International Nuclear Information System (INIS)
Shannon, M.F.; Gamble, J.R.; Vadas, M.A.
1988-01-01
The gene for human granulocyte/macrophage colony-stimulating factor (GM-CSF) is expressed in a tissue-specific as well as an activation-dependent manner. The interaction of nuclear proteins with the promoter region of the GM-CSF gene that is likely to be responsible for this pattern of GM-CSF expression was investigated. The authors show that nuclear proteins interact with DNA fragments from the GM-CSF promoter in a cell-specific manner. A region spanning two cytokine-specific sequences, cytokine 1 (CK-1, 5', GAGATTCCAC 3') and cytokine 2 (CK-2, 5' TCAGGTA 3') bound two nuclear proteins from GM-CSF-expressing cells in gel retardation assays. NF-GMb was inducible with phorbol 12-myristate 13-acetate and accompanied induction of GM-CSF message. NF-GMb was absent in cell lines not producing GM-CSF, some of which had other distinct binding proteins. NF-GMa and NF-GMb eluted from a heparin-Sepharose column at 0.3 and 0.6 M KCl, respectively. They hypothesize that the sequences CK-1 and CK-2 bind specific proteins and regulate GM-CSF transcription
International Nuclear Information System (INIS)
Apostolaki, Angeliki; Kalosakas, George
2011-01-01
We mapped promoter regions of double-stranded DNA with respect to the probabilities of appearance of relatively large bubble openings exclusively due to thermal fluctuations at physiological temperatures. We analyzed five well-studied promoter regions of procaryotic type and found a spatial correlation between the binding sites of transcription factors and the position of peaks in the probability pattern of large thermal openings. Other distinct peaks of the calculated patterns correlate with potential binding sites of DNA-binding proteins. These results suggest that a DNA molecule would more frequently expose the bases that participate in contacts with proteins, which would probably enhance the probability of the latter to reach their targets. It also stands for using this method as a means to analyze DNA sequences based on their intrinsic thermal properties
International Nuclear Information System (INIS)
Kita, Atsushi; Yamasaki, Hironori; Kuwahara, Hironaga; Moriuchi, Akie; Fukushima, Keiko; Kobayashi, Masakazu; Fukushima, Tetsuya; Takahashi, Ryoko; Abiru, Norio; Uotani, Shigeo; Kawasaki, Eiji; Eguchi, Katsumi
2005-01-01
Adiponectin, an adipose tissue-specific plasma protein, is involved in insulin sensitizing and has anti-atherosclerotic properties. Plasma levels of adiponectin are decreased in obese individuals and patients with type 2 diabetes with insulin resistance. Tumor necrosis factor-α (TNF-α) decreases the expression of adiponectin in adipocytes. The aims of the present study were: (1) to identify the promoter region responsible for basal transcription of the human adiponectin gene, and (2) to investigate the mechanism by which adiponectin was regulated by TNF-α. The human adiponectin promoter (2.1 kb) was isolated and used for luciferase reporter analysis by transient transfection into 3T3-L1 adipocytes. Deletion analysis demonstrated that the promoter region from -676 to +41 was sufficient for basal transcriptional activity. Mutation analysis of putative response elements for sterol regulatory element binding protein (SREBP) (-431 to -423) and CCAAT/enhancer binding protein (C/EBP) (-230 to -224) showed that both elements were required for basal promoter activity. Adiponectin transcription was increased 3-fold in cells that over-expressed constitutively active C/EBP-β. Electrophoretic mobility shift assay, using nuclear extract from 3T3-L1 cells and the -258 to -199 region as a probe, demonstrated specific DNA-protein binding, which was abolished by TNF-α treatment. The present data indicate that the putative response elements for SREBP and C/EBP are required for human adiponectin promoter activity, and that suppression by TNF-α may, at least in part, be associated with inactivation of C/EBP-β
Interplay between chaperones and protein disorder promotes the evolution of protein networks.
Directory of Open Access Journals (Sweden)
Sebastian Pechmann
2014-06-01
Full Text Available Evolution is driven by mutations, which lead to new protein functions but come at a cost to protein stability. Non-conservative substitutions are of interest in this regard because they may most profoundly affect both function and stability. Accordingly, organisms must balance the benefit of accepting advantageous substitutions with the possible cost of deleterious effects on protein folding and stability. We here examine factors that systematically promote non-conservative mutations at the proteome level. Intrinsically disordered regions in proteins play pivotal roles in protein interactions, but many questions regarding their evolution remain unanswered. Similarly, whether and how molecular chaperones, which have been shown to buffer destabilizing mutations in individual proteins, generally provide robustness during proteome evolution remains unclear. To this end, we introduce an evolutionary parameter λ that directly estimates the rate of non-conservative substitutions. Our analysis of λ in Escherichia coli, Saccharomyces cerevisiae, and Homo sapiens sequences reveals how co- and post-translationally acting chaperones differentially promote non-conservative substitutions in their substrates, likely through buffering of their destabilizing effects. We further find that λ serves well to quantify the evolution of intrinsically disordered proteins even though the unstructured, thus generally variable regions in proteins are often flanked by very conserved sequences. Crucially, we show that both intrinsically disordered proteins and highly re-wired proteins in protein interaction networks, which have evolved new interactions and functions, exhibit a higher λ at the expense of enhanced chaperone assistance. Our findings thus highlight an intricate interplay of molecular chaperones and protein disorder in the evolvability of protein networks. Our results illuminate the role of chaperones in enabling protein evolution, and underline the
The architecture of mammalian ribosomal protein promoters
Directory of Open Access Journals (Sweden)
Perry Robert P
2005-02-01
Full Text Available Abstract Background Mammalian ribosomes contain 79 different proteins encoded by widely scattered single copy genes. Coordinate expression of these genes at transcriptional and post-transcriptional levels is required to ensure a roughly equimolar accumulation of ribosomal proteins. To date, detailed studies of only a very few ribosomal protein (rp promoters have been made. To elucidate the general features of rp promoter architecture, I made a detailed sequence comparison of the promoter regions of the entire set of orthologous human and mouse rp genes. Results A striking evolutionarily conserved feature of most rp genes is the separation by an intron of the sequences involved in transcriptional and translational regulation from the sequences with protein encoding function. Another conserved feature is the polypyrimidine initiator, which conforms to the consensus (Y2C+1TY(T2(Y3. At least 60 % of the rp promoters contain a largely conserved TATA box or A/T-rich motif, which should theoretically have TBP-binding capability. A remarkably high proportion of the promoters contain conserved binding sites for transcription factors that were previously implicated in rp gene expression, namely upstream GABP and Sp1 sites and downstream YY1 sites. Over 80 % of human and mouse rp genes contain a transposable element residue within 900 bp of 5' flanking sequence; very little sequence identity between human and mouse orthologues was evident more than 200 bp upstream of the transcriptional start point. Conclusions This analysis has provided some valuable insights into the general architecture of mammalian rp promoters and has identified parameters that might coordinately regulate the transcriptional activity of certain subsets of rp genes.
Directory of Open Access Journals (Sweden)
Kiran Sree Pokkuluri
2014-01-01
Full Text Available Protein coding and promoter region predictions are very important challenges of bioinformatics (Attwood and Teresa, 2000. The identification of these regions plays a crucial role in understanding the genes. Many novel computational and mathematical methods are introduced as well as existing methods that are getting refined for predicting both of the regions separately; still there is a scope for improvement. We propose a classifier that is built with MACA (multiple attractor cellular automata and MCC (modified clonal classifier to predict both regions with a single classifier. The proposed classifier is trained and tested with Fickett and Tung (1992 datasets for protein coding region prediction for DNA sequences of lengths 54, 108, and 162. This classifier is trained and tested with MMCRI datasets for protein coding region prediction for DNA sequences of lengths 252 and 354. The proposed classifier is trained and tested with promoter sequences from DBTSS (Yamashita et al., 2006 dataset and nonpromoters from EID (Saxonov et al., 2000 and UTRdb (Pesole et al., 2002 datasets. The proposed model can predict both regions with an average accuracy of 90.5% for promoter and 89.6% for protein coding region predictions. The specificity and sensitivity values of promoter and protein coding region predictions are 0.89 and 0.92, respectively.
Smolikov, Sarit; Schild-Prüfert, Kristina; Colaiácovo, Mónica P
2008-06-06
The synaptonemal complex (SC), a tripartite proteinaceous structure that forms between homologous chromosomes during meiosis, is crucial for faithful chromosome segregation. Here we identify CRA-1, a novel and conserved protein that is required for the assembly of the central region of the SC during C. elegans meiosis. In the absence of CRA-1, central region components fail to extensively localize onto chromosomes at early prophase and instead mostly surround the chromatin at this stage. Later in prophase, central region proteins polymerize along chromosome axes, but for the most part fail to connect the axes of paired homologous chromosomes. This defect results in an inability to stabilize homologous pairing interactions, altered double-strand break (DSB) repair progression, and a lack of chiasmata. Surprisingly, DSB formation and repair are required to promote the polymerization of the central region components along meiotic chromosome axes in cra-1 mutants. In the absence of both CRA-1 and any one of the C. elegans homologs of SPO11, MRE11, RAD51, or MSH5, the polymerization observed along chromosome axes is perturbed, resulting in the formation of aggregates of the SC central region proteins. While radiation-induced DSBs rescue this polymerization in cra-1; spo-11 mutants, they fail to do so in cra-1; mre-11, cra-1; rad-51, and cra-1; msh-5 mutants. Taken together, our studies place CRA-1 as a key component in promoting the assembly of a tripartite SC structure. Moreover, they reveal a scenario in which DSB formation and repair can drive the polymerization of SC components along chromosome axes in C. elegans.
Interaction of an IHF-like protein with the Rhizobium etli nifA promoter.
Benhassine, Traki; Fauvart, Maarten; Vanderleyden, Jos; Michiels, Jan
2007-06-01
The nifA gene fulfills an essential role in the regulation of nitrogen fixation genes in Rhizobium etli. Transcription analysis of the nifA gene, assessed using promoter deletions, indicated an oxygen-independent expression, threefold higher during symbiosis as compared with free-living conditions. Electrophoretic mobility shift assays using those nifA promoter deletion fragments, which were actively transcribed, demonstrated the specific interaction with R. etli cellular protein(s) resulting in the formation of two DNA-protein complexes. An interacting protein was purified by liquid chromatography on Heparin Sepharose and Mono S columns. The purified 12 kDa R. etli protein cross-reacted with antibodies directed against Escherichia coli integration host factor (IHF). Furthermore, purified E. coli IHF was able to specifically bind to the R. etli nifA promoter region. These results point to an as yet undisclosed function of IHF in the regulation of R. etli nifA expression.
DEFF Research Database (Denmark)
Gustafsson, Caj Ulrik Mattias; Lannergård, Jonas; Nilsson, Olof Rickard
2013-01-01
Many pathogens express a surface protein that binds the human complement regulator factor H (FH), as first described for Streptococcus pyogenes and the antiphagocytic M6 protein. It is commonly assumed that FH recruited to an M protein enhances virulence by protecting the bacteria against...... represents a distinct ligand-binding domain. The isolated HVRs specifically interacted with FH among all human serum proteins, interacted with the same region in FH and showed species specificity, but exhibited little or no antigenic cross-reactivity. Although these findings suggested that FH recruited...... to an M protein promotes virulence, studies in transgenic mice did not demonstrate a role for bound FH during acute infection. Moreover, phagocytosis tests indicated that ability to bind FH is neither sufficient nor necessary for S. pyogenes to resist killing in whole human blood. While these data shed...
Hasenkamp, Sandra; Telgmann, Ralph; Staessen, Jan A; Hagedorn, Claudia; Dördelmann, Corinna; Bek, Martin; Brand-Herrmann, Stefan-Martin; Brand, Eva
2008-10-01
The G protein-coupled receptor kinase 4 is involved in renal sodium handling and blood pressure regulation. Missense variants have already been tested functionally and are associated with hypertension, but no data on promoter analyses are yet available. We scanned 94 hypertensive white subjects for genetic variation and performed promoter reporter gene analyses in HEK293T, COS7, and SaOs-2 cells. Transient transfections with various full lengths and wild-type deletion constructs revealed that 1851 bp of the flanking region and 275 bp of the 5'-untranslated region were sufficient for transcriptional activities and composed a powerful cis-active element in the distal 293 bp. The -1702T and +2T alleles resulted in drastic general reductions of promoter function, whereas an activity increasing effect of +268C was cell type specific. Electrophoretic mobility-shift assay, supershift, and cotransfection analyses of transcription factor binding sites predicted in silico (Alibaba2.1/Transfac7) resulted in allele-specific binding patterns of nuclear proteins and identified the participation of CCAAT/enhancer-binding protein transcription factor family members. The G protein-coupled receptor kinase 4 core promoter resides in the first 1851 bp upstream of its transcription start site. The 4 identified genetic variants within this region exert allele-specific impact on both cell type- and stimulation-dependent transcription and may affect the expression balance of renal G protein-coupled receptor kinase 4.
Kristensen, Bodil M.; Olsen, John E.; Harris, Claire L.; Ufret-Vincenty, Rafael L.; Stålhammar-Carlemalm, Margaretha; Lindahl, Gunnar
2013-01-01
Many pathogens express a surface protein that binds the human complement regulator factor H (FH), as first described for Streptococcus pyogenes and the antiphagocytic M6 protein. It is commonly assumed that FH recruited to an M protein enhances virulence by protecting the bacteria against complement deposition and phagocytosis, but the role of FH-binding in S. pyogenes pathogenesis has remained unclear and controversial. Here, we studied seven purified M proteins for ability to bind FH and found that FH binds to the M5, M6 and M18 proteins but not the M1, M3, M4 and M22 proteins. Extensive immunochemical analysis indicated that FH binds solely to the hypervariable region (HVR) of an M protein, suggesting that selection has favored the ability of certain HVRs to bind FH. These FH-binding HVRs could be studied as isolated polypeptides that retain ability to bind FH, implying that an FH-binding HVR represents a distinct ligand-binding domain. The isolated HVRs specifically interacted with FH among all human serum proteins, interacted with the same region in FH and showed species specificity, but exhibited little or no antigenic cross-reactivity. Although these findings suggested that FH recruited to an M protein promotes virulence, studies in transgenic mice did not demonstrate a role for bound FH during acute infection. Moreover, phagocytosis tests indicated that ability to bind FH is neither sufficient nor necessary for S. pyogenes to resist killing in whole human blood. While these data shed new light on the HVR of M proteins, they suggest that FH-binding may affect S. pyogenes virulence by mechanisms not assessed in currently used model systems. PMID:23637608
Directory of Open Access Journals (Sweden)
Mattias C U Gustafsson
Full Text Available Many pathogens express a surface protein that binds the human complement regulator factor H (FH, as first described for Streptococcus pyogenes and the antiphagocytic M6 protein. It is commonly assumed that FH recruited to an M protein enhances virulence by protecting the bacteria against complement deposition and phagocytosis, but the role of FH-binding in S. pyogenes pathogenesis has remained unclear and controversial. Here, we studied seven purified M proteins for ability to bind FH and found that FH binds to the M5, M6 and M18 proteins but not the M1, M3, M4 and M22 proteins. Extensive immunochemical analysis indicated that FH binds solely to the hypervariable region (HVR of an M protein, suggesting that selection has favored the ability of certain HVRs to bind FH. These FH-binding HVRs could be studied as isolated polypeptides that retain ability to bind FH, implying that an FH-binding HVR represents a distinct ligand-binding domain. The isolated HVRs specifically interacted with FH among all human serum proteins, interacted with the same region in FH and showed species specificity, but exhibited little or no antigenic cross-reactivity. Although these findings suggested that FH recruited to an M protein promotes virulence, studies in transgenic mice did not demonstrate a role for bound FH during acute infection. Moreover, phagocytosis tests indicated that ability to bind FH is neither sufficient nor necessary for S. pyogenes to resist killing in whole human blood. While these data shed new light on the HVR of M proteins, they suggest that FH-binding may affect S. pyogenes virulence by mechanisms not assessed in currently used model systems.
Knotted vs. unknotted proteins: evidence of knot-promoting loops.
Directory of Open Access Journals (Sweden)
Raffaello Potestio
Full Text Available Knotted proteins, because of their ability to fold reversibly in the same topologically entangled conformation, are the object of an increasing number of experimental and theoretical studies. The aim of the present investigation is to assess, on the basis of presently available structural data, the extent to which knotted proteins are isolated instances in sequence or structure space, and to use comparative schemes to understand whether specific protein segments can be associated to the occurrence of a knot in the native state. A significant sequence homology is found among a sizeable group of knotted and unknotted proteins. In this family, knotted members occupy a primary sub-branch of the phylogenetic tree and differ from unknotted ones only by additional loop segments. These "knot-promoting" loops, whose virtual bridging eliminates the knot, are found in various types of knotted proteins. Valuable insight into how knots form, or are encoded, in proteins could be obtained by targeting these regions in future computational studies or excision experiments.
Promoters and proteins from Clostridium thermocellum and uses thereof
Wu, J. H. David; Newcomb, Michael
2012-11-13
The present invention relates to an inducible and a high expression nucleic acid promoter isolated from Clostridium thermocellum. These promoters are useful for directing expression of a protein or polypeptide encoded by a nucleic acid molecule operably associated with the nucleic acid promoters. The present invention also relates to nucleic acid constructs including the C. thermocellum promoters, and expression vectors and hosts containing such nucleic acid constructs. The present invention also relates to protein isolated from Clostridium thermocellum, including a repressor protein. The present invention also provides methods of using the isolated promoters and proteins from Clostridium thermocellum, including methods for directing inducible in vitro and in vivo expression of a protein or polypeptide in a host, and methods of producing ethanol from a cellulosic biomass.
Directory of Open Access Journals (Sweden)
Saroj Yadav
Full Text Available MAP7 domain containing protein 3 (MAP7D3, a newly identified microtubule associated protein, has been shown to promote microtubule assembly and stability. Its microtubule binding region has been reported to consist of two coiled coil motifs located at the N-terminus. It possesses a MAP7 domain near the C-terminus and belongs to the microtubule associated protein 7 (MAP7 family. The MAP7 domain of MAP7 protein has been shown to bind to kinesin-1; however, the role of MAP7 domain in MAP7D3 remains unknown. Based on the bioinformatics analysis of MAP7D3, we hypothesized that the MAP7 domain of MAP7D3 may have microtubule binding activity. Indeed, we found that MAP7 domain of MAP7D3 bound to microtubules as well as enhanced the assembly of microtubules in vitro. Interestingly, a longer fragment MDCT that contained the MAP7 domain (MD with the C-terminal tail (CT of the protein promoted microtubule polymerization to a greater extent than MD and CT individually. MDCT stabilized microtubules against dilution induced disassembly. MDCT bound to reconstituted microtubules with an apparent dissociation constant of 3.0 ± 0.5 µM. An immunostaining experiment showed that MDCT localized along the length of the preassembled microtubules. Competition experiments with tau indicated that MDCT shares its binding site on microtubules with tau. Further, we present evidence indicating that MDCT binds to the C-terminal tail of tubulin. In addition, MDCT could bind to tubulin in HeLa cell extract. Here, we report a microtubule binding region in the C-terminal region of MAP7D3 that may have a role in regulating microtubule assembly dynamics.
DEFF Research Database (Denmark)
Seeger, Michael; Hartmann-Petersen, Rasmus; Wilkinson, Caroline R M
2003-01-01
Fission yeast Rhp23 and Pus1 represent two families of multiubiquitin chain-binding proteins that associate with the proteasome. We show that both proteins bind to different regions of the proteasome subunit Mts4. The binding site for Pus1 was mapped to a cluster of repetitive sequences also found...... in the proteasome subunit SpRpn2 and the anaphase-promoting complex/cyclosome (APC/C) subunit Cut4. The putative role of Pus1 as a factor involved in allocation of ubiquitinylated substrates for the proteasome is discussed....
HyCCAPP as a tool to characterize promoter DNA-protein interactions in Saccharomyces cerevisiae.
Guillen-Ahlers, Hector; Rao, Prahlad K; Levenstein, Mark E; Kennedy-Darling, Julia; Perumalla, Danu S; Jadhav, Avinash Y L; Glenn, Jeremy P; Ludwig-Kubinski, Amy; Drigalenko, Eugene; Montoya, Maria J; Göring, Harald H; Anderson, Corianna D; Scalf, Mark; Gildersleeve, Heidi I S; Cole, Regina; Greene, Alexandra M; Oduro, Akua K; Lazarova, Katarina; Cesnik, Anthony J; Barfknecht, Jared; Cirillo, Lisa A; Gasch, Audrey P; Shortreed, Michael R; Smith, Lloyd M; Olivier, Michael
2016-06-01
Currently available methods for interrogating DNA-protein interactions at individual genomic loci have significant limitations, and make it difficult to work with unmodified cells or examine single-copy regions without specific antibodies. In this study, we describe a physiological application of the Hybridization Capture of Chromatin-Associated Proteins for Proteomics (HyCCAPP) methodology we have developed. Both novel and known locus-specific DNA-protein interactions were identified at the ENO2 and GAL1 promoter regions of Saccharomyces cerevisiae, and revealed subgroups of proteins present in significantly different levels at the loci in cells grown on glucose versus galactose as the carbon source. Results were validated using chromatin immunoprecipitation. Overall, our analysis demonstrates that HyCCAPP is an effective and flexible technology that does not require specific antibodies nor prior knowledge of locally occurring DNA-protein interactions and can now be used to identify changes in protein interactions at target regions in the genome in response to physiological challenges. Copyright © 2016 Elsevier Inc. All rights reserved.
Directory of Open Access Journals (Sweden)
Susanne Helm
Full Text Available During the blood meal of a Plasmodium-infected mosquito, 10 to 100 parasites are inoculated into the skin and a proportion of these migrate via the bloodstream to the liver where they infect hepatocytes. The Plasmodium liver stage, despite its clinical silence, represents a highly promising target for antimalarial drug and vaccine approaches. Successfully invaded parasites undergo a massive proliferation in hepatocytes, producing thousands of merozoites that are transported into a blood vessel to infect red blood cells. To successfully develop from the liver stage into infective merozoites, a tight regulation of gene expression is needed. Although this is a very interesting aspect in the biology of Plasmodium, little is known about gene regulation in Plasmodium parasites in general and in the liver stage in particular. We have functionally analyzed a novel promoter region of the rodent parasite Plasmodium berghei that is exclusively active during the liver stage of the parasite. To prove stage-specific activity of the promoter, GFP and luciferase reporter assays have been successfully established, allowing both qualitative and accurate quantitative analysis. To further characterize the promoter region, the transcription start site was mapped by rapid amplification of cDNA ends (5'-RACE. Using promoter truncation experiments and site-directed mutagenesis within potential transcription factor binding sites, we suggest that the minimal promoter contains more than one binding site for the recently identified parasite-specific ApiAP2 transcription factors. The identification of a liver stage-specific promoter in P. berghei confirms that the parasite is able to tightly regulate gene expression during its life cycle. The identified promoter region might now be used to study the biology of the Plasmodium liver stage, which has thus far proven problematic on a molecular level. Stage-specific expression of dominant-negative mutant proteins and
Ambigapathy, Ganesh; Zheng, Zhaoqing; Keifer, Joyce
2014-08-01
Brain-derived neurotrophic factor (BDNF) is an important regulator of neuronal development and synaptic function. The BDNF gene undergoes significant activity-dependent regulation during learning. Here, we identified the BDNF promoter regions, transcription start sites, and potential regulatory sequences for BDNF exons I-III that may contribute to activity-dependent gene and protein expression in the pond turtle Trachemys scripta elegans (tBDNF). By using transfection of BDNF promoter/luciferase plasmid constructs into human neuroblastoma SHSY5Y cells and mouse embryonic fibroblast NIH3T3 cells, we identified the basal regulatory activity of promoter sequences located upstream of each tBDNF exon, designated as pBDNFI-III. Further, through chromatin immunoprecipitation (ChIP) assays, we detected CREB binding directly to exon I and exon III promoters, while BHLHB2, but not CREB, binds within the exon II promoter. Elucidation of the promoter regions and regulatory protein binding sites in the tBDNF gene is essential for understanding the regulatory mechanisms that control tBDNF gene expression.
Protein Hydrolysates as Promoters of Non-Haem Iron Absorption
Li, Yanan; Jiang, Han; Huang, Guangrong
2017-01-01
Iron (Fe) is an essential micronutrient for human growth and health. Organic iron is an excellent iron supplement due to its bioavailability. Both amino acids and peptides improve iron bioavailability and absorption and are therefore valuable components of iron supplements. This review focuses on protein hydrolysates as potential promoters of iron absorption. The ability of protein hydrolysates to chelate iron is thought to be a key attribute for the promotion of iron absorption. Iron-chelatable protein hydrolysates are categorized by their absorption forms: amino acids, di- and tri-peptides and polypeptides. Their structural characteristics, including their size and amino acid sequence, as well as the presence of special amino acids, influence their iron chelation abilities and bioavailabilities. Protein hydrolysates promote iron absorption by keeping iron soluble, reducing ferric iron to ferrous iron, and promoting transport across cell membranes into the gut. We also discuss the use and relative merits of protein hydrolysates as iron supplements. PMID:28617327
Protein Hydrolysates as Promoters of Non-Haem Iron Absorption
Directory of Open Access Journals (Sweden)
Yanan Li
2017-06-01
Full Text Available Iron (Fe is an essential micronutrient for human growth and health. Organic iron is an excellent iron supplement due to its bioavailability. Both amino acids and peptides improve iron bioavailability and absorption and are therefore valuable components of iron supplements. This review focuses on protein hydrolysates as potential promoters of iron absorption. The ability of protein hydrolysates to chelate iron is thought to be a key attribute for the promotion of iron absorption. Iron-chelatable protein hydrolysates are categorized by their absorption forms: amino acids, di- and tri-peptides and polypeptides. Their structural characteristics, including their size and amino acid sequence, as well as the presence of special amino acids, influence their iron chelation abilities and bioavailabilities. Protein hydrolysates promote iron absorption by keeping iron soluble, reducing ferric iron to ferrous iron, and promoting transport across cell membranes into the gut. We also discuss the use and relative merits of protein hydrolysates as iron supplements.
Aggregation propensity of critical regions of the protein Tau
Muthee, Micaiah; Ahmed, Azka; Larini, Luca
The Alzheimer's disease is an irreversible, progressive brain disorder that slowly destroys memory and thinking skills, which eventually leads to the ability to not able to carry out the simplest tasks. The Alzheimer's disease is characterized by the formation of protein aggregates both within and outside of the brain's cells, the neurons. Within the neurons, the aggregation of the protein tau leads to the destruction of the microtubules in the axon of the neuron. Tau belongs to a group of proteins referred to as Microtubule-Associated Proteins. It is extremely flexible and is classified as an intrinsically unstructured protein due to its low propensity to form secondary structure. Tau promotes tubulin assembly into microtubules thereby stabilizing the cytoskeleton of the axon of the neurons. The microtubule binding region of tau consists of 4 pseudo-repeats. In this study, we will focus on the aggregation propensity of two fragments. In this study we will focus on the PHF43 fragment that contains the third pseudo-repeat and has been shown experimentally to aggregate readily. Another fragment that contains the second pseudo-repeat will be considered as well. Mutations in this region are associated with various form of dementia and for this reason we will consider the mutant P301L.
LENUS (Irish Health Repository)
Jablensky, A
2011-10-04
In a previous study, we detected a 6p25-p24 region linked to schizophrenia in families with high composite cognitive deficit (CD) scores, a quantitative trait integrating multiple cognitive measures. Association mapping of a 10 Mb interval identified a 260 kb region with a cluster of single-nucleotide polymorphisms (SNPs) significantly associated with CD scores and memory performance. The region contains two colocalising genes, LYRM4 and FARS2, both encoding mitochondrial proteins. The two tagging SNPs with strongest evidence of association were located around the overlapping putative promoters, with rs2224391 predicted to alter a transcription factor binding site (TFBS). Sequencing the promoter region identified 22 SNPs, many predicted to affect TFBSs, in a tight linkage disequilibrium block. Luciferase reporter assays confirmed promoter activity in the predicted promoter region, and demonstrated marked downregulation of expression in the LYRM4 direction under the haplotype comprising the minor alleles of promoter SNPs, which however is not driven by rs2224391. Experimental evidence from LYRM4 expression in lymphoblasts, gel-shift assays and modelling of DNA breathing dynamics pointed to two adjacent promoter SNPs, rs7752203-rs4141761, as the functional variants affecting expression. Their C-G alleles were associated with higher transcriptional activity and preferential binding of nuclear proteins, whereas the G-A combination had opposite effects and was associated with poor memory and high CD scores. LYRM4 is a eukaryote-specific component of the mitochondrial biogenesis of Fe-S clusters, essential cofactors in multiple processes, including oxidative phosphorylation. LYRM4 downregulation may be one of the mechanisms involved in inefficient oxidative phosphorylation and oxidative stress, increasingly recognised as contributors to schizophrenia pathogenesis.Molecular Psychiatry advance online publication, 4 October 2011; doi:10.1038\\/mp.2011.129.
Yin, Tao; Wu, Hanying; Zhang, Shanglong; Lu, Hongyu; Zhang, Lingxiao; Xu, Yong; Chen, Daming; Liu, Jingmei
2009-01-01
A 1.8 kb 5'-flanking region of the large subunit of ADP-glucose pyrophosphorylase, isolated from watermelon (Citrullus vulgaris S.), has fruit-specific promoter activity in transgenic tomato plants. Two negative regulatory regions, from -986 to -959 and from -472 to -424, were identified in this promoter region by fine deletion analyses. Removal of both regions led to constitutive expression in epidermal cells. Gain-of-function experiments showed that these two regions were sufficient to inhibit RFP (red fluorescent protein) expression in transformed epidermal cells when fused to the cauliflower mosaic virus (CaMV) 35S minimal promoter. Gel mobility shift experiments demonstrated the presence of leaf nuclear factors that interact with these two elements. A TCCAAAA motif was identified in these two regions, as well as one in the reverse orientation, which was confirmed to be a novel specific cis-element. A quantitative beta-glucuronidase (GUS) activity assay of stable transgenic tomato plants showed that the activities of chimeric promoters harbouring only one of the two cis-elements, or both, were approximately 10-fold higher in fruits than in leaves. These data confirm that the TCCAAAA motif functions as a fruit-specific element by inhibiting gene expression in leaves.
[Health-Promoting Schools Regional Initiative of the Americas].
Ippolito-Shepherd, Josefa; Cerqueira, Maria Teresa; Ortega, Diana Patricia
2005-01-01
In Latin America, comprehensive health promotion programmes and activities are being implemented in the school setting, which take into account the conceptual framework of the Health-Promoting Schools Regional Initiative of the Pan American Health Organization, Regional office of the World Health Organization (PAHO/WHO). These programmes help to strengthen the working relationships between the health and education sectors. The Health-Promoting Schools Regional Initiative, officially launched by PAHO/WHO in 1995, aims to form future generations to have the knowledge, abilities, and skills necessary for promoting and caring for their health and that of their family and community, as well as to create and maintain healthy environments and communities. The Initiative focuses on three main components: comprehensive health education, the creation and maintenance of healthy physical and psychosocial environments, and the access to health and nutrition services, mental health, and active life. In 2001, PAHO conducted a survey in 19 Latin American countries to assess the status and trends of Health-Promoting Schools in the Region, for the appropriate regional, subregional, and national planning of pertinent health promotion and health education programmes and activities. The results of this survey provided information about policies and national plans, multisectoral coordination mechanisms for the support of health promotion in the school settings, the formation and participation in national and international networks of Health-Promoting Schools and about the level of dissemination of the strategy. For the successful development of Health-Promoting Schools is essential to involve the society as a whole, in order to mobilise human resources and materials necessary for implementing health promotion in the school settings. Thus, the constitution and consolidation of networks has been a facilitating mechanism for the exchange of ideas, resources and experiences to strengthen
DEFF Research Database (Denmark)
Søgaard-Andersen, L; Martinussen, J; Møllegaard, N E
1990-01-01
We have investigated the regulation of the Escherichia coli deoCp2 promoter by the CytR repressor and the cyclic AMP (cAMP) receptor protein (CRP) complexed to cAMP. Promoter regions controlled by these two proteins characteristically contain tandem cAMP-CRP binding sites. Here we show that (i) Cyt...
Gel shift analysis of the empA promoter region in Vibrio anguillarum
Directory of Open Access Journals (Sweden)
Denkin Steven M
2004-10-01
Full Text Available Abstract Background The induction of metalloprotease encoded by empA in Vibrio anguillarum occurs at high cell density in salmon intestinal mucus. Previously we have shown that there are significant differences in empA expression in two strains of V. anguillarum, M93Sm and NB10. It is hypothesized that differences in empA regulation are due to differences in binding of regulatory elements. Results Two strains of V. anguillarum, M93Sm and NB10, were examined and compared for the presence of DNA regulatory proteins that bind to and control the empA promoter region. Gel mobility shift assays, using a digoxigenin (DIG-labeled oligomer containing a lux box-like element and the promoter for empA, were done to demonstrate the presence of a DNA-binding protein. Protein extracts from NB10 cells incubated in Luria Bertani broth + 2% NaCl (LB20, nine salts solution + 200 μg/ml mucus (NSSM, 3M (marine minimal medium, or NSS resulted in a gel mobility shift. No gel mobility shift was seen when protein extracts from either LB20- or NSSM-grown M93Sm cells were mixed with the DIG-labeled empA oligomer. The azocasein assay detected protease activity in all incubation conditions for NB10 culture supernatants. In contrast, protease activity was detected in M93Sm culture supernatants only when incubated in NSSM. Since the luxR homologue in V. anguillarum, vanT, has been cloned, sequenced, and shown to be required for protease activity, we wanted to determine if vanT mutants of NB10 exhibit the same gel shift observed in the wild-type. Site-directed mutagenesis was used to create vanT mutants in V. anguillarum M93Sm and NB10 to test whether VanT is involved with the gel mobility shift. Both vanT mutants, M02 and NB02, did not produce protease activity in any conditions. However, protein extracts from NB02 incubated in each condition still exhibited a gel shift when mixed with the DIG-labeled empA oligomer. Conclusions The data demonstrate that protein extracts of V
CDH1 promoter hypermethylation and E-cadherin protein expression in infiltrating breast cancer
DEFF Research Database (Denmark)
Caldeira, José Roberto F; Prando, Erika C; Quevedo, Francisco C
2006-01-01
prognosis, and metastasis. Differential CpG island methylation in the promoter region of the CDH1 gene might be an alternative way for the loss of expression and function of E-cadherin, leading to loss of tissue integrity, an essential step in tumor progression. METHODS: The aim of our study was to assess...... not statistically significant, the levels of E-cadherin expression tended to diminish with the CDH1 promoter region methylation. In the group of 71 ductal cancinomas, most of the cases of showing CDH1 hypermethylation also presented reduced levels of expression of ER and PgR proteins, and a possible association......BACKGROUND: The E-cadherin gene (CDH1) maps, at chromosome 16q22.1, a region often associated with loss of heterozygosity (LOH) in human breast cancer. LOH at this site is thought to lead to loss of function of this tumor suppressor gene and was correlated with decreased disease-free survival, poor...
New PAH gene promoter KLF1 and 3'-region C/EBPalpha motifs influence transcription in vitro.
Klaassen, Kristel; Stankovic, Biljana; Kotur, Nikola; Djordjevic, Maja; Zukic, Branka; Nikcevic, Gordana; Ugrin, Milena; Spasovski, Vesna; Srzentic, Sanja; Pavlovic, Sonja; Stojiljkovic, Maja
2017-02-01
Phenylketonuria (PKU) is a metabolic disease caused by mutations in the phenylalanine hydroxylase (PAH) gene. Although the PAH genotype remains the main determinant of PKU phenotype severity, genotype-phenotype inconsistencies have been reported. In this study, we focused on unanalysed sequences in non-coding PAH gene regions to assess their possible influence on the PKU phenotype. We transiently transfected HepG2 cells with various chloramphenicol acetyl transferase (CAT) reporter constructs which included PAH gene non-coding regions. Selected non-coding regions were indicated by in silico prediction to contain transcription factor binding sites. Furthermore, electrophoretic mobility shift assay (EMSA) and supershift assays were performed to identify which transcriptional factors were engaged in the interaction. We found novel KLF1 motif in the PAH promoter, which decreases CAT activity by 50 % in comparison to basal transcription in vitro. The cytosine at the c.-170 promoter position creates an additional binding site for the protein complex involving KLF1 transcription factor. Moreover, we assessed for the first time the role of a multivariant variable number tandem repeat (VNTR) region located in the 3'-region of the PAH gene. We found that the VNTR3, VNTR7 and VNTR8 constructs had approximately 60 % of CAT activity. The regulation is mediated by the C/EBPalpha transcription factor, present in protein complex binding to VNTR3. Our study highlighted two novel promoter KLF1 and 3'-region C/EBPalpha motifs in the PAH gene which decrease transcription in vitro and, thus, could be considered as PAH expression modifiers. New transcription motifs in non-coding regions will contribute to better understanding of the PKU phenotype complexity and may become important for the optimisation of PKU treatment.
Health issues of whey proteins: 3. gut health promotion
Gertjan Schaafsma
2007-01-01
This paper reviews the potential of whey protein to promote gut health. The high digestibility and specific amino acid composition of whey protein, as present in whey powder, whey protein concentrate and whey protein isolate, explain why ingestion of whey protein will exert this beneficial effect.
TALE factors poise promoters for activation by Hox proteins.
Choe, Seong-Kyu; Ladam, Franck; Sagerström, Charles G
2014-01-27
Hox proteins form complexes with TALE cofactors from the Pbx and Prep/Meis families to control transcription, but it remains unclear how Hox:TALE complexes function. Examining a Hoxb1b:TALE complex that regulates zebrafish hoxb1a transcription, we find maternally deposited TALE proteins at the hoxb1a promoter already during blastula stages. These TALE factors recruit histone-modifying enzymes to promote an active chromatin profile at the hoxb1a promoter and also recruit RNA polymerase II (RNAPII) and P-TEFb. However, in the presence of TALE factors, RNAPII remains phosphorylated on serine 5 and hoxb1a transcription is inefficient. By gastrula stages, Hoxb1b binds together with TALE factors to the hoxb1a promoter. This triggers P-TEFb-mediated transitioning of RNAPII to the serine 2-phosphorylated form and efficient hoxb1a transcription. We conclude that TALE factors access promoters during early embryogenesis to poise them for activation but that Hox proteins are required to trigger efficient transcription. Copyright © 2014 Elsevier Inc. All rights reserved.
Toscana virus NSs protein promotes degradation of double-stranded RNA-dependent protein kinase.
Kalveram, Birte; Ikegami, Tetsuro
2013-04-01
Toscana virus (TOSV), which is transmitted by Phlebotomus spp. sandflies, is a major etiologic agent of aseptic meningitis and encephalitis in the Mediterranean. Like other members of the genus Phlebovirus of the family Bunyaviridae, TOSV encodes a nonstructural protein (NSs) in its small RNA segment. Although the NSs of Rift Valley fever virus (RVFV) has been identified as an important virulence factor, which suppresses host general transcription, inhibits transcription from the beta interferon promoter, and promotes the proteasomal degradation of double-stranded RNA-dependent protein kinase (PKR), little is known about the functions of NSs proteins encoded by less-pathogenic members of this genus. In this study we report that TOSV is able to downregulate PKR with similar efficiency as RVFV, while infection with the other phleboviruses-i.e., Punta Toro virus, sandfly fever Sicilian virus, or Frijoles virus-has no effect on cellular PKR levels. In contrast to RVFV, however, cellular transcription remains unaffected during TOSV infection. TOSV NSs protein promotes the proteasome-dependent downregulation of PKR and is able to interact with kinase-inactive PKR in infected cells.
Inhibition of SNW1 association with spliceosomal proteins promotes apoptosis in breast cancer cells
International Nuclear Information System (INIS)
Sato, Naoki; Maeda, Masao; Sugiyama, Mai; Ito, Satoko; Hyodo, Toshinori; Masuda, Akio; Tsunoda, Nobuyuki; Kokuryo, Toshio; Hamaguchi, Michinari; Nagino, Masato; Senga, Takeshi
2015-01-01
RNA splicing is a fundamental process for protein synthesis. Recent studies have reported that drugs that inhibit splicing have cytotoxic effects on various tumor cell lines. In this report, we demonstrate that depletion of SNW1, a component of the spliceosome, induces apoptosis in breast cancer cells. Proteomics and biochemical analyses revealed that SNW1 directly associates with other spliceosome components, including EFTUD2 (Snu114) and SNRNP200 (Brr2). The SKIP region of SNW1 interacted with the N-terminus of EFTUD2 as well as two independent regions in the C-terminus of SNRNP200. Similar to SNW1 depletion, knockdown of EFTUD2 increased the numbers of apoptotic cells. Furthermore, we demonstrate that exogenous expression of either the SKIP region of SNW1 or the N-terminus region of EFTUD2 significantly promoted cellular apoptosis. Our results suggest that the inhibition of SNW1 or its associating proteins may be a novel therapeutic strategy for cancer treatment
Health issues of whey proteins: 3. Gut health promotion
Schaafsma, G.
2007-01-01
This paper reviews the potential of whey protein to promote gut health. The high digestibility and specific amino acid composition of whey protei, as present in whey powder, whey protein concentrate and whey protein isolate, explain why ingestion of whey protein will exert this beneficial effect.
Characterization of a Lactococcus lactis promoter for heterologous protein production
Directory of Open Access Journals (Sweden)
Christian E. Ogaugwu
2018-03-01
Full Text Available Constitutively active promoter elements for heterologous protein production in Lactococcus lactis are scarce. Here, the promoter of the PTS-IIC gene cluster from L. lactis NZ3900 is described. This promoter was cloned upstream of an enhanced green fluorescent protein, GFPmut3a, and transformed into L. lactis. Transformants produced up to 13.5 μg of GFPmut3a per milliliter of log phase cells. Addition of cellobiose further increased the production of GFPmut3a by up to two-fold when compared to glucose. Analysis of mutations at two specific positions in the PTS-IIC promoter showed that a ‘T’ to ‘G’ mutation within the −35 element resulted in constitutive expression in glucose, while a ‘C’ at nucleotide 7 in the putative cre site enhanced promoter activity in cellobiose. Finally, this PTS-IIC promoter is capable of mediating protein expression in Bacillus subtilis and Escherichia coli Nissle 1917, suggesting the potential for future biotechnological applications of this element and its derivatives.
Tsai, P-C; Chen, C-J; Lai, H-M; Chang, S-J
2008-01-01
To explore the associations between the polymorphisms and protein levels of interleukin-6 (IL-6) gene and gout disease. A total of 120 male gout patients and 184 healthy controls were enrolled. Each patient was matched with 1-2 gout-free controls by age within three years. Four polymorphisms in the promoter of IL-6 gene, including -597G/A, -572C/G, -373A(m)T(n), and -174G/C, and the IL-6 levels were analyzed. The clinical characteristics and biochemical markers in plasma were measured, including age of gout onset, duration of gout history, tophus number, gout attack frequency, uric acid, total cholesterol, triglycerides and creatinine. The mean IL-6 level for gout patients was 9.80 (+/-11.76 pg/ml) which showed no significant difference from the controls (7.06+/-7.58 pg/ml, p=0.230). When the IL-6 levels were dichotomized according to the median value (5 pg/ml), there were significantly higher proportions of the gout patients (59.66%) than controls (44%) with high IL-6 levels (OR=1.88, 95% CI=1.17-3.02, p=0.008). Unique genotype was found at polymorphisms -174G/C and -597G/A. Neither the polymorphisms -572C/G nor -373A(m)T(n) in the genotype or allele distributions showed a significant association related to clinical characteristics, biochemical markers, IL-6 levels or gout disease (all p>0.05). Those with gout disease have greater proportions of high IL-6 levels in plasma than controls, and there is no significant association between the four polymorphisms in the promoter region of IL-6 gene and gout disease.
Discovery and Evaluation of Polymorphisms in the and Promoter Regions for Risk of Korean Lung Cancer
Directory of Open Access Journals (Sweden)
Jae Sook Sung
2012-09-01
Full Text Available AKT is a signal transduction protein that plays a central role in the tumorigenesis. There are 3 mammalian isoforms of this serine/threonine protein kinase-AKT1, AKT2, and AKT3-showing a broad tissue distribution. We first discovered 2 novel polymorphisms (AKT2 -9826 C/G and AKT3 -811 A/G, and we confirmed 6 known polymorphisms (AKT2 -9473 C/T, AKT2 -9151 C/T, AKT2 -9025 C/T, AKT2 -8618G/A, AKT3 -675 A/-, and AKT3 -244 C/T of the AKT2 and AKT3 promoter region in 24 blood samples of Korean lung cancer patients using direct sequencing. To evaluate the role of AKT2 and AKT3 polymorphisms in the risk of Korean lung cancer, genotypes of the AKT2 and AKT3 polymorphisms (AKT2 -9826 C/G, AKT2 -9473 C/T, AKT2 -9151 C/T, AKT2 -9025 C/T, AKT2 -8618G/A, and AKT3 -675 A/- were determined in 360 lung cancer patients and 360 normal controls. Statistical analyses revealed that the genotypes and haplotypes in the AKT2 and AKT3 promoter regions were not significantly associated with the risk of lung cancer in the Korean population. These results suggest that polymorphisms of the AKT2 and AKT3 promoter regions do not contribute to the genetic susceptibility to lung cancer in the Korean population.
Kolobova, Elena; Roland, Joseph T; Lapierre, Lynne A; Williams, Janice A; Mason, Twila A; Goldenring, James R
2017-12-15
Microtubules in animal cells assemble (nucleate) from both the centrosome and the cis-Golgi cisternae. A-kinase anchor protein 350 kDa (AKAP350A, also called AKAP450/CG-NAP/AKAP9) is a large scaffolding protein located at both the centrosome and Golgi apparatus. Previous findings have suggested that AKAP350 is important for microtubule dynamics at both locations, but how this scaffolding protein assembles microtubule nucleation machinery is unclear. Here, we found that overexpression of the C-terminal third of AKAP350A, enhanced GFP-AKAP350A(2691-3907), induces the formation of multiple microtubule-nucleation centers (MTNCs). Nevertheless, these induced MTNCs lacked "true" centriole proteins, such as Cep135. Mapping analysis with AKAP350A truncations demonstrated that AKAP350A contains discrete regions responsible for promoting or inhibiting the formation of multiple MTNCs. Moreover, GFP-AKAP350A(2691-3907) recruited several pericentriolar proteins to MTNCs, including γ-tubulin, pericentrin, Cep68, Cep170, and Cdk5RAP2. Proteomic analysis indicated that Cdk5RAP2 and Cep170 both interact with the microtubule nucleation-promoting region of AKAP350A, whereas Cep68 interacts with the distal C-terminal AKAP350A region. Yeast two-hybrid assays established a direct interaction of Cep170 with AKAP350A. Super-resolution and deconvolution microscopy analyses were performed to define the association of AKAP350A with centrosomes, and these studies disclosed that AKAP350A spans the bridge between centrioles, co-localizing with rootletin and Cep68 in the linker region. siRNA-mediated depletion of AKAP350A caused displacement of both Cep68 and Cep170 from the centrosome. These results suggest that AKAP350A acts as a scaffold for factors involved in microtubule nucleation at the centrosome and coordinates the assembly of protein complexes associating with the intercentriolar bridge.
Benferhat, Rima; Josse, Thibaut; Albaud, Benoit; Gentien, David; Mansuroglu, Zeyni; Marcato, Vasco; Souès, Sylvie; Le Bonniec, Bernard; Bouloy, Michèle; Bonnefoy, Eliette
2012-10-01
Rift Valley fever virus (RVFV) is a highly pathogenic Phlebovirus that infects humans and ruminants. Initially confined to Africa, RVFV has spread outside Africa and presently represents a high risk to other geographic regions. It is responsible for high fatality rates in sheep and cattle. In humans, RVFV can induce hepatitis, encephalitis, retinitis, or fatal hemorrhagic fever. The nonstructural NSs protein that is the major virulence factor is found in the nuclei of infected cells where it associates with cellular transcription factors and cofactors. In previous work, we have shown that NSs interacts with the promoter region of the beta interferon gene abnormally maintaining the promoter in a repressed state. In this work, we performed a genome-wide analysis of the interactions between NSs and the host genome using a genome-wide chromatin immunoprecipitation combined with promoter sequence microarray, the ChIP-on-chip technique. Several cellular promoter regions were identified as significantly interacting with NSs, and the establishment of NSs interactions with these regions was often found linked to deregulation of expression of the corresponding genes. Among annotated NSs-interacting genes were present not only genes regulating innate immunity and inflammation but also genes regulating cellular pathways that have not yet been identified as targeted by RVFV. Several of these pathways, such as cell adhesion, axonal guidance, development, and coagulation were closely related to RVFV-induced disorders. In particular, we show in this work that NSs targeted and modified the expression of genes coding for coagulation factors, demonstrating for the first time that this hemorrhagic virus impairs the host coagulation cascade at the transcriptional level.
DNA Methylation Analysis of BRD1 Promoter Regions and the Schizophrenia rs138880 Risk Allele.
Directory of Open Access Journals (Sweden)
Mads Dyrvig
Full Text Available The bromodomain containing 1 gene, BRD1 is essential for embryogenesis and CNS development. It encodes a protein that participates in histone modifying complexes and thereby regulates the expression of a large number of genes. Genetic variants in the BRD1 locus show association with schizophrenia and bipolar disorder and risk alleles in the promoter region correlate with reduced BRD1 expression. Insights into the transcriptional regulation of BRD1 and the pathogenic mechanisms associated with BRD1 risk variants, however, remain sparse. By studying transcripts in human HeLa and SH-SY5Y cells we provide evidence for differences in relative expression of BRD1 transcripts with three alternative 5' UTRs (exon 1C, 1B, and 1A. We further show that expression of these transcript variants covaries negatively with DNA methylation proportions in their upstream promoter regions suggesting that promoter usage might be regulated by DNA methylation. In line with findings that the risk allele of the rs138880 SNP in the BRD1 promoter region correlates with reduced BRD1 expression, we find that it is also associated with moderate regional BRD1 promoter hypermethylation in both adipose tissue and blood. Importantly, we demonstrate by inspecting available DNA methylation and expression data that these regions undergo changes in methylation during fetal brain development and that differences in their methylation proportions in fetal compared to postnatal frontal cortex correlate significantly with BRD1 expression. These findings suggest that BRD1 may be dysregulated in both the developing and mature brain of risk allele carriers. Finally, we demonstrate that commonly used mood stabilizers Lithium, Valproate, and Carbamazepine affect the expression of BRD1 in SH-SY5Y cells. Altogether this study indicates a link between genetic risk and epigenetic dysregulation of BRD1 which raises interesting perspectives for targeting the mechanisms pharmacologically.
Functional analysis of bipartite begomovirus coat protein promoter sequences
International Nuclear Information System (INIS)
Lacatus, Gabriela; Sunter, Garry
2008-01-01
We demonstrate that the AL2 gene of Cabbage leaf curl virus (CaLCuV) activates the CP promoter in mesophyll and acts to derepress the promoter in vascular tissue, similar to that observed for Tomato golden mosaic virus (TGMV). Binding studies indicate that sequences mediating repression and activation of the TGMV and CaLCuV CP promoter specifically bind different nuclear factors common to Nicotiana benthamiana, spinach and tomato. However, chromatin immunoprecipitation demonstrates that TGMV AL2 can interact with both sequences independently. Binding of nuclear protein(s) from different crop species to viral sequences conserved in both bipartite and monopartite begomoviruses, including TGMV, CaLCuV, Pepper golden mosaic virus and Tomato yellow leaf curl virus suggests that bipartite begomoviruses bind common host factors to regulate the CP promoter. This is consistent with a model in which AL2 interacts with different components of the cellular transcription machinery that bind viral sequences important for repression and activation of begomovirus CP promoters
Directory of Open Access Journals (Sweden)
Matsutani Sachiko
2004-08-01
Full Text Available Abstract Background In eukaryotes, RNA polymerase III (RNAP III transcribes the genes for small RNAs like tRNAs, 5S rRNA, and several viral RNAs, and short interspersed repetitive elements (SINEs. The genes for these RNAs and SINEs have internal promoters that consist of two regions. These two regions are called the A and B blocks. The multisubunit transcription factor TFIIIC is required for transcription initiation of RNAP III; in transcription of tRNAs, the B-block binding subunit of TFIIIC recognizes a promoter. Although internal promoter sequences are conserved in eukaryotes, no evidence of homology between the B-block binding subunits of vertebrates and yeasts has been reported previously. Results Here, I reported the results of PSI-BLAST searches using the B-block binding subunits of human and Shizosacchromyces pombe as queries, showing that the same Arabidopsis proteins were hit with low E-values in both searches. Comparison of the convergent iterative alignments obtained by these PSI-BLAST searches revealed that the vertebrate, yeast, and Arabidopsis proteins have similarities in their N-terminal one-third regions. In these regions, there were three domains with conserved sequence similarities, one located in the N-terminal end region. The N-terminal end region of the B-block binding subunit of Saccharomyces cerevisiae is tentatively identified as a HMG box, which is the DNA binding motif. Although I compared the alignment of the N-terminal end regions of the B-block binding subunits, and their homologs, with that of the HMG boxes, it is not clear whether they are related. Conclusion Molecular phylogenetic analyses using the small subunit rRNA and ubiquitous proteins like actin and α-tubulin, show that fungi are more closely related to animals than either is to plants. Interestingly, the results obtained in this study show that, with respect to the B-block binding subunits of TFIIICs, animals appear to be evolutionarily closer to plants
Matsutani, Sachiko
2004-08-09
In eukaryotes, RNA polymerase III (RNAP III) transcribes the genes for small RNAs like tRNAs, 5S rRNA, and several viral RNAs, and short interspersed repetitive elements (SINEs). The genes for these RNAs and SINEs have internal promoters that consist of two regions. These two regions are called the A and B blocks. The multisubunit transcription factor TFIIIC is required for transcription initiation of RNAP III; in transcription of tRNAs, the B-block binding subunit of TFIIIC recognizes a promoter. Although internal promoter sequences are conserved in eukaryotes, no evidence of homology between the B-block binding subunits of vertebrates and yeasts has been reported previously. Here, I reported the results of PSI-BLAST searches using the B-block binding subunits of human and Shizosacchromyces pombe as queries, showing that the same Arabidopsis proteins were hit with low E-values in both searches. Comparison of the convergent iterative alignments obtained by these PSI-BLAST searches revealed that the vertebrate, yeast, and Arabidopsis proteins have similarities in their N-terminal one-third regions. In these regions, there were three domains with conserved sequence similarities, one located in the N-terminal end region. The N-terminal end region of the B-block binding subunit of Saccharomyces cerevisiae is tentatively identified as a HMG box, which is the DNA binding motif. Although I compared the alignment of the N-terminal end regions of the B-block binding subunits, and their homologs, with that of the HMG boxes, it is not clear whether they are related. Molecular phylogenetic analyses using the small subunit rRNA and ubiquitous proteins like actin and alpha-tubulin, show that fungi are more closely related to animals than either is to plants. Interestingly, the results obtained in this study show that, with respect to the B-block binding subunits of TFIIICs, animals appear to be evolutionarily closer to plants than to fungi.
Clem, Brian F; Hudson, Elizabeth A; Clark, Barbara J
2005-03-01
Steroidogenic acute regulatory protein (StAR) transcription is regulated through cAMP-protein kinase A-dependent mechanisms that involve multiple transcription factors including the cAMP-responsive element binding protein (CREB) family members. Classically, binding of phosphorylated CREB to cis-acting cAMP-responsive elements (5'-TGACGTCA-3') within target gene promoters leads to recruitment of the coactivator CREB binding protein (CBP). Herein we examined the extent of CREB family member phosphorylation on protein-DNA interactions and CBP recruitment with the StAR promoter. Immunoblot analysis revealed that CREB, cAMP-responsive element modulator (CREM), and activating transcription factor (ATF)-1 are expressed in MA-10 mouse Leydig tumor cells, yet only CREB and ATF-1 are phosphorylated. (Bu)2cAMP treatment of MA-10 cells increased CREB phosphorylation approximately 2.3-fold within 30 min but did not change total nuclear CREB expression levels. Using DNA-affinity chromatography, we now show that CREB and ATF-1, but not CREM, interact with the StAR promoter, and this interaction is dependent on the activator protein-1 (AP-1) cis-acting element within the cAMP-responsive region. In addition, (Bu)2cAMP-treatment increased phosphorylated CREB (P-CREB) association with the StAR promoter but did not influence total CREB interaction. In vivo chromatin immunoprecipitation assays demonstrated CREB binding to the StAR proximal promoter is independent of (Bu)2cAMP-treatment, confirming our in vitro analysis. However, (Bu)2cAMP-treatment increased P-CREB and CBP interaction with the StAR promoter, demonstrating for the first time the physical role of P-CREB:DNA interactions in CBP recruitment to the StAR proximal promoter.
Iwasaki, T; Yamaguchi-Shinozaki, K; Shinozaki, K
1995-05-20
In Arabidopsis thaliana, the induction of a dehydration-responsive gene, rd22, is mediated by abscisic acid (ABA) but the gene does not include any sequence corresponding to the consensus ABA-responsive element (ABRE), RYACGTGGYR, in its promoter region. The cis-regulatory region of the rd22 promoter was identified by monitoring the expression of beta-glucuronidase (GUS) activity in leaves of transgenic tobacco plants transformed with chimeric gene fusions constructed between 5'-deleted promoters of rd22 and the coding region of the GUS reporter gene. A 67-bp nucleotide fragment corresponding to positions -207 to -141 of the rd22 promoter conferred responsiveness to dehydration and ABA on a non-responsive promoter. The 67-bp fragment contains the sequences of the recognition sites for some transcription factors, such as MYC, MYB, and GT-1. The fact that accumulation of rd22 mRNA requires protein synthesis raises the possibility that the expression of rd22 might be regulated by one of these trans-acting protein factors whose de novo synthesis is induced by dehydration or ABA. Although the structure of the RD22 protein is very similar to that of a non-storage seed protein, USP, of Vicia faba, the expression of the GUS gene driven by the rd22 promoter in non-stressed transgenic Arabidopsis plants was found mainly in flowers and bolted stems rather than in seeds.
Mammalian amyloidogenic proteins promote prion nucleation in yeast.
Chandramowlishwaran, Pavithra; Sun, Meng; Casey, Kristin L; Romanyuk, Andrey V; Grizel, Anastasiya V; Sopova, Julia V; Rubel, Aleksandr A; Nussbaum-Krammer, Carmen; Vorberg, Ina M; Chernoff, Yury O
2018-03-02
Fibrous cross-β aggregates (amyloids) and their transmissible forms (prions) cause diseases in mammals (including humans) and control heritable traits in yeast. Initial nucleation of a yeast prion by transiently overproduced prion-forming protein or its (typically, QN-rich) prion domain is efficient only in the presence of another aggregated (in most cases, QN-rich) protein. Here, we demonstrate that a fusion of the prion domain of yeast protein Sup35 to some non-QN-rich mammalian proteins, associated with amyloid diseases, promotes nucleation of Sup35 prions in the absence of pre-existing aggregates. In contrast, both a fusion of the Sup35 prion domain to a multimeric non-amyloidogenic protein and the expression of a mammalian amyloidogenic protein that is not fused to the Sup35 prion domain failed to promote prion nucleation, further indicating that physical linkage of a mammalian amyloidogenic protein to the prion domain of a yeast protein is required for the nucleation of a yeast prion. Biochemical and cytological approaches confirmed the nucleation of protein aggregates in the yeast cell. Sequence alterations antagonizing or enhancing amyloidogenicity of human amyloid-β (associated with Alzheimer's disease) and mouse prion protein (associated with prion diseases), respectively, antagonized or enhanced nucleation of a yeast prion by these proteins. The yeast-based prion nucleation assay, developed in our work, can be employed for mutational dissection of amyloidogenic proteins. We anticipate that it will aid in the identification of chemicals that influence initial amyloid nucleation and in searching for new amyloidogenic proteins in a variety of proteomes. © 2018 by The American Society for Biochemistry and Molecular Biology, Inc.
Genome-wide analysis of regions similar to promoters of histone genes
Chowdhary, Rajesh
2010-05-28
Background: The purpose of this study is to: i) develop a computational model of promoters of human histone-encoding genes (shortly histone genes), an important class of genes that participate in various critical cellular processes, ii) use the model so developed to identify regions across the human genome that have similar structure as promoters of histone genes; such regions could represent potential genomic regulatory regions, e.g. promoters, of genes that may be coregulated with histone genes, and iii/ identify in this way genes that have high likelihood of being coregulated with the histone genes.Results: We successfully developed a histone promoter model using a comprehensive collection of histone genes. Based on leave-one-out cross-validation test, the model produced good prediction accuracy (94.1% sensitivity, 92.6% specificity, and 92.8% positive predictive value). We used this model to predict across the genome a number of genes that shared similar promoter structures with the histone gene promoters. We thus hypothesize that these predicted genes could be coregulated with histone genes. This hypothesis matches well with the available gene expression, gene ontology, and pathways data. Jointly with promoters of the above-mentioned genes, we found a large number of intergenic regions with similar structure as histone promoters.Conclusions: This study represents one of the most comprehensive computational analyses conducted thus far on a genome-wide scale of promoters of human histone genes. Our analysis suggests a number of other human genes that share a high similarity of promoter structure with the histone genes and thus are highly likely to be coregulated, and consequently coexpressed, with the histone genes. We also found that there are a large number of intergenic regions across the genome with their structures similar to promoters of histone genes. These regions may be promoters of yet unidentified genes, or may represent remote control regions that
Phosphorylation of stress protein pp80 is related to promotion of transformation
International Nuclear Information System (INIS)
Smith, B.M.; Gindhart, T.D.; Hirano, K.; Colburn, N.H.
1986-01-01
The JB6 mouse epidermal cell system is an in vitro model of late stage promotion, and includes cell lines sensitive (P+) or resistant (P-) to phorbol ester-induced anchorage independent transformation, and transformed (T/sub x/) lines. Certain promoter-induced changes in phosphoproteins, identified by gel electrophoresis, are unique to cells of one phenotype, and occur only with specific promoters. An 80Kd protein is inversely correlated with phenotype: P- cells have a constitutively higher level (p 35 S-methionine. pp80 shares properties with the 80Kd heat stress protein: molecular weight relative abundance, and isoelectric point (4.5). Pharmacological analogs of calcium, the lanthanides, promote transformation of JB6 cells, but have no effect on phosphorylation of the 80Kd protein. If pp80 is on the promotion pathway, it is limited to a specific subset of transformation promoters
Core Promoter Structure in the Oomycete Phytophthora infestans
McLeod, Adele; Smart, Christine D.; Fry, William E.
2004-01-01
We have investigated the core promoter structure of the oomycete Phytophthora infestans. The transcriptional start sites (TSS) of three previously characterized P. infestans genes, Piexo1, Piexo3, and Piendo1, were determined by primer extension analyses. The TSS regions were homologous to a previously identified 16-nucleotide (nt) core sequence that overlaps the TSS in most oomycete genes. The core promoter regions of Piexo1 and Piendo1 were investigated by using a transient protoplast expression assay and the reporter gene β-glucuronidase. Mutational analyses of the promoters of Piexo1 and Piendo1 showed that there is a putative core promoter element encompassing the TSS (−2 to + 5) that has high sequence and functional homology to a known core promoter element present in other eukaryotes, the initiator element (Inr). Downstream and flanking the Inr is a highly conserved oomycete promoter region (+7 to + 15), hereafter referred to as FPR (flanking promoter region), which is also important for promoter function. The importance of the 19-nt core promoter region (Inr and FPR) in Piexo1 and Piendo1 was further investigated through electrophoretic mobility shift assays (EMSA). The EMSA studies showed that (i) both core promoters were able to specifically bind a protein or protein complex in a P. infestans whole-cell protein extract and (ii) the same mutations that reduced binding of the EMSA complex also reduced β-glucuronidase (GUS) levels in transient expression assays. The consistency of results obtained using two different assays (GUS transient assays [in vivo] and EMSA studies [in vitro]) supports a convergence of inference about the relative importance of specific nucleotides within the 19-nt core promoter region. PMID:14871940
Denz, Christopher R; Zhang, Chi; Jia, Pingping; Du, Jianfeng; Huang, Xupei; Dube, Syamalima; Thomas, Anish; Poiesz, Bernard J; Dube, Dipak K
2011-09-01
Tropomyosins are a family of actin-binding proteins that show cell-specific diversity by a combination of multiple genes and alternative RNA splicing. Of the 4 different tropomyosin genes, TPM4 plays a pivotal role in myofibrillogenesis as well as cardiac contractility in amphibians. In this study, we amplified and sequenced the upstream regulatory region of the TPM4 gene from both normal and mutant axolotl hearts. To identify the cis-elements that are essential for the expression of the TPM4, we created various deletion mutants of the TPM4 promoter DNA, inserted the deleted segments into PGL3 vector, and performed promoter-reporter assay using luciferase as the reporter gene. Comparison of sequences of the promoter region of the TPM4 gene from normal and mutant axolotl revealed no mutations in the promoter sequence of the mutant TPM4 gene. CArG box elements that are generally involved in controlling the expression of several other muscle-specific gene promoters were not found in the upstream regulatory region of the TPM4 gene. In deletion experiments, loss of activity of the reporter gene was noted upon deletion which was then restored upon further deletion suggesting the presence of both positive and negative cis-elements in the upstream regulatory region of the TPM4 gene. We believe that this is the first axolotl promoter that has ever been cloned and studied with clear evidence that it functions in mammalian cell lines. Although striated muscle-specific cis-acting elements are absent from the promoter region of TPM4 gene, our results suggest the presence of positive and negative cis-elements in the promoter region, which in conjunction with positive and negative trans-elements may be involved in regulating the expression of TPM4 gene in a tissue-specific manner.
Directory of Open Access Journals (Sweden)
Johan Waldemarsson
Full Text Available The surface-localized M protein of Streptococcus pyogenes is a major virulence factor that inhibits phagocytosis, as determined ex vivo. Because little is known about the role of M protein in vivo we analyzed the contribution of different M protein regions to virulence, using the fibrinogen (Fg-binding M5 protein and a mouse model of acute invasive infection. This model was suitable, because M5 is required for mouse virulence and binds mouse and human Fg equally well, as shown here. Mixed infection experiments with wild type bacteria demonstrated that mutants lacking the N-terminal hypervariable region (HVR or the Fg-binding B-repeat region were strongly attenuated, while a mutant lacking the conserved C-repeats was only slightly attenuated. Because the HVR of M5 is not required for phagocytosis resistance, our data imply that this HVR plays a major but unknown role during acute infection. The B-repeat region is required for phagocytosis resistance and specifically binds Fg, suggesting that it promotes virulence by binding Fg. However, B-repeat mutants were attenuated even in Fg-deficient mice, implying that the B-repeats may have a second function, in addition to Fg-binding. These data demonstrate that two distinct M5 regions, including the HVR, are essential to virulence during the early stages of an infection. In particular, our data provide the first in vivo evidence that the HVR of an M protein plays a major role in virulence, focusing interest on the molecular role of this region.
Identification and annotation of promoter regions in microbial
Indian Academy of Sciences (India)
2007-06-15
Jun 15, 2007 ... Analysis of various predicted structural properties of promoter regions in prokaryotic as well as eukaryotic genomes had earlier indicated that they have several common features, such as lower stability, higher curvature and less bendability, when compared with their neighboring regions. Based on the ...
Newton, K; Jorgensen, N M; Wallace, A J; Buchanan, D D; Lalloo, F; McMahon, R F T; Hill, J; Evans, D G
2014-12-01
Lynch syndrome (LS) patients have DNA mismatch repair deficiency and up to 80% lifetime risk of colorectal cancer (CRC). Screening of mutation carriers reduces CRC incidence and mortality. Selection for constitutional mutation testing relies on family history (Amsterdam and Bethesda Guidelines) and tumour-derived biomarkers. Initial biomarker analysis uses mismatch repair protein immunohistochemistry and microsatellite instability. Abnormalities in either identify mismatch repair deficiency but do not differentiate sporadic epigenetic defects, due to MLH1 promoter region methylation (13% of CRCs) from LS (4% of CRCs). A diagnostic biomarker capable of making this distinction would be valuable. This study compared two biomarkers in tumours with mismatch repair deficiency; quantification of methylation of the MLH1 promoter region using a novel assay and BRAF c.1799T>A, p.(Val600Glu) mutation status in the identification of constitutional mutations. Tumour DNA was extracted (formalin fixed, paraffin embedded, FFPE tissue) and pyrosequencing used to test for MLH1 promoter methylation and presence of the BRAF c.1799T>A, p.(Val600Glu) mutation 71 CRCs from individuals with pathogenic MLH1 mutations and 73 CRCs with sporadic MLH1 loss. Specificity and sensitivity was compared. Unmethylated MLH1 promoter: sensitivity 94.4% (95% CI 86.2% to 98.4%), specificity 87.7% (95% CI 77.9% to 94.2%), Wild-type BRAF (codon 600): sensitivity 65.8% (95% CI 53.7% to 76.5%), specificity 98.6% (95% CI 92.4% to 100.0%) for the identification of those with pathogenic MLH1 mutations. Quantitative MLH1 promoter region methylation using pyrosequencing is superior to BRAF codon 600 mutation status in identifying constitutional mutations in mismatch repair deficient tumours. Published by the BMJ Publishing Group Limited. For permission to use (where not already granted under a licence) please go to http://group.bmj.com/group/rights-licensing/permissions.
The LIKE system, a novel protein expression toolbox for Bacillus subtilis based on the liaI promoter
2012-01-01
Background Bacillus subtilis is a very important Gram-positive model organism of high biotechnological relevance, which is widely used as a host for the production of both secreted and cytoplasmic proteins. We developed a novel and efficient expression system, based on the liaI promoter (PliaI) from B. subtilis, which is under control of the LiaRS antibiotic-inducible two-component system. In the absence of a stimulus, this promoter is kept tightly inactive. Upon induction by cell wall antibiotics, it shows an over 100-fold increase in activity within 10 min. Results Based on these traits of PliaI, we developed a novel LiaRS-controlled gene expression system for B. subtilis (the “LIKE" system). Two expression vectors, the integrative pLIKE-int and the replicative pLIKE-rep, were constructed. To enhance the performance of the PliaI-derived system, site-directed mutagenesis was employed to optimize the ribosome binding site and alter its spacing to the initiation codon used for the translational fusion. The impact of these genetic modifications on protein production yield was measured using GFP as a model protein. Moreover, a number of tailored B. subtilis expression strains containing different markerless chromosomal deletions of the liaIH region were constructed to circumvent undesired protein production, enhance the positive autoregulation of the LiaRS system and thereby increase target gene expression strength from the PliaI promoter. Conclusions The LIKE protein expression system is a novel protein expression system, which offers a number of advantages over existing systems. Its major advantages are (i) a tightly switched-off promoter during exponential growth in the absence of a stimulus, (ii) a concentration-dependent activation of PliaI in the presence of suitable inducers, (iii) a very fast but transient response with a very high dynamic range of over 100-fold (up to 1,000-fold) induction, (iv) a choice from a range of well-defined, commercially available
Ignatieva, Elena V; Levitsky, Victor G; Yudin, Nikolay S; Moshkin, Mikhail P; Kolchanov, Nikolay A
2014-01-01
The molecular mechanism of olfactory cognition is very complicated. Olfactory cognition is initiated by olfactory receptor proteins (odorant receptors), which are activated by olfactory stimuli (ligands). Olfactory receptors are the initial player in the signal transduction cascade producing a nerve impulse, which is transmitted to the brain. The sensitivity to a particular ligand depends on the expression level of multiple proteins involved in the process of olfactory cognition: olfactory receptor proteins, proteins that participate in signal transduction cascade, etc. The expression level of each gene is controlled by its regulatory regions, and especially, by the promoter [a region of DNA about 100-1000 base pairs long located upstream of the transcription start site (TSS)]. We analyzed single nucleotide polymorphisms using human whole-genome data from the 1000 Genomes Project and revealed an extremely high level of single nucleotide polymorphisms in promoter regions of olfactory receptor genes and HLA genes. We hypothesized that the high level of polymorphisms in olfactory receptor promoters was responsible for the diversity in regulatory mechanisms controlling the expression levels of olfactory receptor proteins. Such diversity of regulatory mechanisms may cause the great variability of olfactory cognition of numerous environmental olfactory stimuli perceived by human beings (air pollutants, human body odors, odors in culinary etc.). In turn, this variability may provide a wide range of emotional and behavioral reactions related to the vast variety of olfactory stimuli.
International Nuclear Information System (INIS)
Martínez-Galán, Joaquina; Ríos, Sandra; Delgado, Juan Ramón; Torres-Torres, Blanca; Núñez, María Isabel; López-Peñalver, Jesús; Del Moral, Rosario; Ruiz De Almodóvar, José Mariano; Menjón, Salomón; Concha, Ángel; Chamorro, Clara
2014-01-01
Tumor expression of estrogen receptor (ER) is an important marker of prognosis, and is predictive of response to endocrine therapy in breast cancer. Several studies have observed that epigenetic events, such methylation of cytosines and deacetylation of histones, are involved in the complex mechanisms that regulate promoter transcription. However, the exact interplay of these factors in transcription activity is not well understood. In this study, we explored the relationship between ER expression status in tumor tissue samples and the methylation of the 5′ CpG promoter region of the estrogen receptor gene (ESR1) isolated from free circulating DNA (fcDNA) in plasma samples from breast cancer patients. Patients (n = 110) with non-metastatic breast cancer had analyses performed of ER expression (luminal phenotype in tumor tissue, by immunohistochemistry method), and the ESR1-DNA methylation status (fcDNA in plasma, by quantitative methylation specific PCR technique). Our results showed a significant association between presence of methylated ESR1 in patients with breast cancer and ER negative status in the tumor tissue (p = 0.0179). There was a trend towards a higher probability of ESR1-methylation in those phenotypes with poor prognosis i.e. 80% of triple negative patients, 60% of HER2 patients, compared to 28% and 5.9% of patients with better prognosis such as luminal A and luminal B, respectively. Silencing, by methylation, of the promoter region of the ESR1 affects the expression of the estrogen receptor protein in tumors of breast cancer patients; high methylation of ESR1-DNA is associated with estrogen receptor negative status which, in turn, may be implicated in the patient’s resistance to hormonal treatment in breast cancer. As such, epigenetic markers in plasma may be of interest as new targets for anticancer therapy, especially with respect to endocrine treatment
SCOWLP classification: Structural comparison and analysis of protein binding regions
Directory of Open Access Journals (Sweden)
Anders Gerd
2008-01-01
Full Text Available Abstract Background Detailed information about protein interactions is critical for our understanding of the principles governing protein recognition mechanisms. The structures of many proteins have been experimentally determined in complex with different ligands bound either in the same or different binding regions. Thus, the structural interactome requires the development of tools to classify protein binding regions. A proper classification may provide a general view of the regions that a protein uses to bind others and also facilitate a detailed comparative analysis of the interacting information for specific protein binding regions at atomic level. Such classification might be of potential use for deciphering protein interaction networks, understanding protein function, rational engineering and design. Description Protein binding regions (PBRs might be ideally described as well-defined separated regions that share no interacting residues one another. However, PBRs are often irregular, discontinuous and can share a wide range of interacting residues among them. The criteria to define an individual binding region can be often arbitrary and may differ from other binding regions within a protein family. Therefore, the rational behind protein interface classification should aim to fulfil the requirements of the analysis to be performed. We extract detailed interaction information of protein domains, peptides and interfacial solvent from the SCOWLP database and we classify the PBRs of each domain family. For this purpose, we define a similarity index based on the overlapping of interacting residues mapped in pair-wise structural alignments. We perform our classification with agglomerative hierarchical clustering using the complete-linkage method. Our classification is calculated at different similarity cut-offs to allow flexibility in the analysis of PBRs, feature especially interesting for those protein families with conflictive binding regions
Epigenetic transgenerational actions of vinclozolin on promoter regions of the sperm epigenome.
Directory of Open Access Journals (Sweden)
Carlos Guerrero-Bosagna
2010-09-01
Full Text Available Previous observations have demonstrated that embryonic exposure to the endocrine disruptor vinclozolin during gonadal sex determination promotes transgenerational adult onset disease such as male infertility, kidney disease, prostate disease, immune abnormalities and tumor development. The current study investigates genome-wide promoter DNA methylation alterations in the sperm of F3 generation rats whose F0 generation mother was exposed to vinclozolin. A methylated DNA immunoprecipitation with methyl-cytosine antibody followed by a promoter tilling microarray (MeDIP-Chip procedure was used to identify 52 different regions with statistically significant altered methylation in the sperm promoter epigenome. Mass spectrometry bisulfite analysis was used to map the CpG DNA methylation and 16 differential DNA methylation regions were confirmed, while the remainder could not be analyzed due to bisulfite technical limitations. Analysis of these validated regions identified a consensus DNA sequence (motif that associated with 75% of the promoters. Interestingly, only 16.8% of a random set of 125 promoters contained this motif. One candidate promoter (Fam111a was found to be due to a copy number variation (CNV and not a methylation change, suggesting initial alterations in the germline epigenome may promote genetic abnormalities such as induced CNV in later generations. This study identifies differential DNA methylation sites in promoter regions three generations after the initial exposure and identifies common genome features present in these regions. In addition to primary epimutations, a potential indirect genetic abnormality was identified, and both are postulated to be involved in the epigenetic transgenerational inheritance observed. This study confirms that an environmental agent has the ability to induce epigenetic transgenerational changes in the sperm epigenome.
Epigenetic transgenerational actions of vinclozolin on promoter regions of the sperm epigenome.
Guerrero-Bosagna, Carlos; Settles, Matthew; Lucker, Ben; Skinner, Michael K
2010-09-30
Previous observations have demonstrated that embryonic exposure to the endocrine disruptor vinclozolin during gonadal sex determination promotes transgenerational adult onset disease such as male infertility, kidney disease, prostate disease, immune abnormalities and tumor development. The current study investigates genome-wide promoter DNA methylation alterations in the sperm of F3 generation rats whose F0 generation mother was exposed to vinclozolin. A methylated DNA immunoprecipitation with methyl-cytosine antibody followed by a promoter tilling microarray (MeDIP-Chip) procedure was used to identify 52 different regions with statistically significant altered methylation in the sperm promoter epigenome. Mass spectrometry bisulfite analysis was used to map the CpG DNA methylation and 16 differential DNA methylation regions were confirmed, while the remainder could not be analyzed due to bisulfite technical limitations. Analysis of these validated regions identified a consensus DNA sequence (motif) that associated with 75% of the promoters. Interestingly, only 16.8% of a random set of 125 promoters contained this motif. One candidate promoter (Fam111a) was found to be due to a copy number variation (CNV) and not a methylation change, suggesting initial alterations in the germline epigenome may promote genetic abnormalities such as induced CNV in later generations. This study identifies differential DNA methylation sites in promoter regions three generations after the initial exposure and identifies common genome features present in these regions. In addition to primary epimutations, a potential indirect genetic abnormality was identified, and both are postulated to be involved in the epigenetic transgenerational inheritance observed. This study confirms that an environmental agent has the ability to induce epigenetic transgenerational changes in the sperm epigenome.
Soy protein isolate inhibits hepatic tumor promotion in mice fed a high-fat liquid diet.
Mercer, Kelly E; Pulliam, Casey F; Pedersen, Kim B; Hennings, Leah; Ronis, Martin Jj
2017-03-01
Alcoholic and nonalcoholic fatty liver diseases are risk factors for development of hepatocellular carcinoma, but the underlying mechanisms are poorly understood. On the other hand, ingestion of soy-containing diets may oppose the development of certain cancers. We previously reported that replacing casein with a soy protein isolate reduced tumor promotion in the livers of mice with alcoholic liver disease after feeding a high fat ethanol liquid diet following initiation with diethylnitrosamine. Feeding soy protein isolate inhibited processes that may contribute to tumor promotion including inflammation, sphingolipid signaling, and Wnt/β-catenin signaling. We have extended these studies to characterize liver tumor promotion in a model of nonalcoholic fatty liver disease produced by chronic feeding of high-fat liquid diets in the absence of ethanol. Mice treated with diethylnitrosamine on postnatal day 14 were fed a high-fat liquid diet made with casein or SPI as the sole protein source for 16 weeks in adulthood. Relative to mice fed normal chow, a high fat/casein diet led to increased tumor promotion, hepatocyte proliferation, steatosis, and inflammation. Replacing casein with soy protein isolate counteracted these effects. The high fat diets also resulted in a general increase in transcripts for Wnt/β-catenin pathway components, which may be an important mechanism, whereby hepatic tumorigenesis is promoted. However, soy protein isolate did not block Wnt signaling in this nonalcoholic fatty liver disease model. We conclude that replacing casein with soy protein isolate blocks development of steatosis, inflammation, and tumor promotion in diethylnitrosamine-treated mice fed high fat diets. Impact statement The impact of dietary components on cancer is a topic of great interest for both the general public and the scientific community. Liver cancer is currently the second leading form of cancer deaths worldwide. Our study has addressed the effect of the protein
Unveiling DNA structural properties of promoter regions of ...
Indian Academy of Sciences (India)
Aditya Kumar
Unveiling DNA structural properties of promoter regions of prokaryotic transcriptome and their role in gene expression. Aditya Kumar. Assistant Professor. Molecular Biology & Biotechnology. Tezpur University. Tezpur – 784028, Assam ...
Directory of Open Access Journals (Sweden)
Elena V. Ignatieva
2014-03-01
Full Text Available The molecular mechanism of olfactory cognition is very complicated. Olfactory cognition is initiated by olfactory receptor proteins (odorant receptors, which are activated by olfactory stimuli (ligands. Olfactory receptors are the initial player in the signal transduction cascade producing a nerve impulse, which is transmitted to the brain. The sensitivity to a particular ligand depends on the expression level of multiple proteins involved in the process of olfactory cognition: olfactory receptor proteins, proteins that participate in signal transduction cascade, etc. The expression level of each gene is controlled by its regulatory regions, and especially, by the promoter (a region of DNA about 100–1000 base pairs long located upstream of the transcription start site. We analyzed single nucleotide polymorphisms using human whole-genome data from the 1000 Genomes Project and revealed an extremely high level of single nucleotide polymorphisms in promoter regions of olfactory receptor genes and HLA genes. We hypothesized that the high level of polymorphisms in olfactory receptor promoters was responsible for the diversity in regulatory mechanisms controlling the expression levels of olfactory receptor proteins. Such diversity of regulatory mechanisms may cause the great variability of olfactory cognition of numerous environmental olfactory stimuli perceived by human beings (air pollutants, human body odors, odors in culinary etc.. In turn, this variability may provide a wide range of emotional and behavioral reactions related to the vast variety of olfactory stimuli.
Wei, Yongwei; Feng, Kurtis; Yao, Xiangjie; Cai, Hui; Li, Junan; Mirza, Anne M.; Iorio, Ronald M.
2012-01-01
The genus Metapneumovirus within the subfamily Pneumovirinae of the family Paramyxoviridae includes two members, human metapneumovirus (hMPV) and avian metapneumovirus (aMPV), causing respiratory tract infections in humans and birds, respectively. Paramyxoviruses enter host cells by fusing the viral envelope with a host cell membrane. Membrane fusion of hMPV appears to be unique, in that fusion of some hMPV strains requires low pH. Here, we show that the fusion (F) proteins of aMPV promote fusion in the absence of the attachment protein and low pH is not required. Furthermore, there are notable differences in cell-cell fusion among aMPV subtypes. Trypsin was required for cell-cell fusion induced by subtype B but not subtypes A and C. The F protein of aMPV subtype A was highly fusogenic, whereas those from subtypes B and C were not. By construction and evaluation of chimeric F proteins composed of domains from the F proteins of subtypes A and B, we localized a region composed of amino acid residues 170 to 338 in the F protein that is responsible for the hyperfusogenic phenotype of the F from subtype A. Further mutagenesis analysis revealed that residues R295, G297, and K323 in this region collectively contributed to the hyperfusogenicity. Taken together, we have identified a region in the aMPV F protein that modulates the extent of membrane fusion. A model for fusion consistent with these data is presented. PMID:22915815
Wei, Yongwei; Feng, Kurtis; Yao, Xiangjie; Cai, Hui; Li, Junan; Mirza, Anne M; Iorio, Ronald M; Li, Jianrong
2012-11-01
The genus Metapneumovirus within the subfamily Pneumovirinae of the family Paramyxoviridae includes two members, human metapneumovirus (hMPV) and avian metapneumovirus (aMPV), causing respiratory tract infections in humans and birds, respectively. Paramyxoviruses enter host cells by fusing the viral envelope with a host cell membrane. Membrane fusion of hMPV appears to be unique, in that fusion of some hMPV strains requires low pH. Here, we show that the fusion (F) proteins of aMPV promote fusion in the absence of the attachment protein and low pH is not required. Furthermore, there are notable differences in cell-cell fusion among aMPV subtypes. Trypsin was required for cell-cell fusion induced by subtype B but not subtypes A and C. The F protein of aMPV subtype A was highly fusogenic, whereas those from subtypes B and C were not. By construction and evaluation of chimeric F proteins composed of domains from the F proteins of subtypes A and B, we localized a region composed of amino acid residues 170 to 338 in the F protein that is responsible for the hyperfusogenic phenotype of the F from subtype A. Further mutagenesis analysis revealed that residues R295, G297, and K323 in this region collectively contributed to the hyperfusogenicity. Taken together, we have identified a region in the aMPV F protein that modulates the extent of membrane fusion. A model for fusion consistent with these data is presented.
Newton, K; Jorgensen, NM; Wallace, AJ; Buchanan, DD; Lalloo, F; McMahon, RFT; Hill, J; Evans, DG
2016-01-01
Background & Aims Lynch syndrome patients have DNA mismatch repair deficiency and up to 80% life-time risk of colorectal cancer. Screening of mutation carriers reduces colorectal cancer incidence and mortality. Selection for constitutional mutation testing relies on family history (Amsterdam and Bethesda Guidelines) and tumour derived biomarkers. Initial biomarker analysis uses mismatch repair protein immunohistochemistry and microsatellite instability. Abnormalities in either identify mismatch repair deficiency but do not differentiate sporadic epigenetic defects, due to MLH1 promoter region methylation (13% of CRCs) from Lynch Syndrome (4% of CRCs). A diagnostic biomarker capable of making this distinction would be valuable. This study compared two biomarkers in tumours with mismatch repair deficiency; quantification of methylation of the MLH1 promoter region using a novel assay and BRAF c.1799T>A, p.(Val600Glu) mutation status in the identification of constitutional mutations. Methods Tumour DNA was extracted (FFPE tissue) and pyrosequencing used to test for MLH1 promoter methylation and presence of the BRAF c.1799T>A, p.(Val600Glu) mutation 71 CRCs from individuals with pathogenic MLH1 mutations and 73 CRCs with sporadic MLH1 loss. Specificity and sensitivity was compared. Findings Unmethylated MLH1 promoter: sensitivity 94.4% (95% CI 86.2–98.4%), specificity 87.7% (95% CI 77.9–94.2%), Wild-type BRAF (codon 600): sensitivity 65.8% (95% CI 53.7–76.5%), specificity 98.6% (95% CI 92.4–100.0%) for the identification of those with pathogenic MLH1 mutations. Conclusions Quantitative MLH1 promoter region methylation using pyrosequencing is superior to BRAF codon 600 mutation status in identifying constitutional mutations in mismatch repair deficient tumours. PMID:25280751
Social Media Marketing as a tool for promoting the regional investment portals
Directory of Open Access Journals (Sweden)
Alisa Yu. Fadeyeva
2016-01-01
Full Text Available Objective to investigate the potential of Social Media Marketing as a tool for promoting regional investment portals in the information environment to identify the most effective ways of its implementation and to determine the level of mastering of this tool by the Russian regions. Methods general scientific methods observation comparison analysis induction deduction analogy classification. Results the analysis showed that today Social Media Marketing is an essential tool for interaction with the investment community and one of the most effective ways to promote the regional portal which allows to increase the knowledge of and loyalty to the brand to increase the targeted website traffic to increase the awareness of investors about the specific features of the portal and the regional development agenciesrsquo functioning to promptly receive information about the investment environment and to establish contacts with investors. At the same time the study of SMMactivity in the Russian regions revealed a very low level of quality of communication with investors through social networks. Scientific novelty for the first time the article investigates the significance and makes the comparative analysis of the Social Media Marketing channels with regard to investment promotion agencies as well as the results of the regional structures functioning for effective communication through social networks. Practical significance the main results of the research can be used by the regional investment agencies in order to promote their websites increase the quality of communication with investors and promote the investment attractiveness of the region as a whole. nbsp
Kaatz, Glenn W.; Thyagarajan, Rama V.; Seo, Susan M.
2005-01-01
NorA is a Staphylococcus aureus multidrug transporter that confers resistance to structurally distinct compounds. The MgrA global regulatory protein is reported to augment norA expression when mgrA is overexpressed from an undefined plasmid-based promoter. Further details about norA regulatory mechanisms are scant. A chromosomal norA::lacZ transcriptional fusion was constructed in different S. aureus strains, and allele replacement was used to define the relevance of promoter region sequences...
Directory of Open Access Journals (Sweden)
Sophie A Comyn
2016-07-01
Full Text Available Misfolded proteins challenge the ability of cells to maintain protein homeostasis and can accumulate into toxic protein aggregates. As a consequence, cells have adopted a number of protein quality control pathways to prevent protein aggregation, promote protein folding, and target terminally misfolded proteins for degradation. In this study, we employed a thermosensitive allele of the yeast Guk1 guanylate kinase as a model misfolded protein to investigate degradative protein quality control pathways. We performed a flow cytometry based screen to identify factors that promote proteasomal degradation of proteins misfolded as the result of missense mutations. In addition to the E3 ubiquitin ligase Ubr1, we identified the prefoldin chaperone subunit Gim3 as an important quality control factor. Whereas the absence of GIM3 did not impair proteasomal function or the ubiquitination of the model substrate, it led to the accumulation of the poorly soluble model substrate in cellular inclusions that was accompanied by delayed degradation. We found that Gim3 interacted with the Guk1 mutant allele and propose that prefoldin promotes the degradation of the unstable model substrate by maintaining the solubility of the misfolded protein. We also demonstrated that in addition to the Guk1 mutant, prefoldin can stabilize other misfolded cytosolic proteins containing missense mutations.
Directory of Open Access Journals (Sweden)
J Stephen Dumler
2016-09-01
Full Text Available Anaplasma phagocytophilum, an obligate intracellular prokaryote, infects neutrophils and alters cardinal functions via reprogrammed transcription. Large contiguous regions of neutrophil chromosomes are differentially expressed during infection. Secreted A. phagocytophilum effector AnkA transits into the neutrophil or granulocyte nucleus to complex with DNA in heterochromatin across all chromosomes. AnkA binds to gene promoters to dampen cis-transcription and also has features of matrix attachment region (MAR-binding proteins that regulate three-dimensional chromatin architecture and coordinate transcriptional programs encoded in topologically-associated chromatin domains. We hypothesize that identification of additional AnkA binding sites will better delineate how A. phagocytophilum infection results in reprogramming of the neutrophil genome. Using AnkA-binding ChIP-seq, we showed that AnkA binds broadly throughout all chromosomes in a reproducible pattern, especially at: i intergenic regions predicted to be matrix attachment regions (MARs; ii within predicted lamina-associated domains; and iii at promoters ≤3,000 bp upstream of transcriptional start sites. These findings provide genome-wide support for AnkA as a regulator of cis-gene transcription. Moreover, the dominant mark of AnkA in distal intergenic regions known to be AT-enriched, coupled with frequent enrichment in the nuclear lamina, provides strong support for its role as a MAR-binding protein and genome re-organizer. AnkA must be considered a prime candidate to promote neutrophil reprogramming and subsequent functional changes that belie improved microbial fitness and pathogenicity.
Directory of Open Access Journals (Sweden)
Nannenga Brent L
2011-12-01
Full Text Available Abstract Background Membrane proteins (MPs populate 20-30% of genomes sequenced to date and hold potential as therapeutic targets as well as for practical applications in bionanotechnology. However, MP toxicity and low yields in normally robust expression hosts such as E. coli has curtailed progress in our understanding of their structure and function. Results Using the seven transmembrane segments H. turkmenica deltarhodopsin (HtdR as a reporter, we isolated a spontaneous mutant in the arabinose-inducible PBAD promoter leading to improved cell growth and a twofold increase in the recovery of active HtdR at 37°C. A single transversion in a conserved region of the cyclic AMP receptor protein binding site caused the phenotype by reducing htdR transcript levels by 65%. When the mutant promoter was used in conjunction with a host lacking the molecular chaperone Trigger Factor (Δtig cells, toxicity was further suppressed and the amount of correctly folded HtdR was 4-fold that present in the membranes of control cells. More importantly, while improved growth barely compensated for the reduction in transcription rates when another polytopic membrane protein (N. pharonis sensory rhodopsin II was expressed under control of the mutant promoter in wild type cells, a 4-fold increase in productivity could be achieved in a Δtig host. Conclusions Our system, which combines a downregulated version of the tightly repressed PBAD promoter with a TF-deficient host may prove a valuable alternative to T7-based expression for the production of membrane proteins that have so far remained elusive targets.
Hong, Jeum Kyu; Hwang, Byung Kook
2009-01-01
The promoter of the pepper pathogen-induced membrane protein gene CaPIMP1 was analyzed by an Agrobacterium-mediated transient expression assay in tobacco leaves. Several stress-related cis-acting elements (GT-1, W-box and ABRE) are located within the CaPIMP1 promoter. In tobacco leaf tissues transiently transformed with a CaPIMP1 promoter-beta-glucuronidase (GUS) gene fusion, serially 5'-deleted CaPIMP1 promoters were differentially activated by Pseudomonas syringae pv. tabaci, ethylene, methyl jasmonate, abscisic acid, and nitric oxide. The -1,193 bp region of the CaPIMP1 gene promoter sequence exhibited full promoter activity. The -417- and -593 bp promoter regions were sufficient for GUS gene activation by ethylene and methyl jasmonate treatments, respectively. However, CaPIMP1 promoter sequences longer than -793 bp were required for promoter activation by abscisic acid and sodium nitroprusside treatments. CaPIMP1 expression was activated in pepper leaves by treatment with ethylene, methyl jasmonate, abscisic acid, beta-amino-n-butyric acid, NaCl, mechanical wounding, and low temperature, but not with salicylic acid. Overexpression of CaPIMP1 in Arabidopsis conferred hypersensitivity to mannitol, NaCl, and ABA during seed germination but not during seedling development. In contrast, transgenic plants overexpressing CaPIMP1 exhibited enhanced tolerance to oxidative stress induced by methyl viologen during germination and early seedling stages. These results suggest that CaPIMP1 expression may alter responsiveness to environmental stress, as well as to pathogen infection.
Zhou, Jie; Zhang, Haifeng; Meng, Hengkai; Zhu, Yan; Bao, Guanhui; Zhang, Yanping; Li, Yin; Ma, Yanhe
2014-03-28
Cyanobacteria are oxygenic photosynthetic prokaryotes that play important roles in the global carbon cycle. Recently, engineered cyanobacteria capable of producing various small molecules from CO2 have been developed. However, cyanobacteria are seldom considered as factories for producing proteins, mainly because of the lack of efficient strong promoters. Here, we report the discovery and verification of a super-strong promoter P(cpc560), which contains two predicted promoters and 14 predicted transcription factor binding sites (TFBSs). Using P(cpc560), functional proteins were produced at a level of up to 15% of total soluble protein in the cyanobacterium Synechocystis sp. 6803, a level comparable to that produced in Escherichia coli. We demonstrated that the presence of multiple TFBSs in P(cpc560) is crucial for its promoter strength. Genetically transformable cyanobacteria neither have endotoxins nor form inclusion bodies; therefore, P(cpc560) opens the possibility to use cyanobacteria as alternative hosts for producing heterogeneous proteins from CO2 and inorganic nutrients.
Kandasamy, Saveetha; Loganathan, Karthiba; Muthuraj, Raveendran; Duraisamy, Saravanakumar; Seetharaman, Suresh; Thiruvengadam, Raguchander; Ponnusamy, Balasubramanian; Ramasamy, Samiyappan
2009-12-24
Plant Growth Promoting Rhizobacteria (PGPR), Pseudomonas fluorescens strain KH-1 was found to exhibit plant growth promotional activity in rice under both in-vitro and in-vivo conditions. But the mechanism underlying such promotional activity of P. fluorescens is not yet understood clearly. In this study, efforts were made to elucidate the molecular responses of rice plants to P. fluorescens treatment through protein profiling. Two-dimensional polyacrylamide gel electrophoresis strategy was adopted to identify the PGPR responsive proteins and the differentially expressed proteins were analyzed by mass spectrometry. Priming of P. fluorescens, 23 different proteins found to be differentially expressed in rice leaf sheaths and MS analysis revealed the differential expression of some important proteins namely putative p23 co-chaperone, Thioredoxin h- rice, Ribulose-bisphosphate carboxylase large chain precursor, Nucleotide diPhosphate kinase, Proteosome sub unit protein and putative glutathione S-transferase protein. Functional analyses of the differential proteins were reported to be directly or indirectly involved in growth promotion in plants. Thus, this study confirms the primary role of PGPR strain KH-1 in rice plant growth promotion.
Identification and annotation of promoter regions in microbial ...
Indian Academy of Sciences (India)
PRAKASH KUMAR
2007-06-15
Jun 15, 2007 ... It remains important, not only to detect rarely expressed genes but also for ... well as in identifying genes associated with rRNA, tRNA and ... DNA stability; free energy calculation; promoter; upstream and downstream region.
Tao, Yan-Bin; He, Liang-Liang; Niu, Long-Jian; Xu, Zeng-Fu
2015-04-01
The JcUEP promoter is active constitutively in the bio-fuel plant Jatropha curcas , and is an alternative to the widely used CaMV35S promoter for driving constitutive overexpression of transgenes in Jatropha. Well-characterized promoters are required for transgenic breeding of Jatropha curcas, a biofuel feedstock with great potential for production of bio-diesel and bio-jet fuel. In this study, an ubiquitin extension protein gene from Jatropha, designated JcUEP, was identified to be ubiquitously expressed. Thus, we isolated a 1.2 kb fragment of the 5' flanking region of JcUEP and evaluated its activity as a constitutive promoter in Arabidopsis and Jatropha using the β-glucuronidase (GUS) reporter gene. As expected, histochemical GUS assay showed that the JcUEP promoter was active in all Arabidopsis and Jatropha tissues tested. We also compared the activity of the JcUEP promoter with that of the cauliflower mosaic virus 35S (CaMV35S) promoter, a well-characterized constitutive promoter conferring strong transgene expression in dicot species, in various tissues of Jatropha. In a fluorometric GUS assay, the two promoters showed similar activities in stems, mature leaves and female flowers; while the CaMV35S promoter was more effective than the JcUEP promoter in other tissues, especially young leaves and inflorescences. In addition, the JcUEP promoter retained its activity under stress conditions in low temperature, high salt, dehydration and exogenous ABA treatments. These results suggest that the plant-derived JcUEP promoter could be an alternative to the CaMV35S promoter for driving constitutive overexpression of transgenes in Jatropha and other plants.
Directory of Open Access Journals (Sweden)
Mostafa M Abbas
Full Text Available As the number of sequenced bacterial genomes increases, the need for rapid and reliable tools for the annotation of functional elements (e.g., transcriptional regulatory elements becomes more desirable. Promoters are the key regulatory elements, which recruit the transcriptional machinery through binding to a variety of regulatory proteins (known as sigma factors. The identification of the promoter regions is very challenging because these regions do not adhere to specific sequence patterns or motifs and are difficult to determine experimentally. Machine learning represents a promising and cost-effective approach for computational identification of prokaryotic promoter regions. However, the quality of the predictors depends on several factors including: i training data; ii data representation; iii classification algorithms; iv evaluation procedures. In this work, we create several variants of E. coli promoter data sets and utilize them to experimentally examine the effect of these factors on the predictive performance of E. coli σ70 promoter models. Our results suggest that under some combinations of the first three criteria, a prediction model might perform very well on cross-validation experiments while its performance on independent test data is drastically very poor. This emphasizes the importance of evaluating promoter region predictors using independent test data, which corrects for the over-optimistic performance that might be estimated using the cross-validation procedure. Our analysis of the tested models shows that good prediction models often perform well despite how the non-promoter data was obtained. On the other hand, poor prediction models seems to be more sensitive to the choice of non-promoter sequences. Interestingly, the best performing sequence-based classifiers outperform the best performing structure-based classifiers on both cross-validation and independent test performance evaluation experiments. Finally, we propose a
Promoter analysis of the Chilo iridescent virus DNA polymerase and major capsid protein genes
International Nuclear Information System (INIS)
Nalcacioglu, Remziye; Marks, Hendrik; Vlak, Just M.; Demirbag, Zihni; Oers, Monique M. van
2003-01-01
The DNA polymerase (DNApol) and major capsid protein (MCP) genes were used as models to study promoter activity in Chilo iridescent virus (CIV). Infection of Bombyx mori SPC-BM-36 cells in the presence of inhibitors of DNA or protein synthesis showed that DNApol, as well as helicase, is an immediate-early gene and confirmed that the major capsid protein (MCP) is a late gene. Transcription of DNApol initiated 35 nt upstream and that of MCP 14 nt upstream of the translational start site. In a luciferase reporter gene assay both promoters were active only when cells were infected with CIV. For DNApol sequences between position -27 and -6, relative to the transcriptional start site, were essential for promoter activity. Furthermore, mutation of a G within the sequence TTGTTTT located just upstream of the DNApol transcription initiation site reduced the promoter activity by 25%. Sequences crucial for MCP promoter activity are located between positions -53 and -29
Kawaguchi, Koichiro; Kinameri, Ayumi; Suzuki, Shunsuke; Senga, Shogo; Ke, Youqiang; Fujii, Hiroshi
2016-02-15
FABPs (fatty-acid-binding proteins) are a family of low-molecular-mass intracellular lipid-binding proteins consisting of ten isoforms. FABPs are involved in binding and storing hydrophobic ligands such as long-chain fatty acids, as well as transporting these ligands to the appropriate compartments in the cell. FABP5 is overexpressed in multiple types of tumours. Furthermore, up-regulation of FABP5 is strongly associated with poor survival in triple-negative breast cancer. However, the mechanisms underlying the specific up-regulation of the FABP5 gene in these cancers remain poorly characterized. In the present study, we determined that FABP5 has a typical CpG island around its promoter region. The DNA methylation status of the CpG island in the FABP5 promoter of benign prostate cells (PNT2), prostate cancer cells (PC-3, DU-145, 22Rv1 and LNCaP) and human normal or tumour tissue was assessed by bisulfite sequencing analysis, and then confirmed by COBRA (combined bisulfite restriction analysis) and qAMP (quantitative analysis of DNA methylation using real-time PCR). These results demonstrated that overexpression of FABP5 in prostate cancer cells can be attributed to hypomethylation of the CpG island in its promoter region, along with up-regulation of the direct trans-acting factors Sp1 (specificity protein 1) and c-Myc. Together, these mechanisms result in the transcriptional activation of FABP5 expression during human prostate carcinogenesis. Importantly, silencing of Sp1, c-Myc or FABP5 expression led to a significant decrease in cell proliferation, indicating that up-regulation of FABP5 expression by Sp1 and c-Myc is critical for the proliferation of prostate cancer cells. © 2016 Authors; published by Portland Press Limited.
Sequence analysis of the Epstein-Barr virus (EBV) latent membrane protein-1 gene and promoter region
DEFF Research Database (Denmark)
Sandvej, Kristian; Gratama, J W; Munch, M
1997-01-01
Sequence variations in the Epstein-Barr virus (EBV) encoded latent membrane protein-1 (LMP-1) gene have been described in a Chinese nasopharyngeal carcinoma-derived isolate (CAO), and in viral isolates from various EBV-associated tumors. It has been suggested that these genetic changes, which...... include loss of a Xho I restriction site (position 169425) and a C-terminal 30-base pair (bp) deletion (position 168287-168256), define EBV genotypes associated with increased tumorigenicity or with disease among particular geographic populations. To determine the frequency of LMP-1 variations in European...... wild-type virus isolates, we sequenced the LMP-1 promoter and gene in EBV from lymphoblastoid cell lines from healthy carriers and patients without EBV-associated disease. Sequence changes were often present, and defined at least four main groups of viral isolates, which we designate Groups A through D...
International Nuclear Information System (INIS)
Chattopadhyay, Anasuya; Schmidt, Martin C.; Khan, Saleem A.
2005-01-01
Human papillomaviruses (HPVs) replicate as nuclear plasmids in infected cells. Since the DNA replication machinery is generally conserved between humans and Saccharomyces cerevisiae, we studied whether HPV-1 DNA can replicate in yeast. Plasmids containing a selectable marker (with or without a yeast centromere) and either the full-length HPV-1 genome or various regions of the viral long control region (LCR) and the 3' end of the L1 gene were introduced into S. cerevisiae and their ability to replicate episomally was investigated. Our results show that HPV-1 sequences promote episomal replication of plasmids although the yeast centromere is required for plasmid retention. We have mapped the autonomously replicating sequence activity of HPV-1 DNA to a 450 base-pair sequence (HPV-1 nt 6783-7232) that includes 293 nucleotides from the 5' region of the viral LCR and 157 nucleotides from the 3' end of the L1 gene. The HPV-1 ARS does not include the binding sites for the viral E1 and E2 proteins, and these proteins are dispensable for replication in S. cerevisiae
Directory of Open Access Journals (Sweden)
Thiruvengadam Raguchander
2009-12-01
Full Text Available Abstract Background Plant Growth Promoting Rhizobacteria (PGPR, Pseudomonas fluorescens strain KH-1 was found to exhibit plant growth promotional activity in rice under both in-vitro and in-vivo conditions. But the mechanism underlying such promotional activity of P. fluorescens is not yet understood clearly. In this study, efforts were made to elucidate the molecular responses of rice plants to P. fluorescens treatment through protein profiling. Two-dimensional polyacrylamide gel electrophoresis strategy was adopted to identify the PGPR responsive proteins and the differentially expressed proteins were analyzed by mass spectrometry. Results Priming of P. fluorescens, 23 different proteins found to be differentially expressed in rice leaf sheaths and MS analysis revealed the differential expression of some important proteins namely putative p23 co-chaperone, Thioredoxin h- rice, Ribulose-bisphosphate carboxylase large chain precursor, Nucleotide diPhosphate kinase, Proteosome sub unit protein and putative glutathione S-transferase protein. Conclusion Functional analyses of the differential proteins were reported to be directly or indirectly involved in growth promotion in plants. Thus, this study confirms the primary role of PGPR strain KH-1 in rice plant growth promotion.
Neural regeneration protein is a novel chemoattractive and neuronal survival-promoting factor
International Nuclear Information System (INIS)
Gorba, Thorsten; Bradoo, Privahini; Antonic, Ana; Marvin, Keith; Liu, Dong-Xu; Lobie, Peter E.; Reymann, Klaus G.; Gluckman, Peter D.; Sieg, Frank
2006-01-01
Neurogenesis and neuronal migration are the prerequisites for the development of the central nervous system. We have identified a novel rodent gene encoding for a neural regeneration protein (NRP) with an activity spectrum similar to the chemokine stromal-derived factor (SDF)-1, but with much greater potency. The Nrp gene is encoded as a forward frameshift to the hypothetical alkylated DNA repair protein AlkB. The predicted protein sequence of NRP contains domains with homology to survival-promoting peptide (SPP) and the trefoil protein TFF-1. The Nrp gene is first expressed in neural stem cells and expression continues in glial lineages. Recombinant NRP and NRP-derived peptides possess biological activities including induction of neural migration and proliferation, promotion of neuronal survival, enhancement of neurite outgrowth and promotion of neuronal differentiation from neural stem cells. NRP exerts its effect on neuronal survival by phosphorylation of the ERK1/2 and Akt kinases, whereas NRP stimulation of neural migration depends solely on p44/42 MAP kinase activity. Taken together, the expression profile of Nrp, the existence in its predicted protein structure of domains with similarities to known neuroprotective and migration-inducing factors and the high potency of NRP-derived synthetic peptides acting in femtomolar concentrations suggest it to be a novel gene of relevance in cellular and developmental neurobiology
Business networking for SMEs as a means to promote regional competitiveness: A Theoretical Framework
Vitor Braga
2004-01-01
The competitiveness of regions, as a means of promoting the competitiveness of a country as a whole, has been one of the main topics on the agenda of policy makers over the last decades. Several attempts at promoting competitiveness have been made with different degrees of success. In most cases, public investment in the regions was perceived as the solution to promote regional competitiveness and top-down policies were implemented. However, competitiveness also has an important dimension tha...
Moll, Lorna; Ben-Gedalya, Tziona; Reuveni, Hadas; Cohen, Ehud
2016-04-01
The discovery that the alteration of aging by reducing the activity of the insulin/IGF-1 signaling (IIS) cascade protects nematodes and mice from neurodegeneration-linked, toxic protein aggregation (proteotoxicity) raises the prospect that IIS inhibitors bear therapeutic potential to counter neurodegenerative diseases. Recently, we reported that NT219, a highly efficient IGF-1 signaling inhibitor, protects model worms from the aggregation of amyloid β peptide and polyglutamine peptides that are linked to the manifestation of Alzheimer's and Huntington's diseases, respectively. Here, we employed cultured cell systems to investigate whether NT219 promotes protein homeostasis (proteostasis) in mammalian cells and to explore its underlying mechanisms. We found that NT219 enhances the aggregation of misfolded prion protein and promotes its deposition in quality control compartments known as "aggresomes." NT219 also elevates the levels of certain molecular chaperones but, surprisingly, reduces proteasome activity and impairs autophagy. Our findings show that IGF-1 signaling inhibitors in general and NT219 in particular can promote proteostasis in mammalian cells by hyperaggregating hazardous proteins, thereby bearing the potential to postpone the onset and slow the progression of neurodegenerative illnesses in the elderly.-Moll, L., Ben-Gedalya, T., Reuveni, H., Cohen, E. The inhibition of IGF-1 signaling promotes proteostasis by enhancing protein aggregation and deposition. © FASEB.
Tobacco arabinogalactan protein NtEPc can promote banana (Musa AAA) somatic embryogenesis.
Shu, H; Xu, L; Li, Z; Li, J; Jin, Z; Chang, S
2014-12-01
Banana is an important tropical fruit worldwide. Parthenocarpy and female sterility made it impossible to improve banana varieties through common hybridization. Genetic transformation for banana improvement is imperative. But the low rate that banana embryogenic callus was induced made the transformation cannot be performed in many laboratories. Finding ways to promote banana somatic embryogenesis is critical for banana genetic transformation. After tobacco arabinogalactan protein gene NtEPc was transformed into Escherichia coli (DE3), the recombinant protein was purified and filter-sterilized. A series of the sterilized protein was added into tissue culture medium. It was found that the number of banana immature male flowers developing embryogenic calli increased significantly in the presence of NtEPc protein compared with the effect of the control medium. Among the treatments, explants cultured on medium containing 10 mg/l of NtEPc protein had the highest chance to develop embryogenic calli. The percentage of lines that developed embryogenic calli on this medium was about 12.5 %. These demonstrated that NtEPc protein can be used to promote banana embryogenesis. This is the first paper that reported that foreign arabinogalactan protein (AGP) could be used to improve banana somatic embryogenesis.
Ho, Steven C L; Yang, Yuansheng
2014-08-01
Promoters are essential on plasmid vectors to initiate transcription of the transgenes when generating therapeutic recombinant proteins expressing mammalian cell lines. High and sustained levels of gene expression are desired during therapeutic protein production while gene expression is useful for cell engineering. As many finely controlled promoters exhibit cell and product specificity, new promoters need to be identified, optimized and carefully evaluated before use. Suitable promoters can be identified using techniques ranging from simple molecular biology methods to modern high-throughput omics screenings. Promoter engineering is often required after identification to either obtain high and sustained expression or to provide a wider range of gene expression. This review discusses some of the available methods to identify and engineer promoters for therapeutic recombinant protein expression in mammalian cells.
Deng, X; Shao, G; Zhang, H-T; Li, C; Zhang, D; Cheng, L; Elzey, B D; Pili, R; Ratliff, T L; Huang, J; Hu, C-D
2017-03-02
Protein arginine methyltransferase 5 (PRMT5) is an emerging epigenetic enzyme that mainly represses transcription of target genes via symmetric dimethylation of arginine residues on histones H4R3, H3R8 and H2AR3. Accumulating evidence suggests that PRMT5 may function as an oncogene to drive cancer cell growth by epigenetic inactivation of several tumor suppressors. Here, we provide evidence that PRMT5 promotes prostate cancer cell growth by epigenetically activating transcription of the androgen receptor (AR) in prostate cancer cells. Knockdown of PRMT5 or inhibition of PRMT5 by a specific inhibitor reduces the expression of AR and suppresses the growth of multiple AR-positive, but not AR-negative, prostate cancer cells. Significantly, knockdown of PRMT5 in AR-positive LNCaP cells completely suppresses the growth of xenograft tumors in mice. Molecular analysis reveals that PRMT5 binds to the proximal promoter region of the AR gene and contributes mainly to the enriched symmetric dimethylation of H4R3 in the same region. Mechanistically, PRMT5 is recruited to the AR promoter by its interaction with Sp1, the major transcription factor responsible for AR transcription, and forms a complex with Brg1, an ATP-dependent chromatin remodeler, on the proximal promoter region of the AR gene. Furthermore, PRMT5 expression in prostate cancer tissues is significantly higher than that in benign prostatic hyperplasia tissues, and PRMT5 expression correlates positively with AR expression at both the protein and mRNA levels. Taken together, our results identify PRMT5 as a novel epigenetic activator of AR in prostate cancer. Given that inhibiting AR transcriptional activity or androgen synthesis remains the major mechanism of action for most existing anti-androgen agents, our findings also raise an interesting possibility that targeting PRMT5 may represent a novel approach for prostate cancer treatment by eliminating AR expression.
Analysis of tissue-specific region in sericin 1 gene promoter of Bombyx mori
Energy Technology Data Exchange (ETDEWEB)
Yan, Liu [College of Biomedical Engineering and Instrument Science, Zhejiang University, Hangzhou 310027 (China); Institute of Biochemistry and Cell Biology, Shanghai Institutes for Biological Sciences, Chinese Academy of Sciences, Shanghai 200031 (China); Lian, Yu [College of Biomedical Engineering and Instrument Science, Zhejiang University, Hangzhou 310027 (China); Zhejiang Province Key Laboratory of Preventive Veterinary Medicine, Institute of Preventive Veterinary Medicine, Zhejiang University, Hangzhou 310029 (China); Xiuyang, Guo [Institute of Biochemistry and Cell Biology, Shanghai Institutes for Biological Sciences, Chinese Academy of Sciences, Shanghai 200031 (China); Tingqing, Guo [Institute of Biochemistry and Cell Biology, Shanghai Institutes for Biological Sciences, Chinese Academy of Sciences, Shanghai 200031 (China); Shengpeng, Wang [Institute of Biochemistry and Cell Biology, Shanghai Institutes for Biological Sciences, Chinese Academy of Sciences, Shanghai 200031 (China); Changde, Lu [Institute of Biochemistry and Cell Biology, Shanghai Institutes for Biological Sciences, Chinese Academy of Sciences, Shanghai 200031 (China)
2006-03-31
The gene encoding sericin 1 (Ser1) of silkworm (Bombyx mori) is specifically expressed in the middle silk gland cells. To identify element involved in this transcription-dependent spatial restriction, truncation of the 5' terminal from the sericin 1 (Ser1) promoter is studied in vivo. A 209 bp DNA sequence upstream of the transcriptional start site (-586 to -378) is found to be responsible for promoting tissue-specific transcription. Analysis of this 209 bp region by overlapping deletion studies showed that a 25 bp region (-500 to -476) suppresses the ectopic expression of the Ser1 promoter. An unknown factor abundant in fat body nuclear extracts is shown to bind to this 25 bp fragment. These results suggest that this 25 bp region and the unknown factor are necessary for determining the tissue-specificity of the Ser1 promoter.
Zhang, Kang; Su, Lingqia; Duan, Xuguo; Liu, Lina; Wu, Jing
2017-02-20
We recently constructed a Bacillus subtilis strain (CCTCC M 2016536) from which we had deleted the srfC, spoIIAC, nprE, aprE and amyE genes. This strain is capable of robust recombinant protein production and amenable to high-cell-density fermentation. Because the promoter is among the factors that influence the production of target proteins, optimization of the initial promoter, P amyQ from Bacillus amyloliquefaciens, should improve protein expression using this strain. This study was undertaken to develop a new, high-level expression system in B. subtilis CCTCC M 2016536. Using the enzyme β-cyclodextrin glycosyltransferase (β-CGTase) as a reporter protein and B. subtilis CCTCC M 2016536 as the host, nine plasmids equipped with single promoters were screened using shake-flask cultivation. The plasmid containing the P amyQ' promoter produced the greatest extracellular β-CGTase activity; 24.1 U/mL. Subsequently, six plasmids equipped with dual promoters were constructed and evaluated using this same method. The plasmid containing the dual promoter P HpaII -P amyQ' produced the highest extracellular β-CGTase activity (30.5 U/mL) and was relatively glucose repressed. The dual promoter P HpaII -P amyQ' also mediated substantial extracellular pullulanase (90.7 U/mL) and α-CGTase expression (9.5 U/mL) during shake-flask cultivation, demonstrating the general applicability of this system. Finally, the production of β-CGTase using the dual-promoter P HpaII -P amyQ' system was investigated in a 3-L fermenter. Extracellular expression of β-CGTase reached 571.2 U/mL (2.5 mg/mL), demonstrating the potential of this system for use in industrial applications. The dual-promoter P HpaII -P amyQ' system was found to support superior expression of extracellular proteins in B. subtilis CCTCC M 2016536. This system appears generally applicable and is amenable to scale-up.
Direct and indirect effects in the regulation of overlapping promoters
DEFF Research Database (Denmark)
Bendtsen, Kristian Moss; Erdossy, Janos; Csiszovski, Zsolt
2011-01-01
promoter database we found that ~14% of the identified 'forward' promoters overlap with a promoter oriented in the opposite direction. In this article we combine a mathematical model with experimental analysis of synthetic regulatory regions to investigate interference of overlapping promoters. We find...... that promoter interference depends on the characteristics of overlapping promoters. The model predicts that promoter strength and interference can be regulated separately, which provides unique opportunities for regulation. Our experimental data suggest that in principle any DNA binding protein can be used......Optimal response to environmental stimuli often requires activation of certain genes and repression of others. Dual function regulatory proteins play a key role in the differential regulation of gene expression. While repression can be achieved by any DNA binding protein through steric occlusion...
DEFF Research Database (Denmark)
Christiansen, H; Hansen, A C; Vijn, I
1996-01-01
The pea genes PsENOD12A and PsENOD12B are expressed in the root hairs shortly after infection with the nitrogen-fixing bacterium Rhizobium leguminosarum bv. viciae or after application of purified Nod factors. A 199 bp promoter fragment of the PsENOD12B gene contains sufficient information for Nod...... factor-induced tissue-specific expression. We have isolated a Vicia sativa cDNA encoding a 1641 amino acid protein, ENBP1, that interacts with the 199 bp ENOD12 promoter. Two different DNA-binding domains were identified in ENBP1. A domain containing six AT-hooks interacts specifically with an AT...... of the ENBP1 transcript in cells expressing ENOD12 strongly suggest that ENBP1 is a transcription factor involved in the regulation of ENOD12. Finally, the C-terminal region of ENBP1 shows strong homology to a protein from rat that is specifically expressed in testis tissue. Udgivelsesdato: 1996-Dec...
Modeling disordered regions in proteins using Rosetta.
Directory of Open Access Journals (Sweden)
Ray Yu-Ruei Wang
Full Text Available Protein structure prediction methods such as Rosetta search for the lowest energy conformation of the polypeptide chain. However, the experimentally observed native state is at a minimum of the free energy, rather than the energy. The neglect of the missing configurational entropy contribution to the free energy can be partially justified by the assumption that the entropies of alternative folded states, while very much less than unfolded states, are not too different from one another, and hence can be to a first approximation neglected when searching for the lowest free energy state. The shortcomings of current structure prediction methods may be due in part to the breakdown of this assumption. Particularly problematic are proteins with significant disordered regions which do not populate single low energy conformations even in the native state. We describe two approaches within the Rosetta structure modeling methodology for treating such regions. The first does not require advance knowledge of the regions likely to be disordered; instead these are identified by minimizing a simple free energy function used previously to model protein folding landscapes and transition states. In this model, residues can be either completely ordered or completely disordered; they are considered disordered if the gain in entropy outweighs the loss of favorable energetic interactions with the rest of the protein chain. The second approach requires identification in advance of the disordered regions either from sequence alone using for example the DISOPRED server or from experimental data such as NMR chemical shifts. During Rosetta structure prediction calculations the disordered regions make only unfavorable repulsive contributions to the total energy. We find that the second approach has greater practical utility and illustrate this with examples from de novo structure prediction, NMR structure calculation, and comparative modeling.
TPA-inducible proteins may account for sensitivity to promotion of transformation
International Nuclear Information System (INIS)
Hirano, K.; Smith, B.; Colburn, N.H.
1986-01-01
The preneoplastic JB6 mouse epidermal cell system includes cell lines sensitive (P + ) or resistant (P - ) to tumor promoter induced neoplastic transformation. The authors investigated whether a difference in TPA-inducible proteins may explain this differential sensitivity. The synthesis of a 39 Kd cytoplasmic protein (Major Excreted Protein) was TPA-inducible, but to a similar extent in both P + and P - cells. TPA stimulated phosphorylation but not synthesis of the previously described stress protein pp80 in both P + and P - cells from 1 to 5 hr after treatment. Pulse labelling of P + and P - cells with 35 S-methionine revealed a TPA dependent P + specific transient increase in the synthesis of 58Kd protein. Induction was observed at 1 hr, and returned to basal levels by 4 hr and 20 hr, in nuclear and cytoplasmic fractions, respectively. This protein is not phosphorylated in response to TPA treatment. P + cells differ from P - cells in one or more genes that specify sensitivity to promotion of transformation, designated pro genes. Antibodies to three peptides representing the pro-1 open reading frame were used in immunoprecipitation and Western blotting to isolate the pro-1 gene product. A 43 Kd protein was immunologically responsive to the pro-1 peptide antibodies, and showed an increased signal 40 min after TPA treatment. Since the predicted molecular weight of a pro-1 gene product is only 7 Kd, the possibility of a modification of the protein by poly(ADP-ribosylation) or glycosylation is being investigated
Growth-promoting effect on iron-sulfur proteins on axenic cultures of Entamoeba dispar
Directory of Open Access Journals (Sweden)
Khalifa S.A.M.
2006-03-01
Full Text Available A growth-promoting factor (GPF that promotes the growth of Entamoeba dispar under axenic culture conditions was found in fractions of mitochondria (Mt, hydrogenosomes (Hg and chloroplasts (Cp obtained from cells of six different protozoan, mammalian and plant species. We were able to extract the GPF from the Cp-rich leaf cells of a plant (spiderwort: Commelina communis L. in an acetone-soluble fraction as a complex of chlorophyll with low molecular weight proteins (molecular weight [MW] approximately 4,600. We also found that on treatment with 0.6 % complexes of 2-mercapthoethanol (2ME, complexes of chlorophyll-a with iron-sulphur (Fe-S proteins (e.g., ferredoxins [Fd] from spinach and Clostridium pasteurianum and noncomplex rubredoxin (Rd from C. pasteurianum have a growth-promoting effect on E. dispar. These findings suggest that E. dispar may lack a sufficient quantity of some essential components of Fe-S proteins, such as Fe-S center.
Muhle, Rebecca A; Adjalley, Sophie; Falkard, Brie; Nkrumah, Louis J; Muhle, Michael E; Fidock, David A
2009-11-01
Questions surround the mechanism of mutually exclusive expression by which Plasmodium falciparum mediates activation and silencing of var genes. These encode PfEMP1 proteins, which function as cytoadherent and immunomodulatory molecules at the surface of parasitised erythrocytes. Current evidence suggests that promoter silencing by var introns might play a key role in var gene regulation. To evaluate the impact of cis-acting regulatory regions on var silencing, we generated P. falciparum lines in which luciferase was placed under the control of an UpsA var promoter. By utilising the Bxb1 integrase system, these reporter cassettes were targeted to a genomic region that was not in apposition to var subtelomeric domains. This eliminated possible effects from surrounding telomeric elements and removed the variability inherent in episomal systems. Studies with highly synchronised parasites revealed that the UpsA element possessed minimal activity in comparison with a heterologous (hrp3) promoter. This may result from the integrated UpsA promoter being largely silenced by the neighbouring cg6 promoter. Our analyses also revealed that the DownsA 3' untranslated region further decreased the luciferase activity from both cassettes, whereas the var A intron repressed the UpsA promoter specifically. By applying multivariate analysis over the entire cell cycle, we confirmed the significance of these cis-elements and found the parasite stage to be the major factor regulating UpsA-promoter activity. Additionally, we observed that the UpsA promoter was capable of nucleating reversible silencing that spread to a downstream promoter. We believe these studies are the first to analyse promoter activity of Group A var genes, which have been implicated in severe malaria, and support the model that var introns can further suppress var expression. These data also suggest an important suppressive role for the DownsA terminator. Our findings imply the existence of multiple levels of var
Perspectives on Promoting Regional Renewable Energy Research and Development
International Nuclear Information System (INIS)
Dresselhaus, M.
2008-01-01
Recent discussions at the Washington International Renewable Energy Conference (WIREC), hosted in March 2008 by the United States Government, with nearly 9000 participants including 103 ministers from 126 countries, concluded that a major acceleration in the adoption of renewable energy technologies was needed by mid-century. Because of different climatic conditions and societal preferences, regional cooperation is expected to play a major role in the efficient adoption of appropriate renewable energy technologies, and countries with special expertise in specific technologies seem eager to collaborate internationally to promote global goals in renewable energy. A review will be given of what we learned from this conference about renewable energy research and development strategies with a special focus given to using this basic knowledge base to promote the development of renewable energy technologies appropriate to specific regions of the world.(author)
Rampant adaptive evolution in regions of proteins with unknown function in Drosophila simulans.
Directory of Open Access Journals (Sweden)
Alisha K Holloway
2007-10-01
Full Text Available Adaptive protein evolution is pervasive in Drosophila. Genomic studies, thus far, have analyzed each protein as a single entity. However, the targets of adaptive events may be localized to particular parts of proteins, such as protein domains or regions involved in protein folding. We compared the population genetic mechanisms driving sequence polymorphism and divergence in defined protein domains and non-domain regions. Interestingly, we find that non-domain regions of proteins are more frequent targets of directional selection. Protein domains are also evolving under directional selection, but appear to be under stronger purifying selection than non-domain regions. Non-domain regions of proteins clearly play a major role in adaptive protein evolution on a genomic scale and merit future investigations of their functional properties.
Grunden, A M; Self, W T; Villain, M; Blalock, J E; Shanmugam, K T
1999-08-20
Expression of the modABCD operon in Escherichia coli, which codes for a molybdate-specific transporter, is repressed by ModE in vivo in a molybdate-dependent fashion. In vitro DNase I-footprinting experiments identified three distinct regions of protection by ModE-molybdate on the modA operator/promoter DNA, GTTATATT (-15 to -8; region 1), GCCTACAT (-4 to +4; region 2), and GTTACAT (+8 to +14; region 3). Within the three regions of the protected DNA, a pentamer sequence, TAYAT (Y = C or T), can be identified. DNA-electrophoretic mobility experiments showed that the protected regions 1 and 2 are essential for binding of ModE-molybdate to DNA, whereas the protected region 3 increases the affinity of the DNA to the repressor. The stoichiometry of this interaction was found to be two ModE-molybdate per modA operator DNA. ModE-molybdate at 5 nM completely protected the modABCD operator/promoter DNA from DNase I-catalyzed hydrolysis, whereas ModE alone failed to protect the DNA even at 100 nM. The apparent K(d) for the interaction between the modA operator DNA and ModE-molybdate was 0.3 nM, and the K(d) increased to 8 nM in the absence of molybdate. Among the various oxyanions tested, only tungstate replaced molybdate in the repression of modA by ModE, but the affinity of ModE-tungstate for modABCD operator DNA was 6 times lower than with ModE-molybdate. A mutant ModE(T125I) protein, which repressed modA-lac even in the absence of molybdate, protected the same region of modA operator DNA in the absence of molybdate. The apparent K(d) for the interaction between modA operator DNA and ModE(T125I) was 3 nM in the presence of molybdate and 4 nM without molybdate. The binding of molybdate to ModE resulted in a decrease in fluorescence emission, indicating a conformational change of the protein upon molybdate binding. The fluorescence emission spectra of mutant ModE proteins, ModE(T125I) and ModE(Q216*), were unaffected by molybdate. The molybdate-independent mutant Mod
Singh, Pawan; Patil, K Neelakanteshwar; Khanduja, Jasbeer Singh; Kumar, P Sanjay; Williams, Alan; Rossi, Franca; Rizzi, Menico; Davis, Elaine O; Muniyappa, K
2010-06-15
DNA helicases are present in all kingdoms of life and play crucial roles in processes of DNA metabolism such as replication, repair, recombination, and transcription. To date, however, the role of DNA helicases during homologous recombination in mycobacteria remains unknown. In this study, we show that Mycobacterium tuberculosis UvrD1 more efficiently inhibited the strand exchange promoted by its cognate RecA, compared to noncognate Mycobacterium smegmatis or Escherichia coli RecA proteins. The M. tuberculosis UvrD1(Q276R) mutant lacking the helicase and ATPase activities was able to block strand exchange promoted by mycobacterial RecA proteins but not of E. coli RecA. We observed that M. tuberculosis UvrA by itself has no discernible effect on strand exchange promoted by E. coli RecA but impedes the reaction catalyzed by the mycobacterial RecA proteins. Our data also show that M. tuberculosis UvrA and UvrD1 can act together to inhibit strand exchange promoted by mycobacterial RecA proteins. Taken together, these findings raise the possibility that UvrD1 and UvrA might act together in vivo to counter the deleterious effects of RecA nucleoprotein filaments and/or facilitate the dissolution of recombination intermediates. Finally, we provide direct experimental evidence for a physical interaction between M. tuberculosis UvrD1 and RecA on one hand and RecA and UvrA on the other hand. These observations are consistent with a molecular mechanism, whereby M. tuberculosis UvrA and UvrD1, acting together, block DNA strand exchange promoted by cognate and noncognate RecA proteins.
Porcine MYF6 gene: sequence, homology analysis, and variation in the promoter region.
Wyszyńska-Koko, J; Kurył, J
2004-01-01
MYF6 gene codes for the bHLH transcription factor belonging to MyoD family. Its expression accompanies the processes of differentiation and maturation of myotubes during embriogenesis and continues on a relatively high level after birth, affecting the muscle phenotype. The porcine MYF6 gene was amplified and sequenced and compared with MYF6 gene sequences of other species. The amino acid sequence was deduced and an interspecies homology analysis was performed. Myf-6 protein shows a high conservation among species of 99 and 97% identity when comparing pig with cow and human, respectively, and of 93% when comparing pig with mouse and rat. The single nucleotide polymorphism (SNP) was revealed within the promoter region, which appeared to be T --> C transition recognized by a MspI restriction enzyme.
Regional differences in gene expression and promoter usage in aged human brains
Pardo, Luba M.
2013-02-19
To characterize the promoterome of caudate and putamen regions (striatum), frontal and temporal cortices, and hippocampi from aged human brains, we used high-throughput cap analysis of gene expression to profile the transcription start sites and to quantify the differences in gene expression across the 5 brain regions. We also analyzed the extent to which methylation influenced the observed expression profiles. We sequenced more than 71 million cap analysis of gene expression tags corresponding to 70,202 promoter regions and 16,888 genes. More than 7000 transcripts were differentially expressed, mainly because of differential alternative promoter usage. Unexpectedly, 7% of differentially expressed genes were neurodevelopmental transcription factors. Functional pathway analysis on the differentially expressed genes revealed an overrepresentation of several signaling pathways (e.g., fibroblast growth factor and wnt signaling) in hippocampus and striatum. We also found that although 73% of methylation signals mapped within genes, the influence of methylation on the expression profile was small. Our study underscores alternative promoter usage as an important mechanism for determining the regional differences in gene expression at old age.
Fauteux, François; Strömvik, Martina V
2009-01-01
Background Accurate computational identification of cis-regulatory motifs is difficult, particularly in eukaryotic promoters, which typically contain multiple short and degenerate DNA sequences bound by several interacting factors. Enrichment in combinations of rare motifs in the promoter sequence of functionally or evolutionarily related genes among several species is an indicator of conserved transcriptional regulatory mechanisms. This provides a basis for the computational identification of cis-regulatory motifs. Results We have used a discriminative seeding DNA motif discovery algorithm for an in-depth analysis of 54 seed storage protein (SSP) gene promoters from three plant families, namely Brassicaceae (mustards), Fabaceae (legumes) and Poaceae (grasses) using backgrounds based on complete sets of promoters from a representative species in each family, namely Arabidopsis (Arabidopsis thaliana (L.) Heynh.), soybean (Glycine max (L.) Merr.) and rice (Oryza sativa L.) respectively. We have identified three conserved motifs (two RY-like and one ACGT-like) in Brassicaceae and Fabaceae SSP gene promoters that are similar to experimentally characterized seed-specific cis-regulatory elements. Fabaceae SSP gene promoter sequences are also enriched in a novel, seed-specific E2Fb-like motif. Conserved motifs identified in Poaceae SSP gene promoters include a GCN4-like motif, two prolamin-box-like motifs and an Skn-1-like motif. Evidence of the presence of a variant of the TATA-box is found in the SSP gene promoters from the three plant families. Motifs discovered in SSP gene promoters were used to score whole-genome sets of promoters from Arabidopsis, soybean and rice. The highest-scoring promoters are associated with genes coding for different subunits or precursors of seed storage proteins. Conclusion Seed storage protein gene promoter motifs are conserved in diverse species, and different plant families are characterized by a distinct combination of conserved motifs
Directory of Open Access Journals (Sweden)
Fauteux François
2009-10-01
Full Text Available Abstract Background Accurate computational identification of cis-regulatory motifs is difficult, particularly in eukaryotic promoters, which typically contain multiple short and degenerate DNA sequences bound by several interacting factors. Enrichment in combinations of rare motifs in the promoter sequence of functionally or evolutionarily related genes among several species is an indicator of conserved transcriptional regulatory mechanisms. This provides a basis for the computational identification of cis-regulatory motifs. Results We have used a discriminative seeding DNA motif discovery algorithm for an in-depth analysis of 54 seed storage protein (SSP gene promoters from three plant families, namely Brassicaceae (mustards, Fabaceae (legumes and Poaceae (grasses using backgrounds based on complete sets of promoters from a representative species in each family, namely Arabidopsis (Arabidopsis thaliana (L. Heynh., soybean (Glycine max (L. Merr. and rice (Oryza sativa L. respectively. We have identified three conserved motifs (two RY-like and one ACGT-like in Brassicaceae and Fabaceae SSP gene promoters that are similar to experimentally characterized seed-specific cis-regulatory elements. Fabaceae SSP gene promoter sequences are also enriched in a novel, seed-specific E2Fb-like motif. Conserved motifs identified in Poaceae SSP gene promoters include a GCN4-like motif, two prolamin-box-like motifs and an Skn-1-like motif. Evidence of the presence of a variant of the TATA-box is found in the SSP gene promoters from the three plant families. Motifs discovered in SSP gene promoters were used to score whole-genome sets of promoters from Arabidopsis, soybean and rice. The highest-scoring promoters are associated with genes coding for different subunits or precursors of seed storage proteins. Conclusion Seed storage protein gene promoter motifs are conserved in diverse species, and different plant families are characterized by a distinct combination
Growing Significance of EU Institutions in Promotion of Inter-regional policies
Directory of Open Access Journals (Sweden)
Ella V. Ermakova
2014-01-01
Full Text Available The article explores the variety of tools and vehicles applied within the EU to expand the prerogative of the regions of the EU member states. The author uses as an example the inter-regional policies in Belgium in respect of the Flemish Region and the Walloon Region. The author analyzes the mechanisms of promotion of external regional relations in Belgium as a means of addressing different problems both on national and all-European level, supporting the arguments and conclusions by examples of relevant EU initiatives. The article details the activities of the EU Regional Committee (RC, the EU advisory body with the powers of political initiative, upholding the principle ofsubsidarity in the implementation of the EU member states' regional policies. The involvement of the Flemish Region and the Walloon Region in the activities of EU RC is described and summarized. As a case study, the article deals with Belgium's rotating six months presidency in the EUin 2010 when the country, which was going through a severe political crisis with no federal government in place, was represented by the two regions. The special focus of the article is on the strategic EU program "Europe2020" and its implementation by the regions of Belgium. There is an account of the initiatives undertaken by the Flemish Region and the Walloon Region within the framework of this program outlining the interaction of the two regions. The author provides a comprehensive analysis of the involvement of the Flemish Region and the Walloon Region with various EU institutions describing how each party achieves the promotion of its regional interests. Within this context, it is a noteworthy development that the Flemish Region is participating in the international program "Pact 2020" on energy all by its own. The article features quotations by Flemish and Walloon political figures which serve as an illustration of the prevailing attitudes in the Belgian society to the process of
Directory of Open Access Journals (Sweden)
Stephanie Jemielity
2013-03-01
Full Text Available Human T-cell Immunoglobulin and Mucin-domain containing proteins (TIM1, 3, and 4 specifically bind phosphatidylserine (PS. TIM1 has been proposed to serve as a cellular receptor for hepatitis A virus and Ebola virus and as an entry factor for dengue virus. Here we show that TIM1 promotes infection of retroviruses and virus-like particles (VLPs pseudotyped with a range of viral entry proteins, in particular those from the filovirus, flavivirus, New World arenavirus and alphavirus families. TIM1 also robustly enhanced the infection of replication-competent viruses from the same families, including dengue, Tacaribe, Sindbis and Ross River viruses. All interactions between TIM1 and pseudoviruses or VLPs were PS-mediated, as demonstrated with liposome blocking and TIM1 mutagenesis experiments. In addition, other PS-binding proteins, such as Axl and TIM4, promoted infection similarly to TIM1. Finally, the blocking of PS receptors on macrophages inhibited the entry of Ebola VLPs, suggesting that PS receptors can contribute to infection in physiologically relevant cells. Notably, infection mediated by the entry proteins of Lassa fever virus, influenza A virus and SARS coronavirus was largely unaffected by TIM1 expression. Taken together our data show that TIM1 and related PS-binding proteins promote infection of diverse families of enveloped viruses, and may therefore be useful targets for broad-spectrum antiviral therapies.
Multi-protein delivery by nanodiamonds promotes bone formation.
Moore, L; Gatica, M; Kim, H; Osawa, E; Ho, D
2013-11-01
Bone morphogenetic proteins (BMPs) are well-studied regulators of cartilage and bone development that have been Food and Drug Administration (FDA)-approved for the promotion of bone formation in certain procedures. BMPs are seeing more use in oral and maxillofacial surgeries because of recent FDA approval of InFUSE(®) for sinus augmentation and localized alveolar ridge augmentation. However, the utility of BMPs in medical and dental applications is limited by the delivery method. Currently, BMPs are delivered to the surgical site by the implantation of bulky collagen sponges. Here we evaluate the potential of detonation nanodiamonds (NDs) as a delivery vehicle for BMP-2 and basic fibroblast growth factor (bFGF). Nanodiamonds are biocompatible, 4- to 5-nm carbon nanoparticles that have previously been used to deliver a wide variety of molecules, including proteins and peptides. We find that both BMP-2 and bFGF are readily loaded onto NDs by physisorption, forming a stable colloidal solution, and are triggered to release in slightly acidic conditions. Simultaneous delivery of BMP-2 and bFGF by ND induces differentiation and proliferation in osteoblast progenitor cells. Overall, we find that NDs provide an effective injectable alternative for the delivery of BMP-2 and bFGF to promote bone formation.
Wanka, Franziska; Arentshorst, Mark; Cairns, Timothy C; Jørgensen, Thomas; Ram, Arthur F J; Meyer, Vera
2016-08-20
The filamentous ascomycete Aspergillus niger is used in many industrial processes for the production of enzymes and organic acids by batch and fed-batch cultivation. An alternative technique is continuous cultivation, which promises improved yield and optimized pipeline efficiency. In this work, we have used perfusion (retentostat) cultivation to validate two promoters that are suitable for A. niger continuous cultivation of industrially relevant products. Firstly, promoters of genes encoding either an antifungal protein (Panafp) or putative hydrophobin (PhfbD) were confirmed as active throughout retentostat culture by assessing mRNA and protein levels using a luciferase (mluc) reporter system. This demonstrated the anafp promoter mediates a high but temporally variable expression profile, whereas the hfbD promoter mediates a semi-constant, moderate-to-high protein expression during retentostat culture. In order to assess whether these promoters were suitable to produce heterologous proteins during retentostat cultivation, the secreted antifungal protein (AFP) from Aspergillus giganteus, which has many potential biotechnological applications, was expressed in A. niger during retentostat cultivation. Additionally, this assay was used to concomitantly validate that native secretion signals encoded in anafp and hfbD genes can be harnessed for secretion of heterologous proteins. Afp mRNA and protein abundance were comparable to luciferase measurements throughout retentostat cultivation, validating the use of Panafp and PhfbD for perfusion cultivation. Finally, a gene encoding the highly commercially relevant thermal hysteresis protein (THP) was expressed in this system, which did not yield detectable protein. Both hfbD and anafp promoters are suitable for production of useful products in A. niger during perfusion cultivation. These findings provide a platform for further optimisations for high production of heterologous proteins with industrial relevance.
Directory of Open Access Journals (Sweden)
Manuel Hiss
2017-10-01
Full Text Available The moss Physcomitrella patens is used both as an evo-devo model and biotechnological production system for metabolites and pharmaceuticals. Strong in vivo expression of genes of interest is important for production of recombinant proteins, e.g., selectable markers, fluorescent proteins, or enzymes. In this regard, the choice of the promoter sequence as well as codon usage optimization are two important inside factors to consider in order to obtain optimum protein accumulation level. To reliably quantify fluorescence, we transfected protoplasts with promoter:GFP fusion constructs and measured fluorescence intensity of living protoplasts in a plate reader system. We used the red fluorescent protein mCherry under 2x 35S promoter control as second reporter to normalize for different transfection efficiencies. We derived a novel endogenous promoter and compared deletion variants with exogenous promoters. We used different codon-adapted green fluorescent protein (GFP genes to evaluate the influence of promoter choice and codon optimization on protein accumulation in P. patens, and show that the promoter of the gene of P. patens chlorophyll a/b binding protein lhcsr1 drives expression of GFP in protoplasts significantly (more than twofold better than the commonly used 2x 35S promoter or the rice actin1 promoter. We identified a shortened 677 bp version of the lhcsr1 promoter that retains full activity in protoplasts. The codon optimized GFP yields significantly (more than twofold stronger fluorescence signals and thus demonstrates that adjusting codon usage in P. patens can increase expression strength. In combination, new promotor and codon optimized GFP conveyed sixfold increased fluorescence signal.
International Nuclear Information System (INIS)
Sassone-Corsi, P.; Borrelli, E.
1987-01-01
The E1A (early region 1A) oncogene products of adenovirus type 2 trans-activate the other early viral transcription units, as well as some cellular promoters. Using a short-term cotransfection assay in murine NIH 3T3 fibroblasts, we show that c-fos and c-myc promoter activities are stimulated by the E1A proteins, whereas c-Ha-ras transcription is not affected. The product of E1A 13S mRNA is responsible for the trans-activation, whereas the 12S mRNA product has no effect. Analysis of the c-fos promoter sequences required for the E1A stimulation shows that responsive sequences are located between positions -402 and -240 upstream of the transcription initiation site. This same region also contains the c-fos serum-responsive element. Furthermore, transcription of the endogenous c-fos gene in HeLa cells is increased after E1A transfection
DNA methylation of PTEN gene promoter region is not correlated ...
African Journals Online (AJOL)
Tumor suppressor gene PTEN plays an important role in cell cycle. Disorder of PTEN protein can cause cell growth and division in an uncontrolled way, which can lead to the formation of tumors. It has been proven that epigenetic mechanisms, such as promoter hypermethylation, may account for inactivation of PTEN in a ...
The 75-kilodalton cytoplasmic Chlamydia trachomatis L2 polypeptide is a DnaK-like protein
DEFF Research Database (Denmark)
Birkelund, Svend; Lundemose, AG; Christiansen, Gunna
1990-01-01
,980-base-pair open reading frame revealed 94% homology with a 75-kilodalton protein from C. trachomatis serovar D and 57% homology with the DnaK proteins of E. coli and of Bacillus megaterium, while amino acid homology with human heat shock protein 70 (hsp70) was 42%. The promoter region was identified......The gene coding for the 75-kilodalton cytoplasmic Chlamydia trachomatis L2 polypeptide has been cloned in Escherichia coli, and the nucleotide sequence has been determined. The cloned DNA fragment contained the coding region as well as the putative promoter. The deduced amino acid sequence of the 1...... by computer search and by primer extension of mRNA synthesized in recombinant E. coli. The promoter region which differed from the putative promoter region in serovar D was shown to be a mixed promoter type in which the -10 region showed a regular TATA box configuration while the -35 region showed high...
Muhle, Rebecca A.; Adjalley, Sophie; Falkard, Brie; Nkrumah, Louis J.; Muhle, Michael E.; Fidock, David A.
2009-01-01
Questions surround the mechanism of mutually exclusive expression by which Plasmodium falciparum mediates activation and silencing of var genes. These encode PfEMP1 proteins, which function as cytoadherent and immunomodulatory molecules at the surface of parasitized erythrocytes. Current evidence suggests that promoter silencing by var introns might play a key role in var gene regulation. To evaluate the impact of cis-acting regulatory regions on var silencing, we generated P. falciparum lines in which luciferase was placed under the control of an UpsA var promoter. By utilizing the Bxb1 integrase system, these reporter cassettes were targeted to a genomic region that was not in apposition to var sub-telomeric domains. This eliminated possible effects from surrounding telomeric elements and removed the variability inherent in episomal systems. Studies with highly synchronized parasites revealed that the UpsA element possessed minimal activity in comparison with a heterologous (hrp3) promoter. This may well result from the integrated UpsA promoter being largely silenced by the neighboring cg6 promoter. Our analyses also revealed that the DownsA 3’ untranslated region further decreased the luciferase activity from both cassettes, whereas the var A intron repressed the UpsA promoter specifically. By applying multivariate analysis over the entire cell cycle, we confirmed the significance of these cis-elements and found the parasite stage to be the major factor regulating UpsA promoter activity. Additionally, we observed that the UpsA promoter was capable of nucleating reversible silencing that spread to a downstream promoter. We believe these studies are the first to analyze promoter activity of Group A var genes which have been implicated in severe malaria, and support the model that var introns can further suppress var expression. These data also suggest an important suppressive role for the DownsA terminator. Our findings imply the existence of multiple levels of
LINGO-1 promotes lysosomal degradation of amyloid-β protein precursor
Directory of Open Access Journals (Sweden)
Rian de Laat
2015-03-01
Full Text Available Sequential proteolytic cleavages of amyloid-β protein precursor (AβPP by β-secretase and γ-secretase generate amyloid β (Aβ peptides, which are thought to contribute to Alzheimer's disease (AD. Much of this processing occurs in endosomes following endocytosis of AβPP from the plasma membrane. However, this pathogenic mode of processing AβPP may occur in competition with lysosomal degradation of AβPP, a common fate of membrane proteins trafficking through the endosomal system. Following up on published reports that LINGO-1 binds and promotes the amyloidogenic processing of AβPP we have examined the consequences of LINGO-1/AβPP interactions. We report that LINGO-1 and its paralogs, LINGO-2 and LINGO-3, decrease processing of AβPP in the amyloidogenic pathway by promoting lysosomal degradation of AβPP. We also report that LINGO-1 levels are reduced in AD brain, representing a possible pathogenic mechanism stimulating the generation of Aβ peptides in AD.
Directory of Open Access Journals (Sweden)
Sutapa Datta
Full Text Available An important step in understanding gene regulation is to identify the promoter regions where the transcription factor binding takes place. Predicting a promoter region de novo has been a theoretical goal for many researchers for a long time. There exists a number of in silico methods to predict the promoter region de novo but most of these methods are still suffering from various shortcomings, a major one being the selection of appropriate features of promoter region distinguishing them from non-promoters. In this communication, we have proposed a new composite method that predicts promoter sequences based on the interrelationship between structural profiles of DNA and primary sequence elements of the promoter regions. We have shown that a Context Free Grammar (CFG can formalize the relationships between different primary sequence features and by utilizing the CFG, we demonstrate that an efficient parser can be constructed for extracting these relationships from DNA sequences to distinguish the true promoter sequences from non-promoter sequences. Along with CFG, we have extracted the structural features of the promoter region to improve upon the efficiency of our prediction system. Extensive experiments performed on different datasets reveals that our method is effective in predicting promoter sequences on a genome-wide scale and performs satisfactorily as compared to other promoter prediction techniques.
Datta, Sutapa; Mukhopadhyay, Subhasis
2013-01-01
An important step in understanding gene regulation is to identify the promoter regions where the transcription factor binding takes place. Predicting a promoter region de novo has been a theoretical goal for many researchers for a long time. There exists a number of in silico methods to predict the promoter region de novo but most of these methods are still suffering from various shortcomings, a major one being the selection of appropriate features of promoter region distinguishing them from non-promoters. In this communication, we have proposed a new composite method that predicts promoter sequences based on the interrelationship between structural profiles of DNA and primary sequence elements of the promoter regions. We have shown that a Context Free Grammar (CFG) can formalize the relationships between different primary sequence features and by utilizing the CFG, we demonstrate that an efficient parser can be constructed for extracting these relationships from DNA sequences to distinguish the true promoter sequences from non-promoter sequences. Along with CFG, we have extracted the structural features of the promoter region to improve upon the efficiency of our prediction system. Extensive experiments performed on different datasets reveals that our method is effective in predicting promoter sequences on a genome-wide scale and performs satisfactorily as compared to other promoter prediction techniques. PMID:23437045
Xu, Meixiang; Nekhayeva, Ilona; Cross, Courtney E; Rondelli, Catherine M; Wickliffe, Jeffrey K; Abdel-Rahman, Sherif Z
2014-03-01
The O6-methylguanine-DNA methyltransferase gene (MGMT) encodes the direct reversal DNA repair protein that removes alkyl adducts from the O6 position of guanine. Several single-nucleotide polymorphisms (SNPs) exist in the MGMT promoter/enhancer (P/E) region. However, the haplotype structure encompassing these SNPs and their functional/biological significance are currently unknown. We hypothesized that MGMT P/E haplotypes, rather than individual SNPs, alter MGMT transcription and can thus alter human sensitivity to alkylating agents. To identify the haplotype structure encompassing the MGMT P/E region SNPs, we sequenced 104 DNA samples from healthy individuals and inferred the haplotypes using the data generated. We identified eight SNPs in this region, namely T7C (rs180989103), T135G (rs1711646), G290A (rs61859810), C485A (rs1625649), C575A (rs113813075), G666A (rs34180180), C777A (rs34138162) and C1099T (rs16906252). Phylogenetics and Sequence Evolution analysis predicted 21 potential haplotypes that encompass these SNPs ranging in frequencies from 0.000048 to 0.39. Of these, 10 were identified in our study population as 20 paired haplotype combinations. To determine the functional significance of these haplotypes, luciferase reporter constructs representing these haplotypes were transfected into glioblastoma cells and their effect on MGMT promoter activity was determined. Compared with the most common (reference) haplotype 1, seven haplotypes significantly upregulated MGMT promoter activity (18-119% increase; P alkylating agents.
The isoelectric region of proteins: a systematic analysis.
Directory of Open Access Journals (Sweden)
Michael Widmann
Full Text Available BACKGROUND: Binding of proteins in ion exchange chromatography is dominated by electrostatic interactions and can be tuned by adjusting pH and ionic strength of the solvent. Therefore, the isoelectric region (IER, the pH region of almost zero charge near the pI, has been used to predict the binding properties of proteins. PRINCIPAL FINDINGS: Usually the IER is small and binding and elution is carried out at pH values near to the pI. However, some proteins with an extended IER have been shown to bind and elute far away from its pI. To analyze factors that mediate the size of the IER and to identify proteins with an extended IER, two protein families consisting of more than 7000 proteins were systematically investigated. Most proteins were found to have a small IER and thus are expected to bind or elute near to their pI, while only a small fraction of less than 2% had a large IER. CONCLUSIONS: Only four factors, the number of histidines, the pI, the number of titratable amino acids and the ratio of acidic to basic residues, are sufficient to reliably classify proteins by their IER based on their sequence only, and thus to predict their binding and elution behaviour in ion exchange chromatography.
Zhang, Zhichun; Tian, Hua; Lv, Ping; Wang, Weiping; Jia, Zhuqing; Wang, Sainan; Zhou, Chunyan; Gao, Xuejun
2015-01-01
Mutation of distal-less homeobox 3 (DLX3) is responsible for human tricho-dento-osseous syndrome (TDO) with amelogenesis imperfecta, indicating a crucial role of DLX3 in amelogenesis. However, the expression pattern of DLX3 and its specific function in amelogenesis remain largely unknown. The aim of this study was to investigate the effects of DLX3 on enamel matrix protein (EMP) genes. By immunohistochemistry assays of mouse tooth germs, stronger immunostaining of DLX3 protein was identified in ameloblasts in the secretory stage than in the pre-secretory and maturation stages, and the same pattern was found for Dlx3 mRNA using Realtime PCR. In a mouse ameloblast cell lineage, forced expression of DLX3 up-regulated the expression of the EMP genes Amelx, Enam, Klk4, and Odam, whereas knockdown of DLX3 down-regulated these four EMP genes. Further, bioinformatics, chromatin immunoprecipitation, and luciferase assays revealed that DLX3 transactivated Enam, Amelx, and Odam through direct binding to their enhancer regions. Particularly, over-expression of mutant-DLX3 (c.571_574delGGGG, responsible for TDO) inhibited the activation function of DLX3 on expression levels and promoter activities of the Enam, Amelx, and Odam genes. Together, our data show that DLX3 promotes the expression of the EMP genes Amelx, Enam, Klk4, and Odam in amelogenesis, while mutant-DLX3 disrupts this regulatory function, thus providing insights into the molecular mechanisms underlying the enamel defects of TDO disease.
Ellerström, M; Stålberg, K; Ezcurra, I; Rask, L
1996-12-01
The promoter region (-309 to +44) of the Brassica napus storage protein gene napA was studied in transgenic tobacco by successive 5' as well as internal deletions fused to the reporter gene GUS (beta-glucuronidase). The expression in the two main tissues of the seed, the endosperm and the embryo, was shown to be differentially regulated. This tissue-specific regulation within the seed was found to affect the developmental expression during seed development. The region between -309 to -152, which has a large effect on quantitative expression, was shown to harbour four elements regulating embryo and one regulating endosperm expression. This region also displayed enhancer activity. Deletion of eight bp from position -152 to position -144 totally abolished the activity of the napA promoter. This deletion disrupted a cis element with similarity to an ABA-responsive element (ABRE) overlapping with an E-box, demonstrating its crucial importance for quantitative expression. An internal deletion of the region -133 to -120, resulted in increased activity in both leaves and endosperm and a decreased activity in the embryo. Within this region, a cis element similar to the (CA)n element, found in other storage protein promoters, was identified. This suggest that the (CA)n element is important for conferring seed specificity by serving both as an activator and a repressor element.
The mitochondrial outer membrane protein MDI promotes local protein synthesis and mtDNA replication.
Zhang, Yi; Chen, Yong; Gucek, Marjan; Xu, Hong
2016-05-17
Early embryonic development features rapid nuclear DNA replication cycles, but lacks mtDNA replication. To meet the high-energy demands of embryogenesis, mature oocytes are furnished with vast amounts of mitochondria and mtDNA However, the cellular machinery driving massive mtDNA replication in ovaries remains unknown. Here, we describe a Drosophila AKAP protein, MDI that recruits a translation stimulator, La-related protein (Larp), to the mitochondrial outer membrane in ovaries. The MDI-Larp complex promotes the synthesis of a subset of nuclear-encoded mitochondrial proteins by cytosolic ribosomes on the mitochondrial surface. MDI-Larp's targets include mtDNA replication factors, mitochondrial ribosomal proteins, and electron-transport chain subunits. Lack of MDI abolishes mtDNA replication in ovaries, which leads to mtDNA deficiency in mature eggs. Targeting Larp to the mitochondrial outer membrane independently of MDI restores local protein synthesis and rescues the phenotypes of mdi mutant flies. Our work suggests that a selective translational boost by the MDI-Larp complex on the outer mitochondrial membrane might be essential for mtDNA replication and mitochondrial biogenesis during oogenesis. Published 2016. This article is a U.S. Government work and is in the public domain in the USA.
Vanacker, J M; Corbau, R; Adelmant, G; Perros, M; Laudet, V; Rommelaere, J
1996-01-01
The promoter of the thyroid hormone receptor alpha gene (c-erbA-1) is activated by the nonstructural protein 1 (NS1) of parvovirus minute virus of mice (prototype strain [MVMp]) in ras-transformed FREJ4 cells that are permissive for lytic MVMp replication. This stimulation may be related to the sensitivity of host cells to MVMp, as it does not take place in parental FR3T3 cells, which are resistant to the parvovirus killing effect. The analysis of a series of deletion and point mutants of the c-erbA-1 promoter led to the identification of an upstream region that is necessary for NS1-driven transactivation. This sequence harbors a putative hormone-responsive element and is sufficient to render a minimal promoter NS1 inducible in FREJ4 but not in FR3T3 cells, and it is involved in distinct interactions with proteins from the respective cell lines. The NS1-responsive element of the c-erbA-1 promoter bears no homology with sequences that were previously reported to be necessary for NS1 DNA binding and transactivation. Altogether, our data point to a novel, cell-specific mechanism of promoter activation by NS1. PMID:8642664
Directory of Open Access Journals (Sweden)
Christine R Langlois
2016-11-01
Full Text Available Prions are a group of proteins that can adopt a spectrum of metastable conformations in vivo. These alternative states change protein function and are self-replicating and transmissible, creating protein-based elements of inheritance and infectivity. Prion conformational flexibility is encoded in the amino acid composition and sequence of the protein, which dictate its ability not only to form an ordered aggregate known as amyloid but also to maintain and transmit this structure in vivo. But, while we can effectively predict amyloid propensity in vitro, the mechanism by which sequence elements promote prion propagation in vivo remains unclear. In yeast, propagation of the [PSI+] prion, the amyloid form of the Sup35 protein, has been linked to an oligopeptide repeat region of the protein. Here, we demonstrate that this region is composed of separable functional elements, the repeats themselves and a repeat proximal region, which are both required for efficient prion propagation. Changes in the numbers of these elements do not alter the physical properties of Sup35 amyloid, but their presence promotes amyloid fragmentation, and therefore maintenance, by molecular chaperones. Rather than acting redundantly, our observations suggest that these sequence elements make complementary contributions to prion propagation, with the repeat proximal region promoting chaperone binding to and the repeats promoting chaperone processing of Sup35 amyloid.
Directory of Open Access Journals (Sweden)
Xiu-Yun Li
2018-05-01
Full Text Available As a major family of plant-specific transcription factors, SQUAMOSA PROMOTER BINDING PROTEIN-LIKE (SPL genes play vital regulatory roles in plant growth, development and stress responses. In this study, 18 SPL genes were identified and cloned from Betula luminifera. Two zinc finger-like structures and a nuclear location signal (NLS segments were existed in the SBP domains of all BlSPLs. Phylogenetic analysis showed that these genes were clustered into nine groups (group I-IX. The intron/exon structure and motif composition were highly conserved within the same group. 12 of the 18 BlSPLs were experimentally verified as the targets of miR156, and two cleavage sites were detected in these miR156-targeted BlSPL genes. Many putative cis-elements, associated with light, stresses and phytohormones response, were identified in the promoter regions of BlSPLs, suggesting that BlSPL genes are probably involved in important physiological processes and developmental events. Tissue-specific expression analysis showed that miR156-targeted BlSPLs exhibited a more differential expression pattern, while most miR156-nontargeted BlSPLs tended to be constitutively expressed, suggesting the distinct roles of miR156-targeted and nontargeted BlSPLs in development and growth of B. luminifera. Further expression analysis revealed that miR156-targeted BlSPLs were dramatically up-regulated with age, whereas mature BlmiR156 level was apparently declined with age, indicating that miR156/SPL module plays important roles in vegetative phase change of B. luminifera. Moreover, yeast two-hybrid assay indicated that several miR156-targeted and nontargeted BlSPLs could interact with two DELLA proteins (BlRGA and BlRGL, which suggests that certain BlSPLs take part in the GA regulated processes through protein interaction with DELLA proteins. All these results provide an important basis for further exploring the biological functions of BlSPLs in B. luminifera.
Characterization of the promoter region of the human c-erbB-2 protooncogene
International Nuclear Information System (INIS)
Ishii, S.; Imamoto, F.; Yamanashi, Y.; Toyoshima, K.; Yamamoto, T.
1987-01-01
Three overlapping genomic clones that contain the 5'-terminal portion of the human c-erbB-2 gene (ERBB2) were isolated. The promoter region was identified by nuclease S1 mapping with c-erbB-2 mRNA. Seven transcriptional start sites were identified. DNA sequence analysis showed that the promoter region contains a TATA box and a CAAT box about 30 and 80 base pairs (bp), respectively, upstream of the most downstream RNA initiation site. Two putative binding sites for transcription factor Sp1 were identified about 50 and 110 bp upstream of the CAAT box, and six GGA repeats were found between the CAAT box and the TATA box. This region had strong promoter activity when placed upstream of the bacterial chloramphenicol acetyltransferase gene and transfected into monkey CV-1 cells. These data indicate that the promoter of the human c-erbB-2 protooncogene is different from that of the protooncogene c-erbB-1 (epidermal growth factor receptor gene), which does not contain either a TATA box or a CAAT box. Comparison of the promoter sequences and activities of the two protooncogenes should be helpful in analysis of the regulatory mechanism of expression of their gene products, which are growth-factor receptors
Combgap Promotes Ovarian Niche Development and Chromatin Association of EcR-Binding Regions in BR-C.
Hitrik, Anna; Popliker, Malka; Gancz, Dana; Mukamel, Zohar; Lifshitz, Aviezer; Schwartzman, Omer; Tanay, Amos; Gilboa, Lilach
2016-11-01
The development of niches for tissue-specific stem cells is an important aspect of stem cell biology. Determination of niche size and niche numbers during organogenesis involves precise control of gene expression. How this is achieved in the context of a complex chromatin landscape is largely unknown. Here we show that the nuclear protein Combgap (Cg) supports correct ovarian niche formation in Drosophila by controlling ecdysone-Receptor (EcR)- mediated transcription and long-range chromatin contacts in the broad locus (BR-C). Both cg and BR-C promote ovarian growth and the development of niches for germ line stem cells. BR-C levels were lower when Combgap was either reduced or over-expressed, indicating an intricate regulation of the BR-C locus by Combgap. Polytene chromosome stains showed that Cg co-localizes with EcR, the major regulator of BR-C, at the BR-C locus and that EcR binding to chromatin was sensitive to changes in Cg levels. Proximity ligation assay indicated that the two proteins could reside in the same complex. Finally, chromatin conformation analysis revealed that EcR-bound regions within BR-C, which span ~30 KBs, contacted each other. Significantly, these contacts were stabilized in an ecdysone- and Combgap-dependent manner. Together, these results highlight Combgap as a novel regulator of chromatin structure that promotes transcription of ecdysone target genes and ovarian niche formation.
Energy Technology Data Exchange (ETDEWEB)
Huerta, Araceli M.; Francino, M. Pilar; Morett, Enrique; Collado-Vides, Julio
2006-03-01
The evolutionary processes operating in the DNA regions that participate in the regulation of gene expression are poorly understood. In Escherichia coli, we have established a sequence pattern that distinguishes regulatory from nonregulatory regions. The density of promoter-like sequences, that are recognizable by RNA polymerase and may function as potential promoters, is high within regulatory regions, in contrast to coding regions and regions located between convergently-transcribed genes. Moreover, functional promoter sites identified experimentally are often found in the subregions of highest density of promoter-like signals, even when individual sites with higher binding affinity for RNA polymerase exist elsewhere within the regulatory region. In order to investigate the generality of this pattern, we have used position weight matrices describing the -35 and -10 promoter boxes of E. coli to search for these motifs in 43 additional genomes belonging to most established bacterial phyla, after specific calibration of the matrices according to the base composition of the noncoding regions of each genome. We have found that all bacterial species analyzed contain similar promoter-like motifs, and that, in most cases, these motifs follow the same genomic distribution observed in E. coli. Differential densities between regulatory and nonregulatory regions are detectable in most bacterial genomes, with the exception of those that have experienced evolutionary extreme genome reduction. Thus, the phylogenetic distribution of this pattern mirrors that of genes and other genomic features that require weak selection to be effective in order to persist. On this basis, we suggest that the loss of differential densities in the reduced genomes of host-restricted pathogens and symbionts is the outcome of a process of genome degradation resulting from the decreased efficiency of purifying selection in highly structured small populations. This implies that the differential
Bando, Hiroki; Hisada, Hiromoto; Ishida, Hiroki; Hata, Yoji; Katakura, Yoshio; Kondo, Akihiko
2011-11-01
A novel promoter from a hemolysin-like protein encoding the gene, hlyA, was characterized for protein overexpression in Aspergillus oryzae grown in solid-state culture. Using endo-1,4-β-glucanase from A. oryzae (CelA) as the reporter, promoter activity was found to be higher than that of the α-amylase (amyA) and manganese superoxide dismutase (sodM) genes not only in wheat bran solid-state culture but also in liquid culture. Expression of the A. oryzae endoglucanase CelB and two heterologous endoglucanases (TrEglI and TrEglIII from Trichoderma reesei) under the control of the hlyA promoter were also found to be stronger than under the control of the amyA promoter in A. oryzae grown in wheat bran solid-state culture, suggesting that the hlyA promoter may be useful for the overproduction of other proteins as well. In wheat bran solid-state culture, the productivity of the hlyA promoter in terms of protein produced was high when the cultivation temperature was 30°C or 37°C, when the water content was 0.6 or 0.8 ml/g wheat bran, and from 48 to 72 h after inoculation. Because A. oryzae sporulated actively under these conditions and because hemolysin has been reported to play a role in fungal fruiting body formation, high-level expression of hlyA may be related to sporulation.
Mechanosensitive promoter region in the human HB-GAM gene
DEFF Research Database (Denmark)
Liedert, Astrid; Kassem, Moustapha; Claes, Lutz
2009-01-01
Mechanical loading is essential for maintaining bone mass in the adult skeleton. However, the underlying process of the transfer of the physical stimulus into a biochemical response, which is termed mechanotransduction is poorly understood. Mechanotransduction results in the modulation of gene...... cells. Analysis of the human HB-GAM gene upstream regulatory region with luciferase reporter gene assays revealed that the upregulation of HB-GAM expression occurred at the transcriptional level and was mainly dependent on the HB-GAM promoter region most upstream containing three potential AP-1 binding...
International Nuclear Information System (INIS)
Roychoudhury, Paromita; Ghosh, Utpal; Bhattacharyya, Nitai P.; Chaudhuri, Keya
2006-01-01
The cellular response to ionizing radiation is mediated by a complex interaction of number of proteins involving different pathways. Previously, we have shown that up regulation of mitochondrial genes ND1, ND4, and COX1 transcribed from the heavy strand promoter (P H ) has been increased in a radio-resistant cell strain designated as M5 in comparison with the parental Chinese hamster V79 cells. These genes are also up regulated in Chinese hamster V79 cells VB13 that express exogenous human Bcl2. In the present study, the expression of the gene ND6 that is expressed from the light strand promoter (P L ) was found to be similar in both the cell lines, as determined by RT-PCR. To test the possibility that this differential expression of mitochondrial genes under these two promoters was mediated by differences in proteins' affinity to interact with these promoters, we have carried out electrophoretic mobility shift assay (EMSA) using mitochondrial cell extracts from these two cell lines. Our result of these experiments revealed that two different proteins formed complex with the synthetic promoters and higher amount of protein from M5 cell extracts interacted with the P H promoter in comparison to that observed with cell extracts from Chinese hamster V79 cells. The promoter-specific differential binding of proteins was also observed in VB13. These results showed that differential mitochondrial gene expression observed earlier in the radio-resistant M5 cells was due to enhanced interaction proteins with the promoters P H and mediated by the expression of Bcl2
Protein-protein docking using region-based 3D Zernike descriptors.
Venkatraman, Vishwesh; Yang, Yifeng D; Sael, Lee; Kihara, Daisuke
2009-12-09
Protein-protein interactions are a pivotal component of many biological processes and mediate a variety of functions. Knowing the tertiary structure of a protein complex is therefore essential for understanding the interaction mechanism. However, experimental techniques to solve the structure of the complex are often found to be difficult. To this end, computational protein-protein docking approaches can provide a useful alternative to address this issue. Prediction of docking conformations relies on methods that effectively capture shape features of the participating proteins while giving due consideration to conformational changes that may occur. We present a novel protein docking algorithm based on the use of 3D Zernike descriptors as regional features of molecular shape. The key motivation of using these descriptors is their invariance to transformation, in addition to a compact representation of local surface shape characteristics. Docking decoys are generated using geometric hashing, which are then ranked by a scoring function that incorporates a buried surface area and a novel geometric complementarity term based on normals associated with the 3D Zernike shape description. Our docking algorithm was tested on both bound and unbound cases in the ZDOCK benchmark 2.0 dataset. In 74% of the bound docking predictions, our method was able to find a near-native solution (interface C-alphaRMSD 3D Zernike descriptors are adept in capturing shape complementarity at the protein-protein interface and useful for protein docking prediction. Rigorous benchmark studies show that our docking approach has a superior performance compared to existing methods.
Tissue-specific interactions between nuclear proteins and the aminopeptidase N promoter
DEFF Research Database (Denmark)
Kärnström, U; Sjöström, H; Norén, O
1991-01-01
Aminopeptidase N/CD13 is a metallopeptidase found in many tissues. Aminopeptidase N activity is high in the small intestinal mucosa, moderate in the liver, and low in the spleen. Using DNase I footprinting and electrophoretic mobility shift assays with nuclear extracts from these tissues, three cis...... elements (DF, LF-B1, UF) were identified in the aminopeptidase N promoter. The DF region (-53 to -30) interacts with the ubiquitously expressed transcription factor Sp1. The LF-B1 region (-85 to -58) interacts with the liver transcription factor LF-B1 (HNF-1) which was detected as well in nuclei from small...... intestinal mucosa. The UF region (-112 to -90) interacts with nuclear factors which seem to be expressed differentially in the liver and the small intestine. Transfection of promoter deletions into HepG2 cells showed that the LF-B1 region is necessary for high expression of the aminopeptidase N gene in liver...
Sequence-specific capture of protein-DNA complexes for mass spectrometric protein identification.
Directory of Open Access Journals (Sweden)
Cheng-Hsien Wu
Full Text Available The regulation of gene transcription is fundamental to the existence of complex multicellular organisms such as humans. Although it is widely recognized that much of gene regulation is controlled by gene-specific protein-DNA interactions, there presently exists little in the way of tools to identify proteins that interact with the genome at locations of interest. We have developed a novel strategy to address this problem, which we refer to as GENECAPP, for Global ExoNuclease-based Enrichment of Chromatin-Associated Proteins for Proteomics. In this approach, formaldehyde cross-linking is employed to covalently link DNA to its associated proteins; subsequent fragmentation of the DNA, followed by exonuclease digestion, produces a single-stranded region of the DNA that enables sequence-specific hybridization capture of the protein-DNA complex on a solid support. Mass spectrometric (MS analysis of the captured proteins is then used for their identification and/or quantification. We show here the development and optimization of GENECAPP for an in vitro model system, comprised of the murine insulin-like growth factor-binding protein 1 (IGFBP1 promoter region and FoxO1, a member of the forkhead rhabdomyosarcoma (FoxO subfamily of transcription factors, which binds specifically to the IGFBP1 promoter. This novel strategy provides a powerful tool for studies of protein-DNA and protein-protein interactions.
Directory of Open Access Journals (Sweden)
Shira Ninio
2009-01-01
Full Text Available Legionella pneumophila is an opportunistic pathogen that can cause a severe pneumonia called Legionnaires' disease. In the environment, L. pneumophila is found in fresh water reservoirs in a large spectrum of environmental conditions, where the bacteria are able to replicate within a variety of protozoan hosts. To survive within eukaryotic cells, L. pneumophila require a type IV secretion system, designated Dot/Icm, that delivers bacterial effector proteins into the host cell cytoplasm. In recent years, a number of Dot/Icm substrate proteins have been identified; however, the function of most of these proteins remains unknown, and it is unclear why the bacterium maintains such a large repertoire of effectors to promote its survival. Here we investigate a region of the L. pneumophila chromosome that displays a high degree of plasticity among four sequenced L. pneumophila strains. Analysis of GC content suggests that several genes encoded in this region were acquired through horizontal gene transfer. Protein translocation studies establish that this region of genomic plasticity encodes for multiple Dot/Icm effectors. Ectopic expression studies in mammalian cells indicate that one of these substrates, a protein called PieA, has unique effector activities. PieA is an effector that can alter lysosome morphology and associates specifically with vacuoles that support L. pneumophila replication. It was determined that the association of PieA with vacuoles containing L. pneumophila requires modifications to the vacuole mediated by other Dot/Icm effectors. Thus, the localization properties of PieA reveal that the Dot/Icm system has the ability to spatially and temporally control the association of an effector with vacuoles containing L. pneumophila through activities mediated by other effector proteins.
Mishra, Ratnesh Chandra; Grover, Anil
2014-11-01
In Arabidopsis (Arabidopsis thaliana), the At1g74310 locus encodes for caseinolytic protease B-cytoplasmic (ClpB-C)/heat shock protein100 protein (AtClpB-C), which is critical for the acquisition of thermotolerance, and At1g74320 encodes for choline kinase (AtCK2) that catalyzes the first reaction in the Kennedy pathway for phosphatidylcholine biosynthesis. Previous work has established that the knockout mutants of these genes display heat-sensitive phenotypes. While analyzing the AtClpB-C promoter and upstream genomic regions in this study, we noted that AtClpB-C and AtCK2 genes are head-to-head oriented on chromosome 1 of the Arabidopsis genome. Expression analysis showed that transcripts of these genes are rapidly induced in response to heat stress treatment. In stably transformed Arabidopsis plants harboring this intergenic sequence between head-to-head oriented green fluorescent protein and β-glucuronidase reporter genes, both transcripts and proteins of the two reporters were up-regulated upon heat stress. Four heat shock elements were noted in the intergenic region by in silico analysis. In the homozygous transfer DNA insertion mutant Salk_014505, 4,393-bp transfer DNA is inserted at position -517 upstream of ATG of the AtClpB-C gene. As a result, AtCk2 loses proximity to three of the four heat shock elements in the mutant line. Heat-inducible expression of the AtCK2 transcript was completely lost, whereas the expression of AtClpB-C was not affected in the mutant plants. Our results suggest that the 1,329-bp intergenic fragment functions as a heat-inducible bidirectional promoter and the region governing the heat inducibility is possibly shared between the two genes. We propose a model in which AtClpB-C shares its regulatory region with heat-induced choline kinase, which has a possible role in heat signaling. © 2014 American Society of Plant Biologists. All Rights Reserved.
Kawaguchi, Yuka; Nariki, Hiroaki; Kawamoto, Naoko; Kanehiro, Yuichi; Miyazaki, Satoshi; Suzuki, Mari; Magari, Masaki; Tokumitsu, Hiroshi; Kanayama, Naoki
2017-04-01
Activation-induced cytidine deaminase (AID) is essential for diversification of the Ig variable region (IgV). AID is excluded from the nucleus, where it normally functions. However, the molecular mechanisms responsible for regulating AID localization remain to be elucidated. The SR-protein splicing factor SRSF1 is a nucleocytoplasmic shuttling protein, a splicing isoform of which called SRSF1-3, has previously been shown to contribute to IgV diversification in chicken DT40 cells. In this study, we examined whether SRSF1-3 functions in IgV diversification by promoting nuclear localization of AID. AID expressed alone was localized predominantly in the cytoplasm. In contrast, co-expression of AID with SRSF1-3 led to the nuclear accumulation of both AID and SRSF1-3 and the formation of a protein complex that contained them both, although SRSF1-3 was dispensable for nuclear import of AID. Expression of either SRSF1-3 or a C-terminally-truncated AID mutant increased IgV diversification in DT40 cells. However, overexpression of exogenous SRSF1-3 was unable to further enhance IgV diversification in DT40 cells expressing the truncated AID mutant, although SRSF1-3 was able to form a protein complex with the AID mutant. These results suggest that SRSF1-3 promotes nuclear localization of AID probably by forming a nuclear protein complex, which might stabilize nuclear AID and induce IgV diversification in an AID C-terminus-dependent manner. Copyright © 2017 Elsevier Inc. All rights reserved.
Directory of Open Access Journals (Sweden)
Waqasuddin Khan
Full Text Available Disordered regions of proteins often bind to structured domains, mediating interactions within and between proteins. However, it is difficult to identify a priori the short disordered regions involved in binding. We set out to determine if docking such peptide regions to peptide binding domains would assist in these predictions.We assembled a redundancy reduced dataset of SLiM (Short Linear Motif containing proteins from the ELM database. We selected 84 sequences which had an associated PDB structures showing the SLiM bound to a protein receptor, where the SLiM was found within a 50 residue region of the protein sequence which was predicted to be disordered. First, we investigated the Vina docking scores of overlapping tripeptides from the 50 residue SLiM containing disordered regions of the protein sequence to the corresponding PDB domain. We found only weak discrimination of docking scores between peptides involved in binding and adjacent non-binding peptides in this context (AUC 0.58.Next, we trained a bidirectional recurrent neural network (BRNN using as input the protein sequence, predicted secondary structure, Vina docking score and predicted disorder score. The results were very promising (AUC 0.72 showing that multiple sources of information can be combined to produce results which are clearly superior to any single source.We conclude that the Vina docking score alone has only modest power to define the location of a peptide within a larger protein region known to contain it. However, combining this information with other knowledge (using machine learning methods clearly improves the identification of peptide binding regions within a protein sequence. This approach combining docking with machine learning is primarily a predictor of binding to peptide-binding sites, and is not intended as a predictor of specificity of binding to particular receptors.
Directory of Open Access Journals (Sweden)
Dina A Moustafa
Full Text Available Brucella neotomae is not known to be associated with clinical disease in any host species. Previous research suggested that B. neotomae might not express detectable levels of Cu/Zn superoxide dismutase (SOD, a periplasmic enzyme known to be involved in protecting Brucella from oxidative bactericidal effects of host phagocytes. This study was undertaken to investigate the genetic basis for the disparity in SOD expression in B. neotomae. Our Western blot and SOD enzyme assay analyses indicated that B. neotomae does express SOD, but at a substantially reduced level. Nucleotide sequence analysis of region upstream to the sodC gene identified a single-nucleotide insertion in the potential promoter region. The same single-nucleotide insertion was also detected in the sodC promoter of B. suis strain Thomsen, belonging to biovar 2 in which SOD expression was undetectable previously. Examination of the sodC promoter activities using translational fusion constructs with E. coli β-galactosidase demonstrated that the B. neotomae and B. suis biovar 2 promoters were very weak in driving gene expression. Site-directed mutation studies indicated that the insertion of A in the B. neotomae sodC promoter reduced the promoter activity. Increasing the level of SOD expression in B. neotomae through complementation with B. abortus sodC gene did not alter the bacterial survival in J774A.1 macrophage-like cells and in tissues of BALB/c and C57BL/6 mice. These results for the first time demonstrate the occurrence of a single-nucleotide polymorphism affecting promoter function and gene expression in Brucella.
Directory of Open Access Journals (Sweden)
Sun JX
2014-05-01
Full Text Available Jingxu Sun,1,* Yongxi Song,1,* Zhenning Wang,1 Guoli Wang,2 Peng Gao,1 Xiaowan Chen,1 Zhaohua Gao,1 Huimian Xu1 1Department of Surgical Oncology and General Surgery, First Hospital of China Medical University, Shenyang, People’s Republic of China; 2Department of Biochemistry and Molecular Biology, China Medical University, Shenyang, People’s Republic of China *These authors contributed equally to this work Background: MicroRNAs are associated with tumor genesis and progression in various carcinomas. MicroRNA-148a (miR-148a was reported to have low expression in gastrointestinal cancers, and might be regulated by promoter region DNA methylation. Methods: Bisulfite-modified sequencing was used to determine the promoter region DNA methylation status of human gastrointestinal cancer cell lines. Expression levels of miR-148a in cell lines treated with 5-aza-2′-deoxycytidine were determined by quantitative real-time polymerase chain reaction. Total DNA was extracted from the tissues of 64 patients with gastric cancer and 51 patients with colorectal cancer. Methylation status was determined by methylation-specific polymerase chain reaction. All statistical analyses were performed with SPSS 17.0 software. Results: The promoter regions of genes in human gastrointestinal cancer cell lines were all hypermethylated, except for HT-29, and the expression of miR-148a tended to be higher than in controls after treatment with 5-aza-2′-deoxycytidine. The methylation-specific polymerase chain reaction results showed that 56.25% of gastric cancer tissues and 19.61% of colorectal cancer tissues were hypermethylated. A strong correlation was found between the expression of miR-148a and the methylation status of promoter regions (P<0.001, chi-square test and Pearson’s correlation. Furthermore, promoter region CpG site hypermethylation of miR-148a was correlated with increased tumor size (P=0.01 in gastric cancer after analyzing the correlation between
Energy Technology Data Exchange (ETDEWEB)
Galzitskaya, Oxana V; Garbuzynskiy, Sergiy O; Lobanov, Michail Yu [Institute of Protein Research, Russian Academy of Sciences, 142290, Pushchino, Moscow Region (Russian Federation)
2007-07-18
The determination of factors that influence conformational changes in proteins is very important for the identification of potentially amyloidogenic and disordered regions in polypeptide chains. In our work we introduce a new parameter, mean packing density, to detect both amyloidogenic and disordered regions in a protein sequence. It has been shown that regions with strong expected packing density are responsible for amyloid formation. Our predictions are consistent with known disease-related amyloidogenic regions for 9 of 12 amyloid-forming proteins and peptides in which the positions of amyloidogenic regions have been revealed experimentally. Our findings support the concept that the mechanism of formation of amyloid fibrils is similar for different peptides and proteins. Moreover, we have demonstrated that regions with weak expected packing density are responsible for the appearance of disordered regions. Our method has been tested on datasets of globular proteins and long disordered protein segments, and it shows improved performance over other widely used methods. Thus, we demonstrate that the expected packing density is a useful value for predicting both disordered and amyloidogenic regions of a protein based on sequence alone. Our results are important for understanding the structural characteristics of protein folding and misfolding.
Directory of Open Access Journals (Sweden)
Zhichun Zhang
Full Text Available Mutation of distal-less homeobox 3 (DLX3 is responsible for human tricho-dento-osseous syndrome (TDO with amelogenesis imperfecta, indicating a crucial role of DLX3 in amelogenesis. However, the expression pattern of DLX3 and its specific function in amelogenesis remain largely unknown. The aim of this study was to investigate the effects of DLX3 on enamel matrix protein (EMP genes. By immunohistochemistry assays of mouse tooth germs, stronger immunostaining of DLX3 protein was identified in ameloblasts in the secretory stage than in the pre-secretory and maturation stages, and the same pattern was found for Dlx3 mRNA using Realtime PCR. In a mouse ameloblast cell lineage, forced expression of DLX3 up-regulated the expression of the EMP genes Amelx, Enam, Klk4, and Odam, whereas knockdown of DLX3 down-regulated these four EMP genes. Further, bioinformatics, chromatin immunoprecipitation, and luciferase assays revealed that DLX3 transactivated Enam, Amelx, and Odam through direct binding to their enhancer regions. Particularly, over-expression of mutant-DLX3 (c.571_574delGGGG, responsible for TDO inhibited the activation function of DLX3 on expression levels and promoter activities of the Enam, Amelx, and Odam genes. Together, our data show that DLX3 promotes the expression of the EMP genes Amelx, Enam, Klk4, and Odam in amelogenesis, while mutant-DLX3 disrupts this regulatory function, thus providing insights into the molecular mechanisms underlying the enamel defects of TDO disease.
Growth hormone-promoted tyrosyl phosphorylation of SHC proteins and SHC association with Grb2
DEFF Research Database (Denmark)
VanderKuur, J; Allevato, G; Billestrup, Nils
1995-01-01
. To gain insight into pathways coupling GH receptor (GHR) to MAP kinase activation and signaling molecules that might interact with GHR and its associated tyrosine kinase JAK2, we examined whether SHC and Grb2 proteins serve as signaling molecules for GH. Human GH was shown to promote the rapid tyrosyl...... phosphorylation of 66-, 52-, and 46-kDa SHC proteins in 3T3-F442A fibroblasts. GH also promoted binding of GHR and JAK2 to the SH2 domain of 46/52-kDa SHC protein fused to glutathione S-transferase (GST). Constitutively phosphorylated JAK2, from COS-7 cells transiently transfected with murine JAK2 cDNA, bound......-638 and GHR1-638(Y333,338F), GH stimulated phosphorylation of all 3 SHC proteins whereas GH stimulated phosphorylation of only the 66- and 52-kDa SHC proteins in cells expressing GHR1-454. GH had no effect on SHC phosphorylation in cells expressing GHR1-294 or GHR delta P, the latter lacking amino acids 297...
Brand Products of Regional Cuisine in the Promotion of Tourism in Roztocze
Directory of Open Access Journals (Sweden)
Bekier-Jaworska Ewa
2015-03-01
Full Text Available Introduction. There has been a trend over the last few years of using specialties of regional cuisine as an independent tourist attraction. The creation of local brands is an important element in the promotion of a given region and it also influences the development of culinary tourism. The aim of the studies conducted was to identify regional dishes - a choice of dishes that could be described as 'brand dishes' and the use of those dishes as tourist attractions in Roztocze. Material and methods. Studies were conducted on a group of students studying tourism and recreation at State Higher School of Vocational Education (PWSZ in Zamość using a questionnaire. Results. The questionnaire provided an assessment of the levels of knowledge of regional cuisine among Polish and Ukrainian students, identified the most characteristic dishes and selected brand products, and helped to arrive at a suitable method of promotion. Conclusions. Nationality, family customs and selection of local restaurants highly influence knowledge of regional cuisine. Interviewees decided that the most outstanding products from Roztocze were Zwierzyniec beer, and Biłgoraj pie. Regional products should be used as a tourist attraction in Roztocze.
Directory of Open Access Journals (Sweden)
Erica Schulz
2010-09-01
Full Text Available Soluble proteins must maintain backbone hydrogen bonds (BHBs water-tight to ensure structural integrity. This protection is often achieved by burying the BHBs or wrapping them through intermolecular associations. On the other hand, water has low coordination resilience, with loss of hydrogen-bonding partnerships carrying significant thermodynamic cost. Thus, a core problem in structural biology is whether natural design actually exploits the water coordination stiffness to seal the backbone in regions that are exposed to the solvent. This work explores the molecular design features that make this type of seal operative, focusing on the side-chain arrangements that shield the protein backbone. We show that an efficient sealing is achieved by adapting the sub-nanoscale surface topography to the stringency of water coordination: an exposed BHB may be kept dry if the local concave curvature is small enough to impede formation of the coordination shell of a penetrating water molecule. Examination of an exhaustive database of uncomplexed proteins reveals that exposed BHBs invariably occur within such sub-nanoscale cavities in native folds, while this level of local ruggedness is absent in other regions. By contrast, BHB exposure in misfolded proteins occurs with larger local curvature promoting backbone hydration and consequently, structure disruption. These findings unravel physical constraints fitting a spatially dependent least-action for water coordination, introduce a molecular design concept, and herald the advent of water-tight peptide-based materials with sufficient backbone exposure to remain flexible.
Alam, Tanvir
2014-10-02
Transcriptional regulation of protein-coding genes is increasingly well-understood on a global scale, yet no comparable information exists for long non-coding RNA (lncRNA) genes, which were recently recognized to be as numerous as protein-coding genes in mammalian genomes. We performed a genome-wide comparative analysis of the promoters of human lncRNA and protein-coding genes, finding global differences in specific genetic and epigenetic features relevant to transcriptional regulation. These two groups of genes are hence subject to separate transcriptional regulatory programs, including distinct transcription factor (TF) proteins that significantly favor lncRNA, rather than coding-gene, promoters. We report a specific signature of promoter-proximal transcriptional regulation of lncRNA genes, including several distinct transcription factor binding sites (TFBS). Experimental DNase I hypersensitive site profiles are consistent with active configurations of these lncRNA TFBS sets in diverse human cell types. TFBS ChIP-seq datasets confirm the binding events that we predicted using computational approaches for a subset of factors. For several TFs known to be directly regulated by lncRNAs, we find that their putative TFBSs are enriched at lncRNA promoters, suggesting that the TFs and the lncRNAs may participate in a bidirectional feedback loop regulatory network. Accordingly, cells may be able to modulate lncRNA expression levels independently of mRNA levels via distinct regulatory pathways. Our results also raise the possibility that, given the historical reliance on protein-coding gene catalogs to define the chromatin states of active promoters, a revision of these chromatin signature profiles to incorporate expressed lncRNA genes is warranted in the future.
Identification of functional DNA variants in the constitutive promoter region of MDM2
Directory of Open Access Journals (Sweden)
Lalonde Marie-Eve
2012-09-01
Full Text Available Abstract Although mutations in the oncoprotein murine double minute 2 (MDM2 are rare, MDM2 gene overexpression has been observed in several human tumors. Given that even modest changes in MDM2 levels might influence the p53 tumor suppressor signaling pathway, we postulated that sequence variation in the promoter region of MDM2 could lead to disregulated expression and variation in gene dosage. Two promoters have been reported for MDM2; an internal promoter (P2, which is located near the end of intron 1 and is p53-responsive, and an upstream constitutive promoter (P1, which is p53-independent. Both promoter regions contain DNA variants that could influence the expression levels of MDM2, including the well-studied single nucleotide polymorphism (SNP SNP309, which is located in the promoter P2; i.e., upstream of exon 2. In this report, we screened the promoter P1 for DNA variants and assessed the functional impact of the corresponding SNPs. Using the dbSNP database and genotyping validation in individuals of European descent, we identified three common SNPs (−1494 G > A; indel 40 bp; and −182 C > G. Three major promoter haplotypes were inferred by using these three promoter SNPs together with rs2279744 (SNP309. Following subcloning into a gene reporter system, we found that two of the haplotypes significantly influenced MDM2 promoter activity in a haplotype-specific manner. Site-directed mutagenesis experiments indicated that the 40 bp insertion/deletion variation is causing the observed allelic promoter activity. This study suggests that part of the variability in the MDM2 expression levels could be explained by allelic p53-independent P1 promoter activity.
DEFF Research Database (Denmark)
Dossani, Zain Y.; Apel, Amanda Reider; Szmidt-Middleton, Heather
2018-01-01
regions, we have built a library of hybrid promoters that are regulated by a synthetic transcription factor. The hybrid promoters consist of native S. cerevisiae promoters, in which the operator regions have been replaced with sequences that are recognized by the bacterial LexA DNA binding protein....... Correspondingly, the synthetic transcription factor (TF) consists of the DNA binding domain of the LexA protein, fused with the human estrogen binding domain and the viral activator domain, VP16. The resulting system with a bacterial DNA binding domain avoids the transcription of native S. cerevisiae genes...... levels, using the same synthetic TF and a given estradiol. This set of promoters, in combination with our synthetic TF, has the potential to regulate numerous genes or pathways simultaneously, to multiple desired levels, in a single strain....
Directory of Open Access Journals (Sweden)
Patrizia Marinelli
2018-04-01
Full Text Available Oxidatively modified forms of proteins accumulate during aging. Oxidized protein conformers might act as intermediates in the formation of amyloids in age-related disorders. However, it is not known whether this amyloidogenic conversion requires an extensive protein oxidative damage or it can be promoted just by a discrete, localized post-translational modification of certain residues. Here, we demonstrate that the irreversible oxidation of a single free Cys suffices to severely perturb the folding energy landscape of a stable globular protein, compromise its kinetic stability, and lead to the formation of amyloids under physiological conditions. Experiments and simulations converge to indicate that this specific oxidation-promoted protein aggregation requires only local unfolding. Indeed, a large scale analysis indicates that many cellular proteins are at risk of undergoing this kind of deleterious transition; explaining how oxidative stress can impact cell proteostasis and subsequently lead to the onset of pathological states. Keywords: Protein oxidation, Protein misfolding, Protein aggregation, Oxidative stress, Post-translational modification
Promoter analysis of the Chilo iridescent virus DNA polymerase and major capsid protein genes
Nalcacioglu, R.; Marks, H.; Vlak, J.M.; Demirbag, Z.; Oers, van M.M.
2003-01-01
The DNA polymerase (DNApol) and major capsid protein (MCP) genes were used as models to study promoter activity in Chilo iridescent virus (CIV). Infection of Bombyx mori SPC-BM-36 cells in the presence of inhibitors of DNA or protein synthesis showed that DNApol, as well as helicase, is an
A genome-wide analysis of promoter-mediated phenotypic noise in Escherichia coli.
Directory of Open Access Journals (Sweden)
Olin K Silander
2012-01-01
Full Text Available Gene expression is subject to random perturbations that lead to fluctuations in the rate of protein production. As a consequence, for any given protein, genetically identical organisms living in a constant environment will contain different amounts of that particular protein, resulting in different phenotypes. This phenomenon is known as "phenotypic noise." In bacterial systems, previous studies have shown that, for specific genes, both transcriptional and translational processes affect phenotypic noise. Here, we focus on how the promoter regions of genes affect noise and ask whether levels of promoter-mediated noise are correlated with genes' functional attributes, using data for over 60% of all promoters in Escherichia coli. We find that essential genes and genes with a high degree of evolutionary conservation have promoters that confer low levels of noise. We also find that the level of noise cannot be attributed to the evolutionary time that different genes have spent in the genome of E. coli. In contrast to previous results in eukaryotes, we find no association between promoter-mediated noise and gene expression plasticity. These results are consistent with the hypothesis that, in bacteria, natural selection can act to reduce gene expression noise and that some of this noise is controlled through the sequence of the promoter region alone.
International Nuclear Information System (INIS)
Wurm, F.M.; Gwinn, K.A.; Papoulas, O.; Pallavicini, M.; Kingston, R.E.
1987-01-01
After transfection and selection with methotrexate, CHO cell lines were established which contained up to 2000 copies of an expression vector for c-myc protein. The vector contained the Drosophila heat shock protein 70 (hsp70) promoter fused with the coding region of the mouse c-myc gene. Incubation of cells for up to 3 hours at 43 0 C resulted in at least a 100-fold induction of recombinant c-myc mRNA. When cells were shifted back to 37 0 C, within 1 to 4 hours, this RNA was translated into protein to yield about 250 μg per 10 9 cells. Cells died a few hours later, suggesting that high concentrations of intracellular c-myc are cytotoxic. 47 refs., 5 figs
Sato, Mitsuhiko P; Makino, Takashi; Kawata, Masakado
2016-02-09
Understanding the evolutionary forces that influence variation in gene regulatory regions in natural populations is an important challenge for evolutionary biology because natural selection for such variations could promote adaptive phenotypic evolution. Recently, whole-genome sequence analyses have identified regulatory regions subject to natural selection. However, these studies could not identify the relationship between sequence variation in the detected regions and change in gene expression levels. We analyzed sequence variations in core promoter regions, which are critical regions for gene regulation in higher eukaryotes, in a natural population of Drosophila melanogaster, and identified core promoter sequence variations associated with differences in gene expression levels subjected to natural selection. Among the core promoter regions whose sequence variation could change transcription factor binding sites and explain differences in expression levels, three core promoter regions were detected as candidates associated with purifying selection or selective sweep and seven as candidates associated with balancing selection, excluding the possibility of linkage between these regions and core promoter regions. CHKov1, which confers resistance to the sigma virus and related insecticides, was identified as core promoter regions that has been subject to selective sweep, although it could not be denied that selection for variation in core promoter regions was due to linked single nucleotide polymorphisms in the regulatory region outside core promoter regions. Nucleotide changes in core promoter regions of CHKov1 caused the loss of two basal transcription factor binding sites and acquisition of one transcription factor binding site, resulting in decreased gene expression levels. Of nine core promoter regions regions associated with balancing selection, brat, and CG9044 are associated with neuromuscular junction development, and Nmda1 are associated with learning
Anti-Restriction Protein, KlcAHS, Promotes Dissemination of Carbapenem Resistance
Directory of Open Access Journals (Sweden)
Xiaofei Jiang
2017-05-01
Full Text Available Carbapenemase-producing Klebsiella pneumoniae (KPC has emerged and spread throughout the world. A retrospective analysis was performed on carbapenem-resistant K. pneumoniae isolated at our teaching hospital during the period 2009–2010, when the initial outbreak occurred. To determine the mechanism(s that underlies the increased infectivity exhibited by KPC, Multilocus Sequence Typing (MLST was conducted. A series of plasmids was also extracted, sequenced and analyzed. Concurrently, the complete sequences of blaKPC−2-harboring plasmids deposited in GenBank were summarized and aligned. The blaKPC−2 and KlcAHS genes in the carbapenem-resistant K. pneumoniae isolates were examined. E. coli strains, carrying different Type I Restriction and Modification (RM systems, were selected to study the interaction between RM systems, anti-RM systems and horizontal gene transfer (HGT. The ST11 clone predominated among 102 carbapenem-resistant K. pneumoniae isolates, all harbored the blaKPC−2 gene; 98% contained the KlcAHS gene. KlcAHS was one of the core genes in the backbone region of most blaKPC−2 carrying plasmids. Type I RM systems in the host bacteria reduced the rate of pHS10842 plasmid transformation by 30- to 40-fold. Presence of the anti-restriction protein, KlcAHS, on the other hand, increased transformation efficiency by 3- to 6-fold. These results indicate that RM systems can significantly restrict HGT. In contrast, KlcAHS can disrupt the RM systems and promote HGT by transformation. These findings suggest that the anti-restriction protein, KlcAHS, represents a novel mechanism that facilitates the increased transfer of blaKPC-2 and KlcAHS-carrying plasmids among K. pneumoniae strains.
International Nuclear Information System (INIS)
Yan, Jun; Lu, Qian; Dong, Jiahong; Li, Xiaowu; Ma, Kuansheng; Cai, Lei
2012-01-01
To understand the molecular mechanisms of caveolin-1 downregulation by hepatitis B virus X protein (HBx). The DNA methylation status of the caveolin-1 promoter was examined by nested methylation-specific PCR of 33 hepatitis B virus (HBV)-infected hepatocellular carcinoma (HCC) samples. The SMMC-7721 hepatoma cell line was transfected with a recombinant HBx adenoviral vector, and the effects of HBx protein on caveolin-1 expression and promoter methylation were examined and confirmed by sequencing. A reporter gene containing the caveolin-1 promoter region was constructed, and the effects of HBx on the transcriptional activity of the promoter were also studied. Methylation of the caveolin-1 promoter was detected in 84.8% (28/33) of HBV-infected HCC samples. Expression of caveolin-1 was significantly downregulated (P = 0.022), and multiple CpG sites in the promoter region of caveolin-1 were methylated in SMMC-7721 cells after HBx transfection. Transfected HBx significantly suppressed caveolin-1 promoter activity (P = 0.001). HBx protein induces methylation of the caveolin-1 promoter region and suppresses its expression
Kalveram, Birte; Lihoradova, Olga; Ikegami, Tetsuro
2011-07-01
Rift Valley fever virus (RVFV; family Bunyaviridae, genus Phlebovirus) is an important emerging pathogen of humans and ruminants. Its NSs protein has previously been identified as a major virulence factor that suppresses host defense through three distinct mechanisms: it directly inhibits beta interferon (IFN-β) promoter activity, it promotes the degradation of double-stranded RNA-dependent protein kinase (PKR), and it suppresses host transcription by disrupting the assembly of the basal transcription factor TFIIH through sequestration of its p44 subunit. Here, we report that in addition to PKR, NSs also promotes the degradation of the TFIIH subunit p62. Infection of cells with the RVFV MP-12 vaccine strain reduced p62 protein levels to below the detection limit early in the course of infection. This NSs-mediated downregulation of p62 was posttranslational, as it was unaffected by pharmacological inhibition of transcription or translation and MP-12 infection had no effect on p62 mRNA levels. Treatment of cells with proteasome inhibitors but not inhibition of lysosomal acidification or nuclear export resulted in a stabilization of p62 in the presence of NSs. Furthermore, p62 could be coprecipitated with NSs from lysates of infected cells. These data suggest that the RVFV NSs protein is able to interact with the TFIIH subunit p62 inside infected cells and promotes its degradation, which can occur directly in the nucleus.
Analysis of an osmotically regulated pathogenesis-related osmotin gene promoter.
Raghothama, K G; Liu, D; Nelson, D E; Hasegawa, P M; Bressan, R A
1993-12-01
Osmotin is a small (24 kDa), basic, pathogenesis-related protein, that accumulates during adaptation of tobacco (Nicotiana tabacum) cells to osmotic stress. There are more than 10 inducers that activate the osmotin gene in various plant tissues. The osmotin promoter contains several sequences bearing a high degree of similarity to ABRE, as-1 and E-8 cis element sequences. Gel retardation studies indicated the presence of at least two regions in the osmotin promoter that show specific interactions with nuclear factors isolated from cultured cells or leaves. The abundance of these binding factors increased in response to salt, ABA and ethylene. Nuclear factors protected a 35 bp sequence of the promoter from DNase I digestion. Different 5' deletions of the osmotin promoter cloned into a promoter-less GUSNOS plasmid (pBI 201) were used in transient expression studies with a Biolistic gun. The transient expression studies revealed the presence of three distinct regions in the osmotin promoter. The promoter sequence from -108 to -248 bp is absolutely required for reporter gene activity, followed by a long stretch (up to -1052) of enhancer-like sequence and then a sequence upstream of -1052, which appears to contain negative elements. The responses to ABA, ethylene, salt, desiccation and wounding appear to be associated with the -248 bp sequence of the promoter. This region also contains a putative ABRE (CACTGTG) core element. Activation of the osmotin gene by various inducers is discussed in view of antifungal activity of the osmotin protein.
Heiss, Silvia; Hörmann, Angelika; Tauer, Christopher; Sonnleitner, Margot; Egger, Esther; Grabherr, Reingard; Heinl, Stefan
2016-03-10
Engineering lactic acid bacteria (LAB) is of growing importance for food and feed industry as well as for in vivo vaccination or the production of recombinant proteins in food grade organisms. Often, expression of a transgene is only desired at a certain time point or period, e.g. to minimize the metabolic burden for the host cell or to control the expression time span. For this purpose, inducible expression systems are preferred, though cost and availability of the inducing agent must be feasible. We selected the plasmid free strain Lactobacillus plantarum 3NSH for testing and characterization of novel inducible promoters/repressor systems. Their feasibility in recombinant protein production was evaluated. Expression of the reporter protein mCherry was monitored with the BioLector(®) micro-fermentation system. Reporter gene mCherry expression was compared under the control of different promoter/repressor systems: PlacA (an endogenous promoter/repressor system derived from L. plantarum 3NSH), PxylA (a promoter/repressor system derived from Bacillus megaterium DSMZ 319) and PlacSynth (synthetic promoter and codon-optimized repressor gene based on the Escherichia coli lac operon). We observed that PlacA was inducible solely by lactose, but not by non-metabolizable allolactose analoga. PxylA was inducible by xylose, yet showed basal expression under non-induced conditions. Growth on galactose (as compared to exponential growth phase on glucose) reduced basal mCherry expression at non-induced conditions. PlacSynth was inducible with TMG (methyl β-D-thiogalactopyranoside) and IPTG (isopropyl β-D-1-thiogalactopyranoside), but also showed basal expression without inducer. The promoter PlacSynth was used for establishment of a dual plasmid expression system, based on T7 RNA polymerase driven expression in L. plantarum. Comparative Western blot supported BioLector(®) micro-fermentation measurements. Conclusively, overall expression levels were moderate (compared to a
Genome-wide function of H2B ubiquitylation in promoter and genic regions.
Batta, Kiran; Zhang, Zhenhai; Yen, Kuangyu; Goffman, David B; Pugh, B Franklin
2011-11-01
Nucleosomal organization in and around genes may contribute substantially to transcriptional regulation. The contribution of histone modifications to genome-wide nucleosomal organization has not been systematically evaluated. In the present study, we examine the role of H2BK123 ubiquitylation, a key regulator of several histone modifications, on nucleosomal organization at promoter, genic, and transcription termination regions in Saccharomyces cerevisiae. Using high-resolution MNase chromatin immunoprecipitation and sequencing (ChIP-seq), we map nucleosome positioning and occupancy in mutants of the H2BK123 ubiquitylation pathway. We found that H2B ubiquitylation-mediated nucleosome formation and/or stability inhibits the assembly of the transcription machinery at normally quiescent promoters, whereas ubiquitylation within highly active gene bodies promotes transcription elongation. This regulation does not proceed through ubiquitylation-regulated histone marks at H3K4, K36, and K79. Our findings suggest that mechanistically similar functions of H2B ubiquitylation (nucleosome assembly) elicit different functional outcomes on genes depending on its positional context in promoters (repressive) versus transcribed regions (activating).
International Nuclear Information System (INIS)
Kwon, Deug-Nam; Park, Mi-Ryung; Park, Jong-Yi; Cho, Ssang-Goo; Park, Chankyu; Oh, Jae-Wook; Song, Hyuk; Kim, Jae-Hwan; Kim, Jin-Hoi
2011-01-01
Highlights: → The sequences of -604 to -84 bp of the pUPII promoter contained the region of a putative negative cis-regulatory element. → The core promoter was located in the 5F-1. → Transcription factor HNF4 can directly bind in the pUPII core promoter region, which plays a critical role in controlling promoter activity. → These features of the pUPII promoter are fundamental to development of a target-specific vector. -- Abstract: Uroplakin II (UPII) is a one of the integral membrane proteins synthesized as a major differentiation product of mammalian urothelium. UPII gene expression is bladder specific and differentiation dependent, but little is known about its transcription response elements and molecular mechanism. To identify the cis-regulatory elements in the pig UPII (pUPII) gene promoter region, we constructed pUPII 5' upstream region deletion mutants and demonstrated that each of the deletion mutants participates in controlling the expression of the pUPII gene in human bladder carcinoma RT4 cells. We also identified a new core promoter region and putative negative cis-regulatory element within a minimal promoter region. In addition, we showed that hepatocyte nuclear factor 4 (HNF4) can directly bind in the pUPII core promoter (5F-1) region, which plays a critical role in controlling promoter activity. Transient cotransfection experiments showed that HNF4 positively regulates pUPII gene promoter activity. Thus, the binding element and its binding protein, HNF4 transcription factor, may be involved in the mechanism that specifically regulates pUPII gene transcription.
Protein-protein docking using region-based 3D Zernike descriptors
Directory of Open Access Journals (Sweden)
Sael Lee
2009-12-01
Full Text Available Abstract Background Protein-protein interactions are a pivotal component of many biological processes and mediate a variety of functions. Knowing the tertiary structure of a protein complex is therefore essential for understanding the interaction mechanism. However, experimental techniques to solve the structure of the complex are often found to be difficult. To this end, computational protein-protein docking approaches can provide a useful alternative to address this issue. Prediction of docking conformations relies on methods that effectively capture shape features of the participating proteins while giving due consideration to conformational changes that may occur. Results We present a novel protein docking algorithm based on the use of 3D Zernike descriptors as regional features of molecular shape. The key motivation of using these descriptors is their invariance to transformation, in addition to a compact representation of local surface shape characteristics. Docking decoys are generated using geometric hashing, which are then ranked by a scoring function that incorporates a buried surface area and a novel geometric complementarity term based on normals associated with the 3D Zernike shape description. Our docking algorithm was tested on both bound and unbound cases in the ZDOCK benchmark 2.0 dataset. In 74% of the bound docking predictions, our method was able to find a near-native solution (interface C-αRMSD ≤ 2.5 Å within the top 1000 ranks. For unbound docking, among the 60 complexes for which our algorithm returned at least one hit, 60% of the cases were ranked within the top 2000. Comparison with existing shape-based docking algorithms shows that our method has a better performance than the others in unbound docking while remaining competitive for bound docking cases. Conclusion We show for the first time that the 3D Zernike descriptors are adept in capturing shape complementarity at the protein-protein interface and useful for
Exploiting nucleotide composition to engineer promoters.
Directory of Open Access Journals (Sweden)
Manfred G Grabherr
Full Text Available The choice of promoter is a critical step in optimizing the efficiency and stability of recombinant protein production in mammalian cell lines. Artificial promoters that provide stable expression across cell lines and can be designed to the desired strength constitute an alternative to the use of viral promoters. Here, we show how the nucleotide characteristics of highly active human promoters can be modelled via the genome-wide frequency distribution of short motifs: by overlapping motifs that occur infrequently in the genome, we constructed contiguous sequence that is rich in GC and CpGs, both features of known promoters, but lacking homology to real promoters. We show that snippets from this sequence, at 100 base pairs or longer, drive gene expression in vitro in a number of mammalian cells, and are thus candidates for use in protein production. We further show that expression is driven by the general transcription factors TFIIB and TFIID, both being ubiquitously present across cell types, which results in less tissue- and species-specific regulation compared to the viral promoter SV40. We lastly found that the strength of a promoter can be tuned up and down by modulating the counts of GC and CpGs in localized regions. These results constitute a "proof-of-concept" for custom-designing promoters that are suitable for biotechnological and medical applications.
DEFF Research Database (Denmark)
Peng, Nan; Deng, Ling; Mei, Yuxia
2012-01-01
Despite major progresses in genetic studies of hyperthermophilic archaea, recombinant protein production in these organisms always suffers from low yields and a robust expression system is still in great demand. Here we report a versatile vector that confers high levels of protein expression...... to remove the peptide tags from expressed recombinant proteins. While pEXA employed an araS promoter for protein expression, pSeSD utilized P(araS-SD), an araS derivative promoter carrying an engineered ribosome-binding site (RBS; a Shine-Dalgarno [SD] sequence). We found that P(araS-SD) directed high...... levels of target gene expression. More strikingly, N-terminal amino acid sequencing of recombinant proteins unraveled that the protein synthesized from pEXA-N-lacS lacked the designed 6×His tag and that translation initiation did not start at the ATG codon of the fusion gene. Instead, it started...
Activation of the skeletal alpha-actin promoter during muscle regeneration.
Marsh, D R; Carson, J A; Stewart, L N; Booth, F W
1998-11-01
Little is known concerning promoter regulation of genes in regenerating skeletal muscles. In young rats, recovery of muscle mass and protein content is complete within 21 days. During the initial 5-10 days of regeneration, mRNA abundance for IGF-I, myogenin and MyoD have been shown to be dramatically increased. The skeletal alpha-actin promoter contains E box and serum response element (SRE) regulatory regions which are directly or indirectly activated by myogenin (or MyoD) and IGF-I proteins, respectively. We hypothesized that the skeletal alpha-actin promoter activity would increase during muscle regeneration, and that this induction would occur before muscle protein content returned to normal. Total protein content and the percentage content of skeletal alpha-actin protein was diminished at 4 and 8 days and re-accumulation had largely occurred by 16 days post-bupivacaine injection. Skeletal alpha-actin mRNA per whole muscle was decreased at day 8, and thereafter returned to control values. During regeneration at day 8, luciferase activity (a reporter of promoter activity) directed by -424 skeletal alpha-actin and -99 skeletal alpha-actin promoter constructs was increased by 700% and 250% respectively; however, at day 16, skeletal alpha-actin promoter activities were similar to control values. Thus, initial activation of the skeletal alpha-actin promoter is associated with regeneration of skeletal muscle, despite not being sustained during the later stages of regrowth. The proximal SRE of the skeletal alpha-actin promoter was not sufficient to confer a regeneration-induced promoter activation, despite increased serum response factor protein binding to this regulatory element in electrophoretic mobility shift assays. Skeletal alpha-actin promoter induction during regeneration is due to a combination of regulatory elements, at least including the SRE and E box.
Ryu, Sun-Hwa; Kim, Yun-Hee; Kim, Cha Young; Park, Soo-Young; Kwon, Suk-Yoon; Lee, Haeng-Soon; Kwak, Sang-Soo
2009-04-01
Previously, the swpa4 peroxidase gene has been shown to be inducible by a variety of abiotic stresses and pathogenic infections in sweet potato (Ipomoea batatas). To elucidate its regulatory mechanism at the transcriptional level under various stress conditions, we isolated and characterized the promoter region (2374 bp) of swpa4 (referred to as SWPA4). We performed a transient expression assay in tobacco protoplasts with deletions from the 5'-end of SWPA4 promoter fused to the beta-glucuronidase (GUS) reporter gene. The -1408 and -374 bp deletions relative to the transcription start site (+1) showed 8 and 4.5 times higher GUS expression than the cauliflower mosaic virus 35S promoter, respectively. In addition, transgenic tobacco plants expressing GUS under the control of -2374, -1408 or -374 bp region of SWPA4 promoter were generated and studied in various tissues under abiotic stresses and pathogen infection. Gel mobility shift assays revealed that nuclear proteins from sweet potato cultured cells specifically interacted with 60-bp fragment (-178/-118) in -374 bp promoter region. In silico analysis indicated that four kinds of cis-acting regulatory sequences, reactive oxygen species-related element activator protein 1 (AP1), CCAAT/enhancer-binding protein alpha element, ethylene-responsive element (ERE) and heat-shock element, are present in the -60 bp region (-178/-118), suggesting that the -60 bp region might be associated with stress inducibility of the SWPA4 promoter.
DEFF Research Database (Denmark)
Rugbjerg, Peter; Knuf, Christoph; Förster, Jochen
2015-01-01
a less leaky Cu2+-inducible promoter based on CUP1. The basal expression level of the new promoter was approx. 61% below the wild-type CUP1 promoter, thus expanding the absolute range of Cu2+-based gene control. The stability of 3vGFP towards direct-repeat recombination was assayed in S. cerevisiae......Green fluorescent proteins (GFPs) are widely used for visualization of proteins to track localization and expression dynamics. However, phenotypically important processes can operate at too low expression levels for routine detection, i.e. be overshadowed by autofluorescence noise. While GFP...... functions well in translational fusions, the use of tandem GFPs to amplify fluorescence signals is currently avoided in Saccharomyces cerevisiae and many other microorganisms due to the risk of loop-out by direct-repeat recombination. We increased GFP fluorescence by translationally fusing three different...
Monteiro, Rose A; Souza, Emanuel M; Geoffrey Yates, M; Steffens, M Berenice R; Pedrosa, Fábio O; Chubatsu, Leda S
2003-02-01
The Herbaspirillum seropedicae NifA protein is responsible for nif gene expression. The C-terminal domain of the H. seropedicae NifA protein, fused to a His-Tag sequence (His-Tag-C-terminal), was over-expressed and purified by metal-affinity chromatography to yield a highly purified and active protein. Band-shift assays showed that the NifA His-Tag-C-terminal bound specifically to the H. seropedicae nifB promoter region in vitro. In vivo analysis showed that this protein inhibited the Central + C-terminal domains of NifA protein from activating the nifH promoter of K. pneumoniae in Escherichia coli, indicating that the protein must be bound to the NifA-binding site (UAS site) at the nifH promoter region to activate transcription. Copyright 2002 Elsevier Science (USA)
The promotion of regional integration of electricity markets: Lessons for developing countries
International Nuclear Information System (INIS)
Oseni, Musiliu O.; Pollitt, Michael G.
2016-01-01
This paper focuses on how to promote regional cooperation in electricity. We begin by discussing the theory of international trade cooperation in electricity, with a view to discussing what preconditions might be important in facilitating wide area trading across national borders. We then develop lessons based on the comparison of four case studies. These include three regional developing country power pools – the Southern African Power pool (SAPP), West African Power pool (WAPP) and the Central American Power Market (MER). We contrast these with Northern Europe's Nord Pool. These cases highlight both the potential and difficulty of having cross-jurisdictional power pools. In the light of the theory and evidence we present, we draw key lessons in the areas of: preconditions for trading; necessary institutional arrangements; practicalities of timetabling; reasons to be hopeful about future prospects. - Highlights: • This paper focuses on how to promote regional electricity cooperation. • We develop lessons based on comparison of four international case studies. • The cases highlight both the potential and difficulty of power pools. • We identify preconditions, institutional arrangements and timetabling. • We conclude that the future prospects for regional power pools are good.
Peng, Tao; Zhou, Wei; Guo, Feng; Wu, He-shui; Wang, Chun-you; Wang, Li; Yang, Zhi-yong
2017-01-01
Centrosomal protein 55 (CEP55) is a microtubule-bundling protein that participants in cell mitosis. It is overexpressed in several solid tumours and promotes the growth and invasion of cancer cells. However, the role of CEP55 in pancreatic cancer (PANC) remains unclear. Herein, upregulated expression of CEP55 (associated with poor prognosis) was detected in PANC using quantitative real-time reverse transcription PCR, western blotting, and immunohistochemistry. Cell migration, colony formation...
Genome-scale prediction of proteins with long intrinsically disordered regions.
Peng, Zhenling; Mizianty, Marcin J; Kurgan, Lukasz
2014-01-01
Proteins with long disordered regions (LDRs), defined as having 30 or more consecutive disordered residues, are abundant in eukaryotes, and these regions are recognized as a distinct class of biologically functional domains. LDRs facilitate various cellular functions and are important for target selection in structural genomics. Motivated by the lack of methods that directly predict proteins with LDRs, we designed Super-fast predictor of proteins with Long Intrinsically DisordERed regions (SLIDER). SLIDER utilizes logistic regression that takes an empirically chosen set of numerical features, which consider selected physicochemical properties of amino acids, sequence complexity, and amino acid composition, as its inputs. Empirical tests show that SLIDER offers competitive predictive performance combined with low computational cost. It outperforms, by at least a modest margin, a comprehensive set of modern disorder predictors (that can indirectly predict LDRs) and is 16 times faster compared to the best currently available disorder predictor. Utilizing our time-efficient predictor, we characterized abundance and functional roles of proteins with LDRs over 110 eukaryotic proteomes. Similar to related studies, we found that eukaryotes have many (on average 30.3%) proteins with LDRs with majority of proteomes having between 25 and 40%, where higher abundance is characteristic to proteomes that have larger proteins. Our first-of-its-kind large-scale functional analysis shows that these proteins are enriched in a number of cellular functions and processes including certain binding events, regulation of catalytic activities, cellular component organization, biogenesis, biological regulation, and some metabolic and developmental processes. A webserver that implements SLIDER is available at http://biomine.ece.ualberta.ca/SLIDER/. Copyright © 2013 Wiley Periodicals, Inc.
p16(INK4a) promoter methylation and protein expression in breast fibroadenoma and carcinoma.
Di Vinci, Angela; Perdelli, Luisa; Banelli, Barbara; Salvi, Sandra; Casciano, Ida; Gelvi, Ilaria; Allemanni, Giorgio; Margallo, Edoardo; Gatteschi, Beatrice; Romani, Massimo
2005-04-10
The potential role of p16(INK4a) methylation in breast cancer is controversial whereas there are no data on fibroadenoma. To assess if inactivation of p16(INK4a) by promoter hypermethylation occurs in this hyperproliferative benign breast lesion or, on the contrary, it is strictly related to the carcinogenic process, we have tested the different histological components of 15 cases of fibroadenoma and the intraductal and infiltrating components of 15 cases of carcinoma and their adjacent non-tumoral epithelium. All samples were obtained by laser-assisted microdissection. The relationship between promoter methylation status, immunohistochemical protein expression and ki67 proliferative activity was evaluated for each lesion. Our data demonstrate that hypermethylation of p16(INK4a) promoter is a common event occurring at similar frequency in all the different histological areas of the benign and malignant breast lesions taken into exam. Conversely, protein p16 expression, although heterogeneously distributed within the section, is considerably higher in breast carcinoma as compared to fibroadenoma in both tumoral and non-tumoral epithelia and stroma. The protein localization was almost exclusively nuclear in fibroadenoma and non-tumoral epithelia whereas, in carcinoma, the staining was both nuclear and cytoplasmic or cytoplasmic alone. Furthermore, in a subset of fibroadenoma with higher proliferative activity, p16 protein expression was substantially decreased as compared to those showing lower proliferation. We did not observe this association in carcinomas. Our data demonstrate that the hypermethylation of the p16(INK4a) promoter is not specifically associated with malignancy and that, on the contrary, the overexpression of p16 and its cytoplasmic sequestration is a feature of breast carcinoma. (c) 2004 Wiley-Liss, Inc.
Ubiquitin-like protein UBL5 promotes the functional integrity of the Fanconi anemia pathway.
Oka, Yasuyoshi; Bekker-Jensen, Simon; Mailand, Niels
2015-05-12
Ubiquitin and ubiquitin-like proteins (UBLs) function in a wide array of cellular processes. UBL5 is an atypical UBL that does not form covalent conjugates with cellular proteins and which has a known role in modulating pre-mRNA splicing. Here, we report an unexpected involvement of human UBL5 in promoting the function of the Fanconi anemia (FA) pathway for repair of DNA interstrand crosslinks (ICLs), mediated by a specific interaction with the central FA pathway component FANCI. UBL5-deficient cells display spliceosome-independent reduction of FANCI protein stability, defective FANCI function in response to DNA damage and hypersensitivity to ICLs. By mapping the sequence determinants underlying UBL5-FANCI binding, we generated separation-of-function mutants to demonstrate that key aspects of FA pathway function, including FANCI-FANCD2 heterodimerization, FANCD2 and FANCI monoubiquitylation and maintenance of chromosome stability after ICLs, are compromised when the UBL5-FANCI interaction is selectively inhibited by mutations in either protein. Together, our findings establish UBL5 as a factor that promotes the functionality of the FA DNA repair pathway. © 2015 The Authors.
International Nuclear Information System (INIS)
Cui Wei; Yin Lingling; Dong Lingyue
2012-01-01
Objective: To clarify the mechanism of immediate early response gene 5 (Ier5) transcription induced by radiation. Methods: Deletant construction, site-specific mutagenesis,electrophoretic mobility shift assay (EMSA) and chromatin immunoprecipitation (ChIP) were used to forecast the promoter region, binding sites and transcription factors of Ier5 gene in HeLa cells. Results: The promoter region of Ier5 gene might be in the region of Ier5 -8 deletant (-408 - -238 bp). The Ier5 gene had two transcription factors of GCF and NFI, and GCF had two binding sites located in the region of -388 - -382 bp and -274 - -270 bp of Ier5 promoter. The binding site of NFI was located in -362 - -357 bp of Ier5 promoter. GCF could inhibit the expression of Ier5 gene and this inhibition was diminished when the radiation dose increased. In contrast, NFI increased the expression of Ier5. Conclusions: The most possible region of Ier5 promoter is from -408 to -238 bp which has two binding sites for the radiosensitivity transcription factors of GCF and NFI that could negatively and positively regulate the expression of Ier5 respectively. (authors)
Hjelm, Anna; Karyolaimos, Alexandros; Zhang, Zhe; Rujas, Edurne; Vikström, David; Slotboom, Dirk Jan; de Gier, Jan-Willem
Membrane and secretory protein production in Escherichia coli requires precisely controlled production rates to avoid the deleterious saturation of their biogenesis pathways. Based on this requirement, the E. coli L-rhamnose PBAD promoter (PrhaBAD) is often used for membrane and secretory protein
van Erpecum, K. J.; Portincasa, P.; Eckhardt, E.; Go, P. M.; vanBerge-Henegouwen, G. P.; Groen, A. K.
1996-01-01
Background & Aims: Ursodeoxycholic acid prevents gallstone formation in selected patients. The aim of this study was to examine whether decreased concentration and nucleation-promoting activity of various proteins contribute to this beneficial effect. Methods: Gallbladder bile of 13 patients with
Directory of Open Access Journals (Sweden)
D’Urzo Nunzia
2013-02-01
Full Text Available Abstract Background In past years research has focused on the development of alternative Gram positive bacterial expression systems to produce industrially relevant proteins. Brevibacillus choshinensis is an easy to handle non-sporulating bacterium, lacking extracellular proteases, that has been already shown to provide a high level of recombinant protein expression. One major drawback, limiting the applicability of the Brevibacillus expression system, is the absence of expression vectors based on inducible promoters. Here we used the PxylA inducible promoter, commonly employed in other Bacillae expression systems, in Brevibacillus. Results Using GFP, α-amylase and TcdA-GT as model proteins, high level of intracellular protein expression (up to 250 mg/L for the GFP was achieved in Brevibacillus, using the pHis1522 vector carrying the B. megaterium xylose-inducible promoter (PxylA. The GFP expression yields were more than 25 fold higher than those reported for B. megaterium carrying the same vector. All the tested proteins show significant increment in their expression levels (2-10 folds than those obtained using the available plasmids based on the P2 constitutive promoter. Conclusion Combining the components of two different commercially available Gram positive expression systems, such as Brevibacillus (from Takara Bio and B. megaterium (from Mobitec, we demonstrate that vectors based on the B. megaterium PxylA xylose inducible promoter can be successfully used to induce high level of intracellular expression of heterologous proteins in Brevibacillus.
Ku proteins function as corepressors to regulate farnesoid X receptor-mediated gene expression
International Nuclear Information System (INIS)
Ohno, Masae; Kunimoto, Masaaki; Nishizuka, Makoto; Osada, Shigehiro; Imagawa, Masayoshi
2009-01-01
The farnesoid X receptor (FXR; NR1H4) is a member of the nuclear receptor superfamily and regulates the expression of genes involved in enterohepatic circulation and the metabolism of bile acids. Based on functional analyses, nuclear receptors are divided into regions A-F. To explore the cofactors interacting with FXR, we performed a pull-down assay using GST-fused to the N-terminal A/B region and the C region, which are required for the ligand-independent transactivation and DNA-binding, respectively, of FXR, and nuclear extracts from HeLa cells. We identified DNA-dependent protein kinase catalytic subunit (DNA-PKcs), Ku80, and Ku70 as FXR associated factors. These proteins are known to have an important role in DNA repair, recombination, and transcription. DNA-PKcs mainly interacted with the A/B region of FXR, whereas the Ku proteins interacted with the C region and with the D region (hinge region). Chromatin immunoprecipitation assays revealed that the Ku proteins associated with FXR on the bile salt export pump (BSEP) promoter. Furthermore, we demonstrated that ectopic expression of the Ku proteins decreased the promoter activity and expression of BSEP gene mediated by FXR. These results suggest that the Ku proteins function as corepressors for FXR.
Energy Technology Data Exchange (ETDEWEB)
Waller, Zoë A.E., E-mail: z.waller@uea.ac.uk; Howell, Lesley A.; MacDonald, Colin J.; O’Connell, Maria A.; Searcey, Mark, E-mail: m.searcey@uea.ac.uk
2014-04-25
Highlights: • Discovery of a G-quadruplex forming sequence in the promoter sequence of Nrf2. • Characterisation of the G-quadruplex by UV, CD and NMR. • Conformational switching of G-quadruplex induced by 9-aminoacridine. - Abstract: The transcription factor nuclear factor (erythroid-derived 2)-like 2 (Nrf2) regulates multiple antioxidants, Phase II detoxification enzymes and other cytoprotective enzymes in cells. Activation of Nrf2 is recognised as being of potential therapeutic benefit in inflammatory-diseases whereas more recently, it has become clear that the inhibition of Nrf2 may have benefit in the alleviation of resistance in some tumour types. A potential G-quadruplex forming sequence was identified in the promoter region of Nrf2, close to a number of putative transcription factor binding sites. Characterisation of the sequence 5’-d[GGGAAGGGAGCAAGGGCGGGAGGG]-3’ using CD spectroscopy, imino proton NMR resonances and UV melting experiments demonstrated the formation of a parallel intramolecular G-quadruplex in the presence of K{sup +} ions. Incubation with 9-aminoacridine ligands induced a switch from antiparallel to parallel forms. The presence of a G-quadruplex forming sequence in the promoter region of Nrf2 suggests an approach to targeting the production of the protein through stabilisation of the structure, thereby avoiding resistance to antitumour drugs.
Systematic search for the Cra-binding promoters using genomic SELEX system.
Shimada, Tomohiro; Fujita, Nobuyuki; Maeda, Michihisa; Ishihama, Akira
2005-09-01
Cra (or FruR), a global transcription factor with both repression and activation activities, controls a large number of the genes for glycolysis and gluconeogenesis. To get insights into the entire network of transcription regulation of the E. coli genome by Cra, we isolated a set of Cra-binding sequences using an improved method of genomic SELEX. From the DNA sequences of 97 independently isolated DNA fragments by SELEX, the Cra-binding sequences were identified in a total of ten regions on the E. coli genome, including promoters of six known genes and four hitherto-unidentified genes. All six known promoters are repressed by Cra, but none of the activation-type promoters were cloned after two cyles of SELEX, because the Cra-binding affinity to the repression-type promoters is higher than the activation-type promoters, as determined by the quantitative gel shift assay. Of a total of four newly identified Cra-binding sequences, two are associated with promoter regions of the gapA (glyceraldehyde 3-phosphate dehydrogenase) and eno (enolase) genes, both involved in sugar metabolism. The regulation of newly identified genes by Cra was confirmed by the in vivo promoter strength assay using a newly developed TFP (two-fluorescent protein) vector for promoter assay or by in vitro transcription assay in the presence of Cra protein.
Discrete Ramanujan transform for distinguishing the protein coding regions from other regions.
Hua, Wei; Wang, Jiasong; Zhao, Jian
2014-01-01
Based on the study of Ramanujan sum and Ramanujan coefficient, this paper suggests the concepts of discrete Ramanujan transform and spectrum. Using Voss numerical representation, one maps a symbolic DNA strand as a numerical DNA sequence, and deduces the discrete Ramanujan spectrum of the numerical DNA sequence. It is well known that of discrete Fourier power spectrum of protein coding sequence has an important feature of 3-base periodicity, which is widely used for DNA sequence analysis by the technique of discrete Fourier transform. It is performed by testing the signal-to-noise ratio at frequency N/3 as a criterion for the analysis, where N is the length of the sequence. The results presented in this paper show that the property of 3-base periodicity can be only identified as a prominent spike of the discrete Ramanujan spectrum at period 3 for the protein coding regions. The signal-to-noise ratio for discrete Ramanujan spectrum is defined for numerical measurement. Therefore, the discrete Ramanujan spectrum and the signal-to-noise ratio of a DNA sequence can be used for distinguishing the protein coding regions from the noncoding regions. All the exon and intron sequences in whole chromosomes 1, 2, 3 and 4 of Caenorhabditis elegans have been tested and the histograms and tables from the computational results illustrate the reliability of our method. In addition, we have analyzed theoretically and gotten the conclusion that the algorithm for calculating discrete Ramanujan spectrum owns the lower computational complexity and higher computational accuracy. The computational experiments show that the technique by using discrete Ramanujan spectrum for classifying different DNA sequences is a fast and effective method. Copyright © 2014 Elsevier Ltd. All rights reserved.
A study of the frequency of methylation of gene promoter regions in ...
Indian Academy of Sciences (India)
2013-04-02
Apr 2, 2013 ... colorectal cancer in the Taiwanese population. CHANG-CHIEH WU1 ... hypermethylation of promoter-region CpG islands is an important ... mismatch repair gene MLH1 plays an important role in dele- ..... Asia Pac. J. Clin.
Zou, Wei; Ma, Xiangdong; Yang, Hong; Hua, Wei; Chen, Biliang; Cai, Guoqing
2017-03-01
Ovarian cancer is the highest mortality rate of all female reproductive malignancies. Drug resistance is a major cause of treatment failure in malignant tumors. Hepatitis B X-interacting protein acts as an oncoprotein, regulates cell proliferation, and migration in breast cancer. We aimed to investigate the effects and mechanisms of hepatitis B X-interacting protein on resistance to cisplatin in human ovarian cancer cell lines. The mRNA and protein levels of hepatitis B X-interacting protein were detected using RT-PCR and Western blotting in cisplatin-resistant and cisplatin-sensitive tissues, cisplatin-resistant cell lines A2780/CP and SKOV3/CP, and cisplatin-sensitive cell lines A2780 and SKOV3. Cell viability and apoptosis were measured to evaluate cellular sensitivity to cisplatin in A2780/CP cells. Luciferase reporter gene assay was used to determine the relationship between hepatitis B X-interacting protein and CD147. The in vivo function of hepatitis B X-interacting protein on tumor burden was assessed in cisplatin-resistant xenograft models. The results showed that hepatitis B X-interacting protein was highly expressed in ovarian cancer of cisplatin-resistant tissues and cells. Notably, knockdown of hepatitis B X-interacting protein significantly reduced cell viability in A2780/CP compared with cisplatin treatment alone. Hepatitis B X-interacting protein and cisplatin cooperated to induce apoptosis and increase the expression of c-caspase 3 as well as the Bax/Bcl-2 ratio. We confirmed that hepatitis B X-interacting protein up-regulated CD147 at the protein expression and transcriptional levels. Moreover, we found that hepatitis B X-interacting protein was able to activate the CD147 promoter through Sp1. In vivo, depletion of hepatitis B X-interacting protein decreased the tumor volume and weight induced by cisplatin. Taken together, these results indicate that hepatitis B X-interacting protein promotes cisplatin resistance and regulated CD147 via Sp1 in
Li, Y; Chen, J; Zhao, M; Yang, Z; Yue, L; Zhang, X
2017-02-01
To demonstrate the resuscitation-promoting activities of recombinant YeaZ from Vibrio harveyi SF-1. The gene of resuscitation-promoting factor YeaZ was cloned from genomic DNA of V. harveyi SF-1. The gene was expressed in Escherichia coli, and the expressed protein was purified by Ni 2+ -affinity chromatography. A yeaZ mutant was constructed by using the suicide plasmid pNQ705 with homologous recombination. Disruption of yeaZ did not affect cell growth significantly in 2216 E broth at 28°C. The wild-type and mutant viable but nonculturable (VBNC) cells could be resuscitated by temperature upshift method. In addition, the recombinant YeaZ increased the culturable counts from 1·27 × 10 4 CFU per ml and 1·99 × 10 4 CFU per ml to 2·88 × 10 5 CFU per ml and 4·59 × 10 5 CFU per ml, respectively. After the VBNC cells of wild-type and mutant cells were maintained at 4°C for 120 days, no resuscitation was obtained by temperature upshift method, but addition of the recombinant YeaZ promoted the resuscitation of the wild-type and mutant cells, with the culturable cell counts of 1·13 × 10 3 and 1·44 × 10 3 CFU per ml, respectively. Disruption of yeaZ decreased the virulence of V. harveyi in zebrafish. The lethal dose 50% of the yeaZ null mutant was more than 10-fold higher than that of the wild-type cells. The recombinant YeaZ could efficiently promote resuscitation of the wild-type and mutant cells of V. harveyi from VBNC to culturable state. The protein also promoted resuscitation of the VBNC wild-type and mutant cells, which were maintained at 4°C for 120 days and not recovered by temperature upshift method. Disruption of yeaZ decreased the virulence of V. harveyi in zebrafish. Here, we show clear evidence of a resuscitation-promoting factor YeaZ of V. harveyi and the roles in resuscitation of the VBNC cells and its pathogenicity. © 2016 The Society for Applied Microbiology.
An essential GT motif in the lamin A promoter mediates activation by CREB-binding protein
International Nuclear Information System (INIS)
Janaki Ramaiah, M.; Parnaik, Veena K.
2006-01-01
Lamin A is an important component of nuclear architecture in mammalian cells. Mutations in the human lamin A gene lead to highly degenerative disorders that affect specific tissues. In studies directed towards understanding the mode of regulation of the lamin A promoter, we have identified an essential GT motif at -55 position by reporter gene assays and mutational analysis. Binding of this sequence to Sp transcription factors has been observed in electrophoretic mobility shift assays and by chromatin immunoprecipitation studies. Further functional analysis by co-expression of recombinant proteins and ChIP assays has shown an important regulatory role for CREB-binding protein in promoter activation, which is mediated by the GT motif
Promoters of Escherichia coli versus promoter islands: function and structure comparison.
Directory of Open Access Journals (Sweden)
Valeriy V Panyukov
Full Text Available Expression of bacterial genes takes place under the control of RNA polymerase with exchangeable σ-subunits and multiple transcription factors. A typical promoter region contains one or several overlapping promoters. In the latter case promoters have the same or different σ-specificity and are often subjected to different regulatory stimuli. Genes, transcribed from multiple promoters, have on average higher expression levels. However, recently in the genome of Escherichia coli we found 78 regions with an extremely large number of potential transcription start points (promoter islands, PIs. It was shown that all PIs interact with RNA polymerase in vivo and are able to form transcriptionally competent open complexes both in vitro and in vivo but their transcriptional activity measured by oligonucleotide microarrays was very low, if any. Here we confirmed transcriptional defectiveness of PIs by analyzing the 5'-end specific RNA-seq data, but showed their ability to produce short oligos (9-14 bases. This combination of functional properties indicated a deliberate suppression of transcriptional activity within PIs. According to our data this suppression may be due to a specific conformation of the DNA double helix, which provides an ideal platform for interaction with both RNA polymerase and the histone-like nucleoid protein H-NS. The genomic DNA of E.coli contains therefore several dozen sites optimized by evolution for staying in a heterochromatin-like state. Since almost all promoter islands are associated with horizontally acquired genes, we offer them as specific components of bacterial evolution involved in acquisition of foreign genetic material by turning off the expression of toxic or useless aliens or by providing optimal promoter for beneficial genes. The putative molecular mechanism underlying the appearance of promoter islands within recipient genomes is discussed.
Directory of Open Access Journals (Sweden)
Clément Chevalier
2010-03-01
Full Text Available Staphylococcus aureus RNAIII is the intracellular effector of the quorum sensing system that temporally controls a large number of virulence factors including exoproteins and cell-wall-associated proteins. Staphylocoagulase is one major virulence factor, which promotes clotting of human plasma. Like the major cell surface protein A, the expression of staphylocoagulase is strongly repressed by the quorum sensing system at the post-exponential growth phase. Here we used a combination of approaches in vivo and in vitro to analyze the mechanism used by RNAIII to regulate the expression of staphylocoagulase. Our data show that RNAIII represses the synthesis of the protein through a direct binding with the mRNA. Structure mapping shows that two distant regions of RNAIII interact with coa mRNA and that the mRNA harbors a conserved signature as found in other RNAIII-target mRNAs. The resulting complex is composed of an imperfect duplex masking the Shine-Dalgarno sequence of coa mRNA and of a loop-loop interaction occurring downstream in the coding region. The imperfect duplex is sufficient to prevent the formation of the ribosomal initiation complex and to repress the expression of a reporter gene in vivo. In addition, the double-strand-specific endoribonuclease III cleaves the two regions of the mRNA bound to RNAIII that may contribute to the degradation of the repressed mRNA. This study validates another direct target of RNAIII that plays a role in virulence. It also illustrates the diversity of RNAIII-mRNA topologies and how these multiple RNAIII-mRNA interactions would mediate virulence regulation.
Exogenous fatty acid binding protein 4 promotes human prostate cancer cell progression.
Uehara, Hisanori; Takahashi, Tetsuyuki; Oha, Mina; Ogawa, Hirohisa; Izumi, Keisuke
2014-12-01
Epidemiologic studies have found that obesity is associated with malignant grade and mortality in prostate cancer. Several adipokines have been implicated as putative mediating factors between obesity and prostate cancer. Fatty acid binding protein 4 (FABP4), a member of the cytoplasmic fatty acid binding protein multigene family, was recently identified as a novel adipokine. Although FABP4 is released from adipocytes and mean circulating concentrations of FABP4 are linked with obesity, effects of exogenous FABP4 on prostate cancer progression are unclear. In this study, we examined the effects of exogenous FABP4 on human prostate cancer cell progression. FABP4 treatment promoted serum-induced prostate cancer cell invasion in vitro. Furthermore, oleic acid promoted prostate cancer cell invasion only if FABP4 was present in the medium. These promoting effects were reduced by FABP4 inhibitor, which inhibits FABP4 binding to fatty acids. Immunostaining for FABP4 showed that exogenous FABP4 was taken up into DU145 cells in three-dimensional culture. In mice, treatment with FABP4 inhibitor reduced the subcutaneous growth and lung metastasis of prostate cancer cells. Immunohistochemical analysis showed that the number of apoptotic cells, positive for cleaved caspase-3 and cleaved PARP, was increased in subcutaneous tumors of FABP4 inhibitor-treated mice, as compared with control mice. These results suggest that exogenous FABP4 might promote human prostate cancer cell progression by binding with fatty acids. Additionally, exogenous FABP4 activated the PI3K/Akt pathway, independently of binding to fatty acids. Thus, FABP4 might be a key molecule to understand the mechanisms underlying the obesity-prostate cancer progression link. © 2014 UICC.
Directory of Open Access Journals (Sweden)
Álvarez-Morales Ariel
2011-05-01
Full Text Available Abstract Background Pseudomonas syringae pv. phaseolicola, the causal agent of halo blight disease in beans, produces a toxin known as phaseolotoxin, in whose synthesis participate a group of genes organized within the genome in a region known as the "Pht cluster". This region, which is thought to have been acquired by horizontal gene transfer, includes 5 transcriptional units, two monocistronic (argK, phtL and three polycistronic (phtA, phtD, phtM, whose expression is temperature dependent. So far, the regulatory mechanisms involved in phaseolotoxin synthesis have not been elucidated and the only well-established fact is the requirement of low temperatures for its synthesis. In this work, we searched for regulatory proteins that could be involved in phaseolotoxin synthesis, focusing on the regulation of the phtD operon. Results In this study we identified the global regulator IHF (Integration Host Factor, which binds to the promoter region of the phtD operon, exerting a negative effect on the expression of this operon. This is the first regulatory protein identified as part of the phaseolotoxin synthesis system. Our findings suggest that the Pht cluster was similarly regulated in the ancestral cluster by IHF or similar protein, and integrated into the global regulatory mechanism of P. syringae pv. phaseolicola, after the horizontal gene transfer event by using the host IHF protein. Conclusion This study identifies the IHF protein as one element involved in the regulation of phaseolotoxin synthesis in P. syringae pv. phaseolicola NPS3121 and provides new insights into the regulatory mechanisms involved in phaseolotoxin production.
Kalveram, Birte; Lihoradova, Olga; Ikegami, Tetsuro
2011-01-01
Rift Valley fever virus (RVFV; family Bunyaviridae, genus Phlebovirus) is an important emerging pathogen of humans and ruminants. Its NSs protein has previously been identified as a major virulence factor that suppresses host defense through three distinct mechanisms: it directly inhibits beta interferon (IFN-β) promoter activity, it promotes the degradation of double-stranded RNA-dependent protein kinase (PKR), and it suppresses host transcription by disrupting the assembly of the basal transcription factor TFIIH through sequestration of its p44 subunit. Here, we report that in addition to PKR, NSs also promotes the degradation of the TFIIH subunit p62. Infection of cells with the RVFV MP-12 vaccine strain reduced p62 protein levels to below the detection limit early in the course of infection. This NSs-mediated downregulation of p62 was posttranslational, as it was unaffected by pharmacological inhibition of transcription or translation and MP-12 infection had no effect on p62 mRNA levels. Treatment of cells with proteasome inhibitors but not inhibition of lysosomal acidification or nuclear export resulted in a stabilization of p62 in the presence of NSs. Furthermore, p62 could be coprecipitated with NSs from lysates of infected cells. These data suggest that the RVFV NSs protein is able to interact with the TFIIH subunit p62 inside infected cells and promotes its degradation, which can occur directly in the nucleus. PMID:21543505
Directory of Open Access Journals (Sweden)
Doerthe Kuester
2007-03-01
Full Text Available Esophageal Barrett's adenocarcinoma (BA develops through a multistage process, which is associated with the transcriptional silencing of tumor-suppressor genes by promoter CpG island hypermethylation. In this study, we explored the promoter hypermethylation and protein expression of proapoptotic deathassociated protein kinase (DAPK during the multistep Barrett's carcinogenesis cascade. Early BA and paired samples of premalignant lesions of 61 patients were analyzed by methylation-specific polymerase chain reaction and immunohistochemistry. For the association of clinicopathological markers and protein expression, an immunohistochemical tissue microarray analysis of 66 additional BAs of advanced tumor stages was performed. Hypermethylation of DAPK promoter was detected in 20% of normal mucosa, 50% of Barrett's metaplasia, 53% of dysplasia, and 60% of adenocarcinomas, and resulted in a marked decrease in DAPK protein expression (P < .01. The loss of DAPK protein was significantly associated with advanced depth of tumor invasion and advanced tumor stages (P < .001. Moreover, the severity of reflux esophagitis correlated significantly with the hypermethylation rate of the DAPK promoter (P < .003. Thus, we consider DAPK inactivation by promoter hypermethylation as an early event in Barrett's carcinogenesis and suggest that a decreased protein expression of DAPK likely plays a role in the development and progression of BA.
Chen, Y.; Sun, A.; Wang, M.; Zhu, Z.; Ouwerkerk, P.B.F.
2014-01-01
Glutelins are the most abundant storage proteins in rice grain and can make up to 80 % of total protein content. The promoter region of GluB-1, one of the glutelin genes in rice, has been intensively used as a model to understand regulation of seed-storage protein accumulation. In this study, we
A-type nuclear lamins act as transcriptional repressors when targeted to promoters
International Nuclear Information System (INIS)
Lee, Damian C.; Welton, K. Linnea; Smith, Erica D.; Kennedy, Brian K.
2009-01-01
Regions of heterochromatin are often found at the periphery of the mammalian nucleus, juxtaposed to the nuclear lamina. Genes in these regions are likely maintained in a transcriptionally silent state, although other locations at the nuclear periphery associated with nuclear pores are sites of active transcription. As primary components of the nuclear lamina, A- and B-type nuclear lamins are intermediate filament proteins that interact with DNA, histones and known transcriptional repressors, leading to speculation that they may promote establishment of repressive domains. However, no direct evidence of a role for nuclear lamins in transcriptional repression has been reported. Here we find that human lamin A, when expressed in yeast and cultured human cells as a fusion protein to the Gal4 DNA-binding domain (DBD), can mediate robust transcriptional repression of promoters with Gal4 binding sites. Full repression by lamin A requires both the coiled-coil rod domain and the C-terminal tail domain. In human cells, other intermediate filament proteins such as lamin B and vimentin are unable to confer robust repression as Gal4-DBD fusions, indicating that this property is specific to A-type nuclear lamins. These findings indicate that A-type lamins can promote transcriptional repression when in proximity of a promoter
Control of autogenous activation of Herbaspirillum seropedicae nifA promoter by the IHF protein.
Wassem, Roseli; Pedrosa, Fábio O; Yates, Marshall G; Rego, Fabiane G M; Chubatsu, Leda S; Rigo, Liu U; Souza, Emanuel M
2002-07-02
Analysis of the expression of the Herbaspirillum seropedicae nifA promoter in Escherichia coli and Herbaspirillum seropedicae, showed that nifA expression is primarily dependent on NtrC but also required NifA for maximal expression under nitrogen-fixing conditions. Deletion of the IHF (integration host factor)-binding site produced a promoter with two-fold higher activity than the native promoter in the H. seropedicae wild-type strain but not in a nifA strain, indicating that IHF controls NifA auto-activation. IHF is apparently required to prevent overexpression of the NifA protein via auto-activation under nitrogen-fixing conditions in H. seropedicae.
An Aphid Effector Targets Trafficking Protein VPS52 in a Host-Specific Manner to Promote Virulence.
Rodriguez, Patricia A; Escudero-Martinez, Carmen; Bos, Jorunn I B
2017-03-01
Plant- and animal-feeding insects secrete saliva inside their hosts, containing effectors, which may promote nutrient release and suppress immunity. Although for plant pathogenic microbes it is well established that effectors target host proteins to modulate host cell processes and promote disease, the host cell targets of herbivorous insects remain elusive. Here, we show that the existing plant pathogenic microbe effector paradigm can be extended to herbivorous insects in that effector-target interactions inside host cells modify critical host processes to promote plant susceptibility. We showed that the effector Mp1 from Myzus persicae associates with the host Vacuolar Protein Sorting Associated Protein52 (VPS52). Using natural variants, we provide a strong link between effector virulence activity and association with VPS52, and show that the association is highly specific to M persicae -host interactions. Also, coexpression of Mp1, but not Mp1-like variants, specifically with host VPS52s resulted in effector relocalization to vesicle-like structures that associate with prevacuolar compartments. We show that high VPS52 levels negatively impact virulence, and that aphids are able to reduce VPS52 levels during infestation, indicating that VPS52 is an important virulence target. Our work is an important step forward in understanding, at the molecular level, how a major agricultural pest promotes susceptibility during infestation of crop plants. We give evidence that an herbivorous insect employs effectors that interact with host proteins as part of an effective virulence strategy, and that these effectors likely function in a species-specific manner. © 2017 American Society of Plant Biologists. All Rights Reserved.
Role of regional policies in promoting networking and innovation activity of firms
Kirsi Mukkala; Jari Ritsilä
2004-01-01
The success of firms and regions is increasingly defined by their innovation and learning capabilities. It has been emphasized in several studies that a local operational environment may have a positive impact on innovation activity of firms. From policy point of view, the relationship between firms and their local environment is an important research topic. The purpose of this paper is to explore whether there is a demand for regional policy makers in promoting innovative and networking acti...
Prediction of flexible/rigid regions from protein sequences using k-spaced amino acid pairs
Directory of Open Access Journals (Sweden)
Ruan Jishou
2007-04-01
Full Text Available Abstract Background Traditionally, it is believed that the native structure of a protein corresponds to a global minimum of its free energy. However, with the growing number of known tertiary (3D protein structures, researchers have discovered that some proteins can alter their structures in response to a change in their surroundings or with the help of other proteins or ligands. Such structural shifts play a crucial role with respect to the protein function. To this end, we propose a machine learning method for the prediction of the flexible/rigid regions of proteins (referred to as FlexRP; the method is based on a novel sequence representation and feature selection. Knowledge of the flexible/rigid regions may provide insights into the protein folding process and the 3D structure prediction. Results The flexible/rigid regions were defined based on a dataset, which includes protein sequences that have multiple experimental structures, and which was previously used to study the structural conservation of proteins. Sequences drawn from this dataset were represented based on feature sets that were proposed in prior research, such as PSI-BLAST profiles, composition vector and binary sequence encoding, and a newly proposed representation based on frequencies of k-spaced amino acid pairs. These representations were processed by feature selection to reduce the dimensionality. Several machine learning methods for the prediction of flexible/rigid regions and two recently proposed methods for the prediction of conformational changes and unstructured regions were compared with the proposed method. The FlexRP method, which applies Logistic Regression and collocation-based representation with 95 features, obtained 79.5% accuracy. The two runner-up methods, which apply the same sequence representation and Support Vector Machines (SVM and Naïve Bayes classifiers, obtained 79.2% and 78.4% accuracy, respectively. The remaining considered methods are
Sequence organization and control of transcription in the bacteriophage T4 tRNA region.
Broida, J; Abelson, J
1985-10-05
Bacteriophage T4 contains genes for eight transfer RNAs and two stable RNAs of unknown function. These are found in two clusters at 70 X 10(3) base-pairs on the T4 genetic map. To understand the control of transcription in this region we have completed the sequencing of 5000 base-pairs in this region. The sequence contains a part of gene 3, gene 1, gene 57, internal protein I, the tRNA genes and five open reading frames which most likely code for heretofore unidentified proteins. We have used subclones of the region to investigate the kinetics of transcription in vivo. The results show that transcription in this region consists of overlapping early, middle and late transcripts. Transcription is directed from two early promoters, one or two middle promoters and perhaps two late promoters. This region contains all of the features that are seen in T4 transcription and as such is a good place to study the phenomenon in more detail.
DEFF Research Database (Denmark)
Jensen, Anne
Pricing of transport has been part of EU's common transport policy since this gained momentum in the early 1990s. Since then, it has been closely connected to the trans-European transport network (TEN-T) and to rising demands of efficient mobility systems at a local, regional and Community scale....... Development of pricing policies is contested at Community level and has taken place in a clash between different policy rationalities. Significantly though, the effects of the pricing policies are closely related to regional mobility systems, e.g. through financing large trans-border infrastructure projects...... and establishing common technical charging systems thus changing the conditions for regional mobility. This paper explores how policies of infrastructure pricing shape new ways of governing mobility which influences trans-border, regional policy-making. The key findings are that there is a tendency to include...
Moustafa, Savvina; Karakasiliotis, Ioannis; Mavromara, Penelope
2018-05-01
Viruses often encompass overlapping reading frames and unconventional translation mechanisms in order to maximize the output from a minimum genome and to orchestrate their timely gene expression. Hepatitis C virus (HCV) possesses such an unconventional open reading frame (ORF) within the core-coding region, encoding an additional protein, initially designated ARFP, F, or core+1. Two predominant isoforms of core+1/ARFP have been reported, core+1/L, initiating from codon 26, and core+1/S, initiating from codons 85/87 of the polyprotein coding region. The biological significance of core+1/ARFP expression remains elusive. The aim of the present study was to gain insight into the functional and pathological properties of core+1/ARFP through its interaction with the host cell, combining in vitro and in vivo approaches. Our data provide strong evidence that the core+1/ARFP of HCV-1a stimulates cell proliferation in Huh7-based cell lines expressing either core+1/S or core+1/L isoforms and in transgenic liver disease mouse models expressing core+1/S protein in a liver-specific manner. Both isoforms of core+1/ARFP increase the levels of cyclin D1 and phosphorylated Rb, thus promoting the cell cycle. In addition, core+1/S was found to enhance liver regeneration and oncogenesis in transgenic mice. The induction of the cell cycle together with increased mRNA levels of cell proliferation-related oncogenes in cells expressing the core+1/ARFP proteins argue for an oncogenic potential of these proteins and an important role in HCV-associated pathogenesis. IMPORTANCE This study sheds light on the biological importance of a unique HCV protein. We show here that core+1/ARFP of HCV-1a interacts with the host machinery, leading to acceleration of the cell cycle and enhancement of liver carcinogenesis. This pathological mechanism(s) may complement the action of other viral proteins with oncogenic properties, leading to the development of hepatocellular carcinoma. In addition, given that
Directory of Open Access Journals (Sweden)
Perera Rajika L
2004-12-01
Full Text Available Abstract Background In the search for generic expression strategies for mammalian protein families several bacterial expression vectors were examined for their ability to promote high yields of soluble protein. Proteins studied included cell surface receptors (Ephrins and Eph receptors, CD44, kinases (EGFR-cytoplasmic domain, CDK2 and 4, proteases (MMP1, CASP2, signal transduction proteins (GRB2, RAF1, HRAS and transcription factors (GATA2, Fli1, Trp53, Mdm2, JUN, FOS, MAD, MAX. Over 400 experiments were performed where expression of 30 full-length proteins and protein domains were evaluated with 6 different N-terminal and 8 C-terminal fusion partners. Expression of an additional set of 95 mammalian proteins was also performed to test the conclusions of this study. Results Several protein features correlated with soluble protein expression yield including molecular weight and the number of contiguous hydrophobic residues and low complexity regions. There was no relationship between successful expression and protein pI, grand average of hydropathicity (GRAVY, or sub-cellular location. Only small globular cytoplasmic proteins with an average molecular weight of 23 kDa did not require a solubility enhancing tag for high level soluble expression. Thioredoxin (Trx and maltose binding protein (MBP were the best N-terminal protein fusions to promote soluble expression, but MBP was most effective as a C-terminal fusion. 63 of 95 mammalian proteins expressed at soluble levels of greater than 1 mg/l as N-terminal H10-MBP fusions and those that failed possessed, on average, a higher molecular weight and greater number of contiguous hydrophobic amino acids and low complexity regions. Conclusions By analysis of the protein features identified here, this study will help predict which mammalian proteins and domains can be successfully expressed in E. coli as soluble product and also which are best targeted for a eukaryotic expression system. In some cases
Distribution of protein components of wheat from different regions
African Journals Online (AJOL)
kesiena
2012-06-07
Jun 7, 2012 ... The distribution of wheat protein components in different regions was researched to ..... properties of wheat gliadins II. effects on dynamic rheoligical ... fractions properties of wheat dough depending on molecular size and.
Structure of the gene for human β2-adrenergic receptor: expression and promoter characterization
International Nuclear Information System (INIS)
Emorine, L.J.; Marullo, S.; Delavier-Klutchko, C.; Kaveri, S.V.; Durieu-Trautmann, O.; Strosberg, A.D.
1987-01-01
The genomic gene coding for the human β 2 -adrenergic receptor (β 2 AR) from A431 epidermoid cells has been isolated. Transfection of the gene into eukaryotic cells restores a fully active receptor/GTP-binding protein/adenylate cyclase complex with β 2 AR properties. Southern blot analyses with β 2 AR-specific probes show that a single β 2 AR gene is common to various human tissues and that its flanking sequences are highly conserved among humans and between man and rabbit, mouse, and hamster. Functional significance of these regions is supported by the presence of a promoter region (including mRNA cap sites, two TATA boxes, a CAAT box, and three G + C-rich regions that resemble binding sites for transcription factor Sp1) 200-300 base pairs 5' to the translation initiation codon. In the 3' flanking region, sequences homologous to glucocorticoid-response elements might be responsible for the increased expression of the β 2 AR gene observed after treatment of the transfected cells with hydrocortisone. In addition, 5' to the promoter region, an open reading frame encodes a 251-residue polypeptide that displays striking homologies with protein kinases and other nucleotide-binding proteins
Energy Technology Data Exchange (ETDEWEB)
Joshi, J.B. (National Heart, Lung, and Blood Inst., Bethesda, MD (United States)); Dave, H.P.G. (National Inst. of Health, Bethesda, MD (United States))
1992-02-01
Human T-cell lymphotropic virus type I (HTLV-I), an etiologic agent for adult T-cell leukemia, is strongly associated with certain neurological diseases. The HTLV-I genome encodes a protein, Tax{sub 1}, that transactivates viral gene transcription. CD4-positive T helper lymphocytes express the proenkephalin gene, and enkephalins have been implicated as neuroimmunomodulators. The authors have investigated the effect of Tax{sub 1} on the proenkephalin gene promoter in C6 rat glioma cells and demonstrated its transactivation. Analysis using 5{prime} deletion mutants of the promoter region showed that sequences upstream of base pair - 190 are necessary for maximal transactivation. Forskolin, a cAMP modulator, synergistically increased Tax{sub 1}-mediated transactivation of the proenkephalin promoter. Neither Tax{sub 1} transactivation alone nor Tax{sub 1}/cAMP synergism exclusively involved cAMP-responsive elements. Endogenous proenkephalin gene expression increased in Tax{sub 1}-expressing C6 cells. Since HTLV-I infects lymphocytes, which express proenkephalin mRNA, Tax{sub 1} transregulation of proenkephalin expression may provide bidirectional communication between the nervous and immune systems in HTLV-I-related diseases.
Wolff, Dennis W; Xie, Yan; Deng, Caishu; Gatalica, Zoran; Yang, Mingjie; Wang, Bo; Wang, Jincheng; Lin, Ming-Fong; Abel, Peter W; Tu, Yaping
2012-04-01
G-protein-coupled receptor (GPCR)-stimulated androgen-independent activation of androgen receptor (AR) contributes to acquisition of a hormone-refractory phenotype by prostate cancer. We previously reported that regulator of G-protein signaling (RGS) 2, an inhibitor of GPCRs, inhibits androgen-independent AR activation (Cao et al., Oncogene 2006;25:3719-34). Here, we show reduced RGS2 protein expression in human prostate cancer specimens compared to adjacent normal or hyperplastic tissue. Methylation-specific PCR analysis and bisulfite sequencing indicated that methylation of the CpG island in the RGS2 gene promoter correlated with RGS2 downregulation in prostate cancer. In vitro methylation of this promoter suppressed reporter gene expression in transient transfection studies, whereas reversal of this promoter methylation with 5-aza-2'-deoxycytidine (5-Aza-dC) induced RGS2 reexpression in androgen-independent prostate cancer cells and inhibited their growth under androgen-deficient conditions. Interestingly, the inhibitory effect of 5-Aza-dC was significantly reduced by an RGS2-targeted short hairpin RNA, indicating that reexpressed RGS2 contributed to this growth inhibition. Restoration of RGS2 levels by ectopic expression in androgen-independent prostate cancer cells suppressed growth of xenografts in castrated mice. Thus, RGS2 promoter hypermethylation represses its expression and unmasks a latent pathway for AR transactivation in prostate cancer cells. Targeting this reversible process may provide a new strategy for suppressing prostate cancer progression by reestablishing its androgen sensitivity. Copyright © 2011 UICC.
Functional analysis of the rice rubisco activase promoter in transgenic Arabidopsis
Energy Technology Data Exchange (ETDEWEB)
Yang, Zhipan; Lu, Qingtao; Wen, Xiaogang [Key Laboratory of Photobiology, Institute of Botany, Chinese Academy of Sciences, Beijing 100093 (China); Chen, Fan [Key Laboratory of Molecular and Developmental Biology, Institute of Genetics and Developmental Biology, Chinese Academy of Sciences, Beijing 100080 (China); Lu, Congming, E-mail: lucm@ibcas.ac.cn [Key Laboratory of Photobiology, Institute of Botany, Chinese Academy of Sciences, Beijing 100093 (China)
2012-02-17
Highlights: Black-Right-Pointing-Pointer Rice rubisco activase promoter was analyzed in transgenic Arabidopsis system. Black-Right-Pointing-Pointer Region conferring tissue specific and light inducible expression of Rca was identified. Black-Right-Pointing-Pointer -58 to +43 bp region mediates tissue-specific expression of rice Rca. Black-Right-Pointing-Pointer Light inducible expression of rice Rca is mediated by -297 to -58 bp region. Black-Right-Pointing-Pointer Rice nuclear proteins bind specifically with the light inducible region. -- Abstract: To gain a better understanding of the regulatory mechanism of the rice rubisco activase (Rca) gene, variants of the Rca gene promoter (one full-length and four deletion mutants) fused to the coding region of the bacterial reporter gene {beta}-glucuronidase (GUS) were introduced into Arabidopsis via Agrobacterium-mediated transformation. Our results show that a 340 bp fragment spanning from -297 to +43 bp relative to the transcription initiation site is enough to promote tissue-specific and light-inducible expression of the rice Rca gene as done by the full-length promoter (-1428 to +43 bp). Further deletion analysis indicated that the region conferring tissue-specificity of Rca expression is localized within a 105 bp fragment from -58 to +43 bp, while light-inducible expression of Rca is mediated by the region from -297 to -58 bp. Gel shift assays and competition experiments demonstrated that rice nuclear proteins bind specifically with the fragment conferring light responsiveness at more than one binding site. This implies that multiple cis-elements may be involved in light-induced expression of the rice Rca gene. These works provide a useful reference for understanding transcriptional regulation mechanism of the rice Rca gene, and lay a strong foundation for further detection of related cis-elements and trans-factors.
Functional analysis of the rice rubisco activase promoter in transgenic Arabidopsis
International Nuclear Information System (INIS)
Yang, Zhipan; Lu, Qingtao; Wen, Xiaogang; Chen, Fan; Lu, Congming
2012-01-01
Highlights: ► Rice rubisco activase promoter was analyzed in transgenic Arabidopsis system. ► Region conferring tissue specific and light inducible expression of Rca was identified. ► −58 to +43 bp region mediates tissue-specific expression of rice Rca. ► Light inducible expression of rice Rca is mediated by −297 to −58 bp region. ► Rice nuclear proteins bind specifically with the light inducible region. -- Abstract: To gain a better understanding of the regulatory mechanism of the rice rubisco activase (Rca) gene, variants of the Rca gene promoter (one full-length and four deletion mutants) fused to the coding region of the bacterial reporter gene β-glucuronidase (GUS) were introduced into Arabidopsis via Agrobacterium-mediated transformation. Our results show that a 340 bp fragment spanning from −297 to +43 bp relative to the transcription initiation site is enough to promote tissue-specific and light-inducible expression of the rice Rca gene as done by the full-length promoter (−1428 to +43 bp). Further deletion analysis indicated that the region conferring tissue-specificity of Rca expression is localized within a 105 bp fragment from −58 to +43 bp, while light-inducible expression of Rca is mediated by the region from −297 to −58 bp. Gel shift assays and competition experiments demonstrated that rice nuclear proteins bind specifically with the fragment conferring light responsiveness at more than one binding site. This implies that multiple cis-elements may be involved in light-induced expression of the rice Rca gene. These works provide a useful reference for understanding transcriptional regulation mechanism of the rice Rca gene, and lay a strong foundation for further detection of related cis-elements and trans-factors.
Systematic screening for mutations in the promoter and the coding region of the 5-HT{sub 1A} gene
Energy Technology Data Exchange (ETDEWEB)
Erdmann, J.; Shimron-Abarbanell, D.; Cichon, S. [Univ. of Bonn (Germany)] [and others
1995-10-09
In the present study we sought to identify genetic variation in the 5-HT{sub 1A} receptor gene which through alteration of protein function or level of expression might contribute to the genetic predisposition to neuropsychiatric diseases. Genomic DNA samples from 159 unrelated subjects (including 45 schizophrenic, 46 bipolar affective, and 43 patients with Tourette`s syndrome, as well as 25 healthy controls) were investigated by single-strand conformation analysis. Overlapping PCR (polymerase chain reaction) fragments covered the whole coding sequence as well as the 5{prime} untranslated region of the 5-HT{sub 1A} gene. The region upstream to the coding sequence we investigated contains a functional promoter. We found two rare nucleotide sequence variants. Both mutations are located in the coding region of the gene: a coding mutation (A{yields}G) in nucleotide position 82 which leads to an amino acid exchange (Ile{yields}Val) in position 28 of the receptor protein and a silent mutation (C{yields}T) in nucleotide position 549. The occurrence of the Ile-28-Val substitution was studied in an extended sample of patients (n = 352) and controls (n = 210) but was found in similar frequencies in all groups. Thus, this mutation is unlikely to play a significant role in the genetic predisposition to the diseases investigated. In conclusion, our study does not provide evidence that the 5-HT{sub 1A} gene plays either a major or a minor role in the genetic predisposition to schizophrenia, bipolar affective disorder, or Tourette`s syndrome. 29 refs., 4 figs., 1 tab.
Nucleopolis for promoting the nuclear excellence of the Normandy region
International Nuclear Information System (INIS)
2016-01-01
Nucleopolis is the Norman economic pole dedicated to nuclear energy, nuclear medicine and nuclear safety, it gathers about 70 enterprises whatever their sizes, research laboratories and teaching or training units. Nucleopolis was founded in 2009 with the economic development of the region as a unique purpose. Nucleopolis will ease the access of its members to local, national and international markets through actions of networking and by promoting innovations and skill development. Nucleopolis proposes to its members a series of services around 4 departments: Nucleo'Network to promote networking between the members themselves and between the members and major contractors; Nucleo'Business to propose assistance in national and international business; Nucleo'Competence to propose adequate training to its members to upgrade their skills and Nucleo'Innovation to foster collaborative work between its members on innovative projects. (A.C.)
Restoration of CpG Methylation in The Egf Promoter Region during Rat Liver Regeneration
Deming, Li; Ziwei, Li; Xueqiang, Guo; Cunshuan, Xu
2015-01-01
Epidermal growth factor (EGF) is an important factor for healing after tissue damage in diverse experimental models. It plays an important role in liver regeneration (LR). The objective of this experiment is to investigate the methylation variation of 10 CpG sites in the Egf promoter region and their relevance to Egf expression during rat liver regenera- tion. As a follow up of our previous study, rat liver tissue was collected after rat 2/3 partial hepatectomy (PH) during the re-organization phase (from days 14 to days 28). Liver DNA was extracted and modified by sodium bisulfate. The methylation status of 10 CpG sites in Egf promoter region was determined using bisulfite sequencing polymerase chain reaction (PCR), as BSP method. The results showed that 3 (sites 3, 4 and 9) out of 10 CpG sites have strikingly methylation changes during the re-organization phase compared to the regeneration phase (from 2 hours to 168 hours, P=0.002, 0.048 and 0.018, respectively). Our results showed that methylation modification of CpGs in the Egf promoter region could be restored to the status before PH operation and changes of methylation didn’t affect Egf mRNA expression during the re-organization phase. PMID:26464832
Tran, Diem Hong; Shishido, Yuji; Chung, Seong Pil; Trinh, Huong Thi Thanh; Yorita, Kazuko; Sakai, Takashi; Fukui, Kiyoshi
2015-12-10
D-Amino acid oxidase (DAO) is a flavoenzyme that metabolizes D-amino acids and is expected to be a promising therapeutic target of schizophrenia and glioblastoma. The study of DNA-binding proteins has yielded much information in the regulation of transcription and other biological processes. However, proteins interacting with DAO gene have not been elucidated. Our assessment of human DAO promoter activity using luciferase reporter system indicated the 5'-flanking region of this gene (-4289 bp from transcription initiation site) has a regulatory sequence for gene expression, which is regulated by multi-protein complexes interacting with this region. By using pull-down assay coupled with two-dimensional gel electrophoresis and mass spectrometry, we identified six proteins binding to the 5'-flanking region of the human DAO gene (zinc finger C2HC domain-containing protein 1A; histidine-tRNA ligase, cytoplasmic; molybdenum cofactor biosynthesis protein; 60S ribosomal protein L37; calponin-1; calmodulin binding protein and heterogeneous nuclear ribonucleoprotein A2/B1). These preliminary results will contribute to the advance in the understanding of the potential factors associated with the regulatory mechanism of DAO expression. Copyright © 2015 Elsevier B.V. All rights reserved.
GBA manager: an online tool for querying low-complexity regions in proteins.
Bandyopadhyay, Nirmalya; Kahveci, Tamer
2010-01-01
Abstract We developed GBA Manager, an online software that facilitates the Graph-Based Algorithm (GBA) we proposed in our earlier work. GBA identifies the low-complexity regions (LCR) of protein sequences. GBA exploits a similarity matrix, such as BLOSUM62, to compute the complexity of the subsequences of the input protein sequence. It uses a graph-based algorithm to accurately compute the regions that have low complexities. GBA Manager is a user friendly web-service that enables online querying of protein sequences using GBA. In addition to querying capabilities of the existing GBA algorithm, GBA Manager computes the p-values of the LCR identified. The p-value gives an estimate of the possibility that the region appears by chance. GBA Manager presents the output in three different understandable formats. GBA Manager is freely accessible at http://bioinformatics.cise.ufl.edu/GBA/GBA.htm .
Butler, Nathaniel M; Hannapel, David J
2012-12-01
Polypyrimidine tract-binding (PTB) proteins are RNA-binding proteins that target specific RNAs for post-transcriptional processing by binding cytosine/uracil motifs. PTBs have established functions in a range of RNA processes including splicing, translation, stability and long-distance transport. Six PTB-like genes identified in potato have been grouped into two clades based on homology to other known plant PTBs. StPTB1 and StPTB6 are closely related to a PTB protein discovered in pumpkin, designated CmRBP50, and contain four canonical RNA-recognition motifs. CmRBP50 is expressed in phloem tissues and functions as the core protein of a phloem-mobile RNA/protein complex. Sequence from the potato genome database was used to clone the upstream sequence of these two PTB genes and analyzed to identify conserved cis-elements. The promoter of StPTB6 was enriched for regulatory elements for light and sucrose induction and defense. Upstream sequence of both PTB genes was fused to β-glucuronidase and monitored in transgenic potato lines. In whole plants, the StPTB1 promoter was most active in leaf veins and petioles, whereas StPTB6 was most active in leaf mesophyll. Both genes are active in new tubers and tuber sprouts. StPTB6 expression was induced in stems and stolon sections in response to sucrose and in leaves or petioles in response to light, heat, drought and mechanical wounding. These results show that CmRBP50-like genes of potato exhibit distinct expression patterns and respond to both developmental and environmental cues.
Ubiquitin-like protein UBL5 promotes the functional integrity of the Fanconi anemia pathway
DEFF Research Database (Denmark)
Oka, Yasuyoshi; Bekker-Jensen, Simon; Mailand, Niels
2015-01-01
in promoting the function of the Fanconi anemia (FA) pathway for repair of DNA interstrand crosslinks (ICLs), mediated by a specific interaction with the central FA pathway component FANCI. UBL5-deficient cells display spliceosome-independent reduction of FANCI protein stability, defective FANCI function...
Promoter-wide hypermethylation of the ribosomal RNA gene promoter in the suicide brain.
Directory of Open Access Journals (Sweden)
Patrick O McGowan
Full Text Available BACKGROUND: Alterations in gene expression in the suicide brain have been reported and for several genes DNA methylation as an epigenetic regulator is thought to play a role. rRNA genes, that encode ribosomal RNA, are the backbone of the protein synthesis machinery and levels of rRNA gene promoter methylation determine rRNA transcription. METHODOLOGY/PRINCIPAL FINDINGS: We test here by sodium bisulfite mapping of the rRNA promoter and quantitative real-time PCR of rRNA expression the hypothesis that epigenetic differences in critical loci in the brain are involved in the pathophysiology of suicide. Suicide subjects in this study were selected for a history of early childhood neglect/abuse, which is associated with decreased hippocampal volume and cognitive impairments. rRNA was significantly hypermethylated throughout the promoter and 5' regulatory region in the brain of suicide subjects, consistent with reduced rRNA expression in the hippocampus. This difference in rRNA methylation was not evident in the cerebellum and occurred in the absence of genome-wide changes in methylation, as assessed by nearest neighbor. CONCLUSIONS/SIGNIFICANCE: This is the first study to show aberrant regulation of the protein synthesis machinery in the suicide brain. The data implicate the epigenetic modulation of rRNA in the pathophysiology of suicide.
Governmental promotion of the Information Society in the Spanish Region of Valencia
Directory of Open Access Journals (Sweden)
Emilio Feliu-García, Ph.D.
2011-01-01
Full Text Available Regional spheres are considered essential in the governmental promotion of the Information Society at the international level. The regional initiatives in Spain aim to strengthen and complement the initiatives promoted at the national level. This article analyses ICT penetration in the Valencian Community from 1996 to 2008. The objective is to identify which of the actions carried out by the Valencian Regional Government have had a positive effect on its society.The methodology employed in this study is benchmarking. The selection of indicators is based on the policies evaluation model proposed in the Plan Avanza (Spain’s national Information Society strategy. Data were collected from official statistical sources (like Spain’s National Statistics Institute, INE. Three statistical tests were applied to verify the hypotheses (Pearson’s r2, Chi-square and Student’s t.The results indicate that it is not possible to affirm that the actions implemented by the Valencian Regional Government have had a more positive effect on its society than those implemented by the Spanish Central Government. A reason for this may lie in the specific objectives of the political strategy implemented by the Valencian Government, which has focused primarily on e-Government and does not include enough projects centred on the implementation of new technologies in the private sector. Moreover, the integration of new technologies in everyday life is placed in a second level of importance despite citizens are central actors in the international agenda.
Methods for promoting wound healing and muscle regeneration with the cell signaling protein nell1
Energy Technology Data Exchange (ETDEWEB)
Culiat, Cymbeline T.
2018-03-20
The present invention provides methods for promoting wound healing and treating muscle atrophy in a mammal in need. The method comprises administering to the mammal a Nell1 protein or a Nell1 nucleic acid molecule.
Methods for promoting wound healing and muscle regeneration with the cell signaling protein Nell1
Culiat, Cymbeline T [Oak Ridge, TN
2011-03-22
The present invention provides methods for promoting wound healing and treating muscle atrophy in a mammal in need. The method comprises administering to the mammal a Nell1 protein or a Nell1 nucleic acid molecule.
Santangelo, G M; Tornow, J; McLaughlin, C S; Moldave, K
1991-08-30
Two promoters (A7 and A23), isolated at random from the Saccharomyces cerevisiae genome by virtue of their capacity to activate transcription, are identical to known intergenic bidirectional promoters. Sequence analysis of the genomic DNA adjacent to the A7 promoter identified a split gene encoding ribosomal (r) protein L37, which is homologous to the tRNA-binding r-proteins, L35a (from human and rat) and L32 (from frogs).
Gene divergence of homeologous regions associated with a major seed protein content QTL in soybean
Directory of Open Access Journals (Sweden)
Puji eLestari
2013-06-01
Full Text Available Understanding several modes of duplication contributing on the present genome structure is getting an attention because it could be related to numerous agronomically important traits. Since soybean serves as a rich protein source for animal feeds and human consumption, breeding efforts in soybean have been directed toward enhancing seed protein content. The publicly available soybean sequences and its genomically featured elements facilitate comprehending of quantitative trait loci (QTL for seed protein content in concordance with homeologous regions in soybean genome. Although parts of chromosome (Chr 20 and Chr 10 showed synteny, QTLs for seed protein content present only on Chr 20. Using comparative analysis of gene contents in recently duplicated genomic regions harboring QTL for protein/oil content on Chrs 20 and 10, a total of 27 genes are present in duplicated regions of both chromosomes. Notably, 4 tandem duplicates of the putative homeobox protein 22 (HB22 are present only on Chr 20 and this Medicago truncatula homolog expressed in endosperm at seed filling stage. These tandem duplicates could contribute on the protein/oil QTL of Chr 20. Our study suggests that non-shared gene contents within the duplicated genomic regions might lead to absence/presence of QTL related to protein/oil content.
Gerasymenko, I M; Sheludko, Y V
2017-07-01
To exploit cold-inducible biochemical processes beneficial for foreign mRNA transcription, translation and storage, as well as protein product stability, during Agrobacterium-mediated transient expression. The efficiency of three different 5'-regulatory sequences to achieve transient expression of the GFP-based reporter gene under chilling conditions (6-8 °C since the 3rd day post inoculation) was compared. We studied the upstream sequences of a cold-inducible Arabidopsis thaliana cor15a gene, the core element of 35S CaMV promoter fused to the TMV omega 5'-UTR, and the synthetic promoter including the 35S core sequence and two binding sites for cold-inducible CBF transcription factors (P_DRE::35S). Cultivation of plants transiently expressing reporter gene under control of the synthetic P_DRE::35S promoter under chilling conditions since the 3rd dpi led to the reliably higher reporter accumulation as compared to the other tested regulatory sequences under chilling or greenhouse conditions. Reporter protein fluorescence under chilling conditions using P_DRE::35S reached 160% as compared to the transient expression in the greenhouse. Period of transient expression considerably extended if plants were cultivated at chilling temperature since the 3rd dpi: reporter protein fluorescence reached its maximum at the 20th dpi and was detected in leaves up to the 65th dpi. The enhanced protein accumulation at low temperature was accompanied by the prolonged period of corresponding mRNA accumulation. Transient expression under chilling conditions using synthetic cold-inducible promoter enhances target protein accumulation and may decrease greenhouse heating expenses.
Directory of Open Access Journals (Sweden)
Miralem Mrkonjic
Full Text Available We previously identified an association between a mismatch repair gene, MLH1, promoter SNP (rs1800734 and microsatellite unstable (MSI-H colorectal cancers (CRCs in two samples. The current study expanded on this finding as we explored the genetic basis of DNA methylation in this region of chromosome 3. We hypothesized that specific polymorphisms in the MLH1 gene region predispose it to DNA methylation, resulting in the loss of MLH1 gene expression, mismatch-repair function, and consequently to genome-wide microsatellite instability.We first tested our hypothesis in one sample from Ontario (901 cases, 1,097 controls and replicated major findings in two additional samples from Newfoundland and Labrador (479 cases, 336 controls and from Seattle (591 cases, 629 controls. Logistic regression was used to test for association between SNPs in the region of MLH1 and CRC, MSI-H CRC, MLH1 gene expression in CRC, and DNA methylation in CRC. The association between rs1800734 and MSI-H CRCs, previously reported in Ontario and Newfoundland, was replicated in the Seattle sample. Two additional SNPs, in strong linkage disequilibrium with rs1800734, showed strong associations with MLH1 promoter methylation, loss of MLH1 protein, and MSI-H CRC in all three samples. The logistic regression model of MSI-H CRC that included MLH1-promoter-methylation status and MLH1 immunohistochemistry status fit most parsimoniously in all three samples combined. When rs1800734 was added to this model, its effect was not statistically significant (P-value = 0.72 vs. 2.3×10(-4 when the SNP was examined alone.The observed association of rs1800734 with MSI-H CRC occurs through its effect on the MLH1 promoter methylation, MLH1 IHC deficiency, or both.
RNA-binding proteins ZFP36L1 and ZFP36L2 promote cell quiescence.
Galloway, Alison; Saveliev, Alexander; Łukasiak, Sebastian; Hodson, Daniel J; Bolland, Daniel; Balmanno, Kathryn; Ahlfors, Helena; Monzón-Casanova, Elisa; Mannurita, Sara Ciullini; Bell, Lewis S; Andrews, Simon; Díaz-Muñoz, Manuel D; Cook, Simon J; Corcoran, Anne; Turner, Martin
2016-04-22
Progression through the stages of lymphocyte development requires coordination of the cell cycle. Such coordination ensures genomic integrity while cells somatically rearrange their antigen receptor genes [in a process called variable-diversity-joining (VDJ) recombination] and, upon successful rearrangement, expands the pools of progenitor lymphocytes. Here we show that in developing B lymphocytes, the RNA-binding proteins (RBPs) ZFP36L1 and ZFP36L2 are critical for maintaining quiescence before precursor B cell receptor (pre-BCR) expression and for reestablishing quiescence after pre-BCR-induced expansion. These RBPs suppress an evolutionarily conserved posttranscriptional regulon consisting of messenger RNAs whose protein products cooperatively promote transition into the S phase of the cell cycle. This mechanism promotes VDJ recombination and effective selection of cells expressing immunoglobulin-μ at the pre-BCR checkpoint. Copyright © 2016, American Association for the Advancement of Science.
Fine-tuning of protein domain boundary by minimizing potential coiled coil regions
International Nuclear Information System (INIS)
Iwaya, Naoko; Goda, Natsuko; Unzai, Satoru; Fujiwara, Kenichiro; Tanaka, Toshiki; Tomii, Kentaro; Tochio, Hidehito; Shirakawa, Masahiro; Hiroaki, Hidekazu
2007-01-01
Structural determination of individual protein domains isolated from multidomain proteins is a common approach in the post-genomic era. Novel and thus uncharacterized domains liberated from intact proteins often self-associate due to incorrectly defined domain boundaries. Self-association results in missing signals, poor signal dispersion and a low signal-to-noise ratio in 1 H- 15 N HSQC spectra. We have found that a putative, non-canonical coiled coil region close to a domain boundary can cause transient hydrophobic self-association and monomer-dimer equilibrium in solution. Here we propose a rational method to predict putative coiled coil regions adjacent to the globular core domain using the program COILS. Except for the amino acid sequence, no preexisting knowledge concerning the domain is required. A small number of mutant proteins with a minimized coiled coil region have been rationally designed and tested. The engineered domains exhibit decreased self-association as assessed by 1 H- 15 N HSQC spectra with improved peak dispersion and sharper cross peaks. Two successful examples of isolating novel N-terminal domains from AAA-ATPases are demonstrated. Our method is useful for the experimental determination of domain boundaries suited for structural genomics studies
Fine-tuning of protein domain boundary by minimizing potential coiled coil regions.
Iwaya, Naoko; Goda, Natsuko; Unzai, Satoru; Fujiwara, Kenichiro; Tanaka, Toshiki; Tomii, Kentaro; Tochio, Hidehito; Shirakawa, Masahiro; Hiroaki, Hidekazu
2007-01-01
Structural determination of individual protein domains isolated from multidomain proteins is a common approach in the post-genomic era. Novel and thus uncharacterized domains liberated from intact proteins often self-associate due to incorrectly defined domain boundaries. Self-association results in missing signals, poor signal dispersion and a low signal-to-noise ratio in (1)H-(15)N HSQC spectra. We have found that a putative, non-canonical coiled coil region close to a domain boundary can cause transient hydrophobic self-association and monomer-dimer equilibrium in solution. Here we propose a rational method to predict putative coiled coil regions adjacent to the globular core domain using the program COILS. Except for the amino acid sequence, no preexisting knowledge concerning the domain is required. A small number of mutant proteins with a minimized coiled coil region have been rationally designed and tested. The engineered domains exhibit decreased self-association as assessed by (1)H-(15)N HSQC spectra with improved peak dispersion and sharper cross peaks. Two successful examples of isolating novel N-terminal domains from AAA-ATPases are demonstrated. Our method is useful for the experimental determination of domain boundaries suited for structural genomics studies.
2017-01-01
Plant- and animal-feeding insects secrete saliva inside their hosts, containing effectors, which may promote nutrient release and suppress immunity. Although for plant pathogenic microbes it is well established that effectors target host proteins to modulate host cell processes and promote disease, the host cell targets of herbivorous insects remain elusive. Here, we show that the existing plant pathogenic microbe effector paradigm can be extended to herbivorous insects in that effector-target interactions inside host cells modify critical host processes to promote plant susceptibility. We showed that the effector Mp1 from Myzus persicae associates with the host Vacuolar Protein Sorting Associated Protein52 (VPS52). Using natural variants, we provide a strong link between effector virulence activity and association with VPS52, and show that the association is highly specific to M. persicae-host interactions. Also, coexpression of Mp1, but not Mp1-like variants, specifically with host VPS52s resulted in effector relocalization to vesicle-like structures that associate with prevacuolar compartments. We show that high VPS52 levels negatively impact virulence, and that aphids are able to reduce VPS52 levels during infestation, indicating that VPS52 is an important virulence target. Our work is an important step forward in understanding, at the molecular level, how a major agricultural pest promotes susceptibility during infestation of crop plants. We give evidence that an herbivorous insect employs effectors that interact with host proteins as part of an effective virulence strategy, and that these effectors likely function in a species-specific manner. PMID:28100451
Directory of Open Access Journals (Sweden)
Emily A. Byrd
2017-11-01
Full Text Available Alphaviruses are members of a group of small enveloped RNA viruses that includes important human pathogens such as Chikungunya virus and the equine encephalitis viruses. The virus membrane is covered by a lattice composed of 80 spikes, each a trimer of heterodimers of the E2 and E1 transmembrane proteins. During virus endocytic entry, the E1 glycoprotein mediates the low-pH-dependent fusion of the virus membrane with the endosome membrane, thus initiating virus infection. While much is known about E1 structural rearrangements during membrane fusion, it is unclear how the E1/E2 dimer dissociates, a step required for the fusion reaction. A recent Alphavirus cryo-electron microscopy reconstruction revealed a previously unidentified D subdomain in the E2 ectodomain, close to the virus membrane. A loop within this region, here referred to as the D-loop, contains two highly conserved histidines, H348 and H352, which were hypothesized to play a role in dimer dissociation. We generated Semliki Forest virus mutants containing the single and double alanine substitutions H348A, H352A, and H348/352A. The three D-loop mutations caused a reduction in virus growth ranging from 1.6 to 2 log but did not significantly affect structural protein biosynthesis or transport, dimer stability, virus fusion, or specific infectivity. Instead, growth reduction was due to inhibition of a late stage of virus assembly at the plasma membrane. The virus particles that are produced show reduced thermostability compared to the wild type. We propose the E2 D-loop as a key region in establishing the E1-E2 contacts that drive glycoprotein lattice formation and promote Alphavirus budding from the plasma membrane.
High CpG island methylation ofp16 gene and loss of p16 protein ...
Indian Academy of Sciences (India)
Navya
employed to detect CpG island methylation in p16 promoter region and ... of Fallot;p16 gene;p16 protein;CpG islands;Methylation;Promoter regions ..... Our findings that p16 has a role in heart development is ... Asian Pac J Cancer Prev 15, 75-84. .... phenotype in colorectal cancer using a large population-based sample.
Liao, Wei-Ju; Tsao, Ku-Chi; Yang, Ruey-Bing
2016-03-01
SCUBE1 (S1), a secreted and membrane-bound glycoprotein, has a modular protein structure composed of an N-terminal signal peptide sequence followed by nine epidermal growth factor (EGF)-like repeats, a spacer region and three cysteine-rich (CR) motifs with multiple potential N-linked glycosylation sites, and one CUB domain at the C-terminus. Soluble S1 is a biomarker of platelet activation but an active participant of thrombosis via its adhesive EGF-like repeats, whereas its membrane-associated form acts as a bone morphogenetic protein (BMP) co-receptor in promoting BMP signal activity. However, the mechanism responsible for the membrane tethering and the biological importance of N-glycosylation of S1 remain largely unknown. In the present study, molecular mapping analysis identified a polycationic segment (amino acids 501-550) in the spacer region required for its membrane tethering via electrostatic interactions possibly with the anionic heparan sulfate proteoglycans. Furthermore, deglycosylation by peptide N-glycosidase F treatment revealed that N-glycans within the CR motif are essential for membrane recruitment through lectin-mediated surface retention. Injection of mRNA encoding zebrafish wild-type but not N-glycan-deficient scube1 restores the expression of haematopoietic and erythroid markers (scl and gata1) in scube1-knockdown embryos. We describe novel mechanisms in targeting S1 to the plasma membrane and demonstrate that N-glycans are required for S1 functions during primitive haematopoiesis in zebrafish. © 2016 Authors; published by Portland Press Limited.
RADX interacts with single-stranded DNA to promote replication fork stability
DEFF Research Database (Denmark)
Schubert, Lisa; Ho, Teresa; Hoffmann, Saskia
2017-01-01
Single-stranded DNA (ssDNA) regions form as an intermediate in many DNA-associated transactions. Multiple cellular proteins interact with ssDNA via the oligonucleotide/oligosaccharide-binding (OB) fold domain. The heterotrimeric, multi-OB fold domain-containing Replication Protein A (RPA) complex...... ssDNA-binding activities is critical for avoiding these defects. Our findings establish RADX as an important component of cellular pathways that promote DNA replication integrity under basal and stressful conditions by means of multiple ssDNA-binding proteins....
Dhar, Jayeeta; Barik, Sailen
2016-12-01
Pneumonia Virus of Mice (PVM) is the only virus that shares the Pneumovirus genus of the Paramyxoviridae family with Respiratory Syncytial Virus (RSV). A deadly mouse pathogen, PVM has the potential to serve as a robust animal model of RSV infection, since human RSV does not fully replicate the human pathology in mice. Like RSV, PVM also encodes two nonstructural proteins that have been implicated to suppress the IFN pathway, but surprisingly, they exhibit no sequence similarity with their RSV equivalents. The molecular mechanism of PVM NS function, therefore, remains unknown. Here, we show that recombinant PVM NS proteins degrade the mouse counterparts of the IFN pathway components. Proteasomal degradation appears to be mediated by ubiquitination promoted by PVM NS proteins. Interestingly, NS proteins of PVM lowered the levels of several ISG (IFN-stimulated gene) proteins as well. These results provide a molecular foundation for the mechanisms by which PVM efficiently subverts the IFN response of the murine cell. They also reveal that in spite of their high sequence dissimilarity, the two pneumoviral NS proteins are functionally and mechanistically similar.
A liver stress-endocrine nexus promotes metabolic integrity during dietary protein dilution
DEFF Research Database (Denmark)
Maida, Adriano; Zota, Annika; Sjøberg, Kim Anker
2016-01-01
of impaired glucose homeostasis independently of obesity and food intake. DPD-mediated metabolic inefficiency and improvement of glucose homeostasis were independent of uncoupling protein 1 (UCP1), but required expression of liver-derived fibroblast growth factor 21 (FGF21) in both lean and obese mice. FGF21...... expression and secretion as well as the associated metabolic remodeling induced by DPD also required induction of liver-integrated stress response-driven nuclear protein 1 (NUPR1). Insufficiency of select nonessential amino acids (NEAAs) was necessary and adequate for NUPR1 and subsequent FGF21 induction...... and secretion in hepatocytes in vitro and in vivo. Taken together, these data indicate that DPD promotes improved glucose homeostasis through an NEAA insufficiency-induced liver NUPR1/FGF21 axis....
Mechanism of protein splicing of the Pyrococcus abyssi lon protease intein
International Nuclear Information System (INIS)
O'Brien, Kevin M.; Schufreider, Ann K.; McGill, Melissa A.; O'Brien, Kathryn M.; Reitter, Julie N.; Mills, Kenneth V.
2010-01-01
Research highlights: → The Pyrococcus abyssi lon protease intein promotes efficient protein splicing. → Inteins with mutations that interfere with individual steps of splicing do not promote unproductive side reactions. → The intein splices with Lys in place of the highly conserved penultimate His. → The intein is flanked by a Gly-rich region at its C terminus that may increase the efficiency of the third step of splicing, Asn cyclization coupled to peptide bond cleavage. -- Abstract: Protein splicing is a post-translational process by which an intervening polypeptide, the intein, excises itself from the flanking polypeptides, the exteins, coupled to ligation of the exteins. The lon protease of Pyrococcus abyssi (Pab) is interrupted by an intein. When over-expressed as a fusion protein in Escherichia coli, the Pab lon protease intein can promote efficient protein splicing. Mutations that block individual steps of splicing generally do not lead to unproductive side reactions, suggesting that the intein tightly coordinates the splicing process. The intein can splice, although it has Lys in place of the highly conserved penultimate His, and mutants of the intein in the C-terminal region lead to the accumulation of stable branched-ester intermediate.
Blum, Walter; Pecze, László; Rodriguez, Janine Wörthmüller; Steinauer, Martine; Schwaller, Beat
2018-04-27
The calcium-binding protein calretinin (gene name: CALB2) is currently considered as the most sensitive and specific marker for the diagnosis of malignant mesothelioma (MM). MM is a very aggressive tumor strongly linked to asbestos exposure and with no existing cure so far. The mechanisms of calretinin regulation, as well as its distinct function in MM are still poorly understood. We searched for transcription factors binding to the CALB2 promoter and modulating calretinin expression. For this, DNA-binding assays followed by peptide shotgun-mass spectroscopy analyses were used. CALB2 promoter activity was assessed by dual-luciferase reporter assays. Furthermore, we analyzed the effects of CALB2 promoter-binding proteins by lentiviral-mediated overexpression or down-regulation of identified proteins in MM cells. The modulation of expression of such proteins by butyrate was determined by subsequent Western blot analysis. Immunohistochemical analysis of embryonic mouse lung tissue served to verify the simultaneous co-expression of calretinin and proteins interacting with the CALB2 promoter during early development. Finally, direct interactions of calretinin with target proteins were evidenced by co-immunoprecipitation experiments. Septin 7 was identified as a butyrate-dependent transcription factor binding to a CALB2 promoter region containing butyrate-responsive elements (BRE) resulting in decreased calretinin expression. Accordingly, septin 7 overexpression decreased calretinin expression levels in MM cells. The regulation was found to operate bi-directionally, i.e. calretinin overexpression also decreased septin 7 levels. During murine embryonic development calretinin and septin 7 were found to be co-expressed in embryonic mesenchyme and undifferentiated mesothelial cells. In MM cells, calretinin and septin 7 colocalized during cytokinesis in distinct regions of the cleavage furrow and in the midbody region of mitotic cells. Co-immunoprecipitation experiments
Disease-associated mutations disrupt functionally important regions of intrinsic protein disorder.
Directory of Open Access Journals (Sweden)
Vladimir Vacic
Full Text Available The effects of disease mutations on protein structure and function have been extensively investigated, and many predictors of the functional impact of single amino acid substitutions are publicly available. The majority of these predictors are based on protein structure and evolutionary conservation, following the assumption that disease mutations predominantly affect folded and conserved protein regions. However, the prevalence of the intrinsically disordered proteins (IDPs and regions (IDRs in the human proteome together with their lack of fixed structure and low sequence conservation raise a question about the impact of disease mutations in IDRs. Here, we investigate annotated missense disease mutations and show that 21.7% of them are located within such intrinsically disordered regions. We further demonstrate that 20% of disease mutations in IDRs cause local disorder-to-order transitions, which represents a 1.7-2.7 fold increase compared to annotated polymorphisms and neutral evolutionary substitutions, respectively. Secondary structure predictions show elevated rates of transition from helices and strands into loops and vice versa in the disease mutations dataset. Disease disorder-to-order mutations also influence predicted molecular recognition features (MoRFs more often than the control mutations. The repertoire of disorder-to-order transition mutations is limited, with five most frequent mutations (R→W, R→C, E→K, R→H, R→Q collectively accounting for 44% of all deleterious disorder-to-order transitions. As a proof of concept, we performed accelerated molecular dynamics simulations on a deleterious disorder-to-order transition mutation of tumor protein p63 and, in agreement with our predictions, observed an increased α-helical propensity of the region harboring the mutation. Our findings highlight the importance of mutations in IDRs and refine the traditional structure-centric view of disease mutations. The results of this study
CAGE-defined promoter regions of the genes implicated in Rett Syndrome
DEFF Research Database (Denmark)
Vitezic, Morana; Bertin, Nicolas; Andersson, Robin
2014-01-01
BACKGROUND: Mutations in three functionally diverse genes cause Rett Syndrome. Although the functions of Forkhead box G1 (FOXG1), Methyl CpG binding protein 2 (MECP2) and Cyclin-dependent kinase-like 5 (CDKL5) have been studied individually, not much is known about their relation to each other...... reveal the predominantly used transcription start sites (TSSs) for each gene including novel transcription start sites for FOXG1. We show that FOXG1 expression is poorly correlated with the expression of MECP2 and CDKL5. We identify promoter shapes for each TSS, the predicted location of enhancers...
Fanconi anemia core complex gene promoters harbor conserved transcription regulatory elements.
Meier, Daniel; Schindler, Detlev
2011-01-01
The Fanconi anemia (FA) gene family is a recent addition to the complex network of proteins that respond to and repair certain types of DNA damage in the human genome. Since little is known about the regulation of this novel group of genes at the DNA level, we characterized the promoters of the eight genes (FANCA, B, C, E, F, G, L and M) that compose the FA core complex. The promoters of these genes show the characteristic attributes of housekeeping genes, such as a high GC content and CpG islands, a lack of TATA boxes and a low conservation. The promoters functioned in a monodirectional way and were, in their most active regions, comparable in strength to the SV40 promoter in our reporter plasmids. They were also marked by a distinctive transcriptional start site (TSS). In the 5' region of each promoter, we identified a region that was able to negatively regulate the promoter activity in HeLa and HEK 293 cells in isolation. The central and 3' regions of the promoter sequences harbor binding sites for several common and rare transcription factors, including STAT, SMAD, E2F, AP1 and YY1, which indicates that there may be cross-connections to several established regulatory pathways. Electrophoretic mobility shift assays and siRNA experiments confirmed the shared regulatory responses between the prominent members of the TGF-β and JAK/STAT pathways and members of the FA core complex. Although the promoters are not well conserved, they share region and sequence specific regulatory motifs and transcription factor binding sites (TBFs), and we identified a bi-partite nature to these promoters. These results support a hypothesis based on the co-evolution of the FA core complex genes that was expanded to include their promoters.
Fanconi anemia core complex gene promoters harbor conserved transcription regulatory elements.
Directory of Open Access Journals (Sweden)
Daniel Meier
Full Text Available The Fanconi anemia (FA gene family is a recent addition to the complex network of proteins that respond to and repair certain types of DNA damage in the human genome. Since little is known about the regulation of this novel group of genes at the DNA level, we characterized the promoters of the eight genes (FANCA, B, C, E, F, G, L and M that compose the FA core complex. The promoters of these genes show the characteristic attributes of housekeeping genes, such as a high GC content and CpG islands, a lack of TATA boxes and a low conservation. The promoters functioned in a monodirectional way and were, in their most active regions, comparable in strength to the SV40 promoter in our reporter plasmids. They were also marked by a distinctive transcriptional start site (TSS. In the 5' region of each promoter, we identified a region that was able to negatively regulate the promoter activity in HeLa and HEK 293 cells in isolation. The central and 3' regions of the promoter sequences harbor binding sites for several common and rare transcription factors, including STAT, SMAD, E2F, AP1 and YY1, which indicates that there may be cross-connections to several established regulatory pathways. Electrophoretic mobility shift assays and siRNA experiments confirmed the shared regulatory responses between the prominent members of the TGF-β and JAK/STAT pathways and members of the FA core complex. Although the promoters are not well conserved, they share region and sequence specific regulatory motifs and transcription factor binding sites (TBFs, and we identified a bi-partite nature to these promoters. These results support a hypothesis based on the co-evolution of the FA core complex genes that was expanded to include their promoters.
Directory of Open Access Journals (Sweden)
Xian-E Peng
Full Text Available Liver fatty acid-binding protein (L-FABP, also known as fatty acid-binding protein 1 (FABP1, is a key regulator of hepatic lipid metabolism. Elevated FABP1 levels are associated with an increased risk of cardiovascular disease (CVD and metabolic syndromes. In this study, we examine the association of FABP1 gene promoter variants with serum FABP1 and lipid levels in a Chinese population. Four promoter single-nucleotide polymorphisms (SNPs of FABP1 gene were genotyped in a cross-sectional survey of healthy volunteers (n = 1,182 from Fuzhou city of China. Results showed that only the rs2919872 G>A variant was significantly associated with serum TG concentration(P = 0.032.Compared with the rs2919872 G allele, rs2919872 A allele contributed significantly to reduced serum TG concentration, and this allele dramatically decreased the FABP1 promoter activity(P < 0.05. The rs2919872 A allele carriers had considerably lower serum FABP1 levels than G allele carriers (P < 0.01. In the multivariable linear regression analysis, the rs2919872 A allele was negatively associated with serum FABP1 levels (β = -0.320, P = 0.003, while serum TG levels were positively associated with serum FABP1 levels (β = 0.487, P = 0.014. Our data suggest that compared with the rs2919872 G allele, the rs2919872 A allele reduces the transcriptional activity of FABP1 promoter, and thereby may link FABP1 gene variation to TG level in humans.
Directory of Open Access Journals (Sweden)
Dawid Krokowski
2017-12-01
Full Text Available Summary: GADD34, a stress-induced regulatory subunit of the phosphatase PP1, is known to function in hyperosmotic stress through its well-known role in the integrated stress response (ISR pathway. Adaptation to hyperosmotic stress is important for the health of corneal epithelial cells exposed to changes in extracellular osmolarity, with maladaptation leading to dry eye syndrome. This adaptation includes induction of SNAT2, an endoplasmic reticulum (ER-Golgi-processed protein, which helps to reverse the stress-induced loss of cell volume and promote homeostasis through amino acid uptake. Here, we show that GADD34 promotes the processing of proteins synthesized on the ER during hyperosmotic stress independent of its action in the ISR. We show that GADD34/PP1 phosphatase activity reverses hyperosmotic-stress-induced Golgi fragmentation and is important for cis- to trans-Golgi trafficking of SNAT2, thereby promoting SNAT2 plasma membrane localization and function. These results suggest that GADD34 is a protective molecule for ocular diseases such as dry eye syndrome. : Here, Krokowski et al. show that GADD34/PP1 protects the microtubule network, prevents Golgi fragmentation, and preserves protein trafficking independent of its action in the integrated stress response (ISR. In osmoadaptation, GADD34 facilitates trans-Golgi-mediated processing of the endoplasmic reticulum (ER-synthesized amino acid transporter SNAT2, which in turn increases amino acid uptake. Keywords: SNAT2, GADD34, hyperosmotic stress, amino acid transport, Golgi fragmentation, ISR
Barreales, Eva G; Vicente, Cláudia M; de Pedro, Antonio; Santos-Aberturas, Javier; Aparicio, Jesús F
2018-05-15
The biosynthesis of small-size polyene macrolides is ultimately controlled by a couple of transcriptional regulators that act in a hierarchical way. A Streptomyces antibiotic regulatory protein-large ATP-binding regulator of the LuxR family (SARP-LAL) regulator binds the promoter of a PAS-LuxR regulator-encoding gene and activates its transcription, and in turn, the gene product of the latter activates transcription from various promoters of the polyene gene cluster directly. The primary operator of PimR, the archetype of SARP-LAL regulators, contains three heptameric direct repeats separated by four-nucleotide spacers, but the regulator can also bind a secondary operator with only two direct repeats separated by a 3-nucleotide spacer, both located in the promoter region of its unique target gene, pimM A similar arrangement of operators has been identified for PimR counterparts encoded by gene clusters for different antifungal secondary metabolites, including not only polyene macrolides but peptidyl nucleosides, phoslactomycins, or cycloheximide. Here, we used promoter engineering and quantitative transcriptional analyses to determine the contributions of the different heptameric repeats to transcriptional activation and final polyene production. Optimized promoters have thus been developed. Deletion studies and electrophoretic mobility assays were used for the definition of DNA-binding boxes formed by 22-nucleotide sequences comprising two conserved heptameric direct repeats separated by four-nucleotide less conserved spacers. The cooperative binding of PimR SARP appears to be the mechanism involved in the binding of regulator monomers to operators, and at least two protein monomers are required for efficient binding. IMPORTANCE Here, we have shown that a modulation of the production of the antifungal pimaricin in Streptomyces natalensis can be accomplished via promoter engineering of the PAS-LuxR transcriptional activator pimM The expression of this gene is
Puspita, Indun Dewi; Kitagawa, Wataru; Kamagata, Yoichi; Tanaka, Michiko; Nakatsu, Cindy H
2015-01-01
Resuscitation-promoting factor (Rpf) is a protein that has been found in a number of different Actinobacteria species and has been shown to promote the growth of active cells and resuscitate dormant (non-dividing) cells. We previously reported the biological activity of an Rpf protein in Tomitella biformata AHU 1821(T), an Actinobacteria isolated from a permafrost ice wedge. This protein is excreted outside the cell; however, few studies have investigated its contribution in environmental samples to the growth or resuscitation of bacteria other than the original host. Therefore, the aim of the present study was to determine whether Rpf from T. biformata impacted the cultivation of other bacteria from the permafrost ice wedge from which it was originally isolated. All experiments used recombinant Rpf proteins produced using a Rhodococcus erythropolis expression system. Dilutions of melted surface sterilized ice wedge samples mixed with different doses of the purified recombinant Rpf (rRpf) protein indicated that the highest concentration tested, 1250 pM, had a significantly (p permafrost sediments. The results of the present study demonstrated that rRpf not only promoted the growth of T. biformata from which it was isolated, but also enhanced colony formation by another Actinobacteria in an environmental sample.
International Nuclear Information System (INIS)
Masmudur Rahman, Md.; Shaila, M.S.; Gopinathan, Karumathil P.
2003-01-01
Recombinant Bombyx mori nucleopolyhedroviruses (BmNPV) displaying the immunodominant ectodomains of fusion glycoprotein (F) of Peste des petitis ruminants virus (PPRV) and the hemagglutinin protein (H) of Rinderpest virus (RPV), on the budded virions as well as the surface of the infected host cells have been constructed. The F and H protein sequences were inserted in-frame within the amino-terminal region of BmNPV envelope glycoprotein GP64 expressing under the strong viral polyhedrin (polh) promoter. We improved the recombinant virus selection in BmNPV by incorporating the green fluorescent protein gene (gfp) as selection marker under a separate promoter within the transfer cassette harboring the desired genes. Following infection of the insect larvae or the host-derived BmN cells with these recombinant BmNPVs, the expressed GP64 fusion proteins were displayed on the host cell surface and the budded virions. The antigenic epitopes of the recombinant proteins were properly displayed and the recombinant virus particles induced immune response in mice against PPRV or RPV
High genetic diversity in the coat protein and 3' untranslated regions
Indian Academy of Sciences (India)
The 3′ terminal region consisting of the coat protein (CP) coding sequence and 3′ untranslated region (3′UTR) was cloned and sequenced from seven isolates. Sequence comparisons revealed considerable genetic diversity among the isolates in their CP and 3′UTR, making CdMV one of the highly variable members ...
Tumor promoter induced membrane-bound protein kinase C - its influence on hematogenous metastasis
International Nuclear Information System (INIS)
Gopalakrishna, R.; Barsky, S.H.
1987-01-01
A correlation between the amount of membrane-bound detergent-extractable protein kinase C activity in various B16 melanoma sublines (F10, F1, BL6) and their lung metastasizing abilities following intravenous injection was found. The F10 subline which exhibits higher metastasizing ability was found to have higher membrane-bound protein kinase C compared to the lower metastasizing subline, F1. Treatment of F1 cells with 100 nM 12-0 tetradecanoylphorbol-13-acetate (TPA) for 1h resulted in 90% decrease in protein kinase C activity in the cytosol with a concommitent increase in membrane-bound activity. These TPA-treated cells when injected intravenously in C57BL/6 mice produced 6-fold increase in pulmonary metastases compared to untreated F1 cells. However, biologically inactive analogues 4 α-phorbol 12,13-didecanoate and phorbol 13-acetate had no effect on either membrane-bound protein kinase C activity or pulmonary metastases. Treating F1 cells with the second-stage tumor promoter, mezerin, resulted in increase in both membrane association of protein kinase C and also lung metastases. Thus, these results strongly suggests that membrane associated protein kinase C activity influences hematogenous metastasis of these melanoma cells
Alam, Tanvir; Medvedeva, Yulia A.; Jia, Hui; Brown, James B.; Lipovich, Leonard; Bajic, Vladimir B.
2014-01-01
raise the possibility that, given the historical reliance on protein-coding gene catalogs to define the chromatin states of active promoters, a revision of these chromatin signature profiles to incorporate expressed lncRNA genes is warranted
Embryogenesis-promoting factors in rat serum.
Katoh, M; Kimura, R; Shoji, R
1998-06-15
Regarding whole rat embryo cultures in vitro, rat serum as a culture medium is known to support the normal growth of rat embryos in the organogenesis phase. The purpose of the present study was to isolate the embryogenesis-promoting factors from rat serum as a first step in the development of a defined serum-free medium for a whole embryo culture system. Pooled rat serum after heat inactivation was fractionated into three major peaks (frA, containing a region of void volume, frB, and frC) by gel filtration. The 9.5-day rat embryos that were cultivated for 48 hr in essential salt medium containing frB (with a molecular size range of 100-500 kDa) revealed normal growth. Three proteins (27 kDa, 76 kDa, and 190 kDa) that had the embryogenesis-promoting effects were isolated from 3-hr delayed centrifuged rat serum by the ion exchange chromatography. The 76-kDa protein was found to be rat transferrin by immunoblotting. The 27-kDa protein was identified as apo-AI (the major apoprotein of high-density lipoprotein) by immunoblotting. High-density lipoprotein obtained from pooled rat serum by a NaBr density gradient ultracentrifugation was found to have a positive effect on embryogenesis. The 10-kDa protein was also identified as alpha 1-inhibitor 3 by immunoblotting. In addition, the embryogenesis-promoting effect of the fraction containing 27-kDa and 190-kDa proteins declined within a short period of storage at -20 degrees C. This decrease was countered by supplementing its fraction (D-2) with albumin isolated from rat serum. These results in the present study suggest that transferrin, high-density lipoprotein, and alpha 1-inhibitor 3 in rat serum may be embryogenesis-promoting factors, and that albumin appeared to play a role in the embryogenesis of rat embryos in whole embryo cultures.
Cytosine deletion at AP2-box region of HSP70 promoter and its ...
Indian Academy of Sciences (India)
Cytosine deletion at AP2-box region of HSP70 promoter and its influence on semen quality traits in crossbred bulls ... Laboratory, ICAR-Central Institute for Research on Cattle, Meerut 250 001, India; School of Atmospheric Stress Management, ICAR-National Institute of Abiotic Stress Management, Baramati 413 115, India ...
Directory of Open Access Journals (Sweden)
Nelli Babayan
2011-12-01
Full Text Available Building on the model of the enlargement policy, the European Union (EU designed the European Neighbourhood Policy and the Eastern Partnership to further promote its norms and principles. One of the goals of its new policies has been to foster regional cooperation among partner countries and their neighbours. This article specifies the EU’s framework for promoting regional cooperation through the aforementioned policies and discusses its potential impact on the example of the South Caucasus republics of Armenia, Azerbaijan, and Georgia. The South Caucasus has not only been an arena of intraregional conflicts, but has also often been troubled by disputes between its neighbours. This article argues that, due to a lack of proactive and consistent engagement, the EU’s framework risks leaving regional conflicts in the current state of stagnation and without advancement in regional cooperation.
Features of cryptic promoters and their varied reliance on bromodomain-containing factors.
Directory of Open Access Journals (Sweden)
Samantha G Pattenden
Full Text Available The Set2-Rpd3S pathway is important for the control of transcription memory. Mutation of components of this pathway results in cryptic transcription initiation within the coding region of approximately 30% of yeast genes. Specifically, deletion of the Set2 histone methyltransferase or Rco1, a component of the Rpd3S histone deacetylase complex leads to hyperacetylation of certain open reading frames (ORFs. We used this mutant as a system to study the role of histone modifications and co-activator recruitment in preinitiation complex (PIC formation. Specifically, we looked at the dependence of promoters on the bromodomain-containing RSC complex and the Bdf1 protein. We found that the dependence of cryptic promoters for these proteins varied. Overall, our data indicate that cryptic promoters are independently regulated, and their activation is dependent on factors that govern gene activation at canonical promoters.
Expression analysis of four flower-specific promoters of Brassica spp ...
African Journals Online (AJOL)
The 5'-flanking region of ca. 1200 bp upstream of the translation start site (TSS) of a putative cell wall protein gene was cloned from Brassica campestris, B. chinensis, B. napus and B. oleracea, and transferred to tobacco via Agrobacterium-mediation after fused to promoter-less beta-glucuronidase (GUS) reporter gene.
Definition of IgG- and albumin-binding regions of streptococcal protein G.
Akerström, B; Nielsen, E; Björck, L
1987-10-05
Protein G, the immunoglobin G-binding surface protein of group C and G streptococci, also binds serum albumin. The albumin-binding site on protein G is distinct from the immunoglobulin G-binding site. By mild acid hydrolysis of the papain-liberated protein G fragment (35 kDa), a 28-kDa fragment was produced which retained full immunoglobulin G-binding activity (determined by Scatchard plotting) but had lost all albumin-binding capacity. A protein G (65 kDa), isolated after cloning and expression of the protein G gene in Escherichia coli, had comparable affinity to immunoglobulin G (5-10 X 10(10)M-1), but much higher affinity to albumin than the 35- and 28-kDa protein G fragments (31, 2.6, and 0 X 10(9)M-1, respectively). The amino-terminal amino acid sequences of the 65-, 35-, and 28-kDa fragments allowed us to exactly locate the three fragments in an overall sequence map of protein G, based on the partial gene sequences published by Guss et al. (Guss, B., Eliasson, M., Olsson, A., Uhlen, M., Frej, A.-K., Jörnvall, H., Flock, J.-I., and Lindberg, M. (1986) EMBO J. 5, 1567-1575) and Fahnestock et al. (Fahnestock, S. R., Alexander, P., Nagle, J., and Filpula, D. (1986) J. Bacteriol. 167, 870-880). In this map could then be deduced the location of three homologous albumin-binding regions and three homologous immunoglobulin G-binding regions.
Region-specific protein misfolding cyclic amplification reproduces brain tropism of prion strains.
Privat, Nicolas; Levavasseur, Etienne; Yildirim, Serfildan; Hannaoui, Samia; Brandel, Jean-Philippe; Laplanche, Jean-Louis; Béringue, Vincent; Seilhean, Danielle; Haïk, Stéphane
2017-10-06
Human prion diseases such as Creutzfeldt-Jakob disease are transmissible brain proteinopathies, characterized by the accumulation of a misfolded isoform of the host cellular prion protein (PrP) in the brain. According to the prion model, prions are defined as proteinaceous infectious particles composed solely of this abnormal isoform of PrP (PrP Sc ). Even in the absence of genetic material, various prion strains can be propagated in experimental models. They can be distinguished by the pattern of disease they produce and especially by the localization of PrP Sc deposits within the brain and the spongiform lesions they induce. The mechanisms involved in this strain-specific targeting of distinct brain regions still are a fundamental, unresolved question in prion research. To address this question, we exploited a prion conversion in vitro assay, protein misfolding cyclic amplification (PMCA), by using experimental scrapie and human prion strains as seeds and specific brain regions from mice and humans as substrates. We show here that region-specific PMCA in part reproduces the specific brain targeting observed in experimental, acquired, and sporadic Creutzfeldt-Jakob diseases. Furthermore, we provide evidence that, in addition to cellular prion protein, other region- and species-specific molecular factors influence the strain-dependent prion conversion process. This important step toward understanding prion strain propagation in the human brain may impact research on the molecular factors involved in protein misfolding and the development of ultrasensitive methods for diagnosing prion disease. © 2017 by The American Society for Biochemistry and Molecular Biology, Inc.
Directory of Open Access Journals (Sweden)
Min Ju Yi
2017-03-01
Full Text Available PurposeThe most common single nucleotide polymorphism in the IGFBP3 promoter region occurs at position -202. This polymorphic variation occurs frequently and may influence growth hormone responsiveness and somatic growth. However, the effects of IGFBP3 promoter polymorphism on growth in children are unknown.MethodsRestriction fragment length polymorphism-based genotyping of the -202 single nucleotide polymorphism was performed in 146 Korean girls aged between 15 and 16 years, who were selected randomly from the Seoul School Health Promotion Center. The participants were divided into 3 groups (tall, medium, and short according to the height percentile established from normal reference values for Korean children. The serum levels of insulin-like growth factor I (IGF-I and IGF-binding protein-3 (IGFBP-3 were then compared according to genotype.ResultsThe genotype distribution in the participants was 79 AA (54.1%, 60 AC (41.1%, and 7 CC (4.8%. The C allele frequency at the -202 IGFBP3 position was 25.4% in this group. The mean serum IGFBP-3 concentration in girls with the AA genotype was higher than that in girls with the AC genotype in the medium (P=0.047 and short (P=0.035 groups, respectively. There was no difference in the IGF-I to IGFBP-3 molar ratio between the AA and AC genotype groups (P=0.161.ConclusionIn conclusion, the -202 polymorphism in the IGFBP3 promoter region is assumed to affect the serum concentration of IGFBP-3 in children as well as in adults. However, it is unclear whether this affects physical development according to the concentration of IGFBP-3.
Guinane, Caitriona M; Piper, Clare; Draper, Lorraine A; O'Connor, Paula M; Hill, Colin; Ross, R Paul; Cotter, Paul D
2015-11-01
Bacteriocin production is regarded as a desirable probiotic trait that aids in colonization and persistence in the gastrointestinal tract (GIT). Strains of Lactobacillus salivarius, a species associated with the GIT, are regarded as promising probiotic candidates and have a number of associated bacteriocins documented to date. These include multiple class IIb bacteriocins (salivaricin T, salivaricin P, and ABP-118) and the class IId bacteriocin bactofencin A, which show activity against medically important pathogens. However, the production of a bacteriocin in laboratory media does not ensure production under stressful environmental conditions, such as those encountered within the GIT. To allow this issue to be addressed, the promoter regions located upstream of the structural genes encoding the L. salivarius bacteriocins mentioned above were fused to a number of reporter proteins (green fluorescent protein [GFP], red fluorescent protein [RFP], and luciferase [Lux]). Of these, only transcriptional fusions to GFP generated signals of sufficient strength to enable the study of promoter activity in L. salivarius. While analysis of the class IIb bacteriocin promoter regions indicated relatively weak GFP expression, assessment of the promoter of the antistaphylococcal bacteriocin bactofencin A revealed a strong promoter that is most active in the absence of the antimicrobial peptide and is positively induced in the presence of mild environmental stresses, including simulated gastric fluid. Taken together, these data provide information on factors that influence bacteriocin production, which will assist in the development of strategies to optimize in vivo and in vitro production of these antimicrobials. Copyright © 2015, American Society for Microbiology. All Rights Reserved.
Directory of Open Access Journals (Sweden)
Popović Svetlana S.
2011-01-01
Full Text Available Membrane filtration has become one of the major technologies in the food industry. It is widely applied in the dairy industry, and it is mostly used for the concentration and fractionation of milk proteins and for the whey processing. Of all pressure driven membrane processes, ultrafiltration is the most widely used. The major disadvantage of pressure driven membrane processes is severe fouling of membrane during filtration particularly when the fluids containing proteins are processed. Fouling with proteins is complex phenomenon because it occurs at the membrane surface as well as in the pores of membrane, and depends on the operating conditions and on the interactions of proteins and membrane material. In order to reduce fouling of the membrane different techniques have been developed, and one of them relies on the changing of the hydrodynamic conditions in the membrane or module. In this study, influence of twisted tape turbulence promoters on the fouling reduction in cross-flow microfiltration of skim milk was investigated. Twisted tapes with tree characteristic ratios of helix element length to the tape diameter (aspect ratio were studied. It was shown that twisted tapes with different aspect ratios reduce fouling of membrane by a factor of three or more. The presence of twisted tape induces changes in the flow patterns from straight to helicoidally thus producing turbulence flow at the lower cross-flow rates. Turbulence intensification prevents accumulation of proteins at membrane surface enabling reduction in reversible fouling what results in the reduction of overall membrane fouling. The best performance was achieved using a twisted tape with the lowest aspect ratio of 1.0. This promoter reduces fouling seven times at low transmembrane pressure and low cross-flow velocity. The twisted tape with aspect ratio 1.0 induces the most intensive turbulence, the longest helicoidal flow path, and appearance of vortices near the membrane surfaces
International Nuclear Information System (INIS)
Kiehl, Anita; Huang, Lili; Franchi, David; Anders, David G.
2003-01-01
The human cytomegalovirus (HCMV) UL57 gene lies adjacent to HCMV oriLyt, from which it is separated by an organizationally conserved, mostly noncoding region that is thought to both regulate UL57 expression and activate oriLyt function. However, the UL57 promoter has not been studied. We determined the 5' ends of UL57 transcripts toward an understanding of the potential relationship between UL57 expression and oriLyt activation. The results presented here identified three distinct 5' ends spread over 800 bp, at nt 90302, 90530, and 91138; use of these sites exhibited differential sensitivity to phosphonoformic acid treatment. Interestingly, a 10-kb UL57 transcript accumulated in cycloheximide-treated infected cells, even though other early transcripts were not detectable. However, the 10-kb transcript did not accumulate in cells treated with the more stringent translation inhibitor anisomycin. Consistent with the notion that the identified 5' ends arise from distinct transcription start sites, the sequences upstream of sites I and II functioned as promoters responsive to HCMV infection in transient assays. However, the origin-proximal promoter region III required downstream sequences for transcriptional activity. Mutation of candidate core promoter elements suggested that promoter III is regulated by an initiator region (Inr) and a downstream promoter element. Finally, a 42-bp sequence containing the candidate Inr activated a minimal oriLyt core construct in transient replication assays. Thus, these studies showed that a large, complex promoter region with novel features controls UL57 expression, and identified a sequence that regulates both UL57 transcription and oriLyt activation
Ndika, Joseph D T; Lusink, Vera; Beaubrun, Claudine; Kanhai, Warsha; Martinez-Munoz, Cristina; Jakobs, Cornelis; Salomons, Gajja S
2014-01-10
Interconversion between phosphocreatine and creatine, catalyzed by creatine kinase is crucial in the supply of ATP to tissues with high energy demand. Creatine's importance has been established by its use as an ergogenic aid in sport, as well as the development of intellectual disability in patients with congenital creatine deficiency. Creatine biosynthesis is complemented by dietary creatine uptake. Intracellular transport of creatine is carried out by a creatine transporter protein (CT1/CRT/CRTR) encoded by the SLC6A8 gene. Most tissues express this gene, with highest levels detected in skeletal muscle and kidney. There are lower levels of the gene detected in colon, brain, heart, testis and prostate. The mechanism(s) by which this regulation occurs is still poorly understood. A duplicated unprocessed pseudogene of SLC6A8-SLC6A10P has been mapped to chromosome 16p11.2 (contains the entire SLC6A8 gene, plus 2293 bp of 5'flanking sequence and its entire 3'UTR). Expression of SLC6A10P has so far only been shown in human testis and brain. It is still unclear as to what is the function of SLC6A10P. In a patient with autism, a chromosomal breakpoint that intersects the 5'flanking region of SLC6A10P was identified; suggesting that SLC6A10P is a non-coding RNA involved in autism. Our aim was to investigate the presence of cis-acting factor(s) that regulate expression of the creatine transporter, as well as to determine if these factors are functionally conserved upstream of the creatine transporter pseudogene. Via gene-specific PCR, cloning and functional luciferase assays we identified a 1104 bp sequence proximal to the mRNA start site of the SLC6A8 gene with promoter activity in five cell types. The corresponding 5'flanking sequence (1050 bp) on the pseudogene also had promoter activity in all 5 cell lines. Surprisingly the pseudogene promoter was stronger than that of its parent gene in 4 of the cell lines tested. To the best of our knowledge, this is the first
Tian, Ying; Wang, Genjie; Hu, Qingzhu; Xiao, Xichun; Chen, Shuxia
2018-04-01
The AML1/ETO onco-fusion protein is crucial for the genesis of t(8;21) acute myeloid leukemia (AML) and is well documented as a transcriptional repressor through dominant-negative effect. However, little is known about the transactivation mechanism of AML1/ETO. Through large cohort of patient's expression level data analysis and a series of experimental validation, we report here that AML1/ETO transactivates c-KIT expression through directly binding to and mediating the long-range interaction between the promoter and intronic enhancer regions of c-KIT. Gene expression analyses verify that c-KIT expression is significantly high in t(8;21) AML. Further ChIP-seq analysis and motif scanning identify two regulatory regions located in the promoter and intronic enhancer region of c-KIT, respectively. Both regions are enriched by co-factors of AML1/ETO, such as AML1, CEBPe, c-Jun, and c-Fos. Further luciferase reporter assays show that AML1/ETO trans-activates c-KIT promoter activity through directly recognizing the AML1 motif and the co-existence of co-factors. The induction of c-KIT promoter activity is reinforced with the existence of intronic enhancer region. Furthermore, ChIP-3C-qPCR assays verify that AML1/ETO mediates the formation of DNA-looping between the c-KIT promoter and intronic enhancer region through the long-range interaction. Collectively, our data uncover a novel transcriptional activity mechanism of AML1/ETO and enrich our knowledge of the onco-fusion protein mediated transcription regulation. © 2017 Wiley Periodicals, Inc.
The Disordered C-Terminus of Yeast Hsf1 Contains a Cryptic Low-Complexity Amyloidogenic Region
Directory of Open Access Journals (Sweden)
Jordi Pujols
2018-05-01
Full Text Available Response mechanisms to external stress rely on networks of proteins able to activate specific signaling pathways to ensure the maintenance of cell proteostasis. Many of the proteins mediating this kind of response contain intrinsically disordered regions, which lack a defined structure, but still are able to interact with a wide range of clients that modulate the protein function. Some of these interactions are mediated by specific short sequences embedded in the longer disordered regions. Because the physicochemical properties that promote functional and abnormal interactions are similar, it has been shown that, in globular proteins, aggregation-prone and binding regions tend to overlap. It could be that the same principle applies for disordered protein regions. In this context, we show here that a predicted low-complexity interacting region in the disordered C-terminus of the stress response master regulator heat shock factor 1 (Hsf1 protein corresponds to a cryptic amyloid region able to self-assemble into fibrillary structures resembling those found in neurodegenerative disorders.
The Disordered C-Terminus of Yeast Hsf1 Contains a Cryptic Low-Complexity Amyloidogenic Region.
Pujols, Jordi; Santos, Jaime; Pallarès, Irantzu; Ventura, Salvador
2018-05-06
Response mechanisms to external stress rely on networks of proteins able to activate specific signaling pathways to ensure the maintenance of cell proteostasis. Many of the proteins mediating this kind of response contain intrinsically disordered regions, which lack a defined structure, but still are able to interact with a wide range of clients that modulate the protein function. Some of these interactions are mediated by specific short sequences embedded in the longer disordered regions. Because the physicochemical properties that promote functional and abnormal interactions are similar, it has been shown that, in globular proteins, aggregation-prone and binding regions tend to overlap. It could be that the same principle applies for disordered protein regions. In this context, we show here that a predicted low-complexity interacting region in the disordered C-terminus of the stress response master regulator heat shock factor 1 (Hsf1) protein corresponds to a cryptic amyloid region able to self-assemble into fibrillary structures resembling those found in neurodegenerative disorders.
DOF-binding sites additively contribute to guard cell-specificity of AtMYB60 promoter
Directory of Open Access Journals (Sweden)
Cominelli Eleonora
2011-11-01
Full Text Available Abstract Background We previously demonstrated that the Arabidopsis thaliana AtMYB60 protein is an R2R3MYB transcription factor required for stomatal opening. AtMYB60 is specifically expressed in guard cells and down-regulated at the transcriptional levels by the phytohormone ABA. Results To investigate the molecular mechanisms governing AtMYB60 expression, its promoter was dissected through deletion and mutagenesis analyses. By studying different versions of AtMYB60 promoter::GUS reporter fusions in transgenic plants we were able to demonstrate a modular organization for the AtMYB60 promoter. Particularly we defined: a minimal promoter sufficient to confer guard cell-specific activity to the reporter gene; the distinct roles of different DOF-binding sites organised in a cluster in the minimal promoter in determining guard cell-specific expression; the promoter regions responsible for the enhancement of activity in guard cells; a promoter region responsible for the negative transcriptional regulation by ABA. Moreover from the analysis of single and multiple mutants we could rule out the involvement of a group of DOF proteins, known as CDFs, already characterised for their involvement in flowering time, in the regulation of AtMYB60 expression. Conclusions These findings shed light on the regulation of gene expression in guard cells and provide new promoter modules as useful tools for manipulating gene expression in guard cells, both for physiological studies and future biotechnological applications.
DEFF Research Database (Denmark)
Bjørbaek, C; Echwald, Søren Morgenthaler; Hubricht, P
1994-01-01
To examine the hypothesis that variants in the regulatory or coding regions of the glycogen synthase (GS) and insulin-responsive glucose transporter (GLUT4) genes contribute to insulin-resistant glucose processing of muscle from non-insulin-dependent diabetes mellitus (NIDDM) patients, promoter...... volunteers. By applying inverse polymerase chain reaction and direct DNA sequencing, 532 base pairs (bp) of the GS promoter were identified and the transcriptional start site determined by primer extension. SSCP scanning of the promoter region detected five single nucleotide substitutions, positioned at 42......'-untranslated region, and the coding region of the GLUT4 gene showed four polymorphisms, all single nucleotide substitutions, positioned at -581, 1, 30, and 582. None of the three changes in the regulatory region of the gene had any major influence on expression of the GLUT4 gene in muscle. The variant at 582...
Directory of Open Access Journals (Sweden)
Dorrestein Pieter C
2009-12-01
Full Text Available Abstract Background The marine cyanobacterium Lyngbya majuscula is a prolific producer of bioactive secondary metabolites. Although biosynthetic gene clusters encoding several of these compounds have been identified, little is known about how these clusters of genes are transcribed or regulated, and techniques targeting genetic manipulation in Lyngbya strains have not yet been developed. We conducted transcriptional analyses of the jamaicamide gene cluster from a Jamaican strain of Lyngbya majuscula, and isolated proteins that could be involved in jamaicamide regulation. Results An unusually long untranslated leader region of approximately 840 bp is located between the jamaicamide transcription start site (TSS and gene cluster start codon. All of the intergenic regions between the pathway ORFs were transcribed into RNA in RT-PCR experiments; however, a promoter prediction program indicated the possible presence of promoters in multiple intergenic regions. Because the functionality of these promoters could not be verified in vivo, we used a reporter gene assay in E. coli to show that several of these intergenic regions, as well as the primary promoter preceding the TSS, are capable of driving β-galactosidase production. A protein pulldown assay was also used to isolate proteins that may regulate the jamaicamide pathway. Pulldown experiments using the intergenic region upstream of jamA as a DNA probe isolated two proteins that were identified by LC-MS/MS. By BLAST analysis, one of these had close sequence identity to a regulatory protein in another cyanobacterial species. Protein comparisons suggest a possible correlation between secondary metabolism regulation and light dependent complementary chromatic adaptation. Electromobility shift assays were used to evaluate binding of the recombinant proteins to the jamaicamide promoter region. Conclusion Insights into natural product regulation in cyanobacteria are of significant value to drug discovery
Yes-Associated Protein (YAP) Promotes the Nuclear Import of p73
International Nuclear Information System (INIS)
Zhang Heng; Wu Shengnan
2011-01-01
p73 has been identified as a structural and functional homolog of the tumor suppressor p53. However, mechanisms that regulate the localization of p73 have not been fully clarified. The Yes-associated protein (YAP) is a transcriptional coactivator. As a transcriptional coactivator, YAP needs to bind transcription factors to stimulate gene expression. p73 is a reported YAP target transcription factors and YAP has been shown to positively regulate p73 in promoting apoptosis. Previous studies show that p73 interacts with YAP through its PPPY motif, and increases p73 transactivation of apoptotic genes. In this study, we focused on YAP's regulation of the localization of p73. After transient transfection into Rat pheochromocytoma (PC12) cells and Human embryonic kidney 293T cells with GFP-YAP and/or YFP-p73, and incubated for 24 hours expression. p73 was fused to YFP to allow the examination of its subcellular localization. When expressed alone, YFP-p73 was distributed throughout the cell. When coexpressed with YAP, nuclear accumulation of YFP-p73 became evident. We quantitated the effect of YAP on the redistribution of YFP-p73 by counting cells with nuclear-only YFP signal. We found that YAP can influence the subcellular distribution of p73. Altogether, coexpression with YAP affected the subcellular distribution of the p73 protein. Our studies attribute a central role to YAP in regulating p73 accumulation and YAP, at least in part, might promote the nuclear import of p73.
c-Myc activates BRCA1 gene expression through distal promoter elements in breast cancer cells
International Nuclear Information System (INIS)
Chen, Yinghua; Xu, Jinhua; Borowicz, Stanley; Collins, Cindy; Huo, Dezheng; Olopade, Olufunmilayo I
2011-01-01
The BRCA1 gene plays an important role in the maintenance of genomic stability. BRCA1 inactivation contributes to breast cancer tumorigenesis. An increasing number of transcription factors have been shown to regulate BRCA1 expression. c-Myc can act as a transcriptional activator, regulating up to 15% of all genes in the human genome and results from a high throughput screen suggest that BRCA1 is one of its targets. In this report, we used cultured breast cancer cells to examine the mechanisms of transcriptional activation of BRCA1 by c-Myc. c-Myc was depleted using c-Myc-specific siRNAs in cultured breast cancer cells. BRCA1 mRNA expression and BRCA1 protein expression were determined by quantitative RT-PCR and western blot, respectively and BRCA1 promoter activities were examined under these conditions. DNA sequence analysis was conducted to search for high similarity to E boxes in the BRCA1 promoter region. The association of c-Myc with the BRCA1 promoter in vivo was tested by a chromatin immunoprecipitation assay. We investigated the function of the c-Myc binding site in the BRCA1 promoter region by a promoter assay with nucleotide substitutions in the putative E boxes. BRCA1-dependent DNA repair activities were measured by a GFP-reporter assay. Depletion of c-Myc was found to be correlated with reduced expression levels of BRCA1 mRNA and BRCA1 protein. Depletion of c-Myc decreased BRCA1 promoter activity, while ectopically expressed c-Myc increased BRCA1 promoter activity. In the distal BRCA1 promoter, DNA sequence analysis revealed two tandem clusters with high similarity, and each cluster contained a possible c-Myc binding site. c-Myc bound to these regions in vivo. Nucleotide substitutions in the c-Myc binding sites in these regions abrogated c-Myc-dependent promoter activation. Furthermore, breast cancer cells with reduced BRCA1 expression due to depletion of c-Myc exhibited impaired DNA repair activity. The distal BRCA1 promoter region is associated with c
Insulators form gene loops by interacting with promoters in Drosophila.
Erokhin, Maksim; Davydova, Anna; Kyrchanova, Olga; Parshikov, Alexander; Georgiev, Pavel; Chetverina, Darya
2011-09-01
Chromatin insulators are regulatory elements involved in the modulation of enhancer-promoter communication. The 1A2 and Wari insulators are located immediately downstream of the Drosophila yellow and white genes, respectively. Using an assay based on the yeast GAL4 activator, we have found that both insulators are able to interact with their target promoters in transgenic lines, forming gene loops. The existence of an insulator-promoter loop is confirmed by the fact that insulator proteins could be detected on the promoter only in the presence of an insulator in the transgene. The upstream promoter regions, which are required for long-distance stimulation by enhancers, are not essential for promoter-insulator interactions. Both insulators support basal activity of the yellow and white promoters in eyes. Thus, the ability of insulators to interact with promoters might play an important role in the regulation of basal gene transcription.
Energy Technology Data Exchange (ETDEWEB)
Sangsuwan, Jiraporn [Department of Molecular Biology and Bioinformatics, Center for Genomics and Bioinformatics Research, Faculty of Science, Prince of Songkla University, Hat Yai, Songkhla 90112 (Thailand); Department of Oral Biology and Occlusion, Faculty of Dentistry, Prince of Songkla University, Hat Yai, Songkhla 90112 (Thailand); Wanichpakorn, Supreya; Kedjarune-Leggat, Ureporn [Department of Oral Biology and Occlusion, Faculty of Dentistry, Prince of Songkla University, Hat Yai, Songkhla 90112 (Thailand)
2015-09-01
The objective of this study was to evaluate the effect of translationally controlled tumor protein (TCTP) supplemented in a novel glass ionomer cement (BIO-GIC) on normal human osteoblasts (NHost cells). BIO-GIC was a glass ionomer cement (GIC) modified by adding chitosan and albumin to promote the release of TCTP. NHost cells were seeded on specimens of GIC, GIC + TCTP, BIO-GIC and BIO-GIC + TCTP. Cell proliferation was determined by BrdU assay. It was found that BIO-GIC + TCTP had significantly higher proliferation of cells than other specimens. Bone morphogenetic protein-2 (BMP-2) and osteopontin (OPN) gene expressions assessed by quantitative real time PCR and alkaline phosphatase (ALP) activity were used to determine cell differentiation. Bone cell function was investigated by calcium deposition using alizarin assay. Both BMP-2 and OPN gene expressions of cells cultured on specimens with added TCTP increased gradually up-regulation after day 1 and reached the highest on day 3 then down-regulation on day 7. The ALP activity of cells cultured on BIO-GIC + TCTP for 7 days and calcium content after 14 days were significantly higher than other groups. BIO-GIC + TCTP can promote osteoblast cells proliferation, differentiation and function. - Highlights: • Developed a new GIC by supplementing TCTP in BIO-GIC (GIC with chitosan and albumin) • BIO-GIC + TCTP released a higher amount of TCTP than GIC + TCTP. • BIO-GIC + TCTP promoted cell proliferation higher than other specimens and control. • BIO-GIC + TCTP promoted osteoblasts differentiation and function.
International Nuclear Information System (INIS)
Sangsuwan, Jiraporn; Wanichpakorn, Supreya; Kedjarune-Leggat, Ureporn
2015-01-01
The objective of this study was to evaluate the effect of translationally controlled tumor protein (TCTP) supplemented in a novel glass ionomer cement (BIO-GIC) on normal human osteoblasts (NHost cells). BIO-GIC was a glass ionomer cement (GIC) modified by adding chitosan and albumin to promote the release of TCTP. NHost cells were seeded on specimens of GIC, GIC + TCTP, BIO-GIC and BIO-GIC + TCTP. Cell proliferation was determined by BrdU assay. It was found that BIO-GIC + TCTP had significantly higher proliferation of cells than other specimens. Bone morphogenetic protein-2 (BMP-2) and osteopontin (OPN) gene expressions assessed by quantitative real time PCR and alkaline phosphatase (ALP) activity were used to determine cell differentiation. Bone cell function was investigated by calcium deposition using alizarin assay. Both BMP-2 and OPN gene expressions of cells cultured on specimens with added TCTP increased gradually up-regulation after day 1 and reached the highest on day 3 then down-regulation on day 7. The ALP activity of cells cultured on BIO-GIC + TCTP for 7 days and calcium content after 14 days were significantly higher than other groups. BIO-GIC + TCTP can promote osteoblast cells proliferation, differentiation and function. - Highlights: • Developed a new GIC by supplementing TCTP in BIO-GIC (GIC with chitosan and albumin) • BIO-GIC + TCTP released a higher amount of TCTP than GIC + TCTP. • BIO-GIC + TCTP promoted cell proliferation higher than other specimens and control. • BIO-GIC + TCTP promoted osteoblasts differentiation and function
A protocatechuate biosensor for Pseudomonas putida KT2440 via promoter and protein evolution
Directory of Open Access Journals (Sweden)
Ramesh K. Jha
2018-06-01
Full Text Available Robust fluorescence-based biosensors are emerging as critical tools for high-throughput strain improvement in synthetic biology. Many biosensors are developed in model organisms where sophisticated synthetic biology tools are also well established. However, industrial biochemical production often employs microbes with phenotypes that are advantageous for a target process, and biosensors may fail to directly transition outside the host in which they are developed. In particular, losses in sensitivity and dynamic range of sensing often occur, limiting the application of a biosensor across hosts. Here we demonstrate the optimization of an Escherichia coli-based biosensor in a robust microbial strain for the catabolism of aromatic compounds, Pseudomonas putida KT2440, through a generalizable approach of modulating interactions at the protein-DNA interface in the promoter and the protein-protein dimer interface. The high-throughput biosensor optimization approach demonstrated here is readily applicable towards other allosteric regulators. Keywords: Whole cell biosensor, Aromatic catabolism, Transcription factor, PcaU, Shikimate
Carrara, Paola; Antoninetti, Massimo; Bacai, Hina; Basoni, Anna; Bosc, Christelle; Clave, Magali; Cornacchia, Carmela; L'Astorina, Alba; Monbet, Philippe; Mueller, Bastian; Nicolau, Sonia; Pergola, Nicola; Rampini, Anna; Tramutoli, Valerio; Schumacher, Volker; Wells, Alan; Zepeda Juarez, Jesus; Zolotikova, Svetlana
2013-04-01
which have significant impact on the economy, environment and the quality of life of the citizens To this aim since 2011 the system of Regional Contact Offices (RCOs) was promoted by the EU FP7 DORIS_Net (Downsteam Observatory organized by Regions Active in Space - Network, http://www.doris-net.eu/) project as the regional link to the services provided by the European GMES programme. Since then a first nucleus of 12 pilot European Regions were working together establishing 6 first RCOs around Europe. This paper will present RCOs network goals, achievements and perspectives as well as its planned actions devoted to improve quality of Space Technology products from one side, to promote awareness and use of them by potential end-users (and particularly LRAs), from the other side.
Directory of Open Access Journals (Sweden)
Gao Chen
2012-02-01
Full Text Available Abstract Background The human papillomavirus (HPV E2 protein is a multifunctional DNA-binding protein. The transcriptional activity of HPV E2 is mediated by binding to its specific binding sites in the upstream regulatory region of the HPV genomes. Previously we reported a HPV-2 variant from a verrucae vulgaris patient with huge extensive clustered cutaneous, which have five point mutations in its E2 ORF, L118S, S235P, Y287H, S293R and A338V. Under the control of HPV-2 LCR, co-expression of the mutated HPV E2 induced an increased activity on the viral early promoter. In the present study, a series of mammalian expression plasmids encoding E2 proteins with one to five amino acid (aa substitutions for these mutations were constructed and transfected into HeLa, C33A and SiHa cells. Results CAT expression assays indicated that the enhanced promoter activity was due to the co-expressions of the E2 constructs containing A338V mutation within the DNA-binding domain. Western blots analysis demonstrated that the transiently transfected E2 expressing plasmids, regardless of prototype or the A338V mutant, were continuously expressed in the cells. To study the effect of E2 mutations on its DNA-binding activity, a serial of recombinant E2 proteins with various lengths were expressed and purified. Electrophoresis mobility shift assays (EMSA showed that the binding affinity of E2 protein with A338V mutation to both an artificial probe with two E2 binding sites or HPV-2 and HPV-16 promoter-proximal LCR sequences were significantly stronger than that of the HPV-2 prototype E2. Furthermore, co-expression of the construct containing A338V mutant exhibited increased activities on heterologous HPV-16 early promoter P97 than that of prototype E2. Conclusions These results suggest that the mutation from Ala to Val at aa 338 is critical for E2 DNA-binding and its transcriptional regulation.
Cytosine deletion at AP2-box region of HSP70 promoter and its ...
Indian Academy of Sciences (India)
of thermotolerance in cells (Leung et al. 1996). ... region of HSP70 significantly affected cellular thermotol- erance ... The double PCR-RFLP using ScrFI confirmed the occur- ... suade of HSP70 on defense of proteins related to respiration.
DEFF Research Database (Denmark)
Moreira, José Manuel Alfonso; Remacle, J E; Kielland-Brandt, Morten
1998-01-01
A cis-acting element required for GCN4-independent basal-level transcription of ILV1 was previously identified in our laboratories as a binding site for the REB1 protein (Reb1p). Further deletion analysis of the ILV1 promoter region identified a second element also required for GCN4-independent...... basal-level ILV1 expression. This second element is an A.T-rich tract (26 As out of 32 nucleotides) situated 15 bp downstream of the Reb1p-binding site. Deletion of both the Reblp site and the poly(dA:dT) element totally eliminates basal activity of the ILV1 promoter. We show that the two elements act...... synergistically to control ILV1 expression and that the synergistic effect is distance dependent. We demonstrate that (i) datin (Dat1p), the only known poly (dA:dT)-binding protein in yeast, specifically binds to the ILV1 poly(dA:dT) element in vitro; (ii) Dat1p functions as a trans-activating factor in the ILV1...
Characterization and functional analysis of the Paralichthys olivaceus prdm1 gene promoter.
Li, Peizhen; Wang, Bo; Cao, Dandan; Liu, Yuezhong; Zhang, Quanqi; Wang, Xubo
2017-10-01
PR domain containing protein 1 (Prdm1) is a transcriptional repressor identified in various species and plays multiple important roles in immune response and embryonic development. However, little is known about the transcriptional regulation of the prdm1 gene. This study aims to characterize the promoter of Paralichthys olivaceus prdm1 (Po-prdm1) gene and determine the regulatory mechanism of Po-prdm1 expression. A 2000bp-long 5'-flanking region (translation initiation site designated as +1) of the Po-prdm1 gene was isolated and characterized. The regulatory elements in this fragment were then investigated and many putative transcription factor (TF) binding sites involved in immunity and multiple tissue development were identified. A 5'-deletion analysis was then conducted, and the ability of the deletion mutants to promote luciferase and green fluorescent protein (GFP) expression in a flounder gill cell line was examined. The results revealed that the minimal promoter is located in the region between -446 and -13bp, and the region between -1415 and -13bp enhanced the promoter activity. Site-directed mutation analysis was subsequently performed on the putative regulatory elements sites, and the results indicated that FOXP1, MSX and BCL6 binding sites play negative functional roles in the regulation of the Po-prdm1 expression in FG cells. In vivo analysis demonstrated that a GFP reporter gene containing 1.4kb-long promoter fragment (-1415/-13) was expressed in the head and trunk muscle fibres of transient transgenic zebrafish embryos. Our study provided the basic information for the exploration of Po-prdm1 regulation and expression. Copyright © 2017 Elsevier Inc. All rights reserved.
International Nuclear Information System (INIS)
Wyrwicz, Lucjan S; Koczyk, Grzegorz; Rychlewski, Leszek; Plewczynski, Dariusz
2007-01-01
The annotation of protein folds within newly sequenced genomes is the main target for semi-automated protein structure prediction (virtual structural genomics). A large number of automated methods have been developed recently with very good results in the case of single-domain proteins. Unfortunately, most of these automated methods often fail to properly predict the distant homology between a given multi-domain protein query and structural templates. Therefore a multi-domain protein should be split into domains in order to overcome this limitation. ProteinSplit is designed to identify protein domain boundaries using a novel algorithm that predicts disordered regions in protein sequences. The software utilizes various sequence characteristics to assess the local propensity of a protein to be disordered or ordered in terms of local structure stability. These disordered parts of a protein are likely to create interdomain spacers. Because of its speed and portability, the method was successfully applied to several genome-wide fold annotation experiments. The user can run an automated analysis of sets of proteins or perform semi-automated multiple user projects (saving the results on the server). Additionally the sequences of predicted domains can be sent to the Bioinfo.PL Protein Structure Prediction Meta-Server for further protein three-dimensional structure and function prediction. The program is freely accessible as a web service at http://lucjan.bioinfo.pl/proteinsplit together with detailed benchmark results on the critical assessment of a fully automated structure prediction (CAFASP) set of sequences. The source code of the local version of protein domain boundary prediction is available upon request from the authors
Direct inhibition of TNF-α promoter activity by Fanconi anemia protein FANCD2.
Directory of Open Access Journals (Sweden)
Nobuko Matsushita
Full Text Available Fanconi anemia (FA, an inherited disease, is associated with progressive bone marrow failure, predisposition to cancer, and genomic instability. Genes corresponding to 15 identified FA complementation groups have been cloned, and each gene product functions in the response to DNA damage induced by cross-linking agents and/or in protection against genome instability. Interestingly, overproduction of inflammatory cytokines such as tumor necrosis factor alpha (TNF-α and aberrant activation of NF-κB-dependent transcriptional activity have been observed in FA cells. Here we demonstrated that FANCD2 protein inhibits NF-κB activity in its monoubiquitination-dependent manner. Furthermore, we detected a specific association between FANCD2 and an NF-κB consensus element in the TNF-α promoter by electrophoretic mobility shift assays (EMSA and chromatin immunoprecipitation (ChIP assay. Therefore, we propose FANCD2 deficiency promotes transcriptional activity of the TNF-α promoter and induces overproduction of TNF-which then sustains prolonged inflammatory responses. These results also suggest that artificial modulation of TNFα production could be a promising therapeutic approach to FA.
DeepCNF-D: Predicting Protein Order/Disorder Regions by Weighted Deep Convolutional Neural Fields
Directory of Open Access Journals (Sweden)
Sheng Wang
2015-07-01
Full Text Available Intrinsically disordered proteins or protein regions are involved in key biological processes including regulation of transcription, signal transduction, and alternative splicing. Accurately predicting order/disorder regions ab initio from the protein sequence is a prerequisite step for further analysis of functions and mechanisms for these disordered regions. This work presents a learning method, weighted DeepCNF (Deep Convolutional Neural Fields, to improve the accuracy of order/disorder prediction by exploiting the long-range sequential information and the interdependency between adjacent order/disorder labels and by assigning different weights for each label during training and prediction to solve the label imbalance issue. Evaluated by the CASP9 and CASP10 targets, our method obtains 0.855 and 0.898 AUC values, which are higher than the state-of-the-art single ab initio predictors.
Directory of Open Access Journals (Sweden)
Zhang Hua
2006-08-01
Full Text Available Abstract The detailed methylation status of CpG sites in the promoter region of hMSH2 gene has yet not to be reported. We have mapped the complete methylation status of the hMSH2 promoter, a region that contains 75 CpG sites, using bisulfite genomic sequencing in 60 primary colorectal cancers. And the expression of hMSH2 was detected by immunohistochemistry. The hypermethylation of hMSH2 was detected in 18.33% (11/60 of tumor tissues. The protein of hMSH2 was detected in 41.67% (25/60 of tumor tissues. No hypermethylation of hMSH2 was detected in normal tissues. The protein of hMSH2 was detected in all normal tissues. Our study demonstrated that hMSH2 hypermethylation and protein expression were associated with the development of colorectal cancer.
Relationship between promoter methylation & tissue expression of MGMT gene in ovarian cancer
Directory of Open Access Journals (Sweden)
V Shilpa
2014-01-01
Full Text Available Background & objectives: Epigenetic alterations, in addition to multiple gene abnormalities, are involved in the genesis and progression of human cancers. Aberrant methylation of CpG islands within promoter regions is associated with transcriptional inactivation of various tumour suppressor genes. O 6 -methyguanine-DNA methyltransferase (MGMT is a DNA repair gene that removes mutagenic and cytotoxic adducts from the O 6 -position of guanine induced by alkylating agents. MGMT promoter hypermethylation and reduced expression has been found in some primary human carcinomas. We studied DNA methylation of CpG islands of the MGMT gene and its relation with MGMT protein expression in human epithelial ovarian carcinoma. Methods: A total of 88 epithelial ovarian cancer (EOC tissue samples, 14 low malignant potential (LMP tumours and 20 benign ovarian tissue samples were analysed for MGMT promoter methylation by nested methylation-specific polymerase chain reaction (MSP after bisulphite modification of DNA. A subset of 64 EOC samples, 10 LMP and benign tumours and five normal ovarian tissue samples were analysed for protein expression by immunohistochemistry. Results: The methylation frequencies of the MGMT gene promoter were found to be 29.5, 28.6 and 20 per cent for EOC samples, LMP tumours and benign cases, respectively. Positive protein expression was observed in 93.8 per cent of EOC and 100 per cent in LMP, benign tumours and normal ovarian tissue samples. Promoter hypermethylation with loss of protein expression was seen only in one case of EOC. Interpretation & conclusions: Our results suggest that MGMT promoter hypermethylation does not always reflect gene expression.
Qing, Hua; Aono, Jun; Findeisen, Hannes M; Jones, Karrie L; Heywood, Elizabeth B; Bruemmer, Dennis
2016-06-01
Telomerase reverse transcriptase (TERT) maintains telomeres and is rate limiting for replicative life span. While most somatic tissues silence TERT transcription resulting in telomere shortening, cells derived from cancer or cardiovascular diseases express TERT and activate telomerase. In the present study, we demonstrate that histone deacetylase (HDAC) inhibition induces TERT transcription and promoter activation. At the protein level in contrast, HDAC inhibition decreases TERT protein abundance through enhanced degradation, which decreases telomerase activity and induces senescence. Finally, we demonstrate that HDAC inhibition decreases TERT expression during vascular remodeling in vivo. These data illustrate a differential regulation of TERT transcription and protein stability by HDAC inhibition and suggest that TERT may constitute an important target for the anti-proliferative efficacy of HDAC inhibitors. © 2015 Wiley Periodicals, Inc.
Pol, Arno; van Ruissen, Fred; Schalkwijk, Joost
2002-08-01
Inflamed epidermis (psoriasis, wound healing, ultraviolet-irradiated skin) harbors keratinocytes that are hyperproliferative and display an abnormal differentiation program. A distinct feature of this so-called regenerative maturation pathway is the expression of proteins such as the cytokeratins CK6, CK16, and CK17 and the antiinflammatory protein SKALP/elafin. These proteins are absent in normal skin but highly induced in lesional psoriatic skin. Expression of these genes can be used as a surrogate marker for psoriasis in drug-screening procedures of large compound libraries. The aim of this study was to develop a keratinocyte cell line that contained a reporter gene under the control of a psoriasis-associated endogenous promoter and demonstrate its use in an assay suitable for screening. We generated a stably transfected keratinocyte cell line that expresses enhanced green fluorescent protein (EGFP), under the control of a 0.8-kb fragment derived from the promoter of the SKALP/elafin gene, which confers high levels of tissue-specific expression at the mRNA level. Induction of the SKALP promoter by tumor necrosis factor-alpha resulted in increased expression levels of the secreted SKALP-EGFP fusion protein as assessed by direct readout of fluorescence and fluorescence polarization in 96-well cell culture plates. The fold stimulation of the reporter gene was comparable to that of the endogenous SKALP gene as assessed by enzyme-linked immunosorbent assay. Although the dynamic range of the screening system is limited, the small standard deviation yields a Z factor of 0.49. This indicates that the assay is suitable as a high-throughput screen, and provides proof of the concept that a secreted EGFP fusion protein under the control of a physiologically relevant endogenous promoter can be used as a fluorescence-based high-throughput screen for differentiation-modifying or antiinflammatory compounds that act via the keratinocyte.
International Nuclear Information System (INIS)
Banks, G.R.; Sedgwick, S.G.
1986-01-01
When the Escherichia coli RecA protein is UV irradiated in the presence of [alpha- 32 P]ATP, a labeled protein--ATP adduct is formed. All the experimental evidence indicates that, in forming such an adduct, the ATP becomes specifically immobilized in the catalytically relevant ATP binding site. The adduct can also be identified after irradiation of E. coli cell lysates in a similar manner. This direct ATP photolabeling of RecA proteins has been used to identify regions of the polypeptide chain involved in the binding of ATP. The photolabeling of a RecA protein that lacks wild-type carboxy-terminal amino acids is not detectable. A RecA protein in which the amino-terminal sequence NH2-Ala-Ile-Asp-Glu-Asn- is replaced by NH2-Thr-Met-Ile-Thr-Asn-Ser-Ser-Ser- is only about 5% as efficiently photolabeled as the wild-type protein. Both of these RecA protein constructions, however, contain all the elements previously implicated, directly or indirectly, in the binding of ATP. ATP-photolabeled RecA protein has also been chemically cleaved at specific amino acids in order to identify regions of the polypeptide chain to which the nucleotide becomes covalently photolinked. The evidence is consistent with a region comprising amino acids 116-170. Thus, this work and that of others suggest that several disparate regions of the unfolded polypeptide chain may combine to form the ATP binding site upon protein folding or may influence binding through long-range effects
International Nuclear Information System (INIS)
Gilmour, D.S.; Lis, J.T.
1986-01-01
By using a protein-DNA cross-linking method, we examined the in vivo distribution of RNA polymerase II on the hsp70 heat shock gene in Drosophila melanogaster Schneider line 2 cells. In heat shock-induced cells, a high level of RNA polymerase II was detected on the entire gene, while in noninduced cells, the RNA polymerase II was confined to the 5' end of the hsp70 gene, predominantly between nucleotides -12 and +65 relative to the start of transcription. This association of RNA polymerase II was apparent whether the cross-linking was performed by a 10-min UV irradiation of chilled cells with mercury vapor lamps or by a 40-microsecond irradiation of cells with a high-energy xenon flash lamp. We hypothesize that RNA polymerase II has access to, and a high affinity for, the promoter region of this gene before induction, and this poised RNA polymerase II may be critical in the mechanism of transcription activation
Directory of Open Access Journals (Sweden)
Susanne Schmeier
2009-01-01
Full Text Available The development of international rivers is often perceived as leading to conflicts or even water wars. However, as the development of the Mekong River shows, cooperation has not only prevailed in the last decades, but River Basin Organizations (RBOs, established to mitigate river-related conflicts and/or develop the river basin, have also contributed to the emergence of more general cooperation structures, mainly by creating spill-over effects in other issue-areas, bringing cooperation to policy fields beyond the river itself. This article assesses the contribution of the Mekong River Commission (MRC and the Greater Mekong Sub-Region (GMS to the sustainable development of the Mekong Region as well as to the promotion of regional cooperation in mainland South-East Asia in general. --- Die Entwicklung grenzüberschreitender Flüsse wird oft mit Konflikten oder gar Kriegen um Wasser assoziiert. Wie jedoch die Entwicklung im Mekong-Becken zeigt, waren die vergangenen Jahrzehnte nicht nur von Kooperation gezeichnet, sondern Flussbeckenorganisationen konnten außerdem dazu beitragen, weitreichendere Kooperationsstrukturen zu entwickeln, die sich auf andere Politikfelder ausdehnen. Dieser Artikel beschäftigt sich mit dem Beitrag der Mekong River Commission (MRC und der Greater Mekong Sub-Region (GMS zur nachhaltigen Entwicklung in der Mekong Region sowie zur Förderung allgemeiner regionaler Kooperation im Festländischen Südostasien.
Protein Determinants of Meiotic DNA Break Hotspots
Fowler, Kyle R.; Gutiérrez-Velasco, Susana
2013-01-01
SUMMARY Meiotic recombination, crucial for proper chromosome segregation and genome evolution, is initiated by programmed DNA double-strand breaks (DSBs) in yeasts and likely all sexually reproducing species. In fission yeast, DSBs occur up to hundreds of times more frequently at special sites, called hotspots, than in other regions of the genome. What distinguishes hotspots from cold regions is an unsolved problem, although transcription factors determine some hotspots. We report the discovery that three coiled-coil proteins – Rec25, Rec27, and Mug20 – bind essentially all hotspots with unprecedented specificity even without DSB formation. These small proteins are components of linear elements, are related to synaptonemal complex proteins, and are essential for nearly all DSBs at most hotspots. Our results indicate these hotspot determinants activate or stabilize the DSB-forming protein Rec12 (Spo11 homolog) rather than promote its binding to hotspots. We propose a new paradigm for hotspot determination and crossover control by linear element proteins. PMID:23395004
Zhao, Huan-Yu; Han, Yang; Wang, Jian; Yang, Lian-He; Zheng, Xiao-Ying; Du, Jiang; Wu, Guang-Ping; Wang, En-Hua
2017-06-01
IQ-domain GTPase-activating protein 1 is a scaffolding protein with multidomain which plays a role in modulating dishevelled (Dvl) nuclear translocation in canonical Wnt pathway. However, the biological function and mechanism of IQ-domain GTPase-activating protein 1 in invasive ductal carcinoma (IDC) remain unknown. In this study, we found that IQ-domain GTPase-activating protein 1 expression was elevated in invasive ductal carcinoma, which was positively correlated with tumor grade, lymphatic metastasis, and poor prognosis. Coexpression of IQ-domain GTPase-activating protein 1 and Dvl in the nucleus and cytoplasm of invasive ductal carcinoma was significantly correlated but not in the membrane. Postoperative survival in the patients with their coexpression in the nucleus and cytoplasm was obviously lower than that without coexpression. The positive expression rates of c-myc and cyclin D1 were significantly higher in the patients with nuclear coexpression of Dvl and IQ-domain GTPase-activating protein 1 than that with cytoplasmic coexpression, correlating with poor prognosis. IQ-domain GTPase-activating protein 1 significantly enhanced cell proliferation and invasion in invasive ductal carcinoma cell lines by interacting with Dvl in cytoplasm to promote Dvl nuclear translocation so as to upregulate the expression of c-myc and cyclin D1. Collectively, our data suggest that IQ-domain GTPase-activating protein 1 may promote the malignant phenotype of invasive ductal carcinoma via canonical Wnt signaling, and it could be used as a potential prognostic biomarker for breast cancer patients.
Invited review: Whey proteins as antioxidants and promoters of cellular antioxidant pathways.
Corrochano, Alberto R; Buckin, Vitaly; Kelly, Phil M; Giblin, Linda
2018-03-28
Oxidative stress contributes to cell injury and aggravates several chronic diseases. Dietary antioxidants help the body to fight against free radicals and, therefore, avoid or reduce oxidative stress. Recently, proteins from milk whey liquid have been described as antioxidants. This review summarizes the evidence that whey products exhibit radical scavenging activity and reducing power. It examines the processing and treatment attempts to increase the antioxidant bioactivity and identifies 1 enzyme, subtilisin, which consistently produces the most potent whey fractions. The review compares whey from different milk sources and puts whey proteins in the context of other known food antioxidants. However, for efficacy, the antioxidant activity of whey proteins must not only survive processing, but also upper gut transit and arrival in the bloodstream, if whey products are to promote antioxidant levels in target organs. Studies reveal that direct cell exposure to whey samples increases intracellular antioxidants such as glutathione. However, the physiological relevance of these in vitro assays is questionable, and evidence is conflicting from dietary intervention trials, with both rats and humans, that whey products can boost cellular antioxidant biomarkers. Copyright © 2018 American Dairy Science Association. Published by Elsevier Inc. All rights reserved.
Directory of Open Access Journals (Sweden)
Zhiheng Wang
Full Text Available The precise prediction of protein intrinsically disordered regions, which play a crucial role in biological procedures, is a necessary prerequisite to further the understanding of the principles and mechanisms of protein function. Here, we propose a novel predictor, DisoMCS, which is a more accurate predictor of protein intrinsically disordered regions. The DisoMCS bases on an original multi-class conservative score (MCS obtained by sequence-order/disorder alignment. Initially, near-disorder regions are defined on fragments located at both the terminus of an ordered region connecting a disordered region. Then the multi-class conservative score is generated by sequence alignment against a known structure database and represented as order, near-disorder and disorder conservative scores. The MCS of each amino acid has three elements: order, near-disorder and disorder profiles. Finally, the MCS is exploited as features to identify disordered regions in sequences. DisoMCS utilizes a non-redundant data set as the training set, MCS and predicted secondary structure as features, and a conditional random field as the classification algorithm. In predicted near-disorder regions a residue is determined as an order or a disorder according to the optimized decision threshold. DisoMCS was evaluated by cross-validation, large-scale prediction, independent tests and CASP (Critical Assessment of Techniques for Protein Structure Prediction tests. All results confirmed that DisoMCS was very competitive in terms of accuracy of prediction when compared with well-established publicly available disordered region predictors. It also indicated our approach was more accurate when a query has higher homologous with the knowledge database.The DisoMCS is available at http://cal.tongji.edu.cn/disorder/.
International Nuclear Information System (INIS)
Naghavi, Mojgan H.; Nowak, Piotr; Andersson, Jan; Soennerborg, Anders; Yang Huan; Tracey, Kevin J.; Vahlne, Anders
2003-01-01
We investigated whether the high mobility group B 1 (HMGB1), an abundant nuclear protein in all mammalian cells, affects HIV-1 transcription. Intracellular expression of human HMGB1 repressed HIV-1 gene expression in epithelial cells. This inhibitory effect of HMGB1 was caused by repression of long terminal repeat (LTR)-mediated transcription. Other viral promoters/enhancers, including simian virus 40 or cytomegalovirus, were not inhibited by HMGB1. In addition, HMGB1 inhibition of HIV-1 subtype C expression was dependent on the number of NFκB sites in the LTR region. The inhibitory effect of HMGB1 on viral gene expression observed in HeLa cells was confirmed by an upregulation of viral replication in the presence of antisense HMGB1 in monocytic cells. In contrast to what was found in HeLa cells and monocytic cells, endogenous HMGB1 expression did not affect HIV-1 replication in unstimulated Jurkat cells. Thus, intracellular HMGB1 affects HIV-1 LTR-directed transcription in a promoter- and cell-specific manner
National Research Council Canada - National Science Library
Carpenter, Steven
1997-01-01
This study provides retrospective market research information about the population who enrolled in TRICARE Prime in TRICARE Region 11 and the advertising mediums used to promote enrollment in the TRICARE Prime program...
Spermatogenesis-related ring finger gene ZNF230 promoter: identification and functional analysis
DEFF Research Database (Denmark)
Xu, Wenming; Zhang, Sizhong; Qiu, Weimin
2009-01-01
reporter Plasmids. Overexpression and site-directed mutation test were used to characterize the cis-element. The results showed ZNF230 gene promoter to be GC rich and not contain a TATA box. Deletion analysis of the 5'-flanking region of ZNF230 in HEK293 cells indicated that the sequence encompassing from...... nt -131 to +152 has a basal transcriptional activity. Site-directed mutation test and mithramycin A treatment demonstrated that the ZNF230 promoter contained a functional Sp1 site. Overexpression of the Sox5 protein activated the promoter activity. A 312-bp fragment surrounding the transcription...
Churchward-Venne, Tyler A; Murphy, Caoileann H; Longland, Thomas M; Phillips, Stuart M
2013-08-01
Amino acids are major nutrient regulators of muscle protein turnover. After protein ingestion, hyperaminoacidemia stimulates increased rates of skeletal muscle protein synthesis, suppresses muscle protein breakdown, and promotes net muscle protein accretion for several hours. These acute observations form the basis for strategized protein intake to promote lean mass accretion, or prevent lean mass loss over the long term. However, factors such as protein dose, protein source, and timing of intake are important in mediating the anabolic effects of amino acids on skeletal muscle and must be considered within the context of evaluating the reported efficacy of long-term studies investigating protein supplementation as part of a dietary strategy to promote lean mass accretion and/or prevent lean mass loss. Current research suggests that dietary protein supplementation can augment resistance exercise-mediated gains in skeletal muscle mass and strength and can preserve skeletal muscle mass during periods of diet-induced energy restriction. Perhaps less appreciated, protein supplementation can augment resistance training-mediated gains in skeletal muscle mass even in individuals habitually consuming 'adequate' (i.e., >0.8 g kg⁻¹ day⁻¹) protein. Additionally, overfeeding energy with moderate to high-protein intake (15-25 % protein or 1.8-3.0 g kg⁻¹ day⁻¹) is associated with lean, but not fat mass accretion, when compared to overfeeding energy with low protein intake (5 % protein or ~0.68 g kg⁻¹ day⁻¹). Amino acids represent primary nutrient regulators of skeletal muscle anabolism, capable of enhancing lean mass accretion with resistance exercise and attenuating the loss of lean mass during periods of energy deficit, although factors such as protein dose, protein source, and timing of intake are likely important in mediating these effects.
Smad3 induces atrogin-1, inhibits mTOR and protein synthesis, and promotes muscle atrophy in vivo.
Goodman, Craig A; McNally, Rachel M; Hoffmann, F Michael; Hornberger, Troy A
2013-11-01
Myostatin, a member of the TGF superfamily, is sufficient to induce skeletal muscle atrophy. Myostatin-induced atrophy is associated with increases in E3-ligase atrogin-1 expression and protein degradation and decreases in Akt/mechanistic target of rapamycin (mTOR) signaling and protein synthesis. Myostatin signaling activates the transcription factor Smad3 (Small Mothers Against Decapentaplegic), which has been shown to be necessary for myostatin-induced atrogin-1 expression and atrophy; however, it is not known whether Smad3 is sufficient to induce these events or whether Smad3 simply plays a permissive role. Thus, the aim of this study was to address these questions with an in vivo model. To accomplish this goal, in vivo transfection of plasmid DNA was used to create transient transgenic mouse skeletal muscles, and our results show for the first time that Smad3 expression is sufficient to stimulate atrogin-1 promoter activity, inhibit Akt/mTOR signaling and protein synthesis, and induce muscle fiber atrophy. Moreover, we propose that Akt/mTOR signaling is inhibited by a Smad3-induced decrease in microRNA-29 (miR-29) expression and a subsequent increase in the translation of phosphatase and tensin homolog (PTEN) mRNA. Smad3 is also sufficient to inhibit peroxisome proliferator-activated receptor-γ coactivator-1α (PGC1α) promoter activity and to increase FoxO (Forkhead Box Protein, Subclass O)-mediated signaling and the promoter activity of plasminogen activator inhibitor 1 (PAI-1). Combined, this study provides the first evidence that Smad3 is sufficient to regulate many of the events associated with myostatin-induced atrophy and therefore suggests that Smad3 signaling may be a viable target for therapies aimed at preventing myostatin-induced muscle atrophy.
Roth Flach, Rachel J; Danai, Laura V; DiStefano, Marina T; Kelly, Mark; Menendez, Lorena Garcia; Jurczyk, Agata; Sharma, Rohit B; Jung, Dae Young; Kim, Jong Hun; Kim, Jason K; Bortell, Rita; Alonso, Laura C; Czech, Michael P
2016-07-29
Previous studies revealed a paradox whereby mitogen-activated protein kinase kinase kinase kinase 4 (Map4k4) acted as a negative regulator of insulin sensitivity in chronically obese mice, yet systemic deletion of Map4k4 did not improve glucose tolerance. Here, we report markedly reduced glucose-responsive plasma insulin and C-peptide levels in whole body Map4k4-depleted mice (M4K4 iKO) as well as an impaired first phase of insulin secretion from islets derived from M4K4 iKO mice ex vivo After long-term high fat diet (HFD), M4K4 iKO mice pancreata also displayed reduced β cell mass, fewer proliferating β cells and reduced islet-specific gene mRNA expression compared with controls, although insulin content was normal. Interestingly, the reduced plasma insulin in M4K4 iKO mice exposed to chronic (16 weeks) HFD was not observed in response to acute HFD challenge or short term treatment with the insulin receptor antagonist S961. Furthermore, the improved insulin sensitivity in obese M4K4 iKO mice was abrogated by high exogenous insulin over the course of a euglycemic clamp study, indicating that hypoinsulinemia promotes insulin sensitivity in chronically obese M4K4 iKO mice. These results demonstrate that protein kinase Map4k4 drives obesity-induced hyperinsulinemia and insulin resistance in part by promoting insulin secretion from β cells in mice. © 2016 by The American Society for Biochemistry and Molecular Biology, Inc.
Ibarrola, N; Rodríguez-Peña, A
1997-03-28
To assess the role of thyroid hormone on myelin gene expression, we have studied the effect of hypothyroidism on the mRNA steady state levels for the major myelin protein genes: myelin basic protein (MBP), proteolipid protein (PLP), myelin-associated glycoprotein (MAG) and 2':3'-cyclic nucleotide 3'-phosphodiesterase (CNP) in different rat brain regions, during the first postnatal month. We found that hypothyroidism reduces the levels of every myelin protein transcript, with striking differences between the different brain regions. Thus, in the more caudal regions, the effect of hypothyroidism was extremely modest, being only evident at the earlier stages of myelination. In contrast, in the striatum and the cerebral cortex the important decrease in the myelin protein transcripts is maintained beyond the first postnatal month. Therefore, thyroid hormone modulates in a synchronous fashion the expression of the myelin genes and the length of its effect depends on the brain region. On the other hand, hyperthyroidism leads to an increase of the major myelin protein transcripts above control values. Finally, lack of thyroid hormone does not change the expression of the oligodendrocyte progenitor-specific gene, the platelet derived growth factor receptor alpha.
Sha, H.; Yang, L.; Liu, M.; Xia, S.; Liu, Y.; Liu, F.; Kersten, A.H.; Qi, L.
2014-01-01
The physiological role of the spliced form of X-box–binding protein 1 (XBP1s), a key transcription factor of the endoplasmic reticulum (ER) stress response, in adipose tissue remains largely unknown. In this study, we show that overexpression of XBP1s promotes adiponectin multimerization in
Li, Gongyu; Yuan, Siming; Zheng, Shihui; Chen, Yuting; Zheng, Zhen; Liu, Yangzhong; Huang, Guangming
2017-12-01
Specific protein-metal interactions (PMIs) fulfill essential functions in cells and organic bodies, and activation of these functions in vivo are mostly modulated by the complex environmental factors, including pH value, small biomolecules, and salts. Specifically, the role of salts in promoting specific PMIs and their competition among various metals has remained untapped mainly due to the difficulty to distinguish nonspecific PMIs from specific PMIs by classic spectroscopic techniques. Herein, we report Hofmeister salts differentially promote the specific PMIs by combining nanoelectrospray ionization mass spectrometry and spectroscopic techniques (fluorescence measurement and circular dichroism). Furthermore, to explore the influence of salts in competitive binding between metalloproteins and various metals, we designed a series of competitive experiments and applied to a well-defined model system, the competitive binding of zinc (II) and arsenic (III) to holo-promyelocytic leukemia protein (PML). These experiments not only provided new insights at the molecular scale as complementary to previous NMR and spectroscopic results, but also deduced the relative binding ability between zinc finger proteins and metals at the molecular scale, which avoids the mass spectrometric titration-based determination of binding constants that is frequently affected and often degraded by variable solution conditions including salt contents. [Figure not available: see fulltext.
Protein profiles of serum, brain regions and hypophyses of pubertal ...
African Journals Online (AJOL)
The effects of dietary fumonisin B1 (FB1 ), a toxin produced mainly by Fusarium verticillioides and F. proliferatum that grow on maize worldwide, on protein profiles of serum, brain regions and hypophyses were studied in 24 male Large White weanling pigs randomly divided into four groups (n = 6). In a completely ...
Hu, Wen; Wu, Feng; Zhang, Yanchong; Gong, Cheng-Xin; Iqbal, Khalid; Liu, Fei
2017-01-01
Microtubule-associated protein tau is hyperphosphorylated and aggregated in affected neurons in Alzheimer disease (AD) brains. The tau pathology starts from the entorhinal cortex (EC), spreads to the hippocampus and frontal and temporal cortices, and finally to all isocortex areas, but the cerebellum is spared from tau lesions. The molecular basis of differential vulnerability of different brain regions to tau pathology is not understood. In the present study, we analyzed brain regional expressions of tau and tau pathology-related proteins. We found that tau was hyperphosphorylated at multiple sites in the frontal cortex (FC), but not in the cerebellum, from AD brain. The level of tau expression in the cerebellum was about 1/4 of that seen in the frontal and temporal cortices in human brain. In the rat brain, the expression level of tau with three microtubule-binding repeats (3R-tau) was comparable in the hippocampus, EC, FC, parietal-temporal cortex (PTC), occipital-temporal cortex (OTC), striatum, thalamus, olfactory bulb (OB) and cerebellum. However, the expression level of 4R-tau was the highest in the EC and the lowest in the cerebellum. Tau phosphatases, kinases, microtubule-related proteins and other tau pathology-related proteins were also expressed in a region-specific manner in the rat brain. These results suggest that higher levels of tau and tau kinases in the EC and low levels of these proteins in the cerebellum may accounts for the vulnerability and resistance of these representative brain regions to the development of tau pathology, respectively. The present study provides the regional expression profiles of tau and tau pathology-related proteins in the brain, which may help understand the brain regional vulnerability to tau pathology in neurodegenerative tauopathies.
Directory of Open Access Journals (Sweden)
Eleanna Stamatakou
Full Text Available Upon arrival at their synaptic targets, axons slow down their growth and extensively remodel before the assembly of presynaptic boutons. Wnt proteins are target-derived secreted factors that promote axonal remodelling and synaptic assembly. In the developing spinal cord, Wnts secreted by motor neurons promote axonal remodelling of NT-3 responsive dorsal root ganglia neurons. Axon remodelling induced by Wnts is characterised by growth cone pausing and enlargement, processes that depend on the re-organisation of microtubules. However, the contribution of the actin cytoskeleton has remained unexplored. Here, we demonstrate that Wnt3a regulates the actin cytoskeleton by rapidly inducing F-actin accumulation in growth cones from rodent DRG neurons through the scaffold protein Dishevelled-1 (Dvl1 and the serine-threonine kinase Gsk3β. Importantly, these changes in actin cytoskeleton occurs before enlargement of the growth cones is evident. Time-lapse imaging shows that Wnt3a increases lamellar protrusion and filopodia velocity. In addition, pharmacological inhibition of actin assembly demonstrates that Wnt3a increases actin dynamics. Through a yeast-two hybrid screen, we identified the actin-binding protein Eps8 as a direct interactor of Dvl1, a scaffold protein crucial for the Wnt signalling pathway. Gain of function of Eps8 mimics Wnt-mediated axon remodelling, whereas Eps8 silencing blocks the axon remodelling activity of Wnt3a. Importantly, blockade of the Dvl1-Eps8 interaction completely abolishes Wnt3a-mediated axonal remodelling. These findings demonstrate a novel role for Wnt-Dvl1 signalling through Eps8 in the regulation of axonal remodeling.
Li, Xiaojie; Han, Liping; Zhao, Yanying; You, Zhenzhen; Dong, Hansong; Zhang, Chunling
2014-03-01
Hpa1 is a harpin protein produced by Xanthomonas oryzae, an important bacterial pathogen of rice, and has the growth-promoting activity in plants. To understand the molecular basis for the function of Hpa1, we generated an inactive variant protein, Hpa1 delta NT, by deleting the nitroxyl-terminal region of the Hpa1 sequence and compared Hpa1 delta NT with the full-length protein in terms of the effects on vegetative growth and related physiological responses in Arabidopsis. When Hpa1 was applied to plants, it acted to enhance the vegetative growth but did not affect the floral development. Enhanced plant growth was accompanied by induced expression of growth-promoting genes in plant leaves. The growth-promoting activity of Hpa1 was further correlated with a physiological consequence shown as promoted leaf photosynthesis as a result of facilitated CO2 conduction through leaf stomata and mesophyll cells. On the contrary, plant growth, growth-promoting gene expression, and the physiological consequence changed little in response to the Hpa1 delta NT treatment. These analyses suggest that Hpa1 requires the nitroxyl-terminus to facilitate CO2 transport inside leaf cells and promote leaf photosynthesis and vegetative growth of the plant.
Xie, Hongbo; Vucetic, Slobodan; Iakoucheva, Lilia M; Oldfield, Christopher J; Dunker, A Keith; Uversky, Vladimir N; Obradovic, Zoran
2007-05-01
Identifying relationships between function, amino acid sequence, and protein structure represents a major challenge. In this study, we propose a bioinformatics approach that identifies functional keywords in the Swiss-Prot database that correlate with intrinsic disorder. A statistical evaluation is employed to rank the significance of these correlations. Protein sequence data redundancy and the relationship between protein length and protein structure were taken into consideration to ensure the quality of the statistical inferences. Over 200,000 proteins from the Swiss-Prot database were analyzed using this approach. The predictions of intrinsic disorder were carried out using PONDR VL3E predictor of long disordered regions that achieves an accuracy of above 86%. Overall, out of the 710 Swiss-Prot functional keywords that were each associated with at least 20 proteins, 238 were found to be strongly positively correlated with predicted long intrinsically disordered regions, whereas 302 were strongly negatively correlated with such regions. The remaining 170 keywords were ambiguous without strong positive or negative correlation with the disorder predictions. These functions cover a large variety of biological activities and imply that disordered regions are characterized by a wide functional repertoire. Our results agree well with literature findings, as we were able to find at least one illustrative example of functional disorder or order shown experimentally for the vast majority of keywords showing the strongest positive or negative correlation with intrinsic disorder. This work opens a series of three papers, which enriches the current view of protein structure-function relationships, especially with regards to functionalities of intrinsically disordered proteins, and provides researchers with a novel tool that could be used to improve the understanding of the relationships between protein structure and function. The first paper of the series describes our
Uchida, Shotaro; Sato, Hiroki; Yoneda, Misako; Kai, Chieko
2016-09-01
Nipah virus belongs to the genus Henipavirus in the family Paramyxoviridae, and its RNA genome is larger than those of other paramyxoviruses because it has long untranslated regions (UTRs) in each gene. However, the functions of these UTRs are not fully understood. In this study, we investigated the functions of the 5' UTRs and found that the 5' UTR of the M gene upregulated the translation of a reporter gene. Using an RNA pull-down assay, we showed that eukaryotic elongation factor 1-beta (EEF1B2) interacts with nucleotides 81-100 of the M 5' UTR and specifically enhances its translation efficiency. Our results suggest that the M 5' UTR promotes the production of M protein and viral budding by recruiting EEF1B2.
The membrane protein LasM Promotes the Culturability of Legionella pneumophila in Water
Directory of Open Access Journals (Sweden)
Laam Li
2016-09-01
Full Text Available The water-borne pathogen Legionella pneumophila (Lp strongly expresses the lpg1659 gene in water. This gene encodes a hypothetical protein predicted to be a membrane protein using in silico analysis. While no conserved domains were identified in Lpg1659, similar proteins are found in many Legionella species and other aquatic bacteria. RT-qPCR showed that lpg1659 is positively regulated by the alternative sigma factor RpoS, which is essential for Lp to survive in water. These observations suggest an important role of this novel protein in the survival of Lp in water. Deletion of lpg1659 did not affect cell morphology, membrane integrity or tolerance to high temperature. Moreover, lpg1659 was dispensable for growth of Lp in rich medium, and during infection of the amoeba Acanthamoeba castellanii and of THP-1 human macrophages. However, deletion of lpg1659 resulted in an early loss of culturability in water, while over-expression of this gene promoted the culturability of Lp. Therefore, these results suggest that lpg1659 is required for Lp to maintain culturability, and possibly long-term survival, in water. Since the loss of culturability observed in the absence of Lpg1659 was complemented by the addition of trace metals into water, this membrane protein is likely a transporter for acquiring essential trace metal for maintaining culturability in water and potentially in other metal-deprived conditions. Given its role in the survival of Lp in water, Lpg1659 was named LasM for Legionella aquatic survival membrane protein.
Rossi, Valeria; Beffagna, Giorgia; Rampazzo, Alessandra; Bauce, Barbara; Danieli, Gian Antonio
2004-06-23
Isthmins represent a novel family of vertebrate secreted proteins containing one copy of the thrombospondin type 1 repeat (TSR), which in mammals is shared by several proteins with diverse biological functions, including cell adhesion, angiogenesis, and patterning of developing nervous system. We have determined the genomic organization of human TAIL1 (thrombospondin and AMOP containing isthmin-like 1), a novel isthmin-like gene encoding a protein that contains a TSR and a C-terminal AMOP domain (adhesion-associated domain in MUC4 and other proteins), characteristic of extracellular proteins involved in adhesion processes. TAIL1 gene encompasses more than 24.4 kb. Analysis of the DNA sequence surrounding the putative transcriptional start region revealed a TATA-less promoter located in a CpG island. Several consensus binding sites for the transcription factors Sp1 and MZF-1 were identified in this promoter region. In humans, TAIL1 gene is located on chromosome 14q24.3 within ARVD1 (arrhythmogenic right ventricular dysplasia/cardiomyopathy, type 1) critical region; preliminary evidence suggests that it is expressed in several tissues, showing multiple alternative splicing.
DEFF Research Database (Denmark)
Norman, Anders; Hansen, Lars Hestbjerg; Sørensen, Søren Johannes
2005-01-01
Four different green fluorescent protein (GFP)-based whole-cell biosensors were created based on the DNA damage inducible SOS response of Escherichia coli in order to evaluate the sensitivity of individual SOS promoters toward genotoxic substances. Treatment with the known carcinogen N-methyl-N'-......Four different green fluorescent protein (GFP)-based whole-cell biosensors were created based on the DNA damage inducible SOS response of Escherichia coli in order to evaluate the sensitivity of individual SOS promoters toward genotoxic substances. Treatment with the known carcinogen N......-cell biosensor which is not only able to detect minute levels of genotoxins but, due to its use of the green fluorescent protein, also a reporter system which should be applicable in high-throughput screening assays as well as a wide variety of in situ detection studies....
DEFF Research Database (Denmark)
Frikke-Schmidt, R.; Nordestgaard, Børge; Grande, Peer
2008-01-01
Objectives This study was designed to test the hypotheses that single nucleotide polymorphisms ( SNPs), in zinc finger protein 202 ( ZNF202), predict severe atherosclerosis and ischemic heart disease ( IHD). Background ZNF202 is a transcriptional repressor controlling promoter elements in genes...... involved in vascular maintenance and lipid metabolism. Methods We first determined genotype association for 9 ZNF202 SNPs with severe atherosclerosis ( ankle brachial index >0.7 vs. ...,998 controls. Finally, we determined whether g. -660A>G altered transcriptional activity of the ZNF202 promoter in vitro. Results Cross-sectionally, ZNF202 g. -660 GG versus AA homozygosity predicted an odds ratio for severe atherosclerosis of 2.01 ( 95% confidence interval [CI]: 1.34 to 3.01). Prospectively...
Jully, Babu; Vijayalakshmi, Ramshankar; Gopal, Gopisetty; Sabitha, Kesavan; Rajkumar, Thangarajan
2012-11-12
Ewing's sarcoma is a malignancy characterized by a specific 11:22 chromosomal translocation which generates a novel EWS-FLI1 fusion protein functioning as an aberrant transcription factor. In the present study, we have further characterized the junction region of the EWS-FLI1 fusion protein. In-silico model of EWS-FLI1 fusion protein was analysed for ligand binding sites, and a putative region (amino acid (aa) 251-343 of the type 1 fusion protein) in the vicinity of the fusion junction was cloned and expressed using bacterial expression. The recombinant protein was characterized by Circular Dichroism (CD). We then expressed aa 251-280 ectopically in Ewing's sarcoma cell-line and its effect on cell proliferation, tumorigenicity and expression of EWS-FLI1 target genes were analysed. Our modelling analysis indicated that Junction region (aa 251-343) encompasses potential ligand biding sites in the EWS-FLI1 protein and when expressed in bacteria was present as soluble form. Ectopically expressing this region in Ewing's sarcoma cells inhibited tumorigenicity, and EWS-FLI1 target genes indicating a dominant negative biological effect. Junction region can be exploited further as target for drug development in future to specifically target EWS-FLI1 in Ewing's Sarcoma.
Corbi, N; Libri, V; Fanciulli, M; Tinsley, J M; Davies, K E; Passananti, C
2000-06-01
Up-regulation of utrophin gene expression is recognized as a plausible therapeutic approach in the treatment of Duchenne muscular dystrophy (DMD). We have designed and engineered new zinc finger-based transcription factors capable of binding and activating transcription from the promoter of the dystrophin-related gene, utrophin. Using the recognition 'code' that proposes specific rules between zinc finger primary structure and potential DNA binding sites, we engineered a new gene named 'Jazz' that encodes for a three-zinc finger peptide. Jazz belongs to the Cys2-His2 zinc finger type and was engineered to target the nine base pair DNA sequence: 5'-GCT-GCT-GCG-3', present in the promoter region of both the human and mouse utrophin gene. The entire zinc finger alpha-helix region, containing the amino acid positions that are crucial for DNA binding, was specifically chosen on the basis of the contacts more frequently represented in the available list of the 'code'. Here we demonstrate that Jazz protein binds specifically to the double-stranded DNA target, with a dissociation constant of about 32 nM. Band shift and super-shift experiments confirmed the high affinity and specificity of Jazz protein for its DNA target. Moreover, we show that chimeric proteins, named Gal4-Jazz and Sp1-Jazz, are able to drive the transcription of a test gene from the human utrophin promoter.
OPAL: prediction of MoRF regions in intrinsically disordered protein sequences.
Sharma, Ronesh; Raicar, Gaurav; Tsunoda, Tatsuhiko; Patil, Ashwini; Sharma, Alok
2018-06-01
Intrinsically disordered proteins lack stable 3-dimensional structure and play a crucial role in performing various biological functions. Key to their biological function are the molecular recognition features (MoRFs) located within long disordered regions. Computationally identifying these MoRFs from disordered protein sequences is a challenging task. In this study, we present a new MoRF predictor, OPAL, to identify MoRFs in disordered protein sequences. OPAL utilizes two independent sources of information computed using different component predictors. The scores are processed and combined using common averaging method. The first score is computed using a component MoRF predictor which utilizes composition and sequence similarity of MoRF and non-MoRF regions to detect MoRFs. The second score is calculated using half-sphere exposure (HSE), solvent accessible surface area (ASA) and backbone angle information of the disordered protein sequence, using information from the amino acid properties of flanks surrounding the MoRFs to distinguish MoRF and non-MoRF residues. OPAL is evaluated using test sets that were previously used to evaluate MoRF predictors, MoRFpred, MoRFchibi and MoRFchibi-web. The results demonstrate that OPAL outperforms all the available MoRF predictors and is the most accurate predictor available for MoRF prediction. It is available at http://www.alok-ai-lab.com/tools/opal/. ashwini@hgc.jp or alok.sharma@griffith.edu.au. Supplementary data are available at Bioinformatics online.
Rogge, George A; Shen, Li-Ling; Kuhar, Michael J
2010-07-16
Both over expression of cyclic AMP response element binding protein (CREB) in the nucleus accumbens (NAc), and intra-accumbal injection of cocaine- and amphetamine-regulated transcript (CART) peptides, have been shown to decrease cocaine reward. Also, over expression of CREB in the rat NAc increased CART mRNA and peptide levels, but it is not known if this was due to a direct action of P-CREB on the CART gene promoter. The goal of this study was to test if CREB and P-CREB bound directly to the CRE site in the CART promoter, using chromatin immunoprecipitation (ChIP) assays. ChIP assay with anti-CREB antibodies showed an enrichment of the CART promoter fragment containing the CRE region over IgG precipitated material, a non-specific control. Forskolin, which was known to increase CART mRNA levels in GH3 cells, was utilized to show that the drug increased levels of P-CREB protein and P-CREB binding to the CART promoter CRE-containing region. A region of the c-Fos promoter containing a CRE cis-regulatory element was previously shown to bind P-CREB, and it was used here as a positive control. These data suggest that the effects of CREB over expression on blunting cocaine reward could be, at least in part, attributed to the increased expression of the CART gene by direct interaction of P-CREB with the CART promoter CRE site, rather than by some indirect action. Copyright (c) 2010 Elsevier B.V. All rights reserved.
Directory of Open Access Journals (Sweden)
Lu Ying
2004-04-01
Full Text Available Abstract Background TGM1(transglutaminase 1 is an enzyme that crosslinks the cornified envelope of mature keratinocytes. Appropriate expression of the TGM1 gene is crucial for proper keratinocyte function as inactivating mutations lead to the debilitating skin disease, lamellar ichthyosis. TGM1 is also expressed in squamous metaplasia, a consequence in some epithelia of vitamin A deficiency or toxic insult that can lead to neoplasia. An understanding of the regulation of this gene in normal and abnormal differentiation states may contribute to better disease diagnosis and treatment. Methods In vivo requirements for expression of the TGM1 gene were studied by fusing various lengths of promoter DNA to a reporter and injecting the DNA into mouse embryos to generate transgenic animals. Expression of the reporter was ascertained by Western blotting and immunohistochemistry. Further delineation of a transcriptionally important distal region was determined by transfections of progressively shortened or mutated promoter DNA into cultured keratinocytes. Results In vivo analysis of a reporter transgene driven by the TGM1 promoter revealed that 1.6 kilobases, but not 1.1 kilobases, of DNA was sufficient to confer tissue-specific and cell layer-specific expression. This same region was responsible for reporter expression in tissues undergoing squamous metaplasia as a response to vitamin A deprivation. Mutation of a distal promoter AP1 site or proximal promoter CRE site, both identified as important transcriptional elements in transfection assays, did not prevent appropriate expression. Further searching for transcriptional elements using electrophoretic mobility shift (EMSA and transfection assays in cultured keratinocytes identified two Sp1 elements in a transcriptionally active region between -1.6 and -1.4 kilobases. While mutation of either Sp1 site or the AP1 site singly had only a small effect, mutation of all three sites eliminated nearly all the
Directory of Open Access Journals (Sweden)
Yueting Zheng
2016-01-01
Full Text Available Interferons (IFNs are cytokines that have pleiotropic effects and play important roles in innate and adaptive immunity. IFNs have broad antiviral properties and function by different mechanisms. IFNs fail to inhibit wild-type Adenovirus (Ad replication in established cancer cell lines. In this study, we analyzed the effects of IFNs on Ad replication in normal human cells. Our data demonstrate that both IFNα and IFNγ blocked wild-type Ad5 replication in primary human bronchial epithelial cells (NHBEC and TERT-immortalized normal human diploid fibroblasts (HDF-TERT. IFNs inhibited the replication of divergent adenoviruses. The inhibition of Ad5 replication by IFNα and IFNγ is the consequence of repression of transcription of the E1A immediate early gene product. Both IFNα and IFNγ impede the association of the transactivator GABP with the E1A enhancer region during the early phase of infection. The repression of E1A expression by IFNs requires a conserved E2F binding site in the E1A enhancer, and IFNs increased the enrichment of the E2F-associated pocket proteins, Rb and p107, at the E1A enhancer in vivo. PD0332991 (Pabociclib, a specific CDK4/6 inhibitor, dephosphoryles pocket proteins to promote their interaction with E2Fs and inhibited wild-type Ad5 replication dependent on the conserved E2F binding site. Consistent with this result, expression of the small E1A oncoprotein, which abrogates E2F/pocket protein interactions, rescued Ad replication in the presence of IFNα or IFNγ. Finally, we established a persistent Ad infection model in vitro and demonstrated that IFNγ suppresses productive Ad replication in a manner dependent on the E2F binding site in the E1A enhancer. This is the first study that probes the molecular basis of persistent adenovirus infection and reveals a novel mechanism by which adenoviruses utilize IFN signaling to suppress lytic virus replication and to promote persistent infection.
Gan, Li; Ma, Delin; Li, Min; Yang, Fu-Chen; Rogers, Robert S; Wheatley, Joshua L; Koch, Lauren G; Britton, Steven L; Thyfault, John P; Geiger, Paige C; Stanford, John A
2018-05-01
Aerobic capacity is a strong predictor of mortality. Low capacity runner (LCR) rats exhibit reduced mitochondrial function in peripheral organs. A high fat diet (HFD) can worsen metabolic phenotype in LCR rats. Little is known about metabolic changes in the brains of these rats, however. This study examined protein markers of mitochondrial function and metabolism as a function of aerobic running capacity and an acute HFD in four brain regions: the striatum, hippocampus, hypothalamus, and substantia nigra. After 3 days HFD or chow diets, we measured peroxisome proliferator-activated receptor-γ coactivator 1α (PGC1-α), nuclear respiratory factors 1 (Nrf-1), mitochondrial transcription factor A (TFAM), and phosphorylated (activated) AMP-activated protein kinase (p-AMPK) protein levels in the four brain regions. LCR rats exhibited lower levels of mitochondrial proteins (PGC1-α, Nrf-1, TFAM), and greater p-AMPK, in striatum, but not in the other brain regions. Mitochondrial protein levels were greater in HFD LCR striatum, while p-AMPK was lower in this group. Markers of lower mitochondrial biogenesis and increased metabolic demand were limited to the LCR striatum, which nevertheless maintained the capacity to respond to an acute HFD challenge. Copyright © 2018 Elsevier B.V. All rights reserved.
P-body proteins regulate transcriptional rewiring to promote DNA replication stress resistance.
Loll-Krippleber, Raphael; Brown, Grant W
2017-09-15
mRNA-processing (P-) bodies are cytoplasmic granules that form in eukaryotic cells in response to numerous stresses to serve as sites of degradation and storage of mRNAs. Functional P-bodies are critical for the DNA replication stress response in yeast, yet the repertoire of P-body targets and the mechanisms by which P-bodies promote replication stress resistance are unknown. In this study we identify the complete complement of mRNA targets of P-bodies during replication stress induced by hydroxyurea treatment. The key P-body protein Lsm1 controls the abundance of HHT1, ACF4, ARL3, TMA16, RRS1 and YOX1 mRNAs to prevent their toxic accumulation during replication stress. Accumulation of YOX1 mRNA causes aberrant downregulation of a network of genes critical for DNA replication stress resistance and leads to toxic acetaldehyde accumulation. Our data reveal the scope and the targets of regulation by P-body proteins during the DNA replication stress response.P-bodies form in response to stress and act as sites of mRNA storage and degradation. Here the authors identify the mRNA targets of P-bodies during DNA replication stress, and show that P-body proteins act to prevent toxic accumulation of these target transcripts.
Directory of Open Access Journals (Sweden)
Kawe Martin
2009-01-01
Full Text Available Abstract Background Overexpression of proteins in Escherichia coli is considered routine today, at least when the protein is soluble and not otherwise toxic for the host. We report here that the massive overproduction of even such "benign" proteins can cause surprisingly efficient promoter deletions in the expression plasmid, leading to the growth of only non-producers, when expression is not well repressed in the newly transformed bacterial cell. Because deletion is so facile, it might impact on high-throughput protein production, e.g. for structural genomics, where not every expression parameter will be monitored. Results We studied the high-level expression of several robust non-toxic proteins using a T5 promoter under lac operator control. Full induction leads to no significant growth retardation. We compared expression from almost identical plasmids with or without the lacI gene together in strains expressing different levels of LacI. Any combination without net overexpression of LacI led to an efficient promoter deletion in the plasmid, although the number of growing colonies and even the plasmid size – all antibiotic-resistant non-producers – was almost normal, and thus the problem not immediately recognizable. However, by assuring sufficient repression during the initial establishment phase of the plasmid, deletion was completely prevented. Conclusion The deletions in the insufficiently repressed system are caused entirely by the burden of high-level translation. Since the E. coli Dps protein, known to protect DNA against stress in the stationary phase, is accumulated in the deletion mutants, the mutation may have taken place during a transient stationary phase. The cause of the deletion is thus distinct from the well known interference of high-level transcription with plasmid replication. The deletion can be entirely prevented by overexpressing LacI, a useful precaution even without any signs of stress caused by the protein.
de Betue, Carlijn T; van Waardenburg, Dick A; Deutz, Nicolaas E; van Eijk, Hans M; van Goudoever, Johannes B; Luiking, Yvette C; Zimmermann, Luc J; Joosten, Koen F
2011-01-01
Objective The preservation of nutritional status and growth is an important aim in critically ill infants, but difficult to achieve due to the metabolic stress response and inadequate nutritional intake, leading to negative protein balance. This study investigated whether increasing protein and energy intakes can promote anabolism. The primary outcome was whole body protein balance, and the secondary outcome was first pass splanchnic phenylalanine extraction (SPEPhe). Design This was a double-blind randomised controlled trial. Infants (n=18) admitted to the paediatric intensive care unit with respiratory failure due to viral bronchiolitis were randomised to continuous enteral feeding with protein and energy enriched formula (PE-formula) (n=8; 3.1±0.3 g protein/kg/24 h, 119±25 kcal/kg/24 h) or standard formula (S-formula) (n=10; 1.7±0.2 g protein/kg/24 h, 84±15 kcal/kg/24 h; equivalent to recommended intakes for healthy infants <6 months). A combined intravenous-enteral phenylalanine stable isotope protocol was used on day 5 after admission to determine whole body protein metabolism and SPEPhe. Results Protein balance was significantly higher with PE-formula than with S-formula (PE-formula: 0.73±0.5 vs S-formula: 0.02±0.6 g/kg/24 h) resulting from significantly increased protein synthesis (PE-formula: 9.6±4.4, S-formula: 5.2±2.3 g/kg/24 h), despite significantly increased protein breakdown (PE-formula: 8.9±4.3, S-formula: 5.2±2.6 g/kg/24 h). SPEPhe was not statistically different between the two groups (PE-formula: 39.8±18.3%, S-formula: 52.4±13.6%). Conclusions Increasing protein and energy intakes promotes protein anabolism in critically ill infants in the first days after admission. Since this is an important target of nutritional support, increased protein and energy intakes should be preferred above standard intakes in these infants. Dutch Trial Register number: NTR 515. PMID:21673183
Directory of Open Access Journals (Sweden)
Isaacs Richard J
2007-05-01
Full Text Available Abstract Background Topoisomerase IIα has been shown to be down-regulated in doxorubicin-resistant cell lines. The specificity proteins Sp1 and Sp3 have been implicated in regulation of topoisomerase IIα transcription, although the mechanism by which they regulate expression is not fully understood. Sp1 has been shown to bind specifically to both proximal and distal GC elements of the human topoisomerase IIα promoter in vitro, while Sp3 binds only to the distal GC element unless additional flanking sequences are included. While Sp1 is thought to be an activator of human topoisomerase IIα, the functional significance of Sp3 binding is not known. Therefore, we sought to determine the functional relationship between Sp1 and Sp3 binding to the topoisomerase IIα promoter in vivo. We investigated endogenous levels of Sp1, Sp3 and topoisomerase IIα as well as binding of both Sp1 and Sp3 to the GC boxes of the topoisomerase IIα promoter in breast cancer cell lines in vivo after short term doxorubicin exposure. Results Functional effects of Sp1 and Sp3 were studied using transient cotransfection assays using a topoisomerase IIα promoter reporter construct. The in vivo interactions of Sp1 and Sp3 with the GC elements of the topoisomerase IIα promoter were studied in doxorubicin-treated breast cancer cell lines using chromatin immunoprecipitation assays. Relative amounts of endogenous proteins were measured using immunoblotting. In vivo DNA looping mediated by proteins bound at the GC1 and GC2 elements was studied using the chromatin conformation capture assay. Both Sp1 and Sp3 bound to the GC1 and GC2 regions. Sp1 and Sp3 were transcriptional activators and repressors respectively, with Sp3 repression being dominant over Sp1-mediated activation. The GC1 and GC2 elements are linked in vivo to form a loop, thus bringing distal regulatory elements and their cognate transcription factors into close proximity with the transcription start site
Directory of Open Access Journals (Sweden)
James Dollman
2016-01-01
Full Text Available Rural Australians are less physically active than their metropolitan counterparts, and yet very little is known of the candidate intervention targets for promoting physical activity in rural populations. As rural regions are economically, socially and environmentally diverse, drivers of regular physical activity are likely to vary between regions. This study explored the region-specific correlates of daily walking among middle age and older adults in rural regions with contrasting dominant primary industries. Participants were recruited through print and electronic media, primary care settings and community organisations. Pedometers were worn by 153 adults for at least four days, including a weekend day. A questionnaire identified potential intra-personal, social and environmental correlates of physical activity, according to a social ecological framework. Regression modelling identified independent correlates of daily walking separately in the two study regions. In one region, there were independent correlates of walking from all levels of the social ecological framework. In the other region, significant correlates of daily walking were almost all demographic (age, education and marital status. Participants living alone were less likely to be physically active regardless of region. This study highlights the importance of considering region-specific factors when designing strategies for promoting regular walking among rural adults.
Osteoponin Promoter Controlled by DNA Methylation: Aberrant Methylation in Cloned Porcine Genome
Directory of Open Access Journals (Sweden)
Chih-Jie Shen
2014-01-01
Full Text Available Cloned animals usually exhibited many defects in physical characteristics or aberrant epigenetic reprogramming, especially in some important organ development. Osteoponin (OPN is an extracellular-matrix protein involved in heart and bone development and diseases. In this study, we investigated the correlation between OPN mRNA and its promoter methylation changes by the 5-aza-dc treatment in fibroblast cell and promoter assay. Aberrant methylation of porcine OPN was frequently found in different tissues of somatic nuclear transferred cloning pigs, and bisulfite sequence data suggested that the OPN promoter region −2615 to −2239 nucleotides (nt may be a crucial regulation DNA element. In pig ear fibroblast cell culture study, the demethylation of OPN promoter was found in dose-dependent response of 5-aza-dc treatment and followed the OPN mRNA reexpression. In cloned pig study, discrepant expression pattern was identified in several cloned pig tissues, especially in brain, heart, and ear. Promoter assay data revealed that four methylated CpG sites presenting in the −2615 to −2239 nt region cause significant downregulation of OPN promoter activity. These data suggested that methylation in the OPN promoter plays a crucial role in the regulation of OPN expression that we found in cloned pigs genome.
The Zn Finger protein Iguana impacts Hedgehog signaling by promoting ciliogenesis
Glazer, Andrew; Wilkinson, Alex; Backer, Chelsea B.; Lapan, Sylvain; Gutzman, Jennifer H.; Cheeseman, Iain M.; Reddien, Peter W.
2009-01-01
Hedgehog signaling is critical for metazoan development and requires cilia for pathway activity. The gene iguana was discovered in zebrafish as required for Hedgehog signaling, and encodes a novel Zn finger protein. Planarians are flatworms with robust regenerative capacities and that utilize epidermal cilia for locomotion. RNA interference of Smed-iguana in the planarian S. mediterranea caused cilia loss and failure to regenerate new cilia, but did not cause defects similar to those observed in hedgehog(RNAi) animals. Smed-iguana gene expression was also similar in pattern to the expression of multiple other ciliogenesis genes, but was not required for expression of these ciliogenesis genes. iguana-defective zebrafish had too few motile cilia in pronephric ducts and in Kupffer's vesicle. Kupffer's vesicle promotes left-right asymmetry and iguana mutant embryos had left-right asymmetry defects. Finally, human Iguana proteins (dZIP1 and dZIP1L) localize to the basal bodies of primary cilia and, together, are required for primary cilia formation. Our results indicate that a critical and broadly conserved function for Iguana is in ciliogenesis and that this function has come to be required for Hedgehog signaling in vertebrates. PMID:19852954
Sangar, Vineet; Funk, Cory C; Kusebauch, Ulrike; Campbell, David S; Moritz, Robert L; Price, Nathan D
2014-10-01
Glioblastoma multiforme is a highly invasive and aggressive brain tumor with an invariably poor prognosis. The overexpression of epidermal growth factor receptor (EGFR) is a primary influencer of invasion and proliferation in tumor cells and the constitutively active EGFRvIII mutant, found in 30-65% of Glioblastoma multiforme, confers more aggressive invasion. To better understand how EGFR contributes to tumor aggressiveness, we investigated the effect of EGFR on the secreted levels of 65 rationally selected proteins involved in invasion. We employed selected reaction monitoring targeted mass spectrometry using stable isotope labeled internal peptide standards to quantity proteins in the secretome from five GBM (U87) isogenic cell lines in which EGFR, EGFRvIII, and/or PTEN were expressed. Our results show that cell lines with EGFR overexpression and constitutive EGFRvIII expression differ remarkably in the expression profiles for both secreted and intracellular signaling proteins, and alterations in EGFR signaling result in reproducible changes in concentrations of secreted proteins. Furthermore, the EGFRvIII-expressing mutant cell line secretes the majority of the selected invasion-promoting proteins at higher levels than other cell lines tested. Additionally, the intracellular and extracellular protein measurements indicate elevated oxidative stress in the EGFRvIII-expressing cell line. In conclusion, the results of our study demonstrate that EGFR signaling has a significant effect on the levels of secreted invasion-promoting proteins, likely contributing to the aggressiveness of Glioblastoma multiforme. Further characterization of these proteins may provide candidates for new therapeutic strategies and targets as well as biomarkers for this aggressive disease. © 2014 by The American Society for Biochemistry and Molecular Biology, Inc.
Rego, Fabiane G M; Pedrosa, Fábio O; Chubatsu, Leda S; Yates, M Geoffrey; Wassem, Roseli; Steffens, Maria B R; Rigo, Liu U; Souza, Emanuel M
2006-12-01
The putative nifB promoter region of Herbaspirillum seropedicae contained two sequences homologous to NifA-binding site and a -24/-12 type promoter. A nifB::lacZ fusion was assayed in the backgrounds of both Escherichia coli and H. seropedicae. In E. coli, the expression of nifB::lacZ occurred only in the presence of functional rpoN and Klebsiella pneumoniae nifA genes. In addition, the integration host factor (IHF) stimulated the expression of the nifB::lacZ fusion in this background. In H. seropedicae, nifB expression occurred only in the absence of ammonium and under low levels of oxygen, and it was shown to be strictly dependent on NifA. DNA band shift experiments showed that purified K. pneumoniae RpoN and E. coli IHF proteins were capable of binding to the nifB promoter region, and in vivo dimethylsulfate footprinting showed that NifA binds to both NifA-binding sites. These results strongly suggest that the expression of the nifB promoter of H. seropedicae is dependent on the NifA and RpoN proteins and that the IHF protein stimulates NifA activation of nifB promoter.
Balakrishnan, Swati; Sarma, Siddhartha P
2017-08-22
Aromatic interactions are an important force in protein folding as they combine the stability of a hydrophobic interaction with the selectivity of a hydrogen bond. Much of our understanding of aromatic interactions comes from "bioinformatics" based analyses of protein structures and from the contribution of these interactions to stabilizing secondary structure motifs in model peptides. In this study, the structural consequences of aromatic interactions on protein folding have been explored in engineered mutants of the molten globule protein apo-cytochrome b 5 . Structural changes from disorder to order due to aromatic interactions in two variants of the protein, viz., WF-cytb5 and FF-cytb5, result in significant long-range secondary and tertiary structure. The results show that 54 and 52% of the residues in WF-cytb5 and FF-cytb5, respectively, occupy ordered regions versus 26% in apo-cytochrome b 5 . The interactions between the aromatic groups are offset-stacked and edge-to-face for the Trp-Phe and Phe-Phe mutants, respectively. Urea denaturation studies indicate that both mutants have a C m higher than that of apo-cytochrome b 5 and are more stable to chaotropic agents than apo-cytochrome b 5 . The introduction of these aromatic residues also results in "trimer" interactions with existing aromatic groups, reaffirming the selectivity of the aromatic interactions. These studies provide insights into the aromatic interactions that drive disorder-to-order transitions in intrinsically disordered regions of proteins and will aid in de novo protein design beyond small peptide scaffolds.
Sanz, Ricardo L; Ferraro, Gino B; Girouard, Marie-Pier; Fournier, Alyson E
2017-08-11
IgLONs are members of the immunoglobulin superfamily of cell adhesion proteins implicated in the process of neuronal outgrowth, cell adhesion and subdomain target recognition. IgLONs form homophilic and heterophilic complexes on the cell surface that repress or promote growth depending on the neuronal population, the developmental stage and surface repertoire of IgLON family members. In the present study, we identified a metalloproteinase-dependent mechanism necessary to promote growth in embryonic dorsal root ganglion cells (DRGs). Treatment of embryonic DRG neurons with pan-metalloproteinase inhibitors, tissue inhibitor of metalloproteinase-3, or an inhibitor of ADAM Metallopeptidase Domain 10 (ADAM10) reduces outgrowth from DRG neurons indicating that metalloproteinase activity is important for outgrowth. The IgLON family members Neurotrimin (NTM) and Limbic System-Associated Membrane Protein (LSAMP) were identified as ADAM10 substrates that are shed from the cell surface of DRG neurons. Overexpression of LSAMP and NTM suppresses outgrowth from DRG neurons. Furthermore, LSAMP loss of function decreases the outgrowth sensitivity to an ADAM10 inhibitor. Together our findings support a role for ADAM-dependent shedding of cell surface LSAMP in promoting outgrowth from DRG neurons.
Energy Technology Data Exchange (ETDEWEB)
Kim, Min-Sung; Saunders, Adam M.; Hamaoka, Brent Y.; Beachy, Philip A.; Leahy, Daniel J. (Stanford-MED); (JHU)
2011-09-20
Glypicans are heparan sulfate proteoglycans that modulate the signaling of multiple growth factors active during animal development, and loss of glypican function is associated with widespread developmental abnormalities. Glypicans consist of a conserved, approximately 45-kDa N-terminal protein core region followed by a stalk region that is tethered to the cell membrane by a glycosyl-phosphatidylinositol anchor. The stalk regions are predicted to be random coil but contain a variable number of attachment sites for heparan sulfate chains. Both the N-terminal protein core and the heparan sulfate attachments are important for glypican function. We report here the 2.4-{angstrom} crystal structure of the N-terminal protein core region of the Drosophila glypican Dally-like (Dlp). This structure reveals an elongated, {alpha}-helical fold for glypican core regions that does not appear homologous to any known structure. The Dlp core protein is required for normal responsiveness to Hedgehog (Hh) signals, and we identify a localized region on the Dlp surface important for mediating its function in Hh signaling. Purified Dlp protein core does not, however, interact appreciably with either Hh or an Hh:Ihog complex.
Genetic recombination is targeted towards gene promoter regions in dogs.
Auton, Adam; Rui Li, Ying; Kidd, Jeffrey; Oliveira, Kyle; Nadel, Julie; Holloway, J Kim; Hayward, Jessica J; Cohen, Paula E; Greally, John M; Wang, Jun; Bustamante, Carlos D; Boyko, Adam R
2013-01-01
The identification of the H3K4 trimethylase, PRDM9, as the gene responsible for recombination hotspot localization has provided considerable insight into the mechanisms by which recombination is initiated in mammals. However, uniquely amongst mammals, canids appear to lack a functional version of PRDM9 and may therefore provide a model for understanding recombination that occurs in the absence of PRDM9, and thus how PRDM9 functions to shape the recombination landscape. We have constructed a fine-scale genetic map from patterns of linkage disequilibrium assessed using high-throughput sequence data from 51 free-ranging dogs, Canis lupus familiaris. While broad-scale properties of recombination appear similar to other mammalian species, our fine-scale estimates indicate that canine highly elevated recombination rates are observed in the vicinity of CpG rich regions including gene promoter regions, but show little association with H3K4 trimethylation marks identified in spermatocytes. By comparison to genomic data from the Andean fox, Lycalopex culpaeus, we show that biased gene conversion is a plausible mechanism by which the high CpG content of the dog genome could have occurred.
Secreted Frizzled related protein-4 (sFRP4) promotes epidermal differentiation and apoptosis
International Nuclear Information System (INIS)
Maganga, Richard; Giles, Natalie; Adcroft, Katharine; Unni, Ambili; Keeney, Diane; Wood, Fiona; Fear, Mark; Dharmarajan, Arunasalam
2008-01-01
The skin provides vital protection from infection and dehydration. Maintenance of the skin is through a constant program of proliferation, differentiation and apoptosis of epidermal cells, whereby proliferating cells in the basal layer differentiating to form the keratinized, anucleated stratum corneum. The WNT signalling pathway is known to be important in the skin. WNT signalling has been shown to be important both in epidermal development and in the maintenance and cycling of hair follicles and epidermal stem cells. However, the precise role for this pathway in epidermal differentiation remains unknown. We investigated the role of the WNT signalling inhibitor sFRP4 in epidermal differentiation. sFRP4 is expressed in both normal skin and keratinocytes in culture. Expression of sFRP4 mRNA and protein increases with keratinocyte differentiation and apoptosis, whilst exposure of keratinocytes to exogenous sFRP4 promotes apoptosis and expression of the terminal differentiation marker Involucrin. These data suggest sFRP4 promotes epidermal differentiation.
Xie, Hongbo; Vucetic, Slobodan; Iakoucheva, Lilia M.; Oldfield, Christopher J.; Dunker, A. Keith; Uversky, Vladimir N.; Obradovic, Zoran
2008-01-01
Identifying relationships between function, amino acid sequence and protein structure represents a major challenge. In this study we propose a bioinformatics approach that identifies functional keywords in the Swiss-Prot database that correlate with intrinsic disorder. A statistical evaluation is employed to rank the significance of these correlations. Protein sequence data redundancy and the relationship between protein length and protein structure were taken into consideration to ensure the quality of the statistical inferences. Over 200,000 proteins from Swiss-Prot database were analyzed using this approach. The predictions of intrinsic disorder were carried out using PONDR VL3E predictor of long disordered regions that achieves an accuracy of above 86%. Overall, out of the 710 Swiss-Prot functional keywords that were each associated with at least 20 proteins, 238 were found to be strongly positively correlated with predicted long intrinsically disordered regions, whereas 302 were strongly negatively correlated with such regions. The remaining 170 keywords were ambiguous without strong positive or negative correlation with the disorder predictions. These functions cover a large variety of biological activities and imply that disordered regions are characterized by a wide functional repertoire. Our results agree well with literature findings, as we were able to find at least one illustrative example of functional disorder or order shown experimentally for the vast majority of keywords showing the strongest positive or negative correlation with intrinsic disorder. This work opens a series of three papers, which enriches the current view of protein structure-function relationships, especially with regards to functionalities of intrinsically disordered proteins and provides researchers with a novel tool that could be used to improve the understanding of the relationships between protein structure and function. The first paper of the series describes our statistical
The Murine Factor H-Related Protein FHR-B Promotes Complement Activation
Directory of Open Access Journals (Sweden)
Marcell Cserhalmi
2017-09-01
Full Text Available Factor H-related (FHR proteins consist of varying number of complement control protein domains that display various degrees of sequence identity to respective domains of the alternative pathway complement inhibitor factor H (FH. While such FHR proteins are described in several species, only human FHRs were functionally investigated. Their biological role is still poorly understood and in part controversial. Recent studies on some of the human FHRs strongly suggest a role for FHRs in enhancing complement activation via competing with FH for binding to certain ligands and surfaces. The aim of the current study was the functional characterization of a murine FHR, FHR-B. To this end, FHR-B was expressed in recombinant form. Recombinant FHR-B bound to human C3b and was able to compete with human FH for C3b binding. FHR-B supported the assembly of functionally active C3bBb alternative pathway C3 convertase via its interaction with C3b. This activity was confirmed by demonstrating C3 activation in murine serum. In addition, FHR-B bound to murine pentraxin 3 (PTX3, and this interaction resulted in murine C3 fragment deposition due to enhanced complement activation in mouse serum. FHR-B also induced C3 deposition on C-reactive protein, the extracellular matrix (ECM extract Matrigel, and endothelial cell-derived ECM when exposed to mouse serum. Moreover, mouse C3 deposition was strongly enhanced on necrotic Jurkat T cells and the mouse B cell line A20 by FHR-B. FHR-B also induced lysis of sheep erythrocytes when incubated in mouse serum with FHR-B added in excess. Altogether, these data demonstrate that, similar to human FHR-1 and FHR-5, mouse FHR-B modulates complement activity by promoting complement activation via interaction with C3b and via competition with murine FH.
DEFF Research Database (Denmark)
Madsen, Hans Peter Lynge; Hammer, Karin
1998-01-01
to a phage repressor, a single-stranded DNA-binding protein, a topoisomerase, a Cro-like protein and two other phage proteins of unknown function were detected. The gene arrangement in the early transcribed region of TP901-1 thus consists of two transcriptional units: one from PR containing four genes......, of which at least two (the integrase gene and putative repressor) are needed for lysogeny, and the divergent and longer transcriptional unit from PL, presumably encoding functions required for the lytic life cycle. ORFs with homology to proteins involved in DNA replication were identified on the latter......Transcriptional analysis by Northern blotting identified clusters of early, middle and late transcribed regions of the temperate lactococcal bacteriophage TP901-1 during one-step growth experiments. The latent period was found to be 65 min and the burst size 40 +/- 10. The eight early transcripts...
Souza, E M; Pedrosa, F O; Rigo, L U; Machado, H B; Yates, M G
2000-06-01
The nifA promoter of Herbaspirillum seropedicae contains potential NtrC, NifA and IHF binding sites together with a -12/-24 sigma(N)-dependent promoter. This region has now been investigated by deletion mutagenesis for the effect of NtrC and NifA on the expression of a nifA::lacZ fusion. A 5' end to the RNA was identified at position 641, 12 bp downstream from the -12/-24 promoter. Footprinting experiments showed that the G residues at positions -26 and -9 are hypermethylated, and that the region from -10 to +10 is partially melted under nitrogen-fixing conditions, confirming that this is the active nifA promoter. In H. seropedicae nifA expression from the sigma(N)-dependent promoter is repressed by fixed nitrogen but not by oxygen and is probably activated by the NtrC protein. NifA protein is apparently not essential for nifA expression but it can still bind the NifA upstream activating sequence.
International Nuclear Information System (INIS)
Rauscher, Garth H.; Kresovich, Jacob K.; Poulin, Matthew; Yan, Liying; Macias, Virgilia; Mahmoud, Abeer M.; Al-Alem, Umaima; Kajdacsy-Balla, Andre; Wiley, Elizabeth L.; Tonetti, Debra; Ehrlich, Melanie
2015-01-01
Breast cancer formation is associated with frequent changes in DNA methylation but the extent of very early alterations in DNA methylation and the biological significance of cancer-associated epigenetic changes need further elucidation. Pyrosequencing was done on bisulfite-treated DNA from formalin-fixed, paraffin-embedded sections containing invasive tumor and paired samples of histologically normal tissue adjacent to the cancers as well as control reduction mammoplasty samples from unaffected women. The DNA regions studied were promoters (BRCA1, CD44, ESR1, GSTM2, GSTP1, MAGEA1, MSI1, NFE2L3, RASSF1A, RUNX3, SIX3 and TFF1), far-upstream regions (EN1, PAX3, PITX2, and SGK1), introns (APC, EGFR, LHX2, RFX1 and SOX9) and the LINE-1 and satellite 2 DNA repeats. These choices were based upon previous literature or publicly available DNA methylome profiles. The percent methylation was averaged across neighboring CpG sites. Most of the assayed gene regions displayed hypermethylation in cancer vs. adjacent tissue but the TFF1 and MAGEA1 regions were significantly hypomethylated (p ≤0.001). Importantly, six of the 16 regions examined in a large collection of patients (105 – 129) and in 15-18 reduction mammoplasty samples were already aberrantly methylated in adjacent, histologically normal tissue vs. non-cancerous mammoplasty samples (p ≤0.01). In addition, examination of transcriptome and DNA methylation databases indicated that methylation at three non-promoter regions (far-upstream EN1 and PITX2 and intronic LHX2) was associated with higher gene expression, unlike the inverse associations between cancer DNA hypermethylation and cancer-altered gene expression usually reported. These three non-promoter regions also exhibited normal tissue-specific hypermethylation positively associated with differentiation-related gene expression (in muscle progenitor cells vs. many other types of normal cells). The importance of considering the exact DNA region analyzed and the
Mohammadpur, Ahmad; Rezaei, Mehdi; Sadeghi, Rasoul
2010-05-14
The aim of this qualitative study is to explore the way people using modern health care perceive its consequences in Ouraman-e-Takht region of Iranian Kurdistan. Ouraman-e-Takht is a rural, highly mountainous and dry region located in the southwest Kurdistan province of Iran. Recently, modern health practices have been introduced to the region. The purpose of this study was to investigate, from the Ouramains' point of view, the impact that modern health services and practices have had on the Ouraman traditional way of life. Interview data from respondents were analyzed by using grounded theory. Promoting survival was the core category that explained the impact that modern health practices have had on the Ouraman region. The people of Ouraman interpreted modern health practices as increasing their quality of life and promoting their survival. Results are organized around this core category in a paradigm model consisting of conditions, interactions, and consequences. This model can be used to understand the impact of change from the introduction of modern health on a traditional society.
Mohammadpur, Ahmad; Rezaei, Mehdi; Sadeghi, Rasoul
2010-01-01
The aim of this qualitative study is to explore the way people using modern health care perceive its consequences in Ouraman-e-Takht region of Iranian Kurdistan. Ouraman-e-Takht is a rural, highly mountainous and dry region located in the southwest Kurdistan province of Iran. Recently, modern health practices have been introduced to the region. The purpose of this study was to investigate, from the Ouramains' point of view, the impact that modern health services and practices have had on the Ouraman traditional way of life. Interview data from respondents were analyzed by using grounded theory. Promoting survival was the core category that explained the impact that modern health practices have had on the Ouraman region. The people of Ouraman interpreted modern health practices as increasing their quality of life and promoting their survival. Results are organized around this core category in a paradigm model consisting of conditions, interactions, and consequences. This model can be used to understand the impact of change from the introduction of modern health on a traditional society. PMID:20640020
Babault, Nicolas; Païzis, Christos; Deley, Gaëlle; Guérin-Deremaux, Laetitia; Saniez, Marie-Hélène; Lefranc-Millot, Catherine; Allaert, François A
2015-01-01
The effects of protein supplementation on muscle thickness and strength seem largely dependent on its composition. The current study aimed at comparing the impact of an oral supplementation with vegetable Pea protein (NUTRALYS®) vs. Whey protein and Placebo on biceps brachii muscle thickness and strength after a 12-week resistance training program. One hundred and sixty one males, aged 18 to 35 years were enrolled in the study and underwent 12 weeks of resistance training on upper limb muscles. According to randomization, they were included in the Pea protein (n = 53), Whey protein (n = 54) or Placebo (n = 54) group. All had to take 25 g of the proteins or placebo twice a day during the 12-week training period. Tests were performed on biceps muscles at inclusion (D0), mid (D42) and post training (D84). Muscle thickness was evaluated using ultrasonography, and strength was measured on an isokinetic dynamometer. Results showed a significant time effect for biceps brachii muscle thickness (P Pea, Whey and Placebo, respectively; P Pea group as compared to Placebo whereas there was no difference between Whey and the two other conditions. Muscle strength also increased with time with no statistical difference between groups. In addition to an appropriate training, the supplementation with pea protein promoted a greater increase of muscle thickness as compared to Placebo and especially for people starting or returning to a muscular strengthening. Since no difference was obtained between the two protein groups, vegetable pea proteins could be used as an alternative to Whey-based dietary products. The present trial has been registered at ClinicalTrials.gov (NCT02128516).
International Nuclear Information System (INIS)
Zhang, H.; Chen, K.Y.; Liu, A.Y.C.
1987-01-01
The regulation of specific protein synthesis by the phorbol ester tumor promoter, 12-O-tetradecanoyl-phorbol-13-acetate (TPA), was evaluated using the L-8 and C-2 myoblast and the 3T3-L1 fibroblast cell cultures. TPA increased, by 2-4 fold, the synthesis rates of two cytoplasmic proteins with apparent molecular weights of 89,000 and 74,000 as determined by SDS-polyacrylamide gel electrophoresis and autoradiography. The concentration of TPA and the time of incubation needed to elicit this induction was determined to be 10 μg/ml and 20 hrs, respectively. Increasing the concentration of TPA to 100, 200, and 500 ng/ml did not result in a greater magnitude of induction. The possibility that these two TPA-induced proteins may be identical to proteins with similar molecular weights induced under heat-shocked or glucose-starved conditions was evaluated by 1-D and 2-D gel electrophoresis and autoradiography. Results provided evidence that the TPA-induced 89,000- and 74,000-dalton proteins were identical to hsp 89 and hsp 74, 2 out of a set of 8-9 proteins induced under heat shocked conditions. Furthermore, they are identical to two of the set of glucose-regulated proteins induced under a glucose-starved condition
Regulatory elements in the promoter region of the rat gene encoding the acyl-CoA-binding protein
DEFF Research Database (Denmark)
Elholm, M; Bjerking, G; Knudsen, J
1996-01-01
for the ACBP DR-1 element. Addition of peroxisome proliferators (PP) to H4IIEC3 rat hepatoma cells led to an increase in the ACBP mRNA level, indicating that the DR-1 element could be a functional peroxisome proliferator responsive element (PPRE). Analysis of the ACBP promoter by transient transfection showed...
International Nuclear Information System (INIS)
Jully, Babu; Vijayalakshmi, Ramshankar; Gopal, Gopisetty; Sabitha, Kesavan; Rajkumar, Thangarajan
2012-01-01
Ewing’s sarcoma is a malignancy characterized by a specific 11:22 chromosomal translocation which generates a novel EWS-FLI1 fusion protein functioning as an aberrant transcription factor. In the present study, we have further characterized the junction region of the EWS-FLI1 fusion protein. In-silico model of EWS-FLI1 fusion protein was analysed for ligand binding sites, and a putative region (amino acid (aa) 251–343 of the type 1 fusion protein) in the vicinity of the fusion junction was cloned and expressed using bacterial expression. The recombinant protein was characterized by Circular Dichroism (CD). We then expressed aa 251–280 ectopically in Ewing’s sarcoma cell-line and its effect on cell proliferation, tumorigenicity and expression of EWS-FLI1 target genes were analysed. Our modelling analysis indicated that Junction region (aa 251–343) encompasses potential ligand biding sites in the EWS-FLI1 protein and when expressed in bacteria was present as soluble form. Ectopically expressing this region in Ewing’s sarcoma cells inhibited tumorigenicity, and EWS-FLI1 target genes indicating a dominant negative biological effect. Junction region can be exploited further as target for drug development in future to specifically target EWS-FLI1 in Ewing’s Sarcoma
Pengaruh Penggunaan Formalin terhadap Kerusakan Protein Daging Ikan Tuna (Thunus sp)
Apituley, Daniel A. N.
2012-01-01
Formaldehyde is used on handling and processing of fishery product by some fisher at some coastal region of Indonesia was one that promotes protein oxidation and modification of protein structure of fish meat which give direct impact on nutritional quality of fish primarily the amino acids. This experiment was done in vitro experiment by using model of protein preparat of red and white meat of tuna. The purpose of this research was to study the effect of formaldehyde concentration and impact ...
Institute of Scientific and Technical Information of China (English)
Chuandong Zheng; Xi Gu; Zhimei Zhong; Rui Zhu; Tianming Gao; Fang Wang
2012-01-01
In this study, we employed chromatin immunoprecipitation, a useful method for studying the locations of transcription factors bound to specific DNA regions in specific cells, to investigate amyloid precursor protein intracellular domain binding sites in chromatin DNA from hippocampal neurons of rats, and to screen out five putative genes associated with the learning and memory functions. The promoter regions of the calcium/calmodulin-dependent protein kinase II alpha and glutamate receptor-2 genes were amplified by PCR from DNA products immunoprecipitated by amyloid precursor protein intracellular domain. An electrophoretic mobility shift assay and western blot analysis suggested that the promoter regions of these two genes associated with learning and memory were bound by amyloid precursor protein intracellular domain (in complex form). Our experimental findings indicate that the amyloid precursor protein intracellular domain is involved in the transcriptional regulation of learning- and memory-associated genes in hippocampal neurons. These data may provide new insights into the molecular mechanism underlying the symptoms of progressive memory loss in Alzheimer's disease.
Yang, X J; Yuan, Y Z; Niu, Q
2016-04-20
To investigate the association between serum aluminium level and methylation of the promoter region of amyloid precursor protein (APP)gene in workers engaged in aluminium electrolysis. In 2012, 366 electrolysis workers in an aluminium factory were enrolled as exposure group (working years >10 and age >40 years)and divided into low-exposure group and high-exposure group based on the median serum aluminium level. Meanwhile, 102 workers in a cement plant not exposed to aluminium were enrolled as control group. Graphite furnace atomic absorption spectrometry was used to measure serum aluminium level, methylation specific PCR was used to measure the methylation rate of the promoter region of APP gene, and ELI-SA was used to measure the protein expression of APP in lymphocytes in peripheral blood. The exposure group had a significantly higher serum aluminium level than the control group (45.07 μg/L vs 30.51 μg/L, P0.05). The multivariate logistic regression analysis showed that with reference to the control group, low aluminium exposure (OR=1.86, 95% CI 1.67~3.52)and high aluminium exposure (OR=2.98, 95% CI 1.97~4.15)were risk factors for a reduced methylation rate of the promoter region of APP gene. Reduced methylation of the promoter region of APP gene may be associated with increased serum aluminium level, and downregulated methylation of the promoter region of APP gene may accelerate APP gene transcription.
DNA-binding properties of the Bacillus subtilis and Aeribacillus pallidus AC6 σ(D) proteins.
Sevim, Elif; Gaballa, Ahmed; Beldüz, A Osman; Helmann, John D
2011-01-01
σ(D) proteins from Aeribacillus pallidus AC6 and Bacillus subtilis bound specifically, albeit weakly, to promoter DNA even in the absence of core RNA polymerase. Binding required a conserved CG motif within the -10 element, and this motif is known to be recognized by σ region 2.4 and critical for promoter activity.
Takasaki, Hironori; Mahmood, Tariq; Matsuoka, Makoto; Matsumoto, Hiroshi; Komatsu, Setsuko
2008-04-01
Gibberellins (GAs) regulate growth and development in higher plants. To identify GA-regulated proteins during rice leaf sheath elongation, a proteomic approach was used. Proteins from the basal region of leaf sheath in rice seedling treated with GA(3) were analyzed by fluorescence two-dimensional difference gel electrophoresis. The levels of abscisic acid-stress-ripening-inducible 5 protein (ASR5), elongation factor-1 beta, translationally controlled tumor protein, fructose-bisphosphate aldolase and a novel protein increased; whereas the level of RuBisCO subunit binding-protein decreased by GA(3) treatment. ASR5 out of these six proteins was significantly regulated by GA(3) at the protein level but not at the mRNA level in the basal region of leaf sheaths. Since this protein is regulated not only by abscisic acid but also by GA(3), these results indicate that ASR5 might be involved in plant growth in addition to stress in the basal regions of leaf sheaths.
Pradhan, Mohan R; Pal, Arumay; Hu, Zhongqiao; Kannan, Srinivasaraghavan; Chee Keong, Kwoh; Lane, David P; Verma, Chandra S
2016-02-01
Aggregation is an irreversible form of protein complexation and often toxic to cells. The process entails partial or major unfolding that is largely driven by hydration. We model the role of hydration in aggregation using "Dehydrons." "Dehydrons" are unsatisfied backbone hydrogen bonds in proteins that seek shielding from water molecules by associating with ligands or proteins. We find that the residues at aggregation interfaces have hydrated backbones, and in contrast to other forms of protein-protein interactions, are under less evolutionary pressure to be conserved. Combining evolutionary conservation of residues and extent of backbone hydration allows us to distinguish regions on proteins associated with aggregation (non-conserved dehydron-residues) from other interaction interfaces (conserved dehydron-residues). This novel feature can complement the existing strategies used to investigate protein aggregation/complexation. © 2015 Wiley Periodicals, Inc.
Tanaka, H; Sagisaka, A; Suzuki, N; Yamakawa, M
2016-10-01
E26 transformation-specific (Ets) family transcription factors are known to play roles in various biological phenomena, including immunity, in vertebrates. However, the mechanisms by which Ets proteins contribute to immunity in invertebrates remain poorly understood. In this study, we identified a cDNA encoding BmEts2, which is a putative orthologue of Drosophila Yan and human translocation-ets-leukemia/Ets-variant gene 6, from the silkworm Bombyx mori. Expression of the BmEts2 gene was significantly increased in the fat bodies of silkworm larvae in response to injection with Escherichia coli and Staphylococcus aureus. BmEts2 overexpression dramatically repressed B. mori Rels (BmRels)-mediated promoter activation of antimicrobial peptide genes in silkworm cells. Conversely, gene knockdown of BmEts2 significantly enhanced BmRels activity. In addition, two κB sites located on the 5' upstream region of cecropin B1 were found to be involved in the repression of BmRels-mediated promoter activation. Protein-competition analysis further demonstrated that BmEts2 competitively inhibited binding of BmRels to κB sites. Overall, BmEts2 acts as a repressor of BmRels-mediated transactivation of antimicrobial protein genes by inhibiting the binding of BmRels to κB sites. © 2016 The Royal Entomological Society.
Transport proteins promoting Escherichia coli pathogenesis
Tang, Fengyi; Saier, Milton H.
2014-01-01
Escherichia coli is a genetically diverse species infecting hundreds of millions of people worldwide annually. We examined seven well-characterized E. coli pathogens causing urinary tract infections, gastroenteritis, pyelonephritis and haemorrhagic colitis. Their transport proteins were identified and compared with each other and a non-pathogenic E. coli K12 strain to identify transport proteins related to pathogenesis. Each pathogen possesses a unique set of protein secretion systems for export to the cell surface or for injecting effector proteins into host cells. Pathogens have increased numbers of iron siderophore receptors and ABC iron uptake transporters, but the numbers and types of low-affinity secondary iron carriers were uniform in all strains. The presence of outer membrane iron complex receptors and high-affinity ABC iron uptake systems correlated, suggesting co-evolution. Each pathovar encodes a different set of pore-forming toxins and virulence-related outer membrane proteins lacking in K12. Intracellular pathogens proved to have a characteristically distinctive set of nutrient uptake porters, different from those of extracellular pathogens. The results presented in this report provide information about transport systems relevant to various types of E. coli pathogenesis that can be exploited in future basic and applied studies. PMID:24747185
Transport proteins promoting Escherichia coli pathogenesis.
Tang, Fengyi; Saier, Milton H
2014-01-01
Escherichia coli is a genetically diverse species infecting hundreds of millions of people worldwide annually. We examined seven well-characterized E. coli pathogens causing urinary tract infections, gastroenteritis, pyelonephritis and haemorrhagic colitis. Their transport proteins were identified and compared with each other and a non-pathogenic E. coli K12 strain to identify transport proteins related to pathogenesis. Each pathogen possesses a unique set of protein secretion systems for export to the cell surface or for injecting effector proteins into host cells. Pathogens have increased numbers of iron siderophore receptors and ABC iron uptake transporters, but the numbers and types of low-affinity secondary iron carriers were uniform in all strains. The presence of outer membrane iron complex receptors and high-affinity ABC iron uptake systems correlated, suggesting co-evolution. Each pathovar encodes a different set of pore-forming toxins and virulence-related outer membrane proteins lacking in K12. Intracellular pathogens proved to have a characteristically distinctive set of nutrient uptake porters, different from those of extracellular pathogens. The results presented in this report provide information about transport systems relevant to various types of E. coli pathogenesis that can be exploited in future basic and applied studies. Copyright © 2014 Elsevier Ltd. All rights reserved.
DEFF Research Database (Denmark)
Gyan, B A; Goka, B; Cvetkovic, J T
2004-01-01
Immunoglobulin E has been associated with severe malaria suggesting a regulatory role for interleukin (IL)-4 and/or IgE in the pathogenesis of severe malaria. We have investigated possible associations between polymorphisms in the IL-4 repeat region (intron 3) and promoter regions (IL-4 +33CT and...
Lee, C A; Silva, M; Siber, A M; Kelly, A J; Galyov, E; McCormick, B A
2000-10-24
In response to Salmonella typhimurium, the intestinal epithelium generates an intense inflammatory response consisting largely of polymorphonuclear leukocytes (neutrophils, PMN) migrating toward and ultimately across the epithelial monolayer into the intestinal lumen. It has been shown that bacterial-epithelial cell interactions elicit the production of inflammatory regulators that promote transepithelial PMN migration. Although S. typhimurium can enter intestinal epithelial cells, bacterial internalization is not required for the signaling mechanisms that induce PMN movement. Here, we sought to determine which S. typhimurium factors and intestinal epithelial signaling pathways elicit the production of PMN chemoattractants by enterocytes. Our results suggest that S. typhimurium activates a protein kinase C-dependent signal transduction pathway that orchestrates transepithelial PMN movement. We show that the type III effector protein, SipA, is not only necessary but is sufficient to induce this proinflammatory response in epithelial cells. Our results force us to reconsider the long-held view that Salmonella effector proteins must be directly delivered into host cells from bacterial cells.
Armadillo Repeat Containing 8α Binds to HRS and Promotes HRS Interaction with Ubiquitinated Proteins
Tomaru, Koji; Ueda, Atsuhisa; Suzuki, Takeyuki; Kobayashi, Nobuaki; Yang, Jun; Yamamoto, Masaki; Takeno, Mitsuhiro; Kaneko, Takeshi; Ishigatsubo, Yoshiaki
2010-01-01
Recently, we reported that a complex with an essential role in the degradation of Fructose-1,6-bisphosphatase in yeast is well conserved in mammalian cells; we named this mammalian complex C-terminal to the Lissencephaly type-1-like homology (CTLH) complex. Although the function of the CTLH complex remains unclear, here we used yeast two-hybrid screening to isolate Hepatocyte growth factor-regulated tyrosine kinase substrate (HRS) as a protein binding to a key component of CTLH complex, Armadillo repeat containing 8 (ARMc8) α. The association was confirmed by a yeast two-hybrid assay and a co-immunoprecipitation assay. The proline-rich domain of HRS was essential for the association. As demonstrated through immunofluorescence microscopy, ARMc8α co-localized with HRS. ARMc8α promoted the interaction of HRS with various ubiquitinated proteins through the ubiquitin-interacting motif. These findings suggest that HRS mediates protein endosomal trafficking partly through its interaction with ARMc8α. PMID:20224683
Shinzato, Naoya; Enoki, Miho; Sato, Hiroaki; Nakamura, Kohei; Matsui, Toru; Kamagata, Yoichi
2008-10-01
Two methyl coenzyme M reductases (MCRs) encoded by the mcr and mrt operons of the hydrogenotrophic methanogen Methanothermobacter thermautotrophicus DeltaH are expressed in response to H(2) availability. In the present study, cis elements and trans-acting factors responsible for the gene expression of MCRs were investigated by using electrophoretic mobility shift assay (EMSA) and affinity particle purification. A survey of their operator regions by EMSA with protein extracts from mrt-expressing cultures restricted them to 46- and 41-bp-long mcr and mrt upstream regions, respectively. Affinity particle purification of DNA-binding proteins conjugated with putative operator regions resulted in the retrieval of a protein attributed to IMP dehydrogenase-related protein VII (IMPDH VII). IMPDH VII is predicted to have a winged helix-turn-helix DNA-binding motif and two cystathionine beta-synthase domains, and it has been suspected to be an energy-sensing module. EMSA with oligonucleotide probes with unusual sequences showed that the binding site of IMPDH VII mostly overlaps the factor B-responsible element-TATA box of the mcr operon. The results presented here suggest that IMPDH VII encoded by MTH126 is a plausible candidate for the transcriptional regulator of the mcr operon in this methanogen.
Kohno, K; Yasuzawa, K; Hirose, M; Kano, Y; Goshima, N; Tanaka, H; Imamoto, F
1994-06-01
The molecular mechanism of autoregulation of expression of the hupA gene in Escherichia coli was examined. The promoter of the gene contains a palindromic sequence with the potential to form a cruciform DNA structure in which the -35 sequence lies at the base of the stem and the -10 sequence forms a single-stranded loop. An artificial promoter lacking the palindrome, which was constructed by replacing a 10 nucleotide repeat for the predicted cruciform arm by a sequence in the opposite orientation, was not subject to HU-repression. DNA relaxation induced by deleting HU proteins and/or inhibiting DNA gyrase in cells results in increased expression from the hupA promoter. We propose that initiation of transcription of the hupA gene is negatively regulated by steric hindrance of the functional promoter domains for formation of the cruciform configuration, which is facilitated at least in part by negative supercoiling of the hupA promoter DNA region. The promoter region of the hupB gene also contains a palindromic sequence that can assume a cruciform configuration. Negative regulation of this gene by HU proteins may occur by a mechanism similar to that operating for the hupA gene.
Directory of Open Access Journals (Sweden)
Inger Lindin
2014-03-01
Full Text Available The mitogen-activated protein kinase-activated protein kinase MK5 is a substrate of the mitogen-activated protein kinases p38, ERK3 and ERK4. Cell culture and animal studies have demonstrated that MK5 is involved in tumour suppression and promotion, embryogenesis, anxiety, cell motility and cell cycle regulation. In the present study, homology models of MK5 were used for molecular dynamics (MD simulations of: (1 MK5 alone; (2 MK5 in complex with an inhibitor; and (3 MK5 in complex with the interaction partner p38α. The calculations showed that the inhibitor occupied the active site and disrupted the intramolecular network of amino acids. However, intramolecular interactions consistent with an inactive protein kinase fold were not formed. MD with p38α showed that not only the p38 docking region, but also amino acids in the activation segment, αH helix, P-loop, regulatory phosphorylation region and the C-terminal of MK5 may be involved in forming a very stable MK5-p38α complex, and that p38α binding decreases the residual fluctuation of the MK5 model. Electrostatic Potential Surface (EPS calculations of MK5 and p38α showed that electrostatic interactions are important for recognition and binding.
Koike, Eiko; Yanagisawa, Rie; Takigami, Hidetaka; Takano, Hirohisa
2014-03-01
Polybrominated diphenyl ethers (PBDEs) are widely used as flame retardants in consumer products. Humans can be exposed to PBDEs mainly through the inhalation of air or dust. Thus, PBDEs can affect respiratory and immune systems. In the present study, we investigated whether PBDEs stimulate bronchial epithelial cells. We examined commercial penta-BDE (DE-71), octa-BDE (DE-79), and deca-BDE (DE-83R). Human bronchial epithelial cells (BEAS-2B) were exposed to each PBDE for 24h. Subsequently, the expression of intercellular adhesion molecule-1 (ICAM-1) and proinflammatory cytokines were investigated. DE-71 and DE-79, but not DE-83R, significantly increased the expression of ICAM-1, interleukin-6 (IL-6), and IL-8 in BEAS-2B. Because these remarkable effects were observed with DE-71, we further investigated the underlying intracellular mechanisms. DE-71 promoted epidermal growth factor receptor (EGFR) phosphorylation. Inhibitors of EGFR-selective tyrosine kinase and p38 mitogen-activated protein kinase effectively blocked the increase of IL-6 and IL-8. Furthermore, antagonists of thyroid hormone receptor and aryl hydrocarbon receptor significantly suppressed the increase in IL-6 and/or IL-8 production. In conclusion, penta- and octa-BDE, but not deca-BDE, might promote the expression of proinflammatory proteins in bronchial epithelial cells possibly by activating protein kinases and/or stimulating nuclear receptors related to subsequent activation of transcriptional factors. Copyright © 2013 Elsevier Ltd. All rights reserved.
Analysis of the promoters involved in enterocin AS-48 expression.
Cebrián, Rubén; Rodríguez-Ruano, Sonia; Martínez-Bueno, Manuel; Valdivia, Eva; Maqueda, Mercedes; Montalbán-López, Manuel
2014-01-01
The enterocin AS-48 is the best characterized antibacterial circular protein in prokaryotes. It is a hydrophobic and cationic bacteriocin, which is ribosomally synthesized by enterococcal cells and post-translationally cyclized by a head-to-tail peptide bond. The production of and immunity towards AS-48 depend upon the coordinated expression of ten genes organized in two operons, as-48ABC (where genes encoding enzymes with processing, secretion, and immunity functions are adjacent to the structural as-48A gene) and as-48C1DD1EFGH. The current study describes the identification of the promoters involved in AS-48 expression. Seven putative promoters have been here amplified, and separately inserted into the promoter-probe vector pTLR1, to create transcriptional fusions with the mCherry gene used as a reporter. The activity of these promoter regions was assessed measuring the expression of the fluorescent mCherry protein using the constitutive pneumococcal promoter PX as a reference. Our results revealed that only three promoters PA, P2(2) and PD1 were recognized in Enterococcus faecalis, Lactococcus lactis and Escherichia coli, in the conditions tested. The maximal fluorescence was obtained with PX in all the strains, followed by the P2(2) promoter, which level of fluorescence was 2-fold compared to PA and 4-fold compared to PD1. Analysis of putative factors influencing the promoter activity in single and double transformants in E. faecalis JH2-2 demonstrated that, in general, a better expression was achieved in presence of pAM401-81. In addition, the P2(2) promoter could be regulated in a negative fashion by genes existing in the native pMB-2 plasmid other than those of the as-48 cluster, while the pH seems to affect differently the as-48 promoter expression.
Analysis of the promoters involved in enterocin AS-48 expression.
Directory of Open Access Journals (Sweden)
Rubén Cebrián
Full Text Available The enterocin AS-48 is the best characterized antibacterial circular protein in prokaryotes. It is a hydrophobic and cationic bacteriocin, which is ribosomally synthesized by enterococcal cells and post-translationally cyclized by a head-to-tail peptide bond. The production of and immunity towards AS-48 depend upon the coordinated expression of ten genes organized in two operons, as-48ABC (where genes encoding enzymes with processing, secretion, and immunity functions are adjacent to the structural as-48A gene and as-48C1DD1EFGH. The current study describes the identification of the promoters involved in AS-48 expression. Seven putative promoters have been here amplified, and separately inserted into the promoter-probe vector pTLR1, to create transcriptional fusions with the mCherry gene used as a reporter. The activity of these promoter regions was assessed measuring the expression of the fluorescent mCherry protein using the constitutive pneumococcal promoter PX as a reference. Our results revealed that only three promoters PA, P2(2 and PD1 were recognized in Enterococcus faecalis, Lactococcus lactis and Escherichia coli, in the conditions tested. The maximal fluorescence was obtained with PX in all the strains, followed by the P2(2 promoter, which level of fluorescence was 2-fold compared to PA and 4-fold compared to PD1. Analysis of putative factors influencing the promoter activity in single and double transformants in E. faecalis JH2-2 demonstrated that, in general, a better expression was achieved in presence of pAM401-81. In addition, the P2(2 promoter could be regulated in a negative fashion by genes existing in the native pMB-2 plasmid other than those of the as-48 cluster, while the pH seems to affect differently the as-48 promoter expression.
Directory of Open Access Journals (Sweden)
Han Lanlan
2011-10-01
Full Text Available Abstract Background Previous studies have revealed that the C-terminal region of the S-layer protein from Lactobacillus is responsible for the cell wall anchoring, which provide an approach for targeting heterologous proteins to the cell wall of lactic acid bacteria (LAB. In this study, we developed a new surface display system in lactic acid bacteria with the C-terminal region of S-layer protein SlpB of Lactobacillus crispatus K2-4-3 isolated from chicken intestine. Results Multiple sequence alignment revealed that the C-terminal region (LcsB of Lb. crispatus K2-4-3 SlpB had a high similarity with the cell wall binding domains SA and CbsA of Lactobacillus acidophilus and Lb. crispatus. To evaluate the potential application as an anchoring protein, the green fluorescent protein (GFP or beta-galactosidase (Gal was fused to the N-terminus of the LcsB region, and the fused proteins were successfully produced in Escherichia coli, respectively. After mixing them with the non-genetically modified lactic acid bacteria cells, the fused GFP-LcsB and Gal-LcsB were functionally associated with the cell surface of various lactic acid bacteria tested. In addition, the binding capacity could be improved by SDS pretreatment. Moreover, both of the fused proteins could simultaneously bind to the surface of a single cell. Furthermore, when the fused DNA fragment of gfp:lcsB was inserted into the Lactococcus lactis expression vector pSec:Leiss:Nuc, the GFP could not be secreted into the medium under the control of the nisA promoter. Western blot, in-gel fluorescence assay, immunofluorescence microscopy and SDS sensitivity analysis confirmed that the GFP was successfully expressed onto the cell surface of L. lactis with the aid of the LcsB anchor. Conclusion The LcsB region can be used as a functional scaffold to target the heterologous proteins to the cell surfaces of lactic acid bacteria in vitro and in vivo, and has also the potential for biotechnological
Directory of Open Access Journals (Sweden)
Fabian Machens
2017-10-01
Full Text Available Orthogonal systems for heterologous protein expression as well as for the engineering of synthetic gene regulatory circuits in hosts like Saccharomyces cerevisiae depend on synthetic transcription factors (synTFs and corresponding cis-regulatory binding sites. We have constructed and characterized a set of synTFs based on either transcription activator-like effectors or CRISPR/Cas9, and corresponding small synthetic promoters (synPs with minimal sequence identity to the host’s endogenous promoters. The resulting collection of functional synTF/synP pairs confers very low background expression under uninduced conditions, while expression output upon induction of the various synTFs covers a wide range and reaches induction factors of up to 400. The broad spectrum of expression strengths that is achieved will be useful for various experimental setups, e.g., the transcriptional balancing of expression levels within heterologous pathways or the construction of artificial regulatory networks. Furthermore, our analyses reveal simple rules that enable the tuning of synTF expression output, thereby allowing easy modification of a given synTF/synP pair. This will make it easier for researchers to construct tailored transcriptional control systems.
International Nuclear Information System (INIS)
Kanelis, Voula; Donaldson, Logan; Muhandiram, D.R.; Rotin, Daniela; Forman-Kay, Julie D.; Kay, Lewis E.
2000-01-01
Many protein-protein interactions involve amino acid sequences containing proline-rich motifs and even poly-proline stretches. The lack of amide protons in such regions complicates assignment, since 1 HN-based triple-resonance assignment strategies cannot be employed. Two such systems that we are currently studying include an SH2 domain from the protein Crk with a region containing 9 prolines in a 14 amino acid sequence, as well as a WW domain that interacts with a proline-rich target. A modified version of the HACAN pulse scheme, originally described by Bax and co-workers [Wang et al. (1995) J. Biomol. NMR, 5, 376-382], and an experiment which correlates the intra-residue 1 H α , 13 C α / 13 C β chemical shifts with the 15 N shift of the subsequent residue are presented and applied to the two systems listed above, allowing sequential assignment of the molecules
Kim, Hyungsae
2010-10-05
Dof proteins are transcription factors that have a conserved single zinc finger DNA-binding domain. In this study, we isolated an activation tagging mutant Dof5.1-D exhibiting an upward-curling leaf phenotype due to enhanced expression of the REV gene that is required for establishing adaxialabaxial polarity. Dof5.1-D plants also had reduced transcript levels for IAA6 and IAA19 genes, indicating an altered auxin biosynthesis in Dof5.1-D. An electrophoretic mobility shift assay using the Dof5.1 DNA-binding motif and the REV promoter region indicated that the DNA-binding domain of Dof5.1 binds to a TAAAGT motif located in the 5′-distal promoter region of the REV promoter. Further, transient and chromatin immunoprecipitation assays verified binding activity of the Dof5.1 DNA-binding motif with the REV promoter. Consistent with binding assays, constitutive over-expression of the Dof5.1 DNA-binding domain in wild-type plants caused a downward-curling phenotype, whereas crossing Dof5.1-D to a rev mutant reverted the upward-curling phenotype of the Dof5.1-D mutant leaf to the wild-type. These results suggest that the Dof5.1 protein directly binds to the REV promoter and thereby regulates adaxialabaxial polarity. © 2010 Blackwell Publishing Ltd.
Kim, Hyungsae; Kim, Sungjin; Abbasi, Nazia; Bressan, Ray Anthony; Yun, Daejin; Yoo, Sangdong; Kwon, SukYun; Choi, Sangbong
2010-01-01
Dof proteins are transcription factors that have a conserved single zinc finger DNA-binding domain. In this study, we isolated an activation tagging mutant Dof5.1-D exhibiting an upward-curling leaf phenotype due to enhanced expression of the REV gene that is required for establishing adaxialabaxial polarity. Dof5.1-D plants also had reduced transcript levels for IAA6 and IAA19 genes, indicating an altered auxin biosynthesis in Dof5.1-D. An electrophoretic mobility shift assay using the Dof5.1 DNA-binding motif and the REV promoter region indicated that the DNA-binding domain of Dof5.1 binds to a TAAAGT motif located in the 5′-distal promoter region of the REV promoter. Further, transient and chromatin immunoprecipitation assays verified binding activity of the Dof5.1 DNA-binding motif with the REV promoter. Consistent with binding assays, constitutive over-expression of the Dof5.1 DNA-binding domain in wild-type plants caused a downward-curling phenotype, whereas crossing Dof5.1-D to a rev mutant reverted the upward-curling phenotype of the Dof5.1-D mutant leaf to the wild-type. These results suggest that the Dof5.1 protein directly binds to the REV promoter and thereby regulates adaxialabaxial polarity. © 2010 Blackwell Publishing Ltd.
Smith, Alias J; Chudnovsky, Lorissa; Simoes-Barbosa, Augusto; Delgadillo-Correa, Maria G; Jonsson, Zophonias O; Wohlschlegel, James A; Johnson, Patricia J
2011-04-01
A highly conserved DNA initiator (Inr) element has been the only core promoter element described in the divergent unicellular eukaryote Trichomonas vaginalis, although genome analyses reveal that only ∼75% of protein-coding genes appear to contain an Inr. In search of another core promoter element(s), a nonredundant database containing 5' untranslated regions of expressed T. vaginalis genes was searched for overrepresented DNA motifs and known eukaryotic core promoter elements. In addition to identifying the Inr, two elements that lack sequence similarity to the known protein-coding gene core promoter, motif 3 (M3) and motif 5 (M5), were identified. Mutational and functional analyses demonstrate that both are novel core promoter elements. M3 [(A/G/T)(A/G)C(G/C)G(T/C)T(T/A/G)] resembles a Myb recognition element (MRE) and is bound specifically by a unique protein with a Myb-like DNA binding domain. The M5 element (CCTTT) overlaps the transcription start site and replaces the Inr as an alternative, gene-specific initiator element. Transcription specifically initiates at the second cytosine within M5, in contrast to characteristic initiation by RNA polymerase II at an adenosine. In promoters that combine M3 with either M5 or Inr, transcription initiation is regulated by the M3 motif.
Smith, Alias J.; Chudnovsky, Lorissa; Simoes-Barbosa, Augusto; Delgadillo-Correa, Maria G.; Jonsson, Zophonias O.; Wohlschlegel, James A.; Johnson, Patricia J.
2011-01-01
A highly conserved DNA initiator (Inr) element has been the only core promoter element described in the divergent unicellular eukaryote Trichomonas vaginalis, although genome analyses reveal that only ∼75% of protein-coding genes appear to contain an Inr. In search of another core promoter element(s), a nonredundant database containing 5′ untranslated regions of expressed T. vaginalis genes was searched for overrepresented DNA motifs and known eukaryotic core promoter elements. In addition to identifying the Inr, two elements that lack sequence similarity to the known protein-coding gene core promoter, motif 3 (M3) and motif 5 (M5), were identified. Mutational and functional analyses demonstrate that both are novel core promoter elements. M3 [(A/G/T)(A/G)C(G/C)G(T/C)T(T/A/G)] resembles a Myb recognition element (MRE) and is bound specifically by a unique protein with a Myb-like DNA binding domain. The M5 element (CCTTT) overlaps the transcription start site and replaces the Inr as an alternative, gene-specific initiator element. Transcription specifically initiates at the second cytosine within M5, in contrast to characteristic initiation by RNA polymerase II at an adenosine. In promoters that combine M3 with either M5 or Inr, transcription initiation is regulated by the M3 motif. PMID:21245378
Building a pseudo-atomic model of the anaphase-promoting complex
International Nuclear Information System (INIS)
Kulkarni, Kiran; Zhang, Ziguo; Chang, Leifu; Yang, Jing; Fonseca, Paula C. A. da; Barford, David
2013-01-01
This article describes an example of molecular replacement in which atomic models are used to interpret electron-density maps determined using single-particle electron-microscopy data. The anaphase-promoting complex (APC/C) is a large E3 ubiquitin ligase that regulates progression through specific stages of the cell cycle by coordinating the ubiquitin-dependent degradation of cell-cycle regulatory proteins. Depending on the species, the active form of the APC/C consists of 14–15 different proteins that assemble into a 20-subunit complex with a mass of approximately 1.3 MDa. A hybrid approach of single-particle electron microscopy and protein crystallography of individual APC/C subunits has been applied to generate pseudo-atomic models of various functional states of the complex. Three approaches for assigning regions of the EM-derived APC/C density map to specific APC/C subunits are described. This information was used to dock atomic models of APC/C subunits, determined either by protein crystallography or homology modelling, to specific regions of the APC/C EM map, allowing the generation of a pseudo-atomic model corresponding to 80% of the entire complex
Directory of Open Access Journals (Sweden)
Geoffrey M Attardo
2014-04-01
Full Text Available Regulation of tissue and development specific gene expression patterns underlies the functional specialization of organs in multi-cellular organisms. In the viviparous tsetse fly (Glossina, the female accessory gland is specialized to generate nutrients in the form of a milk-like secretion to support growth of intrauterine larva. Multiple milk protein genes are expressed specifically in the female accessory gland and are tightly linked with larval development. Disruption of milk protein synthesis deprives developing larvae of nutrients and results in extended larval development and/or in abortion. The ability to cause such a disruption could be utilized as a tsetse control strategy. Here we identify and delineate the regulatory sequence of a major milk protein gene (milk gland protein 1:mgp1 by utilizing a combination of molecular techniques in tsetse, Drosophila transgenics, transcriptomics and in silico sequence analyses. The function of this promoter is conserved between tsetse and Drosophila. In transgenic Drosophila the mgp1 promoter directs reporter gene expression in a tissue and stage specific manner orthologous to that of Glossina. Analysis of the minimal required regulatory region of mgp1, and the regulatory regions of other Glossina milk proteins identified putative homeodomain protein binding sites as the sole common feature. Annotation and expression analysis of Glossina homeodomain proteins identified ladybird late (lbl as being accessory gland/fat body specific and differentially expressed between lactating/non-lactating flies. Knockdown of lbl in tsetse resulted in a significant reduction in transcript abundance of multiple milk protein genes and in a significant loss of fecundity. The role of Lbl in adult reproductive physiology is previously unknown. These results suggest that Lbl is part of a conserved reproductive regulatory system that could have implications beyond tsetse to other vector insects such as mosquitoes. This
Åvall-Jääskeläinen, Silja; Lindholm, Agneta; Palva, Airi
2003-01-01
Lactobacillus brevis is a promising lactic acid bacterium for use as a probiotic dietary adjunct and a vaccine vector. The N-terminal region of the S-layer protein (SlpA) of L. brevis ATCC 8287 was recently shown to mediate adhesion to various human cell lines in vitro. In this study, a surface display cassette was constructed on the basis of this SlpA receptor-binding domain, a proteinase spacer, and an autolysin anchor. The cassette was expressed under control of the nisA promoter in Lactoc...
International Nuclear Information System (INIS)
Inoue-Toyoda, Maki; Kato, Kohsuke; Nagata, Kyosuke; Yoshikawa, Hiroyuki
2015-01-01
Human cytomegalovirus (HCMV) is a common and usually asymptomatic virus agent in healthy individuals. Initiation of HCMV productive infection depends on expression of the major immediate early (MIE) genes. The transcription of HCMV MIE genes is regulated by a diverse set of transcription factors. It was previously reported that productive HCMV infection is triggered probably by elevation of the plasma hydroxycorticoid level. However, it is poorly understood whether the transcription of MIE genes is directly regulated by glucocorticoid. Here, we found that the dexamethasone (DEX), a synthetic glucocorticoid, facilitates the transcription of HCMV MIE genes through the MIE promoter and enhancer in a glucocorticoid receptor (GR)-dependent manner. By competitive EMSA and reporter assays, we revealed that an NF-I like protein is involved in DEX-mediated transcriptional activation of the MIE promoter. Thus, this study supports a notion that the increased level of hydroxycorticoid in the third trimester of pregnancy reactivates HCMV virus production from the latent state. - Highlights: • DEX facilitates the transcription from the HCMV MIE promoter. • GR is involved in DEX-dependent transcription from the HCMV MIE promoter. • A 17 bp repeat is responsible for the HCMV MIE promoter activation by DEX. • An NF-I-like protein is involved in the HCMV MIE promoter activation by DEX
Villaverde, A; Ventanas, J; Estévez, M
2014-12-01
The role played by curing agents (nitrite, ascorbate) on protein oxidation and Strecker aldehyde formation is studied. To fulfill this objective, increasing concentrations of nitrite (0, 75 and 150ppm) and ascorbate (0, 250 and 500ppm) were added to sausages subjected to a 54day drying process. The concurrence of intense proteolysis, protein carbonylation and formation of Strecker aldehydes during processing of sausages suggests that α-aminoadipic semialdehyde (AAS) and γ-glutamic semialdehyde (GGS) may be implicated in the formation of Strecker aldehydes. The fact that nitrite (150ppm, ingoing amount) significantly promoted the formation of protein carbonyls at early stages of processing and the subsequent formation of Strecker aldehydes provides strength to this hypothesis. Ascorbate (125 and 250ppm) controlled the overall extent of protein carbonylation in sausages without declining the formation of Strecker aldehydes. These results may contribute to understanding the chemistry fundamentals of the positive influence of nitrite on the flavor and overall acceptability of cured muscle foods. Copyright © 2014 Elsevier Ltd. All rights reserved.
Directory of Open Access Journals (Sweden)
Khripko Olga Pavlovna
2008-01-01
Full Text Available IL-18 has proinflammatory effects and participates in both innate and adaptive cellular and humoral immunity. A number of SNPs that influence IL-18 production are found in the gene promoter region. We investigated the association of SNPs in the IL-18 promoter at −607 and −137 with the level of IL-18 protein production by PBMC from healthy donors from Southwestern Siberia. The genetic distribution of these SNPs in the promoter site was established by PCR. IL-18 protein production was determined by ELISA. Our results showed that PBMC from donors carrying allele 137C have lower levels of both spontaneous and LPS-stimulated IL-18 production. In contrast, PBMC from donors carrying allele 607A showed significant increases in spontaneous and stimulated IL-18 production compared to wild type. Our study suggests that the SNPs −607 and −137 in the promoter region of the IL-18 gene influence the level of IL-18 protein production by PBMC from healthy donors in Southwestern Siberia.
Lian, Sen; Cho, Won Kyong; Jo, Yeonhwa; Kim, Sang-Min; Kim, Kook-Hyung
2014-04-01
Rice stripe virus (RSV), which belongs to the genus Tenuivirus, is an emergent virus problem. The RSV genome is composed of four single-strand RNAs (RNA1-RNA4) and encodes seven proteins. We investigated interactions between six of the RSV proteins by yeast-two hybrid (Y2H) assay in vitro and by bimolecular fluorescence complementation (BiFC) in planta. Y2H identified self-interaction of the nucleocapsid protein (NP) and NS3, while BiFC revealed self-interaction of NP, NS3, and NCP. To identify regions(s) and/or crucial amino acid (aa) residues required for NP self-interaction, we generated various truncated and aa substitution mutants. Y2H assay showed that the N-terminal region of NP (aa 1-56) is necessary for NP self-interaction. Further analysis with substitution mutants demonstrated that additional aa residues located at 42-47 affected their interaction with full-length NP. These results indicate that the N-terminal region (aa 1-36 and 42-47) is required for NP self-interaction. BiFC and co-localization studies showed that the region required for NP self-interaction is also required for NP localization at the nucleus. Overall, our results indicate that the N-terminal region (aa 1-47) of the NP is important for NP self-interaction and that six aa residues (42-47) are essential for both NP self-interaction and nuclear localization. Copyright © 2014 Elsevier B.V. All rights reserved.
Directory of Open Access Journals (Sweden)
Aebi Stefan
2008-10-01
Full Text Available Abstract Background The activity of dihydropyrimidine dehydrogenase (DPD, the key enzyme of pyrimidine catabolism, is thought to be an important determinant for the occurrence of severe toxic reactions to 5-fluorouracil (5-FU, which is one of the most commonly prescribed chemotherapeutic agents for the treatment of solid cancers. Genetic variation in the DPD gene (DPYD has been proposed as a main factor for variation in DPD activity in the population. However, only a small proportion of severe toxicities in 5-FU based chemotherapy can be explained with such rare deleterious DPYD mutations resulting in severe enzyme deficiencies. Recently, hypermethylation of the DPYD promoter region has been proposed as an alternative mechanism for DPD deficiency and thus as a major cause of severe 5-FU toxicity. Methods Here, the prognostic significance of this epigenetic marker with respect to severe 5-FU toxicity was assessed in 27 cancer patients receiving 5-FU based chemotherapy, including 17 patients experiencing severe toxic side effects following drug administration, none of which were carriers of a known deleterious DPYD mutation, and ten control patients. The methylation status of the DPYD promoter region in peripheral blood mononuclear cells was evaluated by analysing for each patient between 19 and 30 different clones of a PCR-amplified 209 base pair fragment of the bisulfite-modified DPYD promoter region. The fragments were sequenced to detect bisulfite-induced, methylation-dependent sequence differences. Results No evidence of DPYD promoter methylation was observed in any of the investigated patient samples, whereas in a control experiment, as little as 10% methylated genomic DNA could be detected. Conclusion Our results indicate that DYPD promoter hypermethylation is not of major importance as a prognostic factor for severe toxicity in 5-FU based chemotherapy.
Boundary Dpp promotes growth of medial and lateral regions of the Drosophila wing.
Barrio, Lara; Milán, Marco
2017-07-04
The gradient of Decapentaplegic (Dpp) in the Drosophila wing has served as a paradigm to characterize the role of morphogens in regulating patterning. However, the role of this gradient in regulating tissue size is a topic of intense debate as proliferative growth is homogenous. Here, we combined the Gal4/UAS system and a temperature-sensitive Gal80 molecule to induce RNAi-mediated depletion of dpp and characterise the spatial and temporal requirement of Dpp in promoting growth. We show that Dpp emanating from the AP compartment boundary is required throughout development to promote growth by regulating cell proliferation and tissue size. Dpp regulates growth and proliferation rates equally in central and lateral regions of the developing wing appendage and reduced levels of Dpp affects similarly the width and length of the resulting wing. We also present evidence supporting the proposal that graded activity of Dpp is not an absolute requirement for wing growth.
Effective Feature Selection for Classification of Promoter Sequences.
Directory of Open Access Journals (Sweden)
Kouser K
Full Text Available Exploring novel computational methods in making sense of biological data has not only been a necessity, but also productive. A part of this trend is the search for more efficient in silico methods/tools for analysis of promoters, which are parts of DNA sequences that are involved in regulation of expression of genes into other functional molecules. Promoter regions vary greatly in their function based on the sequence of nucleotides and the arrangement of protein-binding short-regions called motifs. In fact, the regulatory nature of the promoters seems to be largely driven by the selective presence and/or the arrangement of these motifs. Here, we explore computational classification of promoter sequences based on the pattern of motif distributions, as such classification can pave a new way of functional analysis of promoters and to discover the functionally crucial motifs. We make use of Position Specific Motif Matrix (PSMM features for exploring the possibility of accurately classifying promoter sequences using some of the popular classification techniques. The classification results on the complete feature set are low, perhaps due to the huge number of features. We propose two ways of reducing features. Our test results show improvement in the classification output after the reduction of features. The results also show that decision trees outperform SVM (Support Vector Machine, KNN (K Nearest Neighbor and ensemble classifier LibD3C, particularly with reduced features. The proposed feature selection methods outperform some of the popular feature transformation methods such as PCA and SVD. Also, the methods proposed are as accurate as MRMR (feature selection method but much faster than MRMR. Such methods could be useful to categorize new promoters and explore regulatory mechanisms of gene expressions in complex eukaryotic species.
Promoter methylation and age-related downregulation of Klotho in rhesus monkey.
King, Gwendalyn D; Rosene, Douglas L; Abraham, Carmela R
2012-12-01
While overall DNA methylation decreases with age, CpG-rich areas of the genome can become hypermethylated. Hypermethylation near transcription start sites typically decreases gene expression. Klotho (KL) is important in numerous age-associated pathways including insulin/IGF1 and Wnt signaling and naturally decreases with age in brain, heart, and liver across species. Brain tissues from young and old rhesus monkeys were used to determine whether epigenetic modification of the KL promoter underlies age-related decreases in mRNA and protein levels of KL. The KL promoter in genomic DNA from brain white matter did not show evidence of oxidation in vivo but did exhibit an increase in methylation with age. Further analysis identified individual CpG motifs across the region of interest with increased methylation in old animals. In vitro methyl modification of these individual cytosine residues confirmed that methylation of the promoter can decrease gene transcription. These results provide evidence that changes in KL gene expression with age may, at least in part, be the result of epigenetic changes to the 5' regulatory region.
Hoggett, J G; Brierley, I
1992-11-01
The activation of transcription initiation from the P4 promoter of pBR322 by the Escherichia coli cyclic AMP receptor protein (CRP) has been investigated using a fluorescence abortive initiation assay. The effect of the cyclic-AMP/CRP complex on the linear P4 promoter was to increase the initial binding (KB) of RNA polymerase to the promoter by about a factor of 10, but the rate of isomerization of closed to open complex (kf) was unaffected. One molecule of CRP per promoter was required for activation, and the concentration of cyclic AMP producing half-maximal stimulation was about 7-8 microM. Supercoiling caused a 2-3-fold increase in the rate of isomerization of the CRP-activated promoter, but weakened the initial binding of polymerase by about one order of magnitude. The unactivated supercoiled promoter was too weak to allow reliable assessment of kinetic parameters against the high background rate originating from the rest of the plasmid.
An evolutionary model for protein-coding regions with conserved RNA structure
DEFF Research Database (Denmark)
Pedersen, Jakob Skou; Forsberg, Roald; Meyer, Irmtraud Margret
2004-01-01
in the RNA structure. The overlap of these fundamental dependencies is sufficient to cause "contagious" context dependencies which cascade across many nucleotide sites. Such large-scale dependencies challenge the use of traditional phylogenetic models in evolutionary inference because they explicitly assume...... components of traditional phylogenetic models. We applied this to a data set of full-genome sequences from the hepatitis C virus where five RNA structures are mapped within the coding region. This allowed us to partition the effects of selection on different structural elements and to test various hypotheses......Here we present a model of nucleotide substitution in protein-coding regions that also encode the formation of conserved RNA structures. In such regions, apparent evolutionary context dependencies exist, both between nucleotides occupying the same codon and between nucleotides forming a base pair...
MECP2 promoter methylation and X chromosome inactivation in autism.
Nagarajan, Raman P; Patzel, Katherine A; Martin, Michelle; Yasui, Dag H; Swanberg, Susan E; Hertz-Picciotto, Irva; Hansen, Robin L; Van de Water, Judy; Pessah, Isaac N; Jiang, Ruby; Robinson, Wendy P; LaSalle, Janine M
2008-06-01
Epigenetic mechanisms have been proposed to play a role in the etiology of autism. This hypothesis is supported by the discovery of increased MECP2 promoter methylation associated with decreased MeCP2 protein expression in autism male brain. To further understand the influence of female X chromosome inactivation (XCI) and neighboring methylation patterns on aberrant MECP2 promoter methylation in autism, multiple methylation analyses were peformed on brain and blood samples from individuals with autism. Bisulfite sequencing analyses of a region 0.6 kb upstream of MECP2 in brain DNA samples revealed an abrupt transition from a highly methylated region in both sexes to a region unmethylated in males and subject to XCI in females. Chromatin immunoprecipitation analysis demonstrated that the CCTC-binding factor (CTCF) bound to this transition region in neuronal cells, consistent with a chromatin boundary at the methylation transition. Male autism brain DNA samples displayed a slight increase in methylation in this transition region, suggesting a possible aberrant spreading of methylation into the MECP2 promoter in autism males across this boundary element. In addition, autistic female brain DNA samples showed evidence for aberrant MECP2 promoter methylation as an increase in the number of bisulfite sequenced clones with undefined XCI status for MECP2 but not androgen receptor (AR). To further investigate the specificity of MECP2 methylation alterations in autism, blood DNA samples from females and mothers of males with autism were also examined for XCI skewing at AR, but no significant increase in XCI skewing was observed compared to controls. These results suggest that the aberrant MECP2 methylation in autism brain DNA samples is due to locus-specific rather than global X chromosome methylation changes.
Biophysical properties of regions flanking the bHLH-Zip motif in the p22 Max protein
International Nuclear Information System (INIS)
Pursglove, Sharon E.; Fladvad, Malin; Bellanda, Massimo; Moshref, Ahmad; Henriksson, Marie; Carey, Jannette; Sunnerhagen, Maria
2004-01-01
The Max protein is the central dimerization partner in the Myc-Max-Mad network of transcriptional regulators, and a founding structural member of the family of basic-helix-loop-helix (bHLH)-leucine zipper (Zip) proteins. Biologically important regions flanking its bHLH-Zip motif have been disordered or absent in crystal structures. The present study shows that these regions are resistant to proteolysis in both the presence and absence of DNA, and that Max dimers containing both flanking regions have significantly higher helix content as measured by circular dichroism than that predicted from the crystal structures. Nuclear magnetic resonance measurements in the absence of DNA also support the inferred structural order. Deletion of both flanking regions is required to achieve maximal DNA affinity as measured by EMSA. Thus, the previously observed functionalities of these Max regions in DNA binding, phosphorylation, and apoptosis are suggested to be linked to structural properties
Neubauer, Emilie-Fleur; Poole, Angela Z; Neubauer, Philipp; Detournay, Olivier; Tan, Kenneth; Davy, Simon K; Weis, Virginia M
2017-05-08
The mutualistic endosymbiosis between cnidarians and dinoflagellates is mediated by complex inter-partner signaling events, where the host cnidarian innate immune system plays a crucial role in recognition and regulation of symbionts. To date, little is known about the diversity of thrombospondin-type-1 repeat (TSR) domain proteins in basal metazoans or their potential role in regulation of cnidarian-dinoflagellate mutualisms. We reveal a large and diverse repertoire of TSR proteins in seven anthozoan species, and show that in the model sea anemone Aiptasia pallida the TSR domain promotes colonization of the host by the symbiotic dinoflagellate Symbiodinium minutum . Blocking TSR domains led to decreased colonization success, while adding exogenous TSRs resulted in a 'super colonization'. Furthermore, gene expression of TSR proteins was highest at early time-points during symbiosis establishment. Our work characterizes the diversity of cnidarian TSR proteins and provides evidence that these proteins play an important role in the establishment of cnidarian-dinoflagellate symbiosis.
Directory of Open Access Journals (Sweden)
Simrén Magnus
2009-11-01
Full Text Available Abstract Background Oxytocin and the oxytocin receptor have been demonstrated in the gastrointestinal (GI tract and have been shown to exert physiological effects on gut motility. The role for oxytocin in the pathophysiology of GI complaints is unknown. The aim of this study was to examine genetic variations or polymorphism of oxytocin (OXT and its receptor (OXTR genes in patients with GI complaints without visible organic abnormalities. Methods Genetic variants in the OXT promoter region, and in the OXTR gene in DNA samples from 131 rigorously evaluated patients with Irritable Bowel Syndrome (IBS, 408 homozygous subjects referred for lactase (LCT-13910 C>T, rs4988235 genotyping, and 299 asymptomatic blood donors were compared. One polymorphism related to the OXT gene (rs6133010 A>G and 4 related to the OXTR gene (rs1465386 G>T, rs3806675 G>A, rs968389 A>G, rs1042778 G>T were selected for genotyping using Applied Biosystems 7900 HT allele discrimination assays. Results There were no statistically significant differences in the genotype or allele frequencies in any of the SNPs when IBS patients were compared to healthy controls. Among subjects referred for lactase genotyping, the rs6133010 A>G OXT promoter A/G genotype tended to be more common in the 154 non-persistent (27.3% subjects than in the 254 lactase persistant (18.1% subjects and in the healthy controls (19.4% (p = 0.08. When direct comparing, the A/G genotype was less common in the OXT promoter region in controls (p = 0.09 and in subjects with lactase persistence (p = 0.03 compared to subjects with lactase non-persistence. When healthy controls were viewed according to their own LCT-13910 genotypes, the C/C lactase non-persistent controls had a higher frequency for the OXT promoter A/G genotype than LCT-13910 T/T lactase persistent controls (41.2% vs 13.1%. No significant differences in frequencies of the investigated OXTR SNPs were noted in this study. Conclusion The results suggest
Banadakoppa, Manu; Liebenthal, Daniel; Nowak, David E; Urvil, Petri; Yallampalli, Uma; Wilson, Gerald M; Kishor, Aparna; Yallampalli, Chandra
2013-02-01
We previously reported that nitric oxide (NO) reduces the rate of bacteremia and maternal mortality in pregnant rats with uterine infection by Escherichia coli expressing the Dr Fimbria (Dr(+) ). The epithelial invasion of Dr(+) E. coli is dependent on the expression level of its cellular receptor decay accelerating factor (DAF). NO reduces the rate of bacteremia by downregulating the expression of DAF. In this study, we elucidated the role of transcription factor Sp1 and RNA binding protein HuR in the downregulation of human DAF by NO. We generated a series of deletion mutant constructs of DAF gene 5'-untranslated region and mapped the NO-response region upstream to the core promoter region of the DAF gene. One of the several Sp1 binding sites in the DAF 5'-untranslated region was located within the NO-response region. The binding of Sp1 to this site was inhibited by NO. Furthermore, NO also promoted the degradation of DAF mRNA. The 3'-untranslated region of DAF harbors an AU-rich element and this element destabilized the mRNA transcript. NO promoted the rapid degradation of DAF mRNA by inhibiting the binding of mRNA stabilizing protein HuR to this AU-rich region. The inhibition of binding of HuR to the AU-rich region was due to the S-nitrosylation of one or more cysteine residues by NO. Thus, these data reveal the molecular mediators of transcriptional and post-transcriptional regulation of DAF by NO with implications in pathophysiology related to DAF. © 2012 The Authors Journal compilation © 2012 FEBS.
George, Suja; Usha, B; Parida, Ajay
2009-05-01
Plant growth and productivity are adversely affected by various abiotic and biotic stress factors. Despite the wealth of information on abiotic stress and stress tolerance in plants, many aspects still remain unclear. Prosopis juliflora is a hardy plant reported to be tolerant to drought, salinity, extremes of soil pH, and heavy metal stress. In this paper, we report the isolation and characterization of the complementary DNA clone for an atypical late embryogenesis abundant (LEA) protein (Pj LEA3) and its putative promoter sequence from P. juliflora. Unlike typical LEA proteins, rich in glycine, Pj LEA3 has alanine as the most abundant amino acid followed by serine and shows an average negative hydropathy. Pj LEA3 is significantly different from other LEA proteins in the NCBI database and shows high similarity to indole-3 acetic-acid-induced protein ARG2 from Vigna radiata. Northern analysis for Pj LEA3 in P. juliflora leaves under 90 mM H2O2 stress revealed up-regulation of transcript at 24 and 48 h. A 1.5-kb fragment upstream the 5' UTR of this gene (putative promoter) was isolated and analyzed in silico. The possible reasons for changes in gene expression during stress in relation to the host plant's stress tolerance mechanisms are discussed.
International Nuclear Information System (INIS)
Shaw, J.E.; Epp, C.; Pearson, M.L.; Reeve, J.N.
1987-01-01
The patterns of bacteriophage lambda proteins synthesized in UV-irradiated Escherichia coli cells and in anucleate minicells are significantly different; both systems exhibit aberrations of regulation in lambda gene expression. In unirradiated cells or cells irradiated with low UV doses (less than 600 J/m2), regulation of lambda protein synthesis is controlled by the regulatory proteins CI, N, CII, CIII, Cro, and Q. As the UV dose increases, activation of transcription of the cI, rexA, and int genes by CII and CIII proteins fails to occur and early protein synthesis, normally inhibited by the action of Cro, continues. After high UV doses (greater than 2000 J/m2), late lambda protein synthesis does not occur. Progression through the sequence of regulatory steps in lambda gene expression is slower in infected minicells. In minicells, there is no detectable cII- and cIII-dependent synthesis of CI, RexA, or Int proteins and inhibition of early protein synthesis by Cro activity is always incomplete. The synthesis of early b region proteins is not subject to control by CI, N, or Cro proteins, and evidence is presented suggesting that, in minicells, transcription of the early b region is initiated at a promoter(s) within the b region. Proteolytic cleavage of the regulatory proteins O and N and of the capsid proteins C, B, and Nu3 is much reduced in infected minicells. Exposure of minicells to very high UV doses before infection does not completely inhibit late lambda protein synthesis
Cellular Handling of Protein Aggregates by Disaggregation Machines.
Mogk, Axel; Bukau, Bernd; Kampinga, Harm H
2018-01-18
Both acute proteotoxic stresses that unfold proteins and expression of disease-causing mutant proteins that expose aggregation-prone regions can promote protein aggregation. Protein aggregates can interfere with cellular processes and deplete factors crucial for protein homeostasis. To cope with these challenges, cells are equipped with diverse folding and degradation activities to rescue or eliminate aggregated proteins. Here, we review the different chaperone disaggregation machines and their mechanisms of action. In all these machines, the coating of protein aggregates by Hsp70 chaperones represents the conserved, initializing step. In bacteria, fungi, and plants, Hsp70 recruits and activates Hsp100 disaggregases to extract aggregated proteins. In the cytosol of metazoa, Hsp70 is empowered by a specific cast of J-protein and Hsp110 co-chaperones allowing for standalone disaggregation activity. Both types of disaggregation machines are supported by small Hsps that sequester misfolded proteins. Copyright © 2018 Elsevier Inc. All rights reserved.
Different regions of the newcastle disease virus fusion protein modulate pathogenicity.
Directory of Open Access Journals (Sweden)
Sandra Heiden
Full Text Available Newcastle disease virus (NDV, also designated as Avian paramyxovirus type 1 (APMV-1, is the causative agent of a notifiable disease of poultry but it exhibits different pathogenicity dependent on the virus strain. The molecular basis for this variability is not fully understood. The efficiency of activation of the fusion protein (F is determined by presence or absence of a polybasic amino acid sequence at an internal proteolytic cleavage site which is a major determinant of NDV virulence. However, other determinants of pathogenicity must exist since APMV-1 of high (velogenic, intermediate (mesogenic and low (lentogenic virulence specify a polybasic F cleavage site. We aimed at elucidation of additional virulence determinants by constructing a recombinant virus that consists of a lentogenic NDV Clone 30 backbone and the F protein gene from a mesogenic pigeon paramyxovirus-1 (PPMV-1 isolate with an intracerebral pathogenicity index (ICPI of 1.1 specifying the polybasic sequence R-R-K-K-R*F motif at the cleavage site. The resulting virus was characterized by an ICPI of 0.6, indicating a lentogenic pathotype. In contrast, alteration of the cleavage site G-R-Q-G-R*L of the lentogenic Clone 30 to R-R-K-K-R*F resulted in a recombinant virus with an ICPI of 1.36 which was higher than that of parental PPMV-1. Substitution of different regions of the F protein of Clone 30 by those of PPMV-1, while maintaining the polybasic amino acid sequence at the F cleavage site, resulted in recombinant viruses with ICPIs ranging from 0.59 to 1.36 suggesting that virulence is modulated by regions of the F protein other than the polybasic cleavage site.
Ma'ruf, Anwar; Iswati, Sri; Hidajati, Nove; Damayanti, Ratna
2017-09-01
The long-term objective of this study was to produce STAT synthetic protein in chicken during growth period resulting from the increase of growth hormone (GH) as growth promoter. This study used ten male chicken Lohman from PT. Multibreeder Indonesia. The chicken were kept within batteried cage, with a capacity of one chicken in each cage. The chickens were fed twice a day, at 6 a.m. and 6 p.m. with the amount of feed 10% less than standard. On day 21 the chicken were slaughtered to obtain the samples, i.e., adipose, liver and muscles for the following examinations (1) isolation of STAT-3 signaling protein from adipose, liver and muscles of the chicken, (2) analysis of STAT-3 signaling protein using SDS-PAGE method, and (3) identification of STAT-3 signaling protein using Western blot method by means of protein detection using electrophoresis with polyacrylamide gels. Results of examination on protein in hepatic, muscle and adipose of chickens in growth period revealed that STAT protein was positively present in those tissues. This finding was followed-up with SDS-PAGE examination, from which we found the presence of protein band between the markers of 116 kDa and 14.4 kDa. The protein band was supposedly the STAT-3 protein. To prove that protein band formed was the STAT-3, Western blot examination was conducted using rabbit polyclonal antibody STAT-3. The result showed the formation of the protein band, indicating the presence of reaction between antigen (STAT-3 protein) and STAT-3 protein antibody. In conclusion, STAT-3 protein is present in hepatic, muscular, and adipose tissues, with molecular weight of 59.4 kDa.
Mutational analysis of the promoter and the coding region of the 5-HT1A gene
Energy Technology Data Exchange (ETDEWEB)
Erdmann, J.; Noethen, M.M.; Shimron-Abarbanell, D. [Univ. of Bonn (Germany)] [and others
1994-09-01
Disturbances of serotonergic pathways have been implicated in many neuropsychiatric disorders. Serotonin (5HT) receptors can be subdivided into at least three major families (5HT1, 5HT2, and 5HT3). Five human 5HT1 receptor subtypes have been cloned, namely 1A, 1D{alpha}, 1D{beta}, 1E, and 1F. Of these, the 5HT1A receptor is the best characterized subtype. In the present study we sought to identify genetic variation in the 5HT1A receptor gene which through alteration of protein function or level of expression might contribute to the genetics of neuropsychiatric diseases. The coding region and the 5{prime} promoter region of the 5HT1A gene from 159 unrelated subjects (45 schizophrenic, 46 bipolar affective, and 43 patients with Tourette`s syndrome, as well as 25 controls) were analyzed using SSCA. SSCA revealed the presence of two mutations both located in the coding region of the 5HT1A receptor gene. The first mutation is a rare silent C{r_arrow}T substitution at nucleotide position 549. The second mutation is characterized by a base pair substitution (A{r_arrow}G) at the first position of codon 28 and results in an amino acid exchange (Ile{r_arrow}Val). Since Val28 was found only in a single schizophrenic patient and in none of the other patients or controls, we decided to extend our samples and to use a restriction assay for screening a further 74 schizophrenic, 95 bipolar affective, and 49 patients with Tourette`s syndrome, as well as 185 controls, for the presence of the mutation. In total, the mutation was found in 2 schizophrenic patients, in 3 bipolars, in 1 Tourette patient, and in 5 controls. To our knowledge the Ile-28-Val substitution reported here is the first natural occuring molecular variant which has been identified for a serotonin receptor so far.
Kotsaki, Antigoni; Raftogiannis, Maria; Routsi, Christina; Baziaka, Fotini; Kotanidou, Anastasia; Antonopoulou, Anastasia; Orfanos, Stylianos E; Katsenos, Chrisostomos; Koutoukas, Pantelis; Plachouras, Diamantis; Mandragos, Konstantinos; Giamarellos-Bourboulis, Evangelos J
2012-08-01
Debatable findings exist among various studies regarding the impact of single nucleotide polymorphisms (SNPs) within the promoter region of the tumor necrosis factor (TNF) gene for susceptibility to infections. Their impact was investigated in a cohort of mechanically ventilated patients who developed ventilator-associated pneumonia (VAP). Two-hundred and thirteen mechanically ventilated patients who developed VAP were enrolled. Genomic DNA was extracted and SNPs at the -376, -308 and -238 position of the promoter region of the TNF gene were assessed by restriction fragment length polymorphisms. Monocytes were isolated from 47 patients when they developed sepsis and stimulated by bacterial endotoxin for the production of TNFα and of interleukin-6 (IL-6). Patients were divided into two groups; 166 patients bearing only wild-type alleles of all three studied polymorphisms; and 47 patients carrying at least one A allele of the three studied SNPs. Time between start of mechanical ventilation and advent of VAP was significantly shorter in the second group than in the first group (log-rank: 4.416, p: 0.041). When VAP supervened, disease severity did not differ between groups. Stimulation of TNFα and of IL-6 was much greater by monocytes for patients carrying A alleles. Carriage of at least one A allele of the three studied SNPs at the promoter region of the TNF-gene is associated with shorter time to development of VAP but it is not associated with disease severity. Findings may be related with a role of the studied SNPs in the production of pro-inflammatory cytokines. Copyright © 2012 Elsevier Ltd. All rights reserved.
Directory of Open Access Journals (Sweden)
Rachel M. Woodfint
2017-01-01
Full Text Available Identification of tissue- and stage-specific gene promoters is valuable for delineating the functional roles of specific genes in genetically engineered animals. Here, through the comparison of gene expression in different tissues by analysis of a microarray database, the intestinal specificity of mucin 2 (MUC2 expression was identified in mice and humans, and further confirmed in chickens by RT-PCR (reverse transcription-PCR analysis. An analysis of cis-acting elements in avian MUC2 gene promoters revealed conservation of binding sites, within a 2.9 kb proximal promoter region, for transcription factors such as caudal type homeobox 2 (CDX2, GATA binding protein 4 (GATA4, hepatocyte nuclear factor 4 α (HNF4A, and transcription factor 4 (TCF4 that are important for maintaining intestinal homeostasis and functional integrity. By generating transgenic quail, we demonstrated that the 2.9 kb chicken MUC2 promoter could drive green fluorescent protein (GFP reporter expression exclusively in the small intestine, large intestine, and ceca. Fluorescence image analysis further revealed GFP expression in intestine epithelial cells. The GFP expression was barely detectable in the embryonic intestine, but increased during post-hatch development. The spatiotemporal expression pattern of the reporter gene confirmed that the 2.9 kb MUC2 promoter could retain the regulatory element to drive expression of target genes in intestinal tissues after hatching. This new transgene expression system, using the MUC2 promoter, will provide a new method of overexpressing target genes to study gene function in the avian intestine.
International Nuclear Information System (INIS)
Kayaalti, Zeliha; Mergen, Goerkem; Soeylemezoglu, Tuelin
2010-01-01
Metallothioneins (MTs) are metal-binding, low molecular weight proteins and are involved in pathophysiological processes like metabolism of essential metals, metal ion homeostasis and detoxification of heavy metals. Metallothionein expression is induced by various heavy metals especially cadmium, mercury and zinc; MTs suppress toxicity of heavy metals by binding themselves to these metals. The aim of this study was to investigate the association between the - 5 A/G metallothionein 2A (MT2A) single nucleotide polymorphism (SNP) and Cd, Zn and Cu levels in the renal cortex from autopsy cases. MT2A core promoter region - 5 A/G SNP was analyzed by PCR-RFLP method using 114 autopsy kidney tissues and the genotype frequencies of this polymorphism were found as 87.7% homozygote typical (AA), 11.4% heterozygote (AG) and 0.9% homozygote atypical (GG). In order to assess the Cd, Zn and Cu levels in the same autopsy kidney tissues, a dual atomic absorption spectrophotometer system was used and the average levels of Cd, Zn and Cu were measured as 95.54 ± 65.58 μg/g, 181.20 ± 87.72 μg/g and 17.14 ± 16.28 μg/g, respectively. As a result, no statistical association was found between the - 5 A/G SNP in the MT2A gene and the Zn and Cu levels in the renal cortex (p > 0.05), but considerably high accumulation of Cd was monitored for individuals having AG (151.24 ± 60.21 μg/g) and GG genotypes (153.09 μg/g) compared with individuals having AA genotype (87.72 ± 62.98 μg/g) (p < 0.05). These results show that the core promoter region polymorphism of metallothionein 2A increases the accumulation of Cd in human renal cortex.
Directory of Open Access Journals (Sweden)
Piotr Szymczyk
2016-09-01
Full Text Available The promoter, 5' UTR, and 34-nt 5' fragments of protein encoding region of the Salvia miltiorrhiza copalyl diphosphate synthase gene were cloned and characterized. No tandem repeats, miRNA binding sites, or CpNpG islands were observed in the promoter, 5' UTR, or protein encoding fragments. The entire isolated promoter and 5' UTR is 2235 bp long and contains repetitions of many cis-active elements, recognized by homologous transcription factors, found in Arabidopsis thaliana and other plant species. A pyrimidine-rich fragment with only 6 non-pyrimidine bases was localized in the 33-nt stretch from nt 2185 to 2217 in the 5' UTR. The observed cis-active sequences are potential binding sites for trans-factors that could regulate spatio-temporal CPS gene expression in response to biotic and abiotic stress conditions. Obtained results are initially verified by in silico and co-expression studies based on A. thaliana microarray data. The quantitative RT-PCR analysis confirmed that the entire 2269-bp copalyl diphosphate synthase gene fragment has the promoter activity. Quantitative RT-PCR analysis was used to study changes in CPS promoter activity occurring in response to the application of four selected biotic and abiotic regulatory factors; auxin, gibberellin, salicylic acid, and high-salt concentration.
Gori Savellini, Gianni; Gandolfo, Claudia; Cusi, Maria Grazia
2015-12-01
Toscana Virus (TOSV) is a Phlebovirus responsible for central nervous system (CNS) injury in humans. The TOSV non-structural protein (NSs), which interacting with RIG-I leads to its degradation, was analysed in the C terminus fragment in order to identify its functional domains. To this aim, two C-terminal truncated NSs proteins, Δ1C-NSs (aa 1-284) and Δ2C-NSs (aa 1-287) were tested. Only Δ1C-NSs did not present any inhibitory effect on RIG-I and it showed a greater stability than the whole NSs protein. Moreover, the deletion of the TLQ aa sequence interposed between the two ΔC constructs caused a greater accumulation of the protein with a weak inhibitory effect on RIG-I, indicating some involvement of these amino acids in the NSs activity. Nevertheless, all the truncated proteins were still able to interact with RIG-I, suggesting that the domains responsible for RIG-I signaling and RIG-I interaction are mapped on different regions of the protein. Copyright © 2015 Elsevier Inc. All rights reserved.
International Nuclear Information System (INIS)
Depto, A.S.; Stenberg, R.M.
1989-01-01
To better understand the regulation of late gene expression in human cytomegalovirus (CMV)-infected cells, the authors examined expression of the gene that codes for the 65-kilodalton lower-matrix phosphoprotein (pp65). Analysis of RNA isolated at 72 h from cells infected with CMV Towne or ts66, a DNA-negative temperature-sensitive mutant, supported the fact that pp65 is expressed at low levels prior to viral DNA replication but maximally expressed after the initiation of viral DNA replication. To investigate promoter activation in a transient expression assay, the pp65 promoter was cloned into the indicator plasmid containing the gene for chloramphenicol acetyltransferase (CAT). Transfection of the promoter-CAT construct and subsequent superinfection with CMV resulted in activation of the promoter at early times after infection. Cotransfection with plasmids capable of expressing immediate-early (IE) proteins demonstrated that the promoter was activated by IE proteins and that both IE regions 1 and 2 were necessary. These studies suggest that interactions between IE proteins and this octamer sequence may be important for the regulation and expression of this CMV gene
High CpG island methylation ofp16 gene and loss of p16 protein ...
Indian Academy of Sciences (India)
Navya
:Tetralogy of Fallot;p16 gene;p16 protein;CpG islands;Methylation;Promoter regions ... of congenital heart disease, as well as the exclusion of previous history of ..... malignant progression of oral epithelial dysplasia: a prospective cohort study.
Upregulation of human heme oxygenase gene expression by Ets-family proteins.
Deramaudt, B M; Remy, P; Abraham, N G
1999-03-01
Overexpression of human heme oxygenase-1 has been shown to have the potential to promote EC proliferation and angiogenesis. Since Ets-family proteins have been shown to play an important role in angiogenesis, we investigated the presence of ETS binding sites (EBS), GGAA/T, and ETS protein contributing to human HO-1 gene expression. Several chloramphenicol acetyltransferase constructs were examined in order to analyze the effect of ETS family proteins on the transduction of HO-1 in Xenopus oocytes and in microvessel endothelial cells. Heme oxygenase promoter activity was up-regulated by FLI-1ERGETS-1 protein(s). Chloramphenicol acetyltransferase (CAT) assays demonstrated that the promoter region (-1500 to +19) contains positive and negative control elements and that all three members of the ETS protein family were responsible for the up-regulation of HHO-1. Electrophoretic mobility shift assays (EMSA), performed with nuclear extracts from endothelial cells overexpressing HHO-1 gene, and specific HHO-1 oligonucleotides probes containing putative EBS resulted in a specific and marked bandshift. Synergistic binding was observed in EMSA between AP-1 on the one hand, FLI-1, ERG, and ETS-1 protein on the other. Moreover, 5'-deletion analysis demonstrated the existence of a negative control element of HHO-1 expression located between positions -1500 and -120 on the HHO-1 promoter. The presence of regulatory sequences for transcription factors such as ETS-1, FLI-1, or ERG, whose activity is associated with cell proliferation, endothelial cell differentiation, and matrix metalloproteinase transduction, may be an indication of the important role that HO-1 may play in coronary collateral circulation, tumor growth, angiogenesis, and hemoglobin-induced endothelial cell injuries.
Gomez, Sandra; Adalid-Peralta, Laura; Palafox-Fonseca, Hector; Cantu-Robles, Vito Adrian; Soberón, Xavier; Sciutto, Edda; Fragoso, Gladis; Bobes, Raúl J; Laclette, Juan P; Yauner, Luis del Pozo; Ochoa-Leyva, Adrián
2015-05-19
Excretory/Secretory (ES) proteins play an important role in the host-parasite interactions. Experimental identification of ES proteins is time-consuming and expensive. Alternative bioinformatics approaches are cost-effective and can be used to prioritize the experimental analysis of therapeutic targets for parasitic diseases. Here we predicted and functionally annotated the ES proteins in T. solium genome using an integration of bioinformatics tools. Additionally, we developed a novel measurement to evaluate the potential antigenicity of T. solium secretome using sequence length and number of antigenic regions of ES proteins. This measurement was formalized as the Abundance of Antigenic Regions (AAR) value. AAR value for secretome showed a similar value to that obtained for a set of experimentally determined antigenic proteins and was different to the calculated value for the non-ES proteins of T. solium genome. Furthermore, we calculated the AAR values for known helminth secretomes and they were similar to that obtained for T. solium. The results reveal the utility of AAR value as a novel genomic measurement to evaluate the potential antigenicity of secretomes. This comprehensive analysis of T. solium secretome provides functional information for future experimental studies, including the identification of novel ES proteins of therapeutic, diagnosis and immunological interest.
Kizaki, Seiichiro; Zou, Tingting; Li, Yue; Han, Yong-Woon; Suzuki, Yuki; Harada, Yoshie; Sugiyama, Hiroshi
2016-11-07
Tet (ten-eleven translocation) family proteins oxidize 5-methylcytosine (mC) to 5-hydroxymethylcytosine (hmC), 5-formylcytosine (fC), and 5-carboxycytosine (caC), and are suggested to be involved in the active DNA demethylation pathway. In this study, we reconstituted positioned mononucleosomes using CpG-methylated 382 bp DNA containing the Widom 601 sequence and recombinant histone octamer, and subjected the nucleosome to treatment with Tet1 protein. The sites of oxidized methylcytosine were identified by bisulfite sequencing. We found that, for the oxidation reaction, Tet1 protein prefers mCs located in the linker region of the nucleosome compared with those located in the core region. © 2016 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.
US-India Technical Collaboration to Promote Regional Stability
International Nuclear Information System (INIS)
Killinger, Mark H.; Griggs, James R.; Apt, Kenneth E.; Doyle, James E.
2001-01-01
Two US-India documents were signed in 2000 that provided new impetus for scientific and technical cooperation between the two countries. The first document is the US-India Science and Technology Agreement, which is aimed at 'promoting scientific and technological cooperation between the people of their two countries.' The second is the US-India Joint Statement on Energy and Environment, which states 'the United States and India believe that energy and environment could be one of the most important areas of cooperation between the two countries.' In addition to the work already underway as part of these two agreements, DOE has established a US-India Science and Technology Initiative to utilize the expertise of DOE national laboratories to conduct activities that support US policy objectives in South Asia. PNNL and LANL are working with US agencies and the Indian government and scientific communities to identify appropriate non-sensitive areas for US-Indian technical collaboration. The objectives of such collaboration are to address visible national/international problems, build trust between the United States and India, and contribute to regional stability in South Asia. This paper describes research done on the Indian scientific organization and infrastructure, potential areas for collaboration, the approach for this engagement, and current status of the initiative.
US-INDIA TECHNICAL COLLABORATION TO PROMOTE REGIONAL STABILITY
International Nuclear Information System (INIS)
Killinger, M.H.; Griggs, J.R.; Apt, Kenneth E.; Doyle, J.E.
2001-01-01
Two US-India documents were signed in 2000 that provided new impetus for scientific and technical cooperation between the two countries. The first document is the US-India Science and Technology Agreement, which is aimed at 'promoting scientific and technological cooperation between the people of their two countries.' The second is the US-India Joint Statement on Energy and Environment, which states 'the United States and India believe that energy and environment could be one of the most important areas of cooperation between the two countries.' In addition to the work already underway as part of these two agreements, the US Department of Energy (DOE) has established a US-India Science and Technology Initiative to utilize the expertise of DOE national laboratories to conduct activities that support US policy objectives in South Asia. PNNL and LANL are working with US government agencies to identify appropriate non-sensitive, non-nuclear areas for US-Indian technical collaboration. The objectives of such collaboration are to address visible national and international problems, build trust between the United States and India, and contribute to regional stability in South Asia. This paper describes the approach for this engagement, the Indian scientific organization and infrastructure, potential areas for collaboration, and current status of the initiative.
Agarwal, Sonya; Döring, Kristina; Gierusz, Leszek A.; Iyer, Pooja; Lane, Fiona M.; Graham, James F.; Goldmann, Wilfred; Pinheiro, Teresa J. T.; Gill, Andrew C.
2015-10-01
The β2-α2 loop of PrPC is a key modulator of disease-associated prion protein misfolding. Amino acids that differentiate mouse (Ser169, Asn173) and deer (Asn169, Thr173) PrPC appear to confer dramatically different structural properties in this region and it has been suggested that amino acid sequences associated with structural rigidity of the loop also confer susceptibility to prion disease. Using mouse recombinant PrP, we show that mutating residue 173 from Asn to Thr alters protein stability and misfolding only subtly, whilst changing Ser to Asn at codon 169 causes instability in the protein, promotes oligomer formation and dramatically potentiates fibril formation. The doubly mutated protein exhibits more complex folding and misfolding behaviour than either single mutant, suggestive of differential effects of the β2-α2 loop sequence on both protein stability and on specific misfolding pathways. Molecular dynamics simulation of protein structure suggests a key role for the solvent accessibility of Tyr168 in promoting molecular interactions that may lead to prion protein misfolding. Thus, we conclude that ‘rigidity’ in the β2-α2 loop region of the normal conformer of PrP has less effect on misfolding than other sequence-related effects in this region.
Olenkina, O M; Egorova, K S; Aravin, A A; Naumova, N M; Gvozdev, V A; Olenina, L V
2012-11-01
Tandem Stellate genes organized into two clusters in heterochromatin and euchromatin of the X-chromosome are part of the Ste-Su(Ste) genetic system required for maintenance of male fertility and reproduction of Drosophila melanogaster. Stellate genes encode a regulatory subunit of protein kinase CK2 and are the main targets of germline-specific piRNA-silencing; their derepression leads to appearance of protein crystals in spermatocytes, meiotic disturbances, and male sterility. A short promoter region of 134 bp appears to be sufficient for testis-specific transcription of Stellate, and it contains three closely located cis-regulatory elements called E-boxes. By using reporter analysis, we confirmed a strong functionality of the E-boxes in the Stellate promoter for in vivo transcription. Using selective mutagenesis, we have shown that the presence of the central E-box 2 is preferable to maintain a high-level testis-specific transcription of the reporter gene under the Stellate promoter. The Stellate promoter provides transcription even in heterochromatin, and corresponding mRNAs are translated with the generation of full-size protein products in case of disturbances in the piRNA-silencing process. We have also shown for the first time that the activity of the Stellate promoter is determined by chromatin context of the X-chromosome in male germinal cells, and it increases at about twofold when relocating in autosomes.
Attey, A; Belyaeva, T; Savery, N; Hoggett, J; Fujita, N; Ishihama, A; Busby, S
1994-10-25
DNAase I footprinting has been used to study open complexes between Escherichia coli RNA polymerase and the galactose operon P1 promoter, both in the absence and the presence of CRP (the cyclic AMP receptor protein, a transcription activator). From the effects of deletion of the C-terminal part of the RNA polymerase alpha subunit, we deduce that alpha binds at the upstream end of both the binary RNA polymerase-galP1 and ternary RNA polymerase-CRP-galP1 complexes. Disruption of the alpha-upstream contact suppresses open complex formation at galP1 at lower temperatures. In ternary RNA polymerase-CRP-galP1 complexes, alpha appears to make direct contact with Activating Region 1 in CRP. DNAase I footprinting has been used to detect and quantify interactions between purified alpha and CRP bound at galP1.
Barnidge, Ellen K; Baker, Elizabeth A; Estlund, Amy; Motton, Freda; Hipp, Pamela R; Brownson, Ross C
2015-06-11
Rural residents are less likely than urban and suburban residents to meet recommendations for nutrition and physical activity. Interventions at the environmental and policy level create environments that support healthy eating and physical activity. Healthier Missouri Communities (Healthier MO) is a community-based research project conducted by the Prevention Research Center in St. Louis with community partners from 12 counties in rural southeast Missouri. We created a regional partnership to leverage resources and enhance environmental and policy interventions to improve nutrition and physical activity in rural southeast Missouri. Partners were engaged in a participatory action planning process that included prioritizing, implementing, and evaluating promising evidence-based interventions to promote nutrition and physical activity. Group interviews were conducted with Healthier MO community partners post intervention to evaluate resource sharing and sustainability efforts of the regional partnership. Community partners identified the benefits and challenges of resource sharing within the regional partnership as well as the opportunities and threats to long-term partnership sustainability. The partners noted that the regional participatory process was difficult, but the benefits outweighed the challenges. Regional rural partnerships may be an effective way to leverage relationships to increase the capacity of rural communities to implement environmental and policy interventions to promote nutrition and physical activity.
Directory of Open Access Journals (Sweden)
Hasriadi Mat Akin
2011-10-01
Full Text Available Cloning and sequencing of coat protein gene and 3’UTR (untranslated region of peanut stripe virus. The cDNA of 3' terminal of peanut stripe virus genomic RNA was cloned and sequenced. The cDNA was ligated with plasmid vector pGEM-T Easy and transformed to competent cells of Escherichia coli. The 3' terminal of PstV genomic RNA contained 1195 nucleotides (nts. The region included the nucleotide sequences of NIb (nuclear inclusion body (129 nts, CP gene (coat protein gene (861 nts, and 3'UTR (untranslated region (205 nts. The nucleotide sequence of a CP gene contained one long uninterrupted open reading frame (ORF without a start codon, which ended a UAG stop codon. The 287 amino acid residues of PStV coat protein were predicted from the CP gene. The amino acid was analyzed for the presence of consensus polyprotein cleavage site for maturation of potyvirus polyprotein. A putative cleavage site was found at position 43 (Q/S following the Valine (V residue at -4 position. This isolate of PstV can be expected to be aphid transmissible because the coat protein contained a DAG triplet at position 53-55.
International Nuclear Information System (INIS)
Sarfstein, Rive; Belfiore, Antonino; Werner, Haim
2010-01-01
The insulin-like growth factor I receptor (IGF-IR) has been implicated in the etiology of breast cancer. Overexpression of the IGF-IR gene is a typical feature of most primary breast cancers, whereas low IGF-IR levels are seen at advanced stages. Hence, evaluation of IGF-IR levels might be important for assessing prognosis. In the present study, we employed a proteomic approach based on DNA affinity chromatography followed either by mass spectroscopy (MS) or Western blot analysis to identify transcription factors that may associate with the IGF-IR promoter in estrogen receptor (ER)-positive and ER-depleted breast cancer cells. A biotinylated IGF-IR promoter fragment was bound to streptavidin magnetic beads and incubated with nuclear extracts of breast cancer cells. IGF-IR promoter-binding proteins were eluted with high salt and analyzed by MS and Western blots. Among the proteins that were found to bind to the IGF-IR promoter we identified zinc finger transcription factors Sp1 and KLF6, ER-α, p53, c-jun, and poly (ADP-ribosylation) polymerase. Furthermore, chromatin immune-precipitation (ChIP) analysis confirmed the direct in vivo binding of some of these transcription factors to IGF-IR promoter DNA. The functional relevance of binding data was assessed by cotransfection experiments with specific expression vectors along with an IGF-IR promoter reporter. In summary, we identified nuclear proteins that are potentially responsible for the differential expression of the IGF-IR gene in ER-positive and ER-depleted breast cancer cells
Energy Technology Data Exchange (ETDEWEB)
Sarfstein, Rive [Department of Human Molecular Genetics and Biochemistry, Sackler School of Medicine, Tel Aviv University, Tel Aviv 69978 (Israel); Belfiore, Antonino [Department of Clinical and Experimental Medicine, University Magna Graecia of Catanzaro, Catanzaro 88100 (Italy); Werner, Haim, E-mail: hwerner@post.tau.ac.il [Department of Human Molecular Genetics and Biochemistry, Sackler School of Medicine, Tel Aviv University, Tel Aviv 69978 (Israel)
2010-03-25
The insulin-like growth factor I receptor (IGF-IR) has been implicated in the etiology of breast cancer. Overexpression of the IGF-IR gene is a typical feature of most primary breast cancers, whereas low IGF-IR levels are seen at advanced stages. Hence, evaluation of IGF-IR levels might be important for assessing prognosis. In the present study, we employed a proteomic approach based on DNA affinity chromatography followed either by mass spectroscopy (MS) or Western blot analysis to identify transcription factors that may associate with the IGF-IR promoter in estrogen receptor (ER)-positive and ER-depleted breast cancer cells. A biotinylated IGF-IR promoter fragment was bound to streptavidin magnetic beads and incubated with nuclear extracts of breast cancer cells. IGF-IR promoter-binding proteins were eluted with high salt and analyzed by MS and Western blots. Among the proteins that were found to bind to the IGF-IR promoter we identified zinc finger transcription factors Sp1 and KLF6, ER-α, p53, c-jun, and poly (ADP-ribosylation) polymerase. Furthermore, chromatin immune-precipitation (ChIP) analysis confirmed the direct in vivo binding of some of these transcription factors to IGF-IR promoter DNA. The functional relevance of binding data was assessed by cotransfection experiments with specific expression vectors along with an IGF-IR promoter reporter. In summary, we identified nuclear proteins that are potentially responsible for the differential expression of the IGF-IR gene in ER-positive and ER-depleted breast cancer cells.
Directory of Open Access Journals (Sweden)
Dobrovic Alexander
2009-09-01
Full Text Available Abstract Background Succinate dehydrogenase (SDH and fumarate hydratase (FH are tricarboxylic acid (TCA cycle enzymes that are also known to act as tumour suppressor genes. Increased succinate or fumarate levels as a consequence of SDH and FH deficiency inhibit hypoxia inducible factor-1α (HIF-1α prolyl hydroxylases leading to sustained HIF-1α expression in tumours. Since HIF-1α is frequently expressed in breast carcinomas, DNA methylation at the promoter regions of the SDHA, SDHB, SDHC and SDHD and FH genes was evaluated as a possible mechanism in silencing of SDH and FH expression in breast carcinomas. Findings No DNA methylation was identified in the promoter regions of the SDHA, SDHB, SDHC, SDHD and FH genes in 72 breast carcinomas and 10 breast cancer cell lines using methylation-sensitive high resolution melting which detects both homogeneous and heterogeneous methylation. Conclusion These results show that inactivation via DNA methylation of the promoter CpG islands of SDH and FH is unlikely to play a major role in sporadic breast carcinomas.
Directory of Open Access Journals (Sweden)
Casart Yveth
2008-03-01
Full Text Available Abstract Background The ParA/Soj and ParB/Spo0J proteins, and the cis-acting parS site, participate actively in chromosome segregation and cell cycle progression. Genes homologous to parA and parB, and two putative parS copies, have been identified in the Mycobacterium bovis BCG and Mycobacterium smegmatis chromosomes. As in Mycobacterium tuberculosis, the parA and parB genes in these two non-pathogenic mycobacteria are located near the chromosomal origin of replication. The present work focused on the determination of the transcriptional organisation of the ~6 Kb orf60K-parB region of M. bovis BCG and M. smegmatis by primer extension, transcriptional fusions to the green fluorescence protein (GFP and quantitative RT-PCR. Results The parAB genes were arranged in an operon. However, we also found promoters upstream of each one of these genes. Seven putative promoter sequences were identified in the orf60K-parB region of M. bovis BCG, whilst four were identified in the homologous region of M. smegmatis, one upstream of each open reading frame (ORF. Real-time PCR assays showed that in M. smegmatis, mRNA-parA and mRNA-parB levels decreased between the exponential and stationary phases. In M. bovis BCG, mRNA-parA levels also decreased between the exponential and stationary phases. However, parB expression was higher than parA expression and remained almost unchanged along the growth curve. Conclusion The majority of the proposed promoter regions had features characteristic of Mycobacterium promoters previously denoted as Group D. The -10 hexamer of a strong E. coli σ70-like promoter, located upstream of gidB of M. bovis BCG, overlapped with a putative parS sequence, suggesting that the transcription from this promoter might be regulated by the binding of ParB to parS.
Taylor, Kathryne E.
2015-01-01
ABSTRACT It has recently been proposed that the herpes simplex virus (HSV) protein ICP0 has cytoplasmic roles in blocking antiviral signaling and in promoting viral replication in addition to its well-known proteasome-dependent functions in the nucleus. However, the mechanisms through which it produces these effects remain unclear. While investigating this further, we identified a novel cytoplasmic interaction between ICP0 and the poorly characterized cellular protein WDR11. During an HSV infection, WDR11 undergoes a dramatic change in localization at late times in the viral replication cycle, moving from defined perinuclear structures to a dispersed cytoplasmic distribution. While this relocation was not observed during infection with viruses other than HSV-1 and correlated with efficient HSV-1 replication, the redistribution was found to occur independently of ICP0 expression, instead requiring viral late gene expression. We demonstrate for the first time that WDR11 is localized to the trans-Golgi network (TGN), where it interacts specifically with some, but not all, HSV virion components, in addition to ICP0. Knockdown of WDR11 in cultured human cells resulted in a modest but consistent decrease in yields of both wild-type and ICP0-null viruses, in the supernatant and cell-associated fractions, without affecting viral gene expression. Although further study is required, we propose that WDR11 participates in viral assembly and/or secondary envelopment. IMPORTANCE While the TGN has been proposed to be the major site of HSV-1 secondary envelopment, this process is incompletely understood, and in particular, the role of cellular TGN components in this pathway is unknown. Additionally, little is known about the cellular functions of WDR11, although the disruption of this protein has been implicated in multiple human diseases. Therefore, our finding that WDR11 is a TGN-resident protein that interacts with specific viral proteins to enhance viral yields improves both
Directory of Open Access Journals (Sweden)
González Mario
2012-09-01
Full Text Available Abstract Background O-glycosylation of secretory proteins has been found to be an important factor in fungal biology and virulence. It consists in the addition of short glycosidic chains to Ser or Thr residues in the protein backbone via O-glycosidic bonds. Secretory proteins in fungi frequently display Ser/Thr rich regions that could be sites of extensive O-glycosylation. We have analyzed in silico the complete sets of putatively secretory proteins coded by eight fungal genomes (Botrytis cinerea, Magnaporthe grisea, Sclerotinia sclerotiorum, Ustilago maydis, Aspergillus nidulans, Neurospora crassa, Trichoderma reesei, and Saccharomyces cerevisiae in search of Ser/Thr-rich regions as well as regions predicted to be highly O-glycosylated by NetOGlyc (http://www.cbs.dtu.dk. Results By comparison with experimental data, NetOGlyc was found to overestimate the number of O-glycosylation sites in fungi by a factor of 1.5, but to be quite reliable in the prediction of highly O-glycosylated regions. About half of secretory proteins have at least one Ser/Thr-rich region, with a Ser/Thr content of at least 40% over an average length of 40 amino acids. Most secretory proteins in filamentous fungi were predicted to be O-glycosylated, sometimes in dozens or even hundreds of sites. Residues predicted to be O-glycosylated have a tendency to be grouped together forming hyper-O-glycosylated regions of varying length. Conclusions About one fourth of secretory fungal proteins were predicted to have at least one hyper-O-glycosylated region, which consists of 45 amino acids on average and displays at least one O-glycosylated Ser or Thr every four residues. These putative highly O-glycosylated regions can be found anywhere along the proteins but have a slight tendency to be at either one of the two ends.
Staines, Katherine A; Prideaux, Matt; Allen, Steve; Buttle, David J; Pitsillides, Andrew A; Farquharson, Colin
2016-06-01
The transmembrane glycoprotein E11 is considered critical in early osteoblast-osteocyte transitions (osteocytogenesis), however its function and regulatory mechanisms are still unknown. Using the late osteoblast MLO-A5 cell line we reveal increased E11 protein/mRNA expression (P < 0.001) concomitant with extensive osteocyte dendrite formation and matrix mineralization (P < 0.001). Transfection with E11 significantly increased mRNA levels (P < 0.001), but immunoblotting failed to detect any correlative increases in E11 protein levels, suggestive of post-translational degradation. We found that exogenous treatment of MLO-A5 and osteocytic IDG-SW3 cells with 10 μM ALLN (calpain and proteasome inhibitor) stabilized E11 protein levels and induced a profound increase in osteocytic dendrite formation (P < 0.001). Treatment with other calpain inhibitors failed to promote similar osteocytogenic changes, suggesting that these effects of ALLN rely upon its proteasome inhibitor actions. Accordingly we found that proteasome-selective inhibitors (MG132/lactacystin/ Bortezomib/Withaferin-A) produced similar dose-dependent increases in E11 protein levels in MLO-A5 and primary osteoblast cells. This proteasomal targeting was confirmed by immunoprecipitation of ubiquitinylated proteins, which included E11, and by increased levels of ubiquitinylated E11 protein upon addition of the proteasome inhibitors MG132/Bortezomib. Activation of RhoA, the small GTPase, was found to be increased concomitant with the peak in E11 levels and its downstream signaling was also observed to promote MLO-A5 cell dendrite formation. Our data indicate that a mechanism reliant upon blockade of proteasome-mediated E11 destabilization contributes to osteocytogenesis and that this may involve downstream targeting of RhoA. This work adds to our mechanistic understanding of the factors regulating bone homeostasis, which may lead to future therapeutic approaches. © 2015 The Authors. Journal of
Directory of Open Access Journals (Sweden)
Neetika Khurana
Full Text Available The small heat shock proteins (sHSPs have been found to play a critical role in physiological stress conditions in protecting proteins from irreversible aggregation. To characterize the hloroplast targeted sHSP26 promoter in detail, deletion analysis of the promoter is carried out and analysed via transgenics in Arabidopsis. In the present study, complete assessment of the importance of CCAAT-box elements along with Heat shock elements (HSEs in the promoter of sHSP26 was performed. Moreover, the importance of 5' untranslated region (UTR has also been established in the promoter via Arabidopsis transgenics. An intense GUS expression was observed after heat stress in the transgenics harbouring a full-length promoter, confirming the heat-stress inducibility of the promoter. Transgenic plants without UTR showed reduced GUS expression when compared to transgenic plants with UTR as was confirmed at the RNA and protein levels by qRT-PCR and GUS histochemical assays, thus suggesting the possible involvement of some regulatory elements present in the UTR in heat-stress inducibility of the promoter. Promoter activity was also checked under different abiotic stresses and revealed differential expression in different deletion constructs. Promoter analysis based on histochemical assay, real-time qPCR and fluorimetric analysis revealed that HSEs alone could not transcribe GUS gene significantly in sHSP26 promoter and CCAAT box elements contribute synergistically to the transcription. Our results also provide insight into the importance of 5`UTR of sHsp26 promoter thus emphasizing the probable role of imperfect CCAAT-box element or some novel cis-element with respect to heat stress.
Ikegami, Tetsuro; Narayanan, Krishna; Won, Sungyong; Kamitani, Wataru; Peters, C J; Makino, Shinji
2009-02-01
Rift Valley fever virus (RVFV) (genus Phlebovirus, family Bunyaviridae) is a negative-stranded RNA virus with a tripartite genome. RVFV is transmitted by mosquitoes and causes fever and severe hemorrhagic illness among humans, and fever and high rates of abortions in livestock. A nonstructural RVFV NSs protein inhibits the transcription of host mRNAs, including interferon-beta mRNA, and is a major virulence factor. The present study explored a novel function of the RVFV NSs protein by testing the replication of RVFV lacking the NSs gene in the presence of actinomycin D (ActD) or alpha-amanitin, both of which served as a surrogate of the host mRNA synthesis suppression function of the NSs. In the presence of the host-transcriptional inhibitors, the replication of RVFV lacking the NSs protein, but not that carrying NSs, induced double-stranded RNA-dependent protein kinase (PKR)-mediated eukaryotic initiation factor (eIF)2alpha phosphorylation, leading to the suppression of host and viral protein translation. RVFV NSs promoted post-transcriptional downregulation of PKR early in the course of the infection and suppressed the phosphorylated eIF2alpha accumulation. These data suggested that a combination of RVFV replication and NSs-induced host transcriptional suppression induces PKR-mediated eIF2alpha phosphorylation, while the NSs facilitates efficient viral translation by downregulating PKR and inhibiting PKR-mediated eIF2alpha phosphorylation. Thus, the two distinct functions of the NSs, i.e., the suppression of host transcription, including that of type I interferon mRNAs, and the downregulation of PKR, work together to prevent host innate antiviral functions, allowing efficient replication and survival of RVFV in infected mammalian hosts.
Li, Zhiqing; Cheng, Daojun; Mon, Hiroaki; Zhu, Li; Xu, Jian; Tatsuke, Tsuneyuki; Lee, Jae Man; Xia, Qingyou; Kusakabe, Takahiro
2013-01-01
Epigenetic modifiers and transcription factors contribute to developmentally programmed gene expression. Here, we establish a functional link between epigenetic regulation by Polycomb group (PcG) proteins and transcriptional regulation by C/ebp that orchestrates the correct expression of Bombyx mori asparagine synthetase (BmASNS), a gene involved in the biosynthesis of asparagine. We show that the cis-regulatory elements of YY1-binding motifs and the CpG island present on the BmASNS promoter are required for the recruitment of PcG proteins and the subsequent deposition of the epigenetic repression mark H3K27me3. RNAi-mediated knockdown of PcG genes leads to derepression of the BmASNS gene via the recruitment of activators, including BmC/ebp, to the promoter. Intriguingly, we find that PcG proteins and BmC/ebp can dynamically modulate the transcriptional output of the BmASNS target in a cell cycle-dependent manner. It will be essential to suppress BmASNS expression by PcG proteins at the G2/M phase of the cell cycle in the presence of BmC/ebp activator. Thus, our results provide a novel insight into the molecular mechanism underlying the recruitment and regulation of the PcG system at a discrete gene locus in Bombyx mori. PMID:23382816
Quantifying Surface Coal-Mining Patterns to Promote Regional Sustainability in Ordos, Inner Mongolia
Directory of Open Access Journals (Sweden)
Xiaoji Zeng
2018-04-01
Full Text Available Ordos became the new “coal capital” of China within a few decades since the country’s economic reform in 1978, as large-scale surface coal mining dramatically propelled its per capita GDP from being one of the lowest to one of the highest in China, exceeding Hong Kong in 2009. Surface coal-mining areas (SCMAs have continued to expand in this region during recent decades, resulting in serious environmental and socioeconomic consequences. To understand these impacts and promote regional sustainability, quantifying the spatiotemporal patterns of SCMAs is urgently needed. Thus, the main objectives of this study were to quantify the spatiotemporal patterns of SCMAs in the Ordos region from 1990 to 2015, and to examine some of the major environmental and socioeconomic impacts in the study region. We extracted the SCMAs using remote-sensing data, and then quantified their spatiotemporal patterns using landscape metrics. The loss of natural habitat and several socioeconomic indicators were examined in relation to surface coal mining. Our results show that the area of SCMAs increased from 7.12 km2 to 355.95 km2, an increase of nearly 49 times from 1990 to 2015 in the Ordos region. The number of SCMAs in this region increased from 82 to 651, a nearly seven-fold increase. In particular, Zhungeer banner (an administrative division, Yijinhuoluo banner, Dongsheng District and Dalate banner in the north-eastern part of the Ordos region had higher growth rates of SCMAs. The income gap between urban and rural residents increased along with the growth in SCMAs, undermining social equity in the Ordos region. Moreover, the rapid increase in SCMAs resulted in natural habitat loss (including grasslands, forests, and deserts across this region. Thus, we suggest that regional sustainability in Ordos needs to emphasize effective measures to curb large-scale surface coal mining in order to reduce the urban–rural income gap, and to restore degraded natural
DEFF Research Database (Denmark)
Sandvej, K; Andresen, B S; Zhou, X G
2000-01-01
AIMS: To study the distribution of Epstein-Barr virus (EBV) variants containing mutations in the latent membrane protein 1 (LMP-1) oncogene and promoter in EBV associated Hodgkin's disease and infectious mononucleosis compared with previous findings in asymptomatic EBV carriers. METHODS: Sequence...... analysis of the EBV LMP-1 promoter and gene in isolates from Danish patients with Hodgkin's disease (n = 61) and infectious mononucleosis (n = 10). RESULTS: Viruses (previously designated group D) that contain two mutations in the activating transcription factor/cAMP response element (ATF/CRE) in the LMP-1...... promoter, which are known to decrease promoter activity greatly, were significantly less frequent in Hodgkin's disease than in both infectious mononucleosis (p = 0.0081) and asymptomatic EBV carriers (p = 0.0084). In some cases, the LMP-1 gene contained mutations in a recently identified cytotoxic T cell...
International Nuclear Information System (INIS)
Tada, Hiroomi; Lashgari, M.; Amini, S.; Khalili, K.; Rappaport, J.; Wong-Staal, F.
1990-01-01
Progressive multifocal leukoencephalopathy (PML) is a demyelinating disease of the central nervous system caused by the JC virus (JCV), a human papovavirus. PML is a relatively rare disease seen predominantly in immunocompromised individuals and is a frequent complication observed in AIDS patients. The significantly higher incidence of PML in AIDS patients than in other immunosuppressive disorders has suggested that the presence of human immunodeficiency virus type 1 (HIV-1) in the brain may directly or indirectly contribute to the pathogenesis of this disease. In the present study the authors have examined the expression of the JCV genome in both glial and non-glial cells in the presence of HIV-1 regulatory proteins. They find that the HIV-1-encoded trans-regulatory protein tat increases the basal activity of the JCV late promoter, JCV L , in glial cells. They conclude that the presence of the HIV-1-encoded tat protein may positively affect the JCV lytic cycle in glial cells by stimulating JCV gene expression. The results suggest a mechanism for the relatively high incidence of PML in AIDS patients than in other immunosuppressive disorders. Furthermore, the findings indicate that the HIV-1 regulatory protein tat may stimulate other viral and perhaps cellular promoters, in addition to its own
Control of striatal signaling by G protein regulators
Directory of Open Access Journals (Sweden)
Keqiang eXie
2011-08-01
Full Text Available Signaling via heterotrimeric G proteins plays a crucial role in modulating the responses of striatal neurons that ultimately shape core behaviors mediated by the basal ganglia circuitry, such as reward valuation, habit formation and movement coordination. Activation of G-protein-coupled receptors (GPCRs by extracellular signals activates heterotrimeric G proteins by promoting the binding of GTP to their α subunits. G proteins exert their effects by influencing the activity of key effector proteins in this region, including ion channels, second messenger enzymes and protein kinases. Striatal neurons express a staggering number of GPCRs whose activation results in the engagement of downstream signaling pathways and cellular responses with unique profiles but common molecular mechanisms. Studies over the last decade have revealed that the extent and duration of GPCR signaling are controlled by a conserved protein family named Regulator of G protein Signaling (RGS. RGS proteins accelerate GTP hydrolysis by the α subunits of G proteins, thus promoting deactivation of GPCR signaling. In this review, we discuss the progress made in understanding the roles of RGS proteins in controlling striatal G protein signaling and providing integration and selectivity of signal transmission. We review evidence on the formation of a macromolecular complex between RGS proteins and other components of striatal signaling pathways, their molecular regulatory mechanisms and impacts on GPCR signaling in the striatum obtained from biochemical studies and experiments involving genetic mouse models. Special emphasis is placed on RGS9-2, a member of the RGS family that is highly enriched in the striatum and plays critical roles in drug addiction and motor control.
Bøhle, Liv Anette; Brede, Dag Anders; Diep, Dzung B; Holo, Helge; Nes, Ingolf F
2010-11-01
The intestinal flora of mammals contains lactic acid bacteria (LAB) that may provide positive health effects for the host. Such bacteria are referred to as probiotic bacteria. From a pig, we have isolated a Lactobacillus reuteri strain that produces an antimicrobial peptide (AMP). The peptide was purified and characterized, and it was unequivocally shown that the AMP was a well-defined degradation product obtained from the mucus adhesion-promoting protein (MapA); it was therefore termed AP48-MapA. This finding demonstrates how large proteins might inherit unexpected pleiotropic functions by conferring antimicrobial capacities on the producer. The MapA/AP48-MapA system is the first example where a large protein of an intestinal LAB is shown to give rise to such an AMP. It is also of particular interest that the protein that provides this AMP is associated with the binding of the bacterium producing it to the surface/lining of the gut. This finding gives us new perspective on how some probiotic bacteria may successfully compete in this environment and thereby contribute to a healthy microbiota.
Dean, Gillian H; Jin, Zhaoqing; Shi, Lin; Esfandiari, Elahe; McGee, Robert; Nabata, Kylie; Lee, Tiffany; Kunst, Ljerka; Western, Tamara L; Haughn, George W
2017-09-01
The Arabidopsis seed coat-specific promoter fragment described is an important tool for basic and applied research in Brassicaceae species. During differentiation, the epidermal cells of the Arabidopsis seed coat produce and secrete large quantities of mucilage. On hydration of mature seeds, this mucilage becomes easily accessible as it is extruded to form a tightly attached halo at the seed surface. Mucilage is composed mainly of pectin, and also contains the key cell wall components cellulose, hemicellulose, and proteins, making it a valuable model for studying numerous aspects of cell wall biology. Seed coat-specific promoters are an important tool that can be used to assess the effects of expressing biosynthetic enzymes and diverse cell wall-modifying proteins on mucilage structure and function. Additionally, they can be used for production of easily accessible recombinant proteins of commercial interest. The MUCILAGE-MODIFIED4 (MUM4) gene is expressed in a wide variety of plant tissues and is strongly up-regulated in the seed coat during mucilage synthesis, implying the presence of a seed coat-specific region in its promoter. Promoter deletion analysis facilitated isolation of a 308 base pair sequence (MUM4 0.3Pro ) that directs reporter gene expression in the seed coat cells of both Arabidopsis and Camelina sativa, and is regulated by the same transcription factor cascade as endogenous MUM4. Therefore, MUM4 0.3Pro is a promoter fragment that serves as a new tool for seed coat biology research.
Panagopoulou, Maria; Lambropoulou, Maria; Balgkouranidou, Ioanna; Nena, Evangelia; Karaglani, Makrina; Nicolaidou, Christina; Asimaki, Anthi; Konstantinidis, Theocharis; Constantinidis, Theodoros C; Kolios, George; Kakolyris, Stylianos; Agorastos, Theodoros; Chatzaki, Ekaterini
2017-04-01
Cervical cancer is strongly related to certain high-risk types of human papilloma virus infection. Breast cancer metastasis suppressor 1 (BRMS1) is a tumor suppressor gene, its expression being regulated by DNA promoter methylation in several types of cancers. This study aims to evaluate the methylation status of BRMS1 promoter in relation to high-risk types of human papilloma virus infection and the development of pre-cancerous lesions and describe the pattern of BRMS1 protein expression in normal, high-risk types of human papilloma virus-infected pre-cancerous and malignant cervical epithelium. We compared the methylation status of BRMS1 in cervical smears of 64 women with no infection by high-risk types of human papilloma virus to 70 women with proven high-risk types of human papilloma virus infection, using real-time methylation-specific polymerase chain reaction. The expression of BRMS1 protein was described by immunohistochemistry in biopsies from cervical cancer, pre-cancerous lesions, and normal cervices. Methylation of BRMS1 promoter was detected in 37.5% of women with no high-risk types of human papilloma virus infection and was less frequent in smears with high-risk types of human papilloma virus (11.4%) and in women with pathological histology (cervical intraepithelial neoplasia) (11.9%). Methylation was detected also in HeLa cervical cancer cells. Immunohistochemistry revealed nuclear BRMS1 protein staining in normal high-risk types of human papilloma virus-free cervix, in cervical intraepithelial neoplasias, and in malignant tissues, where staining was occasionally also cytoplasmic. In cancer, expression was stronger in the more differentiated cancer blasts. In conclusion, BRMS1 promoter methylation and aberrant protein expression seem to be related to high-risk types of human papilloma virus-induced carcinogenesis in uterine cervix and is worthy of further investigation.
Ansari, Suraiya A.; Paul, Emily; Sommer, Sebastian; Lieleg, Corinna; He, Qiye; Daly, Alexandre Z.; Rode, Kara A.; Barber, Wesley T.; Ellis, Laura C.; LaPorta, Erika; Orzechowski, Amanda M.; Taylor, Emily; Reeb, Tanner; Wong, Jason; Korber, Philipp; Morse, Randall H.
2014-01-01
Transcription by RNA polymerase II (Pol II) in eukaryotes requires the Mediator complex, and often involves chromatin remodeling and histone eviction at active promoters. Here we address the role of Mediator in recruitment of the Swi/Snf chromatin remodeling complex and its role, along with components of the preinitiation complex (PIC), in histone eviction at inducible and constitutively active promoters in the budding yeast Saccharomyces cerevisiae. We show that recruitment of the Swi/Snf chromatin remodeling complex to the induced CHA1 promoter, as well as its association with several constitutively active promoters, depends on the Mediator complex but is independent of Mediator at the induced MET2 and MET6 genes. Although transcriptional activation and histone eviction at CHA1 depends on Swi/Snf, Swi/Snf recruitment is not sufficient for histone eviction at the induced CHA1 promoter. Loss of Swi/Snf activity does not affect histone occupancy of several constitutively active promoters; in contrast, higher histone occupancy is seen at these promoters in Mediator and PIC component mutants. We propose that an initial activator-dependent, nucleosome remodeling step allows PIC components to outcompete histones for occupancy of promoter sequences. We also observe reduced promoter association of Mediator and TATA-binding protein in a Pol II (rpb1-1) mutant, indicating mutually cooperative binding of these components of the transcription machinery and indicating that it is the PIC as a whole whose binding results in stable histone eviction. PMID:24727477
Human FAN1 promotes strand incision in 5'-flapped DNA complexed with RPA.
Takahashi, Daisuke; Sato, Koichi; Hirayama, Emiko; Takata, Minoru; Kurumizaka, Hitoshi
2015-09-01
Fanconi anaemia (FA) is a human infantile recessive disorder. Seventeen FA causal proteins cooperatively function in the DNA interstrand crosslink (ICL) repair pathway. Dual DNA strand incisions around the crosslink are critical steps in ICL repair. FA-associated nuclease 1 (FAN1) is a DNA structure-specific endonuclease that is considered to be involved in DNA incision at the stalled replication fork. Replication protein A (RPA) rapidly assembles on the single-stranded DNA region of the stalled fork. However, the effect of RPA on the FAN1-mediated DNA incision has not been determined. In this study, we purified human FAN1, as a bacterially expressed recombinant protein. FAN1 exhibited robust endonuclease activity with 5'-flapped DNA, which is formed at the stalled replication fork. We found that FAN1 efficiently promoted DNA incision at the proper site of RPA-coated 5'-flapped DNA. Therefore, FAN1 possesses the ability to promote the ICL repair of 5'-flapped DNA covered by RPA. © The Authors 2015. Published by Oxford University Press on behalf of the Japanese Biochemical Society. All rights reserved.
Avall-Jääskeläinen, Silja; Lindholm, Agneta; Palva, Airi
2003-04-01
Lactobacillus brevis is a promising lactic acid bacterium for use as a probiotic dietary adjunct and a vaccine vector. The N-terminal region of the S-layer protein (SlpA) of L. brevis ATCC 8287 was recently shown to mediate adhesion to various human cell lines in vitro. In this study, a surface display cassette was constructed on the basis of this SlpA receptor-binding domain, a proteinase spacer, and an autolysin anchor. The cassette was expressed under control of the nisA promoter in Lactococcus lactis NZ9000. Western blot assay of lactococcal cell wall extracts with anti-SlpA antibodies confirmed that the SlpA adhesion domain of the fusion protein was expressed and located within the cell wall layer. Whole-cell enzyme-linked immunosorbent assay and immunofluorescence microscopy verified that the SlpA adhesion-mediating region was accessible on the lactococcal cell surface. In vitro adhesion assays with the human intestinal epithelial cell line Intestine 407 indicated that the recombinant lactococcal cells had gained an ability to adhere to Intestine 407 cells significantly greater than that of wild-type L. lactis NZ9000. Serum inhibition assay further confirmed that adhesion of recombinant lactococci to Intestine 407 cells was indeed mediated by the N terminus-encoding part of the slpA gene. The ability of the receptor-binding region of SlpA to adhere to fibronectin was also confirmed with this lactococcal surface display system. These results show that, with the aid of the receptor-binding region of the L. brevis SlpA protein, the ability to adhere to gut epithelial cells can indeed be transferred to another, nonadhesive, lactic acid bacterium.
Gudi, Radhika; Zou, Chaozhong; Dhar, Jayeeta; Gao, Qingshen; Vasu, Chenthamarakshan
2014-01-01
Centriole duplication is the process by which two new daughter centrioles are generated from the proximal end of preexisting mother centrioles. Accurate centriole duplication is important for many cellular and physiological events, including cell division and ciliogenesis. Centrosomal protein 4.1-associated protein (CPAP), centrosomal protein of 152 kDa (CEP152), and centrobin are known to be essential for centriole duplication. However, the precise mechanism by which they contribute to centriole duplication is not known. In this study, we show that centrobin interacts with CEP152 and CPAP, and the centrobin-CPAP interaction is critical for centriole duplication. Although depletion of centrobin from cells did not have an effect on the centriolar levels of CEP152, it caused the disappearance of CPAP from both the preexisting and newly formed centrioles. Moreover, exogenous expression of the CPAP-binding fragment of centrobin also caused the disappearance of CPAP from both the preexisting and newly synthesized centrioles, possibly in a dominant negative manner, thereby inhibiting centriole duplication and the PLK4 overexpression-mediated centrosome amplification. Interestingly, exogenous overexpression of CPAP in the centrobin-depleted cells did not restore CPAP localization to the centrioles. However, restoration of centrobin expression in the centrobin-depleted cells led to the reappearance of centriolar CPAP. Hence, we conclude that centrobin-CPAP interaction is critical for the recruitment of CPAP to procentrioles to promote the elongation of daughter centrioles and for the persistence of CPAP on preexisting mother centrioles. Our study indicates that regulation of CPAP levels on the centrioles by centrobin is critical for preserving the normal size, shape, and number of centrioles in the cell. PMID:24700465
Directory of Open Access Journals (Sweden)
Sun Yuping
2016-03-01
Full Text Available Labor resource is the necessary productive factor in regional economic development, and one of important indexes to evaluate regional economic competitiveness. The great economic achievement brought by the 30-year reform and opening up of China is due to the fact that China brought the backward advantage of “demographic dividend” into play, promoted the fast development of industrialization and urbanization, and became the second largest economy in the world. The entity of “demographic dividend” is the non-agricultural migrant population, i.e., migrant workers. The transfer employment of migrant workers has typical regional liquidity, and the imbalance of regional economy causes the flow of many migrant workers. In order to achieve harmonious development and coordinated development, underdeveloped areas must understand the character and regulation, adopt positive industrial policy and supportive policy, guide the reasonable flow of migrant workers, and realize the transfer of local employment and citizenization of migrant workers, which can enhance regional economic competitiveness
Bone morphogenetic protein-7 promotes chondrogenesis in human amniotic epithelial cells.
Zhou, Junjie; Yu, Guangrong; Cao, Chengfu; Pang, Jinhui; Chen, Xianqi
2011-06-01
Bone morphogenetic proteins (BMPs) play important roles at multiple stages of chondrogenesis. This study was undertaken to investigate the potential role of bone morphogenetic protein-7 (BMP-7) in the differentiation of chondrocytes using tissue engineering techniques. The impact of BMP-7 on human amniotic epithelial cells (hAECs) was tested. The hAECs were treated either with recombinant human BMP-7 cDNA or with transforming growth factor beta 1 (TGF-β1) as a positive control for three weeks in vitro. Cartilaginous differentiation and proliferation were assayed by quantitative RT-PCR, histology, and in situ hybridization. Our results were such that hAECs treated with either BMP-7 or TGF-β1 expressed cartilage markers (aggrecan, Sox9, CEP-68, and type II and X collagens) within three weeks. Compared with a control vector, BMP-7 induced a decrease in type I collagen expression, while the transcription of the cartilage-specific type II collagen remained stable. In induction experiments, BMP-7 transgenic hAECs exhibited the largest amount of matrix synthesis. In conclusion, these data indicate that BMP-7 plays an important role in inducing the production of cartilage by hAECs in vitro. Cartilage differentiation and matrix maturation can be promoted by BMPs in a cartilage engineering paradigm. These properties make BMPs promising tools in the engineering of cartilaginous joint bio-prostheses and as candidate biological agents or genes for cartilage stabilisation.
The role of COMESA in promoting intra-regional agricultural trade: Case study of Sudan
Directory of Open Access Journals (Sweden)
Azharia Abdelbagi Elbushra
2011-06-01
Full Text Available African countries have created many regional trade agreements with the economic objectives of reducing trade barriers and encouraging economic growth. The COMESA is an example of regional integration singed on 1993 by 19 African countries including Sudan. COMESA represents a chance for member countries to enhance their economic and social relations through increasing intra-trade. The objective of this paper is to assess the role of COMESA in promoting intra-regional agricultural trade between Sudan and COMESA countries. A multi-market model with Armington non-linear specification was applied. The paper results showed that there is a great potential for Sudan to increase its agricultural exports to other COMESA countries. The domestic agricultural markets are expected to be hampered by imports surge and increase in competition, while the producers of agricultural export commodities will be better off. In order to compete and benefit from potential in the COMESA markets, the paper recommended improving efficiency in the Sudanese agricultural sector through increasing productivity, lowering cost of production, enhancing marketing services, attaining economies of scale and attracting foreign investment.
Gaines, J C; Acebes, S; Virrueta, A; Butler, M; Regan, L; O'Hern, C S
2018-05-01
We compare side chain prediction and packing of core and non-core regions of soluble proteins, protein-protein interfaces, and transmembrane proteins. We first identified or created comparable databases of high-resolution crystal structures of these 3 protein classes. We show that the solvent-inaccessible cores of the 3 classes of proteins are equally densely packed. As a result, the side chains of core residues at protein-protein interfaces and in the membrane-exposed regions of transmembrane proteins can be predicted by the hard-sphere plus stereochemical constraint model with the same high prediction accuracies (>90%) as core residues in soluble proteins. We also find that for all 3 classes of proteins, as one moves away from the solvent-inaccessible core, the packing fraction decreases as the solvent accessibility increases. However, the side chain predictability remains high (80% within 30°) up to a relative solvent accessibility, rSASA≲0.3, for all 3 protein classes. Our results show that ≈40% of the interface regions in protein complexes are "core", that is, densely packed with side chain conformations that can be accurately predicted using the hard-sphere model. We propose packing fraction as a metric that can be used to distinguish real protein-protein interactions from designed, non-binding, decoys. Our results also show that cores of membrane proteins are the same as cores of soluble proteins. Thus, the computational methods we are developing for the analysis of the effect of hydrophobic core mutations in soluble proteins will be equally applicable to analyses of mutations in membrane proteins. © 2018 Wiley Periodicals, Inc.
Seifi Moroudi, Reihane; Masoudi, Ali Akbar; Vaez Torshizi, Rasoul; Zandi, Mohammad
2014-12-01
One of the important behaviors of dogs is trainability which is affected by learning and memory genes. These kinds of the genes have not yet been identified in dogs. In the current research, these genes were found in animal models by mining the biological data and scientific literatures. The proteins of these genes were obtained from the UniProt database in dogs and humans. Not all homologous proteins perform similar functions, thus comparison of these proteins was studied in terms of protein families, domains, biological processes, molecular functions, and cellular location of metabolic pathways in Interpro, KEGG, Quick Go and Psort databases. The results showed that some of these proteins have the same performance in the rat or mouse, dog, and human. It is anticipated that the protein of these genes may be effective in learning and memory in dogs. Then, the expression pattern of the recognized genes was investigated in the dog hippocampus using the existing information in the GEO profile. The results showed that BDNF, TAC1 and CCK genes are expressed in the dog hippocampus, therefore, these genes could be strong candidates associated with learning and memory in dogs. Subsequently, due to the importance of the promoter regions in gene function, this region was investigated in the above genes. Analysis of the promoter indicated that the HNF-4 site of BDNF gene and the transcription start site of CCK gene is exposed to methylation. Phylogenetic analysis of protein sequences of these genes showed high similarity in each of these three genes among the studied species. The dN/dS ratio for BDNF, TAC1 and CCK genes indicates a purifying selection during the evolution of the genes.
International Nuclear Information System (INIS)
Müller, Imke; Wischnewski, Frank; Pantel, Klaus; Schwarzenbach, Heidi
2010-01-01
The aim of the current study was to analyze the involvement of methyl-CpG binding proteins (MBDs) and histone modifications on the regulation of CD44, Cyclin D2, GLIPR1 and PTEN in different cellular contexts such as the prostate cancer cells DU145 and LNCaP, and the breast cancer cells MCF-7. Since global chromatin changes have been shown to occur in tumours and regions of tumour-associated genes are affected by epigenetic modifications, these may constitute important regulatory mechanisms for the pathogenesis of malignant transformation. In DU145, LNCaP and MCF-7 cells mRNA expression levels of CD44, Cyclin D2, GLIPR1 and PTEN were determined by quantitative RT-PCR at the basal status as well as after treatment with demethylating agent 5-aza-2'-deoxycytidine and/or histone deacetylase inhibitor Trichostatin A. Furthermore, genomic DNA was bisulfite-converted and sequenced. Chromatin immunoprecipitation was performed with the stimulated and unstimulated cells using antibodies for MBD1, MBD2 and MeCP2 as well as 17 different histone antibodies. Comparison of the different promoters showed that MeCP2 and MBD2a repressed promoter-specifically Cyclin D2 in all cell lines, whereas in MCF-7 cells MeCP2 repressed cell-specifically all methylated promoters. Chromatin immunoprecipitation showed that all methylated promoters associated with at least one MBD. Treatment of the cells by the demethylating agent 5-aza-2'-deoxycytidine (5-aza-CdR) caused dissociation of the MBDs from the promoters. Only MBD1v1 bound and repressed methylation-independently all promoters. Real-time amplification of DNA immunoprecipitated by 17 different antibodies showed a preferential enrichment for methylated lysine of histone H3 (H3K4me1, H3K4me2 and H3K4me3) at the particular promoters. Notably, the silent promoters were associated with unmodified histones which were acetylated following treatment by 5-aza-CdR. This study is one of the first to reveal the histone code and MBD profile
Directory of Open Access Journals (Sweden)
Coker Robert H
2012-12-01
Full Text Available Abstract Background Excess adipose tissue and sarcopenia presents a multifaceted clinical challenge that promotes morbidity and mortality in the obese, elderly population. Unfortunately, the mortality risks of muscle loss may outweigh the potential benefits of weight loss in the elderly. We have previously demonstrated the effectiveness of whey protein and essential amino acids towards the preservation of lean tissue, even under the conditions of strict bedrest in the elderly. Methods In the context of caloric restriction-based weight loss, we hypothesized that a similar formulation given as a meal replacement (EAAMR would foster the retention of lean tissue through an increase in the skeletal muscle fractional synthesis rate (FSR. We also proposed that EAAMR would promote the preferential loss of adipose tissue through the increased energy cost of skeletal muscle FSR. We recruited and randomized 12 elderly individuals to an 8 week, caloric restriction diet utilizing equivalent caloric meal replacements (800 kcal/day: 1 EAAMR or a 2 competitive meal replacement (CMR in conjunction with 400 kcal of solid food that totaled 1200 kcal/day designed to induce 7% weight loss. Combined with weekly measurements of total body weight and body composition, we also measured the acute change in the skeletal muscle FSR to EAAMR and CMR. Results By design, both groups lost ~7% of total body weight. While EAAMR did not promote a significant preservation of lean tissue, the reduction in adipose tissue was greater in EAAMR compared to CMR. Interestingly, these results corresponded to an increase in the acute skeletal muscle protein FSR. Conclusion The provision of EAAMR during caloric restriction-induced weight loss promotes the preferential reduction of adipose tissue and the modest loss of lean tissue in the elderly population.
Regional distribution of serotonin transporter protein in postmortem human brain
International Nuclear Information System (INIS)
Kish, Stephen J.; Furukawa, Yoshiaki; Chang Lijan; Tong Junchao; Ginovart, Nathalie; Wilson, Alan; Houle, Sylvain; Meyer, Jeffrey H.
2005-01-01
Introduction: The primary approach in assessing the status of brain serotonin neurons in human conditions such as major depression and exposure to the illicit drug ecstasy has been the use of neuroimaging procedures involving radiotracers that bind to the serotonin transporter (SERT). However, there has been no consistency in the selection of a 'SERT-free' reference region for the estimation of free and nonspecific binding, as occipital cortex, cerebellum and white matter have all been employed. Objective and Methods: To identify areas of human brain that might have very low SERT levels, we measured, by a semiquantitative Western blotting procedure, SERT protein immunoreactivity throughout the postmortem brain of seven normal adult subjects. Results: Serotonin transporter could be quantitated in all examined brain areas. However, the SERT concentration in cerebellar cortex and white matter were only at trace values, being approximately 20% of average cerebral cortex and 5% of average striatum values. Conclusion: Although none of the examined brain areas are completely free of SERT, human cerebellar cortex has low SERT binding as compared to other examined brain regions, with the exception of white matter. Since the cerebellar cortical SERT binding is not zero, this region will not be a suitable reference region for SERT radioligands with very low free and nonspecific binding. For SERT radioligands with reasonably high free and nonspecific binding, the cerebellar cortex should be a useful reference region, provided other necessary radioligand assumptions are met
Regional distribution of serotonin transporter protein in postmortem human brain
Energy Technology Data Exchange (ETDEWEB)
Kish, Stephen J. [Human Neurochemical Pathology Laboratory, Centre for Addiction and Mental Health, Toronto, ON, M5T 1R8 (Canada)]. E-mail: Stephen_Kish@CAMH.net; Furukawa, Yoshiaki [Human Neurochemical Pathology Laboratory, Centre for Addiction and Mental Health, Toronto, ON, M5T 1R8 (Canada); Chang Lijan [Human Neurochemical Pathology Laboratory, Centre for Addiction and Mental Health, Toronto, ON, M5T 1R8 (Canada); Tong Junchao [Human Neurochemical Pathology Laboratory, Centre for Addiction and Mental Health, Toronto, ON, M5T 1R8 (Canada); Ginovart, Nathalie [PET Centre, Centre for Addiction and Mental Health, Toronto, ON, M5T 1R8 (Canada); Wilson, Alan [PET Centre, Centre for Addiction and Mental Health, Toronto, ON, M5T 1R8 (Canada); Houle, Sylvain [PET Centre, Centre for Addiction and Mental Health, Toronto, ON, M5T 1R8 (Canada); Meyer, Jeffrey H. [PET Centre, Centre for Addiction and Mental Health, Toronto, ON, M5T 1R8 (Canada)
2005-02-01
Introduction: The primary approach in assessing the status of brain serotonin neurons in human conditions such as major depression and exposure to the illicit drug ecstasy has been the use of neuroimaging procedures involving radiotracers that bind to the serotonin transporter (SERT). However, there has been no consistency in the selection of a 'SERT-free' reference region for the estimation of free and nonspecific binding, as occipital cortex, cerebellum and white matter have all been employed. Objective and Methods: To identify areas of human brain that might have very low SERT levels, we measured, by a semiquantitative Western blotting procedure, SERT protein immunoreactivity throughout the postmortem brain of seven normal adult subjects. Results: Serotonin transporter could be quantitated in all examined brain areas. However, the SERT concentration in cerebellar cortex and white matter were only at trace values, being approximately 20% of average cerebral cortex and 5% of average striatum values. Conclusion: Although none of the examined brain areas are completely free of SERT, human cerebellar cortex has low SERT binding as compared to other examined brain regions, with the exception of white matter. Since the cerebellar cortical SERT binding is not zero, this region will not be a suitable reference region for SERT radioligands with very low free and nonspecific binding. For SERT radioligands with reasonably high free and nonspecific binding, the cerebellar cortex should be a useful reference region, provided other necessary radioligand assumptions are met.
Directory of Open Access Journals (Sweden)
Shifeng Huang
Full Text Available Hepatitis C virus (HCV has been reported to regulate cellular microRNAs (miRNAs. The HCV core protein is considered to be a potential oncoprotein in HCV-related hepatocellular carcinoma (HCV-HCC, but HCV core-regulated miRNAs are largely unknown. Our preliminary experiments revealed significant down-regulation of microRNA-152 (miR-152 by HCV core protein in HepG2 cells. Through target gene prediction softwares, Wnt1 was predicted to be a potential target of miR-152. The present study was initiated to investigate whether miR-152 is aberrantly regulated by the HCV core protein, and involved in the regulation of the aberrant proliferation of HCV-HCC cells.MiR-152 levels were examined by stem-loop real-time RT-PCR (SLqRT-PCR. Cell proliferation was analyzed by MTT and colony formation assay. Cell cycle analysis was performed by flow cytometry. Luciferase reporter assay was conducted to confirm miRNA-target association. Wnt1 expression was determined by real-time qPCR and Western blotting.HCV core protein significantly suppressed miR-152 expression, and led to significant Wnt1 up-regulation with a concomitant aberrantly promoted proliferation. Moreover, we validated that miR-152 inhibition promoted, while miR-152 mimics inhibited cell proliferation. Using, qRT-PCR and western blot, Wnt1 was demonstrated to be regulated by miR-152. Luciferase activity assay showed that while miR-152 mimics significantly reduced the luciferase activity by 83.76% (P<0.0001, miR-152 inhibitor showed no effect on luciferase reporter. Most notably, salvage expression of miR-152 after Ad-HCV core infection for 24 h almost totally reversed the proliferation-promoting effect of the HCV core protein, and meanwhile, reduced the expression of both Wnt1 mRNA and protein to basal levels.These findings provide important evidence that the reduced miR-152 expression by HCV core protein can indirectly lose an inhibitory effect on Wnt1, which might, at least partially lead to cell
International Nuclear Information System (INIS)
Riley, L.K.; Morrow, J.K.; Danton, M.J.; Coleman, M.S.
1988-01-01
Human terminal deoxyribonucleotidyltransferase cDNA contains an open reading frame of 1530 base pairs (bp) corresponding to a protein containing 510 amino acids. The encoded protein is a template-independent DNA polymerase found only in a restricted population of normal and malignant prelymphocytes. To begin to investigate the genetic elements responsible for the tissue-specific expression of terminal deoxyribonucleotidyltransferase, genomic clones, containing the entire human gene were isolated and characterized. Initially, cDNA clones were isolated from a library generated from the human lymphoblastoid cell line, MOLT-4R. A cDNA clone containing the entire coding region of the protein was used to isolate a series of overlapping clones from two human genomic libraries. The gene comprises 11 exons and 10 introns and spans 49.4 kilobases. The 5' flanking region (709 bp) including exon 1 was sequenced. Several putative transcription initiation sites were mapped. Within 500 nucleotides of the translation start site, a series of promoter elements was detected. TATA and CAAT sequences, respectively, were found to start at nucleotides -185 and -204, -328 and -370, and -465 and -505. Start sites were found for a cyclic AMP-dependent promoter analog at nucleotide -121, an eight-base sequence corresponding to the IgG promoter enhancer (cd) at nucleotide -455, and an analog of the IgG promoter (pd) at nucleotide -159. These findings suggest that transcripts coding for terminal deoxyribonucleotidyltransferase may be variable in length and that transcription may be influenced by a variety of genetic elements
Directory of Open Access Journals (Sweden)
Chinnusamy Viswanathan
2010-04-01
Full Text Available Abstract Background Carotenoids are a group of C40 isoprenoid molecules that play diverse biological and ecological roles in plants. Tomato is an important vegetable in human diet and provides the vitamin A precursor β-carotene. Genes encoding enzymes involved in carotenoid biosynthetic pathway have been cloned. However, regulation of genes involved in carotenoid biosynthetic pathway and accumulation of specific carotenoid in chromoplasts are not well understood. One of the approaches to understand regulation of carotenoid metabolism is to characterize the promoters of genes encoding proteins involved in carotenoid metabolism. Lycopene β-cyclase is one of the crucial enzymes in carotenoid biosynthesis pathway in plants. Its activity is required for synthesis of both α-and β-carotenes that are further converted into other carotenoids such as lutein, zeaxanthin, etc. This study describes the isolation and characterization of chromoplast-specific Lycopene β-cyclase (CYC-B promoter from a green fruited S. habrochaites genotype EC520061. Results A 908 bp region upstream to the initiation codon of the Lycopene β-cyclase gene was cloned and identified as full-length promoter. To identify promoter region necessary for regulating developmental expression of the ShCYC-B gene, the full-length promoter and its three different 5' truncated fragments were cloned upstream to the initiation codon of GUS reporter cDNA in binary vectors. These four plant transformation vectors were separately transformed in to Agrobacterium. Agrobacterium-mediated transient and stable expression systems were used to study the GUS expression driven by the full-length promoter and its 5' deletion fragments in tomato. The full-length promoter showed a basal level activity in leaves, and its expression was upregulated > 5-fold in flowers and fruits in transgenic tomato plants. Deletion of -908 to -577 bp 5' to ATG decreases the ShCYC-B promoter strength, while deletion of -908
Mallik, Aritra; Yammani, Raghunatha R
2018-07-20
Obesity and associated metabolic factors are major risk factors for the development of osteoarthritis. Previously, we have shown that the free fatty acid palmitate induces endoplasmic reticulum (ER) stress and induces apoptosis in meniscus cells. However, the molecular mechanisms involved in these effects are not clearly understood. In our current study, we found that palmitate inhibits autophagy by modulating the protein levels of autophagy-related genes-5 (ATG5) that is associated with decreased lipidation of LC3 and increased activation of cleaved caspase 3. Pretreatment of meniscus cells with 4-phenyl butyric acid, a small molecule chemical chaperone that alleviates ER stress, or with MG-132, a proteasome inhibitor, restored normal levels of ATG5 and autophagosome formation, and decreased expression of cleaved caspase 3. Thus, our data suggest that palmitate downregulates autophagy in meniscus cells by degrading ATG5 protein via ER-associated protein degradation, and thus promotes apoptosis. This is the first study to demonstrate that palmitate-induced endoplasmic reticulum stress negatively regulates autophagy. Copyright © 2018 The Authors. Published by Elsevier Inc. All rights reserved.
DEFF Research Database (Denmark)
Rossin, Elizabeth J.; Hansen, Kasper Lage; Raychaudhuri, Soumya
2011-01-01
Genome-wide association studies (GWAS) have defined over 150 genomic regions unequivocally containing variation predisposing to immune-mediated disease. Inferring disease biology from these observations, however, hinges on our ability to discover the molecular processes being perturbed by these r......Genome-wide association studies (GWAS) have defined over 150 genomic regions unequivocally containing variation predisposing to immune-mediated disease. Inferring disease biology from these observations, however, hinges on our ability to discover the molecular processes being perturbed...... in rheumatoid arthritis (RA) and Crohn's disease (CD) GWAS, we build protein-protein interaction (PPI) networks for genes within associated loci and find abundant physical interactions between protein products of associated genes. We apply multiple permutation approaches to show that these networks are more...... that the RA and CD networks have predictive power by demonstrating that proteins in these networks, not encoded in the confirmed list of disease associated loci, are significantly enriched for association to the phenotypes in question in extended GWAS analysis. Finally, we test our method in 3 non...
Vakili Azghandi, Masoume; Nasiri, Mohammadreza; Shamsa, Ali; Jalali, Mohsen; Shariati, Mohammad Mahdi
2016-04-01
The SRY gene (SRY) provides instructions for making a transcription factor called the sex-determining region Y protein. The sex-determining region Y protein causes a fetus to develop as a male. In this study, SRY of 15 spices included of human, chimpanzee, dog, pig, rat, cattle, buffalo, goat, sheep, horse, zebra, frog, urial, dolphin and killer whale were used for determine of bioinformatic differences. Nucleotide sequences of SRY were retrieved from the NCBI databank. Bioinformatic analysis of SRY is done by CLC Main Workbench version 5.5 and ClustalW (http:/www.ebi.ac.uk/clustalw/) and MEGA6 softwares. The multiple sequence alignment results indicated that SRY protein sequences from Orcinus orca (killer whale) and Tursiopsaduncus (dolphin) have least genetic distance of 0.33 in these 15 species and are 99.67% identical at the amino acid level. Homosapiens and Pantroglodytes (chimpanzee) have the next lowest genetic distance of 1.35 and are 98.65% identical at the amino acid level. These findings indicate that the SRY proteins are conserved in the 15 species, and their evolutionary relationships are similar.
Sutoh, Keita; Washio, Kenji; Imai, Ryozo; Wada, Masamitsu; Nakai, Tomonori; Yamauchi, Daisuke
2015-01-01
The expression of the gene for a proteinase (Rep1) is upregulated by gibberellins. The CAACTC regulatory element (CARE) of the Rep1 promoter is involved in the gibberellin response. We isolated a cDNA for a CARE-binding protein containing a Myb domain in its carboxyl-terminal region and designated the gene Carboxyl-terminal Myb1 (CTMyb1). This gene encodes two polypeptides of two distinctive lengths, CTMyb1L and CTMyb1S, which include or exclude 213 N-terminal amino acid residues, respectively. CTMyb1S transactivated the Rep1 promoter in the presence of OsGAMyb, but not CTMyb1L. We observed an interaction between CTMyb1S and the rice prolamin box-binding factor (RPBF). A bimolecular fluorescence complex analysis detected the CTMyb1S and RPBF complex in the nucleus, but not the CTMyb1L and RPBF complex. The results suggest that the arrangement of the transfactors is involved in gibberellin-inducible expression of Rep1.
Directory of Open Access Journals (Sweden)
Tetsuro Ikegami
2009-02-01
Full Text Available Rift Valley fever virus (RVFV (genus Phlebovirus, family Bunyaviridae is a negative-stranded RNA virus with a tripartite genome. RVFV is transmitted by mosquitoes and causes fever and severe hemorrhagic illness among humans, and fever and high rates of abortions in livestock. A nonstructural RVFV NSs protein inhibits the transcription of host mRNAs, including interferon-beta mRNA, and is a major virulence factor. The present study explored a novel function of the RVFV NSs protein by testing the replication of RVFV lacking the NSs gene in the presence of actinomycin D (ActD or alpha-amanitin, both of which served as a surrogate of the host mRNA synthesis suppression function of the NSs. In the presence of the host-transcriptional inhibitors, the replication of RVFV lacking the NSs protein, but not that carrying NSs, induced double-stranded RNA-dependent protein kinase (PKR-mediated eukaryotic initiation factor (eIF2alpha phosphorylation, leading to the suppression of host and viral protein translation. RVFV NSs promoted post-transcriptional downregulation of PKR early in the course of the infection and suppressed the phosphorylated eIF2alpha accumulation. These data suggested that a combination of RVFV replication and NSs-induced host transcriptional suppression induces PKR-mediated eIF2alpha phosphorylation, while the NSs facilitates efficient viral translation by downregulating PKR and inhibiting PKR-mediated eIF2alpha phosphorylation. Thus, the two distinct functions of the NSs, i.e., the suppression of host transcription, including that of type I interferon mRNAs, and the downregulation of PKR, work together to prevent host innate antiviral functions, allowing efficient replication and survival of RVFV in infected mammalian hosts.
International Nuclear Information System (INIS)
Lee Jialing; Klase, Zachary; Gao Xiaoqi; Caldwell, Jeremy S.; Stinski, Mark F.; Kashanchi, Fatah; Chao, S.-H.
2007-01-01
An AT-rich region of the human cytomegalovirus (CMV) genome between the UL127 open reading frame and the major immediate-early (MIE) enhancer is referred to as the unique region (UR). It has been shown that the UR represses activation of transcription from the UL127 promoter and functions as a boundary between the divergent UL127 and MIE genes during human CMV infection [Angulo, A., Kerry, D., Huang, H., Borst, E.M., Razinsky, A., Wu, J., Hobom, U., Messerle, M., Ghazal, P., 2000. Identification of a boundary domain adjacent to the potent human cytomegalovirus enhancer that represses transcription of the divergent UL127 promoter. J. Virol. 74 (6), 2826-2839; Lundquist, C.A., Meier, J.L., Stinski, M.F., 1999. A strong negative transcriptional regulatory region between the human cytomegalovirus UL127 gene and the major immediate-early enhancer. J. Virol. 73 (11), 9039-9052]. A putative forkhead box-like (FOX-like) site, AAATCAATATT, was identified in the UR and found to play a key role in repression of the UL127 promoter in recombinant virus-infected cells [Lashmit, P.E., Lundquist, C.A., Meier, J.L., Stinski, M.F., 2004. Cellular repressor inhibits human cytomegalovirus transcription from the UL127 promoter. J. Virol. 78 (10), 5113-5123]. However, the cellular factors which associate with the UR and FOX-like region remain to be determined. We reported previously that pancreatic-duodenal homeobox factor-1 (PDX1) bound to a 45-bp element located within the UR [Chao, S.H., Harada, J.N., Hyndman, F., Gao, X., Nelson, C.G., Chanda, S.K., Caldwell, J.S., 2004. PDX1, a Cellular Homeoprotein, Binds to and Regulates the Activity of Human Cytomegalovirus Immediate Early Promoter. J. Biol. Chem. 279 (16), 16111-16120]. Here we demonstrate that two additional cellular homeoproteins, special AT-rich sequence binding protein 1 (SATB1) and CCAAT displacement protein (CDP), bind to the human CMV UR in vitro and in vivo. Furthermore, CDP is identified as a FOX-like binding protein
The double bromodomain protein Brd2 promotes B cell expansion and mitogenesis.
Belkina, Anna C; Blanton, Wanda P; Nikolajczyk, Barbara S; Denis, Gerald V
2014-03-01
Bromodomain-containing transcriptional regulators represent new epigenetic targets in different hematologic malignancies. However, bromodomain-mediated mechanisms that couple histone acetylation to transcription in lymphopoiesis and govern mature lymphocyte mitogenesis are poorly understood. Brd2, a transcriptional coregulator that contains dual bromodomains and an extraterminal domain (the BET family), couples chromatin to cell-cycle progression. We reported previously the first functional characterization of a BET protein as an effector of mammalian mitogenic signal transduction: Eμ-Brd2 Tg mice develop "activated B cell" diffuse large B cell lymphoma. No other animal models exist for genetic or lentiviral expression of BET proteins, hampering testing of novel anti-BET anticancer drugs, such as JQ1. We transduced HSCs with Brd2 lentivirus and reconstituted recipient mice to test the hypothesis that Brd2 regulates hematopoiesis in BM and mitogenesis in the periphery. Forced expression of Brd2 provides an expansion advantage to the donor-derived B cell compartment in BM and increases mature B cell mitogenic responsiveness in vitro. Brd2 binds the cyclin A promoter in B cells, shown by ChIP, and increases cyclin A mRNA and protein levels, and S-phase progression in vitro in mitogen-stimulated primary B cells, but not T cells, reinforcing results from Eμ-Brd2 mice. The small molecule BET inhibitor JQ1 reduces B cell mitogenesis, consistent with the interpretation that BET inhibitors are antiproliferative. Brd2-specific knockdown experiments show that Brd2 is also required for hematopoiesis. We conclude that Brd2 plays a critical, independent role in regulation of mitogenic response genes, particularly cyclin A, in B cells.
Prion Protein Promotes Kidney Iron Uptake via Its Ferrireductase Activity*
Haldar, Swati; Tripathi, Ajai; Qian, Juan; Beserra, Amber; Suda, Srinivas; McElwee, Matthew; Turner, Jerrold; Hopfer, Ulrich; Singh, Neena
2015-01-01
Brain iron-dyshomeostasis is an important cause of neurotoxicity in prion disorders, a group of neurodegenerative conditions associated with the conversion of prion protein (PrPC) from its normal conformation to an aggregated, PrP-scrapie (PrPSc) isoform. Alteration of iron homeostasis is believed to result from impaired function of PrPC in neuronal iron uptake via its ferrireductase activity. However, unequivocal evidence supporting the ferrireductase activity of PrPC is lacking. Kidney provides a relevant model for this evaluation because PrPC is expressed in the kidney, and ∼370 μg of iron are reabsorbed daily from the glomerular filtrate by kidney proximal tubule cells (PT), requiring ferrireductase activity. Here, we report that PrPC promotes the uptake of transferrin (Tf) and non-Tf-bound iron (NTBI) by the kidney in vivo and mainly NTBI by PT cells in vitro. Thus, uptake of 59Fe administered by gastric gavage, intravenously, or intraperitoneally was significantly lower in PrP-knock-out (PrP−/−) mouse kidney relative to PrP+/+ controls. Selective in vivo radiolabeling of plasma NTBI with 59Fe revealed similar results. Expression of exogenous PrPC in immortalized PT cells showed localization on the plasma membrane and intracellular vesicles and increased transepithelial transport of 59Fe-NTBI and to a smaller extent 59Fe-Tf from the apical to the basolateral domain. Notably, the ferrireductase-deficient mutant of PrP (PrPΔ51–89) lacked this activity. Furthermore, excess NTBI and hemin caused aggregation of PrPC to a detergent-insoluble form, limiting iron uptake. Together, these observations suggest that PrPC promotes retrieval of iron from the glomerular filtrate via its ferrireductase activity and modulates kidney iron metabolism. PMID:25572394
Morikawa, Kazuya; Shiina, Takashi; Murakami, Shinya; Toyoshima, Yoshinori
2002-03-13
Sigma factor binding proteins are involved in modifying the promoter preferences of the RNA polymerase in bacteria. We found the nuclear encoded protein (SibI) that is transported into chloroplasts and interacts specifically with the region 4 of Sig1 in Arabidopsis. SibI and its homologue, T3K9.5 are novel proteins, which are not homologous to any protein of known function. The expression of sibI was tissue specific, light dependent, and developmentally timed. We suggest the transcriptional regulation by sigma factor binding proteins to function in the plastids of higher plant.
DEFF Research Database (Denmark)
Brorsson, C.; Hansen, Niclas Tue; Hansen, Kasper Lage
2009-01-01
genes. We have developed a novel method that combines single nucleotide polymorphism (SNP) genotyping data with protein-protein interaction (ppi) networks to identify disease-associated network modules enriched for proteins encoded from the MHC region. Approximately 2500 SNPs located in the 4 Mb MHC......To develop novel methods for identifying new genes that contribute to the risk of developing type 1 diabetes within the Major Histocompatibility Complex (MHC) region on chromosome 6, independently of the known linkage disequilibrium (LD) between human leucocyte antigen (HLA)-DRB1, -DQA1, -DQB1...... region were analysed in 1000 affected offspring trios generated by the Type 1 Diabetes Genetics Consortium (T1DGC). The most associated SNP in each gene was chosen and genes were mapped to ppi networks for identification of interaction partners. The association testing and resulting interacting protein...
Directory of Open Access Journals (Sweden)
L.M.P. Passaglia
1998-11-01
Full Text Available NifA protein activates transcription of nitrogen fixation operons by the alternative sigma54 holoenzyme form of RNA polymerase. This protein binds to a well-defined upstream activator sequence (UAS located at the -200/-100 position of nif promoters with the consensus motif TGT-N10-ACA. NifA of Azospirillum brasilense was purified in the form of a glutathione-S-transferase (GST-NifA fusion protein and proteolytic release of GST yielded inactive and partially soluble NifA. However, the purified NifA was able to induce the production of specific anti-A. brasilense NifA-antiserum that recognized NifA from A. brasilense but not from K. pneumoniae. Both GST-NifA and NifA expressed from the E. coli tac promoter are able to activate transcription from the nifHDK promoter but only in an A. brasilense background. In order to investigate the mechanism that regulates NifA binding capacity we have used E. coli total protein extracts expressing A. brasilense nifA in mobility shift assays. DNA fragments carrying the two overlapping, wild-type or mutated UAS motifs present in the nifH promoter region revealed a retarded band of related size. These data show that the binding activity present in the C-terminal domain of A. brasilense NifA protein is still functional even in the presence of oxygen.
Wu, Honghong; Wang, Xiaofu; Zhou, Xinghu; Zhang, Yihua; Huang, Ming; He, Jian; Shen, Wenbiao
2017-09-01
Transgenic components in genetically modified organisms consist not only of the transgenic genes, but also the transgenic protein. However, compared with transgenic DNA, less attention has been paid to the detection of expressed protein, especially those degraded from genetically modified soybean after food processing. In this study, the full length 5-enolpyruvyl-shikimate-3-phosphate synthase (CP4-EPSPS, 47.6 kD) protein was probed with the SC-16 (S19-R33) and the DC-16 (D219-K233) polyclonal antibodies in immunoblots. Both antibodies were able to detect the full length CP4-EPSPS and its residues in soy powder made from Roundup-Ready soybeans after heating and microwaving treatments which also reduced the molecular weight of the protein to 45.8 and 38.7 kD, respectively. Taken together the immunoblot results suggest that the middle region of the CP4-EPSPS protein possessed better stability than its N-terminal during thermal processing. This deduction was further validated by autoclave treatment, where a 37.4 kD residue of the protein was recognized by DC-16. A similar result was obtained in processed smoked sausage containing Roundup Ready soybean protein isolate (as an extender). The additional use of a further polyclonal antibody CK-17 (C372-K388), showed that compared with only the one signal for CP4-EPSPS detected by the SC-16 and CK-17 antibodies, the DC-16 middle region antibody detected four signals for CP4-EPSPS from five market sourced soy protein concentrates. Taken together, the study suggested that the middle region of CP4-EPSPS was more useful than the N- and C-terminal for tracing transgenic CP4-EPSPS protein and its remnants in highly processed soy-related products.
In vivo protein-DNA interactions at the β-globin gene locus
International Nuclear Information System (INIS)
Tohru Ikuta; Yuet Wai Kan
1991-01-01
The authors have investigated in vivo protein-DNA interactions in the β-globin gene locus by dimethyl sulfate (DMS) footprinting in K562 cells, which express var-epsilon- and γ-globin but not β-globin. In the locus control region, hypersensitive site 2 (HS-2) exhibited footprints in several putative protein binding motifs. HS-3 was not footprinted. The β promoter was also not footprinted, while extensive footprints were observed in the promoter of the active γ-globin gene. No footprints were seen in the A γ and β3' enhancers. With several motifs, additional protein interactions and alterations in binding patterns occurred with hemin induction. In HeLa cells, some footprints were observed in some of the motifs in HS-2, compatible with the finding that HS-2 has some enhancer function in HeLa cells, albeit much weaker than its activity in K562 cells. No footprint was seen in B lymphocytes. In vivo footprinting is a useful method for studying relevant protein-DNA interactions in erythroid cells
[HMGA proteins and their genes as a potential neoplastic biomarkers].
Balcerczak, Ewa; Balcerczak, Mariusz; Mirowski, Marek
2005-01-01
HMGA proteins and their genes are described in this article. HMGA proteins reveal ability to bind DNA in AT-rich regions, which are characteristic for gene promoter sequences. This interaction lead to gene silencing or their overexpression. In normal tissue HMGA proteins level is low or even undetectable. During embriogenesis their level is increasing. High HMGA proteins level is characteristic for tumor phenotype of spontaneous and experimental malignant neoplasms. High HMGA proteins expression correlate with bad prognostic factors and with metastases formation. HMGA genes expression can be used as a marker of tumor progression. Present studies connected with tumor gene therapy based on HMGA proteins sythesis inhibition by the use of viral vectors containing gene encoding these proteins in antisence orientation, as well as a new potential anticancer drugs acting as crosslinkers between DNA and HMGA proteins suggest their usefulness as a targets in cancer therapy.
International Nuclear Information System (INIS)
Greenberg, B.M.; Gaba, V.; Canaani, O.; Malkin, S.; Mattoo, A.K.; Edelman, M.
1989-01-01
A component of the photosystem II reaction center, the 32-kDa protein, is rapidly turned over in the light. The mechanism of its light-dependent metabolism is largely unknown. We quantified the rate of 32-kDa protein degradation over a broad spectral range (UV, visible, and far red). The quantum yield for degradation was highest in the UVB (280-320 nm) region. Spectral evidence demonstrates two distinctly different photosensitizers for 32-kDa protein degradation. The data implicate the bulk photosynthetic pigments (primarily chlorophyll) in the visible and far red regions, and plastoquinone (in one or more of its redox states) in the UV region. A significant portion of 32-kDa protein degradation in sunlight is attributed to UVB irradiance
Ansari, Suraiya A; Paul, Emily; Sommer, Sebastian; Lieleg, Corinna; He, Qiye; Daly, Alexandre Z; Rode, Kara A; Barber, Wesley T; Ellis, Laura C; LaPorta, Erika; Orzechowski, Amanda M; Taylor, Emily; Reeb, Tanner; Wong, Jason; Korber, Philipp; Morse, Randall H
2014-05-23
Transcription by RNA polymerase II (Pol II) in eukaryotes requires the Mediator complex, and often involves chromatin remodeling and histone eviction at active promoters. Here we address the role of Mediator in recruitment of the Swi/Snf chromatin remodeling complex and its role, along with components of the preinitiation complex (PIC), in histone eviction at inducible and constitutively active promoters in the budding yeast Saccharomyces cerevisiae. We show that recruitment of the Swi/Snf chromatin remodeling complex to the induced CHA1 promoter, as well as its association with several constitutively active promoters, depends on the Mediator complex but is independent of Mediator at the induced MET2 and MET6 genes. Although transcriptional activation and histone eviction at CHA1 depends on Swi/Snf, Swi/Snf recruitment is not sufficient for histone eviction at the induced CHA1 promoter. Loss of Swi/Snf activity does not affect histone occupancy of several constitutively active promoters; in contrast, higher histone occupancy is seen at these promoters in Mediator and PIC component mutants. We propose that an initial activator-dependent, nucleosome remodeling step allows PIC components to outcompete histones for occupancy of promoter sequences. We also observe reduced promoter association of Mediator and TATA-binding protein in a Pol II (rpb1-1) mutant, indicating mutually cooperative binding of these components of the transcription machinery and indicating that it is the PIC as a whole whose binding results in stable histone eviction. © 2014 by The American Society for Biochemistry and Molecular Biology, Inc.
Sharadamma, N; Harshavardhana, Y; Singh, Pawan; Muniyappa, K
2010-06-01
A number of studies have shown that the structure and composition of bacterial nucleoid influences many a processes related to DNA metabolism. The nucleoid-associated proteins modulate not only the DNA conformation but also regulate the DNA metabolic processes such as replication, recombination, repair and transcription. Understanding of how these processes occur in the context of Mycobacterium tuberculosis nucleoid is of considerable medical importance because the nucleoid structure may be constantly remodeled in response to environmental signals and/or growth conditions. Many studies have concluded that Escherichia coli H-NS binds to DNA in a sequence-independent manner, with a preference for A-/T-rich tracts in curved DNA; however, recent studies have identified the existence of medium- and low-affinity binding sites in the vicinity of the curved DNA. Here, we show that the M. tuberculosis H-NS protein binds in a more structure-specific manner to DNA replication and repair intermediates, but displays lower affinity for double-stranded DNA with relatively higher GC content. Notably, M. tuberculosis H-NS was able to bind Holliday junction (HJ), the central recombination intermediate, with substantially higher affinity and inhibited the three-strand exchange promoted by its cognate RecA. Likewise, E. coli H-NS was able to bind the HJ and suppress DNA strand exchange promoted by E. coli RecA, although much less efficiently compared to M. tuberculosis H-NS. Our results provide new insights into a previously unrecognized function of H-NS protein, with implications for blocking the genome integration of horizontally transferred genes by homologous and/or homeologous recombination.
Promoter Hypermethylation of the EMP3 Gene in a Series of 229 Human Gliomas
Directory of Open Access Journals (Sweden)
Marta Mellai
2013-01-01
Full Text Available The epithelial membrane protein 3 (EMP3 is a candidate tumor suppressor gene in the critical region 19q13.3 for several solid tumors, including tumors of the nervous systems. The aim of this study was to investigate the EMP3 promoter hypermethylation status in a series of 229 astrocytic and oligodendroglial tumors and in 16 GBM cell lines. The analysis was performed by methylation-specific PCR and capillary electrophoresis. Furthermore, the EMP3 expression at protein level was evaluated by immunohistochemistry and Western blotting analysis. Associations of EMP3 hypermethylation with total 1p/19q codeletion, MGMT promoter hypermethylation, IDH1/IDH2 and TP53 mutations, and EGFR amplification were studied, as well as its prognostic significance. The EMP3 promoter hypermethylation has been found in 39.5% of gliomas. It prevailed in low-grade tumors, especially in gliomas with an oligodendroglial component, and in sGBMs upon pGBMs. In oligodendroglial tumors, it was strongly associated with both IDH1/IDH2 mutations and total 1p/19q codeletion and inversely with EGFR gene amplification. No association was found with MGMT hypermethylation and TP53 mutations. In the whole series, the EMP3 hypermethylation status correlated with 19q13.3 loss and lack of EMP3 expression at protein level. A favorable prognostic significance on overall survival of the EMP3 promoter hypermethylation was found in patients with oligodendroglial tumors.
hypoxia-inducible factors activate CD133 promoter through ETS family transcription factors.
Directory of Open Access Journals (Sweden)
Shunsuke Ohnishi
Full Text Available CD133 is a cellular surface protein that has been reported to be a cancer stem cell marker, and thus it is considered to be a potential target for cancer treatment. However, the mechanism regulating CD133 expression is not yet understood. In this study, we analyzed the activity of five putative promoters (P1-P5 of CD133 in human embryonic kidney (HEK 293 cells and colon cancer cell line WiDr, and found that the activity of promoters, particularly of P5, is elevated by overexpression of hypoxia-inducible factors (HIF-1α and HIF-2α. Deletion and mutation analysis identified one of the two E-twenty six (ETS binding sites (EBSs in the P5 region as being essential for its promoter activity induced by HIF-1α and HIF-2α. In addition, a chromatin imunoprecipitation assay demonstrated that HIF-1α and HIF-2α bind to the proximal P5 promoter at the EBSs. The immunoprecipitation assay showed that HIF-1α physically interacts with Elk1; however, HIF-2α did not bind to Elk1 or ETS1. Furthermore, knockdown of both HIF-1α and HIF-2α resulted in a reduction of CD133 expression in WiDr. Taken together, our results revealed that HIF-1α and HIF-2α activate CD133 promoter through ETS proteins.
Mishra, Sonal; Shukla, Aparna; Upadhyay, Swati; Sanchita; Sharma, Pooja; Singh, Seema; Phukan, Ujjal J; Meena, Abha; Khan, Feroz; Tripathi, Vineeta; Shukla, Rakesh Kumar; Shrama, Ashok
2014-04-01
Plants posses a complex co-regulatory network which helps them to elicit a response under diverse adverse conditions. We used an in silico approach to identify the genes with both DRE and ABRE motifs in their promoter regions in Arabidopsis thaliana. Our results showed that Arabidopsis contains a set of 2,052 genes with ABRE and DRE motifs in their promoter regions. Approximately 72% or more of the total predicted 2,052 genes had a gap distance of less than 400 bp between DRE and ABRE motifs. For positional orientation of the DRE and ABRE motifs, we found that the DR form (one in direct and the other one in reverse orientation) was more prevalent than other forms. These predicted 2,052 genes include 155 transcription factors. Using microarray data from The Arabidopsis Information Resource (TAIR) database, we present 44 transcription factors out of 155 which are upregulated by more than twofold in response to osmotic stress and ABA treatment. Fifty-one transcripts from the one predicted above were validated using semiquantitative expression analysis to support the microarray data in TAIR. Taken together, we report a set of genes containing both DRE and ABRE motifs in their promoter regions in A. thaliana, which can be useful to understand the role of ABA under osmotic stress condition. © 2013 Institute of Botany, Chinese Academy of Sciences.
Directory of Open Access Journals (Sweden)
Vingron Martin
2008-10-01
Full Text Available Abstract Background More than two thirds of the highly expressed ribosomal protein (RP genes in Saccharomyces cerevisiae contain introns, which is in sharp contrast to the genome-wide five percent intron-containing genes. It is well established that introns carry regulatory sequences and that the transcription of RP genes is extensively and coordinately regulated. Here we test the hypotheses that introns are innately associated with heavily transcribed genes and that introns of RP genes contribute regulatory TF binding sequences. Moreover, we investigate whether promoter features are significantly different between intron-containing and intronless RP genes. Results We find that directly measured transcription rates tend to be lower for intron-containing compared to intronless RP genes. We do not observe any specifically enriched sequence motifs in the introns of RP genes other than those of the branch point and the two splice sites. Comparing the promoters of intron-containing and intronless RP genes, we detect differences in number and position of Rap1-binding and IFHL motifs. Moreover, the analysis of the length distribution and the folding free energies suggest that, at least in a sub-population of RP genes, the 5' untranslated sequences are optimized for regulatory function. Conclusion Our results argue against the direct involvement of introns in the regulation of transcription of highly expressed genes. Moreover, systematic differences in motif distributions suggest that RP transcription factors may act differently on intron-containing and intronless gene promoters. Thus, our findings contribute to the decoding of the RP promoter architecture and may fuel the discussion on the evolution of introns.
HCV core protein promotes hepatocyte proliferation and chemoresistance by inhibiting NR4A1
Energy Technology Data Exchange (ETDEWEB)
Tan, Yongsheng, E-mail: yongshengtanwhu@126.com; Li, Yan, E-mail: liyansd2@163.com
2015-10-23
This study investigated the effect of HCV core protein on the proliferation of hepatocytes and hepatocellular carcinoma cells (HCC), the influence of HCV core protein on HCC apoptosis induced by the chemotherapeutic agent cisplatin, and the mechanism through which HCV core protein acts as a potential oncoprotein in HCV-related HCC by measuring the levels of NR4A1 and Runt-related transcription factor 3 (RUNX3), which are associated with tumor suppression and chemotherapy resistance. In the present study, PcDNA3.1-core and RUNX3 siRNA were transfected into LO2 and HepG2 cells using Lipofectamine 2000. LO2-core, HepG2-core, LO2-RUNX3 {sup low} and control cells were treated with different concentrations of cisplatin for 72 h, and cell proliferation and apoptosis were assayed using the CellTiter 96{sup ®}Aqueous Non-Radioactive Cell Proliferation Assay Kit. Western blot and real time PCR analyses were used to detect NR4A1, RUNX3, smad7, Cyclin D1 and BAX. Confocal microscopy was used to determine the levels of NR4A1 in HepG2 and HepG2-core cells. The growth rate of HepG2-core cells was considerably greater than that of HepG2 cells. HCV core protein increased the expression of cyclin D1 and decreased the expressions of NR4A1 and RUNX3. In LO2 – RUNX3 {sup low}, the rate of cell proliferation and the level of cisplatin resistance were the same as in the LO2 -core. These results suggest that HCV core protein decreases the sensitivity of hepatocytes to cisplatin by inhibiting the expression of NR4A1 and promoting the expression of smad7, which negatively regulates the TGF-β pathway. This effect results in down regulation of RUNX3, a target of the TGF-β pathway. Taken together, these findings indicate that in hepatocytes, HCV core protein increases drug resistance and inhibits cell apoptosis by inhibiting the expressions of NR4A1 and RUNX3. - Highlights: • HCV core protein inhibits HepG2 cell sensitivity to cisplatin. • Core expression in HepG2 decreases
HCV core protein promotes hepatocyte proliferation and chemoresistance by inhibiting NR4A1
International Nuclear Information System (INIS)
Tan, Yongsheng; Li, Yan
2015-01-01
This study investigated the effect of HCV core protein on the proliferation of hepatocytes and hepatocellular carcinoma cells (HCC), the influence of HCV core protein on HCC apoptosis induced by the chemotherapeutic agent cisplatin, and the mechanism through which HCV core protein acts as a potential oncoprotein in HCV-related HCC by measuring the levels of NR4A1 and Runt-related transcription factor 3 (RUNX3), which are associated with tumor suppression and chemotherapy resistance. In the present study, PcDNA3.1-core and RUNX3 siRNA were transfected into LO2 and HepG2 cells using Lipofectamine 2000. LO2-core, HepG2-core, LO2-RUNX3 "l"o"w and control cells were treated with different concentrations of cisplatin for 72 h, and cell proliferation and apoptosis were assayed using the CellTiter 96"®Aqueous Non-Radioactive Cell Proliferation Assay Kit. Western blot and real time PCR analyses were used to detect NR4A1, RUNX3, smad7, Cyclin D1 and BAX. Confocal microscopy was used to determine the levels of NR4A1 in HepG2 and HepG2-core cells. The growth rate of HepG2-core cells was considerably greater than that of HepG2 cells. HCV core protein increased the expression of cyclin D1 and decreased the expressions of NR4A1 and RUNX3. In LO2 – RUNX3 "l"o"w, the rate of cell proliferation and the level of cisplatin resistance were the same as in the LO2 -core. These results suggest that HCV core protein decreases the sensitivity of hepatocytes to cisplatin by inhibiting the expression of NR4A1 and promoting the expression of smad7, which negatively regulates the TGF-β pathway. This effect results in down regulation of RUNX3, a target of the TGF-β pathway. Taken together, these findings indicate that in hepatocytes, HCV core protein increases drug resistance and inhibits cell apoptosis by inhibiting the expressions of NR4A1 and RUNX3. - Highlights: • HCV core protein inhibits HepG2 cell sensitivity to cisplatin. • Core expression in HepG2 decreases expression of NR4A1
DEFF Research Database (Denmark)
Soler, Laura; Miller, Ingrid; Hummel, Karin
2016-01-01
to explore the systemic molecular effect of feed supplementation with sub therapeutic levels of oxytetracycline (OTC) by analysis of serum proteome changes. Results showed that OTC promoted growth, coinciding with a significant down regulation of different serum proteins related to inflammation, oxidation...
Kinoshita, Yumiko; Kizaki, Zenro; Ishihara, Yasunori; Nakajima, Hisakazu; Adachi, Shinsuke; Kosaka, Kitaro; Kinugasa, Akihiko; Sugimoto, Tohru
2007-01-01
Evidence is accumulating that the promoter region of the insulin-like growth factor I (IGF-I) gene polymorphism and low levels of IGF-I are associated with type 2 diabetes, cardiovascular disease and birth weight; however, the number of wild-type alleles is different in each country. This study aimed to examine the 737/738 marker, a cytosine-adenine repeat in the promoter region of the IGF-I gene polymorphism, and plasma IGF-I levels in Japanese infants and analyze the genetic background. Data were collected for 15 months in Kyoto Prefectural University of Medicine. The body composition parameters of all infants were determined at birth. At 5 days after birth, we took blood samples to measure the product size of the promoter region of the IGF-I gene polymorphism and plasma IGF-I. In a population-based sample of 160 subjects, 6 different alleles and 16 genotypes were identified in the promoter region of the IGF-I gene polymorphism. The existence of a 196-bp allele has proved to result in a low plasma IGF-I level, a small head and chest circumference (p body composition parameters in Japanese infants. Our results suggest genetical influence on prenatal growth and serum IGF-I levels.
DEFF Research Database (Denmark)
Hernandez Castellano, Lorenzo E; Morales-delaNuez, Antonio; Moreno-Indias, Isabel
2013-01-01
of this study, therefore, was to evaluate local and imported carcasses and meat quality in order to promote the consumption of local breeds, using the Canary Islands (Spain) as a model for other subtropical outermost regions. For this study 20 half-carcasses from Palmera breed and 20 imported half...
The N-terminal, polybasic region is critical for prion protein neuroprotective activity.
Directory of Open Access Journals (Sweden)
Jessie A Turnbaugh
Full Text Available Several lines of evidence suggest that the normal form of the prion protein, PrP(C, exerts a neuroprotective activity against cellular stress or toxicity. One of the clearest examples of such activity is the ability of wild-type PrP(C to suppress the spontaneous neurodegenerative phenotype of transgenic mice expressing a deleted form of PrP (Δ32-134, called F35. To define domains of PrP involved in its neuroprotective activity, we have analyzed the ability of several deletion mutants of PrP (Δ23-31, Δ23-111, and Δ23-134 to rescue the phenotype of Tg(F35 mice. Surprisingly, all of these mutants displayed greatly diminished rescue activity, although Δ23-31 PrP partially suppressed neuronal loss when expressed at very high levels. Our results pinpoint the N-terminal, polybasic domain as a critical determinant of PrP(C neuroprotective activity, and suggest that identification of molecules interacting with this region will provide important clues regarding the normal function of the protein. Small molecule ligands targeting this region may also represent useful therapeutic agents for treatment of prion diseases.
Liu, Mengjie; Duan, Liangwei; Wang, Meifang; Zeng, Hongmei; Liu, Xinqi; Qiu, Dewen
2016-01-01
The protein elicitor MoHrip2, which was extracted from Magnaporthe oryzae as an exocrine protein, triggers the tobacco immune system and enhances blast resistance in rice. However, the detailed mechanisms by which MoHrip2 acts as an elicitor remain unclear. Here, we investigated the structure of MoHrip2 to elucidate its functions based on molecular structure. The three-dimensional structure of MoHrip2 was obtained. Overall, the crystal structure formed a β-barrel structure and showed high similarity to the pathogenesis-related (PR) thaumatin superfamily protein thaumatin-like xylanase inhibitor (TL-XI). To investigate the functional regions responsible for MoHrip2 elicitor activities, the full length and eight truncated proteins were expressed in Escherichia coli and were evaluated for elicitor activity in tobacco. Biological function analysis showed that MoHrip2 triggered the defense system against Botrytis cinerea in tobacco. Moreover, only MoHrip2M14 and other fragments containing the 14 amino acids residues in the middle region of the protein showed the elicitor activity of inducing a hypersensitive response and resistance related pathways, which were similar to that of full-length MoHrip2. These results revealed that the central 14 amino acid residues were essential for anti-pathogenic activity.
Directory of Open Access Journals (Sweden)
Mengjie Liu
2016-07-01
Full Text Available The protein elicitor MoHrip2, which was extracted from Magnaporthe oryzae as an exocrine protein, triggers the tobacco immune system and enhances blast resistance in rice. However, the detailed mechanisms by which MoHrip2 acts as an elicitor remain unclear. Here, we investigated the structure of MoHrip2 to elucidate its functions based on molecular structure. The 3-dimensional structure of MoHrip2 was obtained. Overall, the crystal structure formed a β-barrel structure and showed high similarity to the pathogenesis-related (PR thaumatin superfamily protein thaumatin-like xylanase inhibitor (TL-XI. To investigate the functional regions responsible for MoHrip2 elicitor activities, the full length and 8 truncated proteins were expressed in Escherichia coli and were evaluated for elicitor activity in tobacco. Biological function analysis showed that MoHrip2 triggered the defense system against Botrytis cinerea in tobacco. Moreover, only MoHrip2M14 and other fragments containing the 14 amino acids residues in the middle region of the protein showed the elicitor activity of inducing a hypersensitive response and resistance related pathways, which were similar to that of full-length MoHrip2. These results revealed that the central 14 amino acid residues were essential for anti-pathogenic activity.
Identification of a novel temperature sensitive promoter in cho cells
Directory of Open Access Journals (Sweden)
Hesse Friedemann
2011-05-01
Full Text Available Abstract Background The Chinese hamster ovary (CHO expression system is the leading production platform for manufacturing biopharmaceuticals for the treatment of numerous human diseases. Efforts to optimize the production process also include the genetic construct encoding the therapeutic gene. Here we report about the successful identification of an endogenous highly active gene promoter obtained from CHO cells which shows conditionally inducible gene expression at reduced temperature. Results Based on CHO microarray expression data abundantly transcribed genes were selected as potential promoter candidates. The S100a6 (calcyclin and its flanking regions were identified from a genomic CHO-K1 lambda-phage library. Computational analyses showed a predicted TSS, a TATA-box and several TFBSs within the 1.5 kb region upstream the ATG start signal. Various constructs were investigated for promoter activity at 37°C and 33°C in transient luciferase reporter gene assays. Most constructs showed expression levels even higher than the SV40 control and on average a more than two-fold increase at lower temperature. We identified the core promoter sequence (222 bp comprising two SP1 sites and could show a further increase in activity by duplication of this minimal sequence. Conclusions This novel CHO promoter permits conditionally high-level gene expression. Upon a shift to 33°C, a two to three-fold increase of basal productivity (already higher than SV40 promoter is achieved. This property is of particular advantage for a process with reduced expression during initial cell growth followed by the production phase at low temperature with a boost in expression. Additionally, production of toxic proteins becomes feasible, since cell metabolism and gene expression do not directly interfere. The CHO S100a6 promoter can be characterized as cold-shock responsive with the potential for improving process performance of mammalian expression systems.
Directory of Open Access Journals (Sweden)
Hongying Zhang
2017-07-01
Full Text Available Drought, salinity, and cold are the major factors limiting wheat quality and productivity; it is thus highly desirable to characterize the abiotic-stress-inducible promoters suitable for the genetic improvement of plant resistance. The sucrose non-fermenting 1-related protein kinase 2 (SnRK2 family genes show distinct regulatory properties in response to abiotic stresses. The present study characterized the approximately 3000-bp upstream sequence (the 313 bp upstream of the ATG was the transcription start site of the Triticum aestivum TaSnRK2.8 promoter under abscisic acid (ABA and abiotic stresses. Four different-length 5′ deletion fragments of TaSnRK2.8 promoter were fused with the GUS reporter gene and transformed into Arabidopsis. Tissue expression analysis showed that the TaSnRK2.8 promoter region from position -1481 to -821 contained the stalk-specific elements, and the region from position -2631 to -1481 contained the leaf- and root-specific elements. In the ABA-treated seedlings, the deletion analysis showed that the TaSnRK2.8 promoter region from position -821 to -2631 contained ABA response elements. The abiotic stress responses of the TaSnRK2.8 promoter derivatives demonstrated that they harbored abiotic-stress response elements: the region from position -821 to -408 harbored the osmotic-stress response elements, whereas the region from position -2631 to -1481 contained the positive regulatory motifs and the region from position -1481 to -821 contained the leaf- and stalk-specific enhancers. Further deletion analysis of the promoter region from position -821 to -408 indicated that a 125-bp region from position -693 to -568 was required to induce an osmotic-stress response. These results contribute to a better understanding of the molecular mechanisms of TaSnRK2.8 in response to abiotic stresses, and the TaSnRK2.8 promoter seems to be a candidate for regulating the expression of abiotic stress response genes in transgenic plants.
Haywood, J; Yammani, R R
2016-05-01
Obesity is the major risk factor for the development of osteoarthritis (OA); however, the mechanisms involved are not clearly understood. Obesity is associated with increased production of adipokine and elevated levels of circulating free fatty acids (FFA). A recent study has shown that saturated fatty acid palmitate induced pro-inflammatory and pro-apoptotic pathways in chondrocytes. Meniscus has been shown to be more susceptible than articular cartilage to catabolic stimuli. Thus, the aim of this study was to determine the effect of FFA (specifically, palmitate) on meniscus cells. Cultured primary porcine meniscus cells were stimulated with 500 μM FFA (palmitate and oleate) for 24 h to induce endoplasmic reticulum (ER) stress. After treatment, cell lysates were prepared and immunoblotted for C/EBP homologous protein (CHOP). To determine the activation of unfolded protein response (UPR) signaling, cell lysates were probed for cJun n-terminal kinase (JNK), cleaved caspase -3 and Xbp-1s, an alternative mRNA splicing product generated due to Ire1α activation. Treatment of isolated primary meniscus cells with palmitate but not oleate induced expression of CHOP and Xbp-1s. Palmitate treatment of meniscus cells also activated JNK and increased expression of caspase-3, thus promoting apoptosis in meniscus cells. Palmitate induces ER stress and promotes apoptotic pathways in meniscus cells. This is the first study to establish ER stress as a key metabolic mechanistic link between obesity and OA, in addition to (or operating with) biomechanical factors. Copyright © 2015 Osteoarthritis Research Society International. Published by Elsevier Ltd. All rights reserved.
Gudi, Radhika; Zou, Chaozhong; Dhar, Jayeeta; Gao, Qingshen; Vasu, Chenthamarakshan
2014-05-30
Centriole duplication is the process by which two new daughter centrioles are generated from the proximal end of preexisting mother centrioles. Accurate centriole duplication is important for many cellular and physiological events, including cell division and ciliogenesis. Centrosomal protein 4.1-associated protein (CPAP), centrosomal protein of 152 kDa (CEP152), and centrobin are known to be essential for centriole duplication. However, the precise mechanism by which they contribute to centriole duplication is not known. In this study, we show that centrobin interacts with CEP152 and CPAP, and the centrobin-CPAP interaction is critical for centriole duplication. Although depletion of centrobin from cells did not have an effect on the centriolar levels of CEP152, it caused the disappearance of CPAP from both the preexisting and newly formed centrioles. Moreover, exogenous expression of the CPAP-binding fragment of centrobin also caused the disappearance of CPAP from both the preexisting and newly synthesized centrioles, possibly in a dominant negative manner, thereby inhibiting centriole duplication and the PLK4 overexpression-mediated centrosome amplification. Interestingly, exogenous overexpression of CPAP in the centrobin-depleted cells did not restore CPAP localization to the centrioles. However, restoration of centrobin expression in the centrobin-depleted cells led to the reappearance of centriolar CPAP. Hence, we conclude that centrobin-CPAP interaction is critical for the recruitment of CPAP to procentrioles to promote the elongation of daughter centrioles and for the persistence of CPAP on preexisting mother centrioles. Our study indicates that regulation of CPAP levels on the centrioles by centrobin is critical for preserving the normal size, shape, and number of centrioles in the cell. © 2014 by The American Society for Biochemistry and Molecular Biology, Inc.
DEFF Research Database (Denmark)
Aas, Per Arne; Pena Diaz, Javier; Liabakk, Nina Beate
2009-01-01
within the region of DNA marked by PA. Footprinting analysis and electrophoretic mobility shift assays of PA and putative AP-2 binding regions with HeLa cell nuclear extract and recombinant AP-2alpha protein indicate that AP-2 transcription factors are central in the regulated expression of UNG2 m......The PA promoter in the human uracil-DNA glycosylase gene (UNG) directs expression of the nuclear form (UNG2) of UNG proteins. Using a combination of promoter deletion and mutation analyses, and transient transfection of HeLa cells, we show that repressor and derepressor activities are contained......alpha, lacking the activation domain but retaining the DNA binding and dimerization domains, stimulated PA to a level approaching that of full-length AP-2, suggesting that AP-2 overexpression stimulates PA activity by a mechanism involving derepression rather than activation, possibly by neutralizing...
Yilmaz, Lutfu Safak; Atilgan, Ali Rana
2000-09-01
A low-resolution structural model based on the packing geometry of α-carbons is utilized to establish a connection between the flexible and rigid parts of a folded protein. The former commonly recognizes a complementing molecule for making a complex, while the latter manipulates the necessary conformational change for binding. We attempt analytically to distinguish this control architecture that intrinsically exists in globular proteins. First with two-dimensional simple models, then for a native protein, bovine pancreatic trypsin inhibitor, we explicitly demonstrate that inserting fluctuations in tertiary contacts supported by the stable core, one can regulate the displacement of residues on loop regions. The positional fluctuations of the flexible regions are annihilated by the rest of the protein in conformity with the Le Chatelier-Braun principle. The results indicate that the distortion of the principal nonbonded contacts between highly packed residues is accompanied by that of the slavery fluctuations that are widely distributed over the native structure. These positional arrangements do not appear in a reciprocal relation between a perturbation and the associated response; the effect of a movement of residue i on residue j is not equal to that of the same movement of residue j on residue i.
Doyle, Joyce; Atkinson-Briggs, Sharon; Atkinson, Petah; Firebrace, Bradley; Calleja, Julie; Reilly, Rachel; Cargo, Margaret; Riley, Therese; Crumpen, Tui; Rowley, Kevin
2016-11-10
Aboriginal Community Controlled Organisations (ACCOs) provide community-focussed and culturally safe services for First Peoples in Australia, including crisis intervention and health promotion activities, in a holistic manner. The ecological model of health promotion goes some way towards describing the complexity of such health programs. The aims of this project were to: 1) identify the aims and purpose of existing health promotion programs conducted by an alliance of ACCOs in northern Victoria, Australia; and 2) evaluate the extent to which these programs are consistent with an ecological model of health promotion, addressing both individual and environmental determinants of health. The project arose from a long history of collaborative research. Three ACCOs and a university formed the Health Promotion Alliance to evaluate their health promotion programs. Local community members were trained in, and contributed to developing culturally sensitive methods for, data collection. Information on the aims and design of 88 health promotion activities making up 12 different programs across the ACCOs was systematically and prospectively collected. There was a wide range of activities addressing environmental and social determinants of health, as well as physical activity, nutrition and weight loss. The design of the great majority of activities had a minimal Western influence and were designed within a local Aboriginal cultural framework. The most common focus of the activities was social connectedness (76 %). Physical activity was represented in two thirds of the activities, and nutrition, weight loss and culture were each a focus of about half of the activities. A modified coding procedure designed to assess the ecological nature of these programs showed that they recruited from multiple settings; targeted a range of individual, social and environmental determinants; and used numerous and innovative strategies to achieve change. First Peoples' health promotion in the
International Nuclear Information System (INIS)
Ahn, Byung Chul; Breitenbach, Jonathan E.; Kim, Seong K.; O'Callaghan, Dennis J.
2007-01-01
The unique IR3 gene of equine herpesvirus 1 (EHV-1) is expressed as a late 1.0-kb transcript. Previous studies confirmed the IR3 transcription initiation site and tentatively identified other cis-acting elements specific to IR3 such as a TATA box, a 443 base pair 5'untranslated region (UTR), a 285 base pair open reading frame (ORF), and a poly adenylation (A) signal [Holden, V.R., Harty, R.N., Yalamanchili, R.R., O'Callaghan, D.J., 1992. The IR3 gene of equine herpesvirus type 1: a unique gene regulated by sequences within the intron of the immediate-early gene. DNA Seq. 3, 143-152]. Transient transfection assays revealed that the IR3 promoter is strongly trans-activated by the IE protein (IEP) and that coexpression of the IEP with the early EICP0 and IR4 regulatory proteins results in maximal trans-activation of the IR3 promoter. Gel shift assays revealed that the IEP directly binds to the IR3 promoter region. Western blot analysis showed that the IR3 protein produced in E. coli was detected by antibodies to IR3 synthetic peptides; however, the IR3 protein was not detected in EHV-1 infected cell extracts by these same anti-IR3 antibodies, even though the IR3 transcript was detected by northern blot. These findings suggest that the IR3 may not be expressed to a protein. Expression of an IR3/GFP fusion gene was not observed, but expression of a GFP/IR3 fusion gene was detected by fluorescent microscopy. In further attempts to detect the IR3/GFP fusion protein using anti-GFP antibody, western blot analysis showed that the IR3/GFP fusion protein was not detected in vivo. Interestingly, a truncated form of the GFP/IR3 protein was synthesized from the GFP/IR3 fusion gene. However, GFP/IR3 and IR3/GFP fusion proteins of the predicted sizes were synthesized by in vitro coupled transcription and translation of the fusion genes, suggesting poor expression of the IR3 protein in vivo. The possible role of the IR3 transcript in EHV-1 infection is discussed
Directory of Open Access Journals (Sweden)
Bat-Erdene Jugder
2016-07-01
Full Text Available Hydrogenases are metalloenzymes that reversibly catalyse the oxidation or production of molecular hydrogen (H2. Amongst a number of promising candidates for application in the oxidation of H2 is a soluble [Ni–Fe] uptake hydrogenase (SH produced by Cupriavidus necator H16. In the present study, molecular characterisation of the SH operon, responsible for functional SH synthesis, was investigated by developing a green fluorescent protein (GFP reporter system to characterise PSH promoter activity using several gene cloning approaches. A PSH promoter-gfp fusion was successfully constructed and inducible GFP expression driven by the PSH promoter under de-repressing conditions in heterotrophic growth media was demonstrated in the recombinant C. necator H16 cells. Here we report the first successful fluorescent reporter system to study PSH promoter activity in C. necator H16. The fusion construct allowed for the design of a simple screening assay to evaluate PSH activity. Furthermore, the constructed reporter system can serve as a model to develop a rapid fluorescent based reporter for subsequent small-scale process optimisation experiments for SH expression.
Rana, T; Shinde, V M; Starr, C R; Kruglov, A A; Boitet, E R; Kotla, P; Zolotukhin, S; Gross, A K; Gorbatyuk, M S
2014-12-18
Recent studies on the endoplasmic reticulum stress have shown that the unfolded protein response (UPR) is involved in the pathogenesis of inherited retinal degeneration caused by mutant rhodopsin. However, the main question of whether UPR activation actually triggers retinal degeneration remains to be addressed. Thus, in this study, we created a mouse model for retinal degeneration caused by a persistently activated UPR to assess the physiological and morphological parameters associated with this disease state and to highlight a potential mechanism by which the UPR can promote retinal degeneration. We performed an intraocular injection in C57BL6 mice with a known unfolded protein response (UPR) inducer, tunicamycin (Tn) and examined animals by electroretinography (ERG), spectral domain optical coherence tomography (SD-OCT) and histological analyses. We detected a significant loss of photoreceptor function (over 60%) and retinal structure (35%) 30 days post treatment. Analysis of retinal protein extracts demonstrated a significant upregulation of inflammatory markers including interleukin-1β (IL-1β), IL-6, tumor necrosis factor-α (TNF-α), monocyte chemoattractant protein-1 (MCP-1) and IBA1. Similarly, we detected a strong inflammatory response in mice expressing either Ter349Glu or T17M rhodopsin (RHO). These mutant rhodopsin species induce severe retinal degeneration and T17M rhodopsin elicits UPR activation when expressed in mice. RNA and protein analysis revealed a significant upregulation of pro- and anti-inflammatory markers such as IL-1β, IL-6, p65 nuclear factor kappa B (NF-kB) and MCP-1, as well as activation of F4/80 and IBA1 microglial markers in both the retinas expressing mutant rhodopsins. We then assessed if the Tn-induced inflammatory marker IL-1β was capable of inducing retinal degeneration by injecting C57BL6 mice with a recombinant IL-1β. We observed ~19% reduction in ERG a-wave amplitudes and a 29% loss of photoreceptor cells compared with
Bailey, Michelle; Chauhan, Chitra; Liu, Canhui; Unnasch, Thomas R
2011-03-01
Previous studies of Brugia malayi promoters have suggested that they are unusual in that they lack the CAAT or TATAA boxes that are often emblematic of eucaryotic core promoter domains. Instead, the region surrounding the spliced leader (SL) addition site appears to function as the core promoter domain in B. malayi. To test the hypothesis that polymorphisms in this SL addition domain are important determinants of promoter activity, a series of domain swap mutants were prepared replacing the SL addition domain of the B. malayi 13kDa large subunit ribosomal protein (BmRPL13) with those of other ribosomal protein (RP) promoters exhibiting a wide range of activities. These constructs were then tested for promoter activity in a homologous transient transfection system. On average, polymorphisms in the SL addition domain were found to be responsible for 80% of the variation in promoter activity exhibited by the RP promoters tested. Essentially all of this effect could be attributable to polymorphisms in the 10nt located directly upstream of the SL addition site. A comparison of the sequence of this domain to the promoter activity exhibited by the domain swap mutants suggested that promoter activity was related to the number of T residues present in the coding strand of the upstream domain. Confirming this, mutation of the upstream domain of the promoter of the BmRPS4 gene to a homogeneous stretch of 10 T residues resulted in a significant increase in promoter activity. Copyright © 2010 Elsevier B.V. All rights reserved.
Directory of Open Access Journals (Sweden)
Maekawa Tsuyoshi
2010-07-01
Full Text Available Abstract Background Most biological functions controlled by the brain and their related disorders are closely associated with activation in specific regions of the brain. Neuroproteomics has been applied to the analysis of whole brain, and the general pattern of protein expression in all regions has been elucidated. However, the comprehensive proteome of each brain region remains unclear. Results In this study, we carried out comparative proteomics of six regions of the adult rat brain: thalamus, hippocampus, frontal cortex, parietal cortex, occipital cortex, and amygdala using semi-quantitative analysis by Mascot Score of the identified proteins. In order to identify efficiently the proteins that are present in the brain, the proteins were separated by a combination of SDS-PAGE on a C18 column-equipped nano-liquid chromatograph, and analyzed by quadrupole-time of flight-tandem-mass spectrometry. The proteomic data show 2,909 peptides in the rat brain, with more than 200 identified as region-abundant proteins by semi-quantitative analysis. The regions containing the identified proteins are membrane (20.0%, cytoplasm (19.5%, mitochondrion (17.1%, cytoskeleton (8.2%, nucleus (4.7%, extracellular region (3.3%, and other (18.0%. Of the identified proteins, the expressions of glial fibrillary acidic protein, GABA transporter 3, Septin 5, heat shock protein 90, synaptotagmin, heat shock protein 70, and pyruvate kinase were confirmed by immunoblotting. We examined the distributions in rat brain of GABA transporter 3, glial fibrillary acidic protein, and heat shock protein 70 by immunohistochemistry, and found that the proteins are localized around the regions observed by proteomic analysis and immunoblotting. IPA analysis indicates that pathways closely related to the biological functions of each region may be activated in rat brain. Conclusions These observations indicate that proteomics in each region of adult rat brain may provide a novel way to
International Nuclear Information System (INIS)
Sakamoto, K; Imamura, T; Yano, M; Yoshida, H; Fujiki, A; Hirashima, Y; Hosoi, H
2014-01-01
All-trans retinoic acid (ATRA) is well established as differentiation therapy for acute promyelocytic leukemia (APL) in which the PML–RARα (promyelocytic leukemia-retinoic acid receptor α) fusion protein causes blockade of the retinoic acid (RA) pathway; however, in types of acute myeloid leukemia (AML) other than APL, the mechanism of RA pathway inactivation is not fully understood. This study revealed the potential mechanism of high ATRA sensitivity of mixed-lineage leukemia (MLL)-AF9-positive AML compared with MLL-AF4/5q31-positive AML. Treatment with ATRA induced significant myeloid differentiation accompanied by upregulation of RARα, C/EBPα, C/EBPε and PU.1 in MLL-AF9-positive but not in MLL-AF4/5q31-positive cells. Combining ATRA with cytarabine had a synergistic antileukemic effect in MLL-AF9-positive cells in vitro. The level of dimethyl histone H3 lysine 4 (H3K4me2) in the RARα gene-promoter region, PU.1 upstream regulatory region (URE) and RUNX1+24/+25 intronic enhancer was higher in MLL-AF9-positive cells than in MLL-AF4-positive cells, and inhibiting lysine-specific demethylase 1, which acts as a histone demethylase inhibitor, reactivated ATRA sensitivity in MLL-AF4-positive cells. These findings suggest that the level of H3K4me2 in the RARα gene-promoter region, PU.1 URE and RUNX1 intronic enhancer is determined by the MLL-fusion partner. Our findings provide insight into the mechanisms of ATRA sensitivity in AML and novel treatment strategies for ATRA-resistant AML
Bøhle, Liv Anette; Brede, Dag Anders; Diep, Dzung B.; Holo, Helge; Nes, Ingolf F.
2010-01-01
The intestinal flora of mammals contains lactic acid bacteria (LAB) that may provide positive health effects for the host. Such bacteria are referred to as probiotic bacteria. From a pig, we have isolated a Lactobacillus reuteri strain that produces an antimicrobial peptide (AMP). The peptide was purified and characterized, and it was unequivocally shown that the AMP was a well-defined degradation product obtained from the mucus adhesion-promoting protein (MapA); it was therefore termed AP48-MapA. This finding demonstrates how large proteins might inherit unexpected pleiotropic functions by conferring antimicrobial capacities on the producer. The MapA/AP48-MapA system is the first example where a large protein of an intestinal LAB is shown to give rise to such an AMP. It is also of particular interest that the protein that provides this AMP is associated with the binding of the bacterium producing it to the surface/lining of the gut. This finding gives us new perspective on how some probiotic bacteria may successfully compete in this environment and thereby contribute to a healthy microbiota. PMID:20833791
Gonzales, Melissa; Bowden, G Tim
2002-06-26
The ultraviolet B (UVB) portion (280-320 nm) of the ultraviolet spectrum has been shown to contribute to the development of non-melanoma skin cancer in humans. Research in the human keratinocyte cell line, HaCaT, revealed that UVB irradiation caused the upregulation of the transcription factor activator protein-1 (AP-1). The AP-1 complex formed in UVB-irradiated HaCaT cells is specifically composed of c-fos and Jun D. c-Fos expression was induced in a manner that correlated with the UVB-induced activation of AP-1. To investigate how c-fos expression is regulated by UVB irradiation, the role of each of four cis elements within the c-fos promoter was evaluated. Clustered point mutations at the sis inducible element (SIE), serum response element (SRE), c-fos AP-1 site (FAP1), or cyclic AMP response elements (CRE) significantly inhibited UVB induction of the c-fos promoter. This indicated that all four cis elements are required for maximum promoter activity. The CRE and FAP1 elements were the two most active cis elements that mediate the UVB transactivation of c-fos. Homodimers of phosphorylated cAMP response element binding protein (CREB) were induced by UVB irradiation to bind to each of these elements. Therefore, CREB may function as an important regulatory protein in the UVB-induced expression of c-fos.
Posner, M.G; Upadhyay, A.; Abubaker, A.A.; Fortunato, T.M.; Vara, D.; Canobbio, I.; Bagby, S.; Pula, G.
2016-01-01
Extracellular fibrinogen-binding protein (Efb) from Staphylococcus aureus inhibits platelet activation, although its mechanism of action has not been established. In this study, we discovered that the N-terminal region of Efb (Efb-N) promotes platelet binding of fibrinogen and that Efb-N binding to
Characterization of the hupSL promoter activity in Nostoc punctiforme ATCC 29133
2009-01-01
Background In cyanobacteria three enzymes are directly involved in the hydrogen metabolism; a nitrogenase that produces molecular hydrogen, H2, as a by-product of nitrogen fixation, an uptake hydrogenase that recaptures H2 and oxidize it, and a bidirectional hydrogenase that can both oxidize and produce H2.Nostoc punctiforme ATCC 29133 is a filamentous dinitrogen fixing cyanobacterium containing a nitrogenase and an uptake hydrogenase but no bidirectional hydrogenase. Generally, little is known about the transcriptional regulation of the cyanobacterial uptake hydrogenases. In this study gel shift assays showed that NtcA has a specific affinity to a region of the hupSL promoter containing a predicted NtcA binding site. The predicted NtcA binding site is centred at 258.5 bp upstream the transcription start point (tsp). To further investigate the hupSL promoter, truncated versions of the hupSL promoter were fused to either gfp or luxAB, encoding the reporter proteins Green Fluorescent Protein and Luciferase, respectively. Results Interestingly, all hupsSL promoter deletion constructs showed heterocyst specific expression. Unexpectedly the shortest promoter fragment, a fragment covering 57 bp upstream and 258 bp downstream the tsp, exhibited the highest promoter activity. Deletion of the NtcA binding site neither affected the expression to any larger extent nor the heterocyst specificity. Conclusion Obtained data suggest that the hupSL promoter in N. punctiforme is not strictly dependent on the upstream NtcA cis element and that the shortest promoter fragment (-57 to tsp) is enough for a high and heterocyst specific expression of hupSL. This is highly interesting because it indicates that the information that determines heterocyst specific gene expression might be confined to this short sequence or in the downstream untranslated leader sequence. PMID:19284581
Characterization of the hupSL promoter activity in Nostoc punctiforme ATCC 29133
Directory of Open Access Journals (Sweden)
Lindberg Pia
2009-03-01
Full Text Available Abstract Background In cyanobacteria three enzymes are directly involved in the hydrogen metabolism; a nitrogenase that produces molecular hydrogen, H2, as a by-product of nitrogen fixation, an uptake hydrogenase that recaptures H2 and oxidize it, and a bidirectional hydrogenase that can both oxidize and produce H2.Nostoc punctiforme ATCC 29133 is a filamentous dinitrogen fixing cyanobacterium containing a nitrogenase and an uptake hydrogenase but no bidirectional hydrogenase. Generally, little is known about the transcriptional regulation of the cyanobacterial uptake hydrogenases. In this study gel shift assays showed that NtcA has a specific affinity to a region of the hupSL promoter containing a predicted NtcA binding site. The predicted NtcA binding site is centred at 258.5 bp upstream the transcription start point (tsp. To further investigate the hupSL promoter, truncated versions of the hupSL promoter were fused to either gfp or luxAB, encoding the reporter proteins Green Fluorescent Protein and Luciferase, respectively. Results Interestingly, all hupsSL promoter deletion constructs showed heterocyst specific expression. Unexpectedly the shortest promoter fragment, a fragment covering 57 bp upstream and 258 bp downstream the tsp, exhibited the highest promoter activity. Deletion of the NtcA binding site neither affected the expression to any larger extent nor the heterocyst specificity. Conclusion Obtained data suggest that the hupSL promoter in N. punctiforme is not strictly dependent on the upstream NtcA cis element and that the shortest promoter fragment (-57 to tsp is enough for a high and heterocyst specific expression of hupSL. This is highly interesting because it indicates that the information that determines heterocyst specific gene expression might be confined to this short sequence or in the downstream untranslated leader sequence.
C-terminal region of herpes simplex virus ICP8 protein needed for intranuclear localization
International Nuclear Information System (INIS)
Taylor, Travis J; Knipe, David M.
2003-01-01
The herpes simplex virus single-stranded DNA-binding protein, ICP8, localizes initially to structures in the nucleus called prereplicative sites. As replication proceeds, these sites mature into large globular structures called replication compartments. The details of what signals or proteins are involved in the redistribution of viral and cellular proteins within the nucleus between prereplicative sites and replication compartments are poorly understood; however, we showed previously that the dominant-negative d105 ICP8 does not localize to prereplicative sites and prevents the localization of other viral proteins to prereplicative sites (J. Virol. 74 (2000) 10122). Within the residues deleted in d105 (1083 to 1168), we identified a region between amino acid residues 1080 and 1135 that was predicted by computer models to contain two α-helices, one with considerable amphipathic nature. We used site-specific and random mutagenesis techniques to identify residues or structures within this region that are required for proper ICP8 localization within the nucleus. Proline substitutions in the predicted helix generated ICP8 molecules that did not localize to prereplicative sites and acted as dominant-negative inhibitors. Other substitutions that altered the charged residues in the predicted α-helix to alanine or leucine residues had little or no effect on ICP8 intranuclear localization. The predicted α-helix was dispensable for the interaction of ICP8 with the U L 9 origin-binding protein. We propose that this C-terminal α-helix is required for localization of ICP8 to prereplicative sites by binding viral or cellular factors that target or retain ICP8 at specific intranuclear sites
Nucleotide sequence of the promoter region of the gene encoding chicken Calbindin D28K
Energy Technology Data Exchange (ETDEWEB)
Ferrari, S; Drusiani, E; Battini, R; Fregni, M
1988-01-11
Calbindin D28K (formerly Vitamin D-Dependent Calcium Binding Protein) is a protein induced by 1,25-dihydroxycholecalciferol in several chicken tissues. A chicken genomic DNA library was screened with a synthetic oligonucleotide representing the sequence of Calbindin D18K cDNA from nt 146 to nt 176. The positive clone CBAl extends the 5'-end of the first exon by 451 bp. The sequence of a BamHI-SacII restriction fragment with coordinates -451 + 50 is shown. The BamHI-SacII fragment was subcloned 5' to the CAT gene of pUCCAT. The result is shown of a CAT assay on mouse fibroblasts 3T6 transiently transfected with pUCCAT, pUCCAT containing the BamHI-SacII fragment in the correct or opposite orientation or the SV40 promoter. /sup 14/C-chloramphenicol and its acetyl derivatives generated by purified CAT are also shown. The expression of CAT appears to be constitutive since the enzyme activity is not influenced by the presence (+) or absence (-) of 1,25-dihydroxycholecalciferol in the culture medium.
DEFF Research Database (Denmark)
Klemm, Per; Hjerrild, L.; Gjermansen, Morten
2004-01-01
Antigen 43 (Ag43) is a self-recognizing surface adhesin found in most Escherichia coli strains. Expression of Ag43 confers aggregation and fluffing of cells, promotes biofilm formation and is associated with enhanced resistance to antimicrobial agents. Ag43 is an autotransporter protein and consi......Antigen 43 (Ag43) is a self-recognizing surface adhesin found in most Escherichia coli strains. Expression of Ag43 confers aggregation and fluffing of cells, promotes biofilm formation and is associated with enhanced resistance to antimicrobial agents. Ag43 is an autotransporter protein......-clumping variants, we have pinpointed the region of the protein responsible for autoaggregation to be located within the N-terminal one-third of the passenger domain. Our data suggest that ionic interactions between charged residues residing in interacting pairs of Ag43(alpha) domains may be important for the self...
Penta Rao, Tamarba; Rajendra Prasad, P.
2018-04-01
Entry region swirl promoters gain importance in industry because of its effectiveness in augmentation of mass and heat transfer augmentation. Design of equipment needs momentum transfer data along with mass or heat transfer data. Hence an experimental investigation was carried out with coaxially placed entry region spiral coil as turbulence promoters on momentum transfer in forced convection flow of electrolyte in circular conduits. Aqueous solution of sodium hydroxide and 0.01 M equimolal Ferri-ferro cyanide system was chosen for the study. The study covered parameters like effect of pitch of the coil, effect of length of the coil, diameter of the coil, diameter of the coil wire, diameter of the annular rod. The promoter is measured by limiting current technique using diffusion controlled electrochemical reactions. The study comprises of evaluation of momentum transfer rates at the outer wall of the electrochemical cell. Pressure drop measurements were also made to obtain the energy consumption pattern. Within the range of variables covered. The results are correlated by the momentum transfer similarity function. Momentum transfer coefficients were evaluated from measured limiting currents. Effect of each parameter was studied in terms of friction factor. A model was developed for momentum transfer. The experimental data on momentum transfer was modeled in terms of momentum transfer function and Reynolds number, geometric parameters.
Roles of beta-turns in protein folding: from peptide models to protein engineering.
Marcelino, Anna Marie C; Gierasch, Lila M
2008-05-01
Reverse turns are a major class of protein secondary structure; they represent sites of chain reversal and thus sites where the globular character of a protein is created. It has been speculated for many years that turns may nucleate the formation of structure in protein folding, as their propensity to occur will favor the approximation of their flanking regions and their general tendency to be hydrophilic will favor their disposition at the solvent-accessible surface. Reverse turns are local features, and it is therefore not surprising that their structural properties have been extensively studied using peptide models. In this article, we review research on peptide models of turns to test the hypothesis that the propensities of turns to form in short peptides will relate to the roles of corresponding sequences in protein folding. Turns with significant stability as isolated entities should actively promote the folding of a protein, and by contrast, turn sequences that merely allow the chain to adopt conformations required for chain reversal are predicted to be passive in the folding mechanism. We discuss results of protein engineering studies of the roles of turn residues in folding mechanisms. Factors that correlate with the importance of turns in folding indeed include their intrinsic stability, as well as their topological context and their participation in hydrophobic networks within the protein's structure.
Directory of Open Access Journals (Sweden)
Rafael Estrada-Avilés
Full Text Available Calsequestrin-2 (CASQ2 is the main Ca2+-binding protein inside the sarcoplasmic reticulum of cardiomyocytes. Previously, we demonstrated that MEF-2 and SRF binding sites within the human CASQ2 gene (hCASQ2 promoter region are functional in neonatal cardiomyocytes. In this work, we investigated if the calcineurin/NFAT pathway regulates hCASQ2 expression in neonatal cardiomyocytes. The inhibition of NFAT dephosphorylation with CsA or INCA-6, reduced both the luciferase activity of hCASQ2 promoter constructs (-3102/+176 bp and -288/+176 bp and the CASQ2 mRNA levels in neonatal rat cardiomyocytes. Additionally, NFATc1 and NFATc3 over-expressing neonatal cardiomyocytes showed a 2-3-fold increase in luciferase activity of both hCASQ2 promoter constructs, which was prevented by CsA treatment. Site-directed mutagenesis of the -133 bp MEF-2 binding site prevented trans-activation of hCASQ2 promoter constructs induced by NFAT overexpression. Chromatin Immunoprecipitation (ChIP assays revealed NFAT and MEF-2 enrichment within the -288 bp to +76 bp of the hCASQ2 gene promoter. Besides, a direct interaction between NFAT and MEF-2 proteins was demonstrated by protein co-immunoprecipitation experiments. Taken together, these data demonstrate that NFAT interacts with MEF-2 bound to the -133 bp binding site at the hCASQ2 gene promoter. In conclusion, in this work, we demonstrate that the Ca2+-calcineurin/NFAT pathway modulates the transcription of the hCASQ2 gene in neonatal cardiomyocytes.
Kalrn promoter usage and isoform expression respond to chronic cocaine exposure
Directory of Open Access Journals (Sweden)
Ma Xin-Ming
2011-02-01
Full Text Available Abstract Background The long-term effects of cocaine on behavior are accompanied by structural changes in excitatory glutamatergic synapses onto the medium spiny neurons of the striatum. The Kalrn gene encodes several functionally distinct isoforms; these multidomain guanine nucleotide exchange factors (GEFs contain additional domains known to interact with phosphatidylinositides as well as with a number of different proteins. Through their activation of Rho proteins and their interactions with other proteins, the different Kalirin isoforms affect cytoskeletal organization. Chronic exposure of adult male rodents to cocaine increases levels of Kalirin 7 in the striatum. When exposed chronically to cocaine, mice lacking Kalirin 7, the major adult isoform, fail to show an increase in dendritic spine density in the nucleus accumbens, show diminished place preference for cocaine, and exhibit increased locomotor activity in response to cocaine. Results The use of alternate promoters and 3'-terminal exons of the mouse Kalrn gene were investigated using real-time quantitative polymerase chain reaction. While the two most distal full-length Kalrn promoters are used equally in the prefrontal cortex, the more proximal of these promoters accounts for most of the transcripts expressed in the nucleus accumbens. The 3'-terminal exon unique to the Kalirin 7 isoform accounts for a greater percentage of the Kalrn transcripts in prefrontal cortex than in nucleus accumbens. Western blot analyses confirmed these differences. Chronic cocaine treatment increases usage of the promoter encoding the Δ-Kalirin isoforms but does not alter full-length Kalirin promoter usage. Usage of the 3'-terminal exon unique to Kalirin 7 increases following chronic cocaine exposure. Conclusions Kalrn promoter and 3'-terminal exon utilization are region-specific. In the nucleus accumbens, cocaine-mediated alterations in promoter usage and 3'-terminal exon usage favor expression of
Montoya, Gonzalo; Arenas, Jesús; Romo, Enrique; Zeichner-David, Margarita; Alvarez, Marco; Narayanan, A Sampath; Velázquez, Ulises; Mercado, Gabriela; Arzate, Higinio
2014-12-01
Cementum extracellular matrix is similar to other mineralized tissues; however, this unique tissue contains molecules only present in cementum. A cDNA of these molecules, cementum attachment protein (hrPTPLa/CAP) was cloned and expressed in a prokaryotic system. This molecule is an alternative splicing of protein tyrosine phosphatase-like A (PTPLa). In this study, we wanted to determine the structural and functional characteristics of this protein. Our results indicate that hrPTPLa/CAP contains a 43.2% α-helix, 8.9% β-sheet, 2% β-turn and 45.9% random coil secondary structure. Dynamic light scattering shows that this molecule has a size distribution of 4.8 nm and aggregates as an estimated mass of 137 kDa species. AFM characterization and FE-SEM studies indicate that this protein self-assembles into nanospheres with sizes ranging from 7.0 to 27 nm in diameter. Functional studies demonstrate that hrPTPLa/CAP promotes hydroxyapatite crystal nucleation: EDS analysis revealed that hrPTPLa/CAP-induced crystals had a 1.59 ± 0.06 Ca/P ratio. Further confirmation with MicroRaman spectrometry and TEM confirm the presence of hydroxyapatite. In vivo studies using critical-size defects in rat cranium showed that hrPTPLa/CAP promoted 73% ± 2.19% and 87% ± 1.97% new bone formation at 4 and 8 weeks respectively. Although originally identified in cementum, PTPLa/CAP is very effective at inducing bone repair and healing and therefore this novel molecule has a great potential to be used for mineralized tissue bioengineering and tissue regeneration. Copyright © 2014 Elsevier Inc. All rights reserved.
Directory of Open Access Journals (Sweden)
Masoume Vakili Azghandi
2016-05-01
Full Text Available Background: The SRY gene (SRY provides instructions for making a transcription factor called the sex-determining region Y protein. The sex-determining region Y protein causes a fetus to develop as a male. In this study, SRY of 15 spices included of human, chimpanzee, dog, pig, rat, cattle, buffalo, goat, sheep, horse, zebra, frog, urial, dolphin and killer whale were used for determine of bioinformatic differences. Methods: Nucleotide sequences of SRY were retrieved from the NCBI databank. Bioinformatic analysis of SRY is done by CLC Main Workbench version 5.5 and ClustalW (http:/www.ebi.ac.uk/clustalw/ and MEGA6 softwares. Results: The multiple sequence alignment results indicated that SRY protein sequences from Orcinus orca (killer whale and Tursiopsaduncus (dolphin have least genetic distance of 0.33 in these 15 species and are 99.67% identical at the amino acid level. Homosapiens and Pantroglodytes (chimpanzee have the next lowest genetic distance of 1.35 and are 98.65% identical at the amino acid level. Conclusion: These findings indicate that the SRY proteins are conserved in the 15 species, and their evolutionary relationships are similar.
Directory of Open Access Journals (Sweden)
Finan Christopher L
2005-03-01
Full Text Available Abstract Background In Micrococcus luteus growth and resuscitation from starvation-induced dormancy is controlled by the production of a secreted growth factor. This autocrine resuscitation-promoting factor (Rpf is the founder member of a family of proteins found throughout and confined to the actinobacteria (high G + C Gram-positive bacteria. The aim of this work was to search for and characterise a cognate gene family in the firmicutes (low G + C Gram-positive bacteria and obtain information about how they may control bacterial growth and resuscitation. Results In silico analysis of the accessory domains of the Rpf proteins permitted their classification into several subfamilies. The RpfB subfamily is related to a group of firmicute proteins of unknown function, represented by YabE of Bacillus subtilis. The actinobacterial RpfB and firmicute YabE proteins have very similar domain structures and genomic contexts, except that in YabE, the actinobacterial Rpf domain is replaced by another domain, which we have called Sps. Although totally unrelated in both sequence and secondary structure, the Rpf and Sps domains fulfil the same function. We propose that these proteins have undergone "non-orthologous domain displacement", a phenomenon akin to "non-orthologous gene displacement" that has been described previously. Proteins containing the Sps domain are widely distributed throughout the firmicutes and they too fall into a number of distinct subfamilies. Comparative analysis of the accessory domains in the Rpf and Sps proteins, together with their weak similarity to lytic transglycosylases, provide clear evidence that they are muralytic enzymes. Conclusions The results indicate that the firmicute Sps proteins and the actinobacterial Rpf proteins are cognate and that they control bacterial culturability via enzymatic modification of the bacterial cell envelope.
The nuclear protein Artemis promotes AMPK activation by stabilizing the LKB1-AMPK complex
Energy Technology Data Exchange (ETDEWEB)
Nakagawa, Koji, E-mail: k_nakagawa@pharm.hokudai.ac.jp [Department of Pathophysiology and Therapeutics, Division of Pharmascience, Faculty of Pharmaceutical Sciences, Hokkaido University, N12 W6, Kita-ku, Sapporo, Hokkaido 060-0812 (Japan); Uehata, Yasuko; Natsuizaka, Mitsuteru; Kohara, Toshihisa; Darmanin, Stephanie [Department of Gastroenterology and Hematology, Graduate School of Medicine, Hokkaido University, N15 W7, Kita-ku, Sapporo, Hokkaido 060-8638 (Japan); Asaka, Masahiro [Department of Gastroenterology and Hematology, Graduate School of Medicine, Hokkaido University, N15 W7, Kita-ku, Sapporo, Hokkaido 060-8638 (Japan); Department of Cancer Preventive Medicine, Graduate School of Medicine, Hokkaido University, N15 W7, Kita-ku, Sapporo, Hokkaido 060-8638 (Japan); Takeda, Hiroshi [Department of Pathophysiology and Therapeutics, Division of Pharmascience, Faculty of Pharmaceutical Sciences, Hokkaido University, N12 W6, Kita-ku, Sapporo, Hokkaido 060-0812 (Japan); Department of Gastroenterology and Hematology, Graduate School of Medicine, Hokkaido University, N15 W7, Kita-ku, Sapporo, Hokkaido 060-8638 (Japan); Kobayashi, Masanobu [Department of Cancer Preventive Medicine, Graduate School of Medicine, Hokkaido University, N15 W7, Kita-ku, Sapporo, Hokkaido 060-8638 (Japan); School of Nursing and Social Services, Health Sciences University of Hokkaido, Ishikari-Toubetsu, Hokkaido 061-0293 (Japan)
2012-11-02
Highlights: Black-Right-Pointing-Pointer The nuclear protein Artemis physically interacts with AMPK{alpha}2. Black-Right-Pointing-Pointer Artemis co-localizes with AMPK{alpha}2 in the nucleus. Black-Right-Pointing-Pointer Artemis promotes phosphorylation and activation of AMPK. Black-Right-Pointing-Pointer The interaction between AMPK{alpha}2 and LKB1 is stabilized by Artemis. -- Abstract: AMP-activated protein kinase (AMPK) is a hetero-trimeric Ser/Thr kinase composed of a catalytic {alpha} subunit and regulatory {beta} and {gamma} subunits; it functions as an energy sensor that controls cellular energy homeostasis. In response to an increased cellular AMP/ATP ratio, AMPK is activated by phosphorylation at Thr172 in the {alpha}-subunit by upstream AMPK kinases (AMPKKs), including tumor suppressor liver kinase B1 (LKB1). To elucidate more precise molecular mechanisms of AMPK activation, we performed yeast two-hybrid screening and isolated the complementary DNA (cDNA) encoding the nuclear protein Artemis/DNA cross-link repair 1C (DCLRE1C) as an AMPK{alpha}2-binding protein. Artemis was found to co-immunoprecipitate with AMPK{alpha}2, and the co-localization of Artemis with AMPK{alpha}2 in the nucleus was confirmed by immunofluorescence staining in U2OS cells. Moreover, over-expression of Artemis enhanced the phosphorylation of AMPK{alpha}2 and the AMPK substrate acetyl-CoA carboxylase (ACC). Conversely, RNAi-mediated knockdown of Artemis reduced AMPK and ACC phosphorylation. In addition, Artemis markedly increased the physical association between AMPK{alpha}2 and LKB1. Taken together, these results suggest that Artemis functions as a positive regulator of AMPK signaling by stabilizing the LKB1-AMPK complex.
Saify, Khyber; Saadat, Iraj; Saadat, Mostafa
2014-11-30
Within the core promoter region of prodynorphin (PDYN), a 68-bp sequence was found to occur as a polymorphism element, either singular or as tandemly repeated two, three or four times. We report the sequence of a novel allele (5-repeats). Our study revealed the existence of an ancestral nucleotide (A) at 29th position of the VNTR in human. In total, 442 heroin addicts and 799 controls were included in this study. The present findings revealed a male-limited association between VNTR polymorphism and heroin dependence risk. Copyright © 2014 Elsevier Ireland Ltd. All rights reserved.
International Nuclear Information System (INIS)
Rovnak, Joel; Hronek, Brett W.; Ryan, Sean O.; Cai, Sumin; Quackenbush, Sandra L.
2005-01-01
Walleye dermal sarcoma virus (WDSV) is a complex retrovirus associated with seasonal dermal sarcomas. Developing tumors have low levels of accessory gene transcripts, A1 and B, and regressing tumors have high levels of full-length and spliced transcripts. Transcript A1 encodes a retroviral cyclin (rv-cyclin) with limited homology to host cyclins. The rv-cyclin is physically linked to components of the transcriptional co-activator complex, Mediator, and regulates transcription. In walleye fibroblasts, it inhibits the WDSV promoter independently of cis-acting DNA sequences. The rv-cyclin activates transcription from GAL4 promoters when fused to the GAL4 DNA binding domain. A 30 a.a. activation domain in the carboxy region can be inactivated by single point mutations, and these mutations diminish the ability of the rv-cyclin to inhibit the WDSV promoter. When fused to glutathione S-transferase, the rv-cyclin, its carboxy region, and the activation domain pull down components of transcription complexes from nuclear extracts, and pulldown is lost by mutation of the activation domain
What foods are US supermarkets promoting? A content analysis of supermarket sales circulars.
Martin-Biggers, Jennifer; Yorkin, Meredith; Aljallad, Carena; Ciecierski, Caroline; Akhabue, Ivbaria; McKinley, Jessica; Hernandez, Katherine; Yablonsky, Courtney; Jackson, Rachel; Quick, Virginia; Byrd-Bredbenner, Carol
2013-03-01
This study compared the types of foods advertised in supermarket newspaper circulars across geographic region (US Census regions: northeast [n=9], midwest [n=15], south [n=14], and west [n=13]), obesity-rate region (i.e., states with CDC adult obesity rates of advertisements on the first page of each circular were measured (±0.12-in.) to determine the proportion of space occupied and categorized according to food group. Overall, ≥ 50% of the front page of supermarket sales circulars was devoted to protein foods and grains; fruits, vegetables, and dairy, combined, were allocated only about 25% of the front page. The southern geographic region and the highest obesity-rate region both devoted significantly more advertising space to sweets, particularly sugar-sweetened beverages. The lowest obesity-rate region and western geographic region allocated the most space to fruits. Vegetables were allocated the least space in the western geographic region. Grains were the only food group represented in ads in proportions approximately equal to amounts depicted in the MyPlate icon. Protein foods exceeded and fruits, dairy, and vegetables fell below comparable MyPlate proportional areas. Findings suggest supermarket ads do not consistently emphasize foods that support healthy weight and MyPlate recommendations. More research is needed to determine how supermarket newspaper circulars can be used to promote healthy dietary patterns. Copyright © 2012 Elsevier Ltd. All rights reserved.
Directory of Open Access Journals (Sweden)
Francis Sahngun Nahm
2014-01-01
Full Text Available Background. Complex regional pain syndrome (CRPS is a rare but debilitating pain disorder. Although the exact pathophysiology of CRPS is not fully understood, central and peripheral mechanisms might be involved in the development of this disorder. To reveal the central mechanism of CRPS, we conducted a proteomic analysis of rat cerebrum using the chronic postischemia pain (CPIP model, a novel experimental model of CRPS. Materials and Methods. After generating the CPIP animal model, we performed a proteomic analysis of the rat cerebrum using a multidimensional protein identification technology, and screened the proteins differentially expressed between the CPIP and control groups. Results. A total of 155 proteins were differentially expressed between the CPIP and control groups: 125 increased and 30 decreased; expressions of proteins related to cell signaling, synaptic plasticity, regulation of cell proliferation, and cytoskeletal formation were increased in the CPIP group. However, proenkephalin A, cereblon, and neuroserpin were decreased in CPIP group. Conclusion. Altered expression of cerebral proteins in the CPIP model indicates cerebral involvement in the pathogenesis of CRPS. Further study is required to elucidate the roles of these proteins in the development and maintenance of CRPS.
Nahm, Francis Sahngun; Park, Zee-Yong; Nahm, Sang-Soep; Kim, Yong Chul; Lee, Pyung Bok
2014-01-01
Complex regional pain syndrome (CRPS) is a rare but debilitating pain disorder. Although the exact pathophysiology of CRPS is not fully understood, central and peripheral mechanisms might be involved in the development of this disorder. To reveal the central mechanism of CRPS, we conducted a proteomic analysis of rat cerebrum using the chronic postischemia pain (CPIP) model, a novel experimental model of CRPS. After generating the CPIP animal model, we performed a proteomic analysis of the rat cerebrum using a multidimensional protein identification technology, and screened the proteins differentially expressed between the CPIP and control groups. Results. A total of 155 proteins were differentially expressed between the CPIP and control groups: 125 increased and 30 decreased; expressions of proteins related to cell signaling, synaptic plasticity, regulation of cell proliferation, and cytoskeletal formation were increased in the CPIP group. However, proenkephalin A, cereblon, and neuroserpin were decreased in CPIP group. Altered expression of cerebral proteins in the CPIP model indicates cerebral involvement in the pathogenesis of CRPS. Further study is required to elucidate the roles of these proteins in the development and maintenance of CRPS.
Sakuma, Keiichiro; Sasaki, Eiichi; Kimura, Kenya; Komori, Koji; Shimizu, Yasuhiro; Yatabe, Yasushi; Aoki, Masahiro
2018-06-05
HNRNPLL (heterogeneous nuclear ribonucleoprotein L-like), an RNA-binding protein that regulates alternative splicing of pre-mRNAs, has been shown to regulate differentiation of lymphocytes, as well as metastasis of colorectal cancer cells. Here we show that HNRNPLL promotes cell cycle progression and hence proliferation of colorectal cancer cells. Functional annotation analysis of those genes whose expression levels were changed by three-fold or more in RNA sequencing analysis between SW480 cells overexpressing HNRNPLL and those knocked down for HNRNPLL revealed enrichment of DNA replication-related genes by HNRNPLL overexpression. Among 13 genes detected in the DNA replication pathway, PCNA, RFC3, and FEN1 showed reproducible upregulation by HNRNPLL overexpression both at mRNA and protein levels in SW480 and HT29 cells. Importantly, knockdown of any of these genes alone suppressed the proliferation promoting effect induced by HNRNPLL overexpression. RNA-immunoprecipitation assay presented a binding of FLAG-tagged HNRNPLL to mRNA of these genes, and HNRNPLL overexpression significantly suppressed the downregulation of these genes during 12 hours of actinomycin D treatment, suggesting a role of HNRNPLL in mRNA stability. Finally, analysis of a public RNA sequencing dataset of clinical samples suggested a link between overexpression of HNRNPLL and that of PCNA, RFC3, and FEN1. This link was further supported by immunohistochemistry of colorectal cancer clinical samples, whereas expression of CDKN1A, which is known to inhibit the cooperative function of PCNA, RFC3, and FEN1, was negatively associated with HNRNPLL expression. These results indicate that HNRNPLL stabilizes mRNAs encoding regulators of DNA replication and promotes colorectal cancer cell proliferation. This article is protected by copyright. All rights reserved. This article is protected by copyright. All rights reserved.