-restricted rats.

    Science.gov (United States)

    Luo, Kaiju; Chen, Pingyang; Li, Suping; Li, Wen; He, Mingfeng; Wang, Tao; Chen, Juncao

    2017-09-01

    The present study aimed to investigate the response of the phosphatidylinositol 3-kinase (PI3K) signaling pathway and gluconeogenic enzymes in intrauterine growth-restricted rats to dietary L-arginine (L-Arg) supplementation during the lactation period early in life. Pregnant Sprague-Dawley rats were randomly divided into a control group (CON), an intrauterine growth restriction group (IUGR) and an L-Arg group (LA). The pregnant rats in the CON group were fed a 21% protein diet, and those in the IUGR and LA groups were fed a 10% low protein diet, and all rats were fed a 21% protein diet after delivery. Water was available ad libitum to the pregnant rats during the 21-day lactation period, and the water provided to the LA group included 200 mg/kg/day L-Arg. Blood glucose, serum insulin, homeostasis model of assessment for insulin resistance (HOMA-IR), PI3K and protein kinase B (PKB) protein expression, and phosphoenolpyruvate carboxykinase (PEPCK) and glucose-6-phosphatase (G-6-Pase) mRNA expression in the offspring rats were measured postnatally at 1, 3 and 8 weeks. No significant difference in blood glucose, serum insulin and HOMA-IR were identified at any time point among the three groups. PI3K and PKB expression was lower in the IUGR group offspring compared with that in the CON group offspring, but both were increased by dietary L-Arg supplementation. PEPCK mRNA and G-6-Pase mRNA expression levels in the offspring of the IUGR group were higher compared with those in the CON group but were downregulated following L-Arg supplementation. These results suggest that dietary L-Arg supplementation during the early lactation period promoted catch-up growth and reversed abnormalities in hepatic insulin signaling and gene expression of gluconeogenic enzymes in IUGR offspring rats.

  6. Genetic relationships between clinical and non-clinical strains of Yersinia enterocolitica biovar 1A as revealed by multilocus enzyme electrophoresis and multilocus restriction typing

    Science.gov (United States)

    2010-01-01

    Background Genetic relationships among 81 strains of Y. enterocolitica biovar 1A isolated from clinical and non-clinical sources were discerned by multilocus enzyme electrophoresis (MLEE) and multilocus restriction typing (MLRT) using six loci each. Such studies may reveal associations between the genotypes of the strains and their sources of isolation. Results All loci were polymorphic and generated 62 electrophoretic types (ETs) and 12 restriction types (RTs). The mean genetic diversity (H) of the strains by MLEE and MLRT was 0.566 and 0.441 respectively. MLEE (DI = 0.98) was more discriminatory and clustered Y. enterocolitica biovar 1A strains into four groups, while MLRT (DI = 0.77) identified two distinct groups. BURST (Based Upon Related Sequence Types) analysis of the MLRT data suggested aquatic serotype O:6,30-6,31 isolates to be the ancestral strains from which, clinical O:6,30-6,31 strains might have originated by host adaptation and genetic change. Conclusion MLEE revealed greater genetic diversity among strains of Y. enterocolitica biovar 1A and clustered strains in four groups, while MLRT grouped the strains into two groups. BURST analysis of MLRT data nevertheless provided newer insights into the probable evolution of clinical strains from aquatic strains. PMID:20509911

  7. Genetic relationships between clinical and non-clinical strains of Yersinia enterocolitica biovar 1A as revealed by multilocus enzyme electrophoresis and multilocus restriction typing

    Directory of Open Access Journals (Sweden)

    Virdi Jugsharan S

    2010-05-01

    Full Text Available Abstract Background Genetic relationships among 81 strains of Y. enterocolitica biovar 1A isolated from clinical and non-clinical sources were discerned by multilocus enzyme electrophoresis (MLEE and multilocus restriction typing (MLRT using six loci each. Such studies may reveal associations between the genotypes of the strains and their sources of isolation. Results All loci were polymorphic and generated 62 electrophoretic types (ETs and 12 restriction types (RTs. The mean genetic diversity (H of the strains by MLEE and MLRT was 0.566 and 0.441 respectively. MLEE (DI = 0.98 was more discriminatory and clustered Y. enterocolitica biovar 1A strains into four groups, while MLRT (DI = 0.77 identified two distinct groups. BURST (Based Upon Related Sequence Types analysis of the MLRT data suggested aquatic serotype O:6,30-6,31 isolates to be the ancestral strains from which, clinical O:6,30-6,31 strains might have originated by host adaptation and genetic change. Conclusion MLEE revealed greater genetic diversity among strains of Y. enterocolitica biovar 1A and clustered strains in four groups, while MLRT grouped the strains into two groups. BURST analysis of MLRT data nevertheless provided newer insights into the probable evolution of clinical strains from aquatic strains.

  8. Effectiveness of annealing blocking primers versus restriction enzymes for characterization of generalist diets: unexpected prey revealed in the gut contents of two coral reef fish species.

    Science.gov (United States)

    Leray, Matthieu; Agudelo, Natalia; Mills, Suzanne C; Meyer, Christopher P

    2013-01-01

    Characterization of predator-prey interactions is challenging as researchers have to rely on indirect methods that can be costly, biased and too imprecise to elucidate the complexity of food webs. DNA amplification and sequencing techniques of gut and fecal contents are promising approaches, but their success largely depends on the ability to amplify the taxonomic array of prey consumed and then match prey amplicons with reference sequences. When little a priori information on diet is available or a generalist predator is targeted, versatile primer sets (also referred to as universal or general primers) as opposed to group- or species-specific primer sets are the most powerful to unveil the full range of prey consumed. However, versatile primers are likely to preferentially amplify the predominant, less degraded predator DNA if no manipulation is performed to exclude this confounding DNA template. In this study we compare two approaches that eliminate the confounding predator template: restriction digestion and the use of annealing blocking primers. First, we use a preliminary DNA barcode library provided by the Moorea BIOCODE project to 1) evaluate the cutting frequency of commercially available restriction enzymes and 2) design predator specific annealing blocking primers. We then compare the performance of the two predator removal strategies for the detection of prey templates using two versatile primer sets from the gut contents of two generalist coral reef fish species sampled in Moorea. Our study demonstrates that blocking primers should be preferentially used over restriction digestion for predator DNA removal as they recover greater prey diversity. We also emphasize that a combination of versatile primers may be required to best represent the breadth of a generalist's diet.

  9. Effectiveness of annealing blocking primers versus restriction enzymes for characterization of generalist diets: unexpected prey revealed in the gut contents of two coral reef fish species.

    Directory of Open Access Journals (Sweden)

    Matthieu Leray

    Full Text Available Characterization of predator-prey interactions is challenging as researchers have to rely on indirect methods that can be costly, biased and too imprecise to elucidate the complexity of food webs. DNA amplification and sequencing techniques of gut and fecal contents are promising approaches, but their success largely depends on the ability to amplify the taxonomic array of prey consumed and then match prey amplicons with reference sequences. When little a priori information on diet is available or a generalist predator is targeted, versatile primer sets (also referred to as universal or general primers as opposed to group- or species-specific primer sets are the most powerful to unveil the full range of prey consumed. However, versatile primers are likely to preferentially amplify the predominant, less degraded predator DNA if no manipulation is performed to exclude this confounding DNA template. In this study we compare two approaches that eliminate the confounding predator template: restriction digestion and the use of annealing blocking primers. First, we use a preliminary DNA barcode library provided by the Moorea BIOCODE project to 1 evaluate the cutting frequency of commercially available restriction enzymes and 2 design predator specific annealing blocking primers. We then compare the performance of the two predator removal strategies for the detection of prey templates using two versatile primer sets from the gut contents of two generalist coral reef fish species sampled in Moorea. Our study demonstrates that blocking primers should be preferentially used over restriction digestion for predator DNA removal as they recover greater prey diversity. We also emphasize that a combination of versatile primers may be required to best represent the breadth of a generalist's diet.

  10. Short-term calorie restriction feminizes the mRNA profiles of drug metabolizing enzymes and transporters in livers of mice

    Energy Technology Data Exchange (ETDEWEB)

    Fu, Zidong Donna [Department of Pharmacology, Toxicology, and Therapeutics, University of Kansas Medical Center, Kansas City, KS 66160 (United States); Klaassen, Curtis D., E-mail: cklaasse@kumc.edu [Department of Internal Medicine, University of Kansas Medical Center, Kansas City, KS 66160 (United States)

    2014-01-01

    Calorie restriction (CR) is one of the most effective anti-aging interventions in mammals. A modern theory suggests that aging results from a decline in detoxification capabilities and thus accumulation of damaged macromolecules. The present study aimed to determine how short-term CR alters mRNA profiles of genes that encode metabolism and detoxification machinery in the liver. Male C57BL/6 mice were fed CR (0, 15, 30, or 40%) diets for one month, followed by mRNA quantification of 98 xenobiotic processing genes (XPGs) in the liver, including 7 uptake transporters, 39 phase-I enzymes, 37 phase-II enzymes, 10 efflux transporters, and 5 transcription factors. In general, 15% CR did not alter mRNAs of most XPGs, whereas 30 and 40% CR altered over half of the XPGs (32 increased and 29 decreased). CR up-regulated some phase-I enzymes (fold increase), such as Cyp4a14 (12), Por (2.3), Nqo1 (1.4), Fmo2 (5.4), and Fmo3 (346), and numerous number of phase-II enzymes, such as Sult1a1 (1.2), Sult1d1 (2.0), Sult1e1 (33), Sult3a1 (2.2), Gsta4 (1.3), Gstm2 (1.3), Gstm3 (1.7), and Mgst3 (2.2). CR feminized the mRNA profiles of 32 XPGs in livers of male mice. For instance, CR decreased the male-predominantly expressed Oatp1a1 (97%) and increased the female-predominantly expressed Oatp1a4 (11). In conclusion, short-term CR alters the mRNA levels of over half of the 98 XPGs quantified in livers of male mice, and over half of these alterations appear to be due to feminization of the liver. - Highlights: • Utilized a graded CR model in male mice • The mRNA profiles of xenobiotic processing genes (XPGs) in liver were investigated. • CR up-regulates many phase-II enzymes. • CR tends to feminize the mRNA profiles of XPGs.

  11. Comparative characterization of the PvuRts1I family of restriction enzymes and their application in mapping genomic 5-hydroxymethylcytosine.

    Science.gov (United States)

    Wang, Hua; Guan, Shengxi; Quimby, Aine; Cohen-Karni, Devora; Pradhan, Sriharsa; Wilson, Geoffrey; Roberts, Richard J; Zhu, Zhenyu; Zheng, Yu

    2011-11-01

    PvuRts1I is a modification-dependent restriction endonuclease that recognizes 5-hydroxymethylcytosine (5hmC) as well as 5-glucosylhydroxymethylcytosine (5ghmC) in double-stranded DNA. Using PvuRts1I as the founding member, we define a family of homologous proteins with similar DNA modification-dependent recognition properties. At the sequence level, these proteins share a few uniquely conserved features. We show that these enzymes introduce a double-stranded cleavage at the 3'-side away from the recognized modified cytosine. The distances between the cleavage sites and the modified cytosine are fixed within a narrow range, with the majority being 11-13 nt away in the top strand and 9-10 nt away in the bottom strand. The recognition sites of these enzymes generally require two cytosines on opposite strand around the cleavage sites, i.e. 5'-CN(11-13)↓N(9-10)G-3'/3'-GN(9-10)↓N(11-13)C-5', with at least one cytosine being modified for efficient cleavage. As one potential application for these enzymes is to provide useful tools for selectively mapping 5hmC sites, we have compared the relative selectivity of a few PvuRts1I family members towards different forms of modified cytosines. Our results show that the inherently different relative selectivity towards modified cytosines can have practical implications for their application. By using AbaSDFI, a PvuRts1I homolog with the highest relative selectivity towards 5ghmC, to analyze rat brain DNA, we show it is feasible to map genomic 5hmC sites close to base resolution. Our study offers unique tools for determining more accurate hydroxymethylomes in mammalian cells.

  12. A restriction fragment length polymorphism results in a nonconservative amino acid substitution encoded within the first exon of the human lysyl oxidase gene

    Energy Technology Data Exchange (ETDEWEB)

    Csiszar, K.; Mariani, T.J.; Gosin, J.S.; Deak, S.B.; Boyd, C.D. [Robert Wood Johnson Medical School, New Brunswick, NJ (United States)

    1993-05-01

    A cDNA covering most of the coding sequence for human lysyl oxidase was used to screen, by Southern blot analysis, genomic DNA from circulating lymphocytes obtained from unrelated, apparently normal individuals. A heritable restriction fragment length polymorphism (RFLP) within a PstI restriction site was detected in 36% of individuals screened (a total of 72 chromosomes were analyzed). The major allele was represented as a 1.7-kb PstI restriction fragment. The minor allele was detected as 1.4 and 0.3kb restriction fragments. Lambda phage-DNA recombinants were isolated from a human lung fibroblast genomic DNA library using the human lysyl oxidase cDNA clone. DNA sequence analysis of several selected phage recombinants revealed that 83% of the coding sequence of lysyl oxidase was localized in four separate exons. Analysis of the coding sequence within exon 1, the most 5{prime} exon within the lysyl oxidase gene, revealed that the PstI RFLP was due to a G {r_arrow} A transition resulting in a nonconservative arginine to glutamine substitution proximal to a propeptide cleavage domain encoded by exon 1 of the lysyl oxidase gene. 33 refs., 5 figs., 1 tab.

  13. Detection of the Single Nucleotide Polymorphism at Position rs2735940 in the Human Telomerase Reverse Transcriptase Gene by the Introduction of a New Restriction Enzyme Site for the PCR-RFLP Assay.

    Science.gov (United States)

    Wang, Sihua; Ding, Mingcui; Duan, Xiaoran; Wang, Tuanwei; Feng, Xiaolei; Wang, Pengpeng; Yao, Wu; Wu, Yongjun; Yan, Zhen; Feng, Feifei; Yu, Songcheng; Wang, Wei

    2017-09-01

    It has been shown that the single nucleotide polymorphism (SNP) of the rs2735940 site in the human telomerase reverse transcriptase ( hTERT ) gene is associated with increased cancer risk. The traditional method to detect SNP genotypes is polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP). However, there is a limitation to utilizing PCR-RFLP due to a lack of proper restriction enzyme sites at many polymorphic loci. This study used an improved PCR-RFLP method with a mismatched base for detection of the SNP rs2735940. A new restriction enzyme cutting site was created by created restriction site PCR (CRS-PCR), and in addition, the restriction enzyme Msp I for CRS-PCR was cheaper than other enzymes. We used this novel assay to determine the allele frequencies in 552 healthy Chinese Han individuals, and found the allele frequencies to be 63% for allele C and 37% for allele T In summary, the modified PCR-RFLP can be used to detect the SNP of rs2735940 with low cost and high efficiency. © 2017 by the Association of Clinical Scientists, Inc.

  14. Sensitive and selective amplification of methylated DNA sequences using helper-dependent chain reaction in combination with a methylation-dependent restriction enzymes.

    Science.gov (United States)

    Rand, Keith N; Young, Graeme P; Ho, Thu; Molloy, Peter L

    2013-01-07

    We have developed a novel technique for specific amplification of rare methylated DNA fragments in a high background of unmethylated sequences that avoids the need of bisulphite conversion. The methylation-dependent restriction enzyme GlaI is used to selectively cut methylated DNA. Then targeted fragments are tagged using specially designed 'helper' oligonucleotides that are also used to maintain selection in subsequent amplification cycles in a process called 'helper-dependent chain reaction'. The process uses disabled primers called 'drivers' that can only prime on each cycle if the helpers recognize specific sequences within the target amplicon. In this way, selection for the sequence of interest is maintained throughout the amplification, preventing amplification of unwanted sequences. Here we show how the method can be applied to methylated Septin 9, a promising biomarker for early diagnosis of colorectal cancer. The GlaI digestion and subsequent amplification can all be done in a single tube. A detection sensitivity of 0.1% methylated DNA in a background of unmethylated DNA was achieved, which was similar to the well-established Heavy Methyl method that requires bisulphite-treated DNA.

  15. Identification of Two Novel Mycobacterium avium Allelic Variants in Pig and Human Isolates from Brazil by PCR-Restriction Enzyme Analysis

    Science.gov (United States)

    Leão, Sylvia Cardoso; Briones, Marcelo R. S.; Sircili, Marcelo Palma; Balian, Simone Carvalho; Mores, Nelson; Ferreira-Neto, José Soares

    1999-01-01

    Mycobacterium avium complex (MAC) is composed of environmental mycobacteria found widely in soil, water, and aerosols that can cause disease in animals and humans, especially disseminated infections in AIDS patients. MAC consists of two closely related species, M. avium and M. intracellulare, and may also include other, less-defined groups. The precise differentiation of MAC species is a fundamental step in epidemiological studies and for the evaluation of possible reservoirs for MAC infection in humans and animals. In this study, which included 111 pig and 26 clinical MAC isolates, two novel allelic M. avium PCR-restriction enzyme analysis (PRA) variants were identified, differing from the M. avium PRA prototype in the HaeIII digestion pattern. Mutations in HaeIII sites were confirmed by DNA sequencing. Identification of these isolates as M. avium was confirmed by PCR with DT1-DT6 and IS1245 primers, nucleic acid hybridization with the AccuProbe system, 16S ribosomal DNA sequencing, and biochemical tests. The characterization of M. avium PRA variants can be useful in the elucidation of factors involved in mycobacterial virulence and routes of infection and also has diagnostic significance, since they can be misidentified as M. simiae II and M. kansasii I if the PRA method is used in the clinical laboratory for identification of mycobacteria. PMID:10405407

  16. Use of Plasmon Coupling to Reveal the Dynamics of DNA Bending andCleavage by Single EcoRV Restriction Enzymes

    Energy Technology Data Exchange (ETDEWEB)

    Reinhard, Bjorn; Sheikholeslami, Sassan; Mastroianni, Alexander; Alivisatos, A. Paul; Liphardt, Jan

    2006-09-06

    Pairs of Au nanoparticles have recently been proposed asplasmon rulers based on the dependence of their light scattering on theinterparticle distance. Preliminary work has suggested that plasmonrulers can be used to measure and monitor dynamic distance changes overthe 1 to 100nm length scale in biology. Here, we substantiate thatplasmon rulers can be used to effectively measure dynamical biophysicalprocesses by applying the ruler to a system that has been investigatedextensively using ensemble kinetic measurements: the cleavage of DNA bythe restriction enzyme EcoRV. Temporal resolutions of up to 240 Hz wereobtained, and the end-to-end extension of up to 1000 individual dsDNAenzyme substrates could be monitored in parallel for hours. The singlemolecule cleavage trajectories acquired here agree well with valuesobtained in bulk through other methods, and confirm well-known featuresof the cleavage process, such as the fact that the DNA is bent prior tocleavage. New dynamical information is revealed as well, for instance,the degree of softening of the DNA just prior to cleavage. The unlimitedlife time, high temporal resolution, and high signal/noise make theplasmon ruler an excellent tool for studying macromolecular assembliesand conformational changes at the single molecule level.

  17. Restriction enzyme improves the efficiency of genetic transformations in Moniliophthora perniciosa, the causal agent of witches’ broom disease in Theobroma cacao

    Directory of Open Access Journals (Sweden)

    Francis Julio Fagundes Lopes

    2008-02-01

    Full Text Available The presence of restriction enzymes in the transformation mixture improved the efficiency of transformation in Moniliophthora perniciosa. The influence of the vector shape (linear or circular, the patterns of plasmid integration in genomic sites and the influence of the promoter used to express the gene marker were also analyzed. The addition of BamHI or NotI increased the number of transformants by 3-10-fold and 3-fold, respectively, over the control without added enzyme. The use of pre-linearized plasmid did not increase the transformation efficiency in comparison with the circular plasmid. However, the frequency of multi-copy transformants increased significantly. The transformation procedure here reported resulted in better production of protoplasts and transformation efficiency. In addition, the time necessary for the detection of the first transformants and the number of insertions were reduced.A presença de enzima de restrição na mistura de transformação aumentou a eficiência da transformação em Moniliophthora perniciosa. A influência da forma do vetor (linear ou circular, o padrão de integração do plasmídeo nos sítios genômicos e a influência do promotor usado para expressar o gene marcador foram também analisados. A adição de BamHI ou NotI aumentou o número de transformantes 3-10 vezes e 3 vezes, respectivamente, em relação ao controle sem a adição da enzima. O uso de plasmídeos pré-linearizados não aumentou a eficiência da transformação quando comparado à eficiência obtida com plasmídeos circulares. No entanto, a freqüência de transformantes multi-cópias aumentou significativamente. Juntos os procedimentos reportados aqui resultaram em processos mais eficientes de produção de protoplastos e transformação, onde o tempo necessário para o aparecimento dos transformantes e o número de inserções múltiplas foi reduzido.

  18. Differential regulation of renal angiotensin-converting enzyme (ACE) and ACE2 during ACE inhibition and dietary sodium restriction in healthy rats

    NARCIS (Netherlands)

    Hamming, I.; van Goor, H.; Turner, A. J.; Rushworth, C. A.; Michaud, A. A.; Corvol, P.; Navis, G.

    2008-01-01

    Angiotensin-converting enzyme (ACE) 2 is thought to counterbalance ACE by breakdown of angiotensin (Ang) II and formation of Ang(1-7). Both enzymes are highly expressed in the kidney, but reports on their regulation differ. To enhance our understanding of the regulation of renal ACE and ACE2, we

  19. Sodium restriction potentiates the renoprotective effects of combined vitamin D receptor activation and angiotensin-converting enzyme inhibition in established proteinuric nephropathy

    NARCIS (Netherlands)

    Mirkovic, Katarina; Frenay, Anne-Roos S; van den Born, Jacob; van Goor, Harry; Navis, Gerjan; de Borst, Martin H

    2015-01-01

    BACKGROUND: Renin-angiotensin-aldosterone system (RAAS) blockade provides renoprotective effects in chronic kidney disease (CKD); yet progressive renal function loss remains common. Dietary sodium restriction potentiates the renoprotective effects of RAAS blockade. Vitamin D receptor activator

  20. Engineering strand-specific DNA nicking enzymes from the type IIS restriction endonucleases BsaI, BsmBI, and BsmAI.

    Science.gov (United States)

    Zhu, Zhenyu; Samuelson, James C; Zhou, Jing; Dore, Andrew; Xu, Shuang-Yong

    2004-03-26

    More than 80 type IIA/IIS restriction endonucleases with different recognition specificities are now known. In contrast, only a limited number of strand-specific nicking endonucleases are currently available. To overcome this limitation, a novel genetic screening method was devised to convert type IIS restriction endonucleases into strand-specific nicking endonucleases. The genetic screen consisted of four steps: (1) random mutagenesis to create a plasmid library, each bearing an inactivated endonuclease gene; (2) restriction digestion of plasmids containing the wild-type and the mutagenized endonuclease gene; (3) back-crosses with the wild-type gene by ligation to the wild-type N-terminal or C-terminal fragment; (4) transformation of the ligated DNA into a pre-modified host and screening for nicking endonuclease activity in total cell culture or cell extracts of the transformants. Nt.BsaI and Nb.BsaI nicking endonucleases were isolated from BsaI using this genetic screen. In addition, site-directed mutagenesis was carried out to isolate BsaI nicking variants with minimal double-stranded DNA cleavage activity. The equivalent amino acid substitutions were introduced into BsmBI and BsmAI restriction endonucleases with similar recognition sequence and significant amino acid sequence identity and their nicking variants were successfully isolated. This work provides strong evidence that some type IIS restriction endonucleases carry two separate active sites. When one of the active sites is inactivated, the type IIS restriction endonuclease may nick only one strand.

  1. Selection of restriction endonucleases using artificial cells.

    Science.gov (United States)

    Zheng, Yu; Roberts, Richard J

    2007-01-01

    We describe in this article an in vitro system for the selection of restriction endonucleases using artificial cells. The artificial cells are generated in the form of a water-in-oil emulsion by in vitro compartmentalization. Each aqueous compartment contains a reconstituted transcription/translation mix along with the dispersed DNA templates. In the compartments containing endonuclease genes, an endonuclease expressed in vitro cleaves its own DNA template adjacent to the gene, leaving a sticky end. The pooled DNA templates are then ligated to an adaptor with a compatible end. The endonuclease genes are then enriched by adaptor-specific PCR on the ligation mix. We demonstrate that the system can achieve at least 100-fold enrichment in a single round of selection. It is sensitive enough to enrich an active endonuclease gene from a 1:10(5) model library in 2-3 rounds of selection. Finally, we describe experiments where we selected endonuclease genes directly from a bacterial genomic DNA source in three rounds of selections: the known PstI gene from Providencia stuartii and the new TspMI gene from Thermus sp. manalii. This method provides a unique tool for cloning restriction endonuclease genes and has many other potential applications.

  2. Use of Multiplex PCR and PCR Restriction Enzyme Analysis for Detection and Exploration of the Variability in the Free-Living Amoeba Naegleria in the Environment

    Science.gov (United States)

    Pélandakis, Michel; Pernin, Pierre

    2002-01-01

    A multiplex PCR was developed to simultaneously detect Naegleria fowleri and other Naegleria species in the environment. Multiplex PCR was also capable of identifying N. fowleri isolates with internal transcribed spacers of different sizes. In addition, restriction fragment length polymorphism analysis of the PCR product distinguished the main thermophilic Naegleria species from the sampling sites. PMID:11916734

  3. Effects of life-long caloric restriction and voluntary exercise on age-related changes in levels of catecholamine biosynthetic enzymes and angiotensin II receptors in the rat adrenal medulla and hypothalamus.

    Science.gov (United States)

    Erdös, Benedek; Broxson, Christopher S; Landa, Tessa; Scarpace, Philip J; Leeuwenburgh, Christiaan; Zhang, Yi; Tümer, Nihal

    2007-08-01

    We examined if life-long mild caloric restriction (CR) alone or with voluntary exercise prevents the age-related changes in catecholamine biosynthetic enzyme levels in the adrenal medulla and hypothalamus. Ten-week-old Fisher-344 rats were assigned to: sedentary; sedentary+8% CR; or 8% CR+wheel running. Rats were euthanized at 6 or 24 months of age. Tyrosine hydroxylase (TH) mRNA expression was 4.4-fold higher in the adrenal medullae and 60% lower in the hypothalamus of old sedentary rats compared to young (pwheel running decreased AT(1) levels by 50% (pwheel running increased its level by 42% (pfood intake can avert age-related changes in catecholamine biosynthetic enzyme levels in the adrenal medulla and hypothalamus, possibly through affecting angiotensin II signaling.

  4. The Type ISP Restriction-Modification enzymes LlaBIII and LlaGI use a translocation-collision mechanism to cleave non-specific DNA distant from their recognition sites.

    Science.gov (United States)

    Šišáková, Eva; van Aelst, Kara; Diffin, Fiona M; Szczelkun, Mark D

    2013-01-01

    The Type ISP Restriction-Modification (RM) enzyme LlaBIII is encoded on plasmid pJW566 and can protect Lactococcus lactis strains against bacteriophage infections in milk fermentations. It is a single polypeptide RM enzyme comprising Mrr endonuclease, DNA helicase, adenine methyltransferase and target-recognition domains. LlaBIII shares >95% amino acid sequence homology across its first three protein domains with the Type ISP enzyme LlaGI. Here, we determine the recognition sequence of LlaBIII (5'-TnAGCC-3', where the adenine complementary to the underlined base is methylated), and characterize its enzyme activities. LlaBIII shares key enzymatic features with LlaGI; namely, adenosine triphosphate-dependent DNA translocation (∼309 bp/s at 25°C) and a requirement for DNA cleavage of two recognition sites in an inverted head-to-head repeat. However, LlaBIII requires K(+) ions to prevent non-specific DNA cleavage, conditions which affect the translocation and cleavage properties of LlaGI. By identifying the locations of the non-specific dsDNA breaks introduced by LlaGI or LlaBIII under different buffer conditions, we validate that the Type ISP RM enzymes use a common translocation-collision mechanism to trigger endonuclease activity. In their favoured in vitro buffer, both LlaGI and LlaBIII produce a normal distribution of random cleavage loci centred midway between the sites. In contrast, LlaGI in K(+) ions produces a far more distributive cleavage profile.

  5. EcoBLMcrX, a classical modification-dependent restriction enzyme in Escherichia coli B: Characterization in vivo and in vitro with a new approach to cleavage site determination.

    Science.gov (United States)

    Fomenkov, Alexey; Sun, Zhiyi; Dila, Deborah K; Anton, Brian P; Roberts, Richard J; Raleigh, Elisabeth A

    2017-01-01

    Here we characterize the modification-dependent restriction enzyme (MDE) EcoBLMcrX in vivo, in vitro and in its genomic environment. MDE cleavage of modified DNAs protects prokaryote populations from lethal infection by bacteriophage with highly modified DNA, and also stabilizes lineages by reducing gene import when sparse modification occurs in the wrong context. The function and distribution of MDE families are thus important. Here we describe the properties of EcoBLMcrX, an enzyme of the E. coli B lineage, in vivo and in vitro. Restriction in vivo and the genome location of its gene, ecoBLmcrX, were determined during construction and sequencing of a B/K-12 hybrid, ER2566. In classical restriction literature, this B system was named r6 or rglAB. Like many genome defense functions, ecoBLmcrX is found within a genomic island, where gene content is variable among natural E. coli isolates. In vitro, EcoBLMcrX was compared with two related enzymes, BceYI and NhoI. All three degrade fully cytosine-modified phage DNA, as expected for EcoBLMcrX from classical T4 genetic data. A new method of characterizing MDE specificity was developed to better understand action on fully-modified targets such as the phage that provide major evolutionary pressure for MDE maintenance. These enzymes also cleave plasmids with m5C in particular motifs, consistent with a role in lineage-stabilization. The recognition sites were characterized using a site-ranking approach that allows visualization of preferred cleavage sites when fully-modified substrates are digested. A technical constraint on the method is that ligation of one-nucleotide 5' extensions favors G:C over A:T approximately five-fold. Taking this bias into account, we conclude that EcoBLMcrX can cleave 3' to the modified base in the motif Rm5C|. This is compatible with, but less specific than, the site reported by others. Highly-modified site contexts, such as those found in base-substituted virulent phages, are strongly preferred.

  6. DNA cleavage site selection by Type III restriction enzymes provides evidence for head-on protein collisions following 1D bidirectional motion

    Science.gov (United States)

    Schwarz, Friedrich W.; van Aelst, Kara; Tóth, Júlia; Seidel, Ralf; Szczelkun, Mark D.

    2011-01-01

    DNA cleavage by the Type III Restriction–Modification enzymes requires communication in 1D between two distant indirectly-repeated recognitions sites, yet results in non-specific dsDNA cleavage close to only one of the two sites. To test a recently proposed ATP-triggered DNA sliding model, we addressed why one site is selected over another during cleavage. We examined the relative cleavage of a pair of identical sites on DNA substrates with different distances to a free or protein blocked end, and on a DNA substrate using different relative concentrations of protein. Under these conditions a bias can be induced in the cleavage of one site over the other. Monte-Carlo simulations based on the sliding model reproduce the experimentally observed behaviour. This suggests that cleavage site selection simply reflects the dynamics of the preceding stochastic enzyme events that are consistent with bidirectional motion in 1D and DNA cleavage following head-on protein collision. PMID:21724613

  7. Impact of target site distribution for Type I restriction enzymes on the evolution of methicillin-resistant Staphylococcus aureus (MRSA) populations.

    Science.gov (United States)

    Roberts, Gareth A; Houston, Patrick J; White, John H; Chen, Kai; Stephanou, Augoustinos S; Cooper, Laurie P; Dryden, David T F; Lindsay, Jodi A

    2013-08-01

    A limited number of Methicillin-resistant Staphylococcus aureus (MRSA) clones are responsible for MRSA infections worldwide, and those of different lineages carry unique Type I restriction-modification (RM) variants. We have identified the specific DNA sequence targets for the dominant MRSA lineages CC1, CC5, CC8 and ST239. We experimentally demonstrate that this RM system is sufficient to block horizontal gene transfer between clinically important MRSA, confirming the bioinformatic evidence that each lineage is evolving independently. Target sites are distributed randomly in S. aureus genomes, except in a set of large conjugative plasmids encoding resistance genes that show evidence of spreading between two successful MRSA lineages. This analysis of the identification and distribution of target sites explains evolutionary patterns in a pathogenic bacterium. We show that a lack of specific target sites enables plasmids to evade the Type I RM system thereby contributing to the evolution of increasingly resistant community and hospital MRSA.

  8. Sodium restriction potentiates the renoprotective effects of combined vitamin D receptor activation and angiotensin-converting enzyme inhibition in established proteinuric nephropathy.

    Science.gov (United States)

    Mirkovic, Katarina; Frenay, Anne-Roos S; van den Born, Jacob; van Goor, Harry; Navis, Gerjan; de Borst, Martin H

    2017-08-01

    Renin-angiotensin-aldosterone system (RAAS) blockade provides renoprotective effects in chronic kidney disease (CKD); yet progressive renal function loss remains common. Dietary sodium restriction potentiates the renoprotective effects of RAAS blockade. Vitamin D receptor activator (VDRA) treatment reduces proteinuria, inflammation and fibrosis, but whether these effects depend on sodium intake has not been studied. We hypothesized that the renoprotective effects of VDRA treatment, with or without RAAS blockade, are modulated by sodium intake. Six weeks after the induction of adriamycin nephrosis in Wistar rats, i.e. with established proteinuria, animals were treated with the VDRA paricalcitol, lisinopril, the combination, or vehicle; each treatment was given during either a high- (2% NaCl) or a low-sodium (0.05% NaCl) diet for 6 weeks. We assessed proteinuria, blood pressure, renal macrophage accumulation and renal expression of the pre-fibrotic marker alpha-smooth muscle actin (α-SMA) at the end of the treatment. Both paricalcitol and lisinopril individually, as well as in combination, reduced proteinuria and glomerular and interstitial inflammation during a low-sodium diet, but not during a high-sodium diet. All interventions also reduced focal glomerulosclerosis and interstitial expression of α-SMA during the low-sodium diet, while similar trends were observed during the high-sodium diet. The renoprotective effects of paricalcitol were not accompanied by blood pressure reduction. As proteinuria was already abolished by lisinopril during the low-sodium diet, the addition of paricalcitol had no further effect on proteinuria or downstream inflammatory or pre-fibrotic changes. The renoprotective effects of the VDRA paricalcitol are blood pressure independent but do depend on dietary sodium status. The combination of RAAS blockade, dietary sodium restriction and VDRA may be a promising intervention to further retard renal function loss in CKD.

  9. MethylRAD: a simple and scalable method for genome-wide DNA methylation profiling using methylation-dependent restriction enzymes.

    Science.gov (United States)

    Wang, Shi; Lv, Jia; Zhang, Lingling; Dou, Jinzhuang; Sun, Yan; Li, Xue; Fu, Xiaoteng; Dou, Huaiqian; Mao, Junxia; Hu, Xiaoli; Bao, Zhenmin

    2015-11-01

    Characterization of dynamic DNA methylomes in diverse phylogenetic groups has attracted growing interest for a better understanding of the evolution of DNA methylation as well as its function and biological significance in eukaryotes. Sequencing-based methods are promising in fulfilling this task. However, none of the currently available methods offers the 'perfect solution', and they have limitations that prevent their application in the less studied phylogenetic groups. The recently discovered Mrr-like enzymes are appealing for new method development, owing to their ability to collect 32-bp methylated DNA fragments from the whole genome for high-throughput sequencing. Here, we have developed a simple and scalable DNA methylation profiling method (called MethylRAD) using Mrr-like enzymes. MethylRAD allows for de novo (reference-free) methylation analysis, extremely low DNA input (e.g. 1 ng) and adjustment of tag density, all of which are still unattainable for most widely used methylation profiling methods such as RRBS and MeDIP. We performed extensive analyses to validate the power and accuracy of our method in both model (plant Arabidopsis thaliana) and non-model (scallop Patinopecten yessoensis) species. We further demonstrated its great utility in identification of a gene (LPCAT1) that is potentially crucial for carotenoid accumulation in scallop adductor muscle. MethylRAD has several advantages over existing tools and fills a void in the current epigenomic toolkit by providing a universal tool that can be used for diverse research applications, e.g. from model to non-model species, from ordinary to precious samples and from small to large genomes, but at an affordable cost. © 2015 The Authors.

  10. Dietary Methionine Restriction: Novel Treatment for Hormone Independent Prostate Cancer

    National Research Council Canada - National Science Library

    Epner, Daniel

    2003-01-01

    .... We used Southern blot analysis with methylation-sensitive restriction enzymes, western blot analysis, and RT-PCR to determine whether methionine restriction restored expression of growth inhibitory...

  11. Rapid mitochondrial DNA typing using restriction enzyme digestion of polymerase chain reaction amplicons followed by capillary electrophoresis separation with laser-induced fluorescence detection.

    Science.gov (United States)

    Butler, J M; Wilson, M R; Reeder, D J

    1998-01-01

    The polymorphic control region of mitochondrial DNA (mtDNA) is becoming more commonly used in forensic applications to differentiate among individuals in a population. Two hypervariable regions (HV1 and HV2) are often sequenced following amplification of the mtDNA via the polymerase chain reaction (PCR). More rapid screening assays would reduce both the effort and the expense of comparing two samples. A methodology has been developed that first uses restriction endonuclease digestion of the PCR-amplified mtDNA using RsaI and MnlI and then capillary electrophoresis (CE) to separate and size the PCR-RFLP fragments. This rapid procedure offers an alternative method for screening of polymorphisms in amplified mtDNA samples. In addition, the presence of a T-->C transition at position 16189, which gives rise to the so-called "C-stretch" in HV1, may be predicted from the presence of nonspecific PCR products in the CE results.

  12. Escaping the cut by restriction enzymes through single-strand self-annealing of host-edited 12-bp and longer synthetic palindromes.

    Science.gov (United States)

    Castro-Chavez, Fernando

    2012-02-01

    Palindromati, the massive host-edited synthetic palindromic contamination found in GenBank, is illustrated and exemplified. Millions of contaminated sequences with portions or tandems of such portions derived from the ZAP adaptor or related linkers are shown (1) by the 12-bp sequence reported elsewhere, exon Xb, 5' CCCGAATTCGGG 3', (2) by a 22-bp related sequence 5' CTCGTGCCGAATTCGGCACGAG 3', and (3) by a longer 44-bp related sequence: 5' CTCGTGCCGAATTCGGCACGAGCTCGTGCCGAATTCGGCACGAG 3'. Possible reasons for why those long contaminating sequences continue in the databases are presented here: (1) the recognition site for the plus strand (+) is single-strand self-annealed; (2) the recognition site for the minus strand (-) is not only single-strand self-annealed but also located far away from the single-strand self-annealed plus strand, rendering impossible the formation of the active EcoRI enzyme dimer to cut on 5' G/AATTC 3', its target sequence. As a possible solution, it is suggested to rely on at least two or three independent results, such as sequences obtained by independent laboratories with the use, preferably, of independent sequencing methodologies. This information may help to develop tools for bioinformatics capable to detect/remove these contaminants and to infer why some damaged sequences which cause genetic diseases escape detection by the molecular quality control mechanism of cells and organisms, being undesirably transferred unchecked through the generations.

  13. Restriction enzyme analysis of the human cytomegalovirus genome in specimens collected from immunodeficient patients in Belém, State of Pará, Brazil

    Directory of Open Access Journals (Sweden)

    Dorotéa Lobato da Silva

    2011-10-01

    Full Text Available INTRODUCTION: Human cytomegalovirus is an opportunistic betaherpesvirus that causes persistent and serious infections in immunodeficient patients. Recurrent infections occur due to the presence of the virus in a latent state in some cell types. It is possible to examine the virus using molecular methods to aid in the immunological diagnosis and to generate a molecular viral profile in immunodeficient patients. The objective of this study was to characterize cytomegalovirus genotypes and to generate the epidemiological and molecular viral profile in immunodeficient patients. METHODS: A total of 105 samples were collected from immunodeficient patients from the City of Belém, including newborns, hemodialysis patients, transplant recipients and HIV+ patients. An IgG and IgM antibody study was completed using ELISA, and enzymatic analysis by restriction fragment length polymorphism (RFLP was performed to characterize viral genotypes. RESULTS: It was observed that 100% of the patients had IgG antibodies, 87% of which were IgG+/IgM-, consistent with a prior infection profile, 13% were IgG+/IgM+, suggestive of recent infection. The newborn group had the highest frequency (27% of the IgG+/IgM+ profile. By RFLP analysis, only one genotype was observed, gB2, which corresponded to the standard AD169 strain. CONCLUSIONS: The presence of IgM antibodies in new borns indicates that HCMV continues to be an important cause of congenital infection. The low observed genotypic diversity could be attributed to the small sample size because newborns were excluded from the RFLP analysis. This study will be continued including samples from newborns to extend the knowledge of the general and molecular epidemiology of HCMV in immunodeficient patients.

  14. The Type I Restriction Enzymes as Barriers to Horizontal Gene Transfer: Determination of the DNA Target Sequences Recognised by Livestock-Associated Methicillin-Resistant Staphylococcus aureus Clonal Complexes 133/ST771 and 398.

    Science.gov (United States)

    Chen, Kai; Stephanou, Augoustinos S; Roberts, Gareth A; White, John H; Cooper, Laurie P; Houston, Patrick J; Lindsay, Jodi A; Dryden, David T F

    2016-01-01

    The Type I DNA restriction-modification (RM) systems of Staphylococcus aureus are known to act as a significant barrier to horizontal gene transfer between S. aureus strains belonging to different clonal complexes. The livestock-associated clonal complexes CC133/771 and CC398 contain Type I RM systems not found in human MRSA strains as yet but at some point transfer will occur. When this does take place, horizontal gene transfer of resistance will happen more easily between these strains. The reservoir of antibiotic resistance, virulence and host-adaptation genes present in livestock-associated MRSA will then potentially contribute to the development of newly evolving MRSA clones. The target sites recognised by the Type I RM systems of CC133/771 and CC398 were identified as CAG(N)5RTGA and ACC(N)5RTGA, respectively. Assuming that these enzymes recognise the methylation state of adenine, the underlined A and T bases indicate the unique positions of methylation. Target methylation points for enzymes from CC1 were also identified. The methylation points for CC1-1 are CCAY(N)5TTAA and those for CC1-2 are CCAY(N)6 TGT with the underline indicating the adenine methylation site thus clearing up the ambiguity noted previously (Roberts et al. 2013, Nucleic Acids Res 41:7472-7484) for the half sites containing two adenine bases.

  15. Development of a rapid method for identifying carryover contamination of positive control DNA, using a chimeric positive control and restriction enzyme for the diagnosis of white spot syndrome virus by nested PCR.

    Science.gov (United States)

    Kim, Hyoung Jun; Kwon, Se Ryun

    2014-12-01

    Chimeric positive plasmids have been developed to minimize false-positive reactions caused by polymerase chain reaction (PCR) contamination. Here, we developed a rapid method for identifying false-positive results while detecting white spot syndrome virus (WSSV) by nested PCR, using chimeric positive plasmids. The results of PCRs using WSSV diagnostic primer sets showed PCR products of a similar size (WSSV 1st PCR product, 1,447 bp; WSSV 2nd PCR product, 941 bp) using WSSV chimeric plasmids or DNA from shrimp infected with WSSV. The PCR products were digested with DraI for 1 h at 37 °C. The digested chimeric DNA separated into two DNA bands; however, the WSSV-infected shrimp DNA did not separate. Thus, chimeric plasmid DNA may be used as positive control DNA instead of DNA from WSSV-infected shrimp, in order to prevent PCR contamination. Thus, the use of restriction enzyme digestion allowed us to rapidly distinguish between WSSV DNA and WSSV chimeric plasmid DNA.

  16. Restriction glycosylases: involvement of endonuclease activities in the restriction process.

    Science.gov (United States)

    Zhang, Yingbiao; Matsuzaka, Tomoyuki; Yano, Hirokazu; Furuta, Yoshikazu; Nakano, Toshiaki; Ishikawa, Ken; Fukuyo, Masaki; Takahashi, Noriko; Suzuki, Yutaka; Sugano, Sumio; Ide, Hiroshi; Kobayashi, Ichizo

    2017-02-17

    All restriction enzymes examined are phosphodiesterases generating 3΄-OH and 5΄-P ends, but one restriction enzyme (restriction glycosylase) excises unmethylated bases from its recognition sequence. Whether its restriction activity involves endonucleolytic cleavage remains unclear. One report on this enzyme, R.PabI from a hyperthermophile, ascribed the breakage to high temperature while another showed its weak AP lyase activity generates atypical ends. Here, we addressed this issue in mesophiles. We purified R.PabI homologs from Campylobacter coli (R.CcoLI) and Helicobacter pylori (R.HpyAXII) and demonstrated their DNA cleavage, DNA glycosylase and AP lyase activities in vitro at 37°C. The AP lyase activity is more coupled with glycosylase activity in R.CcoLI than in R.PabI. R.CcoLI/R.PabI expression caused restriction of incoming bacteriophage/plasmid DNA and endogenous chromosomal DNA within Escherichia coli at 37°C. The R.PabI-mediated restriction was promoted by AP endonuclease action in vivo or in vitro. These results reveal the role of endonucleolytic DNA cleavage in restriction and yet point to diversity among the endonucleases. The cleaved ends are difficult to repair in vivo, which may indicate their biological significance. These results support generalization of the concept of restriction–modification system to the concept of self-recognizing epigenetic system, which combines any epigenetic labeling and any DNA damaging.

  17. Problem-Solving Test: Restriction Endonuclease Mapping

    Science.gov (United States)

    Szeberenyi, Jozsef

    2011-01-01

    The term "restriction endonuclease mapping" covers a number of related techniques used to identify specific restriction enzyme recognition sites on small DNA molecules. A method for restriction endonuclease mapping of a 1,000-basepair (bp)-long DNA molecule is described in the fictitious experiment of this test. The most important fact needed to…

  18. Pancreatic Enzymes

    Science.gov (United States)

    ... NOW HONOR/MEMORIAL GENERAL DONATION MONTHLY PURPLESTRIDE Pancreatic enzymes Home Facing Pancreatic Cancer Living with Pancreatic Cancer ... and see a registered dietitian. What are pancreatic enzymes? Pancreatic enzymes help break down fats, proteins and ...

  19. Pectic enzymes

    NARCIS (Netherlands)

    Benen, J.A.E.; Voragen, A.G.J.; Visser, J.

    2003-01-01

    The pectic enzymes comprise a diverse group of enzymes. They consist of main-chain depolymerases and esterases active on methyl- and acetylesters of galacturonosyl uronic acid residues. The depolymerizing enzymes comprise hydrolases as wel as lyases

  20. Enzyme Kinetics? Elementary, my dear

    Indian Academy of Sciences (India)

    Suppose that, in the absence of an enzyme, the. Desirazu N Rao is at the. Department of. Biochemistry, Indian. Institute of Science,. Bangalore. His main research interests are in the ateas of protein-DNA interactions using restriction enzymes as model systems and in. DNA methylation. 1 When a carbon atom has four.

  1. Kunstige Enzymer

    DEFF Research Database (Denmark)

    Bols, Mikael; Bjerre, Jeannette; Marinescu, Lavinia

    2007-01-01

    Enzymer har en enestående evne til at accelerere kemiske processer. Der forskes målrettet i at optimere enzymer baseret på cyclodextrin.......Enzymer har en enestående evne til at accelerere kemiske processer. Der forskes målrettet i at optimere enzymer baseret på cyclodextrin....

  2. Enzyme assays

    OpenAIRE

    Bisswanger, Hans

    2014-01-01

    The essential requirements for enzyme assays are described and frequently occurring errors and pitfalls as well as their avoidance are discussed. The main factors, which must be considered for assaying enzymes, are temperature, pH, ionic strength and the proper concentrations of the essential components like substrates and enzymes. Standardization of these parameters would be desirable, but the diversity of the features of different enzymes prevents unification of assay conditions. Neverthele...

  3. Restricted Mobilities

    DEFF Research Database (Denmark)

    Nielsen, Mette; Lassen, Claus

    2012-01-01

    communities and shopping centres through mobility lenses. The article shows how different mobility systems enable and restrict the public access to private-public spaces, and it points out that proprietary communities create an unequal potential for human movement and access in the city. The main argument......Privatisation of public spaces in the contemporary city has increased during the last decades but only few studies have approached this field from a mobility perspective. Therefore the article seeks to rectify this by exploring two Australian examples of private spaces in the city; gated...... in the article is that the many mobility systems enable specialization of places that are targeted at a special section of the population. This means that various forms of motilities not only create new opportunities for urban life but it is also one of the most critical components of production of new exclusion...

  4. Enzyme Informatics

    Science.gov (United States)

    Alderson, Rosanna G.; Ferrari, Luna De; Mavridis, Lazaros; McDonagh, James L.; Mitchell, John B. O.; Nath, Neetika

    2012-01-01

    Over the last 50 years, sequencing, structural biology and bioinformatics have completely revolutionised biomolecular science, with millions of sequences and tens of thousands of three dimensional structures becoming available. The bioinformatics of enzymes is well served by, mostly free, online databases. BRENDA describes the chemistry, substrate specificity, kinetics, preparation and biological sources of enzymes, while KEGG is valuable for understanding enzymes and metabolic pathways. EzCatDB, SFLD and MACiE are key repositories for data on the chemical mechanisms by which enzymes operate. At the current rate of genome sequencing and manual annotation, human curation will never finish the functional annotation of the ever-expanding list of known enzymes. Hence there is an increasing need for automated annotation, though it is not yet widespread for enzyme data. In contrast, functional ontologies such as the Gene Ontology already profit from automation. Despite our growing understanding of enzyme structure and dynamics, we are only beginning to be able to design novel enzymes. One can now begin to trace the functional evolution of enzymes using phylogenetics. The ability of enzymes to perform secondary functions, albeit relatively inefficiently, gives clues as to how enzyme function evolves. Substrate promiscuity in enzymes is one example of imperfect specificity in protein-ligand interactions. Similarly, most drugs bind to more than one protein target. This may sometimes result in helpful polypharmacology as a drug modulates plural targets, but also often leads to adverse side-effects. Many cheminformatics approaches can be used to model the interactions between druglike molecules and proteins in silico. We can even use quantum chemical techniques like DFT and QM/MM to compute the structural and energetic course of enzyme catalysed chemical reaction mechanisms, including a full description of bond making and breaking. PMID:23116471

  5. Enzyme Informatics

    OpenAIRE

    Alderson, Rosanna G.; De Ferrari, Luna; Mavridis, Lazaros; McDonagh, James L.; Mitchell, John B O; Nath, Neetika

    2012-01-01

    Over the last 50 years, sequencing, structural biology and bioinformatics have completely revolutionised biomolecular science, with millions of sequences and tens of thousands of three dimensional structures becoming available. The bioinformatics of enzymes is well served by, mostly free, online databases. BRENDA describes the chemistry, substrate specificity, kinetics, preparation and biological sources of enzymes, while KEGG is valuable for understanding enzymes and metabolic pathways. EzCa...

  6. Amplicon restriction patterns associated with nitrogenase activity of ...

    Indian Academy of Sciences (India)

    2013-10-01

    Oct 1, 2013 ... [Yanthan M and Misra AK 2013 Amplicon restriction patterns associated with nitrogenase activity of root nodules for selection of superior Myrica seedlings. J. Biosci. ... Table 1. Amplicon restriction patterns generated by restriction enzyme MboI. Profile. Samples .... The injection port, oven and de-.

  7. Intrauterine Growth Restriction (IUGR)

    Science.gov (United States)

    ... Homework Tips Raising Confident Kids Intrauterine Growth Restriction (IUGR) KidsHealth > For Parents > Intrauterine Growth Restriction (IUGR) Print ... is called intrauterine growth restriction, or IUGR. About IUGR IUGR is when a baby in the womb ...

  8. Structural insight into the specificity of the B3 DNA-binding domains provided by the co-crystal structure of the C-terminal fragment of BfiI restriction enzyme.

    Science.gov (United States)

    Golovenko, Dmitrij; Manakova, Elena; Zakrys, Linas; Zaremba, Mindaugas; Sasnauskas, Giedrius; Gražulis, Saulius; Siksnys, Virginijus

    2014-04-01

    The B3 DNA-binding domains (DBDs) of plant transcription factors (TF) and DBDs of EcoRII and BfiI restriction endonucleases (EcoRII-N and BfiI-C) share a common structural fold, classified as the DNA-binding pseudobarrel. The B3 DBDs in the plant TFs recognize a diverse set of target sequences. The only available co-crystal structure of the B3-like DBD is that of EcoRII-N (recognition sequence 5'-CCTGG-3'). In order to understand the structural and molecular mechanisms of specificity of B3 DBDs, we have solved the crystal structure of BfiI-C (recognition sequence 5'-ACTGGG-3') complexed with 12-bp cognate oligoduplex. Structural comparison of BfiI-C-DNA and EcoRII-N-DNA complexes reveals a conserved DNA-binding mode and a conserved pattern of interactions with the phosphodiester backbone. The determinants of the target specificity are located in the loops that emanate from the conserved structural core. The BfiI-C-DNA structure presented here expands a range of templates for modeling of the DNA-bound complexes of the B3 family of plant TFs.

  9. Comparison of restriction enzyme pattern analysis and full gene sequencing of 16S rRNA gene for Nocardia species identification, the first report of Nocardia transvalensis isolated of sputum from Iran, and review of the literature.

    Science.gov (United States)

    Fatahi-Bafghi, Mehdi; Heidarieh, Parvin; Rasouli-Nasab, Masoumeh; Habibnia, Shadi; Hashemi-Shahraki, Abdorazagh; Eshraghi, Seyyed Saeed

    2016-10-01

    Nocardial infections occur in different organs of the body and are common in immune disorder diseases of individuals. The aim of this study was to assess Nocardia species identification by phenotypic tests and molecular techniques applied to nocardiosis in Iranian patients. In the current study, various clinical samples were collected and cultured on conventional media and using the paraffin baiting method. Various phenotypic tests were performed. For accurate identification at the species level, restriction fragment length polymorphisms (RFLP) in the hsp65 and partial 16S rRNA genes and full gene sequencing of the 16S rRNA gene were used. Twenty-seven Nocardia spp. were isolated and analysis of phenotypic tests results showed Nocardia asteroides complex, Nocardia otitidiscaviarum, Nocardia nova, and Nocardia spp. New RFLP patterns of Nocardia strains with hsp65 and partial 16S rRNA genes were obtained. Full gene sequencing of the 16S rRNA gene identified Nocardia cyriacigeorgica, N. otitidiscaviarum, Nocardia farcinica, Nocardia transvalensis, and N. nova. Nocardia infections are rarely reported and this genus is the cause of various illnesses. Accurate identification of Nocardia spp. is important for epidemiology studies and treatment. It should also be noted that some species may have similar RFLP patterns; therefore, full gene sequencing of the 16S rRNA gene is necessary for confirmation.

  10. Enzyme immunoassay

    DEFF Research Database (Denmark)

    Feldt-Rasmussen, B; Dinesen, B; Deckert, M

    1985-01-01

    An enzyme linked immunoadsorbent assay for urinary albumin using commercially available reagents is described. The assay range is 2.5-120 micrograms/l. When samples are analysed in two standard dilutions, the assayable albumin concentration range is 2.5-240 mg/l, covering the clinical range from...

  11. Food Enzymes

    Science.gov (United States)

    McBroom, Rachel; Oliver-Hoyo, Maria T.

    2007-01-01

    Many students view biology and chemistry as two unrelated, separate sciences; how these courses are generally taught in high schools may do little to change that impression. The study of enzymes provide a great opportunity for both biology and chemistry teachers to share with students the interdisciplinary nature of science. This article describes…

  12. Enzymatic cleavage of type II restriction endonucleases on the 2'-O-methyl nucleotide and phosphorothioate substituted DNA.

    Directory of Open Access Journals (Sweden)

    Guojie Zhao

    Full Text Available The effects of nucleotide analogue substitution on the cleavage efficiencies of type II restriction endonucleases have been investigated. Six restriction endonucleases (EcoRV, SpeI, XbaI, XhoI, PstI and SphI were investigated respectively regarding their cleavage when substrates were substituted by 2'-O-methyl nucleotide (2'-OMeN and phosphorothioate (PS. Substitutions were made in the recognition sequence and the two nucleotides flanking the recognition sequence for each endonuclease. The endonuclease cleavage efficiencies were determined using FRET-based assay. Results demonstrated a position-dependent inhibitory effect of substitution on the cleavage efficiency for all the six endonucleases. In general, the 2'-OMeN substitutions had greater impact than the PS substitutions on the enzymatic activities. Nucleotides of optimal substitutions for protection against RE cleavage were identified. Experimental results and conclusions in this study facilitate our insight into the DNA-protein interactions and the enzymatic cleavage mechanism, particularly for those whose detailed structure information is not available. In addition, the information could benefit the development of bioengineering and synthetic biology.

  13. Enzymatic cleavage of type II restriction endonucleases on the 2'-O-methyl nucleotide and phosphorothioate substituted DNA.

    Science.gov (United States)

    Zhao, Guojie; Li, Jun; Tong, Zhaoxue; Zhao, Bin; Mu, Runqing; Guan, Yifu

    2013-01-01

    The effects of nucleotide analogue substitution on the cleavage efficiencies of type II restriction endonucleases have been investigated. Six restriction endonucleases (EcoRV, SpeI, XbaI, XhoI, PstI and SphI) were investigated respectively regarding their cleavage when substrates were substituted by 2'-O-methyl nucleotide (2'-OMeN) and phosphorothioate (PS). Substitutions were made in the recognition sequence and the two nucleotides flanking the recognition sequence for each endonuclease. The endonuclease cleavage efficiencies were determined using FRET-based assay. Results demonstrated a position-dependent inhibitory effect of substitution on the cleavage efficiency for all the six endonucleases. In general, the 2'-OMeN substitutions had greater impact than the PS substitutions on the enzymatic activities. Nucleotides of optimal substitutions for protection against RE cleavage were identified. Experimental results and conclusions in this study facilitate our insight into the DNA-protein interactions and the enzymatic cleavage mechanism, particularly for those whose detailed structure information is not available. In addition, the information could benefit the development of bioengineering and synthetic biology.

  14. Effects of methylation-sensitive enzymes on the enrichment of genic SNPs and the degree of genome complexity reduction in a two-enzyme genotyping-by-sequencing (GBS) approach: a case study in oil palm (Elaeis guineensis).

    Science.gov (United States)

    Pootakham, Wirulda; Sonthirod, Chutima; Naktang, Chaiwat; Jomchai, Nukoon; Sangsrakru, Duangjai; Tangphatsornruang, Sithichoke

    2016-01-01

    Advances in next generation sequencing have facilitated a large-scale single nucleotide polymorphism (SNP) discovery in many crop species. Genotyping-by-sequencing (GBS) approach couples next generation sequencing with genome complexity reduction techniques to simultaneously identify and genotype SNPs. Choice of enzymes used in GBS library preparation depends on several factors including the number of markers required, the desired level of multiplexing, and whether the enrichment of genic SNP is preferred. We evaluated various combinations of methylation-sensitive (AatII, PstI, MspI) and methylation-insensitive (SphI, MseI) enzymes for their effectiveness in genome complexity reduction and enrichment of genic SNPs. We discovered that the use of two methylation-sensitive enzymes effectively reduced genome complexity and did not require a size selection step. On the contrary, the genome coverage of libraries constructed with methylation-insensitive enzymes was quite high, and the additional size selection step may be required to increase the overall read depth. We also demonstrated the effectiveness of methylation-sensitive enzymes in enriching for SNPs located in genic regions. When two methylation-insensitive enzymes were used, only 16% of SNPs identified were located in genes and 18% in the vicinity (± 5 kb) of the genic regions, while most SNPs resided in the intergenic regions. In contrast, a remarkable degree of enrichment was observed when two methylation-sensitive enzymes were employed. Almost two thirds of the SNPs were located either inside (32-36%) or in the vicinity (28-31%) of the genic regions. These results provide useful information to help researchers choose appropriate GBS enzymes in oil palm and other crop species.

  15. Enzyme Nanorings

    OpenAIRE

    Chou, Tsui-Fen; So, Christopher; White, Brian R.; Carlson, Jonathan C.T.; Sarikaya, Mehmet; Wagner, Carston

    2008-01-01

    We have demonstrated that nanostructures, and in particular nanorings incorporating a homodimeric enzyme, can be prepared by chemically induced self-assembly of dihydrofolate reductase (DHFR)-histidine triad nucleotide binding 1(Hint1) fusion proteins. The dimensions of the nanorings were found by static light scattering and atomic force microscopy studies to be dependent on the length and composition of the peptide linking the fusion proteins, ranging in size from 10 to 70 nm in diameter and...

  16. Determination of genotype differences through restriction ...

    African Journals Online (AJOL)

    Tyrosinase gene or C locus has long been implicated in the coat colour determination. This gene a copper-containing enzyme located on chromosome 11q14.3 is expressed in melanocytes and controls the major steps in pigment production. In camel, C locus a restriction site provoked by the T variant of the mutation was ...

  17. Mitochondrial DNA restriction site map of Cochliomyia macellaria (Diptera:Calliphoridae).

    Science.gov (United States)

    Roehrdanz, R L; Johnson, D A

    1996-09-01

    The mitochondrial DNA of the secondary screwworm, Cochliomyia macellaria (F.), was cleaved with 15 restriction endonucleases to produce 54 restriction fragments. Forty-three restriction sites recognized by 12 enzymes were assigned positions on a restriction site map. Both the restriction fragments and the restriction site map were compared with published data from the screwworm, Cochliomyia hominivorax (Coquerel). The restriction site maps were aligned using a combination of highly conserved restriction sites. Estimated nucleotide divergence between the 2 species based on the fragments was 0.052. The divergence based on the restriction site map was 0.093. The data provide a baseline for future population or phylogenetic investigations.

  18. Mechanistic insight into Type I restriction endonucleases.

    Science.gov (United States)

    Youell, James; Firman, Keith

    2012-06-01

    Restriction and modification are two opposing activities that are used to protect bacteria from cellular invasion by DNA (e.g. bacteriophage infection). Restriction activity involves cleavage of the DNA; while modification activity is the mechanism used to "mark" host DNA and involves DNA methylation. The study of Type I restriction enzymes has often been seen as an esoteric exercise and this reflects some of their more unusual properties - non-stoichiometric (non-catalytic) cleavage of the DNA substrate, random cleavage of DNA, a massive ATPase activity, and the ability to both cleave DNA and methylate DNA. Yet these enzymes have been found in many bacteria and are very efficient as a means of protecting bacteria against bacteriophage infection, indicating they are successful enzymes. In this review, we summarise recent work on the mechanisms of action, describe switching of function and review their mechanism of action. We also discuss structural rearrangements and cellular localisation, which provide powerful mechanisms for controlling the enzyme activity. Finally, we speculate as to their involvement in recombination and discuss their relationship to helicase enzymes.

  19. Identification of leptospiral isolates by bacterial restriction endonuclease analysis (Brenda

    Directory of Open Access Journals (Sweden)

    Venkatesha M

    2001-01-01

    Full Text Available DNA samples from 19 reference serovars belonging to 19 different serogroups of Leptospira interrogans and two serovars belonging to Leptospira biflexa were examined by bacterial restriction endonuclease analysis using EcoR I and Hae III enzymes. All the serovars gave unique restriction patterns that differed from each other. DNA from 10 local isolates digested with these enzymes produced patterns which on comparison with the standard patterns produced by reference strains could be identified to serovar level.

  20. Massively parallel characterization of restriction endonucleases.

    Science.gov (United States)

    Kamps-Hughes, Nick; Quimby, Aine; Zhu, Zhenyu; Johnson, Eric A

    2013-06-01

    Restriction endonucleases are highly specific in recognizing the particular DNA sequence they act on. However, their activity is affected by sequence context, enzyme concentration and buffer composition. Changes in these factors may lead to either ineffective cleavage at the cognate restriction site or relaxed specificity allowing cleavage of degenerate 'star' sites. Additionally, uncharacterized restriction endonucleases and engineered variants present novel activities. Traditionally, restriction endonuclease activity is assayed on simple substrates such as plasmids and synthesized oligonucleotides. We present and use high-throughput Illumina sequencing-based strategies to assay the sequence specificity and flanking sequence preference of restriction endonucleases. The techniques use fragmented DNA from sequenced genomes to quantify restriction endonuclease cleavage on a complex genomic DNA substrate in a single reaction. By mapping millions of restriction site-flanking reads back to the Escherichia coli and Drosophila melanogaster genomes we were able to quantitatively characterize the cognate and star site activity of EcoRI and MfeI and demonstrate genome-wide decreases in star activity with engineered high-fidelity variants EcoRI-HF and MfeI-HF, as well as quantify the influence on MfeI cleavage conferred by flanking nucleotides. The methods presented are readily applicable to all type II restriction endonucleases that cleave both strands of double-stranded DNA.

  1. A simple method of DNA extraction from coffee seeds suitable for ...

    African Journals Online (AJOL)

    SERVER

    2008-02-19

    Feb 19, 2008 ... Quality of DNA was confirmed by digestion using EcoRI, HindIII and PstI restriction endonucleases and complete digestion ... Villarsachi x Hybrido de Timor. 360.0. 8. Cauvery. Caturra x Hybrido de ... buffer, 2 µl of BSA (10 mg/ml) and 8 units of restriction enzymes at. 37oC overnight. The digested DNA was ...

  2. Restriction Inhibition Assay: A Qualitative and Quantitative Method to ...

    African Journals Online (AJOL)

    rich fractions (PRFs) with high affinity for EcoRI and HindIII restriction .... DNA along with each restriction enzyme was kept to analyze the results of the ..... Puvvada MS, Hartley JA, Jenkins TC, Thurston DE. A quantitative assay to measure the ...

  3. Identification of beef using restriction fragment length polymorphism–

    Directory of Open Access Journals (Sweden)

    R. A. Al-Sanjary

    2009-01-01

    Full Text Available To differentiate the beef from other types of meat consumed by human, DNA markers based on polymerase chain reaction restriction fragment length polymorphism technique is performed by using universal primers designed on mitochondrial cytochrome b gene to obtain amplified band 359 bp, then digested with some of restriction enzymes like Tru91, RsaI, Hinf I, Hae III, Alu I, Taq I, Mob I. The result revealed that, the Hinf I enzyme produce three bands 198, 117, 44 bp and the Hae III enzyme revealed two band 285, 74 bp, the Alu I enzyme also produced two band but the molecular weight are 190, 169 bp. The other enzymes did not reveal any digestion of the amplified bands and this result is a characteristic unique to beef compared with other types of meat when using same enzymes.

  4. A physical map of human Alu repeats cleavage by restriction endonucleases

    Directory of Open Access Journals (Sweden)

    Chernukhin Valery A

    2008-06-01

    Full Text Available Abstract Background Alu repetitive elements are the abundant sequences in human genome. Diversity of DNA sequences of these elements makes difficult the construction of theoretical patterns of Alu repeats cleavage by restriction endonucleases. We have proposed a method of restriction analysis of Alu repeats sequences in silico. Results Simple software to analyze Alu repeats database has been suggested and Alu repeats digestion patterns for several restriction enzymes' recognition sites have been constructed. Restriction maps of Alu repeats cleavage for corresponding restriction enzymes have been calculated and plotted. Theoretical data have been compared with experimental results on DNA hydrolysis with restriction enzymes, which we obtained earlier. Conclusion Alu repeats digestions provide the main contribution to the patterns of human chromosomal DNA cleavage. This corresponds to the experimental data on total human DNA hydrolysis with restriction enzymes.

  5. distribution, abundance and properties of restriction enzymes on ...

    African Journals Online (AJOL)

    structural and functional information derived from cDNA sequences of the genes is limited because the origin of such DNA sequence is. RNA, which is an expressed part of the gene. To close this information gap, we have cloned, sequenced and described the genomic arrangement of GBSS I and II in cassava. (Opabode et ...

  6. Restriction fragment length polymorphism of flagellin genes of Campylobacter jejuni and/or C. coli isolates from Egypt.

    Science.gov (United States)

    Mohran, Z S; Guerry, P; Lior, H; Murphy, J R; el-Gendy, A M; Mikhail, M M; Oyofo, B A

    1996-05-01

    The conservation of flagellin genes from thermophilic Campylobacter spp. strains isolated in Egypt was evaluated by a restriction fragment length polymorphism (RFLP) assay. The flaA and flaB genes were amplified from 59 independent clinical isolates and digested with EcoRI and PstI, and the resulting patterns were compared with each other and with previously described RFLP groups. The results indicate that the isolates fell into 14 groups for flaA and 11 groups for flaB, 9 of which have been described, and that considerable genetic variability exists among isolates belonging to the same LIO serogroup. In most cases, the flaB gene displayed the same RFLP pattern as that of the flaA gene of the same strain, although some variability was observed. The data suggest that more variability of flagellin genes exists within the LIO serogroups common to Campylobacter field isolates from Egypt than has previously been reported for North American isolates.

  7. RestrictionDigest: A powerful Perl module for simulating genomic restriction digests

    Directory of Open Access Journals (Sweden)

    Jinpeng Wang

    2016-05-01

    Conclusions: RestrictionDigest is an easy-to-use Perl module with flexible parameter settings. With the help of the information produced by the module, researchers can easily determine the most appropriate enzymes to construct the reduced-representation libraries to meet their experimental requirements.

  8. Restrictions and Proportionality

    DEFF Research Database (Denmark)

    Werlauff, Erik

    2009-01-01

    against host country restrictions, but which is often not recognised to the same extent by national law, and 3) the importance of also identifying and recognising an exit restriction, so that it is possible to achieve the required test of appropriateness and proportionality in relation to the rule......The article discusses three central aspects of the freedoms under European Community law, namely 1) the prohibition against restrictions as an important extension of the prohibition against discrimination, 2) a prohibition against exit restrictions which is just as important as the prohibition...

  9. Restriction site extension PCR: a novel method for high-throughput characterization of tagged DNA fragments and genome walking.

    Directory of Open Access Journals (Sweden)

    Jiabing Ji

    Full Text Available BACKGROUND: Insertion mutant isolation and characterization are extremely valuable for linking genes to physiological function. Once an insertion mutant phenotype is identified, the challenge is to isolate the responsible gene. Multiple strategies have been employed to isolate unknown genomic DNA that flanks mutagenic insertions, however, all these methods suffer from limitations due to inefficient ligation steps, inclusion of restriction sites within the target DNA, and non-specific product generation. These limitations become close to insurmountable when the goal is to identify insertion sites in a high throughput manner. METHODOLOGY/PRINCIPAL FINDINGS: We designed a novel strategy called Restriction Site Extension PCR (RSE-PCR to efficiently conduct large-scale isolation of unknown genomic DNA fragments linked to DNA insertions. The strategy is a modified adaptor-mediated PCR without ligation. An adapter, with complementarity to the 3' overhang of the endonuclease (KpnI, NsiI, PstI, or SacI restricted DNA fragments, extends the 3' end of the DNA fragments in the first cycle of the primary RSE-PCR. During subsequent PCR cycles and a second semi-nested PCR (secondary RSE-PCR, touchdown and two-step PCR are combined to increase the amplification specificity of target fragments. The efficiency and specificity was demonstrated in our characterization of 37 tex mutants of Arabidopsis. All the steps of RSE-PCR can be executed in a 96 well PCR plate. Finally, RSE-PCR serves as a successful alternative to Genome Walker as demonstrated by gene isolation from maize, a plant with a more complex genome than Arabidopsis. CONCLUSIONS/SIGNIFICANCE: RSE-PCR has high potential application in identifying tagged (T-DNA or transposon sequence or walking from known DNA toward unknown regions in large-genome plants, with likely application in other organisms as well.

  10. Restricting wolves risks escape

    Science.gov (United States)

    Mech, L. David; Ballard, Warren; Bangs, Ed; Ream, Bob

    2010-01-01

    Implementing the proposal set forth by Licht and colleagues (BioScience 60: 147–153) requires restricting wolves to tiny "islands," areas that are magnitudes smaller than the ranges of most wolf populations. Wolves naturally have large ranges; restricting their spatial needs increases the risk of wolves escaping, exacerbating public relations and political and legal problems.

  11. Enzyme detection by microfluidics

    DEFF Research Database (Denmark)

    2013-01-01

    Microfluidic-implemented methods of detecting an enzyme, in particular a DNA-modifying enzyme, are provided, as well as methods for detecting a cell, or a microorganism expressing said enzyme. The enzyme is detected by providing a nucleic acid substrate, which is specifically targeted by that enzyme......Microfluidic-implemented methods of detecting an enzyme, in particular a DNA-modifying enzyme, are provided, as well as methods for detecting a cell, or a microorganism expressing said enzyme. The enzyme is detected by providing a nucleic acid substrate, which is specifically targeted...

  12. Optical Whole-Genome Restriction Mapping as a Tool for Rapidly Distinguishing and Identifying Bacterial Contaminants in Clinical Samples

    Science.gov (United States)

    2015-08-01

    mapping is a technology in which a genome is linearized on a surface and digested with specific restriction enzymes , giving an arrangement of the genome... enzyme . Finally, we demonstrated that optical restriction maps were successfully obtained and the correct organism identified within a clinical matrix...is a technology in which a genome is linearized on a surface and digested with specific restriction enzymes , giving an arrangement of the genome

  13. DNA Modification Methylase Activity of Escherichia coli Restriction Endonucleases K and P

    Science.gov (United States)

    Haberman, Allan; Heywood, Janet; Meselson, Matthew

    1972-01-01

    The highly purified restriction endonucleases of E. coli K and coliphage P1 transfer methyl groups from S-adenosylmethionine to adenine residues of unmodified DNA. Incubation of unmodified DNA with endonucleases K or P and S-adenosylmethionine renders the DNA resistant to restriction. The enzymes, therefore, have both restriction endonuclease and modification methylase activities. PMID:4564204

  14. Enzyme Kinetics? Elementary, my dear 3 -8 ...

    Indian Academy of Sciences (India)

    Elementary, my dear. 2. The Analysis and Significance of Kinetic Parameters. Desirazu N. Rao is at the. Department of. Biochemistry, Indian. Institute of Science,. Bangalore. His main research interests are in the areas of protein-DNA interactions using restriction enzymes as model systems, and in. DNA methylation.

  15. Bifunctional TaqII restriction endonuclease: redefining the prototype DNA recognition site and establishing the Fidelity Index for partial cleaving

    National Research Council Canada - National Science Library

    Zylicz-Stachula, Agnieszka; Zołnierkiewicz, Olga; Sliwińska, Katarzyna; Jeżewska-Frąckowiak, Joanna; Skowron, Piotr M

    2011-01-01

    The TaqII enzyme is a member of the Thermus sp. enzyme family that we propounded previously within Type IIS restriction endonucleases, containing related thermophilic bifunctional endonucleases-methyltransferases from various Thermus sp...

  16. Mining for Restriction Endonucleases in Nicaragua

    Directory of Open Access Journals (Sweden)

    Suyén S. Espinoza-Miranda

    2012-12-01

    Full Text Available The Molecular Biology Center at the University of Central America in Nicaragua (CBM-UCA was founded in 1999 to strengthen biotechnology research capacity and education in Nicaragua and the Central American region. One of the first projects launched by the CBM-UCA was bio-prospecting for key industrial enzymes. This ongoing study seeks to discover and characterize restriction enzymes (RE in bacteria, and to create a database of microorganisms isolated and identified by 16S rDNA sequencing methodology. In this paper we highlight the importance of studying the extreme environmental conditions for building knowledge of Nicaraguan biodiversity through modern molecular biology techniques such as metagenomics. The isolation of prototype enzymes such as EcoRV and ClaI is presented as an update and extension of previously undertaken work.

  17. Elevated Liver Enzymes

    Science.gov (United States)

    Symptoms Elevated liver enzymes By Mayo Clinic Staff Elevated liver enzymes may indicate inflammation or damage to cells in the liver. Inflamed or ... than normal amounts of certain chemicals, including liver enzymes, into the bloodstream, which can result in elevated ...

  18. Formalizing Restriction Categories

    Directory of Open Access Journals (Sweden)

    James Chapman

    2017-03-01

    Full Text Available Restriction categories are an abstract axiomatic framework by Cockett and Lack for reasoning about (generalizations of the idea of partiality of functions. In a restriction category, every map defines an endomap on its domain, the corresponding partial identity map. Restriction categories cover a number of examples of different flavors and are sound and complete with respect to the more synthetic and concrete partial map categories. A partial map category is based on a given category (of total maps and a map in it is a map from a subobject of the domain. In this paper, we report on an Agda formalization of the first chapters of the theory of restriction categories, including the challenging completeness result. We explain the mathematics formalized, comment on the design decisions we made for the formalization, and illustrate them at work.

  19. Energy restriction and potential energy restriction mimetics.

    Science.gov (United States)

    Nikolai, Sibylle; Pallauf, Kathrin; Huebbe, Patricia; Rimbach, Gerald

    2015-12-01

    Energy restriction (ER; also known as caloric restriction) is the only nutritional intervention that has repeatedly been shown to increase lifespan in model organisms and may delay ageing in humans. In the present review we discuss current scientific literature on ER and its molecular, metabolic and hormonal effects. Moreover, criteria for the classification of substances that might induce positive ER-like changes without having to reduce energy intake are summarised. Additionally, the putative ER mimetics (ERM) 2-deoxy-d-glucose, metformin, rapamycin, resveratrol, spermidine and lipoic acid and their suggested molecular targets are discussed. While there are reports on these ERM candidates that describe lifespan extension in model organisms, data on longevity-inducing effects in higher organisms such as mice remain controversial or are missing. Furthermore, some of these candidates produce detrimental side effects such as immunosuppression or lactic acidosis, or have not been tested for safety in long-term studies. Up to now, there are no known ERM that could be recommended without limitations for use in humans.

  20. Characterization and intraspecific variation of Fusarium semitectum ...

    African Journals Online (AJOL)

    Corresponding to the morphological characterization, IGS-RFLP analysis indicated that the 79 isolates could be divided into 2 different clusters assigned as RFLP groups I and II. 49 IGS haplotypes were produced by 8 restriction enzymes (AluI, Bsu15I, BsuRI, Eco881, Hin6I, MspI, PstI and TaqI) which indicated a high level ...

  1. Enzyme loading dependence of cellulose hydrolysis of sugarcane bagasse

    Directory of Open Access Journals (Sweden)

    Carlos Martín

    2012-01-01

    Full Text Available The enzymatic hydrolysis of steam-pretreated sugarcane bagasse, either delignified or non-delignified, was studied as a function of enzyme loading. Hydrolysis experiments were carried out using five enzyme loadings (2.5 to 20 FPU/g cellulose and the concentration of solids was 2% for both materials. Alkaline delignification improved cellulose hydrolysis by increasing surface area. For both materials, glucose concentrations increased with enzyme loading. On the other hand, enzyme loadings higher than 15 FPU/g did not result in any increase in the initial rate, since the excess of enzyme adsorbed onto the substrate restricted the diffusion process through the structure.

  2. Caracterization of Aujeszky's disease virus isolated from South Brazil in the last twenty years by restriction enzyme analysis Caracterização de amostras do vírus de Aujeszky isoladas na região Sul do Brasil nos últimos vinte anos através de análise de restrição enzimática

    Directory of Open Access Journals (Sweden)

    Rejane Schaefer

    2006-09-01

    Full Text Available Aujeszky's disease virus (ADV belongs to Herpesviridae family and is an important etiological agent which infects pigs causing economic losses in swine producing countries worldwide and international trade restrictions to products of swine origin. An eradication program for ADV was established in Santa Catarina State since 2001. The last outbreak was reported in July 2004 and since then none has been reported. The disease has been controlled with the use of a genetic modified vaccine and elimination of seropositives. Aiming the characterization of ADV isolated in the South of Brazil in the last twenty years (1983-2003, a retrospective study based on the genomic analysis of the isolates through a digestion of viral genomic DNA with restriction enzyme Bam HI was done. Thirty-seven ADV samples isolated from swine from the States of Santa Catarina, Parana and Rio Grande do Sul were analyzed. These isolates were compared to the reference strains NIA-4, Bartha and Begonia. The most predominant genomic arrangement was type II found in 33 samples isolated in Santa Catarina State and in one isolate from Rio Grande do Sul State. Genomic arrangement type I, characteristic of vaccine strains was identified in 2 isolates from Parana State and in 1 isolate from Rio Grande do Sul State.O vírus da doença de Aujeszky (VDA pertencente à família Herpesviridae é um importante agente etiológico que infecta suínos causando perdas na produção de suínos no mundo inteiro e restrições para o comércio internacional de suínos ou de seus subprodutos. No estado de Santa Catarina, Brasil, foi instituído em 2001 um programa de erradicação da doença de Aujeszky (DA. O último surto da DA foi reportado em julho de 2004 e desde então não foram notificados mais casos. A doença tem sido controlada com o uso de uma vacina geneticamente modificada e eliminação de animais soropositivos para o VDA. Visando caracterizar amostras do VDA isoladas nos últimos vinte

  3. Fundamentals of enzyme kinetics.

    Science.gov (United States)

    Seibert, Eleanore; Tracy, Timothy S

    2014-01-01

    This chapter provides a general introduction to the kinetics of enzyme-catalyzed reactions, with a focus on drug-metabolizing enzymes. A prerequisite to understanding enzyme kinetics is having a clear grasp of the meanings of "enzyme" and "catalysis." Catalysts are reagents that can increase the rate of a chemical reaction without being consumed in the reaction. Enzymes are proteins that form a subset of catalysts. These concepts are further explored below.

  4. Industrial enzyme applications.

    Science.gov (United States)

    Kirk, Ole; Borchert, Torben Vedel; Fuglsang, Claus Crone

    2002-08-01

    The effective catalytic properties of enzymes have already promoted their introduction into several industrial products and processes. Recent developments in biotechnology, particularly in areas such as protein engineering and directed evolution, have provided important tools for the efficient development of new enzymes. This has resulted in the development of enzymes with improved properties for established technical applications and in the production of new enzymes tailor-made for entirely new areas of application where enzymes have not previously been used.

  5. Solitary restriction endonucleases in prokaryotic genomes.

    Science.gov (United States)

    Ershova, Anna S; Karyagina, Anna S; Vasiliev, Mikhail O; Lyashchuk, Alexander M; Lunin, Vladimir G; Spirin, Sergey A; Alexeevski, Andrei V

    2012-11-01

    Prokaryotic restriction-modification (R-M) systems defend the host cell from the invasion of a foreign DNA. They comprise two enzymatic activities: specific DNA cleavage activity and DNA methylation activity preventing cleavage. Typically, these activities are provided by two separate enzymes: a DNA methyltransferase (MTase) and a restriction endonuclease (RE). In the absence of a corresponding MTase, an RE of Type II R-M system is highly toxic for the cell. Genes of the R-M system are linked in the genome in the vast majority of annotated cases. There are only a few reported cases in which the genes of MTase and RE from one R-M system are not linked. Nevertheless, a few hundreds solitary RE genes are present in the Restriction Enzyme Database (http://rebase.neb.com) annotations. Using the comparative genomic approach, we analysed 272 solitary RE genes. For 57 solitary RE genes we predicted corresponding MTase genes located distantly in a genome. Of the 272 solitary RE genes, 99 are likely to be fragments of RE genes. Various explanations for the existence of the remaining 116 solitary RE genes are also discussed.

  6. Intrauterine growth restriction

    Directory of Open Access Journals (Sweden)

    Bernardita Donoso Bernales

    2012-07-01

    Full Text Available It is estimated that the true prevalence of intrauterine growth restriction is 3-10% of all pregnancies, making this fetal condition one of the most frequent obstetric problems, together with premature labor and premature rupture of membranes. The article stresses the importance of early diagnosis because of the associated risks.

  7. Effect of dietary protein restriction on renal ammonia metabolism

    Science.gov (United States)

    Lee, Hyun-Wook; Osis, Gunars; Handlogten, Mary E.; Guo, Hui; Verlander, Jill W.

    2015-01-01

    Dietary protein restriction has multiple benefits in kidney disease. Because protein intake is a major determinant of endogenous acid production, it is important that net acid excretion change in parallel during protein restriction. Ammonia is the primary component of net acid excretion, and inappropriate ammonia excretion can lead to negative nitrogen balance. Accordingly, we examined ammonia excretion in response to protein restriction and then we determined the molecular mechanism of the changes observed. Wild-type C57Bl/6 mice fed a 20% protein diet and then changed to 6% protein developed an 85% reduction in ammonia excretion within 2 days, which persisted during a 10-day study. The expression of multiple proteins involved in renal ammonia metabolism was altered, including the ammonia-generating enzymes phosphate-dependent glutaminase (PDG) and phosphoenolpyruvate carboxykinase (PEPCK) and the ammonia-metabolizing enzyme glutamine synthetase. Rhbg, an ammonia transporter, increased in expression in the inner stripe of outer medullary collecting duct intercalated cell (OMCDis-IC). However, collecting duct-specific Rhbg deletion did not alter the response to protein restriction. Rhcg deletion did not alter ammonia excretion in response to dietary protein restriction. These results indicate 1) dietary protein restriction decreases renal ammonia excretion through coordinated regulation of multiple components of ammonia metabolism; 2) increased Rhbg expression in the OMCDis-IC may indicate a biological role in addition to ammonia transport; and 3) Rhcg expression is not necessary to decrease ammonia excretion during dietary protein restriction. PMID:25925252

  8. Late gestational nutrient restriction

    DEFF Research Database (Denmark)

    Tygesen, Malin Plumhoff; Nielsen, Mette Olaf; Nørgaard, Peder

    2008-01-01

    We investigated the effect of 50% nutrient restriction during the last 6 weeks of gestation on twin-pregnant ewes' plasma glucose, non-esterified fatty acid, beta-hydroxybutyrate, insulin, IGF-1 and leptin concentrations and the effects on lamb birth weight and ewes' lactation performance. Plasma...... changes in feed intake and energy balance. It is concluded that severely reduced nutrient availability in late gestation affects fetal growth in utero and has a prolonged negative effect on lactation performance....

  9. License restrictions at Barnwell

    Energy Technology Data Exchange (ETDEWEB)

    Autry, V.R. [S.C. Dept. of Health and Environmental Control, Columbia, SC (United States). Bureau of Radiological Health

    1991-12-31

    The State of South Carolina was delegated the authority by the US Nuclear Regulatory Commission to regulate the receipt, possession, use and disposal of radioactive material as an Agreement State. Since 1970, the state has been the principal regulatory authority for the Barnwell Low-Level Waste Disposal Facility operated by Chem-Nuclear Systems, Inc. The radioactive material license issued authorizing the receipt and disposal of low-level waste contains numerous restrictions to ensure environmental protection and compliance with shallow land disposal performance criteria. Low-level waste has evolved from minimally contaminated items to complex waste streams containing high concentrations of radionuclides and processing chemicals which necessitated these restrictions. Additionally, some waste with their specific radionuclides and concentration levels, many classified as low-level radioactive waste, are not appropriate for shallow land disposal unless additional precautions are taken. This paper will represent a number of these restrictions, the rationale for them, and how they are being dealt with at the Barnwell disposal facility.

  10. Enzyme inhibition by iminosugars

    DEFF Research Database (Denmark)

    López, Óscar; Qing, Feng-Ling; Pedersen, Christian Marcus

    2013-01-01

    Imino- and azasugar glycosidase inhibitors display pH dependant inhibition reflecting that both the inhibitor and the enzyme active site have groups that change protonation state with pH. With the enzyme having two acidic groups and the inhibitor one basic group, enzyme-inhibitor complexes...

  11. The growth performance of growing pigs during feed restriction and ...

    African Journals Online (AJOL)

    STORAGESEVER

    2009-01-19

    Jan 19, 2009 ... restriction period. However, at the end of the 56 days re-alimentation, pigs on the 80% and 70% feeding regime had superior ADG than the pigs on the control and 90 percent feeding regime. .... enzyme activity and metabolism of various nutrients, .... of exotic pigs reared in the tropics was reported to de-.

  12. Rapid establishment of polymerase chain reaction-restriction ...

    African Journals Online (AJOL)

    Seven sets of chloroplast primers could produce one or more distinct bands. After the amplified products were digested by 10 restriction enzymes, a total of 135 bands were detected, among which 98 bands (72.59%) were polymorphic. The cpDNA PCR-RFLP based genetic distance (GD) among 30 tea accessions ranged ...

  13. Genetic variation of Japanese loach inferred from restriction ...

    African Journals Online (AJOL)

    Ten haplotypes were detected using seven restriction enzymes (Alu I, Hinc II, Msp I, EcoR I, Hinf I, Hae III and Taq I). The differences between each pair of the populations were significant (p<0,0001~p<0.05), except for the test involving populations Saito and Nikko, and Ueda and Futtsu (p=1). The haplotypic and nucleotide ...

  14. The Restriction Endonuclease Cleavage Map of Rat Liver Mitochondrial DNA

    NARCIS (Netherlands)

    Bakker, H.; Holtrop, M.; Terpstra, P.

    1977-01-01

    Mitochondrial DNA from rat liver contains six sites for cleavage by the restriction endonucleases Hind III and EcoRI. A large stretch of DNA, comprising about 40% of the mitochondrial genome is not cleaved by either of the enzymes; eight cleavage sites are located on a DNA stretch of 35% of the

  15. Restriction-modification system with methyl-inhibited base excision and abasic-site cleavage activities.

    Science.gov (United States)

    Fukuyo, Masaki; Nakano, Toshiaki; Zhang, Yingbiao; Furuta, Yoshikazu; Ishikawa, Ken; Watanabe-Matsui, Miki; Yano, Hirokazu; Hamakawa, Takeshi; Ide, Hiroshi; Kobayashi, Ichizo

    2015-03-11

    The restriction-modification systems use epigenetic modification to distinguish between self and nonself DNA. A modification enzyme transfers a methyl group to a base in a specific DNA sequence while its cognate restriction enzyme introduces breaks in DNA lacking this methyl group. So far, all the restriction enzymes hydrolyze phosphodiester bonds linking the monomer units of DNA. We recently reported that a restriction enzyme (R.PabI) of the PabI superfamily with half-pipe fold has DNA glycosylase activity that excises an adenine base in the recognition sequence (5'-GTAC). We now found a second activity in this enzyme: at the resulting apurinic/apyrimidinic (AP) (abasic) site (5'-GT#C, # = AP), its AP lyase activity generates an atypical strand break. Although the lyase activity is weak and lacks sequence specificity, its covalent DNA-R.PabI reaction intermediates can be trapped by NaBH4 reduction. The base excision is not coupled with the strand breakage and yet causes restriction because the restriction enzyme action can impair transformation ability of unmethylated DNA even in the absence of strand breaks in vitro. The base excision of R.PabI is inhibited by methylation of the target adenine base. These findings expand our understanding of genetic and epigenetic processes linking those in prokaryotes and eukaryotes. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.

  16. Temporal dynamics of methyltransferase and restriction endonuclease accumulation in individual cells after introducing a restriction-modification system.

    Science.gov (United States)

    Morozova, Natalia; Sabantsev, Anton; Bogdanova, Ekaterina; Fedorova, Yana; Maikova, Anna; Vedyaykin, Alexey; Rodic, Andjela; Djordjevic, Marko; Khodorkovskii, Mikhail; Severinov, Konstantin

    2016-01-29

    Type II restriction-modification (R-M) systems encode a restriction endonuclease that cleaves DNA at specific sites, and a methyltransferase that modifies same sites protecting them from restriction endonuclease cleavage. Type II R-M systems benefit bacteria by protecting them from bacteriophages. Many type II R-M systems are plasmid-based and thus capable of horizontal transfer. Upon the entry of such plasmids into a naïve host with unmodified genomic recognition sites, methyltransferase should be synthesized first and given sufficient time to methylate recognition sites in the bacterial genome before the toxic restriction endonuclease activity appears. Here, we directly demonstrate a delay in restriction endonuclease synthesis after transformation of Escherichia coli cells with a plasmid carrying the Esp1396I type II R-M system, using single-cell microscopy. We further demonstrate that before the appearance of the Esp1396I restriction endonuclease the intracellular concentration of Esp1396I methyltransferase undergoes a sharp peak, which should allow rapid methylation of host genome recognition sites. A mathematical model that satisfactorily describes the observed dynamics of both Esp1396I enzymes is presented. The results reported here were obtained using a functional Esp1396I type II R-M system encoding both enzymes fused to fluorescent proteins. Similar approaches should be applicable to the studies of other R-M systems at single-cell level. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.

  17. Enzymes and muscle diseases

    Directory of Open Access Journals (Sweden)

    M. Plebani

    2011-09-01

    Full Text Available Skeletal muscle disorders may result in release of muscle enzymes into the circulation and give increased serum enzyme activity. A variety of enzymes routinely determined in the clinical laboratory may be elevated, but creatine kinase is the enzyme present in the highest concentration in muscle, and in every variety of muscle disease is the serum enzyme which shows the greatest incidence and degree of elevation. Aspartate aminotransferase is the enzyme associated most significantly with inflammation. A diagnostic algorithm based on the combined measurement of creatine kinase, aspartate aminotransferase and aldolase has been found to discriminate muscular distrophies from polymyositis and other myopathies. This combination of laboratory tests has diagnostic application and thus allows the clinician to better select patients who need to have a skeletal muscle biopsy as a diagnostic procedure.

  18. Enzymes for improved biomass conversion

    Science.gov (United States)

    Brunecky, Roman; Himmel, Michael E.

    2016-02-02

    Disclosed herein are enzymes and combinations of the enzymes useful for the hydrolysis of cellulose and the conversion of biomass. Methods of degrading cellulose and biomass using enzymes and cocktails of enzymes are also disclosed.

  19. Profiling the orphan enzymes

    Science.gov (United States)

    2014-01-01

    The emergence of Next Generation Sequencing generates an incredible amount of sequence and great potential for new enzyme discovery. Despite this huge amount of data and the profusion of bioinformatic methods for function prediction, a large part of known enzyme activities is still lacking an associated protein sequence. These particular activities are called “orphan enzymes”. The present review proposes an update of previous surveys on orphan enzymes by mining the current content of public databases. While the percentage of orphan enzyme activities has decreased from 38% to 22% in ten years, there are still more than 1,000 orphans among the 5,000 entries of the Enzyme Commission (EC) classification. Taking into account all the reactions present in metabolic databases, this proportion dramatically increases to reach nearly 50% of orphans and many of them are not associated to a known pathway. We extended our survey to “local orphan enzymes” that are activities which have no representative sequence in a given clade, but have at least one in organisms belonging to other clades. We observe an important bias in Archaea and find that in general more than 30% of the EC activities have incomplete sequence information in at least one superkingdom. To estimate if candidate proteins for local orphans could be retrieved by homology search, we applied a simple strategy based on the PRIAM software and noticed that candidates may be proposed for an important fraction of local orphan enzymes. Finally, by studying relation between protein domains and catalyzed activities, it appears that newly discovered enzymes are mostly associated with already known enzyme domains. Thus, the exploration of the promiscuity and the multifunctional aspect of known enzyme families may solve part of the orphan enzyme issue. We conclude this review with a presentation of recent initiatives in finding proteins for orphan enzymes and in extending the enzyme world by the discovery of new

  20. Enzymes in animal nutrition

    OpenAIRE

    Scientific Committee on Animal Nutrition

    2011-01-01

    This report brings overview of endogenous as well as exogenous enzymes and their role and importance in animal nutrition. Enzymes for animal nutrition have been systematically developed since 1980´s. Phytase, xylanase and β-glucanase are used in poultry-rising, pig breeding, aquaculture and begin to push to the ruminant nutrition. Phytase increase availability of P, Ca, Zn, digestibility of proteins and fats. Its positive effect on the environment is well described – enzymes decrease the cont...

  1. Enzyme catalysed tandem reactions

    OpenAIRE

    Oroz-Guinea, Isabel; García-Junceda, Eduardo

    2013-01-01

    To transfer to the laboratory, the excellent efficiency shown by enzymes in Nature, biocatalysis, had to mimic several synthetic strategies used by the living organisms. Biosynthetic pathways are examples of tandem catalysis and may be assimilated in the biocatalysis field for the use of isolated multi-enzyme systems in the homogeneous phase. The concurrent action of several enzymes that work sequentially presents extraordinary advantages from the synthetic point of view, since it permits a r...

  2. Food and feed enzymes.

    Science.gov (United States)

    Fraatz, Marco Alexander; Rühl, Martin; Zorn, Holger

    2014-01-01

    Humans have benefited from the unique catalytic properties of enzymes, in particular for food production, for thousands of years. Prominent examples include the production of fermented alcoholic beverages, such as beer and wine, as well as bakery and dairy products. The chapter reviews the historic background of the development of modern enzyme technology and provides an overview of the industrial food and feed enzymes currently available on the world market. The chapter highlights enzyme applications for the improvement of resource efficiency, the biopreservation of food, and the treatment of food intolerances. Further topics address the improvement of food safety and food quality.

  3. Training Restricted Boltzmann Machines

    DEFF Research Database (Denmark)

    Fischer, Asja

    Restricted Boltzmann machines (RBMs) are probabilistic graphical models that can also be interpreted as stochastic neural networks. Training RBMs is known to be challenging. Computing the likelihood of the model parameters or its gradient is in general computationally intensive. Thus, training re...... of the applied sampling procedure and I will introduce a transition operator that leads to faster mixing. Finally, a different parametrisation of RBMs will be discussed that leads to better learning results and more robustness against changes in the data representation....... relies on sampling based approximations of the log-likelihood gradient. I will present an empirical and theoretical analysis of the bias of these approximations and show that the approximation error can lead to a distortion of the learning process. The bias decreases with increasing mixing rate...

  4. Operating considerations of ultrafiltration in enzyme enhanced carbon capture

    DEFF Research Database (Denmark)

    Deslauriers, Maria Gundersen; Gladis, Arne; Fosbøl, Philip Loldrup

    2017-01-01

    could be used. It was found that with enzyme retention of 99.9%, with instant deactivation, after 1 month 50% of the activity is lost. Thus the use of membranes in enzyme enhanced CCS might be restricted to temperatures below 100 °C, or temperatures the enzyme can withstand for shorter time periods.......Today, enzyme enhanced carbon capture and storage (CCS) is gaining interest, since it can enable the use of energy efficient solvents, and thus potentially reduce the carbon footprint of CCS. However, a limitation of this technology is the high temperatures encountered in the stripper column, which...... can deactivate the enzymes. One solution to this challenge is the use of ultrafiltration to retain the enzyme in the absorber unit. In this report, a base case of a CCS facility is used to model the impact of such membranes for use in a full scale CCS commercial plant. The base case has an approximate...

  5. The effects of dietary restriction on oxidative stress in rodents

    Science.gov (United States)

    Walsh, Michael E.; Shi, Yun; Van Remmen, Holly

    2013-01-01

    Oxidative stress is observed during aging and in numerous age-related diseases. Dietary restriction (DR) is a regimen that protects against disease and extends lifespan in multiple species. However, it is unknown how DR mediates its protective effects. One prominent and consistent effect of DR in a number of systems is the ability to reduce oxidative stress and damage. The purpose of this review is to comprehensively examine the hypothesis that dietary restriction reduces oxidative stress in rodents by decreasing reactive oxygen species (ROS) production and increasing antioxidant enzyme activity, leading to an overall reduction of oxidative damage to macromolecules. The literature reveals that the effects of DR on oxidative stress are complex and likely influenced by a variety of factors, including sex, species, tissue examined, types of ROS and antioxidant enzymes examined, and duration of DR. Here we present a comprehensive review of the existing literature on the effect of DR on mitochondrial ROS generation, antioxidant enzymes and oxidative damage. In a majority of studies, dietary restriction had little effect on mitochondrial ROS production or antioxidant activity. On the other hand, DR decreased oxidative damage in the majority of cases. Although the effects of DR on endogenous antioxidants are mixed, we find that glutathione levels are the most likely antioxidant to be increased by dietary restriction, which supports the emerging redox-stress hypothesis of aging. PMID:23743291

  6. Análise de restrição enzimática do gene hsp65 de isolados clínicos de pacientes com suspeita de tuberculose pulmonar em Teresina, Piauí Restriction enzyme analysis of the hsp65 gene in clinical isolates from patients suspected of having pulmonary tuberculosis in Teresina, Brazil

    Directory of Open Access Journals (Sweden)

    Maria das Graças Motta e Bona

    2011-10-01

    suspected of having pulmonary tuberculosis and to determine the impact that the acquisition of this knowledge has on the therapeutic approach. METHODS: We evaluated 106 patients suspected of having pulmonary tuberculosis and referred to the pulmonology department of a public hospital in the city of Teresina, Brazil. Morning sputum specimens were evaluated for the presence of mycobacteria by sputum smear microscopy and culture. We used PCR and restriction enzyme analysis of the hsp65 gene (PRA-hsp65 to identify the strains of mycobacteria isolated in culture. RESULTS: A total of 206 sputum samples were analyzed. Patient ages ranged from 15 to 87 years, and 67% were male. There was cough in 100% of the cases. The predominant radiographic pattern was moderate disease, observed in 70%. Smear positivity was 76%, and isolation in culture occurred in 91% of the cultures. Traditional tests identified nontuberculous mycobacteria (NTM in 9% of the isolates. The PRA-hsp65 method confirmed these data, showing seven band patterns that were able to identify the isolated species of NTM: Mycobacterium kansasii; M. abscessus 1; M. abscessus 2; M. smegmatis; M. flavescens 1; M. gordonae 5; and M. gordonae 7. All of the patients with NTM were over 60 years of age, and bronchiectasis was seen in 88% of the X-rays. There were two cases of reinfection, initially attributed to M. abscessus and M. kansasii. CONCLUSIONS: In immunocompetent patients, NTM can infect the lungs. It is important to identify the specific NTM in order to establish the correct diagnosis and choose the most appropriate therapeutic regimen. The PRA-hsp65 method is useful in identifying NTM species and can be implemented in molecular biology laboratories that do not specialize in the identification of mycobacteria.

  7. Characterization and assessment of an avian repetitive DNA sequence as an icterid phylogenetic marker.

    Science.gov (United States)

    Quinn, J S; Guglich, E; Seutin, G; Lau, R; Marsolais, J; Parna, L; Boag, P T; White, B N

    1992-02-01

    The first tandemly repeated sequence examined in a passerine bird, a 431-bp PstI fragment named pMAT1, has been cloned from the genome of the brown-headed cowbird (Molothrus ater). The sequence represents about 5-10% of the genome (about 4 x 10(5) copies) and yields prominent ethidium bromide stained bands when genomic DNA cut with a variety of restriction enzymes is electrophoresed in agarose gels. A particularly striking ladder of fragments is apparent when the DNA is cut with HinfI, indicative of a tandem arrangement of the monomer. The cloned PstI monomer has been sequenced, revealing no internal repeated structure. There are sequences that hybridize with pMAT1 found in related nine-primaried oscines but not in more distantly related oscines, suboscines, or nonpasserine species. Little sequence similarity to tandemly repeated PstI cut sequences from the merlin (Falco columbarius), saurus crane (Grus antigone), or Puerto Rican parrot (Amazona vittata) or to HinfI digested sequence from the Toulouse goose (Anser anser) was detected. The isolated sequence was used as a probe to examine DNA samples of eight members of the tribe Icterini. This examination revealed phylogenetically informative characters. The repeat contains cutting sites from a number of restriction enzymes, which, if sufficiently polymorphic, would provide new phylogenetic characters. Sequences like these, conserved within a species, but variable between closely related species, may be very useful for phylogenetic studies of closely related taxa.

  8. Enzymes in Fermented Fish.

    Science.gov (United States)

    Giyatmi; Irianto, H E

    Fermented fish products are very popular particularly in Southeast Asian countries. These products have unique characteristics, especially in terms of aroma, flavor, and texture developing during fermentation process. Proteolytic enzymes have a main role in hydrolyzing protein into simpler compounds. Fermentation process of fish relies both on naturally occurring enzymes (in the muscle or the intestinal tract) as well as bacteria. Fermented fish products processed using the whole fish show a different characteristic compared to those prepared from headed and gutted fish. Endogenous enzymes like trypsin, chymotrypsin, elastase, and aminopeptidase are the most involved in the fermentation process. Muscle tissue enzymes like cathepsins, peptidases, transaminases, amidases, amino acid decarboxylases, glutamic dehydrogenases, and related enzymes may also play a role in fish fermentation. Due to the decreased bacterial number during fermentation, contribution of microbial enzymes to proteolysis may be expected prior to salting of fish. Commercial enzymes are supplemented during processing for specific purposes, such as quality improvement and process acceleration. In the case of fish sauce, efforts to accelerate fermentation process and to improve product quality have been studied by addition of enzymes such as papain, bromelain, trypsin, pepsin, and chymotrypsin. © 2017 Elsevier Inc. All rights reserved.

  9. Amperometric enzyme electrodes

    OpenAIRE

    Calvo,E.J.; Danilowicz, C.

    1997-01-01

    Recent advances on amperometric enzyme electrodes are reviewed with particular emphasis on biosensors based on Glucose Oxidase and Horseradish Peroxidase. Redox mediation by artificial soluble and polymer attached redox mediators is discussed in terms of recent theoretical developments and experimental verification. The dependence of the amperometric response on substrate and mediator concentration, enzyme concentration, electrode potential and film thickness are analyzed. Possible applicatio...

  10. Enzyme Vs. Extremozyme -32 ...

    Indian Academy of Sciences (India)

    industries, while Taq polymerase T 4 lysozyme, ribonuclease and malate dehydrogenase are enzymes used in research laboratories. A major limitation of most enzymes used in the industries/ research .... pol 1 , (8) Small domain of Klentaq 1 and (C) Superimposed cluster of aromatic residues in K1entaq1. (thick lines) ...

  11. A Rationale for Restrictive Rules

    OpenAIRE

    Krehbiel, Keith

    1985-01-01

    Congressmen often claim to dislike restrictions on their opportunities to offer amendments to legislation in the Committee of the Whole. Yet restrictive rules of various forms not only are quite common but often are voted into existence explicitly or implicitly. Whenever a modified closed rule from the Rules Committee receives a majority vote, members explicitly accept the restrictions that such rules place on amendments. Whenever a bill is passed under suspension of the rules, the requisite ...

  12. Property Rights, Restrictions and Responsibilities

    DEFF Research Database (Denmark)

    Enemark, Stig

    Land Administration Systems are the basis for conceptualizing rights, restrictions and responsibilities related to people, policies and places. Property rights are normally concerned with ownership and tenure whereas restrictions usually control use and activities on land. Responsibilities relate...... more to a social, ethical commitment or attitude to environmental sustainability and good husbandry. This paper provides an overall understanding of the concept of land administration systems for dealing with rights, restrictions and responsibilities in future spatially enabled government. Finally...

  13. The BsaHI restriction-modification system: Cloning, sequencing and analysis of conserved motifs

    Directory of Open Access Journals (Sweden)

    Roberts Richard J

    2008-05-01

    Full Text Available Abstract Background Restriction and modification enzymes typically recognise short DNA sequences of between two and eight bases in length. Understanding the mechanism of this recognition represents a significant challenge that we begin to address for the BsaHI restriction-modification system, which recognises the six base sequence GRCGYC. Results The DNA sequences of the genes for the BsaHI methyltransferase, bsaHIM, and restriction endonuclease, bsaHIR, have been determined (GenBank accession #EU386360, cloned and expressed in E. coli. Both the restriction endonuclease and methyltransferase enzymes share significant similarity with a group of 6 other enzymes comprising the restriction-modification systems HgiDI and HgiGI and the putative HindVP, NlaCORFDP, NpuORFC228P and SplZORFNP restriction-modification systems. A sequence alignment of these homologues shows that their amino acid sequences are largely conserved and highlights several motifs of interest. We target one such conserved motif, reading SPERRFD, at the C-terminal end of the bsaHIR gene. A mutational analysis of these amino acids indicates that the motif is crucial for enzymatic activity. Sequence alignment of the methyltransferase gene reveals a short motif within the target recognition domain that is conserved among enzymes recognising the same sequences. Thus, this motif may be used as a diagnostic tool to define the recognition sequences of the cytosine C5 methyltransferases. Conclusion We have cloned and sequenced the BsaHI restriction and modification enzymes. We have identified a region of the R. BsaHI enzyme that is crucial for its activity. Analysis of the amino acid sequence of the BsaHI methyltransferase enzyme led us to propose two new motifs that can be used in the diagnosis of the recognition sequence of the cytosine C5-methyltransferases.

  14. NcoI restriction fragment length polymorphism (RFLP) of the tumour necrosis factor (TNF alpha) region in primary biliary cirrhosis and in healthy Danes

    DEFF Research Database (Denmark)

    Fugger, L; Morling, N; Ryder, L P

    1989-01-01

    The restriction fragment length polymorphism of the human tumour necrosis factor (TNF alpha) region was investigated by means of 20 different restriction enzymes and a human TNF alpha cDNA probe. Only one of the enzymes, NcoI, revealed a polymorphic pattern consisting of fragments of 10.5 and 5...

  15. NcoI restriction fragment length polymorphism (RFLP) of the tumour necrosis factor (TNF alpha) region in primary biliary cirrhosis and in healthy Danes

    DEFF Research Database (Denmark)

    Fugger, L; Morling, N; Ryder, L P

    1989-01-01

    The restriction fragment length polymorphism of the human tumour necrosis factor (TNF alpha) region was investigated by means of 20 different restriction enzymes and a human TNF alpha cDNA probe. Only one of the enzymes, NcoI, revealed a polymorphic pattern consisting of fragments of 10.5 and 5.5...

  16. Indicators: Sediment Enzymes

    Science.gov (United States)

    Sediment enzymes are proteins that are produced by microorganisms living in the sediment or soil. They are indicators of key ecosystem processes and can help determine which nutrients are affecting the biological community of a waterbody.

  17. Enzyme catalysed tandem reactions.

    Science.gov (United States)

    Oroz-Guinea, Isabel; García-Junceda, Eduardo

    2013-04-01

    To transfer to the laboratory, the excellent efficiency shown by enzymes in Nature, biocatalysis, had to mimic several synthetic strategies used by the living organisms. Biosynthetic pathways are examples of tandem catalysis and may be assimilated in the biocatalysis field for the use of isolated multi-enzyme systems in the homogeneous phase. The concurrent action of several enzymes that work sequentially presents extraordinary advantages from the synthetic point of view, since it permits a reversible process to become irreversible, to shift the equilibrium reaction in such a way that enantiopure compounds can be obtained from prochiral or racemic substrates, reduce or eliminate problems due to product inhibition or prevent the shortage of substrates by dilution or degradation in the bulk media, etc. In this review we want to illustrate the developments of recent studies involving in vitro multi-enzyme reactions for the synthesis of different classes of organic compounds. Copyright © 2013 Elsevier Ltd. All rights reserved.

  18. Starch Biorefinery Enzymes.

    Science.gov (United States)

    Läufer, Albrecht

    2017-03-07

    Nature uses enzymes to build and convert biomass; mankind uses the same enzymes and produces them on a large scale to make optimum use of biomass in biorefineries. Bacterial α-amylases and fungal glucoamylases have been the workhorses of starch biorefineries for many decades. Pullulanases were introduced in the 1980s. Proteases, cellulases, hemicellulases, and phytases have been on the market for a few years as process aids, improving yields, performance, and costs. Detailed studies of the complex chemical structures of biomass and of the physicochemical limitations of industrial biorefineries have led enzyme developers to produce novel tailor-made solutions for improving yield and profitability in the industry. This chapter reviews the development of enzyme applications in the major starch biorefining processes.

  19. Advances in enzyme immobilisation

    CSIR Research Space (South Africa)

    Brady, D

    2009-07-10

    Full Text Available substrate to fix the structure of cyclodextrin glycosyltransferases during rigidification by immobilisation, thereby enhancing the synthetic capability of the enzyme relative to its hydrolytic activity. In particular, modulation of enzyme... aggregates for enantioselective nitrile hydrolysis. Adv Synth Catal 349:2167- 2176 Kaulpiboon J, Pongsawasdi P, Zimmermann W (2007) Molecular imprinting of cyclodextrin glycosyltransferases from Paenibacillus sp. A11 and Bacillus macerans with γ-cyclodextrin...

  20. Overproduction of ligninolytic enzymes

    Science.gov (United States)

    Elisashvili, Vladimir; Kachlishvili, Eva; Torok, Tamas

    2014-06-17

    Methods, compositions, and systems for overproducing ligninolytic enzymes from the basidiomycetous fungus are described herein. As described, the method can include incubating a fungal strain of Cerrena unicolor IBB 303 in a fermentation system having growth medium which includes lignocellulosic material and then cultivating the fungal strain in the fermentation system under conditions wherein the fungus expresses the ligninolytic enzymes. In some cases, the lignocellulosic material is mandarin peel, ethanol production residue, walnut pericarp, wheat bran, wheat straw, or banana peel.

  1. Influence of Thyroxine on Blood Parameters and Liver Enzymes in ...

    African Journals Online (AJOL)

    This study investigated and compared the influence of exogenous thyroxine with restricted feeding and sex on the blood parameters and liver enzymes in adult male and female Wistar rats. Twelve adult wistar rats (six males and females) were given thyroxine in drinking water at dosage of 50mg/100ml of water/pair/day with ...

  2. Restriction-modification systems in Mycoplasma spp

    Directory of Open Access Journals (Sweden)

    Marcelo Brocchi

    2007-01-01

    Full Text Available Restriction and Modification (R-M systems are present in all Mycoplasma species sequenced so far. The presence of these genes poses barriers to gene transfer and could protect the cell against phage infections. The number and types of R-M genes between different Mycoplasma species are variable, which is characteristic of a polymorphism. The majority of the CDSs code for Type III R-M systems and particularly for methyltransferase enzymes, which suggests that functions other than the protection against the invasion of heterologous DNA may exist. A possible function of these enzymes could be the protection against the invasion of other but similar R-M systems. In Mycoplasma hyopneumoniae strain J, three of the putative methyltransferase genes were clustered in a region forming a genomic island. Many R-M CDSs were mapped in the vicinity of transposable elements suggesting an association between these genes and reinforcing the idea of R-M systems as mobile selfish DNA. Also, many R-M genes present repeats within their coding sequences, indicating that their expression is under the control of phase variation mechanisms. Altogether, these data suggest that R-M systems are a remarkable characteristic of Mycoplasma species and are probably involved in the adaptation of these bacteria to different environmental conditions.

  3. Random-walk enzymes

    Science.gov (United States)

    Mak, Chi H.; Pham, Phuong; Afif, Samir A.; Goodman, Myron F.

    2015-09-01

    Enzymes that rely on random walk to search for substrate targets in a heterogeneously dispersed medium can leave behind complex spatial profiles of their catalyzed conversions. The catalytic signatures of these random-walk enzymes are the result of two coupled stochastic processes: scanning and catalysis. Here we develop analytical models to understand the conversion profiles produced by these enzymes, comparing an intrusive model, in which scanning and catalysis are tightly coupled, against a loosely coupled passive model. Diagrammatic theory and path-integral solutions of these models revealed clearly distinct predictions. Comparison to experimental data from catalyzed deaminations deposited on single-stranded DNA by the enzyme activation-induced deoxycytidine deaminase (AID) demonstrates that catalysis and diffusion are strongly intertwined, where the chemical conversions give rise to new stochastic trajectories that were absent if the substrate DNA was homogeneous. The C →U deamination profiles in both analytical predictions and experiments exhibit a strong contextual dependence, where the conversion rate of each target site is strongly contingent on the identities of other surrounding targets, with the intrusive model showing an excellent fit to the data. These methods can be applied to deduce sequence-dependent catalytic signatures of other DNA modification enzymes, with potential applications to cancer, gene regulation, and epigenetics.

  4. Enzyme recycling in lignocellulosic biorefineries

    DEFF Research Database (Denmark)

    Jørgensen, Henning; Pinelo, Manuel

    2017-01-01

    platform. Cellulases are the most important enzymes required in this process, but the complex nature of lignocellulose requires several other enzymes (hemicellulases and auxiliary enzymes) for efficient hydrolysis. Enzyme recycling increases the catalytic productivity of the enzymes by reusing them...... upscaled and tested in industrial settings, mainly because of many difficulties with recycling of enzymes from the complex lignocellulose hydrolyzate at industrially relevant conditions, i.e., high solids loadings. The challenges are associated with the large number of different enzymes required...... for efficient hydrolysis, enzyme stability, and the detrimental interaction between enzyme and lignin. This review provides a comprehensive overview of the various methods for enzyme recovery and recycling, for example recycling of free enzymes, readsorption to fresh material, recycling of solids, membrane...

  5. Screening for restriction endonucleases in methane-oxidizing bacteria.

    Science.gov (United States)

    Romanovskaya, V A; Alexeyev, M F; Gun'kovskaya, N V; Stolyar, S M; Shatohina, E S; Malashenko Yu, R

    1992-01-01

    51 methane-oxidizing bacteria strains such as Methylomonas methanica, M. rubra, Methylococcus capsulatus, M. thermophilus, M. luteus, M. ucrainicus, M. whittenburyi, Methylosinus trichosporium, M. sporium, Methylocystis parvus isolated from various ecological niches and geographical regions of the Ukraine and also the strains received from R. Whittenbury and Y. Heyer were screened for restriction endonucleases. Type II restriction endonucleases were detected in IMV B-3112 (= 12 b), IMV B-3027 (= 26), IMV B-3019 (= 9 c), IMV B-3017 (= 17 c), IMV B-3226 (= 26 v), IMV B-3033 (= Y), IMV B-3100 (= 100) and IMV B-3494 (= 1E494). The results obtained were indicative of relatively high frequency of restriction enzymes occurrence in methane-oxidizing bacteria. There were Kpn I (Asp 7181) restriction endonuclease isoschizomers in crude extracts of IMV B-3112, B-3017, B-3019, B-3027 isolated from fresh-water silt as well as in IMV B-3226 strain isolated from waste-water silt. Although these isolates had bee previously considered as untypical strains of M. ucrainicus, more detailed study of their properties allowed placing them with Methylovarius luteus (= Methylococcus luteus). IMV B-3494 strain was identified as Methylococcus capsulatus. Strain IMV B-3033 had earlier been allocated to Methylovarius whittenburyi (= Methylococcus whittenburyi). Specificity of restriction endonucleases of this strain was not tested. Therefore, for the first time restriction endonucleases were detected in methane-oxidizing bacteria. 8 strains (3 species) among 51 strains (13 species) were found to produce restriction endonucleases displaying three different types of specificity in the least. Producers of restriction endonucleases having Kpn I (Asp 7181) specificity were isolated from different water and silt samples of the Dnieper flood-land more than 20 years ago.

  6. IS-linked movement of a restriction-modification system.

    Directory of Open Access Journals (Sweden)

    Noriko Takahashi

    Full Text Available Potential mobility of restriction-modification systems has been suggested by evolutionary/bioinformatic analysis of prokaryotic genomes. Here we demonstrate in vivo movement of a restriction-modification system within a genome under a laboratory condition. After blocking replication of a temperature-sensitive plasmid carrying a PaeR7I restriction-modification system in Escherichia coli cells, the plasmid was found integrated into the chromosome of the surviving cells. Sequence analysis revealed that, in the majority of products, the restriction-modification system was linked to chromosomal insertion sequences (ISs. Three types of products were: (I apparent co-integration of the plasmid and the chromosome at a chromosomal IS1 or IS5 copy (24/28 analyzed; (II de novo insertion of IS1 with the entire plasmid except for a 1-3 bp terminal deletion (2/28; and (III reciprocal crossing-over between the plasmid and the chromosome involving 1-3 bp of sequence identity (2/28. An R-negative mutation apparently decreased the efficiency of successful integration by two orders of magnitude. Reconstruction experiments demonstrated that the restriction-dependence was mainly due to selection against cells without proper integration: their growth was inhibited by the restriction enzyme action. These results demonstrate collaboration of a mobile element and a restriction-modification system for successful joint migration. This collaboration may have promoted the spread and, therefore, the long-term persistence of these complexes and restriction-modification systems in a wide range of prokaryotes.

  7. How Harmful are Adaptation Restrictions

    OpenAIRE

    Bruin, de, H.A.R.; Dellink, R.B.

    2009-01-01

    The dominant assumption in economic models of climate policy remains that adaptation will be implemented in an optimal manner. There are, however, several reasons why optimal levels of adaptation may not be attainable. This paper investigates the effects of suboptimal levels of adaptation, i.e. adaptation restrictions, on the composition and level of climate change costs and on welfare. Several adaptation restrictions are identified and then simulated in a revised DICE model, extended with ad...

  8. Artificial Enzymes, "Chemzymes"

    DEFF Research Database (Denmark)

    Bjerre, Jeannette; Rousseau, Cyril Andre Raphaël; Pedersen, Lavinia Georgeta M

    2008-01-01

    that successfully perform Michaelis-Menten catalysis under enzymatic conditions (i.e., aqueous medium, neutral pH, ambient temperature) and for those that do, very high rate accelerations are seldomly seen. This review will provide a brief summary of the recent developments in artificial enzymes, so called...... "Chemzymes", based on cyclodextrins and other molecules. Only the chemzymes that have shown enzyme-like activity that has been quantified by different methods will be mentioned. This review will summarize the work done in the field of artificial glycosidases, oxidases, epoxidases, and esterases, as well...

  9. The Fidelity Index provides a systematic quantitation of star activity of DNA restriction endonucleases.

    Science.gov (United States)

    Wei, Hua; Therrien, Caitlin; Blanchard, Aine; Guan, Shengxi; Zhu, Zhenyu

    2008-05-01

    Restriction endonucleases are the basic tools of molecular biology. Many restriction endonucleases show relaxed sequence recognition, called star activity, as an inherent property under various digestion conditions including the optimal ones. To quantify this property we propose the concept of the Fidelity Index (FI), which is defined as the ratio of the maximum enzyme amount showing no star activity to the minimum amount needed for complete digestion at the cognate recognition site for any particular restriction endonuclease. Fidelity indices for a large number of restriction endonucleases are reported here. The effects of reaction vessel, reaction volume, incubation mode, substrate differences, reaction time, reaction temperature and additional glycerol, DMSO, ethanol and Mn(2+) on the FI are also investigated. The FI provides a practical guideline for the use of restriction endonucleases and defines a fundamental property by which restriction endonucleases can be characterized.

  10. The surface science of enzymes

    DEFF Research Database (Denmark)

    Rod, Thomas Holm; Nørskov, Jens Kehlet

    2002-01-01

    One of the largest challenges to science in the coming years is to find the relation between enzyme structure and function. Can we predict which reactions an enzyme catalyzes from knowledge of its structure-or from its amino acid sequence? Can we use that knowledge to modify enzyme function......? To solve these problems we must understand in some detail how enzymes interact with reactants from its surroundings. These interactions take place at the surface of the enzyme and the question of enzyme function can be viewed as the surface science of enzymes. In this article we discuss how to describe...... catalysis by enzymes, and in particular the analogies between enzyme catalyzed reactions and surface catalyzed reactions. We do this by discussing two concrete examples of reactions catalyzed both in nature (by enzymes) and in industrial reactors (by inorganic materials), and show that although analogies...

  11. enzyme-linked

    African Journals Online (AJOL)

    SA MEDIESE TYDSKRIF DEEL 63 29 JANUARIE 1983. B surface antigen in donated screening and confirmation by immunosorbent assay. Hepatitis blood - enzyme-linked. M. O. BUBB, T. ... weeks at weekly intervals. After 6 weeks test blood samples were ... This assay normally takes 3 hours. Results. Fig. 1. Frequency ...

  12. Implantable enzyme amperometric biosensors.

    Science.gov (United States)

    Kotanen, Christian N; Moussy, Francis Gabriel; Carrara, Sandro; Guiseppi-Elie, Anthony

    2012-05-15

    The implantable enzyme amperometric biosensor continues as the dominant in vivo format for the detection, monitoring and reporting of biochemical analytes related to a wide range of pathologies. Widely used in animal studies, there is increasing emphasis on their use in diabetes care and management, the management of trauma-associated hemorrhage and in critical care monitoring by intensivists in the ICU. These frontier opportunities demand continuous indwelling performance for up to several years, well in excess of the currently approved seven days. This review outlines the many challenges to successful deployment of chronically implantable amperometric enzyme biosensors and emphasizes the emerging technological approaches in their continued development. The foreign body response plays a prominent role in implantable biotransducer failure. Topics considering the approaches to mitigate the inflammatory response, use of biomimetic chemistries, nanostructured topographies, drug eluting constructs, and tissue-to-device interface modulus matching are reviewed. Similarly, factors that influence biotransducer performance such as enzyme stability, substrate interference, mediator selection and calibration are reviewed. For the biosensor system, the opportunities and challenges of integration, guided by footprint requirements, the limitations of mixed signal electronics, and power requirements, has produced three systems approaches. The potential is great. However, integration along the multiple length scales needed to address fundamental issues and integration across the diverse disciplines needed to achieve success of these highly integrated systems, continues to be a challenge in the development and deployment of implantable amperometric enzyme biosensor systems. Copyright © 2012 Elsevier B.V. All rights reserved.

  13. Angiotensin-converting enzyme

    DEFF Research Database (Denmark)

    Sørensen, P G; Rømer, F K; Cortes, D

    1984-01-01

    In order to evaluate bleomycin-associated lung damage in humans, lung function parameters and serum levels of the endothelial-bound angiotensin-converting enzyme (ACE) were determined by serial measurements in 11 patients who were treated for testicular cancer. None developed clinical or radiolog...

  14. Enzymes and fungal virulence

    African Journals Online (AJOL)

    may be common across a variety of fungal pathogens. Most fungal pathogens and ... Fungi utilize the food substances in their immediate vicinity to .... digestion of the fungal secreted enzymes thereby denying access to the host cell. For a pathogen to be successful, it mttst be able to circumvent or overcome these antifungal ...

  15. [Elevated liver enzymes].

    Science.gov (United States)

    Holstege, Axel

    2016-10-01

    Elevated liver enzymes are a frequent finding in both symptomatic and asymptomatic patients necessitating further evaluation to clarify the underlying disease. Three different patterns of increased liver enzymes can be defined to allow for a more precise and rational further diagnostic approach. A predominant increase in transaminase activities reflects a disturbance of hepatocellular integrity which can be found in patients with viral hepatitis, genetic liver diseases like Wilson`s disease or hemochromatosis, and drug-induced liver diseases. A second pattern is characterized by high serum alkaline phosphatase and γ-glutamyltranspeptidase activities indicating cholestatic liver diseases. The next important diagnostic measure in this group is an ultrasound study discerning intra- from extrahepatic cholestasis. Intrahepatic cholestatic diseases include primary and secondary sclerosing cholangitis, genetic disturbances of canalicular membrane transporters or drug-induced liver dieseases. Extrahepatic cholestasis involves obstruction of the large bile ducts by gall stones or tumors. The third enzym pattern is defined by a predominant rise in γ-glutamyl transpeptidase which is observed in alcoholic or non-alcoholic fatty liver disease and infiltrating liver diseases. A rise in liver enzymes is not necessarily indicative of a primary hepatic origin. Extrahepatic diseases often cause similarly increased serum activities. In addition even higher values can be observed under normal conditions during pregnancy or in adolescens. Lower values in asymptomatic patients should only be controlled since more than 30% of elevated transaminases spontaneously normalize during follow-up. © Georg Thieme Verlag KG Stuttgart · New York.

  16. ISFET based enzyme sensors

    NARCIS (Netherlands)

    van der Schoot, Bart H.; Bergveld, Piet

    1987-01-01

    This paper reviews the results that have been reported on ISFET based enzyme sensors. The most important improvement that results from the application of ISFETs instead of glass membrane electrodes is in the method of fabrication. Problems with regard to the pH dependence of the response and the

  17. Enzymes and fungal virulence

    African Journals Online (AJOL)

    Plant pathogenic fungi secrete extracellular enlymes that are capable of degrading the cell walls of their host plants. These CWDES may be necessary for penetration ofthc cell wall harricr. as well as for generation of simple molecules that can he assimilated for growth. Most of these enzymes are substrawinducible and both ...

  18. The Enzyme Function Initiative†

    Science.gov (United States)

    Gerlt, John A.; Allen, Karen N.; Almo, Steven C.; Armstrong, Richard N.; Babbitt, Patricia C.; Cronan, John E.; Dunaway-Mariano, Debra; Imker, Heidi J.; Jacobson, Matthew P.; Minor, Wladek; Poulter, C. Dale; Raushel, Frank M.; Sali, Andrej; Shoichet, Brian K.; Sweedler, Jonathan V.

    2011-01-01

    The Enzyme Function Initiative (EFI) was recently established to address the challenge of assigning reliable functions to enzymes discovered in bacterial genome projects; in this Current Topic we review the structure and operations of the EFI. The EFI includes the Superfamily/Genome, Protein, Structure, Computation, and Data/Dissemination Cores that provide the infrastructure for reliably predicting the in vitro functions of unknown enzymes. The initial targets for functional assignment are selected from five functionally diverse superfamilies (amidohydrolase, enolase, glutathione transferase, haloalkanoic acid dehalogenase, and isoprenoid synthase), with five superfamily-specific Bridging Projects experimentally testing the predicted in vitro enzymatic activities. The EFI also includes the Microbiology Core that evaluates the in vivo context of in vitro enzymatic functions and confirms the functional predictions of the EFI. The deliverables of the EFI to the scientific community include: 1) development of a large-scale, multidisciplinary sequence/structure-based strategy for functional assignment of unknown enzymes discovered in genome projects (target selection, protein production, structure determination, computation, experimental enzymology, microbiology, and structure-based annotation); 2) dissemination of the strategy to the community via publications, collaborations, workshops, and symposia; 3) computational and bioinformatic tools for using the strategy; 4) provision of experimental protocols and/or reagents for enzyme production and characterization; and 5) dissemination of data via the EFI’s website, enzymefunction.org. The realization of multidisciplinary strategies for functional assignment will begin to define the full metabolic diversity that exists in nature and will impact basic biochemical and evolutionary understanding, as well as a wide range of applications of central importance to industrial, medicinal and pharmaceutical efforts. PMID

  19. 14 CFR 1203.305 - Restricted data.

    Science.gov (United States)

    2010-01-01

    ... Aeronautics and Space NATIONAL AERONAUTICS AND SPACE ADMINISTRATION INFORMATION SECURITY PROGRAM Classification Principles and Considerations § 1203.305 Restricted data. Restricted Data or Formerly Restricted...” published by the Department of Energy. ...

  20. Genetics Home Reference: familial restrictive cardiomyopathy

    Science.gov (United States)

    ... Home Health Conditions Familial restrictive cardiomyopathy Familial restrictive cardiomyopathy Printable PDF Open All Close All Enable Javascript ... view the expand/collapse boxes. Description Familial restrictive cardiomyopathy is a genetic form of heart disease. For ...

  1. Monitoring enzyme kinetic behavior of enzyme-quantum dot bioconjugates

    Science.gov (United States)

    Claussen, Jonathan C.; Walper, Scott A.; Susumu, Kimihiro; Ancona, Mario G.; Medintz, Igor L.

    2014-05-01

    Luminescent semiconductor nanocrystals or quantum dots (QDs) hold tremendous promise for in vivo biosensing, cellular imaging, theranostics, and smart molecular sensing probes due to their small size and favorable photonic properties such as resistance to photobleaching, size-tunable PL, and large effective Stokes shifts. Herein, we demonstrate how QD-based bioconjugates can be used to enhance enzyme kinetics. Enzyme-substrate kinetics are analyzed for solutions containing both alkaline phosphatase enzymes and QDs with enzyme-to- QD molar ratios of 2, 12, and 24 as well as for a solution containing the same concentration of enzymes but without QDs. The enzyme kinetic paramters Vmax, KM, and Kcat/KM are extracted from the enzyme progress curves via the Lineweaver-Burk plot. Results demonstrate an approximate increase in enzyme efficiency of 5 - 8% for enzymes immobilized on the QD versus free in solution without QD immobilization.

  2. HIV restriction by APOBEC3 in humanized mice.

    Directory of Open Access Journals (Sweden)

    John F Krisko

    2013-03-01

    Full Text Available Innate immune restriction factors represent important specialized barriers to zoonotic transmission of viruses. Significant consideration has been given to their possible use for therapeutic benefit. The apolipoprotein B mRNA editing enzyme catalytic polypeptide 3 (APOBEC3 family of cytidine deaminases are potent immune defense molecules capable of efficiently restricting endogenous retroelements as well as a broad range of viruses including Human Immunodeficiency virus (HIV, Hepatitis B virus (HBV, Human Papilloma virus (HPV, and Human T Cell Leukemia virus (HTLV. The best characterized members of this family are APOBEC3G (A3G and APOBEC3F (A3F and their restriction of HIV. HIV has evolved to counteract these powerful restriction factors by encoding an accessory gene designated viral infectivity factor (vif. Here we demonstrate that APOBEC3 efficiently restricts CCR5-tropic HIV in the absence of Vif. However, our results also show that CXCR4-tropic HIV can escape from APOBEC3 restriction and replicate in vivo independent of Vif. Molecular analysis identified thymocytes as cells with reduced A3G and A3F expression. Direct injection of vif-defective HIV into the thymus resulted in viral replication and dissemination detected by plasma viral load analysis; however, vif-defective viruses remained sensitive to APOBEC3 restriction as extensive G to A mutation was observed in proviral DNA recovered from other organs. Remarkably, HIV replication persisted despite the inability of HIV to develop resistance to APOBEC3 in the absence of Vif. Our results provide novel insight into a highly specific subset of cells that potentially circumvent the action of APOBEC3; however our results also demonstrate the massive inactivation of CCR5-tropic HIV in the absence of Vif.

  3. Pathological phenotypes and in vivo DNA cleavage by unrestrained activity of a phosphorothioate-based restriction system in Salmonella.

    Science.gov (United States)

    Cao, Bo; Cheng, Qiuxiang; Gu, Chen; Yao, Fen; DeMott, Michael S; Zheng, Xiaoqing; Deng, Zixin; Dedon, Peter C; You, Delin

    2014-08-01

    Prokaryotes protect their genomes from foreign DNA with a diversity of defence mechanisms, including a widespread restriction-modification (R-M) system involving phosphorothioate (PT) modification of the DNA backbone. Unlike classical R-M systems, highly partial PT modification of consensus motifs in bacterial genomes suggests an unusual mechanism of PT-dependent restriction. In Salmonella enterica, PT modification is mediated by four genes dptB-E, while restriction involves additional three genes dptF-H. Here, we performed a series of studies to characterize the PT-dependent restriction, and found that it presented several features distinct with traditional R-M systems. The presence of restriction genes in a PT-deficient mutant was not lethal, but instead resulted in several pathological phenotypes. Subsequent transcriptional profiling revealed the expression of > 600 genes was affected by restriction enzymes in cells lacking PT, including induction of bacteriophage, SOS response and DNA repair-related genes. These transcriptional responses are consistent with the observation that restriction enzymes caused extensive DNA cleavage in the absence of PT modifications in vivo. However, overexpression of restriction genes was lethal to the host in spite of the presence PT modifications. These results point to an unusual mechanism of PT-dependent DNA cleavage by restriction enzymes in the face of partial PT modification. © 2014 John Wiley & Sons Ltd.

  4. Pathological phenotypes and in vivo DNA cleavage by unrestrained activity of a phosphorothioate-based restriction system in Salmonella

    Science.gov (United States)

    Cao, Bo; Cheng, Qiuxiang; Gu, Chen; Yao, Fen; DeMott, Michael S.; Zheng, Xiaoqing; Deng, Zixin; Dedon, Peter C.; You, Delin

    2015-01-01

    Summary Prokaryotes protect their genomes from foreign DNA with a diversity of defense mechanisms, including a widespread restriction-modification (R-M) system involving phosphorothioate (PT) modification of the DNA backbone. Unlike classical R-M systems, highly partial PT-modification of consensus motifs in bacterial genomes suggests an unusual mechanism of PT-dependent restriction. In Salmonella enterica, PT modification is mediated by four genes dptB-E, while restriction involves additional three genes dptF-H. Here, we performed a series of studies to characterize the PT-dependent restriction, and found that it presented several features distinct with traditional R-M systems. The presence of restriction genes in a PT-deficient mutant was not lethal, but instead resulted in several pathological phenotypes. Subsequent transcriptional profiling revealed the expression of >600 genes was affected by restriction enzymes in cells lacking PT, including induction of bacteriophage, SOS response and DNA repair-related genes. These transcriptional responses are consistent with the observation that restriction enzymes caused extensive DNA cleavage in the absence of PT modifications in vivo. However, over-expression of restriction genes was lethal to the host in spite of the presence PT modifications. These results point to an unusual mechanism of PT-dependent DNA cleavage by restriction enzymes in the face of partial PT modification. PMID:25040300

  5. Special Issue: Retroviral Enzymes

    Directory of Open Access Journals (Sweden)

    Luis Menéndez-Arias

    2010-05-01

    Full Text Available The retroviral RNA genome encodes for three enzymes essential for virus replication: (i the viral protease (PR, that converts the immature virion into a mature virus through the cleavage of precursor polypeptides; (ii the reverse transcriptase (RT, responsible for the conversion of the single-stranded genomic RNA into double-stranded proviral DNA; and (iii the integrase (IN that inserts the proviral DNA into the host cell genome. All of them are important targets for therapeutic intervention. This Special Issue provides authoritative reviews on the most recent research towards a better understanding of structure-function relationships in retroviral enzymes. The Issue includes three reviews on retroviral PRs, seven on RT and reverse transcription, and four dedicated to viral integration. [...

  6. Halophilic adaptation of enzymes.

    Science.gov (United States)

    Madern, D; Ebel, C; Zaccai, G

    2000-04-01

    It is now clear that the understanding of halophilic adaptation at a molecular level requires a strategy of complementary experiments, combining molecular biology, biochemistry, and cellular approaches with physical chemistry and thermodynamics. In this review, after a discussion of the definition and composition of halophilic enzymes, the effects of salt on their activity, solubility, and stability are reviewed. We then describe how thermodynamic observations, such as parameters pertaining to solvent-protein interactions or enzyme-unfolding kinetics, depend strongly on solvent composition and reveal the important role played by water and ion binding to halophilic proteins. The three high-resolution crystal structures now available for halophilic proteins are analyzed in terms of haloadaptation, and finally cellular response to salt stress is discussed briefly.

  7. Membrane Assisted Enzyme Fractionation

    DEFF Research Database (Denmark)

    Yuan, Linfeng

    Purification of proteins is an increasingly important process for the biotechnology industry. Separation of the desired high value protein from other proteins produced by the cell is usually attempted using a combination of different chromatographic techniques. These techniques separate mixtures...... of proteins on the basis of their charge, degree of hydrophobicity, affinity or size. Adequate purity is often not achieved unless several purification steps are combined thereby increasing cost and reducing product yield. Conventional fractionation of proteins using ultrafiltration membranes is limited....... In this thesis, separations using crossflow elecro-membrane filtration (EMF) of amino acids, bovine serum albumin (BSA) and industrial enzymes from Novozymes were performed. The main objective of this study was to investigate the technological feasibility of EMF in the application of industrial enzyme...

  8. Restrictive Cardiomyopathy in a Child

    Directory of Open Access Journals (Sweden)

    Shan-Miao Lin

    2008-04-01

    Full Text Available Restrictive cardiomyopathy in young children is rare and carries a poor prognosis. We report an 18-month-old girl with poor feeding and abdominal distension. Except for hepatomegaly, no other gastrointestinal abnormalities were found. She had normalsized ventricles but biatrial enlargement. Echocardiography demonstrated normal systolic but impaired diastolic function. Cardiac catheterization revealed a characteristic dip-and-plateau configuration of the right ventricular pressure tracing. The diagnosis turned out to be typical restrictive cardiomyopathy. The patient was maintained on aspirin while awaiting cardiac transplant.

  9. Quorum quenching enzymes.

    Science.gov (United States)

    Fetzner, Susanne

    2015-05-10

    Bacteria use cell-to-cell communication systems based on chemical signal molecules to coordinate their behavior within the population. These quorum sensing systems are potential targets for antivirulence therapies, because many bacterial pathogens control the expression of virulence factors via quorum sensing networks. Since biofilm maturation is also usually influenced by quorum sensing, quenching these systems may contribute to combat biofouling. One possibility to interfere with quorum sensing is signal inactivation by enzymatic degradation or modification. Such quorum quenching enzymes are wide-spread in the bacterial world and have also been found in eukaryotes. Lactonases and acylases that hydrolyze N-acyl homoserine lactone (AHL) signaling molecules have been investigated most intensively, however, different oxidoreductases active toward AHLs or 2-alkyl-4(1H)-quinolone signals as well as other signal-converting enzymes have been described. Several approaches have been assessed which aim at alleviating virulence, or biofilm formation, by reducing the signal concentration in the bacterial environment. These involve the application or stimulation of signal-degrading bacteria as biocontrol agents in the protection of crop plants against soft-rot disease, the use of signal-degrading bacteria as probiotics in aquaculture, and the immobilization or entrapment of quorum quenching enzymes or bacteria to control biofouling in membrane bioreactors. While most approaches to use quorum quenching as antivirulence strategy are still in the research phase, the growing number of organisms and enzymes known to interfere with quorum sensing opens up new perspectives for the development of innovative antibacterial strategies. Copyright © 2014 Elsevier B.V. All rights reserved.

  10. Uronic polysaccharide degrading enzymes.

    Science.gov (United States)

    Garron, Marie-Line; Cygler, Miroslaw

    2014-10-01

    In the past several years progress has been made in the field of structure and function of polysaccharide lyases (PLs). The number of classified polysaccharide lyase families has increased to 23 and more detailed analysis has allowed the identification of more closely related subfamilies, leading to stronger correlation between each subfamily and a unique substrate. The number of as yet unclassified polysaccharide lyases has also increased and we expect that sequencing projects will allow many of these unclassified sequences to emerge as new families. The progress in structural analysis of PLs has led to having at least one representative structure for each of the families and for two unclassified enzymes. The newly determined structures have folds observed previously in other PL families and their catalytic mechanisms follow either metal-assisted or Tyr/His mechanisms characteristic for other PL enzymes. Comparison of PLs with glycoside hydrolases (GHs) shows several folds common to both classes but only for the β-helix fold is there strong indication of divergent evolution from a common ancestor. Analysis of bacterial genomes identified gene clusters containing multiple polysaccharide cleaving enzymes, the Polysaccharides Utilization Loci (PULs), and their gene complement suggests that they are organized to process completely a specific polysaccharide. Copyright © 2014 Elsevier Ltd. All rights reserved.

  11. AGORA: Assembly Guided by Optical Restriction Alignment

    Directory of Open Access Journals (Sweden)

    Lin Henry C

    2012-08-01

    Full Text Available Abstract Background Genome assembly is difficult due to repeated sequences within the genome, which create ambiguities and cause the final assembly to be broken up into many separate sequences (contigs. Long range linking information, such as mate-pairs or mapping data, is necessary to help assembly software resolve repeats, thereby leading to a more complete reconstruction of genomes. Prior work has used optical maps for validating assemblies and scaffolding contigs, after an initial assembly has been produced. However, optical maps have not previously been used within the genome assembly process. Here, we use optical map information within the popular de Bruijn graph assembly paradigm to eliminate paths in the de Bruijn graph which are not consistent with the optical map and help determine the correct reconstruction of the genome. Results We developed a new algorithm called AGORA: Assembly Guided by Optical Restriction Alignment. AGORA is the first algorithm to use optical map information directly within the de Bruijn graph framework to help produce an accurate assembly of a genome that is consistent with the optical map information provided. Our simulations on bacterial genomes show that AGORA is effective at producing assemblies closely matching the reference sequences. Additionally, we show that noise in the optical map can have a strong impact on the final assembly quality for some complex genomes, and we also measure how various characteristics of the starting de Bruijn graph may impact the quality of the final assembly. Lastly, we show that a proper choice of restriction enzyme for the optical map may substantially improve the quality of the final assembly. Conclusions Our work shows that optical maps can be used effectively to assemble genomes within the de Bruijn graph assembly framework. Our experiments also provide insights into the characteristics of the mapping data that most affect the performance of our algorithm, indicating the

  12. Selective microbial genomic DNA isolation using restriction endonucleases.

    Science.gov (United States)

    Barnes, Helen E; Liu, Guohong; Weston, Christopher Q; King, Paula; Pham, Long K; Waltz, Shannon; Helzer, Kimberly T; Day, Laura; Sphar, Dan; Yamamoto, Robert T; Forsyth, R Allyn

    2014-01-01

    To improve the metagenomic analysis of complex microbiomes, we have repurposed restriction endonucleases as methyl specific DNA binding proteins. As an example, we use DpnI immobilized on magnetic beads. The ten minute extraction technique allows specific binding of genomes containing the DpnI Gm6ATC motif common in the genomic DNA of many bacteria including γ-proteobacteria. Using synthetic genome mixtures, we demonstrate 80% recovery of Escherichia coli genomic DNA even when only femtogram quantities are spiked into 10 µg of human DNA background. Binding is very specific with less than 0.5% of human DNA bound. Next Generation Sequencing of input and enriched synthetic mixtures results in over 100-fold enrichment of target genomes relative to human and plant DNA. We also show comparable enrichment when sequencing complex microbiomes such as those from creek water and human saliva. The technique can be broadened to other restriction enzymes allowing for the selective enrichment of trace and unculturable organisms from complex microbiomes and the stratification of organisms according to restriction enzyme enrichment.

  13. Restriction endonucleases: natural and directed evolution.

    Science.gov (United States)

    Gupta, Richa; Capalash, Neena; Sharma, Prince

    2012-05-01

    Type II restriction endonucleases (REs) are highly sequence-specific compared with other classes of nucleases. PD-(D/E)XK nucleases, initially represented by only type II REs, now comprise a large and extremely diverse superfamily of proteins and, although sharing a structurally conserved core, typically display little or no detectable sequence similarity except for the active site motifs. Sequence similarity can only be observed in methylases and few isoschizomers. As a consequence, REs are classified according to combinations of functional properties rather than on the basis of genetic relatedness. New alignment matrices and classification systems based on structural core connectivity and cleavage mechanisms have been developed to characterize new REs and related proteins. REs recognizing more than 300 distinct specificities have been identified in RE database (REBASE: http://rebase.neb.com/cgi-bin/statlist ) but still the need for newer specificities is increasing due to the advancement in molecular biology and applications. The enzymes have undergone constant evolution through structural changes in protein scaffolds which include random mutations, homologous recombinations, insertions, and deletions of coding DNA sequences but rational mutagenesis or directed evolution delivers protein variants with new functions in accordance with defined biochemical or environmental pressures. Redesigning through random mutation, addition or deletion of amino acids, methylation-based selection, synthetic molecules, combining recognition and cleavage domains from different enzymes, or combination with domains of additional functions change the cleavage specificity or substrate preference and stability. There is a growing number of patents awarded for the creation of engineered REs with new and enhanced properties.

  14. Enzyme synthesis in the regulation of hepatic `malic' enzyme activity

    Science.gov (United States)

    Murphy, Gillian; Walker, Deryck G.

    1974-01-01

    A homogeneous preparation of `malic' enzyme (EC 1.1.1.40) from livers of thyroxine-treated rats was used to prepare in rabbits an antiserum to the enzyme that reacts monospecifically with the `malic' enzyme in livers of rats in several physiological states. Changes in enzyme activity resulting from modification of the state of the animal are hence due to an altered amount of enzyme protein. The antiserum has been used to precipitate out `malic' enzyme from heat-treated supernatant preparations of livers from both adult and neonatal rats, in a number of physiological conditions, that had been injected 30min earlier with l-[4,5-3H]leucine. The low incorporations of radioactivity into the immunoprecipitable enzyme have permitted the qualitative conclusion that changed enzyme activity in adult rats arises mainly from alterations in the rate of enzyme synthesis. The marked increase in `malic' enzyme activity that occurs naturally or as a result of thyroxine treatment of the weanling rat is likewise due to a marked increase in the rate of enzyme synthesis possibly associated with a concurrent diminished rate of enzyme degradation. PMID:4462568

  15. Enzyme synthesis in the regulation of hepatic "malic" enzyme activity.

    Science.gov (United States)

    Murphy, G; Walker, D G

    1974-10-01

    A homogeneous preparation of ;malic' enzyme (EC 1.1.1.40) from livers of thyroxine-treated rats was used to prepare in rabbits an antiserum to the enzyme that reacts monospecifically with the ;malic' enzyme in livers of rats in several physiological states. Changes in enzyme activity resulting from modification of the state of the animal are hence due to an altered amount of enzyme protein. The antiserum has been used to precipitate out ;malic' enzyme from heat-treated supernatant preparations of livers from both adult and neonatal rats, in a number of physiological conditions, that had been injected 30min earlier with l-[4,5-(3)H]leucine. The low incorporations of radioactivity into the immunoprecipitable enzyme have permitted the qualitative conclusion that changed enzyme activity in adult rats arises mainly from alterations in the rate of enzyme synthesis. The marked increase in ;malic' enzyme activity that occurs naturally or as a result of thyroxine treatment of the weanling rat is likewise due to a marked increase in the rate of enzyme synthesis possibly associated with a concurrent diminished rate of enzyme degradation.

  16. Processing Games with Restricted Capacities

    NARCIS (Netherlands)

    Meertens, M.; Borm, P.E.M.; Reijnierse, J.H.; Quant, M.

    2004-01-01

    This paper analyzes processing problems and related cooperative games.In a processing problem there is a finite set of jobs, each requiring a specific amount of effort to be completed, whose costs depend linearly on their completion times.There are no restrictions whatsoever on the processing

  17. Space-restricted attribute grammars

    DEFF Research Database (Denmark)

    Schmidt, Erik Meineche

    1980-01-01

    Restricting the size of attribute values, relative to the length of the string under consideration, leads to a model of attribute grammars in which grammars with both inherited and synthesized attributes can be significantly more economical than grammars with synthesized attributes only....

  18. Gentile statistics and restricted partitions

    Indian Academy of Sciences (India)

    In a recent paper (Tran et al, Ann. Phys. 311, 204 (2004)), some asymptotic number theoretical results on the partitioning of an integer were derived exploiting its connection to the quantum density of states of a many-particle system. We generalise these results to obtain an asymptotic formula for the restricted or coloured ...

  19. NRSA enzyme decomposition model data

    Data.gov (United States)

    U.S. Environmental Protection Agency — Microbial enzyme activities measured at more than 2000 US streams and rivers. These enzyme data were then used to predict organic matter decomposition and microbial...

  20. The Catalytic Function of Enzymes.

    Science.gov (United States)

    Splittgerber, Allan G.

    1985-01-01

    Discusses: structure of the enzyme molecule; active site; reaction mechanism; transition state; factors affecting enzyme reaction rates, concentration of enzyme; concentration of substrate; product concentration; temperature effects and pH effects; factors causing a lowering of activation energy; proximity and orientation effects; substrate strain…

  1. Identification of Egyptian Fasciola species by PCR and restriction endonucleases digestion of the nuclear small subunit ribosomal RNA gene.

    Science.gov (United States)

    El-Gozamy, Bothina R; Shoukry, Nahla M

    2009-08-01

    Fascioliasis is one of the familiar zoonotic health problems of worldwide distribution including Egypt. In this study, a simple and rapid polymerase chain reaction/restriction fragment length polymorphisms (PCR/RFLPs) assay, using the common restriction endonucleases Aval, EcoRI, Eael, Sac11 and Avail was applied to differentiate between both Fasciola gigantica and F. hepatica. The five restriction endonucleases were used to differentiate between the two species of Fasciola based on -1950 bp long sequence of the 18S nuclear small subunit ribosomal RNA gene. Aval and EcoRI restriction endonucleases failed to differentiate between the two Fasciola species when each restriction enzyme gave the same restriction patterns in both of them. However, F. gigantica and F. hepatica were well-differentiated when their small subunit ribosomal DNA were digested with Eael and Sac 11 restriction endonucleases.

  2. A whole genome screen for HIV restriction factors

    Directory of Open Access Journals (Sweden)

    Liu Li

    2011-11-01

    Full Text Available Abstract Background Upon cellular entry retroviruses must avoid innate restriction factors produced by the host cell. For human immunodeficiency virus (HIV human restriction factors, APOBEC3 (apolipoprotein-B-mRNA-editing-enzyme, p21 and tetherin are well characterised. Results To identify intrinsic resistance factors to HIV-1 replication we screened 19,121 human genes and identified 114 factors with significant inhibition of infection. Those with a known function are involved in a broad spectrum of cellular processes including receptor signalling, vesicle trafficking, transcription, apoptosis, cross-nuclear membrane transport, meiosis, DNA damage repair, ubiquitination and RNA processing. We focused on the PAF1 complex which has been previously implicated in gene transcription, cell cycle control and mRNA surveillance. Knockdown of all members of the PAF1 family of proteins enhanced HIV-1 reverse transcription and integration of provirus. Over-expression of PAF1 in host cells renders them refractory to HIV-1. Simian Immunodeficiency Viruses and HIV-2 are also restricted in PAF1 expressing cells. PAF1 is expressed in primary monocytes, macrophages and T-lymphocytes and we demonstrate strong activity in MonoMac1, a monocyte cell line. Conclusions We propose that the PAF1c establishes an anti-viral state to prevent infection by incoming retroviruses. This previously unrecognised mechanism of restriction could have implications for invasion of cells by any pathogen.

  3. Temperature based Restricted Boltzmann Machines

    Science.gov (United States)

    Li, Guoqi; Deng, Lei; Xu, Yi; Wen, Changyun; Wang, Wei; Pei, Jing; Shi, Luping

    2016-01-01

    Restricted Boltzmann machines (RBMs), which apply graphical models to learning probability distribution over a set of inputs, have attracted much attention recently since being proposed as building blocks of multi-layer learning systems called deep belief networks (DBNs). Note that temperature is a key factor of the Boltzmann distribution that RBMs originate from. However, none of existing schemes have considered the impact of temperature in the graphical model of DBNs. In this work, we propose temperature based restricted Boltzmann machines (TRBMs) which reveals that temperature is an essential parameter controlling the selectivity of the firing neurons in the hidden layers. We theoretically prove that the effect of temperature can be adjusted by setting the parameter of the sharpness of the logistic function in the proposed TRBMs. The performance of RBMs can be improved by adjusting the temperature parameter of TRBMs. This work provides a comprehensive insights into the deep belief networks and deep learning architectures from a physical point of view.

  4. Using Restriction Mapping to Teach Basic Skills in the Molecular Biology Lab

    Science.gov (United States)

    Walsh, Lauren; Shaker, Elizabeth; De Stasio, Elizabeth A.

    2007-01-01

    Digestion of DNA with restriction enzymes, calculation of volumes and concentrations of reagents for reactions, and the separation of DNA fragments by agarose gel electrophoresis are common molecular biology techniques that are best taught through repetition. The following open-ended, investigative laboratory exercise in plasmid restriction…

  5. Demonstration of the Principles of Restriction Endonuclease Cleavage Reactions Using Thermostable Bfl I from "Anoxybacillus Flavithermus"

    Science.gov (United States)

    Sharma, Prince; D'Souza, David R.; Bhandari, Deepali; Parashar, Vijay; Capalash, Neena

    2003-01-01

    Restriction enzymes are basic tools in recombinant DNA technology. To shape the molecular biology experiments, the students must know how to work with these molecular scissors. Here, we describe an integrated set of experiments, introduced in the "Advances in Molecular Biology and Biotechnology" postgraduate course, which covers the important…

  6. Structure-based substrate screening for an enzyme

    Directory of Open Access Journals (Sweden)

    Wei Dongzhi

    2009-08-01

    Full Text Available Abstract Background Nowadays, more and more novel enzymes can be easily found in the whole enzyme pool with the rapid development of genetic operation. However, experimental work for substrate screening of a new enzyme is laborious, time consuming and costly. On the other hand, many computational methods have been widely used in lead screening of drug design. Seeing that the ligand-target protein system in drug design and the substrate-enzyme system in enzyme applications share the similar molecular recognition mechanism, we aim to fulfill the goal of substrate screening by in silico means in the present study. Results A computer-aided substrate screening (CASS system which was based on the enzyme structure was designed and employed successfully to help screen substrates of Candida antarctica lipase B (CALB. In this system, restricted molecular docking which was derived from the mechanism of the enzyme was applied to predict the energetically favorable poses of substrate-enzyme complexes. Thereafter, substrate conformation, distance between the oxygen atom of the alcohol part of the ester (in some compounds, this oxygen atom was replaced by nitrogen atom of the amine part of acid amine or sulfur atom of the thioester and the hydrogen atom of imidazole of His224, distance between the carbon atom of the carbonyl group of the compound and the oxygen atom of hydroxyl group of Ser105 were used sequentially as the criteria to screen the binding poses. 223 out of 233 compounds were identified correctly for the enzyme by this screening system. Such high accuracy guaranteed the feasibility and reliability of the CASS system. Conclusion The idea of computer-aided substrate screening is a creative combination of computational skills and enzymology. Although the case studied in this paper is tentative, high accuracy of the CASS system sheds light on the field of computer-aided substrate screening.

  7. Ribotyping for differentiating Flavobacterium meningosepticum isolates from clinical and environmental sources

    DEFF Research Database (Denmark)

    Colding, H; Bangsborg, J; Fiehn, N E

    1994-01-01

    On the basis of DNA-DNA hybridization data, two main genomic relatedness groups (I and II) have been reported for a geographically varied collection of 52 strains of Flavobacterium meningosepticum. Herein, we have shown that genomic group II can be further divided into four subgroups (II:1 to II:4...... correctly to one of the five genomic groups or subgroups. To assess the value of ribotyping for the interpretation of epidemiological data, the discriminatory power of the method was investigated for the 52 F. meningosepticum strains. With one to four restriction enzymes (PstI, HindIII, ClaI, Eco...

  8. [Carbohydrate restriction in the larval diet causes oxidative stress in adult insects of Drosophila melanogaster].

    Science.gov (United States)

    Rovenko, B M; Lushchak, V I; Lushchak, O V

    2013-01-01

    The influence of 20 and 1% glucose and fructose, which were components of larval diet, on the level of oxidized proteins and lipids, low molecular mass antioxidant content as well as activities of antioxidant and associated enzymes in adult fruit fly Drosophila melanogaster were investigated. The restriction of carbohydrates in larval diet leads to oxidative stress in adult insects. It is supported by 40-50% increased content of protein carbonyl groups and by 60-70% decreased level of protein thiol groups as well as by a 4-fold increase of lipid peroxide content in 2-day-old flies of both sexes, developed on the diet with 1% carbohydrates. Oxidative stress, induced by carbohydrate restriction of the larval diet, caused the activation of antioxidant defence, differently exhibited in male and female fruit flies. Caloric restriction increased activity of superoxide dismutase and thioredoxin reductase associating only in males with 2-fold higher activity of NADPH-producing enzymes--glucose-6-phosphate dehydrogenase and isocitrate dehydrogenase. Carbohydrate restriction in the larval diet caused the increase of uric acid content, but the decrease in catalase activity in males. In females the values of these parameters were changed in opposite direction compared with males. The obtained results let us conclude the different involvement of low molecular mass antioxidants, glutathione and uric acid, and antioxidant enzyme catalase in the protection of male and female fruit fly macromolecules against oxidative damages, caused by calorie restriction of larval diet.

  9. Enzyme changes associated with mitochondrial malic enzyme deficiency in mice

    Energy Technology Data Exchange (ETDEWEB)

    Mohrenweiser, H.W.; Erickson, R.P.

    1979-01-01

    A genetically determined absence of mitochondrial malic enzyme (EC 1.1.1.40) in c/sup 3H//c/sup 6H/ mice is accompanied by a four-fold increase in liver glucose-6-phosphate dehydrogenase and a two-fold increase for 6-phosphogluconate dehydrogenase activity. Smaller increases in the activity of serine dehydratase and glutamic oxaloacetic transaminase are observed while the level of glutamic pyruvate transaminase activity is reduced in the liver of deficient mice. Unexpectedly, the level of activity of total malic enzyme in the livers of mitochrondrial malic enzyme-deficient mice is increased approximately 50% compared to littermate controls. No similar increase in solublle malic enzyme activity is observed in heart of kidney tissue of mutant mice and the levels of total malic enzyme in these tissues are in accord with expected levels of activity in mitochondrial malic enzyme-deficient mice. The divergence in levels of enzyme activity between mutant and wild-type mice begins at 19 to 21 days of age. Immunoinactivation experiments with monospecific antisera to the soluble malic enzyme and glucose-6-phosphate dehydrogenase demonstrate that the activity increases represent increases in the amount of enzyme protein. The alterations are not consistent with a single hormonal response.

  10. Characterization of LlaKI, a New Metal Ion-Independent Restriction Endonuclease from Lactococcus lactis KLDS4.

    Science.gov (United States)

    Belkebir, Abdelkarim; Azeddoug, Houssine

    2012-01-01

    Requirement of divalent cations for DNA cleavage is a general feature of type II restriction enzymes with the exception of few members of this group. A new type II restriction endonuclease has been partially purified from Lactococcus lactis KLDS4. The enzyme was denoted as LlaKI and showed to recognize and cleave the same site as FokI. The enzyme displayed a denatured molecular weight of 50 kDa and behaved as a dimer in solution as evidenced by the size exclusion chromatography. To investigate the role of divalent cations in DNA cleavage by LlaKI, digestion reactions were carried out at different Mg(2+), Mn(2+), and Ca(2+) concentrations. Unlike most of type II restriction endonucleases, LlaKI did not require divalent metal ions to cleave DNA and is one of the few metal-independent restriction endonucleases found in bacteria. The enzyme showed near-maximal levels of activity in 10 mM Tris-HCl pH 7.9, 50 mM NaCl, 10 mM MgCl2, and 1 mM dithiothreitol at 30°C. The presence of DNA modification was also determined and was correlated with the correspondent restriction enzyme.

  11. Genotyping of the fish rhabdovirus, viral haemorrhagic septicaemia virus, by restriction fragment length polymorphisms

    DEFF Research Database (Denmark)

    Einer-Jensen, Katja; Winton, J.; Lorenzen, Niels

    2005-01-01

    -gene by a set of three restriction enzymes was predicted to accurately enable the assignment of the VHSV isolates into the four major genotypes discovered to date. Further sub-typing of the isolates into the recently described sub-lineages of genotype I was possible by applying three additional enzymes......The aim of this study was to develop a standardized molecular assay that used limited resources and equipment for routine genotyping of isolates of the fish rhabdovirus, viral haemorrhagic septicaemia virus (VHSV). Computer generated restriction maps, based on 62 unique full-length (1524 nt......) sequences of the VHSV glycoprotein (G) gene, were used to predict restriction fragment length polymorphism (RFLP) patterns that were subsequently grouped and compared with a phylogenetic analysis of the G-gene sequences of the same set of isolates. Digestion of PCR amplicons from the full-length G...

  12. Suppression of APOBEC3-mediated restriction of HIV-1 by Vif

    Science.gov (United States)

    Feng, Yuqing; Baig, Tayyba T.; Love, Robin P.; Chelico, Linda

    2014-01-01

    The APOBEC3 restriction factors are a family of deoxycytidine deaminases that are able to suppress replication of viruses with a single-stranded DNA intermediate by inducing mutagenesis and functional inactivation of the virus. Of the seven human APOBEC3 enzymes, only APOBEC3-D, -F, -G, and -H appear relevant to restriction of HIV-1 in CD4+ T cells and will be the focus of this review. The restriction of HIV-1 occurs most potently in the absence of HIV-1 Vif that induces polyubiquitination and degradation of APOBEC3 enzymes through the proteasome pathway. To restrict HIV-1, APOBEC3 enzymes must be encapsidated into budding virions. Upon infection of the target cell during reverse transcription of the HIV-1 RNA into (-)DNA, APOBEC3 enzymes deaminate cytosines to form uracils in single-stranded (-)DNA regions. Upon replication of the (-)DNA to (+)DNA, the HIV-1 reverse transcriptase incorporates adenines opposite to the uracils thereby inducing C/G to T/A mutations that can functionally inactivate HIV-1. APOBEC3G is the most studied APOBEC3 enzyme and it is known that Vif attempts to thwart APOBEC3 function not only by inducing its proteasomal degradation but also by several degradation-independent mechanisms, such as inhibiting APOBEC3G virion encapsidation, mRNA translation, and for those APOBEC3G molecules that still become virion encapsidated, Vif can inhibit APOBEC3G mutagenic activity. Although most Vif variants can induce efficient degradation of APOBEC3-D, -F, and -G, there appears to be differential sensitivity to Vif-mediated degradation for APOBEC3H. This review examines APOBEC3-mediated HIV restriction mechanisms, how Vif acts as a substrate receptor for a Cullin5 ubiquitin ligase complex to induce degradation of APOBEC3s, and the determinants and functional consequences of the APOBEC3 and Vif interaction from a biological and biochemical perspective. PMID:25206352

  13. Intrauterine growth restriction - part 1.

    Science.gov (United States)

    Sharma, Deepak; Shastri, Sweta; Farahbakhsh, Nazanin; Sharma, Pradeep

    2016-12-01

    Intrauterine growth restriction (IUGR) is a major and silent cause of various morbidity and mortality for the fetal and neonatal population. It is defined as a rate of fetal growth that is less than normal for the growth potential of that specific infant. The terms IUGR and small for gestational age (SGA) are often used interchangeably, although there exists subtle differences between the two. IUGR/SGA is an end result of various etiologies that includes maternal, placental and fetal factors and recently added genetic factors too, also contribute to IUGR. In this review article we will cover the antenatal aspect of IUGR and management with proven preventive intervention.

  14. Enzyme actuated bioresponsive hydrogels

    Science.gov (United States)

    Wilson, Andrew Nolan

    Bioresponsive hydrogels are emerging with technological significance in targeted drug delivery, biosensors and regenerative medicine. Conferred with the ability to respond to specific biologically derived stimuli, the design challenge is in effectively linking the conferred biospecificity with an engineered response tailored to the needs of a particular application. Moreover, the fundamental phenomena governing the response must support an appropriate dynamic range and limit of detection. The design of these systems is inherently complicated due to the high interdependency of the governing phenomena that guide the sensing, transduction, and the actuation response of hydrogels. To investigate the dynamics of these materials, model systems may be used which seek to interrogate the system dynamics by uni-variable experimentation and limit confounding phenomena such as: polymer-solute interactions, polymer swelling dynamics and biomolecular reaction-diffusion concerns. To this end, a model system, alpha-chymotrypsin (Cht) (a protease) and a cleavable peptide-chromogen (pro-drug) covalently incorporated into a hydrogel, was investigated to understand the mechanisms of covalent loading and release by enzymatic cleavage in bio-responsive delivery systems. Using EDC and Sulfo-NHS, terminal carboxyl groups of N-succinyl-Ala-Ala-Pro-Phe p-nitroanilide, a cleavable chromogen, were conjugated to primary amines of a hydrated poly(HEMA)-based hydrogel. Hydrogel discs were incubated in buffered Cht causing enzyme-mediated cleavage of the peptide and concomitant release of the chromophore for monitoring. To investigate substrate loading and the effects of hydrogel morphology on the system, the concentration of the amino groups (5, 10, 20, and 30 mol%) and the cross-linked density (1, 5, 7, 9 and 12 mol%) were independently varied. Loading-Release Efficiency of the chromogen was shown to exhibit a positive relation to increasing amino groups (AEMA). The release rates demonstrated a

  15. Hydrolytic enzymes of "Streptococcus milleri".

    Science.gov (United States)

    Ruoff, K L; Ferraro, M J

    1987-01-01

    Seventy-two isolates classified as "Streptococcus milleri" were examined for the presence of various hydrolytic enzymes. While no protein or lipid-degrading activities were demonstrated, some isolates showed DNase and mucopolysaccharide-degrading activities. Beta-hemolytic isolates were more likely to produce these enzymes than were nonhemolytic strains. Isolates of one "S. milleri" biotype (mannitol fermentation positive) were uniformly devoid of all enzyme activities tested. PMID:2958496

  16. Enzymes From Rare Actinobacterial Strains.

    Science.gov (United States)

    Suriya, J; Bharathiraja, S; Manivasagan, P; Kim, S-K

    Actinobacteria constitute rich sources of novel biocatalysts and novel natural products for medical and industrial utilization. Although actinobacteria are potential source of economically important enzymes, the isolation and culturing are somewhat tough because of its extreme habitats. But now-a-days, the rate of discovery of novel compounds producing actinomycetes from soil, freshwater, and marine ecosystem has increased much through the developed culturing and genetic engineering techniques. Actinobacteria are well-known source of their bioactive compounds and they are the promising source of broad range of industrially important enzymes. The bacteria have the capability to degrade a range of pesticides, hydrocarbons, aromatic, and aliphatic compounds (Sambasiva Rao, Tripathy, Mahalaxmi, & Prakasham, 2012). Most of the enzymes are mainly derived from microorganisms because of their easy of growth, minimal nutritional requirements, and low-cost for downstream processing. The focus of this review is about the new, commercially useful enzymes from rare actinobacterial strains. Industrial requirements are now fulfilled by the novel actinobacterial enzymes which assist the effective production. Oxidative enzymes, lignocellulolytic enzymes, extremozymes, and clinically useful enzymes are often utilized in many industrial processes because of their ability to catalyze numerous reactions. Novel, extremophilic, oxidative, lignocellulolytic, and industrially important enzymes from rare Actinobacterial population are discussed in this chapter. © 2016 Elsevier Inc. All rights reserved.

  17. Enzyme Mimics: Advances and Applications.

    Science.gov (United States)

    Kuah, Evelyn; Toh, Seraphina; Yee, Jessica; Ma, Qian; Gao, Zhiqiang

    2016-06-13

    Enzyme mimics or artificial enzymes are a class of catalysts that have been actively pursued for decades and have heralded much interest as potentially viable alternatives to natural enzymes. Aside from having catalytic activities similar to their natural counterparts, enzyme mimics have the desired advantages of tunable structures and catalytic efficiencies, excellent tolerance to experimental conditions, lower cost, and purely synthetic routes to their preparation. Although still in the midst of development, impressive advances have already been made. Enzyme mimics have shown immense potential in the catalysis of a wide range of chemical and biological reactions, the development of chemical and biological sensing and anti-biofouling systems, and the production of pharmaceuticals and clean fuels. This Review concerns the development of various types of enzyme mimics, namely polymeric and dendrimeric, supramolecular, nanoparticulate and proteinic enzyme mimics, with an emphasis on their synthesis, catalytic properties and technical applications. It provides an introduction to enzyme mimics and a comprehensive summary of the advances and current standings of their applications, and seeks to inspire researchers to perfect the design and synthesis of enzyme mimics and to tailor their functionality for a much wider range of applications. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  18. Restrictive Imputation of Incomplete Survey Data

    NARCIS (Netherlands)

    Vink, G.|info:eu-repo/dai/nl/323348793

    2015-01-01

    This dissertation focuses on finding plausible imputations when there is some restriction posed on the imputation model. In these restrictive situations, current imputation methodology does not lead to satisfactory imputations. The restrictions, and the resulting missing data problems are real-life

  19. 50 CFR 648.23 - Gear restrictions.

    Science.gov (United States)

    2010-10-01

    ... gear, on the top of the regulated portion of a trawl net that results in an effective mesh opening of... 50 Wildlife and Fisheries 8 2010-10-01 2010-10-01 false Gear restrictions. 648.23 Section 648.23... Mackerel, Squid, and Butterfish Fisheries § 648.23 Gear restrictions. (a) Mesh restrictions and exemptions...

  20. Restricting Gang Clothing in the Public Schools.

    Science.gov (United States)

    Burke, N. Denise

    1993-01-01

    Examines whether schools can or should restrict gang clothing and how to restrict gang clothing without infringing on students' constitutional rights. Concludes that a policy that stresses the importance of reducing distractions that inhibit learning is more likely to be found legal than a policy restricting gang communication via limitations on…

  1. [Codeine--Restrictions on use for children and teenagers].

    Science.gov (United States)

    Stingl, Julia C; Rotthauwe, Jens

    2015-07-01

    The Pharmacovigilance Risk Assessment Committee (PRAC) of the European Medicines Agency has issued European-wide restrictions on the use of codeine-containing medicines for cough and cold in children at the age of 0-12 because of the risk of serious side effects, including the risk of breathing problems. The PRAC further recommended that "codeine must not be used in people of any age who are known to convert codeine into morphine at a faster rate than normal ('ultra-rapid metabolisers')". The reasons for this variability in codeine biotransformation lay in a genetic polymorphism in the liver enzyme CYP2D6 leading to 3% of the northern European population being ultrarapid metabolisers due to a gene duplication of the enzyme.This is the first restriction of a common drug in CYP2D6 ultrarapid metabolizers, and more use of pharmacogenetic biomarkers for stratified benefit-risk assessment in drug regulation can be expected and will be a first step to Individualized Medicine Regulation. © Georg Thieme Verlag KG Stuttgart · New York.

  2. Enzyme structure, enzyme function and allozyme diversity in ...

    African Journals Online (AJOL)

    In estimates of population genetic diversity based on allozyme heterozygosity, some enzymes are regularly more variable than others. Evolutionary theory suggests that functionally less important molecules, or parts of molecules, evolve more rapidly than more important ones; the latter enzymes should then theoretically be ...

  3. Restrictive management of neonatal polycythemia.

    Science.gov (United States)

    Morag, Iris; Strauss, Tzipora; Lubin, Daniel; Schushan-Eisen, Irit; Kenet, Gili; Kuint, Jacob

    2011-10-01

    Partial exchange transfusion (PET) is traditionally suggested as treatment for neonates diagnosed with polycythemia. Nevertheless, justification of this treatment is controversial. We evaluated the risk for short-term complications associated with a restrictive treatment protocol for neonatal polycythemia. A retrospective cross-sectional analytical study was conducted. Three treatment groups were defined and managed according to their degree of polycythemia, defined by capillary tube filled with venous blood and manually centrifuged hematocrit: group 1, hematocrit 65 to 69% and no special treatment was recommended; group 2, hematocrit 70 to 75% and intravenous fluids were given and feedings were withheld until hematocrit decreased to polycythemia. The overall rate of short-term complications was 15% (28 neonates). Seizures, proven necrotizing enterocolitis, or thrombosis did not occur in any participating neonates. PET was performed in 31 (16%) neonates. The groups did not differ in their rate of early neonatal morbidities or length of hospitalization. Restrictive treatment for neonatal asymptomatic polycythemia is not associated with an increased risk of short-term complications. © Thieme Medical Publishers.

  4. [The rise of enzyme engineering in China].

    Science.gov (United States)

    Li, Gaoxiang

    2015-06-01

    Enzyme engineering is an important part of the modern biotechnology. Industrial biocatalysis is considered the third wave of biotechnology following pharmaceutical and agricultural waves. In 25 years, China has made a mighty advances in enzyme engineering research. This review focuses on enzyme genomics, enzyme proteomics, biosynthesis, microbial conversion and biosensors in the Chinese enzyme engineering symposiums and advances in enzyme preparation industry in China.

  5. Computational enzyme design: transitioning from catalytic proteins to enzymes.

    Science.gov (United States)

    Mak, Wai Shun; Siegel, Justin B

    2014-08-01

    The widespread interest in enzymes stem from their ability to catalyze chemical reactions under mild and ecologically friendly conditions with unparalleled catalytic proficiencies. While thousands of naturally occurring enzymes have been identified and characterized, there are still numerous important applications for which there are no biological catalysts capable of performing the desired chemical transformation. In order to engineer enzymes for which there is no natural starting point, efforts using a combination of quantum chemistry and force-field based protein molecular modeling have led to the design of novel proteins capable of catalyzing chemical reactions not catalyzed by naturally occurring enzymes. Here we discuss the current status and potential avenues to pursue as the field of computational enzyme design moves forward. Published by Elsevier Ltd.

  6. Phosphoenolpyruvate-Dependent Mannitol Phosphotransferase System of Escherichia coli : Overexpression, Purification, and Characterization of the Enzymatically Active C-Terminal Domain of Enzyme IImtl Equivalent to Enzyme IIImtl

    NARCIS (Netherlands)

    Weeghel, R.P. van; Keck, W.; Robillard, G.T.

    1991-01-01

    The extreme C-terminus (Ser-490 to Lys-637) of the Escherichia coli EII(mtl) was subcloned to test structural and mechanistic proposals about the existence of an EIII-like domain in this enzyme. Oligonucleotide-directed mutagenesis was used to produce a unique NcoI restriction site and, at the same

  7. Restriction fragment length polymorphism (RFLP) of two HLA-B-associated transcripts (BATs) genes in healthy Danes

    DEFF Research Database (Denmark)

    Fugger, L; Morling, N; Ryder, L P

    1990-01-01

    The restriction fragment length polymorphism (RFLP) of the two human HLA-B-associated transcripts (BATs) genes, BAT1 and BAT2, was investigated using 5 different restriction enzymes and two human BAT1 and BAT2 cDNA probes. Two of the enzymes, NcoI and RsaI, revealed polymorphic patterns which were...... investigated in healthy Danes. The cDNA/restriction enzyme combination BAT1/NcoI identifies polymorphic bands at 12 kb, 8 kb, 2.5 kb, and 1.1 kb, while the BAT2/RsaI combination identifies polymorphic bands at 3.3 kb, 2.7 kb, 2.3 kb, and 0.9 kb. The frequencies of these markers were determined in 90 unrelated...

  8. Cellulase enzyme and biomass utilization

    African Journals Online (AJOL)

    STORAGESEVER

    2009-06-03

    Jun 3, 2009 ... Key words: Cellulose, cellulase enzyme, fuel ethanol, biomass. ... nearly all fuel ethanol is produced by fermentation of corn ... efficiency. This review will introduce some background knowledge of cellulase enzyme and its hydrolyzation mechanism, focus on its current status in research and application,.

  9. THE HUMAN FUMARYLACETOACETATE GENE : CHARACTERIZATION OF RESTRICTION-FRAGMENT-LENGTH-POLYMORPHISMS AND IDENTIFICATION OF HAPLOTYPES IN TYROSINEMIA TYPE-1 AND PSEUDODEFICIENCY

    NARCIS (Netherlands)

    ROOTWELT, H; KVITTINGEN, EA; HOIE, K; AGSTERIBBE, E; HARTOG, M; BERGER, R

    Deficiency of human fumarylacetoacetase (FAH) activity results in hereditary tyrosinemia type I. Using the restriction enzymes BglII, KpnI and StuI and a 1.3-kb cDNA probe for the FAH gene, we have found 6 restriction fragment length polymorphisms (RFLPs). These RFLPs were utilised in 3 tyrosinemia

  10. Positron emitter labeled enzyme inhibitors

    Science.gov (United States)

    Fowler, J.S.; MacGregor, R.R.; Wolf, A.P.

    1987-05-22

    This invention involved a new strategy for imaging and mapping enzyme activity in the living human and animal body using positron emitter-labeled suicide enzyme inactivators or inhibitors which become covalently bound to the enzyme as a result of enzymatic catalysis. Two such suicide in activators for monoamine oxidase have been labeled with carbon-11 and used to map the enzyme subtypes in the living human and animal body using PET. By using positron emission tomography to image the distribution of radioactivity produced by the body penetrating radiation emitted by carbon-11, a map of functionally active monoamine oxidase activity is obtained. Clorgyline and L-deprenyl are suicide enzyme inhibitors and irreversibly inhibit monoamine oxidase. When these inhibitors are labeled with carbon-11 they provide selective probes for monoamine oxidase localization and reactivity in vivo using positron emission tomography. 2 figs.

  11. Engineering Cellulase Enzymes for Bioenergy

    Science.gov (United States)

    Atreya, Meera Elizabeth

    Sustainable energy sources, such as biofuels, offer increasingly important alternatives to fossil fuels that contribute less to global climate change. The energy contained within cellulosic biofuels derives from sunlight energy stored in the form of carbon-carbon bonds comprising sugars such as glucose. Second-generation biofuels are produced from lignocellulosic biomass feedstocks, including agricultural waste products and non-food crops like Miscanthus, that contain lignin and the polysaccharides hemicellulose and cellulose. Cellulose is the most abundant biological material on Earth; it is a polymer of glucose and a structural component of plant cell walls. Accessing the sugar is challenging, as the crystalline structure of cellulose resists degradation; biochemical and thermochemical means can be used to depolymerize cellulose. Cellulase enzymes catalyze the biochemical depolymerization of cellulose into glucose. Glucose can be used as a carbon source for growth of a biofuel-producing microorganism. When it converts glucose to a hydrocarbon fuel, this microbe completes the biofuels process of transforming sunlight energy into accessible, chemical energy capable of replacing non-renewable transportation fuels. Due to strong intermolecular interactions between polymer chains, cellulose is significantly more challenging to depolymerize than starch, a more accessible polymer of glucose utilized in first-generation biofuels processes (often derived from corn). While most mammals cannot digest cellulose (dietary fiber), certain fungi and bacteria produce cellulase enzymes capable of hydrolyzing it. These organisms secrete a wide variety of glycoside hydrolase and other classes of enzymes that work in concert. Because cellulase enzymes are slow-acting and expensive to produce, my aim has been to improve the properties of these enzymes as a means to make a cellulosic biofuels process possible that is more efficient and, consequently, more economical than current

  12. Stillbirth and fetal growth restriction.

    Science.gov (United States)

    Bukowski, Radek

    2010-09-01

    The association between stillbirth and fetal growth restriction is strong and supported by a large body of evidence and clinically employed for the stillbirth prediction. However, although assessment of fetal growth is a basis of clinical practice, it is not trivial. Essentially, fetal growth is a result of the genetic growth potential of the fetus and placental function. The growth potential is the driving force of fetal growth, whereas the placenta as the sole source of nutrients and oxygen might become the rate limiting element of fetal growth if its function is impaired. Thus, placental dysfunction may prevent the fetus from reaching its full genetically determined growth potential. In this sense fetal growth and its aberration provides an insight into placental function. Fetal growth is a proxy for the test of the effectiveness of placenta, whose function is otherwise obscured during pregnancy.

  13. Evaluating the Relationship between FRET Changes and Distance Changes Using DNA Length and Restriction Enzyme Specificity

    Science.gov (United States)

    Pazhani, Yogitha; Horn, Abigail E.; Grado, Lizbeth; Kugel, Jennifer F.

    2016-01-01

    FRET (Fo¨rster resonance energy transfer) involves the transfer of energy from an excited donor fluorophore to an acceptor molecule in a manner that is dependent on the distance between the two. A biochemistry laboratory experiment is described that teaches students how to use FRET to evaluate distance changes in biological molecules. Students…

  14. Development of restriction enzyme analyses to distinguish winter moth from bruce spanworm and hybrids between them

    Science.gov (United States)

    Marinko Sremac; Joseph Elkinton; Adam. Porter

    2011-01-01

    Elkinton et. al. recently completed a survey of northeastern North America for the newly invasive winter moth, Operophtera brumata L. The survey used traps baited with the winter moth pheromone, which consists of a single compound also used by Bruce spanworm, O. bruceata (Hulst), the North American congener of winter moth. Our...

  15. Detection and genotyping of cutaneous leishmaniasis species in the southeast of Iran: restriction enzyme analysis (RFLP

    Directory of Open Access Journals (Sweden)

    Khalili M

    2009-06-01

    Full Text Available "n Normal 0 false false false EN-GB X-NONE AR-SA MicrosoftInternetExplorer4 /* Style Definitions */ table.MsoNormalTable {mso-style-name:"Table Normal"; mso-tstyle-rowband-size:0; mso-tstyle-colband-size:0; mso-style-noshow:yes; mso-style-priority:99; mso-style-qformat:yes; mso-style-parent:""; mso-padding-alt:0cm 5.4pt 0cm 5.4pt; mso-para-margin:0cm; mso-para-margin-bottom:.0001pt; mso-pagination:widow-orphan; font-size:11.0pt; font-family:"Calibri","sans-serif"; mso-ascii-font-family:Calibri; mso-ascii-theme-font:minor-latin; mso-fareast-font-family:"Times New Roman"; mso-fareast-theme-font:minor-fareast; mso-hansi-font-family:Calibri; mso-hansi-theme-font:minor-latin; mso-bidi-font-family:Arial; mso-bidi-theme-font:minor-bidi;} Background: Leishmaniasis is a parasitic infectious disease which causes skin sores. There is no effective laboratory screening tests for leishmaniasis. Some diagnostic techniques exist that allow parasite detection and species identification by special culture and microscopy, biochemical (Isoenzymes, immunologic (immunoassays, and molecular (PCR approaches. Specific major objectives of this study was to genotyping of Leishmania species in Bam and Shiraz city."n"n Methods: A total of 83 samples of Leishmania were collected from patients clinically suspected of cutaneous leishmaniasis. The geographic distributions of the samples were 55 samples from Bam and 28 from Shiraz city. For this propose samples of skin and bloods were blotted on filter paper. Genomic DNA extracted with a Genomic DNA extraction kit (AccuPrep, BIONEER. Aliquots of extracted DNA were kept at -20°C. region of ITS1 amplified with the published Leishmania-specific primers. 15-20mL of these amplicons, containing the amplified ITS1 region, was digested for 2h with HaeIII."n"n Results: All 55 samples from Bam were considered as L. tropica and the positive samples from Shiraz considered as L. tropica and just one sample was L. major which was belonged to a patient had previously traveled to Isfahan and Khuzestan."n"n Conclusion: In the current study a PCR technique was employed for amplification of Leishmania DNA directly in biological materials. Characterization of genus of Leishmania using RFLP-PCR method is too sensitive and too rapid, and there is no need for culturing the parasite for diagnosis.

  16. Updating rDNA restriction enzyme maps of Tetrahymena reveals four new intron-containing species

    DEFF Research Database (Denmark)

    Nielsen, Henrik; Simon, E M; Engberg, J

    1985-01-01

    an intron in the 26s rRNA coding region. The evolutionary relationship among the species of the T. pyriformis complex was examined on the basis of the rDNA maps with emphasis on similarities between two of the new species and the widely studied T. thermophila and T. pigmentosa. Examination of a large number...

  17. Differentiation of sheeppox and goatpox viruses by polymerase Chain reaction-restriction fragment length polymorphism.

    Science.gov (United States)

    Venkatesan, Gnanavel; Balamurugan, Vinayagamurthy; Yogisharadhya, Revaniah; Kumar, Amit; Bhanuprakash, Veerakyathappa

    2012-12-01

    In the present study, the partial gene sequences of P32 protein, an immunogenic envelope protein of Capripoxviruses (CaPV), were analyzed to assess the genetic relationship among sheeppox and goatpox virus isolates, and restriction enzyme specific PCR-RFLP was developed to differentiate CaPV strains. A total of six goatpox virus (GTPV) and nine sheeppox virus (SPPV) isolates of Indian origin were included in the sequence analysis of the attachment gene. The sequence analysis revealed a high degree of sequence identity among all the Indian SPPV and GTPV isolates at both nucleotide and amino acid levels. Phylogenetic analysis showed three distinct clusters of SPPV, GTPV and Lumpy skin disease virus (LSDV) isolates. Further, multiple sequence alignment revealed a unique change at G120A in all GTPV isolates resulting in the formation of Dra I restriction site in lieu of EcoR I, which is present in SPPV isolates studied. This change was unique and exploited to develop restriction enzyme specific PCR-RFLP for detection and differentiation of SPPV and GTPV strains. The optimized PCR-RFLP was validated using a total of fourteen (n=14) cell culture isolates and twenty two (n=22) known clinical samples of CaPV. The Restriction Enzyme specific PCR-RFLP to differentiate both species will allow a rapid differential diagnosis during CaPV outbreaks particularly in mixed flocks of sheep and goats and could be an adjunct/supportive tool for complete gene or virus genome sequencing methods.

  18. Genotyping of Campylobacter jejuni strains from Danish broiler chickens by restriction fragment length polymorphism of the LPS gene cluster

    DEFF Research Database (Denmark)

    Knudsen, K.N.; Bang, Dang Duong; Nielsen, E.M.

    2005-01-01

    , the LG genotyping method was used to study the genetic stability of four C. jejuni strains after gastrointestinal passage through experimentally infected chickens. Methods and Results: In the present study, the LG genotyping method was modified with respect to the restriction enzymes used. To validate...... no changes in the LG genotype of the C. jejuni strains obtained after experimental passage through chickens. Concusions: All C. jejuni strains obtained from broiler chickens were typeable by the LG genotyping method. Application of the RsaI restriction enzyme improved the method in terms of ease...

  19. BAKERY ENZYMES IN CEREAL TECHNOLOGIES

    Directory of Open Access Journals (Sweden)

    Václav Koman

    2012-10-01

    Full Text Available Normal 0 21 false false false SK X-NONE X-NONE Bread is the most common and traditional food in the world. For years, enzymes such as malt and fungal alpha-amylase have been used in bread making. Due to the changes in the baking industry and the ever-increasing demand for more natural products, enzymes have gained real importance in bread-making. If an enzyme is added, it is often destroyed by the heat during the baking process. For generations, enzymes have been used for the improvement of texture and appearance, enhancement of nutritional values and generation of appealing flavours and aromas. Enzymes used in bakery industry constitute nearly one third of the market. The bakery products have undergone radical improvements in quality over the past years in terms of flavour, texture and shelf-life. The the biggest contributor for these improvementsis the usage of enzymes. Present work seeks to systematically describe bakery enzymes, their classification, benefits, usage and chemical reactions in the bread making process.doi:10.5219/193

  20. Identification of fungemia agents using the polymerase chain reaction and restriction fragment length polymorphism analysis

    Directory of Open Access Journals (Sweden)

    M.S. Santos

    2010-08-01

    Full Text Available Prompt and specific identification of fungemia agents is important in order to define clinical treatment. However, in most cases conventional culture identification can be considered to be time-consuming and not without errors. The aim of the present study was to identify the following fungemia agents: Candida albicans, Candida parapsilosis, Candida tropicalis, Candida glabrata, Cryptococcus neoformans, Cryptococcus gattii, and Histoplasma capsulatum using the polymerase chain reaction and restriction fragment length polymorphism analysis (PCR/RFLP. More specifically: a to evaluate 3 different amplification regions, b to investigate 3 different restriction enzymes, and c to use the best PCR/RFLP procedure to indentify 60 fungemia agents from a culture collection. All 3 pairs of primers (ITS1/ITS4, NL4/ITS5 and Primer1/Primer2 were able to amplify DNA from the reference strains. However, the size of these PCR products did not permit the identification of all the species studied. Three restriction enzymes were used to digest the PCR products: HaeIII, Ddel and Bfal. Among the combinations of pairs of primers and restriction enzymes, only one (primer pair NL4/ITS5 and restriction enzyme Ddel produced a specific RFLP pattern for each microorganism studied. Sixty cultures of fungemia agents (selected from the culture collection of Fundação de Medicina Tropical do Amazonas - FMTAM were correctly identified by PCR/RFLP using the prime pair NL4/ITS5 and Ddel. We conclude that the method proved to be both simple and reproducible, and may offer potential advantages over phenotyping methods.

  1. Assessing restrictiveness of national alcohol marketing policies.

    Science.gov (United States)

    Esser, Marissa B; Jernigan, David H

    2014-01-01

    To develop an approach for monitoring national alcohol marketing policies globally, an area of the World Health Organization's (WHO) Global Alcohol Strategy. Data on restrictiveness of alcohol marketing policies came from the 2002 and 2008 WHO Global Surveys on Alcohol and Health. We included four scales in a sensitivity analysis to determine optimal weights to score countries on their marketing policies and applied the selected scale to assess national marketing policy restrictiveness. Nearly, 36% of countries had no marketing restrictions. The overall restrictiveness levels were not significantly different between 2002 and 2008. The number of countries with strict marketing regulations did not differ across years. This method of monitoring alcohol marketing restrictiveness helps track progress towards implementing WHO'S Global Alcohol Strategy. Findings indicate a consistent lack of restrictive policies over time, making this a priority area for national and global action. © The Author 2014. Medical Council on Alcohol and Oxford University Press. All rights reserved.

  2. Autoscreening of restriction endonucleases for PCR-restriction fragment length polymorphism identification of fungal species, with Pleurotus spp. as an example.

    Science.gov (United States)

    Yang, Zhi-Hui; Huang, Ji-Xiang; Yao, Yi-Jian

    2007-12-01

    A molecular method based on PCR-restriction fragment length polymorphism (RFLP) analysis of internal transcribed spacer (ITS) ribosomal DNA sequences was designed to rapidly identify fungal species, with members of the genus Pleurotus as an example. Based on the results of phylogenetic analysis of ITS sequences from Pleurotus, a PCR-RFLP endonuclease autoscreening (PRE Auto) program was developed to screen restriction endonucleases for discriminating multiple sequences from different species. The PRE Auto program analyzes the endonuclease recognition sites and calculates the sizes of the fragments in the sequences that are imported into the program in groups according to species recognition. Every restriction endonuclease is scored through the calculation of the average coefficient for the sequence groups and the average coefficient for the sequences within a group, and then virtual electrophoresis maps for the selected restriction enzymes, based on the results of the scoring system, are displayed for the rapid determination of the candidate endonucleases. A total of 85 haplotypes representing 151 ITS sequences were used for the analysis, and 2,992 restriction endonucleases were screened to find the candidates for the identification of species. This method was verified by an experiment with 28 samples representing 12 species of Pleurotus. The results of the digestion by the restriction enzymes showed the same patterns of DNA fragments anticipated by the PRE Auto program, apart from those for four misidentified samples. ITS sequences from 14 samples (of which nine sequences were obtained in this study), including four originally misidentified samples, confirmed the species identities revealed by the PCR-RFLP analysis. The method developed here can be used for the identification of species of other living microorganisms.

  3. Start and the restriction point.

    Science.gov (United States)

    Johnson, Amy; Skotheim, Jan M

    2013-12-01

    Commitment to division requires that cells sense, interpret, and respond appropriately to multiple signals. In most eukaryotes, cells commit to division in G1 before DNA replication. Beyond a point, known as Start in yeast and the restriction point in mammals, cells will proceed through the cell cycle despite changes in upstream signals. In metazoans, misregulated G1 control can lead to developmental problems or disease, so it is important to understand how cells decipher the myriad external and internal signals that contribute to the fundamental all-or-none decision to divide. Extensive study of G1 control in the budding yeast Saccharomyces cerevisiae and mammalian culture systems has revealed highly similar networks regulating commitment. However, protein sequences of functional orthologs often indicate a total lack of conservation suggesting significant evolution of G1 control. Here, we review recent studies defining the conserved and diverged features of G1 control and highlight systems-level aspects that may be common to other biological regulatory networks. Copyright © 2013 Elsevier Ltd. All rights reserved.

  4. Placental Adaptations in Growth Restriction

    Science.gov (United States)

    Zhang, Song; Regnault, Timothy R.H.; Barker, Paige L.; Botting, Kimberley J.; McMillen, Isabella C.; McMillan, Christine M.; Roberts, Claire T.; Morrison, Janna L.

    2015-01-01

    The placenta is the primary interface between the fetus and mother and plays an important role in maintaining fetal development and growth by facilitating the transfer of substrates and participating in modulating the maternal immune response to prevent immunological rejection of the conceptus. The major substrates required for fetal growth include oxygen, glucose, amino acids and fatty acids, and their transport processes depend on morphological characteristics of the placenta, such as placental size, morphology, blood flow and vascularity. Other factors including insulin-like growth factors, apoptosis, autophagy and glucocorticoid exposure also affect placental growth and substrate transport capacity. Intrauterine growth restriction (IUGR) is often a consequence of insufficiency, and is associated with a high incidence of perinatal morbidity and mortality, as well as increased risk of cardiovascular and metabolic diseases in later life. Several different experimental methods have been used to induce placental insufficiency and IUGR in animal models and a range of factors that regulate placental growth and substrate transport capacity have been demonstrated. While no model system completely recapitulates human IUGR, these animal models allow us to carefully dissect cellular and molecular mechanisms to improve our understanding and facilitate development of therapeutic interventions. PMID:25580812

  5. Cardiac MRI in restrictive cardiomyopathy

    Energy Technology Data Exchange (ETDEWEB)

    Gupta, A. [Department of Cardiovascular Radiology, All India Institute of Medical Sciences, Ansari Nagar, Delhi (India); Singh Gulati, G., E-mail: gulatigurpreet@rediffmail.com [Department of Cardiovascular Radiology, All India Institute of Medical Sciences, Ansari Nagar, Delhi (India); Seth, S. [Department of Cardiology, All India Institute of Medical Sciences, Ansari Nagar, Delhi (India); Sharma, S. [Department of Cardiovascular Radiology, All India Institute of Medical Sciences, Ansari Nagar, Delhi (India)

    2012-02-15

    Restrictive cardiomyopathy (RCM) is a specific group of heart muscle disorders characterized by inadequate ventricular relaxation during diastole. This leads to diastolic dysfunction with relative preservation of systolic function. Although short axis systolic function is usually preserved in RCM, the long axis systolic function may be severely impaired. Confirmation of diagnosis and information regarding aetiology, extent of myocardial damage, and response to treatment requires imaging. Importantly, differentiation from constrictive pericarditis (CCP) is needed, as only the latter is managed surgically. Echocardiography is the initial cardiac imaging technique but cannot reliably suggest a tissue diagnosis; although recent advances, especially tissue Doppler imaging and spectral tracking, have improved its ability to differentiate RCM from CCP. Cardiac catheterization is the reference standard, but is invasive, two-dimensional, and does not aid myocardial characterization. Cardiac magnetic resonance (CMR) is a versatile technique providing anatomical, morphological and functional information. In recent years, it has been shown to provide important information regarding disease mechanisms, and also been found useful to guide treatment, assess its outcome and predict patient prognosis. This review describes the CMR features of RCM, appearances in various diseases, its overall role in patient management, and how it compares with other imaging techniques.

  6. Placental Adaptations in Growth Restriction

    Directory of Open Access Journals (Sweden)

    Song Zhang

    2015-01-01

    Full Text Available The placenta is the primary interface between the fetus and mother and plays an important role in maintaining fetal development and growth by facilitating the transfer of substrates and participating in modulating the maternal immune response to prevent immunological rejection of the conceptus. The major substrates required for fetal growth include oxygen, glucose, amino acids and fatty acids, and their transport processes depend on morphological characteristics of the placenta, such as placental size, morphology, blood flow and vascularity. Other factors including insulin-like growth factors, apoptosis, autophagy and glucocorticoid exposure also affect placental growth and substrate transport capacity. Intrauterine growth restriction (IUGR is often a consequence of insufficiency, and is associated with a high incidence of perinatal morbidity and mortality, as well as increased risk of cardiovascular and metabolic diseases in later life. Several different experimental methods have been used to induce placental insufficiency and IUGR in animal models and a range of factors that regulate placental growth and substrate transport capacity have been demonstrated. While no model system completely recapitulates human IUGR, these animal models allow us to carefully dissect cellular and molecular mechanisms to improve our understanding and facilitate development of therapeutic interventions.

  7. Measuring Regulatory Restrictions in Logistics Services

    OpenAIRE

    Claire HOLLWEG; Marn-Heong WONG

    2009-01-01

    This study measures the extent of restrictions on trade in logistics services in the ASEAN+6 economies by constructing a logistics regulatory restrictiveness index for each economy that quantifies the extent of government regulations faced by logistics service providers. This is the first study of its kind to construct a regulatory index of the entire logistics sector, which includes the main modes of international transport and customs restrictions. The indices show that large differences ex...

  8. Enzymes of inorganic polyphosphate metabolism.

    Science.gov (United States)

    Kulakovskaya, Tatyana; Kulaev, Igor

    2013-01-01

    Inorganic polyphosphate (PolyP) is a linear polymer containing a few to several hundred orthophosphate residues linked by energy-rich phosphoanhydride bonds. Investigation of PolyP-metabolizing enzymes is important for medicine, because PolyPs perform numerous functions in the cells. In human organism, PolyPs are involved in the regulation of Ca(2+) uptake in mitochondria, bone tissue development, and blood coagulation. The essentiality of polyphosphate kinases in the virulence of pathogenic bacteria is a basis for the discovery of new antibiotics. The properties of the major enzymes of PolyP metabolism, first of all polyphosphate kinases and exopolyphosphatases, are described in the review. The main differences between the enzymes of PolyP biosynthesis and utilization of prokaryotic and eukaryotic cells, as well as the multiple functions of some enzymes of PolyP metabolism, are considered.

  9. Photosynthetic fuel for heterologous enzymes

    DEFF Research Database (Denmark)

    Mellor, Silas Busck; Vavitsas, Konstantinos; Nielsen, Agnieszka Janina Zygadlo

    2017-01-01

    of reducing power. Recent work on the metabolic engineering of photosynthetic organisms has shown that the electron carriers such as ferredoxin and flavodoxin can be used to couple heterologous enzymes to photosynthetic reducing power. Because these proteins have a plethora of interaction partners and rely...... on electrostatically steered complex formation, they form productive electron transfer complexes with non-native enzymes. A handful of examples demonstrate channeling of photosynthetic electrons to drive the activity of heterologous enzymes, and these focus mainly on hydrogenases and cytochrome P450s. However......, competition from native pathways and inefficient electron transfer rates present major obstacles, which limit the productivity of heterologous reactions coupled to photosynthesis. We discuss specific approaches to address these bottlenecks and ensure high productivity of such enzymes in a photosynthetic...

  10. GRE Enzymes for Vector Analysis

    Data.gov (United States)

    U.S. Environmental Protection Agency — Microbial enzyme data that were collected during the 2004-2006 EMAP-GRE program. These data were then used by Moorhead et al (2016) in their ecoenzyme vector...

  11. Structural and functional analysis of the symmetrical Type I restriction endonuclease R.EcoR124I(NT.

    Directory of Open Access Journals (Sweden)

    James E Taylor

    Full Text Available Type I restriction-modification (RM systems are comprised of two multi-subunit enzymes, the methyltransferase (∼160 kDa, responsible for methylation of DNA, and the restriction endonuclease (∼400 kDa, responsible for DNA cleavage. Both enzymes share a number of subunits. An engineered RM system, EcoR124I(NT, based on the N-terminal domain of the specificity subunit of EcoR124I was constructed that recognises the symmetrical sequence GAAN(7TTC and is active as a methyltransferase. Here, we investigate the restriction endonuclease activity of R. EcoR124I(NTin vitro and the subunit assembly of the multi-subunit enzyme. Finally, using small-angle neutron scattering and selective deuteration, we present a low-resolution structural model of the endonuclease and locate the motor subunits within the multi-subunit enzyme. We show that the covalent linkage between the two target recognition domains of the specificity subunit is not required for subunit assembly or enzyme activity, and discuss the implications for the evolution of Type I enzymes.

  12. Enzymes: principles and biotechnological applications

    Science.gov (United States)

    Robinson, Peter K.

    2015-01-01

    Enzymes are biological catalysts (also known as biocatalysts) that speed up biochemical reactions in living organisms, and which can be extracted from cells and then used to catalyse a wide range of commercially important processes. This chapter covers the basic principles of enzymology, such as classification, structure, kinetics and inhibition, and also provides an overview of industrial applications. In addition, techniques for the purification of enzymes are discussed. PMID:26504249

  13. Multi-enzyme Process Modeling

    DEFF Research Database (Denmark)

    Andrade Santacoloma, Paloma de Gracia

    or potential process configurations operated under different conditions. In these cases, process engineering, enzyme immobilization and protein engineering are presented as fields that can offer feasible solutions for better process configurations or biocatalyst modification to enhance actual process...... proven to be useful for a fast model formulation of multi-enzyme processes. Additionally, programming codes were developed using MATLAB (The Mathworks, Natick, MA) which were also used as computational tools to support the implementation, solution and analysis of all the mathematical problems faced...

  14. A FLUORESCENCE BASED ASSAY FOR DNA DAMAGE: INDUCED BY RADIATION, CHEMICALS AND ENZYMES

    Science.gov (United States)

    A simple and rapid assay to detect DNA damage is reported. This assay is based on the ability of certain dyes to fluoresce upon intercalation with dsDNA. Damage caused by ultraviolet (UV) radiation, chemicals or restriction enzymes is detected using this assay. UV radiation at...

  15. Enzymes and Enzyme Activity Encoded by Nonenveloped Viruses.

    Science.gov (United States)

    Azad, Kimi; Banerjee, Manidipa; Johnson, John E

    2017-09-29

    Viruses are obligate intracellular parasites that rely on host cell machineries for their replication and survival. Although viruses tend to make optimal use of the host cell protein repertoire, they need to encode essential enzymatic or effector functions that may not be available or accessible in the host cellular milieu. The enzymes encoded by nonenveloped viruses-a group of viruses that lack any lipid coating or envelope-play vital roles in all the stages of the viral life cycle. This review summarizes the structural, biochemical, and mechanistic information available for several classes of enzymes and autocatalytic activity encoded by nonenveloped viruses. Advances in research and development of antiviral inhibitors targeting specific viral enzymes are also highlighted.

  16. Stability of Enzymes in Granular Enzyme Products for Laundry Detergents

    DEFF Research Database (Denmark)

    Biran, Suzan; Bach, Poul; Simonsen, Ole

    with previously reported H2O2-induced oxidation studies of Savinase® in solutions. Preliminary formulation studies were conducted and application of the designed setup on stability measurements of commercial granulates was illustrated. Addition of salts resulted in a considerable conservation of enzyme activity...... stability was significantly conserved, while at multilayer hydration level, especially when samples were exposed to 100% RH, the activity was reduced by 80% in a one week period. Since no auto-proteolytic activity and covalently-bound aggregate formation were detected, humidity possibly induced formation...... with the enzyme provided better protection than coating the salt as a separate layer. The effect of site-directed mutagenesis on Savinase® stability was illustrated and possible stability enhancing additives for enzyme granulates were proposed. The present study is the first to report the solid-state inactivation...

  17. Restricted Interests and Teacher Presentation of Items

    Science.gov (United States)

    Stocco, Corey S.; Thompson, Rachel H.; Rodriguez, Nicole M.

    2011-01-01

    Restricted and repetitive behavior (RRB) is more pervasive, prevalent, frequent, and severe in individuals with autism spectrum disorders (ASDs) than in their typical peers. One subtype of RRB is restricted interests in items or activities, which is evident in the manner in which individuals engage with items (e.g., repetitious wheel spinning),…

  18. 45 CFR 3.42 - Restricted activities.

    Science.gov (United States)

    2010-10-01

    ... 45 Public Welfare 1 2010-10-01 2010-10-01 false Restricted activities. 3.42 Section 3.42 Public... THE NATIONAL INSTITUTES OF HEALTH FEDERAL ENCLAVE Facilities and Grounds § 3.42 Restricted activities... by appropriate signs. Photographs and similar activities for advertising or commercial purposes may...

  19. 50 CFR 24.11 - General restrictions.

    Science.gov (United States)

    2010-10-01

    ... 50 Wildlife and Fisheries 6 2010-10-01 2010-10-01 false General restrictions. 24.11 Section 24.11 Wildlife and Fisheries UNITED STATES FISH AND WILDLIFE SERVICE, DEPARTMENT OF THE INTERIOR (CONTINUED... § 24.11 General restrictions. No person shall import, export, or reexport plants at any place other...

  20. 50 CFR 14.11 - General restrictions.

    Science.gov (United States)

    2010-10-01

    ... 50 Wildlife and Fisheries 1 2010-10-01 2010-10-01 false General restrictions. 14.11 Section 14.11 Wildlife and Fisheries UNITED STATES FISH AND WILDLIFE SERVICE, DEPARTMENT OF THE INTERIOR TAKING....11 General restrictions. Except as otherwise provided in this part, no person may import or export...

  1. [Anesthesia and restrictive and obstructive pulmonary diseases].

    Science.gov (United States)

    Bremerich, Dorothee H; Hachenberg, Thomas

    2007-05-01

    Restrictive and obstructive pulmonary diseases are major risk factors of perioperative morbidity and mortality. The incidence of pulmonary complications may be in the range of 3 and 40% (3), depending on the underlying disease and the type of surgery. In this review the specific pathophysiology, preoperative evaluation and suitable anesthesia procedures are discussed for patients with restrictive and obstructive pulmonary diseases.

  2. 50 CFR 648.104 - Gear restrictions.

    Science.gov (United States)

    2010-10-01

    ..., lines, or chafing gear, on the top of the regulated portion of a trawl net; except that, one splitting... 50 Wildlife and Fisheries 8 2010-10-01 2010-10-01 false Gear restrictions. 648.104 Section 648.104... Flounder Fisheries § 648.104 Gear restrictions. (a) General. (1) Otter trawlers whose owners are issued a...

  3. 50 CFR 648.123 - Gear restrictions.

    Science.gov (United States)

    2010-10-01

    ... limited to, nets, net strengtheners, ropes, lines, or chafing gear, on the top of the regulated portion of... 50 Wildlife and Fisheries 8 2010-10-01 2010-10-01 false Gear restrictions. 648.123 Section 648.123... § 648.123 Gear restrictions. (a) Trawl vessel gear restrictions—(1) Minimum mesh size. No owner or...

  4. 46 CFR 184.202 - Restrictions.

    Science.gov (United States)

    2010-10-01

    ... 46 Shipping 7 2010-10-01 2010-10-01 false Restrictions. 184.202 Section 184.202 Shipping COAST... CONTROL AND MISCELLANEOUS SYSTEMS AND EQUIPMENT Cooking and Heating § 184.202 Restrictions. (a) The use of... in § 184.240 of this part. The use of these fuels for cooking, heating, and lighting on ferry vessels...

  5. Isothermal detection of RNA with restriction endonucleases.

    Science.gov (United States)

    Yan, Lei; Nakayama, Shizuka; Yitbarek, Saron; Greenfield, Isabel; Sintim, Herman O

    2011-01-07

    Herein, we demonstrate how to detect nucleic acids that do not contain restriction endonuclease recognition sites with restriction endonucleases. We show that the topology of DNA probes used in this detection strategy remarkably affects the efficiency of RNA/DNA detection.

  6. Immunolocalization of two hydrogenosomal enzymes of Trichomonas vaginalis.

    Science.gov (United States)

    Brugerolle, G; Bricheux, G; Coffe, G

    2000-01-01

    Three monoclonal antibodies specific for malic enzyme and for the alpha- and beta-subunits, respectively, of the succinyl-coenzyme A (CoA) synthetase of Trichomonas vaginalis were used to immunolocalize these proteins in the cell. All antibodies labeled the hydrogenosome matrix as determined both by immunofluorescence and by immunogold staining. There was no labeling on the cell surface or in any other cell compartment. These results support the idea that these proteins are restricted to a hydrogenosomal function and do not play a role as adhesins at the plasma membrane surface.

  7. PCR-RFLP Using BseDI Enzyme for Pork Authentication in Sausage and Nugget Products

    Directory of Open Access Journals (Sweden)

    Y. Erwanto

    2011-04-01

    Full Text Available A polymerase chain reaction–restriction fragment length polymorphism (PCR–RFLP using BseDI restriction enzyme had been applied for identifying the presence of pork in processed meat (beef sausage and chicken nugget including before and after frying. Pork sample in various levels (1%, 3%, 5%, 10%, and 25 % was prepared in a mixture with beef and chicken meats and processed for sausage and nugget. The primers CYTb1 and CYTb2 were designed in the mitochondrial cytochrome b (cyt b gene and PCR successfully amplified fragments of 359 bp. To distinguish existence of porcine species, the amplified PCR products of mitochondrial DNA were cut by BseDI restriction enzyme. The result showed pig mitochondrial DNA was cut into 131 and 228 bp fragments. The PCR-RFLP species identification assay yielded excellent results for identification of porcine species. It is a potentially reliable technique for pork detection in animal food processed products for Halal authentication.

  8. Characterization of six rat strains (Rattus norvegicus by mitochondrial DNA restriction fragment length polymorphism

    Directory of Open Access Journals (Sweden)

    Hilsdorf A.W.

    1999-01-01

    Full Text Available Restriction fragment length polymorphism (RFLP was used to examine the extent of mtDNA polymorphism among six strains of rats (Rattus norvegicus - Wistar, Wistar Munich, Brown Norway, Wistar Kyoto, SHR and SHR-SP. A survey of 26 restriction enzymes has revealed a low level of genetic divergence among strains. The sites of cleavage by EcoRI, NcoI and XmnI were shown to be polymorphic. The use of these three enzymes allows the 6 strains to be classified into 4 haplotypes and identifies specific markers for each one. The percentage of sequence divergence among all pairs of haplotypes ranged from 0.035 to 0.33%, which is the result of a severe population constriction undergone by the strains. These haplotypes are easily demonstrable and therefore RFLP analysis can be employed for genetic monitoring of rats within animal facilities or among different laboratories.

  9. Asymmetric Stetter reactions catalyzed by thiamine diphosphate-dependent enzymes.

    Science.gov (United States)

    Kasparyan, Elena; Richter, Michael; Dresen, Carola; Walter, Lydia S; Fuchs, Georg; Leeper, Finian J; Wacker, Tobias; Andrade, Susana L A; Kolter, Geraldine; Pohl, Martina; Müller, Michael

    2014-12-01

    The intermolecular asymmetric Stetter reaction is an almost unexplored transformation for biocatalysts. Previously reported thiamine diphosphate (ThDP)-dependent PigD from Serratia marcescens is the first enzyme identified to catalyze the Stetter reaction of α,β-unsaturated ketones (Michael acceptor substrates) and α-keto acids. PigD is involved in the biosynthesis of the potent cytotoxic agent prodigiosin. Here, we describe the investigation of two new ThDP-dependent enzymes, SeAAS from Saccharopolyspora erythraea and HapD from Hahella chejuensis. Both show a high degree of homology to the amino acid sequence of PigD (39 and 51 %, respectively). The new enzymes were heterologously overproduced in Escherichia coli, and the yield of soluble protein was enhanced by co-expression of the chaperone genes groEL/ES. SeAAS and HapD catalyze intermolecular Stetter reactions in vitro with high enantioselectivity. The enzymes possess a characteristic substrate range with respect to Michael acceptor substrates. This provides support for a new type of ThDP-dependent enzymatic activity, which is abundant in various species and not restricted to prodigiosin biosynthesis in different strains. Moreover, PigD, SeAAS, and HapD are also able to catalyze asymmetric carbon-carbon bond formation reactions of aldehydes and α-keto acids, resulting in 2-hydroxy ketones.

  10. Calorie restriction increases muscle mitochondrial biogenesis in healthy humans.

    Directory of Open Access Journals (Sweden)

    Anthony E Civitarese

    2007-03-01

    Full Text Available Caloric restriction without malnutrition extends life span in a range of organisms including insects and mammals and lowers free radical production by the mitochondria. However, the mechanism responsible for this adaptation are poorly understood.The current study was undertaken to examine muscle mitochondrial bioenergetics in response to caloric restriction alone or in combination with exercise in 36 young (36.8 +/- 1.0 y, overweight (body mass index, 27.8 +/- 0.7 kg/m(2 individuals randomized into one of three groups for a 6-mo intervention: Control, 100% of energy requirements; CR, 25% caloric restriction; and CREX, caloric restriction with exercise (CREX, 12.5% CR + 12.5% increased energy expenditure (EE. In the controls, 24-h EE was unchanged, but in CR and CREX it was significantly reduced from baseline even after adjustment for the loss of metabolic mass (CR, -135 +/- 42 kcal/d, p = 0.002 and CREX, -117 +/- 52 kcal/d, p = 0.008. Participants in the CR and CREX groups had increased expression of genes encoding proteins involved in mitochondrial function such as PPARGC1A, TFAM, eNOS, SIRT1, and PARL (all, p < 0.05. In parallel, mitochondrial DNA content increased by 35% +/- 5% in the CR group (p = 0.005 and 21% +/- 4% in the CREX group (p < 0.004, with no change in the control group (2% +/- 2%. However, the activity of key mitochondrial enzymes of the TCA (tricarboxylic acid cycle (citrate synthase, beta-oxidation (beta-hydroxyacyl-CoA dehydrogenase, and electron transport chain (cytochrome C oxidase II was unchanged. DNA damage was reduced from baseline in the CR (-0.56 +/- 0.11 arbitrary units, p = 0.003 and CREX (-0.45 +/- 0.12 arbitrary units, p = 0.011, but not in the controls. In primary cultures of human myotubes, a nitric oxide donor (mimicking eNOS signaling induced mitochondrial biogenesis but failed to induce SIRT1 protein expression, suggesting that additional factors may regulate SIRT1 content during CR.The observed increase in

  11. Comparison of canine parvovirus with mink enteritis virus by restriction site mapping.

    OpenAIRE

    McMaster, G K; Tratschin, J D; Siegl, G

    1981-01-01

    The genomes of canine parvovirus and mink enteritis virus were compared by restriction enzyme analysis of their replicative-form DNAs. Of 79 mapped sites, 68, or 86%, were found to be common for both types of DNA, indicating that canine parvovirus and mink enteritis virus are closely related viruses. Whether they evolved from a common precursor or whether canine parvovirus is derived from mink enteritis virus, however, cannot be deduced from our present data.

  12. Nonclassical Kinetics of Clonal yet Heterogeneous Enzymes.

    Science.gov (United States)

    Park, Seong Jun; Song, Sanggeun; Jeong, In-Chun; Koh, Hye Ran; Kim, Ji-Hyun; Sung, Jaeyoung

    2017-07-06

    Enzyme-to-enzyme variation in the catalytic rate is ubiquitous among single enzymes created from the same genetic information, which persists over the lifetimes of living cells. Despite advances in single-enzyme technologies, the lack of an enzyme reaction model accounting for the heterogeneous activity of single enzymes has hindered a quantitative understanding of the nonclassical stochastic outcome of single enzyme systems. Here we present a new statistical kinetics and exactly solvable models for clonal yet heterogeneous enzymes with possibly nonergodic state dynamics and state-dependent reactivity, which enable a quantitative understanding of modern single-enzyme experimental results for the mean and fluctuation in the number of product molecules created by single enzymes. We also propose a new experimental measure of the heterogeneity and nonergodicity for a system of enzymes.

  13. Enzyme-guided DNA Sewing Architecture

    Science.gov (United States)

    Song, In Hyun; Shin, Seung Won; Park, Kyung Soo; Lansac, Yves; Jang, Yun Hee; Um, Soong Ho

    2015-12-01

    With the advent of nanotechnology, a variety of nanoarchitectures with varied physicochemical properties have been designed. Owing to the unique characteristics, DNAs have been used as a functional building block for novel nanoarchitecture. In particular, a self-assembly of long DNA molecules via a piece DNA staple has been utilized to attain such constructs. However, it needs many talented prerequisites (e.g., complicated computer program) with fewer yields of products. In addition, it has many limitations to overcome: for instance, (i) thermal instability under moderate environments and (ii) restraint in size caused by the restricted length of scaffold strands. Alternatively, the enzymatic sewing linkage of short DNA blocks is simply designed into long DNA assemblies but it is more error-prone due to the undeveloped sequence data. Here, we present, for the first time, a comprehensive study for directly combining DNA structures into higher DNA sewing constructs through the 5‧-end cohesive ligation of T4 enzyme. Inspired by these achievements, the synthesized DNA nanomaterials were also utilized for effective detection and real-time diagnosis of cancer-specific and cytosolic RNA markers. This generalized protocol for generic DNA sewing is expected to be useful in several DNA nanotechnology as well as any nucleic acid-related fields.

  14. Enzymes in CO2 Capture

    DEFF Research Database (Denmark)

    Fosbøl, Philip Loldrup; Gladis, Arne; Thomsen, Kaj

    The enzyme Carbonic Anhydrase (CA) can accelerate the absorption rate of CO2 into aqueous solutions by several-fold. It exist in almost all living organisms and catalyses different important processes like CO2 transport, respiration and the acid-base balances. A new technology in the field...... of carbon capture is the application of enzymes for acceleration of typically slow ternary amines or inorganic carbonates. There is a hidden potential to revive currently infeasible amines which have an interesting low energy consumption for regeneration but too slow kinetics for viable CO2 capture. The aim...... of this work is to discuss the measurements of kinetic properties for CA promoted CO2 capture solvent systems. The development of a rate-based model for enzymes will be discussed showing the principles of implementation and the results on using a well-known ternary amine for CO2 capture. Conclusions...

  15. Electric Fields and Enzyme Catalysis.

    Science.gov (United States)

    Fried, Stephen D; Boxer, Steven G

    2017-06-20

    What happens inside an enzyme's active site to allow slow and difficult chemical reactions to occur so rapidly? This question has occupied biochemists' attention for a long time. Computer models of increasing sophistication have predicted an important role for electrostatic interactions in enzymatic reactions, yet this hypothesis has proved vexingly difficult to test experimentally. Recent experiments utilizing the vibrational Stark effect make it possible to measure the electric field a substrate molecule experiences when bound inside its enzyme's active site. These experiments have provided compelling evidence supporting a major electrostatic contribution to enzymatic catalysis. Here, we review these results and develop a simple model for electrostatic catalysis that enables us to incorporate disparate concepts introduced by many investigators to describe how enzymes work into a more unified framework stressing the importance of electric fields at the active site.

  16. Enzyme-Based Listericidal Nanocomposites

    Science.gov (United States)

    Solanki, Kusum; Grover, Navdeep; Downs, Patrick; Paskaleva, Elena E.; Mehta, Krunal K.; Lee, Lillian; Schadler, Linda S.; Kane, Ravi S.; Dordick, Jonathan S.

    2013-01-01

    Cell lytic enzymes represent an alternative to chemical decontamination or use of antibiotics to kill pathogenic bacteria, such as listeria. A number of phage cell lytic enzymes against listeria have been isolated and possess listericidal activity; however, there has been no attempt to incorporate these enzymes onto surfaces. We report three facile routes for the surface incorporation of the listeria bacteriophage endolysin Ply500: covalent attachment onto FDA approved silica nanoparticles (SNPs), incorporation of SNP-Ply500 conjugates into a thin poly(hydroxyethyl methacrylate) film; and affinity binding to edible crosslinked starch nanoparticles via construction of a maltose binding protein fusion. These Ply500 formulations were effective in killing L. innocua (a reduced pathogenic surrogate) at challenges up to 105 CFU/ml both in non-growth sustaining PBS as well as under growth conditions on lettuce. This strategy represents a new route toward achieving highly selective and efficient pathogen decontamination and prevention in public infrastructure. PMID:23545700

  17. Fragmentation of bacteriophage S13 replicative from DNA by restriction endonucleases from Hemophilus influenzae and Hemophilus aegyptius.

    NARCIS (Netherlands)

    F.G. Grosveld (Frank); K.M. Ojamaa; J.H. Spencer

    1976-01-01

    textabstractThe restriction enzymes Hind from Hemophilus influenzae and HaeIII from Hemophilus aegyptius cleave bacteriophage S13 replicative form (RF) DNA into 13 and 10 specific fragments, respectively. The sizes of these fragments were estimated by gel electrophoresis, electron microscopy, and

  18. Peculiarities of Crystallization of the Restriction Endonuclease EcoRII

    Science.gov (United States)

    Karpove, Elizaveta; Pusey, M.arc L.

    1998-01-01

    Nucleases interfere with most standard molecular biology procedures. We have purified and crystallized the restriction endonuclease EcoRII, which belongs to the type II of restriction- modification enzyme, to study the protein crystallization process using a "non standard" macromolecule. A procedure for the purification of EcoRII was developed and 99% pure protein as determined by SDS PAGE electrophoresis obtained. Light scattering experiments were performed to assist in screening protein suitable crystallization conditions. The second virial coefficient was determined as a function of precipitating salt concentration, using sodium chloride, ammonium sulfate, and sodium sulfate. Small (maximum size approximately 0.2 mm) well shaped crystals have been obtained. Larger poorly formed crystals (ca 0.5 mm) have also been obtained, but we have been unable to mount them for diff-raction analysis due to their extreme fragility. Crystallization experiments with PEG have shown that using this precipitant, the best crystals are obtained from slightly over-saturated solutions. Use of higher precipitant concentration leads to dendritic crystal formation. EcoRII is difficult to solubilize and meticulous attention must be paid to the presence of reducing agents.

  19. Methylation-dependent DNA restriction in Bacillus anthracis.

    Science.gov (United States)

    Sitaraman, Ramakrishnan; Leppla, Stephen H

    2012-02-15

    Bacillus anthracis, the causative agent of anthrax, is poorly transformed with DNA that is methylated on adenine or cytosine. Here we characterize three genetic loci encoding type IV methylation-dependent restriction enzymes that target DNA containing C5-methylcytosine (m5C). Strains in which these genes were inactivated, either singly or collectively, showed increased transformation by methylated DNA. Additionally, a triple mutant with an ~30-kb genomic deletion could be transformed by DNA obtained from Dam(+)Dcm(+)E. coli, although at a low frequency of ~10(-3) transformants/10(6)cfu. This strain of B. anthracis can potentially serve as a preferred host for shuttle vectors that express recombinant proteins, including proteins to be used in vaccines. The gene(s) responsible for the restriction of m6A-containing DNA in B. anthracis remain unidentified, and we suggest that poor transformation by such DNA could in part be a consequence of the inefficient replication of hemimethylated DNA in B. anthracis. Published by Elsevier B.V.

  20. Natural C-independent expression of restriction endonuclease in a C protein-associated restriction-modification system.

    Science.gov (United States)

    Rezulak, Monika; Borsuk, Izabela; Mruk, Iwona

    2016-04-07

    Restriction-modification (R-M) systems are highly prevalent among bacteria and archaea, and appear to play crucial roles in modulating horizontal gene transfer and protection against phage. There is much to learn about these diverse enzymes systems, especially their regulation. Type II R-M systems specify two independent enzymes: a restriction endonuclease (REase) and protective DNA methyltransferase (MTase). Their activities need to be finely balanced in vivo Some R-M systems rely on specialized transcription factors called C (controller) proteins. These proteins play a vital role in the temporal regulation of R-M gene expression, and function to indirectly modulate the horizontal transfer of their genes across the species. We report novel regulation of a C-responsive R-M system that involves a C protein of a poorly-studied structural class - C.Csp231I. Here, the C and REase genes share a bicistronic transcript, and some of the transcriptional auto-control features seen in other C-regulated R-M systems are conserved. However, separate tandem promoters drive most transcription of the REase gene, a distinctive property not seen in other tested C-linked R-M systems. Further, C protein only partially controls REase expression, yet plays a role in system stability and propagation. Consequently, high REase activity was observed after deletion of the entire C gene, and cells bearing the ΔC R-M system were outcompeted in mixed culture assays by those with the WT R-M system. Overall, our data reveal unexpected regulatory variation among R-M systems. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.

  1. Structure-guided sequence specificity engineering of the modification-dependent restriction endonuclease LpnPI.

    Science.gov (United States)

    Sasnauskas, Giedrius; Zagorskaitė, Evelina; Kauneckaitė, Kotryna; Tamulaitiene, Giedre; Siksnys, Virginijus

    2015-07-13

    The eukaryotic Set and Ring Associated (SRA) domains and structurally similar DNA recognition domains of prokaryotic cytosine modification-dependent restriction endonucleases recognize methylated, hydroxymethylated or glucosylated cytosine in various sequence contexts. Here, we report the apo-structure of the N-terminal SRA-like domain of the cytosine modification-dependent restriction enzyme LpnPI that recognizes modified cytosine in the 5'-C(mC)DG-3' target sequence (where mC is 5-methylcytosine or 5-hydroxymethylcytosine and D = A/T/G). Structure-guided mutational analysis revealed LpnPI residues involved in base-specific interactions and demonstrated binding site plasticity that allowed limited target sequence degeneracy. Furthermore, modular exchange of the LpnPI specificity loops by structural equivalents of related enzymes AspBHI and SgrTI altered sequence specificity of LpnPI. Taken together, our results pave the way for specificity engineering of the cytosine modification-dependent restriction enzymes. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.

  2. Enzyme and biochemical producing fungi

    DEFF Research Database (Denmark)

    Lübeck, Peter Stephensen; Lübeck, Mette; Nilsson, Lena

    2010-01-01

    We are developing a biorefinery concept for biological production of chemicals, drugs, feed and fuels using plant biomass as raw material in well-defined cell-factories. Among the important goals is the discovery of new biocatalysts for production of enzymes, biochemicals and fuels and already our...... screening of a large collection of fungal strains isolated from natural habitats have resulted in identification of strains with high production of hydrolytic enzymes and excretion of organic acids. Our research focuses on creating a fungal platform based on synthetic biology for developing new cell...

  3. Urban water restrictions: Attitudes and avoidance

    Science.gov (United States)

    Cooper, Bethany; Burton, Michael; Crase, Lin

    2011-12-01

    In most urban cities across Australia, water restrictions remain the dominant policy mechanism to restrict urban water consumption. The extensive adoption of water restrictions as a means to limit demand, over several years, means that Australian urban water prices have consistently not reflected the opportunity cost of water. Given the generally strong political support for water restrictions and the likelihood that they will persist for some time, there is value in understanding households' attitudes in this context. More specifically, identifying the welfare gains associated with avoiding urban water restrictions entirely would be a nontrivial contribution to our knowledge and offer insights into the benefits of alternative policy responses. This paper describes the results from a contingent valuation study that investigates consumers' willingness to pay to avoid urban water restrictions. Importantly, the research also investigates the influence of cognitive and exogenous dimensions on the utility gain associated with avoiding water restrictions. The results provide insights into the impact of the current policy mechanism on economic welfare.

  4. Effect of postnatal nutrition restriction on the oxidative status of neonates with intrauterine growth restriction in a pig model.

    Science.gov (United States)

    Che, Lianqiang; Xuan, Yue; Hu, Liang; Liu, Yan; Xu, Qin; Fang, Zhengfeng; Lin, Yan; Xu, Shengyu; Wu, De; Zhang, Keying; Chen, Daiwen

    2015-01-01

    In offspring with intrauterine growth restriction (IUGR), where oxidative stress may play an important role in inducing metabolic syndrome, nutrition restriction has been shown to improve oxidative status. In this study, we aimed to investigate the effect of postnatal nutrition restriction on the oxidative status of IUGR neonates. A total of twelve pairs of piglets, of normal birth-weight (NBW) and with IUGR (7 days old), respectively, were randomly allocated to have adequate nutritional intake (ANI) and restricted nutritional intake (RNI) for a period of 21 days, respectively. This design produced 4 experimental groups: NBW-ANI, IUGR-ANI, NBW-RNI and IUGR-RNI (n = 6 per group). Serum, ileum and liver samples were analyzed for antioxidant parameters and the mRNA expression of genes with regard to oxidative status. The data were subjected to general linear model analysis and Duncan's test with a 5% significance level. Irrespective of nutritional intake, the IUGR pigs had markedly lower activity of glutathione peroxidase (GPX), gene expressions of liver mitochondrial manganese superoxide dismutase (Mn-SOD) and ileum cytoplasmic copper/zinc (CuZn)-SOD and, accordingly, there was a markedly higher malondialdehyde concentration in the liver of these pigs compared to in the NBW pigs. Irrespective of body weight, pigs receiving ANI treatment had significantly lower activities of antioxidant enzymes in the serum (total antioxidative capability, CuZn-SOD and GPX) and liver (total SOD and glutathione reductase) and decreased gene expression of liver CuZn-SOD and Mn-SOD compared to the pigs receiving RNI. In addition, the IUGR pigs had a markedly lower concentration of liver reduced glutathione (GSH), ratio of GSH to oxidized glutathione, gene expression of ileum CuZn-SOD and extracellular SOD than the NBW pigs when receiving ANI, but not all of these differences were observed in those receiving RNI. IUGR neonates may have poor antioxidant defense systems, and postnatal

  5. Modified Terminal Restriction Fragment Analysis for Quantifying Telomere Length Using In-gel Hybridization.

    Science.gov (United States)

    Jenkins, Frank J; Kerr, Charles M; Fouquerel, Elise; Bovbjerg, Dana H; Opresko, Patricia L

    2017-07-10

    There are several different techniques for measuring telomere length, each with their own advantages and disadvantages. The traditional approach, Telomere Restriction Fragment (TRF) analysis, utilizes a DNA hybridization technique whereby genomic DNA samples are digested with restriction enzymes, leaving behind telomere DNA repeats and some sub-telomeric DNA. These are separated by agarose gel electrophoresis, transferred to a filter membrane and hybridized to oligonucleotide probes tagged with either chemiluminescence or radioactivity to visualize telomere restriction fragments. This approach, while requiring a larger quantity of DNA than other techniques such as PCR, can measure the telomere length distribution of a population of cells and allows measurement expressed in absolute kilobases. This manuscript demonstrates a modified DNA hybridization procedure for determining telomere length. Genomic DNA is first digested with restriction enzymes (that do not cut telomeres) and separated by agarose gel electrophoresis. The gel is then dried and the DNA is denatured and hybridized in situ to a radiolabeled oligonucleotide probe. This in situ hybridization avoids loss of telomere DNA and improves signal intensity. Following hybridization, the gels are imaged utilizing phosphor screens and the telomere length is quantified using a graphing program. This procedure was developed by the laboratories of Drs. Woodring Wright and Jerry Shay at the University of Texas Southwestern 1 , 2 . Here, we present a detailed description of this procedure, with some modifications.

  6. Assaying multiple restriction endonucleases functionalities and inhibitions on DNA microarray with multifunctional gold nanoparticle probes.

    Science.gov (United States)

    Ma, Lan; Zhu, Zhijun; Li, Tao; Wang, Zhenxin

    2014-02-15

    Herein, a double-stranded (ds) DNA microarray-based resonance light scattering (RLS) assay with multifunctional gold nanoparticle (GNP) probes has been developed for studying restriction endonuclease functionality and inhibition. Because of decreasing significantly melting temperature, the enzyme-cleaved dsDNAs easily unwind to form single-stranded (ss) DNAs. The ssDNAs are hybridized with multiplex complementary ssDNAs functionalized GNP probes followed by silver enhancement and RLS detection. Three restriction endonucleases (EcoRI, BamHI and EcoRV) and three potential inhibitors (doxorubicin hydrochloride (DOX), ethidium bromide (EB) and an EcoRI-derived helical peptide (α4)) were selected to demonstrate capability of the assay. Enzyme activities of restriction endonucleases are detected simultaneously with high specificity down to the limits of 2.0 × 10(-2)U/mL for EcoRI, 1.1 × 10(-2)U/mL for BamHI and 1.6 × 10(-2)U/mL for EcoRV, respectively. More importantly, the inhibitory potencies of three inhibitors are showed quantitatively, indicating that our approach has great promise for high-throughput screening of restriction endonuclease inhibitors. © 2013 Elsevier B.V. All rights reserved.

  7. Creation of a type IIS restriction endonuclease with a long recognition sequence.

    Science.gov (United States)

    Lippow, Shaun M; Aha, Patti M; Parker, Matthew H; Blake, William J; Baynes, Brian M; Lipovsek, Dasa

    2009-05-01

    Type IIS restriction endonucleases cleave DNA outside their recognition sequences, and are therefore particularly useful in the assembly of DNA from smaller fragments. A limitation of type IIS restriction endonucleases in assembly of long DNA sequences is the relative abundance of their target sites. To facilitate ligation-based assembly of extremely long pieces of DNA, we have engineered a new type IIS restriction endonuclease that combines the specificity of the homing endonuclease I-SceI with the type IIS cleavage pattern of FokI. We linked a non-cleaving mutant of I-SceI, which conveys to the chimeric enzyme its specificity for an 18-bp DNA sequence, to the catalytic domain of FokI, which cuts DNA at a defined site outside the target site. Whereas previously described chimeric endonucleases do not produce type IIS-like precise DNA overhangs suitable for ligation, our chimeric endonuclease cleaves double-stranded DNA exactly 2 and 6 nt from the target site to generate homogeneous, 5', four-base overhangs, which can be ligated with 90% fidelity. We anticipate that these enzymes will be particularly useful in manipulation of DNA fragments larger than a thousand bases, which are very likely to contain target sites for all natural type IIS restriction endonucleases.

  8. Decoding restricted participation in sequential electricity markets

    Energy Technology Data Exchange (ETDEWEB)

    Knaut, Andreas; Paschmann, Martin

    2017-06-15

    Restricted participation in sequential markets may cause high price volatility and welfare losses. In this paper we therefore analyze the drivers of restricted participation in the German intraday auction which is a short-term electricity market with quarter-hourly products. Applying a fundamental electricity market model with 15-minute temporal resolution, we identify the lack of sub-hourly market coupling being the most relevant driver of restricted participation. We derive a proxy for price volatility and find that full market coupling may trigger quarter-hourly price volatility to decrease by a factor close to four.

  9. The third restriction-modification system from Thermus aquaticus YT-1: solving the riddle of two TaqII specificities.

    Science.gov (United States)

    Skowron, Piotr M; Anton, Brian P; Czajkowska, Edyta; Zebrowska, Joanna; Sulecka, Ewa; Krefft, Daria; Jezewska-Frackowiak, Joanna; Zolnierkiewicz, Olga; Witkowska, Malgorzata; Morgan, Richard D; Wilson, Geoffrey G; Fomenkov, Alexey; Roberts, Richard J; Zylicz-Stachula, Agnieszka

    2017-09-06

    Two restriction-modification systems have been previously discovered in Thermus aquaticus YT-1. TaqI is a 263-amino acid (aa) Type IIP restriction enzyme that recognizes and cleaves within the symmetric sequence 5'-TCGA-3'. TaqII, in contrast, is a 1105-aa Type IIC restriction-and-modification enzyme, one of a family of Thermus homologs. TaqII was originally reported to recognize two different asymmetric sequences: 5'-GACCGA-3' and 5'-CACCCA-3'. We previously cloned the taqIIRM gene, purified the recombinant protein from Escherichia coli, and showed that TaqII recognizes the 5'-GACCGA-3' sequence only. Here, we report the discovery, isolation, and characterization of TaqIII, the third R-M system from T. aquaticus YT-1. TaqIII is a 1101-aa Type IIC/IIL enzyme and recognizes the 5'-CACCCA-3' sequence previously attributed to TaqII. The cleavage site is 11/9 nucleotides downstream of the A residue. The enzyme exhibits striking biochemical similarity to TaqII. The 93% identity between their aa sequences suggests that they have a common evolutionary origin. The genes are located on two separate plasmids, and are probably paralogs or pseudoparalogs. Putative positions and aa that specify DNA recognition were identified and recognition motifs for 6 uncharacterized Thermus-family enzymes were predicted. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.

  10. Keragaman Genotip dan Jarak Genetik Sapi Madura Berdasarkan Restriction Fragment Length Polymorphism-DNA (RFLP-DNA

    Directory of Open Access Journals (Sweden)

    Marleny Leasa

    2013-02-01

    Full Text Available Penelitian ini bertujuan untuk mengetahui variasi genotip dan jarak genetik sapi Madura di Kabupaten Sampang dan Balai Besar Inseminasi Buatan (BBIB Singosari berdasarkan teknik RFLP. Digesti DNA genom dengan enzim EcoRI dan PstI menghasilkan fragmen DNA dengan ukuran yang bervariasi baik pada induk, pedet, dan pejantan unggul dengan kisaran antara 10000 bp sampai 980 bp dan 10000 bp sampai 1250 bp. Analisis MVSP1 dengan metode UPGMA untuk jarak genetik ditemukan bahwa sampel sapi Madura berada dalam 2 cluster dan 1 outgroup. Persentase jarak genetik berada pada rentangan 0 sampai 25%.   (Kata kunci: Variasi genotip, Jarak genetik, Sapi Madura, RFLP

  11. Species determination within Staphylococcus genus by extended PCR-restriction fragment length polymorphism of saoC gene.

    Science.gov (United States)

    Bukowski, Michal; Polakowska, Klaudia; Ilczyszyn, Weronika M; Sitarska, Agnieszka; Nytko, Kinga; Kosecka, Maja; Miedzobrodzki, Jacek; Dubin, Adam; Wladyka, Benedykt

    2015-01-01

    Genetic methods based on PCR-restriction fragment length polymorphism (RFLP) are widely used for microbial species determination. In this study, we present the application of saoC gene as an effective tool for species determination and within-species diversity analysis for Staphylococcus genus. The unique sequence diversity of saoC allows us to apply four restriction enzymes to obtain RFLP patterns, which appear highly distinctive even among closely related species as well as atypical isolates of environmental origin. Such patterns were successfully obtained for 26 species belonging to Staphylococcus genus. What is more, tracing polymorphisms detected by different restriction enzymes allowed for basic phylogeny analysis for Staphylococcus aureus, which is potentially applicable for other staphylococcal species. © FEMS 2014. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

  12. Organoclay-enzyme film electrodes.

    Science.gov (United States)

    Mbouguen, Justin Kemmegne; Ngameni, Emmanuel; Walcarius, Alain

    2006-09-25

    This paper aims at showing the interest of organoclays (clay minerals containing organic groups covalently attached to the inorganic particles) as suitable host matrices likely to immobilize enzymes onto electrode surfaces for biosensing applications. The organoclays used in this work were natural Cameroonian smectites grafted with either aminopropyl (AP) or trimethylpropylammonium (TMPA) groups. The first ones were exploited for their ability to anchor biomolecules by covalent bonding while the second category exhibited favorable electrostatic interactions with negatively charged enzymes due to ion exchange properties that were pointed out here by means of multisweep cyclic voltammetry. AP-clay materials were applied to the immobilization of glucose oxidase (GOD) and TMPA-clays for polyphenol oxidase (PPO) anchoring. When deposited onto the surface of platinum or glassy carbon electrodes as enzyme/organoclay films, these systems were evaluated as biosensing electrochemical devices for detection of glucose and catechol chosen as model analytes. The advantageous features of these organoclays were discussed by comparison to the performance of related film electrodes made of non-functionalized clays. It appeared that organoclays provide a favorable environment to enzymes activity, as highlighted from the biosensors characteristics and determination of Michaelis-Menten constants.

  13. Cellulase enzyme and biomass utilization

    African Journals Online (AJOL)

    In recent years, fundamental and applied researches on cellulase enzyme have not only generated significant scientific knowledge but also have revealed their enormous potential in biotechnology. Growing attention has been devoted to its bioconversion of biomass into fuel ethanol, considered the cleanest liquid fuel ...

  14. Udfordringer ved undervisning i enzymer

    DEFF Research Database (Denmark)

    Skriver, Karen; Dandanell, Gert; von Stemann, Jakob Hjorth

    2015-01-01

    Enzymer er et centralt emne i biokemiundervisning. Det forudsætter og anvender grundlæggende viden inden for og kompetencer i kemi og matematik. Artiklen undersøger hvilke forståelsesvanskeligheder og udfordringer der er knyttet til dette område, såvel som virtuelle øvelsers potentiale i denne ko...

  15. Immobilized Enzymes for Automated Analyses.

    Science.gov (United States)

    1979-12-01

    more sensitive than either UV absorption at 2780 R or the biuret method . We evaluated the effect of complete protein denaturation on absorbance by... Methods were developed for analyzing enzyme immobilization pro- cesses applicable to carrier materials suitable for automated cliical chemistry...carrier. The methods were applied to study of immobilization of glycerol dehydrogenase (GD). Three distinct types of immobilization pro- cesses were

  16. Enzymes with activity toward Xyloglucan

    NARCIS (Netherlands)

    Vincken, J.P.

    2003-01-01

    Xyloglucans are plant cell wall polysaccharides, which belong to the hemicellulose class. Here the structural variations of xyloglucans will be reviewed. Subsequently, the anchoring of xyloglucan in the plant cell wall will be discussed. Enzymes involved in degradation or modification of xyloglucan

  17. Enzyme recovery using reversed micelles

    NARCIS (Netherlands)

    Dekker, M.

    1990-01-01

    The objective of this study was to develop a liquid-liquid extraction process for the recovery of extracellular enzymes. The potentials of reaching this goal by using reversed micelles in an organic solvent have been investigated.

    Reversed micelles are aggregates of surfactant

  18. Phage lytic enzymes targeting streptococci

    Science.gov (United States)

    Streptococcal pathogens contribute to a wide variety of human and livestock diseases. There is a need for new antimicrobials to replace over-used conventional antibiotics. Bacteriophage (viruses that infect bacteria) endolysins (enzymes that help degrade the bacterial cell wall) are ideal candidat...

  19. Kathepsine C : Een allosterisch enzyme

    NARCIS (Netherlands)

    Gorter, Jeannette

    1969-01-01

    In chapter I an introduction into allosteric systems is given. In chapter II is a detailed method is described for the applica of Gly-Phe--p. nitroanilide (GPNA) as a substrate for the activity assay of the lysosomal enzyme cathepsin C. It is an allosteric which is activated by Cl-, Br-, 1-, CNS-,

  20. The enzymes associated with denitrification

    Science.gov (United States)

    Hochstein, L. I.; Tomlinson, G. A.

    1988-01-01

    The enzymes involved in the reduction of nitrogenous oxides are thought to be intermediates in denitrification processes. This review examines the roles of nitrate reductase, nitrite reductases, nitric oxide reductase, mechanisms of N-N bond formation, and nitrous oxide reductases.

  1. Analysis of the Campylobacter jejuni genome by SMRT DNA sequencing identifies restriction-modification motifs.

    Directory of Open Access Journals (Sweden)

    Jason L O'Loughlin

    Full Text Available Campylobacter jejuni is a leading bacterial cause of human gastroenteritis. The goal of this study was to analyze the C. jejuni F38011 strain, recovered from an individual with severe enteritis, at a genomic and proteomic level to gain insight into microbial processes. The C. jejuni F38011 genome is comprised of 1,691,939 bp, with a mol.% (G+C content of 30.5%. PacBio sequencing coupled with REBASE analysis was used to predict C. jejuni F38011 genomic sites and enzymes that may be involved in DNA restriction-modification. A total of five putative methylation motifs were identified as well as the C. jejuni enzymes that could be responsible for the modifications. Peptides corresponding to the deduced amino acid sequence of the C. jejuni enzymes were identified using proteomics. This work sets the stage for studies to dissect the precise functions of the C. jejuni putative restriction-modification enzymes. Taken together, the data generated in this study contributes to our knowledge of the genomic content, methylation profile, and encoding capacity of C. jejuni.

  2. Crystallographic and bioinformatic studies on restriction endonucleases: inference of evolutionary relationships in the "midnight zone" of homology.

    Science.gov (United States)

    Bujnicki, Janusz M

    2003-10-01

    Type II restriction endonucleases (ENases) cleave DNA with remarkable sequence specificity. Their discovery in 1970 and studies on molecular genetics and biochemistry carried out over the past four decades laid foundations for recombinant DNA techniques. Today, restriction enzymes are indispensable tools in molecular biology and molecular medicine and a paradigm for proteins that specifically interact with DNA as well as a challenging target for protein engineering. The sequence-structure-function relationships for these proteins are therefore of central interest in biotechnology. However, among numerous ENase sequences, only a few exhibit statistically significant similarity in pairwise comparisons, which was initially interpreted as evidence for the lack of common origin. Nevertheless, X-ray crystallographic studies of seemingly dissimilar type II ENases demonstrated that they share a common structural core and metal-binding/catalytic site, arguing for extreme divergence rather than independent evolution. A similar nuclease domain has been also identified in various enzymes implicated in DNA repair and recombination. Ironically, following the series of crystallographic studies suggesting homology of all type II ENases, bioinformatic studies provided evidence that some restriction enzymes are in fact diverged members of unrelated nuclease superfamilies: Nuc, HNH and GIY-YIG. Hence, the restriction enzymes as a whole, represent a group of functionally similar proteins, which evolved on multiple occasions and subsequently diverged into the "midnight zone" of homology, where common origins within particular groups can be inferred only from structure-guided comparisons. The structure-guided approaches used for this purpose include: identification of functionally important residues using superposition of atomic coordinates, alignment of sequence profiles enhanced by secondary structures, fold recognition, and homology modeling. This review covers recent results of

  3. Simple and sensitive fluorescence assay of restriction endonuclease on graphene oxide

    Energy Technology Data Exchange (ETDEWEB)

    Gang, Jong Back [Dept. of Nano Chemistry, Gachon University, Incheon (Korea, Republic of)

    2015-09-15

    Restriction endonucleases hydrolyze internal phosphodiester bonds at specific sites in a DNA sequence. These enzymes are essential in a variety of fields, such as biotechnology and clinical diagnostics. It is of great importance and necessity for the scientific and biomedical use of enzymes to measure endonuclease activity. In this study, graphene oxide (GO) has been used as a platform to measure enzyme activity with high sensitivity. To increase the detection sensitivity of Hinf I, the endonuclease-digested reaction was treated with exonuclease III (Exo III) and a fluorescence assay was conducted to measure the emission. Results showed that Exo III treatment enhanced 2.7-fold signal-to-background ratio for the detection of Hinf I compared with that done without Exo III in the presence of GO.

  4. Does quantum entanglement in DNA synchronize the catalytic centers of type II restriction endonucleases?

    CERN Document Server

    Kurian, P; Lindesay, J

    2014-01-01

    Several living systems have been examined for their apparent optimization of structure and function for quantum behavior at biological length scales. Orthodox type II endonucleases, the largest class of restriction enzymes, recognize four-to-eight base pair sequences of palindromic DNA, cut both strands symmetrically, and act without an external metabolite such as ATP. While it is known that these enzymes induce strand breaks by attacking phosphodiester bonds, what remains unclear is the mechanism by which cutting occurs in concert at the catalytic centers. Previous studies indicate the primacy of intimate DNA contacts made by the specifically bound enzyme in coordinating the two synchronized cuts. We propose that collective electronic behavior in the DNA helix generates coherent oscillations, quantized through boundary conditions imposed by the endonuclease, that provide the energy required to break two phosphodiester bonds. Such quanta may be preserved in the presence of thermal noise and electromagnetic in...

  5. Thermodynamics of Enzyme-Catalyzed Reactions Database

    Science.gov (United States)

    SRD 74 Thermodynamics of Enzyme-Catalyzed Reactions Database (Web, free access)   The Thermodynamics of Enzyme-Catalyzed Reactions Database contains thermodynamic data on enzyme-catalyzed reactions that have been recently published in the Journal of Physical and Chemical Reference Data (JPCRD). For each reaction the following information is provided: the reference for the data, the reaction studied, the name of the enzyme used and its Enzyme Commission number, the method of measurement, the data and an evaluation thereof.

  6. EGFR Activation by Spatially Restricted Ligands

    National Research Council Canada - National Science Library

    Goodrich, Jennifer S

    2005-01-01

    ...) activity has been associated with an increased prognosis of breast cancer. During oogenesis in Drosophila melanogaster, local EGFR activation by the spatially restricted TGF alpha-like ligand, Gurken (Grk...

  7. Epigenetic regulation of caloric restriction in aging

    National Research Council Canada - National Science Library

    Li, Yuanyuan; Daniel, Michael; Tollefsbol, Trygve O

    2011-01-01

    .... The aging process is frequently affected by environmental factors, and caloric restriction is by far the most effective and established environmental manipulation for extending lifespan in various animal models...

  8. Health Benefits of Fasting and Caloric Restriction.

    Science.gov (United States)

    Golbidi, Saeid; Daiber, Andreas; Korac, Bato; Li, Huige; Essop, M Faadiel; Laher, Ismail

    2017-10-23

    Obesity and obesity-related diseases, largely resulting from urbanization and behavioral changes, are now of global importance. Energy restriction, though, is associated with health improvements and increased longevity. We review some important mechanisms related to calorie limitation aimed at controlling of metabolic diseases, particularly diabetes. Calorie restriction triggers a complex series of intricate events, including activation of cellular stress response elements, improved autophagy, modification of apoptosis, and alteration in hormonal balance. Intermittent fasting is not only more acceptable to patients, but it also prevents some of the adverse effects of chronic calorie restriction, especially malnutrition. There are many somatic and potentially psychologic benefits of fasting or intermittent calorie restriction. However, some behavioral modifications related to abstinence of binge eating following a fasting period are crucial in maintaining the desired favorable outcomes.

  9. Restricting query relaxation through user constraints

    Energy Technology Data Exchange (ETDEWEB)

    Gaasterland, T.

    1993-07-01

    This paper describes techniques to restrict and to heuristically control relaxation of deductive database queries. The process of query relaxation provides a user with a means to automatically identify new queries that are related to the user`s original query. However, for large databases, many relaxations may be possible. The methods to control and restrict the relaxation process introduced in this paper focus the relaxation process and make it more efficient. User restrictions over the data base domain may be expressed as user constraints. This paper describes how user constraints can restrict relaxed queries. Also, a set of heuristics based on cooperative answering techniques are presented for controlling the relaxation process. Finally, the interaction of the methods for relaxing queries, processing user constraints, and applying the heuristic rules is described.

  10. Restricted Coherent Risk Measures and Actuarial Solvency

    Directory of Open Access Journals (Sweden)

    Christos E. Kountzakis

    2012-01-01

    Full Text Available We prove a general dual representation form for restricted coherent risk measures, and we apply it to a minimization problem of the required solvency capital for an insurance company.

  11. Compensatory mechanisms activated with intermittent energy restriction

    DEFF Research Database (Denmark)

    Coutinho, Sílvia Ribeiro; Halset, Eline Holli; Gåsbakk, Sigrid

    2017-01-01

    Background & aims: Strong compensatory responses, with reduced resting metabolic rate (RMR), increased exercise efficiency (ExEff) and appetite, are activated when weight loss (WL) is achieved with continuous energy restriction (CER), which try to restore energy balance. Intermittent energy......, respectively). No between group differences were apparent for any of the outcomes. Conclusions: The technique used to achieve energy restriction, whether it is continuous or intermittent, does not appear to modulate the compensatory mechanisms activated by weight loss. Clinical Trial Registration number: NCT...

  12. Advanced Restricted Area Entry Control System (ARAECS)

    OpenAIRE

    Appleton, Robert; Casillas, Jose; Scales, Gregory; Green, Robert; Niehoff, Mellissa; Fitzgerald, David; Ouellette, David

    2014-01-01

    Approved for public release; distribution is unlimited The Navy requires a capability for effective and efficient entry control for restricted areas that house critical assets. This thesis describes an Advanced Restricted Area Entry Control System (ARAECS) to meet this requirement. System requirements were obtained from existing governing documentation as well as stakeholder inputs. A functional architecture was developed and then modeled using the Imagine That Inc. ExtendSim tool. Factors...

  13. Behavioral and Physiological Consequences of Sleep Restriction

    OpenAIRE

    Banks, Siobhan; Dinges, David F.

    2007-01-01

    Adequate sleep is essential for general healthy functioning. This paper reviews recent research on the effects of chronic sleep restriction on neurobehavioral and physiological functioning and discusses implications for health and lifestyle. Restricting sleep below an individual's optimal time in bed (TIB) can cause a range of neurobehavioral deficits, including lapses of attention, slowed working memory, reduced cognitive throughput, depressed mood, and perseveration of thought. Neurobehavio...

  14. Heavy enzymes--experimental and computational insights in enzyme dynamics.

    Science.gov (United States)

    Swiderek, Katarzyna; Ruiz-Pernía, J Javier; Moliner, Vicent; Tuñón, Iñaki

    2014-08-01

    The role of protein motions in the chemical step of enzyme-catalyzed reactions is the subject of an open debate in the scientific literature. The systematic use of isotopically substituted enzymes has been revealed as a useful tool to quantify the role of these motions. According to the Born-Oppenheimer approximation, changing the mass of the protein does not change the forces acting on the system but alters the frequencies of the protein motions, which in turn can affect the rate constant. Experimental and theoretical studies carried out in this field are presented in this article and discussed in the framework of Transition State Theory. Copyright © 2014 Elsevier Ltd. All rights reserved.

  15. Behavioral and physiological consequences of sleep restriction.

    Science.gov (United States)

    Banks, Siobhan; Dinges, David F

    2007-08-15

    Adequate sleep is essential for general healthy functioning. This paper reviews recent research on the effects of chronic sleep restriction on neurobehavioral and physiological functioning and discusses implications for health and lifestyle. Restricting sleep below an individual's optimal time in bed (TIB) can cause a range of neurobehavioral deficits, including lapses of attention, slowed working memory, reduced cognitive throughput, depressed mood, and perseveration of thought. Neurobehavioral deficits accumulate across days of partial sleep loss to levels equivalent to those found after 1 to 3 nights of total sleep loss. Recent experiments reveal that following days of chronic restriction of sleep duration below 7 hours per night, significant daytime cognitive dysfunction accumulates to levels comparable to that found after severe acute total sleep deprivation. Additionally, individual variability in neurobehavioral responses to sleep restriction appears to be stable, suggesting a trait-like (possibly genetic) differential vulnerability or compensatory changes in the neurobiological systems involved in cognition. A causal role for reduced sleep duration in adverse health outcomes remains unclear, but laboratory studies of healthy adults subjected to sleep restriction have found adverse effects on endocrine functions, metabolic and inflammatory responses, suggesting that sleep restriction produces physiological consequences that may be unhealthy.

  16. 7 CFR 58.436 - Rennet, pepsin, other milk clotting enzymes and flavor enzymes.

    Science.gov (United States)

    2010-01-01

    ... 7 Agriculture 3 2010-01-01 2010-01-01 false Rennet, pepsin, other milk clotting enzymes and flavor enzymes. 58.436 Section 58.436 Agriculture Regulations of the Department of Agriculture (Continued... clotting enzymes and flavor enzymes. Enzyme preparations used in the manufacture of cheese shall be safe...

  17. Dietary restriction with and without caloric restriction for healthy aging [version 1; referees: 3 approved

    Directory of Open Access Journals (Sweden)

    Changhan Lee

    2016-01-01

    Full Text Available Caloric restriction is the most effective and reproducible dietary intervention known to regulate aging and increase the healthy lifespan in various model organisms, ranging from the unicellular yeast to worms, flies, rodents, and primates. However, caloric restriction, which in most cases entails a 20–40% reduction of food consumption relative to normal intake, is a severe intervention that results in both beneficial and detrimental effects. Specific types of chronic, intermittent, or periodic dietary restrictions without chronic caloric restriction have instead the potential to provide a significant healthspan increase while minimizing adverse effects. Improved periodic or targeted dietary restriction regimens that uncouple the challenge of food deprivation from the beneficial effects will allow a safe intervention feasible for a major portion of the population. Here we focus on healthspan interventions that are not chronic or do not require calorie restriction.

  18. Enzyme technology: Key to selective biorefining

    DEFF Research Database (Denmark)

    Meyer, Anne S.

    2014-01-01

    their rational use in biorefinery processes requires an understanding of the basic features of enzymes and reaction traits with respect to specificity, kinetics, reaction optima, stability and structure-function relations – we are now at a stage where it is possible to use nature’s enzyme structures as starting...... point and then improve the functional traits by targeted mutation of the protein. The talk will display some of our recent hypotheses related to enzyme action, recently obtained results within knowledge-based enzyme improvements as well as cast light on research methods used in optimizing enzyme...... to the reaction is a unique trait of enzyme catalysis. Since enzyme selectivity means that a specific reaction is catalysed between particular species to produce definite products, enzymes are particularly fit for converting specific compounds in mixed biomass streams. Since enzymes are protein molecules...

  19. Controlled enzyme catalyzed heteropolysaccharide degradation

    DEFF Research Database (Denmark)

    Rasmussen, Louise Enggaard

    of the progress of enzymatic hydrolysis of different xylan substrates was developed. The method relies on dividing the HPSEC elution profiles into fixed time intervals and utilizing the linear refractive index response (area under the curve) of defined standard compounds. In order to obtain optimal high......-performance size exclusion chromatography profiles, the method was designed using 0.1 M CH3COONa in both the mobile phase and as the sample solution. This was based on the systematic evaluation of the influence of the mobile phase, including the type, ionic strength and pH, on the refractive index detector...... response. A time study of the enzyme catalyzed hydrolysis of birchwood xylan and wheat bran by BsX was used as an example to demonstrate the workability of the new HPSEC method for obtaining progress curves describing the evolution in the product profile during enzyme catalysis. Flaxseed mucilage (FM) has...

  20. Performance of PCR-restriction fragment length polymorphism analysis of the Helicobacter pylori ureB gene in differentiating gene variants

    DEFF Research Database (Denmark)

    Colding, H; Hartzen, S H; Mohammadi, M

    2003-01-01

    unrelated clinical H. pylori isolates with PCR-RFLP typing of the ureB gene (933 bp), combining the results obtained with restriction enzymes HaeIII and Sau3A, and a mixture of the enzymes. We therefore find that PCR-RFLP typing of the ureB gene of H. pylori with restriction enzymes HaeIII and Sau3A......Recently, PCR-restriction fragment length polymorphism (PCR-RFLP) of the urease genes of Helicobacter pylori was evaluated in a meta-analysis; acceptable discriminatory indices of the ureAB and C genes were found. In the present investigation, we found a discriminatory index of 0.95 for 191...

  1. Malolactic enzyme from Oenococcus oeni

    Science.gov (United States)

    Schümann, Christina; Michlmayr, Herbert; del Hierro, Andrés M.; Kulbe, Klaus D.; Jiranek, Vladimir; Eder, Reinhard; Nguyen, Thu-Ha

    2013-01-01

    Malolactic enzymes (MLE) are known to directly convert L-malic acid into L-lactic acid with a catalytical requirement of nicotinamide adenine dinucleotide (NAD+) and Mn2+; however, the reaction mechanism is still unclear. To study a MLE, the structural gene from Oenococcus oeni strain DSM 20255 was heterologously expressed in Escherichia coli, yielding 22.9 kU l−1 fermentation broth. After affinity chromatography and removal of apparently inactive protein by precipitation, purified recombinant MLE had a specific activity of 280 U mg−1 protein with a recovery of approximately 61%. The enzyme appears to be a homodimer with a molecular mass of 128 kDa consisting of two 64 kDa subunits. Characterization of the recombinant enzyme showed optimum activity at pH 6.0 and 45°C, and Km, Vmax and kcat values of 4.9 mM, 427 U mg−1 and 456 sec−1 for L-malic acid, 91.4 µM, 295 U mg−1 and 315 sec−1 for NAD+ and 4.6 µM, 229 U mg−1 and 244 sec−1 for Mn2+, respectively. The recombinant MLE retained 95% of its activity after 3 mo at room temperature and 7 mo at 4°C. When using pyruvic acid as substrate, the enzyme showed the conversion of pyruvic acid with detectable L-lactate dehydrogenase (L-LDH) activity and oxidation of NADH. This interesting observation might explain that MLE catalyzes a redox reaction and hence, the requirements for NAD+ and Mn2+ during the conversion of L-malic to L-lactic acid. PMID:23196745

  2. Localization of enzymes within microbodies.

    Science.gov (United States)

    Huang, A H; Beevers, H

    1973-08-01

    Microbodies from rat liver and a variety of plant tissues were osmotically shocked and subsequently centrifuged at 40,000 g for 30 min to yield supernatant and pellet fractions. From rat liver microbodies, all of the uricase activity but little glycolate oxidase or catalase activity were recovered in the pellet, which probably contained the crystalline cores as many other reports had shown. All the measured enzymes in spinach leaf microbodies were solubilized. With microbodies from potato tuber, further sucrose gradient centrifugation of the pellet yielded a fraction at density 1.28 g/cm(3) which, presumably representing the crystalline cores, contained 7% of the total catalase activity but no uricase or glycolate oxidase activity. Using microbodies from castor bean endosperm (glyoxysomes), 50-60% of the malate dehydrogenase, fatty acyl CoA dehydrogenase, and crotonase and 90% of the malate synthetase and citrate synthetase were recovered in the pellet, which also contained 96% of the radioactivity when lecithin in the glyoxysomal membrane had been labeled by previous treatment of the tissue with [(14)C]choline. When the labeled pellet was centrifuged to equilibrium on a sucrose gradient, all the radioactivity, protein, and enzyme activities were recovered together at peak density 1.21-1.22 g/cm(3), whereas the original glyoxysomes appeared at density 1.24 g/cm(3). Electron microscopy showed that the fraction at 1.21-1.22 g/cm(3) was comprised of intact glyoxysomal membranes. All of the membrane-bound enzymes were stripped off with 0.15 M KCl, leaving the "ghosts" still intact as revealed by electron microscopy and sucrose gradient centrifugation. It is concluded that the crystalline cores of plant microbodies contain no uricase and are not particularly enriched with catalase. Some of the enzymes in glyoxysomes are associated with the membranes and this probably has functional significance.

  3. The Synthesis of Artificial Enzymes

    Science.gov (United States)

    1993-01-01

    21] describe an interesting model (4) of these processes in which vitamin B-12 is attached to cyclodextrin . The cyclodextrin simultaneously plays the...rotation to permit the second step leading to product. In a cyclodextrin enzyme mimic we had very effective imitation of the first step : , • when...been done on the cyclodextrin dimers that were proposed for this contract period. The previously reported paper with Greenspoon et. al.(5) described

  4. Automated Ribotyping Using Different Enzymes To Improve Discrimination of Listeria monocytogenes Isolates, with a Particular Focus on Serotype 4b Strains

    Science.gov (United States)

    De Cesare, Alessandra; Bruce, James L.; Dambaugh, Timothy R.; Guerzoni, Maria E.; Wiedmann, Martin

    2001-01-01

    To develop improved automated subtyping approaches for Listeria monocytogenes, we characterized the discriminatory power of different restriction enzymes for ribotyping. When 15 different restriction enzymes were used for automated ribotyping of 16 selected L. monocytogenes isolates, the restriction enzymes EcoRI, PvuII, and XhoI showed high discriminatory ability (Simpson's index of discrimination > 0.900) and produced complete and reproducible restriction cut patterns. These three enzymes were thus evaluated for their ability to differentiate among isolates representing the two major serotype 4b epidemic clones, those having ribotype reference pattern DUP-1038 (51 isolates) and those having pattern DUP-1042 (20 isolates). Among these isolates, PvuII provided the highest discrimination for a single enzyme (nine different subtypes; index of discrimination = 0.518). A combination of PvuII and XhoI showed the highest discriminatory ability (index of discrimination = 0.590) for these isolates. A group of 44 DUP-1038 isolates and a group of 12 DUP-1042 isolates were identical to each other even when the combined data for all three enzymes were used. We conclude that automated ribotyping using different enzymes allows improved discrimination of L. monocytogenes isolates, including epidemic serotype 4b strains. We furthermore confirm that most of the isolates representing the genotypes linked to the two major epidemic L. monocytogenes clonal groups form two genetically homogeneous groups. PMID:11474034

  5. Substrate mediated enzyme prodrug therapy.

    Directory of Open Access Journals (Sweden)

    Betina Fejerskov

    Full Text Available In this report, we detail Substrate Mediated Enzyme Prodrug Therapy (SMEPT as a novel approach in drug delivery which relies on enzyme-functionalized cell culture substrates to achieve a localized conversion of benign prodrug(s into active therapeutics with subsequent delivery to adhering cells or adjacent tissues. For proof-of-concept SMEPT, we use surface adhered micro-structured physical hydrogels based on poly(vinyl alcohol, β-glucuronidase enzyme and glucuronide prodrugs. We demonstrate enzymatic activity mediated by the assembled hydrogel samples and illustrate arms of control over rate of release of model fluorescent cargo. SMEPT was not impaired by adhering cells and afforded facile time - and dose - dependent uptake of the in situ generated fluorescent cargo by hepatic cells, HepG2. With the use of a glucuronide derivative of an anticancer drug, SN-38, SMEPT afforded a decrease in cell viability to a level similar to that achieved using parent drug. Finally, dose response was achieved using SMEPT and administration of judiciously chosen concentration of SN-38 glucuronide prodrug thus revealing external control over drug delivery using drug eluting surface. We believe that this highly adaptable concept will find use in diverse biomedical applications, specifically surface mediated drug delivery and tissue engineering.

  6. Antibiotic resistance and restriction endonucleases in fecal enterococci of chamois (Rupicapra rupicapra Linnaeus, 1758).

    Science.gov (United States)

    Vandžurová, A; Hrašková, I; Júdová, J; Javorský, P; Pristaš, P

    2012-07-01

    Two hundred eighty-four isolates of enterococci from feces of wild living chamois from alpine environments were tested for sensitivity to three antibiotics. Low frequency of resistance was observed in studied enterococcal populations (about 5 % for tetracycline and erythromycin and 0 % for ampicillin). In six animals, the population of enterococci lacked any detectable resistance. Our data indicated that enterococcal population in feces of the majority of studied animals did not encounter mobile genetic elements encoding antibiotic resistance probably due to spatial separation and/or due to low exposure to the antibiotics. Based on resistance profiles observed, three populations were analyzed for the presence of restriction endonucleases. The restriction enzymes from two isolates-31K and 1K-were further purified and characterized. Restriction endonuclease Efa1KI recognizes CCWGG sequence and is an isoschizomer of BstNI. Endonuclease Efc31KI, a BsmAI isoschizomer, recognizes the sequence GTCTC and it is a first restriction endonuclease identified in Enterococcus faecium. Our data indicate that restriction-modification (R-M) systems do not represent an efficient barrier for antibiotic resistance spreading; enterococcal populations colonized by antibiotics resistance genes were also colonized by the R-M systems.

  7. Identification of screwworm species by polymerase chain reaction-restriction fragment length polymorphism.

    Science.gov (United States)

    Taylor, D B; Szalanski, A L; Peterson, R D

    1996-01-01

    Restriction fragment length polymorphisms in polymerase chain reaction amplified fragments (PCR-RFLP) of mitochondrial DNA were used to differentiate species of New World screwworms (Diptera: Calliphoridae). Twenty-seven restriction enzymes were screened on five regions of mtDNA. Eleven restriction fragment length patterns differentiated New World screwworm, Cochliomyia hominivorax (Coquerel), from secondary screwworm, Cochliomyia macellaria (F.). Five restriction fragment length patterns were polymorphic in C.hominivorax while all fragment patterns were fixed in C.macellaria. Diagnostic restriction fragment length patterns were used for species diagnosis, whereas intraspecific variable patterns were used to characterize field samples and laboratory strains. The PCR-RFLP technique is flexible with regard to developmental stage of the sample and method of preservation. We were able to characterize specimens of all life stages from egg to adult including larvae preserved in alcohol and pinned adults. PCR-RFLP is rapid and inexpensive, enabling specimens to be characterized within 24 h for less than $2.50.

  8. Exercise coupled with dietary restriction reduces oxidative stress in male adolescents with obesity.

    Science.gov (United States)

    Li, Chunyan; Feng, Feihu; Xiong, Xiaoling; Li, Rui; Chen, Ning

    2017-04-01

    The increased oxidative stress is usually observed in obese population, but the control of body weight by calorie restriction and/or exercise training can ameliorate oxidative stress. In order to evaluate oxidative stress in response to exercise and dietary restriction in obese adolescents, a total of 20 obese volunteers were enrolled in a 4-week intervention program including exercise training and dietary restriction. Body compositions and blood samples were analysed before and after 4-week intervention, and biomarkers associated with oxidative stress were examined. After 4-week exercise training coupled with dietary restriction, physical composition parameters including body mass, body mass index (BMI), lean body mass, body fat mass and fat mass ratio had obvious reduction by 12.43%, 13.51%, 5.83%, 25.05% and 14.52%, respectively. In addition, the activities of antioxidant enzymes, such as superoxide dismutase (SOD) and glutathione peroxidase (GPx) revealed a remarkable enhancement. On the other hand, protein carbonyls (PC) exhibited an obvious reduction. Moreover, total thiols and nitrites with respect to baseline revealed a reducing trend although no significant difference was observed. Therefore, the 4-week exercise intervention coupled with dietary restriction is benefit for the loss of body weight and the mitigation of oxidative stress in obese population so that it can be a recommendable intervention prescription for the loss of body weight.

  9. Catalytic activity control of restriction endonuclease--triplex forming oligonucleotide conjugates.

    Science.gov (United States)

    Silanskas, Arunas; Zaremba, Mindaugas; Sasnauskas, Giedrius; Siksnys, Virginijus

    2012-02-15

    Targeting of individual genes in complex genomes requires endonucleases of extremely high specificity. To direct cleavage at the unique site(s) in the genome, both naturally occurring and artificial enzymes have been developed. These include homing endonucleases, zinc-finger nucleases, transcription activator-like effector nucleases, and restriction or chemical nucleases coupled to a triple-helix forming oligonucleotide (TFO). The desired cleavage has been demonstrated both in vivo and in vitro for several model systems. However, to limit cleavage strictly to unique sites and avoid undesired reactions, endonucleases with controlled activity are highly desirable. In this study we present a proof-of-concept demonstration of two strategies to generate restriction endonuclease-TFO conjugates with controllable activity. First, we combined the restriction endonuclease caging and TFO coupling procedures to produce a caged MunI-TFO conjugate, which can be activated by UV-light upon formation of a triple helix. Second, we coupled TFO to a subunit interface mutant of restriction endonuclease Bse634I which shows no activity due to impaired dimerization but is assembled into an active dimer when two Bse634I monomers are brought into close proximity by triple helix formation at the targeted site. Our results push the restriction endonuclease-TFO conjugate technology one step closer to potential in vivo applications.

  10. Research progress of nanoparticles as enzyme mimetics

    Science.gov (United States)

    Hu, XiaoNa; Liu, JianBo; Hou, Shuai; Wen, Tao; Liu, WenQi; Zhang, Ke; He, WeiWei; Ji, YingLu; Ren, HongXuan; Wang, Qi; Wu, XiaoChun

    2011-10-01

    Natural enzymes as biological catalysts possess remarkable advantages, especially their highly efficient and selective catalysis under mild conditions. However, most natural enzymes are proteins, thus exhibiting an inherent low durability to harsh reaction conditions. Artificial enzyme mimetics have been pursued extensively to avoid this drawback. Quite recently, some inorganic nanoparticles (NPs) have been found to exhibit unique enzyme mimetics. In addition, their much higher stability overcomes the inherent disadvantage of natural enzymes. Furthermore, easy mass-production and low cost endow them more benefits. As a new member of artificial enzyme mimetics, they have received intense attention. In this review article, major progress in this field is summarized and future perspectives are highlighted.

  11. Consumer attitudes to enzymes in food production

    DEFF Research Database (Denmark)

    Søndergaard, Helle Alsted; Grunert, Klaus G.; Scholderer, Joachim

    2005-01-01

    The use of enzymes in food production has potential benefits for both food manufacturers and consumers. A central question is how consumers react to new ways of producing foods with enzymes. This study investigates the formation of consumer attitudes to different enzyme production methods in three...... European countries. Results show that consumers are most positive towards non-GM enzyme production methods. The enzyme production method is by far the most important factor for the formation of buying intentions compared to price and benefits. Results also show that environmental concern and attitudes...... to technological progress are the socio-political attitudes that have the highest predictive value regarding attitudes to enzyme production methods....

  12. Allosteric regulation of epigenetic modifying enzymes.

    Science.gov (United States)

    Zucconi, Beth E; Cole, Philip A

    2017-08-01

    Epigenetic enzymes including histone modifying enzymes are key regulators of gene expression in normal and disease processes. Many drug development strategies to target histone modifying enzymes have focused on ligands that bind to enzyme active sites, but allosteric pockets offer potentially attractive opportunities for therapeutic development. Recent biochemical studies have revealed roles for small molecule and peptide ligands binding outside of the active sites in modulating the catalytic activities of histone modifying enzymes. Here we highlight several examples of allosteric regulation of epigenetic enzymes and discuss the biological significance of these findings. Copyright © 2017 Elsevier Ltd. All rights reserved.

  13. Effect of restricted spinal motion on gait.

    Science.gov (United States)

    Konz, Regina; Fatone, Stefania; Gard, Steven

    2006-01-01

    Spinal orthoses are common in the treatment of various conditions that affect the spine. They encompass both the spine and pelvis and thus have implications for pelvic and lower-limb motion during walking in addition to a direct effect on spinal motion. The role of the spine in walking is largely ill-defined, and the consequences of restricted spinal motion on walking have yet to be explored. This study investigated the effect of spinal restriction on gait in able-bodied persons. Gait analyses were performed on 10 able-bodied subjects as they walked at five different speeds that were distributed across their comfortable range of speeds. Data were collected during walking with and without spinal restriction by a fiberglass body jacket, which is similar to a thoracolumbosacral orthosis (TLSO). With spinal restriction, peak-to-peak (PP) pelvic obliquity and rotation were significantly reduced across all walking speeds (p TLSO use or surgical restriction of spinal motion. An awareness of these issues will enable clinicians to monitor patients for problems that may result from decreased spine and pelvic motion.

  14. Fasting or caloric restriction for healthy aging.

    Science.gov (United States)

    Anton, Stephen; Leeuwenburgh, Christiaan

    2013-10-01

    Aging is associated with a host of biological changes that contribute to a progressive decline in cognitive and physical function, ultimately leading to a loss of independence, and increased risk of mortality. To date, prolonged caloric restriction (i.e., a reduction in caloric intake without malnutrition) is the only non-genetic intervention that has consistently been found to extend both mean and maximal life span across a variety of species. Most individuals have difficulty sustaining prolonged caloric restriction, which has led to a search for alternative approaches that can produce similar to benefits as caloric restriction. A growing body of evidence indicates that fasting periods and intermittent fasting regimens in particular can trigger similar biological pathways as caloric restriction. For this reason, there is increasing scientific interest in further exploring the biological and metabolic effects of intermittent fasting periods, as well as whether long-term compliance may be improved by this type of dietary approach. This special will highlight the latest scientific findings related to the effects of both caloric restriction and intermittent fasting across various species including yeast, fruit flies, worms, rodents, primates, and humans. A specific emphasis is placed on translational research with findings from basic bench to bedside reviewed and practical clinical implications discussed. Copyright © 2013 Elsevier Inc. All rights reserved.

  15. Placental Nutrient Transport and Intrauterine Growth Restriction

    Directory of Open Access Journals (Sweden)

    Francesca eGaccioli

    2016-02-01

    Full Text Available Intrauterine growth restriction refers to the inability of the fetus to reach its genetically determined potential size. Fetal growth restriction affects approximately 5–15% of all pregnancies in the United States and Europe. In developing countries the occurrence varies widely between 10 and 55%, impacting about 30 million newborns per year. Besides having high perinatal mortality rates these infants are at greater risk for severe adverse outcomes, such as hypoxic ischemic encephalopathy and cerebral palsy. Moreover, reduced fetal growth has lifelong health consequences, including higher risks of developing metabolic and cardiovascular diseases in adulthood. Numerous reports indicate placental insufficiency as one of the underlying causes leading to altered fetal growth and impaired placental capacity of delivering nutrients to the fetus has been shown to contribute to the etiology of intrauterine growth restriction. Indeed, reduced expression and/or activity of placental nutrient transporters have been demonstrated in several conditions associated with an increased risk of delivering a small or growth restricted infant. This review focuses on human pregnancies and summarizes the changes in placental amino acid, fatty acid, and glucose transport reported in conditions associated with intrauterine growth restriction, such as pre-eclampsia and young maternal age.

  16. Newer antidiabetic drugs and calorie restriction mimicry

    Directory of Open Access Journals (Sweden)

    Sanjay Kalra

    2016-01-01

    Full Text Available De-acceleration of aging and delayed development of age-related morbidity accompanies the restriction of calories (without malnutrition in laboratory mice, nematodes, yeast, fish, and dogs. Recent results from long-term longitudinal studies conducted on primates have suggested longevity benefits of a 30% restriction of calories in rhesus monkeys as well. Among calorie restricted rhesus monkeys one of the mechanisms for the improvement in lifespan was the reduction in the development of glucose intolerance and cardiovascular disease. Although there are no comparable human studies, it is likely that metabolic and longevity benefits will accompany a reduction in calories in humans as well. However, considering the difficulties in getting healthy adults to limit food intake science has focused on understanding the biochemical processes that accompany calorie restriction (CR to formulate drugs that would mimic the effects of CR without the need to actually restrict calories. Drugs in this emerging therapeutic field are called CR mimetics. Some of the currently used anti-diabetic agents may have some CR mimetic like effects. This review focuses on the CR mimetic properties of the currently available anti-diabetic agents.

  17. Role of dynamics in enzyme catalysis: substantial versus semantic controversies.

    Science.gov (United States)

    Kohen, Amnon

    2015-02-17

    studies could be that enzyme, substrate, and solvent dynamics contribute to enzyme catalyzed reactions in several ways: first via mutual "induced-fit" shifting of their conformational ensemble upon binding; then via thermal search of the conformational space toward the reaction's transition-state (TS) and the rare event of the barrier crossing toward products, which is likely to be on faster time scales then the first and following events; and finally via the dynamics associated with products release, which are rate-limiting for many enzymatic reactions. From a chemical perspective, close to the TS, enzymatic systems seem to stiffen, restricting motions orthogonal to the chemical coordinate and enabling dynamics along the reaction coordinate to occur selectively. Studies of how enzymes evolved to support those efficient dynamics at various time scales are still in their infancy, and further experiments and calculations are needed to reveal these phenomena in both enzymes and uncatalyzed reactions.

  18. Comparison of the locations of homologous fowlpox and vaccinia virus genes reveals major genome reorganization.

    Science.gov (United States)

    Mockett, B; Binns, M M; Boursnell, M E; Skinner, M A

    1992-10-01

    We have derived a restriction enzyme map for the fowlpox virus FP9 strain. Sites for BamHI, PvuII, PstI and NcoI have been mapped mainly by Southern blotting. The size of the genome derived from the restriction maps (254 kb) corresponds to the figure of 260 +/- 8 kb determined from analysis of genomic DNA by pulsed-field electrophoresis. The map can be compared with a previously published map for a different strain of fowlpox virus using the PstI digest which is common to both studies. Some 65 kb of fowlpox virus sequence, in 11 blocks, as well as individual M13 clones have been aligned with the map. Where those blocks correspond with blocks of homologous genes in vaccinia virus, it is possible to compare the genomic locations for those genes in the two viruses. This comparison reveals that, whereas there are blocks of sequence within which genes exist in the same relative position in the two viruses, the genomic location of those sequence blocks differs widely between the two viruses.

  19. Home smoking restrictions and adolescent smoking.

    Science.gov (United States)

    Proescholdbell, R J; Chassin, L; MacKinnon, D P

    2000-05-01

    The prevention of adolescent smoking has focused on peer influences to the relative neglect of parental influences. Parents socialize their children about many behaviors including smoking, and parental rules about their child's smoking have been related to lower levels of adolescent smoking. Moreover, among adults, indoor smoking restrictions have been associated with decreased smoking. Accordingly, the current study tested the relation of adolescent smoking to home smoking policy (rules regulating where adults are allowed to smoke in the home). Results showed that restrictive home smoking policies were associated with lower likelihood of trying smoking for both middle and high school students. However, for high school students this relation was restricted to homes with non-smoking parents. Home smoking policies were not associated with current regular smoking for either middle or high school students. Home smoking policies may be useful in preventing adolescent smoking experimentation, although longitudinal and experimental research is necessary to confirm this hypothesis.

  20. Castor Oil Transesterification Catalysed by Liquid Enzymes

    DEFF Research Database (Denmark)

    Andrade, Thalles; Errico, Massimiliano; Christensen, Knud Villy

    2017-01-01

    In the present work, biodiesel production by reaction of non-edible castor oil with methanol under enzymatic catalysis is investigated. Two liquid enzymes were tested: Eversa Transform and Resinase HT. Reactions were performed at 35 °C and with a molar ratio of methanol to oil of 6:1. The reaction...... time was 8 hours. Stepwise addition of methanol was necessary to avoid enzyme inhibition by methanol. In order to minimize the enzyme costs, the influence of enzyme activity loss during reuse of both enzymes was evaluated under two distinct conditions. In the former, the enzymes were recovered...... and fully reused; in the latter, a mixture of 50 % reused and 50 % fresh enzymes was tested. In the case of total reuse after three cycles, both enzymes achieved only low conversions. The biodiesel content in the oil-phase using Eversa Transform was 94.21 % for the first cycle, 68.39 % in the second, and 33...

  1. How quantum entanglement in DNA synchronizes double-strand breakage by type II restriction endonucleases.

    Science.gov (United States)

    Kurian, P; Dunston, G; Lindesay, J

    2016-02-21

    Macroscopic quantum effects in living systems have been studied widely in pursuit of fundamental explanations for biological energy transport and sensing. While it is known that type II endonucleases, the largest class of restriction enzymes, induce DNA double-strand breaks by attacking phosphodiester bonds, the mechanism by which simultaneous cutting is coordinated between the catalytic centers remains unclear. We propose a quantum mechanical model for collective electronic behavior in the DNA helix, where dipole-dipole oscillations are quantized through boundary conditions imposed by the enzyme. Zero-point modes of coherent oscillations would provide the energy required for double-strand breakage. Such quanta may be preserved in the presence of thermal noise by the enzyme's displacement of water surrounding the DNA recognition sequence. The enzyme thus serves as a decoherence shield. Palindromic mirror symmetry of the enzyme-DNA complex should conserve parity, because symmetric bond-breaking ceases when the symmetry of the complex is violated or when physiological parameters are perturbed from optima. Persistent correlations in DNA across longer spatial separations-a possible signature of quantum entanglement-may be explained by such a mechanism. Copyright © 2015 Elsevier Ltd. All rights reserved.

  2. IFITM proteins restrict viral membrane hemifusion.

    Directory of Open Access Journals (Sweden)

    Kun Li

    2013-01-01

    Full Text Available The interferon-inducible transmembrane (IFITM protein family represents a new class of cellular restriction factors that block early stages of viral replication; the underlying mechanism is currently not known. Here we provide evidence that IFITM proteins restrict membrane fusion induced by representatives of all three classes of viral membrane fusion proteins. IFITM1 profoundly suppressed syncytia formation and cell-cell fusion induced by almost all viral fusion proteins examined; IFITM2 and IFITM3 also strongly inhibited their fusion, with efficiency somewhat dependent on cell types. Furthermore, treatment of cells with IFN also markedly inhibited viral membrane fusion and entry. By using the Jaagsiekte sheep retrovirus envelope and influenza A virus hemagglutinin as models for study, we showed that IFITM-mediated restriction on membrane fusion is not at the steps of receptor- and/or low pH-mediated triggering; instead, the creation of hemifusion was essentially blocked by IFITMs. Chlorpromazine (CPZ, a chemical known to promote the transition from hemifusion to full fusion, was unable to rescue the IFITM-mediated restriction on fusion. In contrast, oleic acid (OA, a lipid analog that generates negative spontaneous curvature and thereby promotes hemifusion, virtually overcame the restriction. To explore the possible effect of IFITM proteins on membrane molecular order and fluidity, we performed fluorescence labeling with Laurdan, in conjunction with two-photon laser scanning and fluorescence-lifetime imaging microscopy (FLIM. We observed that the generalized polarizations (GPs and fluorescence lifetimes of cell membranes expressing IFITM proteins were greatly enhanced, indicating higher molecularly ordered and less fluidized membranes. Collectively, our data demonstrated that IFITM proteins suppress viral membrane fusion before the creation of hemifusion, and suggested that they may do so by reducing membrane fluidity and conferring a positive

  3. Halloween genes encode P450 enzymes that mediate steroid hormone biosynthesis in Drosophila melanogaster.

    Science.gov (United States)

    Gilbert, Lawrence I

    2004-02-27

    Mutation of members of the Halloween gene family results in embryonic lethality. We have shown that two of these genes code for enzymes responsible for specific steps in the synthesis of ecdysone, a polyhydroxylated sterol that is the precursor of the major molting hormone of all arthropods, 20-hydroxyecdysone. These two mitochondrial P450 enzymes, coded for by disembodied (dib) (CYP302A1) and shadow (sad) (CYP315A1), are the C22 and C2 hydroxylases, respectively, as shown by transfection of the gene into S2 cells and subsequent biochemical analysis. These are the last two enzymes in the ecdysone biosynthetic pathway. A third enzyme, necessary for the critical conversion of ecdysone to 20-hydroxyecdysone, the 20-monooxygenase, is encoded by shade (shd) (CYP314A1). All three enzymes are mitochondrial although shade has motifs suggesting both mitochondrial and microsomal locations. By tagging these enzymes, their subcellular location has been confirmed by confocal microscopy. Shade is present in several tissues as expected while disembodied and shadow are restricted to the ring gland. The paradigm used should allow us to define the enzymes mediating the entire ecdysteroid biosynthetic pathway.

  4. EFFECT OF MARINATION WITH PROTEOLYTIC ENZYMES ON QUALITY OF BEEF MUSCLE

    Directory of Open Access Journals (Sweden)

    Daniela Istrati

    2012-03-01

    Full Text Available During storage and thermal treatment meat suffers a number of biochemical and physical-chemical changes in the substrate protein, changes that take place with varying intensity depending on the method of preservation utilized and temperature of thermal treatment applied. Application of different treatments aimed to influence the proteolytic activity as is the case of enzymatic tenderization of beef.Improving the meat tenderness with proteolytic enzymes is promising, but current legislation restricting the use of proteolytic enzymes from bacterial origin and recommended tenderizers salts containing papain, ficin and bromelain. Recent research revealed that meat marinating before grilling results in a reduction of heterocyclic amine content after thermal treatment. Also, the addition of fruit pulp, garlic or other spices contributes to decreased production of heterocyclic amines because of their antioxidant activity. In the present study was aimed influence of exogenous proteolytic enzymes on adult beef tenderness. To increase the tenderness of adult beef were used exogenous enzymes preparations (papain and bromelain and natural sources of enzymes using pineapple and papaya fruit. It was intended to establish the correlation between enzymatic activity of enzymes used in the study, the processing technology and changes in the physical-chemical and biochemical characteristics that occur during storage in refrigerated conditions (evolution of the rigidity index and water holding capacity, cooking losses and cooking yield of the samples injected/marinated with enzymes.

  5. NADPH Oxidase Enzymes in Skin Fibrosis: Molecular Targets and Therapeutic Agents

    Science.gov (United States)

    Lev-Tov, Hadar; Jagdeo, Jared

    2013-01-01

    Fibrosis is characterized by the excessive deposition of extracellular matrix components eventually resulting in organ dysfunction and failure. In dermatology, fibrosis is the hallmark component of many skin diseases, including systemic sclerosis, graft versus host disease, hypertrophic scars, keloids, nephrogenic systemic fibrosis, porphyria cutanea tarda, restrictive dermopathy and other conditions. Fibrotic skin disorders may be debilitating and impair quality of life. There are few FDA-approved anti-fibrotic drugs; thus, research in this area is crucial in addressing this deficiency. Recent investigations elucidating the pathogenesis of skin fibrosis have implicated endogenous reactive oxygen species produced by the multicomponent nicotinamide adenine dinucleotide phosphate (NADPH) oxidase (Nox) enzyme complex. In this review we discuss Nox enzymes and their role in skin fibrosis. An overview of the Nox enzyme family is presented and their role in the pathogenesis of skin fibrosis is discussed. The mechanisms that Nox enzymes influence specific skin fibrotic disorders are also reviewed. Finally, we describe the therapeutic approaches to ameliorate skin fibrosis by directly targeting Nox enzymes with the use of statins, p47phox subunit modulators, or GKT137831, a competitive inhibitor of Nox enzymes. Nox enzymes can also be targeted indirectly via scavenging ROS with antioxidants. We believe that Nox modulators are worthy of further investigation and have the potential to transform the management of skin fibrosis by dermatologists. PMID:24155025

  6. Biomedical Applications of Enzymes From Marine Actinobacteria.

    Science.gov (United States)

    Kamala, K; Sivaperumal, P

    Marine microbial enzyme technologies have progressed significantly in the last few decades for different applications. Among the various microorganisms, marine actinobacterial enzymes have significant active properties, which could allow them to be biocatalysts with tremendous bioactive metabolites. Moreover, marine actinobacteria have been considered as biofactories, since their enzymes fulfill biomedical and industrial needs. In this chapter, the marine actinobacteria and their enzymes' uses in biological activities and biomedical applications are described. © 2017 Elsevier Inc. All rights reserved.

  7. Is fluid restriction needed in heart failure?

    Science.gov (United States)

    Castro-Gutiérrez, Victoria; Rada, Gabriel

    2017-01-09

    Fluid restriction is usually recommended in chronic heart failure. However, the evidence base to support this is not that clear. Searching in Epistemonikos database, which is maintained by screening multiple databases, we identified five systematic reviews evaluating 11 studies addressing the question of this article, including seven randomized trials. We extracted data, combined the evidence using meta-analysis and generated a summary of findings table following the GRADE approach. We concluded fluid restriction probably decreases hospital readmission in chronic heart failure and might decrease mortality, but the certainty of the evidence for the latter is low.

  8. The AplI restriction-modification system in an edible cyanobacterium, Arthrospira (Spirulina) platensis NIES-39, recognizes the nucleotide sequence 5'-CTGCAG-3'.

    Science.gov (United States)

    Shiraishi, Hideaki; Tabuse, Yosuke

    2013-01-01

    The degradation of foreign DNAs by restriction enzymes in an edible cyanobacterium, Arthrospira platensis, is a potential barrier for gene-transfer experiments in this economically valuable organism. We overproduced in Escherichia coli the proteins involved in a putative restriction-modification system of A. platensis NIES-39. The protein produced from the putative type II restriction enzyme gene NIES39_K04640 exhibited an endonuclease activity that cleaved DNA within the sequence 5'-CTGCAG-3' between the A at the fifth position and the G at the sixth position. We designated this enzyme AplI. The protein from the adjacent gene NIES39_K04650, which encodes a putative DNA (cytosine-5-)-methyltransferase, rendered DNA molecules resistant to AplI by modifying the C at the fourth position (but not the C at the first position) in the recognition sequence. This modification enzyme, M.AplI, should be useful for converting DNA molecules into AplI-resistant forms for use in gene-transfer experiments. A summary of restriction enzymes in various Arthrospira strains is also presented in this paper.

  9. Enzyme Technology for Shipboard Waste Management

    Science.gov (United States)

    1976-12-01

    APPLICATIONS OF ENZYMES Ezm Type I Applications Soluble Enzymes Amylase Starch degradation; conversion of starch to glucose; liquefac- tion of grain...manufac- turing; chillproofing beer in brewing. Cellulase Clarification of fruit juices. Oxidase Removal of glucose or oxygen. Immobilized Enzymes

  10. Purification and characterization of extracellular amylolytic enzyme ...

    African Journals Online (AJOL)

    In the present study, the amylase enzyme producing potential of four different Aspergillus species was analyzed. The extracted amylase enzyme was purified by diethyl amino ethyl (DEAE) cellulose and Sephadex G-50 column chromatography and the enzyme activity was measured by using synthetic substrate starch.

  11. Immobilization of Enzymes in Polymer Supports.

    Science.gov (United States)

    Conlon, Hugh D.; Walt, David R.

    1986-01-01

    Two experiments in which an enzyme is immobilized onto a polymeric support are described. The experiments (which also demonstrate two different polymer preparations) involve: (1) entrapping an enzyme in an acrylamide polymer; and (2) reacting the amino groups on the enzyme's (esterase) lysine residues with an activated polymer. (JN)

  12. Activation of interfacial enzymes at membrane surfaces

    DEFF Research Database (Denmark)

    Mouritsen, Ole G.; Andresen, Thomas Lars; Halperin, Avi

    2006-01-01

    A host of water-soluble enzymes are active at membrane surfaces and in association with membranes. Some of these enzymes are involved in signalling and in modification and remodelling of the membranes. A special class of enzymes, the phospholipases, and in particular secretory phospholipase A2 (s...

  13. Purification and characterization of extracellular amylolytic enzyme ...

    African Journals Online (AJOL)

    DOSS

    2012-10-16

    Oct 16, 2012 ... In the present study, the amylase enzyme producing potential of four different Aspergillus species was analyzed. The extracted amylase enzyme was purified by diethyl amino ethyl (DEAE) cellulose and. Sephadex G-50 column chromatography and the enzyme activity was measured by using synthetic.

  14. Cellulolytic enzyme compositions and uses thereof

    Energy Technology Data Exchange (ETDEWEB)

    Iyer, Prashant; Gaspar, Armindo Ribiero; Croonenberghs, James; Binder, Thomas P.

    2017-07-25

    The present invention relates enzyme composition comprising a cellulolytic preparation and an acetylxylan esterase (AXE); and the used of cellulolytic enzyme compositions for hydrolyzing acetylated cellulosic material. Finally the invention also relates to processes of producing fermentation products from acetylated cellulosic materials using a cellulolytic enzyme composition of the invention.

  15. 21 CFR 864.4400 - Enzyme preparations.

    Science.gov (United States)

    2010-04-01

    ... 21 Food and Drugs 8 2010-04-01 2010-04-01 false Enzyme preparations. 864.4400 Section 864.4400...) MEDICAL DEVICES HEMATOLOGY AND PATHOLOGY DEVICES Specimen Preparation Reagents § 864.4400 Enzyme preparations. (a) Identification. Enzyme preparations are products that are used in the histopathology...

  16. [Enzyme replacement therapy for hypophosphatasia].

    Science.gov (United States)

    Ozono, Keiichi

    2014-02-01

    Hypophosphatasia is caused by abnormal tissue-nonspecific alkaline phosphatase (ALP), leading to impaired calcification in bone. Patients with severe hypophosphatasia have difficulties in respiratory function from early days after birth and the rate of lethality is extremely high. Enzyme replacement therapy using bone-targeting recombinant ALP, which has 10 aspartic acids in the C-terminal tail has developed. The efficacy of ERT was firstly observed in model mice of hypophosphatasia. In clinical trial including perinatal and infantile types of hypophosphatasia, efficacy and safety have been reported. Expanded clinical trial is underway and the results of the clinical trial might be reported by the end of the next year.

  17. Identification of blood meal sources of Lutzomyia longipalpis using polymerase chain reaction-restriction fragment length polymorphism analysis of the cytochrome B gene.

    Science.gov (United States)

    Soares, Vítor Yamashiro Rocha; Silva, Jailthon Carlos da; Silva, Kleverton Ribeiro da; Pires e Cruz, Maria do Socorro; Santos, Marcos Pérsio Dantas; Ribolla, Paulo Eduardo Martins; Alonso, Diego Peres; Coelho, Luiz Felipe Leomil; Costa, Dorcas Lamounier; Costa, Carlos Henrique Nery

    2014-06-01

    An analysis of the dietary content of haematophagous insects can provide important information about the transmission networks of certain zoonoses. The present study evaluated the potential of polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) analysis of the mitochondrial cytochrome B (cytb) gene to differentiate between vertebrate species that were identified as possible sources of sandfly meals. The complete cytb gene sequences of 11 vertebrate species available in the National Center for Biotechnology Information database were digested with Aci I, Alu I, Hae III and Rsa I restriction enzymes in silico using Restriction Mapper software. The cytb gene fragment (358 bp) was amplified from tissue samples of vertebrate species and the dietary contents of sandflies and digested with restriction enzymes. Vertebrate species presented a restriction fragment profile that differed from that of other species, with the exception of Canis familiaris and Cerdocyon thous. The 358 bp fragment was identified in 76 sandflies. Of these, 10 were evaluated using the restriction enzymes and the food sources were predicted for four: Homo sapiens (1), Bos taurus (1) and Equus caballus (2). Thus, the PCR-RFLP technique could be a potential method for identifying the food sources of arthropods. However, some points must be clarified regarding the applicability of the method, such as the extent of DNA degradation through intestinal digestion, the potential for multiple sources of blood meals and the need for greater knowledge regarding intraspecific variations in mtDNA.

  18. Identification of blood meal sources of Lutzomyia longipalpis using polymerase chain reaction-restriction fragment length polymorphism analysis of the cytochrome B gene

    Directory of Open Access Journals (Sweden)

    Vítor Yamashiro Rocha Soares

    2014-06-01

    Full Text Available An analysis of the dietary content of haematophagous insects can provide important information about the transmission networks of certain zoonoses. The present study evaluated the potential of polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP analysis of the mitochondrial cytochrome B (cytb gene to differentiate between vertebrate species that were identified as possible sources of sandfly meals. The complete cytb gene sequences of 11 vertebrate species available in the National Center for Biotechnology Information database were digested with Aci I, Alu I, Hae III and Rsa I restriction enzymes in silico using Restriction Mapper software. The cytb gene fragment (358 bp was amplified from tissue samples of vertebrate species and the dietary contents of sandflies and digested with restriction enzymes. Vertebrate species presented a restriction fragment profile that differed from that of other species, with the exception of Canis familiaris and Cerdocyon thous. The 358 bp fragment was identified in 76 sandflies. Of these, 10 were evaluated using the restriction enzymes and the food sources were predicted for four: Homo sapiens (1, Bos taurus (1 and Equus caballus (2. Thus, the PCR-RFLP technique could be a potential method for identifying the food sources of arthropods. However, some points must be clarified regarding the applicability of the method, such as the extent of DNA degradation through intestinal digestion, the potential for multiple sources of blood meals and the need for greater knowledge regarding intraspecific variations in mtDNA.

  19. The SUMOylation Pathway Restricts Gene Transduction by Adeno-Associated Viruses.

    Directory of Open Access Journals (Sweden)

    Christina Hölscher

    2015-12-01

    Full Text Available Adeno-associated viruses are members of the genus dependoviruses of the parvoviridae family. AAV vectors are considered promising vectors for gene therapy and genetic vaccination as they can be easily produced, are highly stable and non-pathogenic. Nevertheless, transduction of cells in vitro and in vivo by AAV in the absence of a helper virus is comparatively inefficient requiring high multiplicity of infection. Several bottlenecks for AAV transduction have previously been described, including release from endosomes, nuclear transport and conversion of the single stranded DNA into a double stranded molecule. We hypothesized that the bottlenecks in AAV transduction are, in part, due to the presence of host cell restriction factors acting directly or indirectly on the AAV-mediated gene transduction. In order to identify such factors we performed a whole genome siRNA screen which identified a number of putative genes interfering with AAV gene transduction. A number of factors, yielding the highest scores, were identified as members of the SUMOylation pathway. We identified Ubc9, the E2 conjugating enzyme as well as Sae1 and Sae2, enzymes responsible for activating E1, as factors involved in restricting AAV. The restriction effect, mediated by these factors, was validated and reproduced independently. Our data indicate that SUMOylation targets entry of AAV capsids and not downstream processes of uncoating, including DNA single strand conversion or DNA damage signaling. We suggest that transiently targeting SUMOylation will enhance application of AAV in vitro and in vivo.

  20. Physiological Responses, Growth Rate and Blood Metabolites Under Feed Restriction and Thermal Exposure in Kids

    Directory of Open Access Journals (Sweden)

    O.K. Hooda

    2014-05-01

    Full Text Available The study was carried out to study the cumulative effect of thermal stress and feed restriction in kids. Twelve kids of Alpine x Beetle cross were divided into two groups. Group 1 served as control and group 2 was put on restricted feeding and exposed at 40, 42 and 44oC. Body weights of both groups were similar before thermal exposure and feed restriction. Body weight of group 1 increased significantly and were higher than group 2 throughout the experiment. Body weight gain, average daily gain and feed conversion efficiency were comparable in both groups after removal of thermal stress and switching over to ad libitum feeding (42-63 days. Body weights of group 2 remained lower than group 1, the losses in body weights of group 2 could not be compensated and there was approximately 25% loss in body weight at the end of experiment. Physiological responses of group 2 were significantly lower before exposure to high temperature but increased significantly after exposure at temperature 40, 42 and 44oC and the increase was in commensurate with the increase in exposure temperature. Blood glucose, total protein, albumin and serum enzymes decreased significantly on exposure at higher temperature and differences were higher in feed restricted group. T3, T4 and cortisol concentration were similar in both groups before feed restriction and thermal stress. T3, T4 concentration decreased while cortisol concentration increased significantly after exposure to high temperature. Variations in plasma enzymes, acid phosphatase, alkaline phosphatase, SGOT and SGPT were not significant before feed restriction and thermal stress. The activities of acid phosphatase and alkaline phosphatase decreased whereas that of SGOT and SGPT increased significantly on exposure at temperature 40oC and subsequent changes at temperature 42 and 44oC were not significant. The study indicated that animals of group 2 experienced more stress as observed by significant alteration in body

  1. Restriction enzyme analysis of the human cytomegalovirus genome in specimens collected from immunodeficient patients in Belém, State of Pará, Brazil Análise de restrição enzimática do genoma viral do citomegalovírus humano em espécimes clínicos de pacientes imunodeficientes, Belém, Estado do Pará

    Directory of Open Access Journals (Sweden)

    Dorotéa Lobato da Silva

    2011-10-01

    Full Text Available INTRODUCTION: Human cytomegalovirus is an opportunistic betaherpesvirus that causes persistent and serious infections in immunodeficient patients. Recurrent infections occur due to the presence of the virus in a latent state in some cell types. It is possible to examine the virus using molecular methods to aid in the immunological diagnosis and to generate a molecular viral profile in immunodeficient patients. The objective of this study was to characterize cytomegalovirus genotypes and to generate the epidemiological and molecular viral profile in immunodeficient patients. METHODS: A total of 105 samples were collected from immunodeficient patients from the City of Belém, including newborns, hemodialysis patients, transplant recipients and HIV+ patients. An IgG and IgM antibody study was completed using ELISA, and enzymatic analysis by restriction fragment length polymorphism (RFLP was performed to characterize viral genotypes. RESULTS: It was observed that 100% of the patients had IgG antibodies, 87% of which were IgG+/IgM-, consistent with a prior infection profile, 13% were IgG+/IgM+, suggestive of recent infection. The newborn group had the highest frequency (27% of the IgG+/IgM+ profile. By RFLP analysis, only one genotype was observed, gB2, which corresponded to the standard AD169 strain. CONCLUSIONS: The presence of IgM antibodies in new borns indicates that HCMV continues to be an important cause of congenital infection. The low observed genotypic diversity could be attributed to the small sample size because newborns were excluded from the RFLP analysis. This study will be continued including samples from newborns to extend the knowledge of the general and molecular epidemiology of HCMV in immunodeficient patients.INTRODUÇÃO: O citomegalovírus é um betaherpesvírus oportunista, causador de infecções persistentes e graves em pacientes imunodeficientes. As infecções recorrentes ocorrem devido à presença do vírus em estado de

  2. Modification-dependent restriction endonuclease, MspJI, flips 5-methylcytosine out of the DNA helix.

    Science.gov (United States)

    Horton, John R; Wang, Hua; Mabuchi, Megumu Yamada; Zhang, Xing; Roberts, Richard J; Zheng, Yu; Wilson, Geoffrey G; Cheng, Xiaodong

    2014-10-29

    MspJI belongs to a family of restriction enzymes that cleave DNA containing 5-methylcytosine (5mC) or 5-hydroxymethylcytosine (5hmC). MspJI is specific for the sequence 5(h)mC-N-N-G or A and cleaves with some variability 9/13 nucleotides downstream. Earlier, we reported the crystal structure of MspJI without DNA and proposed how it might recognize this sequence and catalyze cleavage. Here we report its co-crystal structure with a 27-base pair oligonucleotide containing 5mC. This structure confirms that MspJI acts as a homotetramer and that the modified cytosine is flipped from the DNA helix into an SRA-like-binding pocket. We expected the structure to reveal two DNA molecules bound specifically to the tetramer and engaged with the enzyme's two DNA-cleavage sites. A coincidence of crystal packing precluded this organization, however. We found that each DNA molecule interacted with two adjacent tetramers, binding one specifically and the other non-specifically. The latter interaction, which prevented cleavage-site engagement, also involved base flipping and might represent the sequence-interrogation phase that precedes specific recognition. MspJI is unusual in that DNA molecules are recognized and cleaved by different subunits. Such interchange of function might explain how other complex multimeric restriction enzymes act. © The Author(s) 2014. Published by Oxford University Press on behalf of Nucleic Acids Research.

  3. Depletion of Ascorbic Acid Restricts Angiogenesis and Retards Tumor Growth in a Mouse Model

    Directory of Open Access Journals (Sweden)

    Sucheta Telang

    2007-01-01

    Full Text Available Angiogenesis requires the deposition of type IV collagen by endothelial cells into the basement membrane of new blood vessels. Stabilization of type IV collagen triple helix depends on the hydroxylation of proline, which is catalyzed by the iron-containing enzyme prolyl hydroxylase. This enzyme, in turn, requires ascorbic acid to maintain the enzyme-bound iron in its reduced state. We hypothesized that dietary ascorbic acid might be required for tumor angiogenesis and, therefore, tumor growth. Here, we show that, not surprisingly, ascorbic acid is necessary for the synthesis of collagen type IV by human endothelial cells and for their effective migration and tube formation on a basement membrane matrix. Furthermore, ascorbic acid depletion in mice incapable of synthesizing ascorbic acid (Gulo-/- dramatically restricts the in vivo growth of implanted Lewis lung carcinoma tumors. Histopathological analyses of these tumors reveal poorly formed blood vessels, extensive hemorrhagic foci, and decreased collagen and von Willebrand factor expression. Our data indicate that ascorbic acid plays an essential role in tumor angiogenesis and growth, and that restriction of ascorbic acid or pharmacological inhibition of prolyl hydroxylase may prove to be novel therapeutic approaches to the treatment of cancer.

  4. Rat Neutrophil Phagocytosis Following Feed Restriction

    Czech Academy of Sciences Publication Activity Database

    Slapničková, Martina; Berger, J.

    2002-01-01

    Roč. 11, č. 3 (2002), s. 172-177 ISSN 0938-7714 Institutional research plan: CEZ:AV0Z5052915 Keywords : circulating neutrophil * diet restriction * phagocytosis Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 0.167, year: 2001

  5. 12 CFR 1805.808 - Lobbying restrictions.

    Science.gov (United States)

    2010-01-01

    ... 12 Banks and Banking 7 2010-01-01 2010-01-01 false Lobbying restrictions. 1805.808 Section 1805.808 Banks and Banking COMMUNITY DEVELOPMENT FINANCIAL INSTITUTIONS FUND, DEPARTMENT OF THE TREASURY COMMUNITY DEVELOPMENT FINANCIAL INSTITUTIONS PROGRAM Terms and Conditions of Assistance § 1805.808 Lobbying...

  6. 50 CFR 16.3 - General restrictions.

    Science.gov (United States)

    2010-10-01

    ... INJURIOUS WILDLIFE Introduction § 16.3 General restrictions. Any importation or transportation of live... and welfare of human beings, to the interest of forestry, agriculture, and horticulture, and to the... into or the transportation of live wildlife or eggs thereof between the continental United States, the...

  7. Restrictive cardiomyopathy. Report of seven cases

    Directory of Open Access Journals (Sweden)

    Fonseca Sánchez Luis Alfonso

    2014-07-01

    Full Text Available Restrictive cardiomyopathy is a disease characterized by ventricular diastolic failure with elevation of end-dyastolic pressure and preserved systolic function. Materials and methods: retrospective study of patients with a diagnosis of restrictive cardiomyopathy. We carry out an analysis of demographic data, clinical presentation, and studies of patients diagnosed in the last 15 years at Instituto Nacional de Pediatría. Results: all included patients had clinical data of heart failure manifested mainly by medium-sized efforts dyspnea on schoolchildren and dyspnea by feeding in infants, as well as polypnea and diaphoresis. The most important signs were hepatomegaly, ascites, and gallop rhythm. Cardiomegaly by right atrial dilatation was the most frequent radiological data. The most frequent electrocardiographic data were dilatation of both atria, ST-segment depression and negative T waves. Echocardiogram showed in all cases binaural dilation and restrictive pattern. Conclusions: our patients were similar to those described in the specialized literature. Echocardiogram is still the best study for the diagnosis and the use of functional measurements as Doppler imaging can help to reveal early diastolic failure. In our country the heart transplant is just feasible; mortality remains 100%. Keywords: Restrictive cardiomyopathy, Heart failure, Cardiomyopathy.

  8. 18 CFR 35.39 - Affiliate restrictions.

    Science.gov (United States)

    2010-04-01

    ... with a market-regulated power sales affiliate if the sharing could be used to the detriment of captive... 18 Conservation of Power and Water Resources 1 2010-04-01 2010-04-01 false Affiliate restrictions. 35.39 Section 35.39 Conservation of Power and Water Resources FEDERAL ENERGY REGULATORY COMMISSION...

  9. Restricting mutualistic partners to enforce trade reliance

    NARCIS (Netherlands)

    Wyatt, G.A.K.; Kiers, E.T.; Gardner, A.

    2016-01-01

    Mutualisms are cooperative interactions between members of different species, often involving the trade of resources. Here, we suggest that otherwise-cooperative mutualists might be able to gain a benefit from actively restricting their partners' ability to obtain resources directly, hampering the

  10. Activity limitations and participation restrictions experienced by ...

    African Journals Online (AJOL)

    Cite as: Urimubenshi G. Activity limitations and participation restrictions experienced by people with stroke in Musanze district in Rwanda. Afri Health ..... analysis in nursing research: concepts, procedures and measures to achieve trustworthiness. Nurse Education To- day 2004, 24(2), 105–112. 20. Lincoln YS, Guba EA.

  11. Perceived and experienced restrictions in participation and ...

    African Journals Online (AJOL)

    Perceived and experienced restrictions in participation and autonomy among adult survivors of stroke in Ghana. ... There were significant differences in two domains between survivors who received physiotherapy and those who received traditional rehabilitation. Over half of the survivors also perceived they would ...

  12. 50 CFR 654.22 - Gear restrictions.

    Science.gov (United States)

    2010-10-01

    ... 50 Wildlife and Fisheries 8 2010-10-01 2010-10-01 false Gear restrictions. 654.22 Section 654.22..., DEPARTMENT OF COMMERCE STONE CRAB FISHERY OF THE GULF OF MEXICO Management Measures § 654.22 Gear... be located on the top horizontal section of the trap. If the throat is longer in one dimension, the...

  13. Restricted Liberty, Parental Choice and Homeschooling

    Science.gov (United States)

    Merry, Michael S.; Karsten, Sjoerd

    2010-01-01

    In this paper the authors carefully study the problem of liberty as it applies to school choice, and whether there ought to be restricted liberty in the case of homeschooling. They examine three prominent concerns that might be brought against homeschooling, viz., that it aggravates social inequality, worsens societal conflict and works against…

  14. Restricted liberty, parental choice and homeschooling

    NARCIS (Netherlands)

    Merry, M.S.; Karsten, S.

    2010-01-01

    In this paper the authors carefully study the problem of liberty as it applies to school choice, and whether there ought to be restricted liberty in the case of homeschooling. They examine three prominent concerns that might be brought against homeschooling, viz., that it aggravates social

  15. 7 CFR 400.407 - Restricted access.

    Science.gov (United States)

    2010-01-01

    ... 7 Agriculture 6 2010-01-01 2010-01-01 false Restricted access. 400.407 Section 400.407 Agriculture Regulations of the Department of Agriculture (Continued) FEDERAL CROP INSURANCE CORPORATION, DEPARTMENT OF AGRICULTURE GENERAL ADMINISTRATIVE REGULATIONS General Administrative Regulations; Collection and Storage of...

  16. 32 CFR 770.6 - Restrictions.

    Science.gov (United States)

    2010-07-01

    ... 32 National Defense 5 2010-07-01 2010-07-01 false Restrictions. 770.6 Section 770.6 National Defense Department of Defense (Continued) DEPARTMENT OF THE NAVY MISCELLANEOUS RULES RULES LIMITING PUBLIC ACCESS TO PARTICULAR INSTALLATIONS Hunting and Fishing at Marine Corps Base, Quantico, Virginia § 770.6...

  17. Preventive maintenance at opportunities of restricted duration

    NARCIS (Netherlands)

    R. Dekker (Rommert); E. Smeitink

    1994-01-01

    textabstractThis article deals with the problem of setting priorities for the execution of maintenance packages at randomly occurring opportunities. These opportunities are of restricted duration, implying that only a limited number of packages can be executed. The main idea proposed is to set up a

  18. Nutrigenetics and nutrigenomics of caloric restriction.

    Science.gov (United States)

    Abete, Itziar; Navas-Carretero, Santiago; Marti, Amelia; Martinez, J Alfredo

    2012-01-01

    Obesity is a complex disease resulting from a chronic and long-term positive energy balance in which both genetic and environmental factors are involved. Weight-reduction methods are mainly focused on dietary changes and increased physical activity. However, responses to nutritional intervention programs show a wide range of interindividual variation, which is importantly influenced by genetic determinants. In this sense, subjects carrying several obesity-related single-nucleotide polymorphisms (SNPs) show differences in the response to calorie-restriction programs. Furthermore, there is evidence indicating that dietary components not only fuel the body but also participate in the modulation of gene expression. Thus, the expression pattern and nutritional regulation of several obesity-related genes have been studied, as well as those that are differentially expressed by caloric restriction. The responses to caloric restriction linked to the presence of SNPs in obesity-related genes are reviewed in this chapter. Also, the influence of energy restriction on gene expression pattern in different tissues is addressed. Copyright © 2012 Elsevier Inc. All rights reserved.

  19. 42 CFR 2.13 - Confidentiality restrictions.

    Science.gov (United States)

    2010-10-01

    ... CONFIDENTIALITY OF ALCOHOL AND DRUG ABUSE PATIENT RECORDS General Provisions § 2.13 Confidentiality restrictions..., administrative, or legislative proceedings conducted by any Federal, State, or local authority. Any disclosure... place where only alcohol or drug abuse diagnosis, treatment, or referral is provided may be acknowledged...

  20. Optimal Policy under Restricted Government Spending

    DEFF Research Database (Denmark)

    Sørensen, Anders

    2006-01-01

    Welfare ranking of policy instruments is addressed in a two-sector Ramsey model with monopoly pricing in one sector as the only distortion. When government spending is restricted, i.e. when a government is unable or unwilling to finance the required costs for implementing the optimum policy...

  1. 47 CFR 64.1200 - Delivery restrictions.

    Science.gov (United States)

    2010-10-01

    ... RULES RELATING TO COMMON CARRIERS Restrictions on Telemarketing, Telephone Solicitation, and Facsimile... telemarketing call prior to at least 15 seconds or four (4) rings. (6) Abandon more than three percent of all telemarketing calls that are answered live by a person, or measured over a 30-day period. A call is “abandoned...

  2. Epigenetic regulation of caloric restriction in aging

    Directory of Open Access Journals (Sweden)

    Daniel Michael

    2011-08-01

    Full Text Available Abstract The molecular mechanisms of aging are the subject of much research and have facilitated potential interventions to delay aging and aging-related degenerative diseases in humans. The aging process is frequently affected by environmental factors, and caloric restriction is by far the most effective and established environmental manipulation for extending lifespan in various animal models. However, the precise mechanisms by which caloric restriction affects lifespan are still not clear. Epigenetic mechanisms have recently been recognized as major contributors to nutrition-related longevity and aging control. Two primary epigenetic codes, DNA methylation and histone modification, are believed to dynamically influence chromatin structure, resulting in expression changes of relevant genes. In this review, we assess the current advances in epigenetic regulation in response to caloric restriction and how this affects cellular senescence, aging and potential extension of a healthy lifespan in humans. Enhanced understanding of the important role of epigenetics in the control of the aging process through caloric restriction may lead to clinical advances in the prevention and therapy of human aging-associated diseases.

  3. Periodic Solutions for Circular Restricted -Body Problems

    Directory of Open Access Journals (Sweden)

    Xiaoxiao Zhao

    2013-01-01

    Full Text Available For circular restricted -body problems, we study the motion of a sufficiently small mass point (called the zero mass point in the plane of equal masses located at the vertices of a regular polygon. By using variational minimizing methods, for some , we prove the existence of the noncollision periodic solution for the zero mass point with some fixed wingding number.

  4. Restricting temptations : Neural mechanisms of precommitment

    NARCIS (Netherlands)

    Crockett, M.J.; Braams, B.R.; Clark, L.; Tobler, P.N.; Robbins, T.W.; Kalenscher, T.

    2013-01-01

    Humans can resist temptations by exerting willpower, the effortful inhibition of impulses. But willpower can be disrupted by emotions and depleted over time. Luckily, humans can deploy alternative self-control strategies like precommitment, the voluntary restriction of access to temptations. Here,

  5. Legal Status of Diplomats: Duties, Restrictions, Prohibitions

    Directory of Open Access Journals (Sweden)

    Tigran Antonovich Zanko

    2014-01-01

    Full Text Available This article provides analysis of such elements of the legal status of diplomats as obligations, prohibitions, restrictions and responsibility. Elements of the legal status are evaluated through the lens of comparative research and include the experience of diplomatic service legal regulation in the former Soviet Union countries as well as in other foreign countries.

  6. Sexual Arousal, Situational Restrictiveness, and Aggressive Behavior

    Science.gov (United States)

    Frodi, Ann

    1977-01-01

    Eighty male college freshmen participated in an experiment designed to investigate the hypothesis that enhanced arousal will facilitate subsequent aggressive behavior and that an increase in aggressive behavior will be more likely to occur in a setting of situational permissiveness rather than situational restrictiveness. (Editor)

  7. Restrictive lung involvement in facioscapulohumeral muscular dystrophy.

    Science.gov (United States)

    Scully, Michele A; Eichinger, Katy J; Donlin-Smith, Colleen M; Tawil, Rabi; Statland, Jeffery M

    2014-11-01

    Few studies have evaluated the frequency or predisposing factors for respiratory involvement in facioscapulohumeral muscular dystrophy type 1 (FSHD1) and type 2 (FSHD2). We performed a prospective cross-sectional observational study of 61 genetically confirmed FSHD participants (53 FSHD1 and 8 FSHD2). Participants underwent bedside pulmonary function testing in sitting and supine positions, a standard clinical history and physical assessment, and manual muscle testing. Restrictive respiratory involvement was suggested in 9.8% (95% confidence interval 2.4-17.3): 7.5% FSHD1 and 25.0% FSHD2 (P = 0.17). Participants with testing suggestive of restrictive lung involvement (n = 6) were more severely affected (P = 0.005), had weaker hip flexion (P = 0.0007), and were more likely to use a wheelchair (P = 0.01). Restrictive respiratory involvement should be considered in all moderate to severely affected FSHD patients with proximal lower extremity weakness. The higher frequency of restrictive lung disease in FSHD2 seen here requires confirmation in a larger cohort of FSHD2 patients. © Published 2014 by Wiley Periodicals, Inc.

  8. Restrictive dermopathy - Report of 12 cases

    NARCIS (Netherlands)

    Smitt, JHS; van Asperen, CJ; Niessen, CM; Beemer, FA; van Essen, AJ; Hulsmans, RFHJ; Oranje, AP; Steijlen, PM; Wesby-van Swaay, E; Tamminga, P; Breslau-Siderius, EJ

    Background: This study describes 12 cases of restrictive dermopathy seen during a period of 8 years by the Dutch Task Force on Genodermatology. We present these unique consecutive cases to provide more insight into the clinical picture and pathogenesis of the disease. Observations: Clinical features

  9. Mutational remodeling of enzyme specificity.

    Science.gov (United States)

    Bone, R; Agard, D A

    1991-01-01

    With the advent of genetic engineering techniques has come the ability to modify proteins as desired. Given this stunning capability, the question remains what residues should be altered, and how should they be changed to achieve a particular specificity pattern. The goals of such modifications are likely to fall into either of two categories: probing the function of a protein or attempting to alter its properties. In either case, our understanding of the consequences of a mutation, as ascertained by our ability to predict the results, is currently quite limited. The problem is extraordinarily complex; our understanding of how to calculate the energetics involved is still incomplete, and we are just beginning to accumulate experimental data which may help guide us. On the positive side, theoretical methods are now being developed and refined that should prove useful in the drive to engineer enzyme specificity. What may be most important at this juncture is to expand the experimental database interrelating sequence, function, and structure. That is, there should be a concerted effort to combine functional analysis of mutant proteins with structural analysis. Only from this combined examination of the effects of mutations can sufficient data be accumulated to test and improve both qualitative and quantitative approaches or methods for remodeling enzyme specificity.

  10. 7 CFR 322.28 - General requirements; restricted articles.

    Science.gov (United States)

    2010-01-01

    ... 7 Agriculture 5 2010-01-01 2010-01-01 false General requirements; restricted articles. 322.28... EQUIPMENT Importation and Transit of Restricted Articles § 322.28 General requirements; restricted articles. (a) The following articles from any region are restricted articles: (1) Dead bees of any genus; (2...

  11. 7 CFR 319.75-2 - Restricted articles. 1

    Science.gov (United States)

    2010-01-01

    ... 7 Agriculture 5 2010-01-01 2010-01-01 false Restricted articles. 1 319.75-2 Section 319.75-2... SERVICE, DEPARTMENT OF AGRICULTURE FOREIGN QUARANTINE NOTICES Khapra Beetle § 319.75-2 Restricted articles. 1 1 The importation of restricted articles may be subject to prohibitions or restrictions under...

  12. Culturable heterotrophic bacteria from Potter Cove, Antarctica, and their hydrolytic enzymes production

    OpenAIRE

    Vázquez, Susana; Tropeano, Mauro; Coria, Silvia; Turjanski, Adrían; Cicero, Daniel; Bercovich, Andrés; Mac Cormack, Walter

    2012-01-01

    Affiliations of the dominant culturable bacteria isolated from Potter Cove, South Shetland Islands, Antarctica, were investigated together with their production of cold-active hydrolytic enzymes. A total of 189 aerobic heterotrophic bacterial isolates were obtained at 4°C and sorted into 63 phylotypes based on their amplified ribosomal DNA restriction analysis profiles. The sequencing of the 16S rRNA genes of representatives from each phylotype showed that the isolates belong to the phyla Pro...

  13. Evaluation of thermostable enzymes for bioethanol processing

    DEFF Research Database (Denmark)

    Skovgaard, Pernille Anastasia

    for the ioethanol production, but the expenses can be reduced by using thermostable enzymes, which are known for their increased stability and inhibitor olerance. However, the advantage of using thermostable enzymes has not been studied thoroughly and more knowledge is needed for development of bioethanol processes...... concentration reduced the stability of the enzymes, while addition of polyethylene glycol (PEG) had the opposite effect. In addition, thermostable enzymes retained more activity when tested in a pilot distillation setup, where the enzymes were exposed to increasing temperature and air-liquid interfaces (chapter......, thermostable enzymes were shown to be more efficient than mesophilic enzymes when it came to temperature, inhibitor tolerance and stability against air-liquid forces....

  14. DNA-Based Enzyme Reactors and Systems

    Directory of Open Access Journals (Sweden)

    Veikko Linko

    2016-07-01

    Full Text Available During recent years, the possibility to create custom biocompatible nanoshapes using DNA as a building material has rapidly emerged. Further, these rationally designed DNA structures could be exploited in positioning pivotal molecules, such as enzymes, with nanometer-level precision. This feature could be used in the fabrication of artificial biochemical machinery that is able to mimic the complex reactions found in living cells. Currently, DNA-enzyme hybrids can be used to control (multi-enzyme cascade reactions and to regulate the enzyme functions and the reaction pathways. Moreover, sophisticated DNA structures can be utilized in encapsulating active enzymes and delivering the molecular cargo into cells. In this review, we focus on the latest enzyme systems based on novel DNA nanostructures: enzyme reactors, regulatory devices and carriers that can find uses in various biotechnological and nanomedical applications.

  15. The EcoKI Type I Restriction-Modification System in Escherichia coli Affects but Is Not an Absolute Barrier for Conjugation

    DEFF Research Database (Denmark)

    Roer, Louise; Aarestrup, Frank Møller; Hasman, Henrik

    2015-01-01

    results about restriction-modification systems based on phenotypic studies have been presented as reasons for a barrier to conjugation with and other means of uptake of exogenous DNA. In this study, we show that inactivation of the R.EcoKI restriction enzyme in strain Escherichia coli K-12 strain MG1655...... of the mutant recipient with a disrupted hsdR gene. This leads to the conclusion that EcoKI restriction-modification affects the uptake of DNA by conjugation but is not a major barrier to plasmid transfer....

  16. Bifunctional TaqII restriction endonuclease: redefining the prototype DNA recognition site and establishing the Fidelity Index for partial cleaving

    Directory of Open Access Journals (Sweden)

    Żylicz-Stachula Agnieszka

    2011-12-01

    Full Text Available Abstract Background The TaqII enzyme is a member of the Thermus sp. enzyme family that we propounded previously within Type IIS restriction endonucleases, containing related thermophilic bifunctional endonucleases-methyltransferases from various Thermus sp.: TaqII, Tth111II, TthHB27I, TspGWI, TspDTI and TsoI. These enzymes show significant nucleotide and amino acid sequence similarities, a rare phenomenon among restriction endonucleases, along with similarities in biochemical properties, molecular size, DNA recognition sequences and cleavage sites. They also feature some characteristics of Types I and III. Results Barker et al. reported the Type IIS/IIC restriction endonuclease TaqII as recognizing two distinct cognate site variants (5'-GACCGA-3' and 5'-CACCCA-3' while cleaving 11/9 nucleotides downstream. We used four independent methods, namely, shotgun cloning and sequencing, restriction pattern analysis, digestion of particular custom substrates and GeneScan analysis, to demonstrate that the recombinant enzyme recognizes only 5'-GACCGA-3' sites and cleaves 11/9 nucleotides downstream. We did not observe any 5'-CACCCA-3' cleavage under a variety of conditions and site arrangements tested. We also characterized the enzyme biochemically and established new digestion conditions optimal for practical enzyme applications. Finally, we developed and propose a new version of the Fidelity Index - the Fidelity Index for Partial Cleavage (FI-PC. Conclusions The DNA recognition sequence of the bifunctional prototype TaqII endonuclease-methyltransferase from Thermus aquaticus has been redefined as recognizing only 5'-GACCGA-3' cognate sites. The reaction conditions (pH and salt concentrations were designed either to minimize (pH = 8.0 and 10 mM ammonium sulphate or to enhance star activity (pH = 6.0 and no salt. Redefinition of the recognition site and reaction conditions makes this prototype endonuclease a useful tool for DNA manipulation; as yet, this

  17. Bifunctional TaqII restriction endonuclease: redefining the prototype DNA recognition site and establishing the Fidelity Index for partial cleaving.

    Science.gov (United States)

    Zylicz-Stachula, Agnieszka; Zołnierkiewicz, Olga; Sliwińska, Katarzyna; Jeżewska-Frąckowiak, Joanna; Skowron, Piotr M

    2011-12-05

    The TaqII enzyme is a member of the Thermus sp. enzyme family that we propounded previously within Type IIS restriction endonucleases, containing related thermophilic bifunctional endonucleases-methyltransferases from various Thermus sp.: TaqII, Tth111II, TthHB27I, TspGWI, TspDTI and TsoI. These enzymes show significant nucleotide and amino acid sequence similarities, a rare phenomenon among restriction endonucleases, along with similarities in biochemical properties, molecular size, DNA recognition sequences and cleavage sites. They also feature some characteristics of Types I and III. Barker et al. reported the Type IIS/IIC restriction endonuclease TaqII as recognizing two distinct cognate site variants (5'-GACCGA-3' and 5'-CACCCA-3') while cleaving 11/9 nucleotides downstream. We used four independent methods, namely, shotgun cloning and sequencing, restriction pattern analysis, digestion of particular custom substrates and GeneScan analysis, to demonstrate that the recombinant enzyme recognizes only 5'-GACCGA-3' sites and cleaves 11/9 nucleotides downstream. We did not observe any 5'-CACCCA-3' cleavage under a variety of conditions and site arrangements tested. We also characterized the enzyme biochemically and established new digestion conditions optimal for practical enzyme applications. Finally, we developed and propose a new version of the Fidelity Index - the Fidelity Index for Partial Cleavage (FI-PC). The DNA recognition sequence of the bifunctional prototype TaqII endonuclease-methyltransferase from Thermus aquaticus has been redefined as recognizing only 5'-GACCGA-3' cognate sites. The reaction conditions (pH and salt concentrations) were designed either to minimize (pH = 8.0 and 10 mM ammonium sulphate) or to enhance star activity (pH = 6.0 and no salt). Redefinition of the recognition site and reaction conditions makes this prototype endonuclease a useful tool for DNA manipulation; as yet, this enzyme has no practical applications. The extension of

  18. A Biotin Biosynthesis Gene Restricted to Helicobacter

    Science.gov (United States)

    Bi, Hongkai; Zhu, Lei; Jia, Jia; Cronan, John E.

    2016-01-01

    In most bacteria the last step in synthesis of the pimelate moiety of biotin is cleavage of the ester bond of pimeloyl-acyl carrier protein (ACP) methyl ester. The paradigm cleavage enzyme is Escherichia coli BioH which together with the BioC methyltransferase allows synthesis of the pimelate moiety by a modified fatty acid biosynthetic pathway. Analyses of the extant bacterial genomes showed that bioH is absent from many bioC-containing bacteria and is replaced by other genes. Helicobacter pylori lacks a gene encoding a homologue of the known pimeloyl-ACP methyl ester cleavage enzymes suggesting that it encodes a novel enzyme that cleaves this intermediate. We isolated the H. pylori gene encoding this enzyme, bioV, by complementation of an E. coli bioH deletion strain. Purified BioV cleaved the physiological substrate, pimeloyl-ACP methyl ester to pimeloyl-ACP by use of a catalytic triad, each member of which was essential for activity. The role of BioV in biotin biosynthesis was demonstrated using a reconstituted in vitro desthiobiotin synthesis system. BioV homologues seem the sole pimeloyl-ACP methyl ester esterase present in the Helicobacter species and their occurrence only in H. pylori and close relatives provide a target for development of drugs to specifically treat Helicobacter infections. PMID:26868423

  19. Type II restriction endonucleases—a historical perspective and more

    Science.gov (United States)

    Pingoud, Alfred; Wilson, Geoffrey G.; Wende, Wolfgang

    2014-01-01

    This article continues the series of Surveys and Summaries on restriction endonucleases (REases) begun this year in Nucleic Acids Research. Here we discuss ‘Type II’ REases, the kind used for DNA analysis and cloning. We focus on their biochemistry: what they are, what they do, and how they do it. Type II REases are produced by prokaryotes to combat bacteriophages. With extreme accuracy, each recognizes a particular sequence in double-stranded DNA and cleaves at a fixed position within or nearby. The discoveries of these enzymes in the 1970s, and of the uses to which they could be put, have since impacted every corner of the life sciences. They became the enabling tools of molecular biology, genetics and biotechnology, and made analysis at the most fundamental levels routine. Hundreds of different REases have been discovered and are available commercially. Their genes have been cloned, sequenced and overexpressed. Most have been characterized to some extent, but few have been studied in depth. Here, we describe the original discoveries in this field, and the properties of the first Type II REases investigated. We discuss the mechanisms of sequence recognition and catalysis, and the varied oligomeric modes in which Type II REases act. We describe the surprising heterogeneity revealed by comparisons of their sequences and structures. PMID:24878924

  20. Type II restriction endonucleases--a historical perspective and more.

    Science.gov (United States)

    Pingoud, Alfred; Wilson, Geoffrey G; Wende, Wolfgang

    2014-07-01

    This article continues the series of Surveys and Summaries on restriction endonucleases (REases) begun this year in Nucleic Acids Research. Here we discuss 'Type II' REases, the kind used for DNA analysis and cloning. We focus on their biochemistry: what they are, what they do, and how they do it. Type II REases are produced by prokaryotes to combat bacteriophages. With extreme accuracy, each recognizes a particular sequence in double-stranded DNA and cleaves at a fixed position within or nearby. The discoveries of these enzymes in the 1970s, and of the uses to which they could be put, have since impacted every corner of the life sciences. They became the enabling tools of molecular biology, genetics and biotechnology, and made analysis at the most fundamental levels routine. Hundreds of different REases have been discovered and are available commercially. Their genes have been cloned, sequenced and overexpressed. Most have been characterized to some extent, but few have been studied in depth. Here, we describe the original discoveries in this field, and the properties of the first Type II REases investigated. We discuss the mechanisms of sequence recognition and catalysis, and the varied oligomeric modes in which Type II REases act. We describe the surprising heterogeneity revealed by comparisons of their sequences and structures. © The Author(s) 2014. Published by Oxford University Press on behalf of Nucleic Acids Research.