International Nuclear Information System (INIS)
Apostolaki, Angeliki; Kalosakas, George
2011-01-01
We mapped promoter regions of double-stranded DNA with respect to the probabilities of appearance of relatively large bubble openings exclusively due to thermal fluctuations at physiological temperatures. We analyzed five well-studied promoter regions of procaryotic type and found a spatial correlation between the binding sites of transcription factors and the position of peaks in the probability pattern of large thermal openings. Other distinct peaks of the calculated patterns correlate with potential binding sites of DNA-binding proteins. These results suggest that a DNA molecule would more frequently expose the bases that participate in contacts with proteins, which would probably enhance the probability of the latter to reach their targets. It also stands for using this method as a means to analyze DNA sequences based on their intrinsic thermal properties
International Nuclear Information System (INIS)
Shannon, M.F.; Gamble, J.R.; Vadas, M.A.
1988-01-01
The gene for human granulocyte/macrophage colony-stimulating factor (GM-CSF) is expressed in a tissue-specific as well as an activation-dependent manner. The interaction of nuclear proteins with the promoter region of the GM-CSF gene that is likely to be responsible for this pattern of GM-CSF expression was investigated. The authors show that nuclear proteins interact with DNA fragments from the GM-CSF promoter in a cell-specific manner. A region spanning two cytokine-specific sequences, cytokine 1 (CK-1, 5', GAGATTCCAC 3') and cytokine 2 (CK-2, 5' TCAGGTA 3') bound two nuclear proteins from GM-CSF-expressing cells in gel retardation assays. NF-GMb was inducible with phorbol 12-myristate 13-acetate and accompanied induction of GM-CSF message. NF-GMb was absent in cell lines not producing GM-CSF, some of which had other distinct binding proteins. NF-GMa and NF-GMb eluted from a heparin-Sepharose column at 0.3 and 0.6 M KCl, respectively. They hypothesize that the sequences CK-1 and CK-2 bind specific proteins and regulate GM-CSF transcription
Tsai, P-C; Chen, C-J; Lai, H-M; Chang, S-J
2008-01-01
To explore the associations between the polymorphisms and protein levels of interleukin-6 (IL-6) gene and gout disease. A total of 120 male gout patients and 184 healthy controls were enrolled. Each patient was matched with 1-2 gout-free controls by age within three years. Four polymorphisms in the promoter of IL-6 gene, including -597G/A, -572C/G, -373A(m)T(n), and -174G/C, and the IL-6 levels were analyzed. The clinical characteristics and biochemical markers in plasma were measured, including age of gout onset, duration of gout history, tophus number, gout attack frequency, uric acid, total cholesterol, triglycerides and creatinine. The mean IL-6 level for gout patients was 9.80 (+/-11.76 pg/ml) which showed no significant difference from the controls (7.06+/-7.58 pg/ml, p=0.230). When the IL-6 levels were dichotomized according to the median value (5 pg/ml), there were significantly higher proportions of the gout patients (59.66%) than controls (44%) with high IL-6 levels (OR=1.88, 95% CI=1.17-3.02, p=0.008). Unique genotype was found at polymorphisms -174G/C and -597G/A. Neither the polymorphisms -572C/G nor -373A(m)T(n) in the genotype or allele distributions showed a significant association related to clinical characteristics, biochemical markers, IL-6 levels or gout disease (all p>0.05). Those with gout disease have greater proportions of high IL-6 levels in plasma than controls, and there is no significant association between the four polymorphisms in the promoter region of IL-6 gene and gout disease.
DEFF Research Database (Denmark)
Jensen, Anne
Pricing of transport has been part of EU's common transport policy since this gained momentum in the early 1990s. Since then, it has been closely connected to the trans-European transport network (TEN-T) and to rising demands of efficient mobility systems at a local, regional and Community scale....... Development of pricing policies is contested at Community level and has taken place in a clash between different policy rationalities. Significantly though, the effects of the pricing policies are closely related to regional mobility systems, e.g. through financing large trans-border infrastructure projects...... and establishing common technical charging systems thus changing the conditions for regional mobility. This paper explores how policies of infrastructure pricing shape new ways of governing mobility which influences trans-border, regional policy-making. The key findings are that there is a tendency to include...
DEFF Research Database (Denmark)
Gustafsson, Caj Ulrik Mattias; Lannergård, Jonas; Nilsson, Olof Rickard
2013-01-01
Many pathogens express a surface protein that binds the human complement regulator factor H (FH), as first described for Streptococcus pyogenes and the antiphagocytic M6 protein. It is commonly assumed that FH recruited to an M protein enhances virulence by protecting the bacteria against...... represents a distinct ligand-binding domain. The isolated HVRs specifically interacted with FH among all human serum proteins, interacted with the same region in FH and showed species specificity, but exhibited little or no antigenic cross-reactivity. Although these findings suggested that FH recruited...... to an M protein promotes virulence, studies in transgenic mice did not demonstrate a role for bound FH during acute infection. Moreover, phagocytosis tests indicated that ability to bind FH is neither sufficient nor necessary for S. pyogenes to resist killing in whole human blood. While these data shed...
International Nuclear Information System (INIS)
Kita, Atsushi; Yamasaki, Hironori; Kuwahara, Hironaga; Moriuchi, Akie; Fukushima, Keiko; Kobayashi, Masakazu; Fukushima, Tetsuya; Takahashi, Ryoko; Abiru, Norio; Uotani, Shigeo; Kawasaki, Eiji; Eguchi, Katsumi
2005-01-01
Adiponectin, an adipose tissue-specific plasma protein, is involved in insulin sensitizing and has anti-atherosclerotic properties. Plasma levels of adiponectin are decreased in obese individuals and patients with type 2 diabetes with insulin resistance. Tumor necrosis factor-α (TNF-α) decreases the expression of adiponectin in adipocytes. The aims of the present study were: (1) to identify the promoter region responsible for basal transcription of the human adiponectin gene, and (2) to investigate the mechanism by which adiponectin was regulated by TNF-α. The human adiponectin promoter (2.1 kb) was isolated and used for luciferase reporter analysis by transient transfection into 3T3-L1 adipocytes. Deletion analysis demonstrated that the promoter region from -676 to +41 was sufficient for basal transcriptional activity. Mutation analysis of putative response elements for sterol regulatory element binding protein (SREBP) (-431 to -423) and CCAAT/enhancer binding protein (C/EBP) (-230 to -224) showed that both elements were required for basal promoter activity. Adiponectin transcription was increased 3-fold in cells that over-expressed constitutively active C/EBP-β. Electrophoretic mobility shift assay, using nuclear extract from 3T3-L1 cells and the -258 to -199 region as a probe, demonstrated specific DNA-protein binding, which was abolished by TNF-α treatment. The present data indicate that the putative response elements for SREBP and C/EBP are required for human adiponectin promoter activity, and that suppression by TNF-α may, at least in part, be associated with inactivation of C/EBP-β
Sequence analysis of the Epstein-Barr virus (EBV) latent membrane protein-1 gene and promoter region
DEFF Research Database (Denmark)
Sandvej, Kristian; Gratama, J W; Munch, M
1997-01-01
Sequence variations in the Epstein-Barr virus (EBV) encoded latent membrane protein-1 (LMP-1) gene have been described in a Chinese nasopharyngeal carcinoma-derived isolate (CAO), and in viral isolates from various EBV-associated tumors. It has been suggested that these genetic changes, which...... include loss of a Xho I restriction site (position 169425) and a C-terminal 30-base pair (bp) deletion (position 168287-168256), define EBV genotypes associated with increased tumorigenicity or with disease among particular geographic populations. To determine the frequency of LMP-1 variations in European...... wild-type virus isolates, we sequenced the LMP-1 promoter and gene in EBV from lymphoblastoid cell lines from healthy carriers and patients without EBV-associated disease. Sequence changes were often present, and defined at least four main groups of viral isolates, which we designate Groups A through D...
Kristensen, Bodil M.; Olsen, John E.; Harris, Claire L.; Ufret-Vincenty, Rafael L.; Stålhammar-Carlemalm, Margaretha; Lindahl, Gunnar
2013-01-01
Many pathogens express a surface protein that binds the human complement regulator factor H (FH), as first described for Streptococcus pyogenes and the antiphagocytic M6 protein. It is commonly assumed that FH recruited to an M protein enhances virulence by protecting the bacteria against complement deposition and phagocytosis, but the role of FH-binding in S. pyogenes pathogenesis has remained unclear and controversial. Here, we studied seven purified M proteins for ability to bind FH and found that FH binds to the M5, M6 and M18 proteins but not the M1, M3, M4 and M22 proteins. Extensive immunochemical analysis indicated that FH binds solely to the hypervariable region (HVR) of an M protein, suggesting that selection has favored the ability of certain HVRs to bind FH. These FH-binding HVRs could be studied as isolated polypeptides that retain ability to bind FH, implying that an FH-binding HVR represents a distinct ligand-binding domain. The isolated HVRs specifically interacted with FH among all human serum proteins, interacted with the same region in FH and showed species specificity, but exhibited little or no antigenic cross-reactivity. Although these findings suggested that FH recruited to an M protein promotes virulence, studies in transgenic mice did not demonstrate a role for bound FH during acute infection. Moreover, phagocytosis tests indicated that ability to bind FH is neither sufficient nor necessary for S. pyogenes to resist killing in whole human blood. While these data shed new light on the HVR of M proteins, they suggest that FH-binding may affect S. pyogenes virulence by mechanisms not assessed in currently used model systems. PMID:23637608
Directory of Open Access Journals (Sweden)
Mattias C U Gustafsson
Full Text Available Many pathogens express a surface protein that binds the human complement regulator factor H (FH, as first described for Streptococcus pyogenes and the antiphagocytic M6 protein. It is commonly assumed that FH recruited to an M protein enhances virulence by protecting the bacteria against complement deposition and phagocytosis, but the role of FH-binding in S. pyogenes pathogenesis has remained unclear and controversial. Here, we studied seven purified M proteins for ability to bind FH and found that FH binds to the M5, M6 and M18 proteins but not the M1, M3, M4 and M22 proteins. Extensive immunochemical analysis indicated that FH binds solely to the hypervariable region (HVR of an M protein, suggesting that selection has favored the ability of certain HVRs to bind FH. These FH-binding HVRs could be studied as isolated polypeptides that retain ability to bind FH, implying that an FH-binding HVR represents a distinct ligand-binding domain. The isolated HVRs specifically interacted with FH among all human serum proteins, interacted with the same region in FH and showed species specificity, but exhibited little or no antigenic cross-reactivity. Although these findings suggested that FH recruited to an M protein promotes virulence, studies in transgenic mice did not demonstrate a role for bound FH during acute infection. Moreover, phagocytosis tests indicated that ability to bind FH is neither sufficient nor necessary for S. pyogenes to resist killing in whole human blood. While these data shed new light on the HVR of M proteins, they suggest that FH-binding may affect S. pyogenes virulence by mechanisms not assessed in currently used model systems.
Directory of Open Access Journals (Sweden)
Saroj Yadav
Full Text Available MAP7 domain containing protein 3 (MAP7D3, a newly identified microtubule associated protein, has been shown to promote microtubule assembly and stability. Its microtubule binding region has been reported to consist of two coiled coil motifs located at the N-terminus. It possesses a MAP7 domain near the C-terminus and belongs to the microtubule associated protein 7 (MAP7 family. The MAP7 domain of MAP7 protein has been shown to bind to kinesin-1; however, the role of MAP7 domain in MAP7D3 remains unknown. Based on the bioinformatics analysis of MAP7D3, we hypothesized that the MAP7 domain of MAP7D3 may have microtubule binding activity. Indeed, we found that MAP7 domain of MAP7D3 bound to microtubules as well as enhanced the assembly of microtubules in vitro. Interestingly, a longer fragment MDCT that contained the MAP7 domain (MD with the C-terminal tail (CT of the protein promoted microtubule polymerization to a greater extent than MD and CT individually. MDCT stabilized microtubules against dilution induced disassembly. MDCT bound to reconstituted microtubules with an apparent dissociation constant of 3.0 ± 0.5 µM. An immunostaining experiment showed that MDCT localized along the length of the preassembled microtubules. Competition experiments with tau indicated that MDCT shares its binding site on microtubules with tau. Further, we present evidence indicating that MDCT binds to the C-terminal tail of tubulin. In addition, MDCT could bind to tubulin in HeLa cell extract. Here, we report a microtubule binding region in the C-terminal region of MAP7D3 that may have a role in regulating microtubule assembly dynamics.
Smolikov, Sarit; Schild-Prüfert, Kristina; Colaiácovo, Mónica P
2008-06-06
The synaptonemal complex (SC), a tripartite proteinaceous structure that forms between homologous chromosomes during meiosis, is crucial for faithful chromosome segregation. Here we identify CRA-1, a novel and conserved protein that is required for the assembly of the central region of the SC during C. elegans meiosis. In the absence of CRA-1, central region components fail to extensively localize onto chromosomes at early prophase and instead mostly surround the chromatin at this stage. Later in prophase, central region proteins polymerize along chromosome axes, but for the most part fail to connect the axes of paired homologous chromosomes. This defect results in an inability to stabilize homologous pairing interactions, altered double-strand break (DSB) repair progression, and a lack of chiasmata. Surprisingly, DSB formation and repair are required to promote the polymerization of the central region components along meiotic chromosome axes in cra-1 mutants. In the absence of both CRA-1 and any one of the C. elegans homologs of SPO11, MRE11, RAD51, or MSH5, the polymerization observed along chromosome axes is perturbed, resulting in the formation of aggregates of the SC central region proteins. While radiation-induced DSBs rescue this polymerization in cra-1; spo-11 mutants, they fail to do so in cra-1; mre-11, cra-1; rad-51, and cra-1; msh-5 mutants. Taken together, our studies place CRA-1 as a key component in promoting the assembly of a tripartite SC structure. Moreover, they reveal a scenario in which DSB formation and repair can drive the polymerization of SC components along chromosome axes in C. elegans.
Regulatory elements in the promoter region of the rat gene encoding the acyl-CoA-binding protein
DEFF Research Database (Denmark)
Elholm, M; Bjerking, G; Knudsen, J
1996-01-01
for the ACBP DR-1 element. Addition of peroxisome proliferators (PP) to H4IIEC3 rat hepatoma cells led to an increase in the ACBP mRNA level, indicating that the DR-1 element could be a functional peroxisome proliferator responsive element (PPRE). Analysis of the ACBP promoter by transient transfection showed...
International Nuclear Information System (INIS)
Martínez-Galán, Joaquina; Ríos, Sandra; Delgado, Juan Ramón; Torres-Torres, Blanca; Núñez, María Isabel; López-Peñalver, Jesús; Del Moral, Rosario; Ruiz De Almodóvar, José Mariano; Menjón, Salomón; Concha, Ángel; Chamorro, Clara
2014-01-01
Tumor expression of estrogen receptor (ER) is an important marker of prognosis, and is predictive of response to endocrine therapy in breast cancer. Several studies have observed that epigenetic events, such methylation of cytosines and deacetylation of histones, are involved in the complex mechanisms that regulate promoter transcription. However, the exact interplay of these factors in transcription activity is not well understood. In this study, we explored the relationship between ER expression status in tumor tissue samples and the methylation of the 5′ CpG promoter region of the estrogen receptor gene (ESR1) isolated from free circulating DNA (fcDNA) in plasma samples from breast cancer patients. Patients (n = 110) with non-metastatic breast cancer had analyses performed of ER expression (luminal phenotype in tumor tissue, by immunohistochemistry method), and the ESR1-DNA methylation status (fcDNA in plasma, by quantitative methylation specific PCR technique). Our results showed a significant association between presence of methylated ESR1 in patients with breast cancer and ER negative status in the tumor tissue (p = 0.0179). There was a trend towards a higher probability of ESR1-methylation in those phenotypes with poor prognosis i.e. 80% of triple negative patients, 60% of HER2 patients, compared to 28% and 5.9% of patients with better prognosis such as luminal A and luminal B, respectively. Silencing, by methylation, of the promoter region of the ESR1 affects the expression of the estrogen receptor protein in tumors of breast cancer patients; high methylation of ESR1-DNA is associated with estrogen receptor negative status which, in turn, may be implicated in the patient’s resistance to hormonal treatment in breast cancer. As such, epigenetic markers in plasma may be of interest as new targets for anticancer therapy, especially with respect to endocrine treatment
The architecture of mammalian ribosomal protein promoters
Directory of Open Access Journals (Sweden)
Perry Robert P
2005-02-01
Full Text Available Abstract Background Mammalian ribosomes contain 79 different proteins encoded by widely scattered single copy genes. Coordinate expression of these genes at transcriptional and post-transcriptional levels is required to ensure a roughly equimolar accumulation of ribosomal proteins. To date, detailed studies of only a very few ribosomal protein (rp promoters have been made. To elucidate the general features of rp promoter architecture, I made a detailed sequence comparison of the promoter regions of the entire set of orthologous human and mouse rp genes. Results A striking evolutionarily conserved feature of most rp genes is the separation by an intron of the sequences involved in transcriptional and translational regulation from the sequences with protein encoding function. Another conserved feature is the polypyrimidine initiator, which conforms to the consensus (Y2C+1TY(T2(Y3. At least 60 % of the rp promoters contain a largely conserved TATA box or A/T-rich motif, which should theoretically have TBP-binding capability. A remarkably high proportion of the promoters contain conserved binding sites for transcription factors that were previously implicated in rp gene expression, namely upstream GABP and Sp1 sites and downstream YY1 sites. Over 80 % of human and mouse rp genes contain a transposable element residue within 900 bp of 5' flanking sequence; very little sequence identity between human and mouse orthologues was evident more than 200 bp upstream of the transcriptional start point. Conclusions This analysis has provided some valuable insights into the general architecture of mammalian rp promoters and has identified parameters that might coordinately regulate the transcriptional activity of certain subsets of rp genes.
Benferhat, Rima; Josse, Thibaut; Albaud, Benoit; Gentien, David; Mansuroglu, Zeyni; Marcato, Vasco; Souès, Sylvie; Le Bonniec, Bernard; Bouloy, Michèle; Bonnefoy, Eliette
2012-10-01
Rift Valley fever virus (RVFV) is a highly pathogenic Phlebovirus that infects humans and ruminants. Initially confined to Africa, RVFV has spread outside Africa and presently represents a high risk to other geographic regions. It is responsible for high fatality rates in sheep and cattle. In humans, RVFV can induce hepatitis, encephalitis, retinitis, or fatal hemorrhagic fever. The nonstructural NSs protein that is the major virulence factor is found in the nuclei of infected cells where it associates with cellular transcription factors and cofactors. In previous work, we have shown that NSs interacts with the promoter region of the beta interferon gene abnormally maintaining the promoter in a repressed state. In this work, we performed a genome-wide analysis of the interactions between NSs and the host genome using a genome-wide chromatin immunoprecipitation combined with promoter sequence microarray, the ChIP-on-chip technique. Several cellular promoter regions were identified as significantly interacting with NSs, and the establishment of NSs interactions with these regions was often found linked to deregulation of expression of the corresponding genes. Among annotated NSs-interacting genes were present not only genes regulating innate immunity and inflammation but also genes regulating cellular pathways that have not yet been identified as targeted by RVFV. Several of these pathways, such as cell adhesion, axonal guidance, development, and coagulation were closely related to RVFV-induced disorders. In particular, we show in this work that NSs targeted and modified the expression of genes coding for coagulation factors, demonstrating for the first time that this hemorrhagic virus impairs the host coagulation cascade at the transcriptional level.
Interplay between chaperones and protein disorder promotes the evolution of protein networks.
Directory of Open Access Journals (Sweden)
Sebastian Pechmann
2014-06-01
Full Text Available Evolution is driven by mutations, which lead to new protein functions but come at a cost to protein stability. Non-conservative substitutions are of interest in this regard because they may most profoundly affect both function and stability. Accordingly, organisms must balance the benefit of accepting advantageous substitutions with the possible cost of deleterious effects on protein folding and stability. We here examine factors that systematically promote non-conservative mutations at the proteome level. Intrinsically disordered regions in proteins play pivotal roles in protein interactions, but many questions regarding their evolution remain unanswered. Similarly, whether and how molecular chaperones, which have been shown to buffer destabilizing mutations in individual proteins, generally provide robustness during proteome evolution remains unclear. To this end, we introduce an evolutionary parameter λ that directly estimates the rate of non-conservative substitutions. Our analysis of λ in Escherichia coli, Saccharomyces cerevisiae, and Homo sapiens sequences reveals how co- and post-translationally acting chaperones differentially promote non-conservative substitutions in their substrates, likely through buffering of their destabilizing effects. We further find that λ serves well to quantify the evolution of intrinsically disordered proteins even though the unstructured, thus generally variable regions in proteins are often flanked by very conserved sequences. Crucially, we show that both intrinsically disordered proteins and highly re-wired proteins in protein interaction networks, which have evolved new interactions and functions, exhibit a higher λ at the expense of enhanced chaperone assistance. Our findings thus highlight an intricate interplay of molecular chaperones and protein disorder in the evolvability of protein networks. Our results illuminate the role of chaperones in enabling protein evolution, and underline the
Energy Technology Data Exchange (ETDEWEB)
LaRock, Doris L.; Brzovic, Peter S.; Levin, Itay; Blanc, Marie-Pierre; Miller, Samuel I.
2012-08-24
Salmonella enterica serovar typhimurium translocates a glycerophospholipid: cholesterol acyltransferase (SseJ) into the host cytosol after its entry into mammalian cells. SseJ is recruited to the cytoplasmic face of the host cell phagosome membrane where it is activated upon binding the small GTPase, RhoA. SseJ is regulated similarly to cognate eukaryotic effectors, as only the GTP-bound form of RhoA family members stimulates enzymatic activity. Using NMR and biochemistry, this work demonstrates that SseJ competes effectively with Rhotekin, ROCK, and PKN1 in binding to a similar RhoA surface. The RhoA surface that binds SseJ includes the regulatory switch regions that control activation of mammalian effectors. These data were used to create RhoA mutants with altered SseJ binding and activation. This structure-function analysis supports a model in which SseJ activation occurs predominantly through binding to residues within switch region II. We further defined the nature of the interaction between SseJ and RhoA by constructing SseJ mutants in the RhoA binding surface. These data indicate that SseJ binding to RhoA is required for recruitment of SseJ to the endosomal network and for full Salmonella virulence for inbred susceptible mice, indicating that regulation of SseJ by small GTPases is an important virulence strategy of this bacterial pathogen. The dependence of a bacterial effector on regulation by a mammalian GTPase defines further how intimately host pathogen interactions have coevolved through similar and divergent evolutionary strategies.
Health issues of whey proteins: 3. gut health promotion
Gertjan Schaafsma
2007-01-01
This paper reviews the potential of whey protein to promote gut health. The high digestibility and specific amino acid composition of whey protein, as present in whey powder, whey protein concentrate and whey protein isolate, explain why ingestion of whey protein will exert this beneficial effect.
Knotted vs. unknotted proteins: evidence of knot-promoting loops.
Directory of Open Access Journals (Sweden)
Raffaello Potestio
Full Text Available Knotted proteins, because of their ability to fold reversibly in the same topologically entangled conformation, are the object of an increasing number of experimental and theoretical studies. The aim of the present investigation is to assess, on the basis of presently available structural data, the extent to which knotted proteins are isolated instances in sequence or structure space, and to use comparative schemes to understand whether specific protein segments can be associated to the occurrence of a knot in the native state. A significant sequence homology is found among a sizeable group of knotted and unknotted proteins. In this family, knotted members occupy a primary sub-branch of the phylogenetic tree and differ from unknotted ones only by additional loop segments. These "knot-promoting" loops, whose virtual bridging eliminates the knot, are found in various types of knotted proteins. Valuable insight into how knots form, or are encoded, in proteins could be obtained by targeting these regions in future computational studies or excision experiments.
Health issues of whey proteins: 3. Gut health promotion
Schaafsma, G.
2007-01-01
This paper reviews the potential of whey protein to promote gut health. The high digestibility and specific amino acid composition of whey protei, as present in whey powder, whey protein concentrate and whey protein isolate, explain why ingestion of whey protein will exert this beneficial effect.
Raibaud, O; Débarbouillé, M; Cossart, P
1982-01-01
A 5,800-bp (base pair) HindIII-EcoRI DNA fragment containing malT, the positive regulator gene of the maltose regulon, and most of malP, the structural gene for maltodextrin phosphorylase, was cloned into pBR322. A sequence of 802 bp was established in a DNA segment containing the promotor for malPQ and the promoter for malT. A total of 611 bp separates the initiation codons for these two genes, which are transcribed in opposite directions. The malT product was identified as a 94,000 dalton polypeptide.
Promoters and proteins from Clostridium thermocellum and uses thereof
Wu, J. H. David; Newcomb, Michael
2012-11-13
The present invention relates to an inducible and a high expression nucleic acid promoter isolated from Clostridium thermocellum. These promoters are useful for directing expression of a protein or polypeptide encoded by a nucleic acid molecule operably associated with the nucleic acid promoters. The present invention also relates to nucleic acid constructs including the C. thermocellum promoters, and expression vectors and hosts containing such nucleic acid constructs. The present invention also relates to protein isolated from Clostridium thermocellum, including a repressor protein. The present invention also provides methods of using the isolated promoters and proteins from Clostridium thermocellum, including methods for directing inducible in vitro and in vivo expression of a protein or polypeptide in a host, and methods of producing ethanol from a cellulosic biomass.
Protein Hydrolysates as Promoters of Non-Haem Iron Absorption
Li, Yanan; Jiang, Han; Huang, Guangrong
2017-01-01
Iron (Fe) is an essential micronutrient for human growth and health. Organic iron is an excellent iron supplement due to its bioavailability. Both amino acids and peptides improve iron bioavailability and absorption and are therefore valuable components of iron supplements. This review focuses on protein hydrolysates as potential promoters of iron absorption. The ability of protein hydrolysates to chelate iron is thought to be a key attribute for the promotion of iron absorption. Iron-chelatable protein hydrolysates are categorized by their absorption forms: amino acids, di- and tri-peptides and polypeptides. Their structural characteristics, including their size and amino acid sequence, as well as the presence of special amino acids, influence their iron chelation abilities and bioavailabilities. Protein hydrolysates promote iron absorption by keeping iron soluble, reducing ferric iron to ferrous iron, and promoting transport across cell membranes into the gut. We also discuss the use and relative merits of protein hydrolysates as iron supplements. PMID:28617327
Protein Hydrolysates as Promoters of Non-Haem Iron Absorption
Directory of Open Access Journals (Sweden)
Yanan Li
2017-06-01
Full Text Available Iron (Fe is an essential micronutrient for human growth and health. Organic iron is an excellent iron supplement due to its bioavailability. Both amino acids and peptides improve iron bioavailability and absorption and are therefore valuable components of iron supplements. This review focuses on protein hydrolysates as potential promoters of iron absorption. The ability of protein hydrolysates to chelate iron is thought to be a key attribute for the promotion of iron absorption. Iron-chelatable protein hydrolysates are categorized by their absorption forms: amino acids, di- and tri-peptides and polypeptides. Their structural characteristics, including their size and amino acid sequence, as well as the presence of special amino acids, influence their iron chelation abilities and bioavailabilities. Protein hydrolysates promote iron absorption by keeping iron soluble, reducing ferric iron to ferrous iron, and promoting transport across cell membranes into the gut. We also discuss the use and relative merits of protein hydrolysates as iron supplements.
Unveiling DNA structural properties of promoter regions of ...
Indian Academy of Sciences (India)
Aditya Kumar
Unveiling DNA structural properties of promoter regions of prokaryotic transcriptome and their role in gene expression. Aditya Kumar. Assistant Professor. Molecular Biology & Biotechnology. Tezpur University. Tezpur – 784028, Assam ...
Identification and annotation of promoter regions in microbial ...
Indian Academy of Sciences (India)
PRAKASH KUMAR
2007-06-15
Jun 15, 2007 ... It remains important, not only to detect rarely expressed genes but also for ... well as in identifying genes associated with rRNA, tRNA and ... DNA stability; free energy calculation; promoter; upstream and downstream region.
Shinzato, Naoya; Enoki, Miho; Sato, Hiroaki; Nakamura, Kohei; Matsui, Toru; Kamagata, Yoichi
2008-10-01
Two methyl coenzyme M reductases (MCRs) encoded by the mcr and mrt operons of the hydrogenotrophic methanogen Methanothermobacter thermautotrophicus DeltaH are expressed in response to H(2) availability. In the present study, cis elements and trans-acting factors responsible for the gene expression of MCRs were investigated by using electrophoretic mobility shift assay (EMSA) and affinity particle purification. A survey of their operator regions by EMSA with protein extracts from mrt-expressing cultures restricted them to 46- and 41-bp-long mcr and mrt upstream regions, respectively. Affinity particle purification of DNA-binding proteins conjugated with putative operator regions resulted in the retrieval of a protein attributed to IMP dehydrogenase-related protein VII (IMPDH VII). IMPDH VII is predicted to have a winged helix-turn-helix DNA-binding motif and two cystathionine beta-synthase domains, and it has been suspected to be an energy-sensing module. EMSA with oligonucleotide probes with unusual sequences showed that the binding site of IMPDH VII mostly overlaps the factor B-responsible element-TATA box of the mcr operon. The results presented here suggest that IMPDH VII encoded by MTH126 is a plausible candidate for the transcriptional regulator of the mcr operon in this methanogen.
[Health-Promoting Schools Regional Initiative of the Americas].
Ippolito-Shepherd, Josefa; Cerqueira, Maria Teresa; Ortega, Diana Patricia
2005-01-01
In Latin America, comprehensive health promotion programmes and activities are being implemented in the school setting, which take into account the conceptual framework of the Health-Promoting Schools Regional Initiative of the Pan American Health Organization, Regional office of the World Health Organization (PAHO/WHO). These programmes help to strengthen the working relationships between the health and education sectors. The Health-Promoting Schools Regional Initiative, officially launched by PAHO/WHO in 1995, aims to form future generations to have the knowledge, abilities, and skills necessary for promoting and caring for their health and that of their family and community, as well as to create and maintain healthy environments and communities. The Initiative focuses on three main components: comprehensive health education, the creation and maintenance of healthy physical and psychosocial environments, and the access to health and nutrition services, mental health, and active life. In 2001, PAHO conducted a survey in 19 Latin American countries to assess the status and trends of Health-Promoting Schools in the Region, for the appropriate regional, subregional, and national planning of pertinent health promotion and health education programmes and activities. The results of this survey provided information about policies and national plans, multisectoral coordination mechanisms for the support of health promotion in the school settings, the formation and participation in national and international networks of Health-Promoting Schools and about the level of dissemination of the strategy. For the successful development of Health-Promoting Schools is essential to involve the society as a whole, in order to mobilise human resources and materials necessary for implementing health promotion in the school settings. Thus, the constitution and consolidation of networks has been a facilitating mechanism for the exchange of ideas, resources and experiences to strengthen
Transport proteins promoting Escherichia coli pathogenesis
Tang, Fengyi; Saier, Milton H.
2014-01-01
Escherichia coli is a genetically diverse species infecting hundreds of millions of people worldwide annually. We examined seven well-characterized E. coli pathogens causing urinary tract infections, gastroenteritis, pyelonephritis and haemorrhagic colitis. Their transport proteins were identified and compared with each other and a non-pathogenic E. coli K12 strain to identify transport proteins related to pathogenesis. Each pathogen possesses a unique set of protein secretion systems for export to the cell surface or for injecting effector proteins into host cells. Pathogens have increased numbers of iron siderophore receptors and ABC iron uptake transporters, but the numbers and types of low-affinity secondary iron carriers were uniform in all strains. The presence of outer membrane iron complex receptors and high-affinity ABC iron uptake systems correlated, suggesting co-evolution. Each pathovar encodes a different set of pore-forming toxins and virulence-related outer membrane proteins lacking in K12. Intracellular pathogens proved to have a characteristically distinctive set of nutrient uptake porters, different from those of extracellular pathogens. The results presented in this report provide information about transport systems relevant to various types of E. coli pathogenesis that can be exploited in future basic and applied studies. PMID:24747185
Transport proteins promoting Escherichia coli pathogenesis.
Tang, Fengyi; Saier, Milton H
2014-01-01
Escherichia coli is a genetically diverse species infecting hundreds of millions of people worldwide annually. We examined seven well-characterized E. coli pathogens causing urinary tract infections, gastroenteritis, pyelonephritis and haemorrhagic colitis. Their transport proteins were identified and compared with each other and a non-pathogenic E. coli K12 strain to identify transport proteins related to pathogenesis. Each pathogen possesses a unique set of protein secretion systems for export to the cell surface or for injecting effector proteins into host cells. Pathogens have increased numbers of iron siderophore receptors and ABC iron uptake transporters, but the numbers and types of low-affinity secondary iron carriers were uniform in all strains. The presence of outer membrane iron complex receptors and high-affinity ABC iron uptake systems correlated, suggesting co-evolution. Each pathovar encodes a different set of pore-forming toxins and virulence-related outer membrane proteins lacking in K12. Intracellular pathogens proved to have a characteristically distinctive set of nutrient uptake porters, different from those of extracellular pathogens. The results presented in this report provide information about transport systems relevant to various types of E. coli pathogenesis that can be exploited in future basic and applied studies. Copyright © 2014 Elsevier Ltd. All rights reserved.
Shinzato, Naoya; Enoki, Miho; Sato, Hiroaki; Nakamura, Kohei; Matsui, Toru; Kamagata, Yoichi
2008-01-01
Two methyl coenzyme M reductases (MCRs) encoded by the mcr and mrt operons of the hydrogenotrophic methanogen Methanothermobacter thermautotrophicus ΔH are expressed in response to H2 availability. In the present study, cis elements and trans-acting factors responsible for the gene expression of MCRs were investigated by using electrophoretic mobility shift assay (EMSA) and affinity particle purification. A survey of their operator regions by EMSA with protein extracts from mrt-expressing cul...
Identification and annotation of promoter regions in microbial
Indian Academy of Sciences (India)
2007-06-15
Jun 15, 2007 ... Analysis of various predicted structural properties of promoter regions in prokaryotic as well as eukaryotic genomes had earlier indicated that they have several common features, such as lower stability, higher curvature and less bendability, when compared with their neighboring regions. Based on the ...
Interaction of an IHF-like protein with the Rhizobium etli nifA promoter.
Benhassine, Traki; Fauvart, Maarten; Vanderleyden, Jos; Michiels, Jan
2007-06-01
The nifA gene fulfills an essential role in the regulation of nitrogen fixation genes in Rhizobium etli. Transcription analysis of the nifA gene, assessed using promoter deletions, indicated an oxygen-independent expression, threefold higher during symbiosis as compared with free-living conditions. Electrophoretic mobility shift assays using those nifA promoter deletion fragments, which were actively transcribed, demonstrated the specific interaction with R. etli cellular protein(s) resulting in the formation of two DNA-protein complexes. An interacting protein was purified by liquid chromatography on Heparin Sepharose and Mono S columns. The purified 12 kDa R. etli protein cross-reacted with antibodies directed against Escherichia coli integration host factor (IHF). Furthermore, purified E. coli IHF was able to specifically bind to the R. etli nifA promoter region. These results point to an as yet undisclosed function of IHF in the regulation of R. etli nifA expression.
Modeling disordered regions in proteins using Rosetta.
Directory of Open Access Journals (Sweden)
Ray Yu-Ruei Wang
Full Text Available Protein structure prediction methods such as Rosetta search for the lowest energy conformation of the polypeptide chain. However, the experimentally observed native state is at a minimum of the free energy, rather than the energy. The neglect of the missing configurational entropy contribution to the free energy can be partially justified by the assumption that the entropies of alternative folded states, while very much less than unfolded states, are not too different from one another, and hence can be to a first approximation neglected when searching for the lowest free energy state. The shortcomings of current structure prediction methods may be due in part to the breakdown of this assumption. Particularly problematic are proteins with significant disordered regions which do not populate single low energy conformations even in the native state. We describe two approaches within the Rosetta structure modeling methodology for treating such regions. The first does not require advance knowledge of the regions likely to be disordered; instead these are identified by minimizing a simple free energy function used previously to model protein folding landscapes and transition states. In this model, residues can be either completely ordered or completely disordered; they are considered disordered if the gain in entropy outweighs the loss of favorable energetic interactions with the rest of the protein chain. The second approach requires identification in advance of the disordered regions either from sequence alone using for example the DISOPRED server or from experimental data such as NMR chemical shifts. During Rosetta structure prediction calculations the disordered regions make only unfavorable repulsive contributions to the total energy. We find that the second approach has greater practical utility and illustrate this with examples from de novo structure prediction, NMR structure calculation, and comparative modeling.
DNA methylation of PTEN gene promoter region is not correlated ...
African Journals Online (AJOL)
Tumor suppressor gene PTEN plays an important role in cell cycle. Disorder of PTEN protein can cause cell growth and division in an uncontrolled way, which can lead to the formation of tumors. It has been proven that epigenetic mechanisms, such as promoter hypermethylation, may account for inactivation of PTEN in a ...
Aggregation propensity of critical regions of the protein Tau
Muthee, Micaiah; Ahmed, Azka; Larini, Luca
The Alzheimer's disease is an irreversible, progressive brain disorder that slowly destroys memory and thinking skills, which eventually leads to the ability to not able to carry out the simplest tasks. The Alzheimer's disease is characterized by the formation of protein aggregates both within and outside of the brain's cells, the neurons. Within the neurons, the aggregation of the protein tau leads to the destruction of the microtubules in the axon of the neuron. Tau belongs to a group of proteins referred to as Microtubule-Associated Proteins. It is extremely flexible and is classified as an intrinsically unstructured protein due to its low propensity to form secondary structure. Tau promotes tubulin assembly into microtubules thereby stabilizing the cytoskeleton of the axon of the neurons. The microtubule binding region of tau consists of 4 pseudo-repeats. In this study, we will focus on the aggregation propensity of two fragments. In this study we will focus on the PHF43 fragment that contains the third pseudo-repeat and has been shown experimentally to aggregate readily. Another fragment that contains the second pseudo-repeat will be considered as well. Mutations in this region are associated with various form of dementia and for this reason we will consider the mutant P301L.
Hasenkamp, Sandra; Telgmann, Ralph; Staessen, Jan A; Hagedorn, Claudia; Dördelmann, Corinna; Bek, Martin; Brand-Herrmann, Stefan-Martin; Brand, Eva
2008-10-01
The G protein-coupled receptor kinase 4 is involved in renal sodium handling and blood pressure regulation. Missense variants have already been tested functionally and are associated with hypertension, but no data on promoter analyses are yet available. We scanned 94 hypertensive white subjects for genetic variation and performed promoter reporter gene analyses in HEK293T, COS7, and SaOs-2 cells. Transient transfections with various full lengths and wild-type deletion constructs revealed that 1851 bp of the flanking region and 275 bp of the 5'-untranslated region were sufficient for transcriptional activities and composed a powerful cis-active element in the distal 293 bp. The -1702T and +2T alleles resulted in drastic general reductions of promoter function, whereas an activity increasing effect of +268C was cell type specific. Electrophoretic mobility-shift assay, supershift, and cotransfection analyses of transcription factor binding sites predicted in silico (Alibaba2.1/Transfac7) resulted in allele-specific binding patterns of nuclear proteins and identified the participation of CCAAT/enhancer-binding protein transcription factor family members. The G protein-coupled receptor kinase 4 core promoter resides in the first 1851 bp upstream of its transcription start site. The 4 identified genetic variants within this region exert allele-specific impact on both cell type- and stimulation-dependent transcription and may affect the expression balance of renal G protein-coupled receptor kinase 4.
Characterization of a Lactococcus lactis promoter for heterologous protein production
Directory of Open Access Journals (Sweden)
Christian E. Ogaugwu
2018-03-01
Full Text Available Constitutively active promoter elements for heterologous protein production in Lactococcus lactis are scarce. Here, the promoter of the PTS-IIC gene cluster from L. lactis NZ3900 is described. This promoter was cloned upstream of an enhanced green fluorescent protein, GFPmut3a, and transformed into L. lactis. Transformants produced up to 13.5 μg of GFPmut3a per milliliter of log phase cells. Addition of cellobiose further increased the production of GFPmut3a by up to two-fold when compared to glucose. Analysis of mutations at two specific positions in the PTS-IIC promoter showed that a ‘T’ to ‘G’ mutation within the −35 element resulted in constitutive expression in glucose, while a ‘C’ at nucleotide 7 in the putative cre site enhanced promoter activity in cellobiose. Finally, this PTS-IIC promoter is capable of mediating protein expression in Bacillus subtilis and Escherichia coli Nissle 1917, suggesting the potential for future biotechnological applications of this element and its derivatives.
Mammalian amyloidogenic proteins promote prion nucleation in yeast.
Chandramowlishwaran, Pavithra; Sun, Meng; Casey, Kristin L; Romanyuk, Andrey V; Grizel, Anastasiya V; Sopova, Julia V; Rubel, Aleksandr A; Nussbaum-Krammer, Carmen; Vorberg, Ina M; Chernoff, Yury O
2018-03-02
Fibrous cross-β aggregates (amyloids) and their transmissible forms (prions) cause diseases in mammals (including humans) and control heritable traits in yeast. Initial nucleation of a yeast prion by transiently overproduced prion-forming protein or its (typically, QN-rich) prion domain is efficient only in the presence of another aggregated (in most cases, QN-rich) protein. Here, we demonstrate that a fusion of the prion domain of yeast protein Sup35 to some non-QN-rich mammalian proteins, associated with amyloid diseases, promotes nucleation of Sup35 prions in the absence of pre-existing aggregates. In contrast, both a fusion of the Sup35 prion domain to a multimeric non-amyloidogenic protein and the expression of a mammalian amyloidogenic protein that is not fused to the Sup35 prion domain failed to promote prion nucleation, further indicating that physical linkage of a mammalian amyloidogenic protein to the prion domain of a yeast protein is required for the nucleation of a yeast prion. Biochemical and cytological approaches confirmed the nucleation of protein aggregates in the yeast cell. Sequence alterations antagonizing or enhancing amyloidogenicity of human amyloid-β (associated with Alzheimer's disease) and mouse prion protein (associated with prion diseases), respectively, antagonized or enhanced nucleation of a yeast prion by these proteins. The yeast-based prion nucleation assay, developed in our work, can be employed for mutational dissection of amyloidogenic proteins. We anticipate that it will aid in the identification of chemicals that influence initial amyloid nucleation and in searching for new amyloidogenic proteins in a variety of proteomes. © 2018 by The American Society for Biochemistry and Molecular Biology, Inc.
Directory of Open Access Journals (Sweden)
Susanne Helm
Full Text Available During the blood meal of a Plasmodium-infected mosquito, 10 to 100 parasites are inoculated into the skin and a proportion of these migrate via the bloodstream to the liver where they infect hepatocytes. The Plasmodium liver stage, despite its clinical silence, represents a highly promising target for antimalarial drug and vaccine approaches. Successfully invaded parasites undergo a massive proliferation in hepatocytes, producing thousands of merozoites that are transported into a blood vessel to infect red blood cells. To successfully develop from the liver stage into infective merozoites, a tight regulation of gene expression is needed. Although this is a very interesting aspect in the biology of Plasmodium, little is known about gene regulation in Plasmodium parasites in general and in the liver stage in particular. We have functionally analyzed a novel promoter region of the rodent parasite Plasmodium berghei that is exclusively active during the liver stage of the parasite. To prove stage-specific activity of the promoter, GFP and luciferase reporter assays have been successfully established, allowing both qualitative and accurate quantitative analysis. To further characterize the promoter region, the transcription start site was mapped by rapid amplification of cDNA ends (5'-RACE. Using promoter truncation experiments and site-directed mutagenesis within potential transcription factor binding sites, we suggest that the minimal promoter contains more than one binding site for the recently identified parasite-specific ApiAP2 transcription factors. The identification of a liver stage-specific promoter in P. berghei confirms that the parasite is able to tightly regulate gene expression during its life cycle. The identified promoter region might now be used to study the biology of the Plasmodium liver stage, which has thus far proven problematic on a molecular level. Stage-specific expression of dominant-negative mutant proteins and
TALE factors poise promoters for activation by Hox proteins.
Choe, Seong-Kyu; Ladam, Franck; Sagerström, Charles G
2014-01-27
Hox proteins form complexes with TALE cofactors from the Pbx and Prep/Meis families to control transcription, but it remains unclear how Hox:TALE complexes function. Examining a Hoxb1b:TALE complex that regulates zebrafish hoxb1a transcription, we find maternally deposited TALE proteins at the hoxb1a promoter already during blastula stages. These TALE factors recruit histone-modifying enzymes to promote an active chromatin profile at the hoxb1a promoter and also recruit RNA polymerase II (RNAPII) and P-TEFb. However, in the presence of TALE factors, RNAPII remains phosphorylated on serine 5 and hoxb1a transcription is inefficient. By gastrula stages, Hoxb1b binds together with TALE factors to the hoxb1a promoter. This triggers P-TEFb-mediated transitioning of RNAPII to the serine 2-phosphorylated form and efficient hoxb1a transcription. We conclude that TALE factors access promoters during early embryogenesis to poise them for activation but that Hox proteins are required to trigger efficient transcription. Copyright © 2014 Elsevier Inc. All rights reserved.
Perspectives on Promoting Regional Renewable Energy Research and Development
International Nuclear Information System (INIS)
Dresselhaus, M.
2008-01-01
Recent discussions at the Washington International Renewable Energy Conference (WIREC), hosted in March 2008 by the United States Government, with nearly 9000 participants including 103 ministers from 126 countries, concluded that a major acceleration in the adoption of renewable energy technologies was needed by mid-century. Because of different climatic conditions and societal preferences, regional cooperation is expected to play a major role in the efficient adoption of appropriate renewable energy technologies, and countries with special expertise in specific technologies seem eager to collaborate internationally to promote global goals in renewable energy. A review will be given of what we learned from this conference about renewable energy research and development strategies with a special focus given to using this basic knowledge base to promote the development of renewable energy technologies appropriate to specific regions of the world.(author)
Mechanosensitive promoter region in the human HB-GAM gene
DEFF Research Database (Denmark)
Liedert, Astrid; Kassem, Moustapha; Claes, Lutz
2009-01-01
Mechanical loading is essential for maintaining bone mass in the adult skeleton. However, the underlying process of the transfer of the physical stimulus into a biochemical response, which is termed mechanotransduction is poorly understood. Mechanotransduction results in the modulation of gene...... cells. Analysis of the human HB-GAM gene upstream regulatory region with luciferase reporter gene assays revealed that the upregulation of HB-GAM expression occurred at the transcriptional level and was mainly dependent on the HB-GAM promoter region most upstream containing three potential AP-1 binding...
Directory of Open Access Journals (Sweden)
Kiran Sree Pokkuluri
2014-01-01
Full Text Available Protein coding and promoter region predictions are very important challenges of bioinformatics (Attwood and Teresa, 2000. The identification of these regions plays a crucial role in understanding the genes. Many novel computational and mathematical methods are introduced as well as existing methods that are getting refined for predicting both of the regions separately; still there is a scope for improvement. We propose a classifier that is built with MACA (multiple attractor cellular automata and MCC (modified clonal classifier to predict both regions with a single classifier. The proposed classifier is trained and tested with Fickett and Tung (1992 datasets for protein coding region prediction for DNA sequences of lengths 54, 108, and 162. This classifier is trained and tested with MMCRI datasets for protein coding region prediction for DNA sequences of lengths 252 and 354. The proposed classifier is trained and tested with promoter sequences from DBTSS (Yamashita et al., 2006 dataset and nonpromoters from EID (Saxonov et al., 2000 and UTRdb (Pesole et al., 2002 datasets. The proposed model can predict both regions with an average accuracy of 90.5% for promoter and 89.6% for protein coding region predictions. The specificity and sensitivity values of promoter and protein coding region predictions are 0.89 and 0.92, respectively.
Functional analysis of bipartite begomovirus coat protein promoter sequences
International Nuclear Information System (INIS)
Lacatus, Gabriela; Sunter, Garry
2008-01-01
We demonstrate that the AL2 gene of Cabbage leaf curl virus (CaLCuV) activates the CP promoter in mesophyll and acts to derepress the promoter in vascular tissue, similar to that observed for Tomato golden mosaic virus (TGMV). Binding studies indicate that sequences mediating repression and activation of the TGMV and CaLCuV CP promoter specifically bind different nuclear factors common to Nicotiana benthamiana, spinach and tomato. However, chromatin immunoprecipitation demonstrates that TGMV AL2 can interact with both sequences independently. Binding of nuclear protein(s) from different crop species to viral sequences conserved in both bipartite and monopartite begomoviruses, including TGMV, CaLCuV, Pepper golden mosaic virus and Tomato yellow leaf curl virus suggests that bipartite begomoviruses bind common host factors to regulate the CP promoter. This is consistent with a model in which AL2 interacts with different components of the cellular transcription machinery that bind viral sequences important for repression and activation of begomovirus CP promoters
DEFF Research Database (Denmark)
Seeger, Michael; Hartmann-Petersen, Rasmus; Wilkinson, Caroline R M
2003-01-01
Fission yeast Rhp23 and Pus1 represent two families of multiubiquitin chain-binding proteins that associate with the proteasome. We show that both proteins bind to different regions of the proteasome subunit Mts4. The binding site for Pus1 was mapped to a cluster of repetitive sequences also found...... in the proteasome subunit SpRpn2 and the anaphase-promoting complex/cyclosome (APC/C) subunit Cut4. The putative role of Pus1 as a factor involved in allocation of ubiquitinylated substrates for the proteasome is discussed....
Tao, Yan-Bin; He, Liang-Liang; Niu, Long-Jian; Xu, Zeng-Fu
2015-04-01
The JcUEP promoter is active constitutively in the bio-fuel plant Jatropha curcas , and is an alternative to the widely used CaMV35S promoter for driving constitutive overexpression of transgenes in Jatropha. Well-characterized promoters are required for transgenic breeding of Jatropha curcas, a biofuel feedstock with great potential for production of bio-diesel and bio-jet fuel. In this study, an ubiquitin extension protein gene from Jatropha, designated JcUEP, was identified to be ubiquitously expressed. Thus, we isolated a 1.2 kb fragment of the 5' flanking region of JcUEP and evaluated its activity as a constitutive promoter in Arabidopsis and Jatropha using the β-glucuronidase (GUS) reporter gene. As expected, histochemical GUS assay showed that the JcUEP promoter was active in all Arabidopsis and Jatropha tissues tested. We also compared the activity of the JcUEP promoter with that of the cauliflower mosaic virus 35S (CaMV35S) promoter, a well-characterized constitutive promoter conferring strong transgene expression in dicot species, in various tissues of Jatropha. In a fluorometric GUS assay, the two promoters showed similar activities in stems, mature leaves and female flowers; while the CaMV35S promoter was more effective than the JcUEP promoter in other tissues, especially young leaves and inflorescences. In addition, the JcUEP promoter retained its activity under stress conditions in low temperature, high salt, dehydration and exogenous ABA treatments. These results suggest that the plant-derived JcUEP promoter could be an alternative to the CaMV35S promoter for driving constitutive overexpression of transgenes in Jatropha and other plants.
Nucleopolis for promoting the nuclear excellence of the Normandy region
International Nuclear Information System (INIS)
2016-01-01
Nucleopolis is the Norman economic pole dedicated to nuclear energy, nuclear medicine and nuclear safety, it gathers about 70 enterprises whatever their sizes, research laboratories and teaching or training units. Nucleopolis was founded in 2009 with the economic development of the region as a unique purpose. Nucleopolis will ease the access of its members to local, national and international markets through actions of networking and by promoting innovations and skill development. Nucleopolis proposes to its members a series of services around 4 departments: Nucleo'Network to promote networking between the members themselves and between the members and major contractors; Nucleo'Business to propose assistance in national and international business; Nucleo'Competence to propose adequate training to its members to upgrade their skills and Nucleo'Innovation to foster collaborative work between its members on innovative projects. (A.C.)
Discovery and Evaluation of Polymorphisms in the and Promoter Regions for Risk of Korean Lung Cancer
Directory of Open Access Journals (Sweden)
Jae Sook Sung
2012-09-01
Full Text Available AKT is a signal transduction protein that plays a central role in the tumorigenesis. There are 3 mammalian isoforms of this serine/threonine protein kinase-AKT1, AKT2, and AKT3-showing a broad tissue distribution. We first discovered 2 novel polymorphisms (AKT2 -9826 C/G and AKT3 -811 A/G, and we confirmed 6 known polymorphisms (AKT2 -9473 C/T, AKT2 -9151 C/T, AKT2 -9025 C/T, AKT2 -8618G/A, AKT3 -675 A/-, and AKT3 -244 C/T of the AKT2 and AKT3 promoter region in 24 blood samples of Korean lung cancer patients using direct sequencing. To evaluate the role of AKT2 and AKT3 polymorphisms in the risk of Korean lung cancer, genotypes of the AKT2 and AKT3 polymorphisms (AKT2 -9826 C/G, AKT2 -9473 C/T, AKT2 -9151 C/T, AKT2 -9025 C/T, AKT2 -8618G/A, and AKT3 -675 A/- were determined in 360 lung cancer patients and 360 normal controls. Statistical analyses revealed that the genotypes and haplotypes in the AKT2 and AKT3 promoter regions were not significantly associated with the risk of lung cancer in the Korean population. These results suggest that polymorphisms of the AKT2 and AKT3 promoter regions do not contribute to the genetic susceptibility to lung cancer in the Korean population.
DNA Methylation Analysis of BRD1 Promoter Regions and the Schizophrenia rs138880 Risk Allele.
Directory of Open Access Journals (Sweden)
Mads Dyrvig
Full Text Available The bromodomain containing 1 gene, BRD1 is essential for embryogenesis and CNS development. It encodes a protein that participates in histone modifying complexes and thereby regulates the expression of a large number of genes. Genetic variants in the BRD1 locus show association with schizophrenia and bipolar disorder and risk alleles in the promoter region correlate with reduced BRD1 expression. Insights into the transcriptional regulation of BRD1 and the pathogenic mechanisms associated with BRD1 risk variants, however, remain sparse. By studying transcripts in human HeLa and SH-SY5Y cells we provide evidence for differences in relative expression of BRD1 transcripts with three alternative 5' UTRs (exon 1C, 1B, and 1A. We further show that expression of these transcript variants covaries negatively with DNA methylation proportions in their upstream promoter regions suggesting that promoter usage might be regulated by DNA methylation. In line with findings that the risk allele of the rs138880 SNP in the BRD1 promoter region correlates with reduced BRD1 expression, we find that it is also associated with moderate regional BRD1 promoter hypermethylation in both adipose tissue and blood. Importantly, we demonstrate by inspecting available DNA methylation and expression data that these regions undergo changes in methylation during fetal brain development and that differences in their methylation proportions in fetal compared to postnatal frontal cortex correlate significantly with BRD1 expression. These findings suggest that BRD1 may be dysregulated in both the developing and mature brain of risk allele carriers. Finally, we demonstrate that commonly used mood stabilizers Lithium, Valproate, and Carbamazepine affect the expression of BRD1 in SH-SY5Y cells. Altogether this study indicates a link between genetic risk and epigenetic dysregulation of BRD1 which raises interesting perspectives for targeting the mechanisms pharmacologically.
SCOWLP classification: Structural comparison and analysis of protein binding regions
Directory of Open Access Journals (Sweden)
Anders Gerd
2008-01-01
Full Text Available Abstract Background Detailed information about protein interactions is critical for our understanding of the principles governing protein recognition mechanisms. The structures of many proteins have been experimentally determined in complex with different ligands bound either in the same or different binding regions. Thus, the structural interactome requires the development of tools to classify protein binding regions. A proper classification may provide a general view of the regions that a protein uses to bind others and also facilitate a detailed comparative analysis of the interacting information for specific protein binding regions at atomic level. Such classification might be of potential use for deciphering protein interaction networks, understanding protein function, rational engineering and design. Description Protein binding regions (PBRs might be ideally described as well-defined separated regions that share no interacting residues one another. However, PBRs are often irregular, discontinuous and can share a wide range of interacting residues among them. The criteria to define an individual binding region can be often arbitrary and may differ from other binding regions within a protein family. Therefore, the rational behind protein interface classification should aim to fulfil the requirements of the analysis to be performed. We extract detailed interaction information of protein domains, peptides and interfacial solvent from the SCOWLP database and we classify the PBRs of each domain family. For this purpose, we define a similarity index based on the overlapping of interacting residues mapped in pair-wise structural alignments. We perform our classification with agglomerative hierarchical clustering using the complete-linkage method. Our classification is calculated at different similarity cut-offs to allow flexibility in the analysis of PBRs, feature especially interesting for those protein families with conflictive binding regions
HyCCAPP as a tool to characterize promoter DNA-protein interactions in Saccharomyces cerevisiae.
Guillen-Ahlers, Hector; Rao, Prahlad K; Levenstein, Mark E; Kennedy-Darling, Julia; Perumalla, Danu S; Jadhav, Avinash Y L; Glenn, Jeremy P; Ludwig-Kubinski, Amy; Drigalenko, Eugene; Montoya, Maria J; Göring, Harald H; Anderson, Corianna D; Scalf, Mark; Gildersleeve, Heidi I S; Cole, Regina; Greene, Alexandra M; Oduro, Akua K; Lazarova, Katarina; Cesnik, Anthony J; Barfknecht, Jared; Cirillo, Lisa A; Gasch, Audrey P; Shortreed, Michael R; Smith, Lloyd M; Olivier, Michael
2016-06-01
Currently available methods for interrogating DNA-protein interactions at individual genomic loci have significant limitations, and make it difficult to work with unmodified cells or examine single-copy regions without specific antibodies. In this study, we describe a physiological application of the Hybridization Capture of Chromatin-Associated Proteins for Proteomics (HyCCAPP) methodology we have developed. Both novel and known locus-specific DNA-protein interactions were identified at the ENO2 and GAL1 promoter regions of Saccharomyces cerevisiae, and revealed subgroups of proteins present in significantly different levels at the loci in cells grown on glucose versus galactose as the carbon source. Results were validated using chromatin immunoprecipitation. Overall, our analysis demonstrates that HyCCAPP is an effective and flexible technology that does not require specific antibodies nor prior knowledge of locally occurring DNA-protein interactions and can now be used to identify changes in protein interactions at target regions in the genome in response to physiological challenges. Copyright © 2016 Elsevier Inc. All rights reserved.
DEFF Research Database (Denmark)
Fuglsang, Anja T; Borch, Jonas; Bych, Katrine
2003-01-01
14-3-3 proteins constitute a family of well conserved proteins interacting with a large number of phosphorylated binding partners in eukaryotic cells. The plant plasma membrane H+-ATPase is an unusual target in that a unique phosphothreonine motif (946YpTV, where pT represents phosphothreonine...... of the Arabidopsis plasma membrane H+-ATPase isoform 2 (AHA2). Following site-directed mutagenesis within the 45 C-terminal residues of AHA2, we conclude that, in addition to the 946YpTV motif, a number of residues located further upstream are required for phosphorylation-independent binding of 14-3-3. Among these...
Directory of Open Access Journals (Sweden)
Enrique Yamil Alul González
2010-12-01
Full Text Available The Regional Productive Development Agencies implemented in Chile in 2006, were developed as a way to answer the longing desire to territorially decentralize, and that the own Regions be whom define their future. The Agencies have the responsibility to develop innovation and productive development Agendas in participative processes, which means with public, academic and private actors. Also, the Agencies have the mission to implement Competitive Improvement Plans-PMC (clusters in prioritized economic sectors by the own region. These PMC are leaded by private actors in each sector.
DEFF Research Database (Denmark)
Søgaard-Andersen, L; Martinussen, J; Møllegaard, N E
1990-01-01
We have investigated the regulation of the Escherichia coli deoCp2 promoter by the CytR repressor and the cyclic AMP (cAMP) receptor protein (CRP) complexed to cAMP. Promoter regions controlled by these two proteins characteristically contain tandem cAMP-CRP binding sites. Here we show that (i) Cyt...
Multi-protein delivery by nanodiamonds promotes bone formation.
Moore, L; Gatica, M; Kim, H; Osawa, E; Ho, D
2013-11-01
Bone morphogenetic proteins (BMPs) are well-studied regulators of cartilage and bone development that have been Food and Drug Administration (FDA)-approved for the promotion of bone formation in certain procedures. BMPs are seeing more use in oral and maxillofacial surgeries because of recent FDA approval of InFUSE(®) for sinus augmentation and localized alveolar ridge augmentation. However, the utility of BMPs in medical and dental applications is limited by the delivery method. Currently, BMPs are delivered to the surgical site by the implantation of bulky collagen sponges. Here we evaluate the potential of detonation nanodiamonds (NDs) as a delivery vehicle for BMP-2 and basic fibroblast growth factor (bFGF). Nanodiamonds are biocompatible, 4- to 5-nm carbon nanoparticles that have previously been used to deliver a wide variety of molecules, including proteins and peptides. We find that both BMP-2 and bFGF are readily loaded onto NDs by physisorption, forming a stable colloidal solution, and are triggered to release in slightly acidic conditions. Simultaneous delivery of BMP-2 and bFGF by ND induces differentiation and proliferation in osteoblast progenitor cells. Overall, we find that NDs provide an effective injectable alternative for the delivery of BMP-2 and bFGF to promote bone formation.
Genetic recombination is targeted towards gene promoter regions in dogs.
Auton, Adam; Rui Li, Ying; Kidd, Jeffrey; Oliveira, Kyle; Nadel, Julie; Holloway, J Kim; Hayward, Jessica J; Cohen, Paula E; Greally, John M; Wang, Jun; Bustamante, Carlos D; Boyko, Adam R
2013-01-01
The identification of the H3K4 trimethylase, PRDM9, as the gene responsible for recombination hotspot localization has provided considerable insight into the mechanisms by which recombination is initiated in mammals. However, uniquely amongst mammals, canids appear to lack a functional version of PRDM9 and may therefore provide a model for understanding recombination that occurs in the absence of PRDM9, and thus how PRDM9 functions to shape the recombination landscape. We have constructed a fine-scale genetic map from patterns of linkage disequilibrium assessed using high-throughput sequence data from 51 free-ranging dogs, Canis lupus familiaris. While broad-scale properties of recombination appear similar to other mammalian species, our fine-scale estimates indicate that canine highly elevated recombination rates are observed in the vicinity of CpG rich regions including gene promoter regions, but show little association with H3K4 trimethylation marks identified in spermatocytes. By comparison to genomic data from the Andean fox, Lycalopex culpaeus, we show that biased gene conversion is a plausible mechanism by which the high CpG content of the dog genome could have occurred.
Identifying Floppy and Rigid Regions in Proteins
Jacobs, D. J.; Thorpe, M. F.; Kuhn, L. A.
1998-03-01
In proteins it is possible to separate hard covalent forces involving bond lengths and bond angles from other weak forces. We model the microstructure of the protein as a generic bar-joint truss framework, where the hard covalent forces and strong hydrogen bonds are regarded as rigid bar constraints. We study the mechanical stability of proteins using FIRST (Floppy Inclusions and Rigid Substructure Topography) based on a recently developed combinatorial constraint counting algorithm (the 3D Pebble Game), which is a generalization of the 2D pebble game (D. J. Jacobs and M. F. Thorpe, ``Generic Rigidity: The Pebble Game'', Phys. Rev. Lett.) 75, 4051-4054 (1995) for the special class of bond-bending networks (D. J. Jacobs, "Generic Rigidity in Three Dimensional Bond-bending Networks", Preprint Aug (1997)). This approach is useful in identifying rigid motifs and flexible linkages in proteins, and thereby determines the essential degrees of freedom. We will show some preliminary results from the FIRST analysis on the myohemerythrin and lyozyme proteins.
Toscana virus NSs protein promotes degradation of double-stranded RNA-dependent protein kinase.
Kalveram, Birte; Ikegami, Tetsuro
2013-04-01
Toscana virus (TOSV), which is transmitted by Phlebotomus spp. sandflies, is a major etiologic agent of aseptic meningitis and encephalitis in the Mediterranean. Like other members of the genus Phlebovirus of the family Bunyaviridae, TOSV encodes a nonstructural protein (NSs) in its small RNA segment. Although the NSs of Rift Valley fever virus (RVFV) has been identified as an important virulence factor, which suppresses host general transcription, inhibits transcription from the beta interferon promoter, and promotes the proteasomal degradation of double-stranded RNA-dependent protein kinase (PKR), little is known about the functions of NSs proteins encoded by less-pathogenic members of this genus. In this study we report that TOSV is able to downregulate PKR with similar efficiency as RVFV, while infection with the other phleboviruses-i.e., Punta Toro virus, sandfly fever Sicilian virus, or Frijoles virus-has no effect on cellular PKR levels. In contrast to RVFV, however, cellular transcription remains unaffected during TOSV infection. TOSV NSs protein promotes the proteasome-dependent downregulation of PKR and is able to interact with kinase-inactive PKR in infected cells.
Newton, K; Jorgensen, N M; Wallace, A J; Buchanan, D D; Lalloo, F; McMahon, R F T; Hill, J; Evans, D G
2014-12-01
Lynch syndrome (LS) patients have DNA mismatch repair deficiency and up to 80% lifetime risk of colorectal cancer (CRC). Screening of mutation carriers reduces CRC incidence and mortality. Selection for constitutional mutation testing relies on family history (Amsterdam and Bethesda Guidelines) and tumour-derived biomarkers. Initial biomarker analysis uses mismatch repair protein immunohistochemistry and microsatellite instability. Abnormalities in either identify mismatch repair deficiency but do not differentiate sporadic epigenetic defects, due to MLH1 promoter region methylation (13% of CRCs) from LS (4% of CRCs). A diagnostic biomarker capable of making this distinction would be valuable. This study compared two biomarkers in tumours with mismatch repair deficiency; quantification of methylation of the MLH1 promoter region using a novel assay and BRAF c.1799T>A, p.(Val600Glu) mutation status in the identification of constitutional mutations. Tumour DNA was extracted (formalin fixed, paraffin embedded, FFPE tissue) and pyrosequencing used to test for MLH1 promoter methylation and presence of the BRAF c.1799T>A, p.(Val600Glu) mutation 71 CRCs from individuals with pathogenic MLH1 mutations and 73 CRCs with sporadic MLH1 loss. Specificity and sensitivity was compared. Unmethylated MLH1 promoter: sensitivity 94.4% (95% CI 86.2% to 98.4%), specificity 87.7% (95% CI 77.9% to 94.2%), Wild-type BRAF (codon 600): sensitivity 65.8% (95% CI 53.7% to 76.5%), specificity 98.6% (95% CI 92.4% to 100.0%) for the identification of those with pathogenic MLH1 mutations. Quantitative MLH1 promoter region methylation using pyrosequencing is superior to BRAF codon 600 mutation status in identifying constitutional mutations in mismatch repair deficient tumours. Published by the BMJ Publishing Group Limited. For permission to use (where not already granted under a licence) please go to http://group.bmj.com/group/rights-licensing/permissions.
US-India Technical Collaboration to Promote Regional Stability
International Nuclear Information System (INIS)
Killinger, Mark H.; Griggs, James R.; Apt, Kenneth E.; Doyle, James E.
2001-01-01
Two US-India documents were signed in 2000 that provided new impetus for scientific and technical cooperation between the two countries. The first document is the US-India Science and Technology Agreement, which is aimed at 'promoting scientific and technological cooperation between the people of their two countries.' The second is the US-India Joint Statement on Energy and Environment, which states 'the United States and India believe that energy and environment could be one of the most important areas of cooperation between the two countries.' In addition to the work already underway as part of these two agreements, DOE has established a US-India Science and Technology Initiative to utilize the expertise of DOE national laboratories to conduct activities that support US policy objectives in South Asia. PNNL and LANL are working with US agencies and the Indian government and scientific communities to identify appropriate non-sensitive areas for US-Indian technical collaboration. The objectives of such collaboration are to address visible national/international problems, build trust between the United States and India, and contribute to regional stability in South Asia. This paper describes research done on the Indian scientific organization and infrastructure, potential areas for collaboration, the approach for this engagement, and current status of the initiative.
US-INDIA TECHNICAL COLLABORATION TO PROMOTE REGIONAL STABILITY
International Nuclear Information System (INIS)
Killinger, M.H.; Griggs, J.R.; Apt, Kenneth E.; Doyle, J.E.
2001-01-01
Two US-India documents were signed in 2000 that provided new impetus for scientific and technical cooperation between the two countries. The first document is the US-India Science and Technology Agreement, which is aimed at 'promoting scientific and technological cooperation between the people of their two countries.' The second is the US-India Joint Statement on Energy and Environment, which states 'the United States and India believe that energy and environment could be one of the most important areas of cooperation between the two countries.' In addition to the work already underway as part of these two agreements, the US Department of Energy (DOE) has established a US-India Science and Technology Initiative to utilize the expertise of DOE national laboratories to conduct activities that support US policy objectives in South Asia. PNNL and LANL are working with US government agencies to identify appropriate non-sensitive, non-nuclear areas for US-Indian technical collaboration. The objectives of such collaboration are to address visible national and international problems, build trust between the United States and India, and contribute to regional stability in South Asia. This paper describes the approach for this engagement, the Indian scientific organization and infrastructure, potential areas for collaboration, and current status of the initiative.
Distribution of protein components of wheat from different regions
African Journals Online (AJOL)
kesiena
2012-06-07
Jun 7, 2012 ... The distribution of wheat protein components in different regions was researched to ..... properties of wheat gliadins II. effects on dynamic rheoligical ... fractions properties of wheat dough depending on molecular size and.
Prion Protein Promotes Kidney Iron Uptake via Its Ferrireductase Activity*
Haldar, Swati; Tripathi, Ajai; Qian, Juan; Beserra, Amber; Suda, Srinivas; McElwee, Matthew; Turner, Jerrold; Hopfer, Ulrich; Singh, Neena
2015-01-01
Brain iron-dyshomeostasis is an important cause of neurotoxicity in prion disorders, a group of neurodegenerative conditions associated with the conversion of prion protein (PrPC) from its normal conformation to an aggregated, PrP-scrapie (PrPSc) isoform. Alteration of iron homeostasis is believed to result from impaired function of PrPC in neuronal iron uptake via its ferrireductase activity. However, unequivocal evidence supporting the ferrireductase activity of PrPC is lacking. Kidney provides a relevant model for this evaluation because PrPC is expressed in the kidney, and ∼370 μg of iron are reabsorbed daily from the glomerular filtrate by kidney proximal tubule cells (PT), requiring ferrireductase activity. Here, we report that PrPC promotes the uptake of transferrin (Tf) and non-Tf-bound iron (NTBI) by the kidney in vivo and mainly NTBI by PT cells in vitro. Thus, uptake of 59Fe administered by gastric gavage, intravenously, or intraperitoneally was significantly lower in PrP-knock-out (PrP−/−) mouse kidney relative to PrP+/+ controls. Selective in vivo radiolabeling of plasma NTBI with 59Fe revealed similar results. Expression of exogenous PrPC in immortalized PT cells showed localization on the plasma membrane and intracellular vesicles and increased transepithelial transport of 59Fe-NTBI and to a smaller extent 59Fe-Tf from the apical to the basolateral domain. Notably, the ferrireductase-deficient mutant of PrP (PrPΔ51–89) lacked this activity. Furthermore, excess NTBI and hemin caused aggregation of PrPC to a detergent-insoluble form, limiting iron uptake. Together, these observations suggest that PrPC promotes retrieval of iron from the glomerular filtrate via its ferrireductase activity and modulates kidney iron metabolism. PMID:25572394
Denz, Christopher R; Zhang, Chi; Jia, Pingping; Du, Jianfeng; Huang, Xupei; Dube, Syamalima; Thomas, Anish; Poiesz, Bernard J; Dube, Dipak K
2011-09-01
Tropomyosins are a family of actin-binding proteins that show cell-specific diversity by a combination of multiple genes and alternative RNA splicing. Of the 4 different tropomyosin genes, TPM4 plays a pivotal role in myofibrillogenesis as well as cardiac contractility in amphibians. In this study, we amplified and sequenced the upstream regulatory region of the TPM4 gene from both normal and mutant axolotl hearts. To identify the cis-elements that are essential for the expression of the TPM4, we created various deletion mutants of the TPM4 promoter DNA, inserted the deleted segments into PGL3 vector, and performed promoter-reporter assay using luciferase as the reporter gene. Comparison of sequences of the promoter region of the TPM4 gene from normal and mutant axolotl revealed no mutations in the promoter sequence of the mutant TPM4 gene. CArG box elements that are generally involved in controlling the expression of several other muscle-specific gene promoters were not found in the upstream regulatory region of the TPM4 gene. In deletion experiments, loss of activity of the reporter gene was noted upon deletion which was then restored upon further deletion suggesting the presence of both positive and negative cis-elements in the upstream regulatory region of the TPM4 gene. We believe that this is the first axolotl promoter that has ever been cloned and studied with clear evidence that it functions in mammalian cell lines. Although striated muscle-specific cis-acting elements are absent from the promoter region of TPM4 gene, our results suggest the presence of positive and negative cis-elements in the promoter region, which in conjunction with positive and negative trans-elements may be involved in regulating the expression of TPM4 gene in a tissue-specific manner.
Business networking for SMEs as a means to promote regional competitiveness: A Theoretical Framework
Vitor Braga
2004-01-01
The competitiveness of regions, as a means of promoting the competitiveness of a country as a whole, has been one of the main topics on the agenda of policy makers over the last decades. Several attempts at promoting competitiveness have been made with different degrees of success. In most cases, public investment in the regions was perceived as the solution to promote regional competitiveness and top-down policies were implemented. However, competitiveness also has an important dimension tha...
The mitochondrial outer membrane protein MDI promotes local protein synthesis and mtDNA replication.
Zhang, Yi; Chen, Yong; Gucek, Marjan; Xu, Hong
2016-05-17
Early embryonic development features rapid nuclear DNA replication cycles, but lacks mtDNA replication. To meet the high-energy demands of embryogenesis, mature oocytes are furnished with vast amounts of mitochondria and mtDNA However, the cellular machinery driving massive mtDNA replication in ovaries remains unknown. Here, we describe a Drosophila AKAP protein, MDI that recruits a translation stimulator, La-related protein (Larp), to the mitochondrial outer membrane in ovaries. The MDI-Larp complex promotes the synthesis of a subset of nuclear-encoded mitochondrial proteins by cytosolic ribosomes on the mitochondrial surface. MDI-Larp's targets include mtDNA replication factors, mitochondrial ribosomal proteins, and electron-transport chain subunits. Lack of MDI abolishes mtDNA replication in ovaries, which leads to mtDNA deficiency in mature eggs. Targeting Larp to the mitochondrial outer membrane independently of MDI restores local protein synthesis and rescues the phenotypes of mdi mutant flies. Our work suggests that a selective translational boost by the MDI-Larp complex on the outer mitochondrial membrane might be essential for mtDNA replication and mitochondrial biogenesis during oogenesis. Published 2016. This article is a U.S. Government work and is in the public domain in the USA.
Ambigapathy, Ganesh; Zheng, Zhaoqing; Keifer, Joyce
2014-08-01
Brain-derived neurotrophic factor (BDNF) is an important regulator of neuronal development and synaptic function. The BDNF gene undergoes significant activity-dependent regulation during learning. Here, we identified the BDNF promoter regions, transcription start sites, and potential regulatory sequences for BDNF exons I-III that may contribute to activity-dependent gene and protein expression in the pond turtle Trachemys scripta elegans (tBDNF). By using transfection of BDNF promoter/luciferase plasmid constructs into human neuroblastoma SHSY5Y cells and mouse embryonic fibroblast NIH3T3 cells, we identified the basal regulatory activity of promoter sequences located upstream of each tBDNF exon, designated as pBDNFI-III. Further, through chromatin immunoprecipitation (ChIP) assays, we detected CREB binding directly to exon I and exon III promoters, while BHLHB2, but not CREB, binds within the exon II promoter. Elucidation of the promoter regions and regulatory protein binding sites in the tBDNF gene is essential for understanding the regulatory mechanisms that control tBDNF gene expression.
Directory of Open Access Journals (Sweden)
Mostafa M Abbas
Full Text Available As the number of sequenced bacterial genomes increases, the need for rapid and reliable tools for the annotation of functional elements (e.g., transcriptional regulatory elements becomes more desirable. Promoters are the key regulatory elements, which recruit the transcriptional machinery through binding to a variety of regulatory proteins (known as sigma factors. The identification of the promoter regions is very challenging because these regions do not adhere to specific sequence patterns or motifs and are difficult to determine experimentally. Machine learning represents a promising and cost-effective approach for computational identification of prokaryotic promoter regions. However, the quality of the predictors depends on several factors including: i training data; ii data representation; iii classification algorithms; iv evaluation procedures. In this work, we create several variants of E. coli promoter data sets and utilize them to experimentally examine the effect of these factors on the predictive performance of E. coli σ70 promoter models. Our results suggest that under some combinations of the first three criteria, a prediction model might perform very well on cross-validation experiments while its performance on independent test data is drastically very poor. This emphasizes the importance of evaluating promoter region predictors using independent test data, which corrects for the over-optimistic performance that might be estimated using the cross-validation procedure. Our analysis of the tested models shows that good prediction models often perform well despite how the non-promoter data was obtained. On the other hand, poor prediction models seems to be more sensitive to the choice of non-promoter sequences. Interestingly, the best performing sequence-based classifiers outperform the best performing structure-based classifiers on both cross-validation and independent test performance evaluation experiments. Finally, we propose a
Gel shift analysis of the empA promoter region in Vibrio anguillarum
Directory of Open Access Journals (Sweden)
Denkin Steven M
2004-10-01
Full Text Available Abstract Background The induction of metalloprotease encoded by empA in Vibrio anguillarum occurs at high cell density in salmon intestinal mucus. Previously we have shown that there are significant differences in empA expression in two strains of V. anguillarum, M93Sm and NB10. It is hypothesized that differences in empA regulation are due to differences in binding of regulatory elements. Results Two strains of V. anguillarum, M93Sm and NB10, were examined and compared for the presence of DNA regulatory proteins that bind to and control the empA promoter region. Gel mobility shift assays, using a digoxigenin (DIG-labeled oligomer containing a lux box-like element and the promoter for empA, were done to demonstrate the presence of a DNA-binding protein. Protein extracts from NB10 cells incubated in Luria Bertani broth + 2% NaCl (LB20, nine salts solution + 200 μg/ml mucus (NSSM, 3M (marine minimal medium, or NSS resulted in a gel mobility shift. No gel mobility shift was seen when protein extracts from either LB20- or NSSM-grown M93Sm cells were mixed with the DIG-labeled empA oligomer. The azocasein assay detected protease activity in all incubation conditions for NB10 culture supernatants. In contrast, protease activity was detected in M93Sm culture supernatants only when incubated in NSSM. Since the luxR homologue in V. anguillarum, vanT, has been cloned, sequenced, and shown to be required for protease activity, we wanted to determine if vanT mutants of NB10 exhibit the same gel shift observed in the wild-type. Site-directed mutagenesis was used to create vanT mutants in V. anguillarum M93Sm and NB10 to test whether VanT is involved with the gel mobility shift. Both vanT mutants, M02 and NB02, did not produce protease activity in any conditions. However, protein extracts from NB02 incubated in each condition still exhibited a gel shift when mixed with the DIG-labeled empA oligomer. Conclusions The data demonstrate that protein extracts of V
Yin, Tao; Wu, Hanying; Zhang, Shanglong; Lu, Hongyu; Zhang, Lingxiao; Xu, Yong; Chen, Daming; Liu, Jingmei
2009-01-01
A 1.8 kb 5'-flanking region of the large subunit of ADP-glucose pyrophosphorylase, isolated from watermelon (Citrullus vulgaris S.), has fruit-specific promoter activity in transgenic tomato plants. Two negative regulatory regions, from -986 to -959 and from -472 to -424, were identified in this promoter region by fine deletion analyses. Removal of both regions led to constitutive expression in epidermal cells. Gain-of-function experiments showed that these two regions were sufficient to inhibit RFP (red fluorescent protein) expression in transformed epidermal cells when fused to the cauliflower mosaic virus (CaMV) 35S minimal promoter. Gel mobility shift experiments demonstrated the presence of leaf nuclear factors that interact with these two elements. A TCCAAAA motif was identified in these two regions, as well as one in the reverse orientation, which was confirmed to be a novel specific cis-element. A quantitative beta-glucuronidase (GUS) activity assay of stable transgenic tomato plants showed that the activities of chimeric promoters harbouring only one of the two cis-elements, or both, were approximately 10-fold higher in fruits than in leaves. These data confirm that the TCCAAAA motif functions as a fruit-specific element by inhibiting gene expression in leaves.
Constructing a State Policy To Promote Regionalism in School Government.
Zukowsky, Jerome; And Others.
This paper defines regionalism, sets some tentative directions for the concept, and raises difficult questions related to its application in New York State. Regionalism, which offers an alternative to a State-local school governing system, is used to decentralize the planning and management of public services. A regional unit permits district…
Inhibition of SNW1 association with spliceosomal proteins promotes apoptosis in breast cancer cells
International Nuclear Information System (INIS)
Sato, Naoki; Maeda, Masao; Sugiyama, Mai; Ito, Satoko; Hyodo, Toshinori; Masuda, Akio; Tsunoda, Nobuyuki; Kokuryo, Toshio; Hamaguchi, Michinari; Nagino, Masato; Senga, Takeshi
2015-01-01
RNA splicing is a fundamental process for protein synthesis. Recent studies have reported that drugs that inhibit splicing have cytotoxic effects on various tumor cell lines. In this report, we demonstrate that depletion of SNW1, a component of the spliceosome, induces apoptosis in breast cancer cells. Proteomics and biochemical analyses revealed that SNW1 directly associates with other spliceosome components, including EFTUD2 (Snu114) and SNRNP200 (Brr2). The SKIP region of SNW1 interacted with the N-terminus of EFTUD2 as well as two independent regions in the C-terminus of SNRNP200. Similar to SNW1 depletion, knockdown of EFTUD2 increased the numbers of apoptotic cells. Furthermore, we demonstrate that exogenous expression of either the SKIP region of SNW1 or the N-terminus region of EFTUD2 significantly promoted cellular apoptosis. Our results suggest that the inhibition of SNW1 or its associating proteins may be a novel therapeutic strategy for cancer treatment
Promotion of bone morphogenetic protein signaling by tetraspanins and glycosphingolipids.
Directory of Open Access Journals (Sweden)
Zhiyu Liu
2015-05-01
Full Text Available Bone morphogenetic proteins (BMPs belong to the transforming growth factor β (TGFβ superfamily of secreted molecules. BMPs play essential roles in multiple developmental and homeostatic processes in metazoans. Malfunction of the BMP pathway can cause a variety of diseases in humans, including cancer, skeletal disorders and cardiovascular diseases. Identification of factors that ensure proper spatiotemporal control of BMP signaling is critical for understanding how this pathway is regulated. We have used a unique and sensitive genetic screen to identify the plasma membrane-localized tetraspanin TSP-21 as a key new factor in the C. elegans BMP-like "Sma/Mab" signaling pathway that controls body size and postembryonic M lineage development. We showed that TSP-21 acts in the signal-receiving cells and genetically functions at the ligand-receptor level. We further showed that TSP-21 can associate with itself and with two additional tetraspanins, TSP-12 and TSP-14, which also promote Sma/Mab signaling. TSP-12 and TSP-14 can also associate with SMA-6, the type I receptor of the Sma/Mab pathway. Finally, we found that glycosphingolipids, major components of the tetraspanin-enriched microdomains, are required for Sma/Mab signaling. Our findings suggest that the tetraspanin-enriched membrane microdomains are important for proper BMP signaling. As tetraspanins have emerged as diagnostic and prognostic markers for tumor progression, and TSP-21, TSP-12 and TSP-14 are all conserved in humans, we speculate that abnormal BMP signaling due to altered expression or function of certain tetraspanins may be a contributing factor to cancer development.
Research Article Polymorphism detection of promoter region of IFN ...
Indian Academy of Sciences (India)
MRT Pack 24 DVDs
Introduction. Improving animal health is considered to be the basic goal of the animal breeding industry ... agriculture sector for providing the invaluable supply of proteins, fats, minerals and vitamins as well as ..... 2011 MyD88 deficiency leads.
The isoelectric region of proteins: a systematic analysis.
Directory of Open Access Journals (Sweden)
Michael Widmann
Full Text Available BACKGROUND: Binding of proteins in ion exchange chromatography is dominated by electrostatic interactions and can be tuned by adjusting pH and ionic strength of the solvent. Therefore, the isoelectric region (IER, the pH region of almost zero charge near the pI, has been used to predict the binding properties of proteins. PRINCIPAL FINDINGS: Usually the IER is small and binding and elution is carried out at pH values near to the pI. However, some proteins with an extended IER have been shown to bind and elute far away from its pI. To analyze factors that mediate the size of the IER and to identify proteins with an extended IER, two protein families consisting of more than 7000 proteins were systematically investigated. Most proteins were found to have a small IER and thus are expected to bind or elute near to their pI, while only a small fraction of less than 2% had a large IER. CONCLUSIONS: Only four factors, the number of histidines, the pI, the number of titratable amino acids and the ratio of acidic to basic residues, are sufficient to reliably classify proteins by their IER based on their sequence only, and thus to predict their binding and elution behaviour in ion exchange chromatography.
Porcine MYF6 gene: sequence, homology analysis, and variation in the promoter region.
Wyszyńska-Koko, J; Kurył, J
2004-01-01
MYF6 gene codes for the bHLH transcription factor belonging to MyoD family. Its expression accompanies the processes of differentiation and maturation of myotubes during embriogenesis and continues on a relatively high level after birth, affecting the muscle phenotype. The porcine MYF6 gene was amplified and sequenced and compared with MYF6 gene sequences of other species. The amino acid sequence was deduced and an interspecies homology analysis was performed. Myf-6 protein shows a high conservation among species of 99 and 97% identity when comparing pig with cow and human, respectively, and of 93% when comparing pig with mouse and rat. The single nucleotide polymorphism (SNP) was revealed within the promoter region, which appeared to be T --> C transition recognized by a MspI restriction enzyme.
CDH1 promoter hypermethylation and E-cadherin protein expression in infiltrating breast cancer
DEFF Research Database (Denmark)
Caldeira, José Roberto F; Prando, Erika C; Quevedo, Francisco C
2006-01-01
prognosis, and metastasis. Differential CpG island methylation in the promoter region of the CDH1 gene might be an alternative way for the loss of expression and function of E-cadherin, leading to loss of tissue integrity, an essential step in tumor progression. METHODS: The aim of our study was to assess...... not statistically significant, the levels of E-cadherin expression tended to diminish with the CDH1 promoter region methylation. In the group of 71 ductal cancinomas, most of the cases of showing CDH1 hypermethylation also presented reduced levels of expression of ER and PgR proteins, and a possible association......BACKGROUND: The E-cadherin gene (CDH1) maps, at chromosome 16q22.1, a region often associated with loss of heterozygosity (LOH) in human breast cancer. LOH at this site is thought to lead to loss of function of this tumor suppressor gene and was correlated with decreased disease-free survival, poor...
Research Article Polymorphism detection of promoter region of IFN ...
Indian Academy of Sciences (India)
MRT Pack 24 DVDs
Improving animal health is considered to be the basic goal of the animal breeding ..... Additionally, cytokines including TGF-β, IFN-y and TNF-α, IL-1α, IL- .... of lipopolysaccharide-binding protein in protection of mice against a ... Humoral Immune Response to Killed H5N1 HPAI Vaccine in a Red Jungle fowl Population.
LENUS (Irish Health Repository)
Jablensky, A
2011-10-04
In a previous study, we detected a 6p25-p24 region linked to schizophrenia in families with high composite cognitive deficit (CD) scores, a quantitative trait integrating multiple cognitive measures. Association mapping of a 10 Mb interval identified a 260 kb region with a cluster of single-nucleotide polymorphisms (SNPs) significantly associated with CD scores and memory performance. The region contains two colocalising genes, LYRM4 and FARS2, both encoding mitochondrial proteins. The two tagging SNPs with strongest evidence of association were located around the overlapping putative promoters, with rs2224391 predicted to alter a transcription factor binding site (TFBS). Sequencing the promoter region identified 22 SNPs, many predicted to affect TFBSs, in a tight linkage disequilibrium block. Luciferase reporter assays confirmed promoter activity in the predicted promoter region, and demonstrated marked downregulation of expression in the LYRM4 direction under the haplotype comprising the minor alleles of promoter SNPs, which however is not driven by rs2224391. Experimental evidence from LYRM4 expression in lymphoblasts, gel-shift assays and modelling of DNA breathing dynamics pointed to two adjacent promoter SNPs, rs7752203-rs4141761, as the functional variants affecting expression. Their C-G alleles were associated with higher transcriptional activity and preferential binding of nuclear proteins, whereas the G-A combination had opposite effects and was associated with poor memory and high CD scores. LYRM4 is a eukaryote-specific component of the mitochondrial biogenesis of Fe-S clusters, essential cofactors in multiple processes, including oxidative phosphorylation. LYRM4 downregulation may be one of the mechanisms involved in inefficient oxidative phosphorylation and oxidative stress, increasingly recognised as contributors to schizophrenia pathogenesis.Molecular Psychiatry advance online publication, 4 October 2011; doi:10.1038\\/mp.2011.129.
Zhang, Zhichun; Tian, Hua; Lv, Ping; Wang, Weiping; Jia, Zhuqing; Wang, Sainan; Zhou, Chunyan; Gao, Xuejun
2015-01-01
Mutation of distal-less homeobox 3 (DLX3) is responsible for human tricho-dento-osseous syndrome (TDO) with amelogenesis imperfecta, indicating a crucial role of DLX3 in amelogenesis. However, the expression pattern of DLX3 and its specific function in amelogenesis remain largely unknown. The aim of this study was to investigate the effects of DLX3 on enamel matrix protein (EMP) genes. By immunohistochemistry assays of mouse tooth germs, stronger immunostaining of DLX3 protein was identified in ameloblasts in the secretory stage than in the pre-secretory and maturation stages, and the same pattern was found for Dlx3 mRNA using Realtime PCR. In a mouse ameloblast cell lineage, forced expression of DLX3 up-regulated the expression of the EMP genes Amelx, Enam, Klk4, and Odam, whereas knockdown of DLX3 down-regulated these four EMP genes. Further, bioinformatics, chromatin immunoprecipitation, and luciferase assays revealed that DLX3 transactivated Enam, Amelx, and Odam through direct binding to their enhancer regions. Particularly, over-expression of mutant-DLX3 (c.571_574delGGGG, responsible for TDO) inhibited the activation function of DLX3 on expression levels and promoter activities of the Enam, Amelx, and Odam genes. Together, our data show that DLX3 promotes the expression of the EMP genes Amelx, Enam, Klk4, and Odam in amelogenesis, while mutant-DLX3 disrupts this regulatory function, thus providing insights into the molecular mechanisms underlying the enamel defects of TDO disease.
Promoting regional energy co-operation in South Asia
International Nuclear Information System (INIS)
Srivastava, Leena; Misra, Neha
2007-01-01
Energy is a key ingredient of the socio-economic development of any region. South Asia is not only one of the fastest growing regions in the world; it is also one of the poorest, which thus puts energy at the very heart of the development process in the region. This paper looks at the challenges faced by the South Asia sub-region for economic co-operation (SASEC) comprised of Bangladesh, Bhutan, India and Nepal, and also at the role of greater regional energy co-operation therein. The region is characterized by pressures of growing economies and increasing population. While the per capita energy consumption is one of the lowest in the world, energy intensity continues to be very high. A large portion of the population lacks access to modern sources of energy and depends on traditional sources that are not only inefficient but also have severe health and environmental problems associated with them. Increasing oil import dependency and huge investment needs for energy market development pose a further challenge. The region has a good resource potential and tremendous scope for energy co-operation, which can play a key role in addressing many of these energy security concerns and in putting it on the path of sustainable development. It is ironic that the record in the area has been so limited and that too in the most basic form of co-operation, i.e. bilateral arrangements between countries. This paper puts forth a multi-pronged strategy for sub-regional energy co-operation encompassing softer options aimed at confidence building to more substantial and larger scale co-operation efforts. Delays in decision making to ensure stronger and mutually beneficial co-operation efforts are associated with high costs not only to the energy sector but also for the entire development agenda. With the precarious energy situation in the region and unprecedented increases in international oil prices seen in recent times, it is high time for policy makers, financing institutions, NGOs
Protein profiles of serum, brain regions and hypophyses of pubertal ...
African Journals Online (AJOL)
The effects of dietary fumonisin B1 (FB1 ), a toxin produced mainly by Fusarium verticillioides and F. proliferatum that grow on maize worldwide, on protein profiles of serum, brain regions and hypophyses were studied in 24 male Large White weanling pigs randomly divided into four groups (n = 6). In a completely ...
Phosphorylation of stress protein pp80 is related to promotion of transformation
International Nuclear Information System (INIS)
Smith, B.M.; Gindhart, T.D.; Hirano, K.; Colburn, N.H.
1986-01-01
The JB6 mouse epidermal cell system is an in vitro model of late stage promotion, and includes cell lines sensitive (P+) or resistant (P-) to phorbol ester-induced anchorage independent transformation, and transformed (T/sub x/) lines. Certain promoter-induced changes in phosphoproteins, identified by gel electrophoresis, are unique to cells of one phenotype, and occur only with specific promoters. An 80Kd protein is inversely correlated with phenotype: P- cells have a constitutively higher level (p 35 S-methionine. pp80 shares properties with the 80Kd heat stress protein: molecular weight relative abundance, and isoelectric point (4.5). Pharmacological analogs of calcium, the lanthanides, promote transformation of JB6 cells, but have no effect on phosphorylation of the 80Kd protein. If pp80 is on the promotion pathway, it is limited to a specific subset of transformation promoters
Ligand-promoted protein folding by biased kinetic partitioning.
Hingorani, Karan S; Metcalf, Matthew C; Deming, Derrick T; Garman, Scott C; Powers, Evan T; Gierasch, Lila M
2017-04-01
Protein folding in cells occurs in the presence of high concentrations of endogenous binding partners, and exogenous binding partners have been exploited as pharmacological chaperones. A combined mathematical modeling and experimental approach shows that a ligand improves the folding of a destabilized protein by biasing the kinetic partitioning between folding and alternative fates (aggregation or degradation). Computationally predicted inhibition of test protein aggregation and degradation as a function of ligand concentration are validated by experiments in two disparate cellular systems.
The Digital North Denmark Programme -Promoting Regional Change?
DEFF Research Database (Denmark)
Østergaard, Christian Richter
2007-01-01
The Digital North Denmark (DDN) was an IT programme running from 2000 to 2003 in the North Jutland County in Denmark with national government support of € 23 million. The Danish government initiated the programme with the aim of further strengthening regions with an already proven ICT capability...... (Dybkjær and Lindegaard, 1999, p.96-100). The declared approach was to build on the existing competencies in industry as well as at universities. The national government chose two regions – Ørestaden, a new concentration of knowledge-based institutions near Copenhagen Airport, and North Jutland......-offers within four themes. The participants - meant to be project consortia of ideally private firms, public or private organisations as well as regional and municipal government bodies - could get a maximum national government support of one third of the total project sum.This chapter investigates how...
New PAH gene promoter KLF1 and 3'-region C/EBPalpha motifs influence transcription in vitro.
Klaassen, Kristel; Stankovic, Biljana; Kotur, Nikola; Djordjevic, Maja; Zukic, Branka; Nikcevic, Gordana; Ugrin, Milena; Spasovski, Vesna; Srzentic, Sanja; Pavlovic, Sonja; Stojiljkovic, Maja
2017-02-01
Phenylketonuria (PKU) is a metabolic disease caused by mutations in the phenylalanine hydroxylase (PAH) gene. Although the PAH genotype remains the main determinant of PKU phenotype severity, genotype-phenotype inconsistencies have been reported. In this study, we focused on unanalysed sequences in non-coding PAH gene regions to assess their possible influence on the PKU phenotype. We transiently transfected HepG2 cells with various chloramphenicol acetyl transferase (CAT) reporter constructs which included PAH gene non-coding regions. Selected non-coding regions were indicated by in silico prediction to contain transcription factor binding sites. Furthermore, electrophoretic mobility shift assay (EMSA) and supershift assays were performed to identify which transcriptional factors were engaged in the interaction. We found novel KLF1 motif in the PAH promoter, which decreases CAT activity by 50 % in comparison to basal transcription in vitro. The cytosine at the c.-170 promoter position creates an additional binding site for the protein complex involving KLF1 transcription factor. Moreover, we assessed for the first time the role of a multivariant variable number tandem repeat (VNTR) region located in the 3'-region of the PAH gene. We found that the VNTR3, VNTR7 and VNTR8 constructs had approximately 60 % of CAT activity. The regulation is mediated by the C/EBPalpha transcription factor, present in protein complex binding to VNTR3. Our study highlighted two novel promoter KLF1 and 3'-region C/EBPalpha motifs in the PAH gene which decrease transcription in vitro and, thus, could be considered as PAH expression modifiers. New transcription motifs in non-coding regions will contribute to better understanding of the PKU phenotype complexity and may become important for the optimisation of PKU treatment.
Directory of Open Access Journals (Sweden)
Sophie A Comyn
2016-07-01
Full Text Available Misfolded proteins challenge the ability of cells to maintain protein homeostasis and can accumulate into toxic protein aggregates. As a consequence, cells have adopted a number of protein quality control pathways to prevent protein aggregation, promote protein folding, and target terminally misfolded proteins for degradation. In this study, we employed a thermosensitive allele of the yeast Guk1 guanylate kinase as a model misfolded protein to investigate degradative protein quality control pathways. We performed a flow cytometry based screen to identify factors that promote proteasomal degradation of proteins misfolded as the result of missense mutations. In addition to the E3 ubiquitin ligase Ubr1, we identified the prefoldin chaperone subunit Gim3 as an important quality control factor. Whereas the absence of GIM3 did not impair proteasomal function or the ubiquitination of the model substrate, it led to the accumulation of the poorly soluble model substrate in cellular inclusions that was accompanied by delayed degradation. We found that Gim3 interacted with the Guk1 mutant allele and propose that prefoldin promotes the degradation of the unstable model substrate by maintaining the solubility of the misfolded protein. We also demonstrated that in addition to the Guk1 mutant, prefoldin can stabilize other misfolded cytosolic proteins containing missense mutations.
A new polymorphism in goat β-lactoglobulin promoter region
Directory of Open Access Journals (Sweden)
Mirella Graziano
2003-01-01
Full Text Available An individual variability in β-lactoglobulin content has been previously observed in Girgentana goat milk by HPLC analysis. To identify eventual mutations affecting the transcription level of the gene, the prooter region was characterized in goats showing an anomalous phenotype, consisting in a reduced content of β-lactoglobulin respect to α-lactoalbumine. A single nucleotide substitution not previously reported has been detected. A PCR-RFLP procedure was developed for fast detection of the mutation in different goat breeds: Girgentana, Garganica, Sarda, Alpine, Montefalcone and Saanen. The Montefalcone goat showed the highest frequency of the mutation, confirming one more the peculiarity of this breed.
Promoter analysis of the Chilo iridescent virus DNA polymerase and major capsid protein genes
International Nuclear Information System (INIS)
Nalcacioglu, Remziye; Marks, Hendrik; Vlak, Just M.; Demirbag, Zihni; Oers, Monique M. van
2003-01-01
The DNA polymerase (DNApol) and major capsid protein (MCP) genes were used as models to study promoter activity in Chilo iridescent virus (CIV). Infection of Bombyx mori SPC-BM-36 cells in the presence of inhibitors of DNA or protein synthesis showed that DNApol, as well as helicase, is an immediate-early gene and confirmed that the major capsid protein (MCP) is a late gene. Transcription of DNApol initiated 35 nt upstream and that of MCP 14 nt upstream of the translational start site. In a luciferase reporter gene assay both promoters were active only when cells were infected with CIV. For DNApol sequences between position -27 and -6, relative to the transcriptional start site, were essential for promoter activity. Furthermore, mutation of a G within the sequence TTGTTTT located just upstream of the DNApol transcription initiation site reduced the promoter activity by 25%. Sequences crucial for MCP promoter activity are located between positions -53 and -29
National Research Council Canada - National Science Library
Carpenter, Steven
1997-01-01
This study provides retrospective market research information about the population who enrolled in TRICARE Prime in TRICARE Region 11 and the advertising mediums used to promote enrollment in the TRICARE Prime program...
Methods for promoting wound healing and muscle regeneration with the cell signaling protein nell1
Energy Technology Data Exchange (ETDEWEB)
Culiat, Cymbeline T.
2018-03-20
The present invention provides methods for promoting wound healing and treating muscle atrophy in a mammal in need. The method comprises administering to the mammal a Nell1 protein or a Nell1 nucleic acid molecule.
Methods for promoting wound healing and muscle regeneration with the cell signaling protein Nell1
Culiat, Cymbeline T [Oak Ridge, TN
2011-03-22
The present invention provides methods for promoting wound healing and treating muscle atrophy in a mammal in need. The method comprises administering to the mammal a Nell1 protein or a Nell1 nucleic acid molecule.
Active sales promotion in urban regions; Aktive Verkaufsfoerderung in Verdichtungsgebieten
Energy Technology Data Exchange (ETDEWEB)
Becker, H.D. [Oeffentlichkeitsarbeit, Maingas AG, Frankfurt am Main (Germany)
1995-03-01
The first step in any worthwhile marketing strategy for urban regions is to make a survey of all real estates without a gas supply. The data stock thus obtained serves as a short, medium, and long-term basis for all further activity. It cal be used to set up yearly personnel and activity plans. The activities are rounded off by incentives in the form of conversion aids or financing offers and additional measures presented within a Full Service Package Defining clear aims makes it easier to evaluate the success of the activities. (orig.) [Deutsch] Der erste Schritt zu einer erfolgreichen Marktbearbeitung in Verdichtungsgebieten ist die Erhebung aller Liegenschaften ohne Gasversorgung. Der gewonnene Datenbestand dient kurz-, mittel- und langfristig als Grundlage aller Aktivitaeten. Eine Personal- und Aktivitaetenplanung kann jaehrlich daraus abgeleitet werden. Kaufanreize in Form von Umstellhilfen, Finanzierungsangeboten und zusaetzlichen Dienstleistungen im Rahmen eines Full-Service-Angebotes runden die Aktivitaeten ab. Die klare Vorgabe von Zielen erleichert die Erfolgskontrolle. (orig.)
Social Media Marketing as a tool for promoting the regional investment portals
Directory of Open Access Journals (Sweden)
Alisa Yu. Fadeyeva
2016-01-01
Full Text Available Objective to investigate the potential of Social Media Marketing as a tool for promoting regional investment portals in the information environment to identify the most effective ways of its implementation and to determine the level of mastering of this tool by the Russian regions. Methods general scientific methods observation comparison analysis induction deduction analogy classification. Results the analysis showed that today Social Media Marketing is an essential tool for interaction with the investment community and one of the most effective ways to promote the regional portal which allows to increase the knowledge of and loyalty to the brand to increase the targeted website traffic to increase the awareness of investors about the specific features of the portal and the regional development agenciesrsquo functioning to promptly receive information about the investment environment and to establish contacts with investors. At the same time the study of SMMactivity in the Russian regions revealed a very low level of quality of communication with investors through social networks. Scientific novelty for the first time the article investigates the significance and makes the comparative analysis of the Social Media Marketing channels with regard to investment promotion agencies as well as the results of the regional structures functioning for effective communication through social networks. Practical significance the main results of the research can be used by the regional investment agencies in order to promote their websites increase the quality of communication with investors and promote the investment attractiveness of the region as a whole. nbsp
Directory of Open Access Journals (Sweden)
Johan Waldemarsson
Full Text Available The surface-localized M protein of Streptococcus pyogenes is a major virulence factor that inhibits phagocytosis, as determined ex vivo. Because little is known about the role of M protein in vivo we analyzed the contribution of different M protein regions to virulence, using the fibrinogen (Fg-binding M5 protein and a mouse model of acute invasive infection. This model was suitable, because M5 is required for mouse virulence and binds mouse and human Fg equally well, as shown here. Mixed infection experiments with wild type bacteria demonstrated that mutants lacking the N-terminal hypervariable region (HVR or the Fg-binding B-repeat region were strongly attenuated, while a mutant lacking the conserved C-repeats was only slightly attenuated. Because the HVR of M5 is not required for phagocytosis resistance, our data imply that this HVR plays a major but unknown role during acute infection. The B-repeat region is required for phagocytosis resistance and specifically binds Fg, suggesting that it promotes virulence by binding Fg. However, B-repeat mutants were attenuated even in Fg-deficient mice, implying that the B-repeats may have a second function, in addition to Fg-binding. These data demonstrate that two distinct M5 regions, including the HVR, are essential to virulence during the early stages of an infection. In particular, our data provide the first in vivo evidence that the HVR of an M protein plays a major role in virulence, focusing interest on the molecular role of this region.
Genome-wide analysis of regions similar to promoters of histone genes
Chowdhary, Rajesh
2010-05-28
Background: The purpose of this study is to: i) develop a computational model of promoters of human histone-encoding genes (shortly histone genes), an important class of genes that participate in various critical cellular processes, ii) use the model so developed to identify regions across the human genome that have similar structure as promoters of histone genes; such regions could represent potential genomic regulatory regions, e.g. promoters, of genes that may be coregulated with histone genes, and iii/ identify in this way genes that have high likelihood of being coregulated with the histone genes.Results: We successfully developed a histone promoter model using a comprehensive collection of histone genes. Based on leave-one-out cross-validation test, the model produced good prediction accuracy (94.1% sensitivity, 92.6% specificity, and 92.8% positive predictive value). We used this model to predict across the genome a number of genes that shared similar promoter structures with the histone gene promoters. We thus hypothesize that these predicted genes could be coregulated with histone genes. This hypothesis matches well with the available gene expression, gene ontology, and pathways data. Jointly with promoters of the above-mentioned genes, we found a large number of intergenic regions with similar structure as histone promoters.Conclusions: This study represents one of the most comprehensive computational analyses conducted thus far on a genome-wide scale of promoters of human histone genes. Our analysis suggests a number of other human genes that share a high similarity of promoter structure with the histone genes and thus are highly likely to be coregulated, and consequently coexpressed, with the histone genes. We also found that there are a large number of intergenic regions across the genome with their structures similar to promoters of histone genes. These regions may be promoters of yet unidentified genes, or may represent remote control regions that
How to promote the regional cooperation in Asia
Energy Technology Data Exchange (ETDEWEB)
Nakano, Masayuki [International Affairs and Safeguards Division, Atomic Energy Bureau, Science and Technology Agency, Tokyo (Japan)
2000-12-01
The Tenth International Conference for Nuclear Cooperation in Asia was held in Tokyo on March 10, 1999. Representatives participated from Australia, China, Indonesia, Japan, Korea, Malaysia, the Philippines, Thailand, and Vietnam as well as IAEA as an observer. The countries reflected on the positive achievements of the past ten years and affirmed the major goals for the future, the major theme of the meeting being the evolution of the framework. Some typical cooperative activities have result in: (a) new varieties of plants with greater productivity under a range of environmental conditions (b) development and adoptions of improved analytical procedures to track air pollution in major cities where the identification of the major sources will facilitate remediation measures (c) coordinated trials for radiation therapy of cervical cancer and the development of rigorous protocols (d) training of staff in research reactor operation and in the use of research reactors for the study of new materials. The participating countries have committed to reviewing the six existing sub-categories, namely (1) utilization of research reactors, (2,3) application of radiation and radioisotope in the agriculture and the medical fields, (4) public acceptance of nuclear energy, (5) radioactive waste management, and (6) nuclear safety culture. To share knowledge on human resources development within the region and to consider measures for the further development of human resources in relevant fields, a seminar for human resources development, sponsored by Japan, will be held in Japan. The conference will be renamed as (Forum for Nuclear Cooperation in Asia) beginning with the next conference. The Forum for Nuclear Cooperation in Asia will be held in Japan and in a participating country other than Japan in alternating years. To enhance the regional nuclear cooperation activities under this framework, each participating country will register a Coordinator and Project Leaders to facilitate
How to promote the regional cooperation in Asia
International Nuclear Information System (INIS)
Nakano, Masayuki
2000-01-01
The Tenth International Conference for Nuclear Cooperation in Asia was held in Tokyo on March 10, 1999. Representatives participated from Australia, China, Indonesia, Japan, Korea, Malaysia, the Philippines, Thailand, and Vietnam as well as IAEA as an observer. The countries reflected on the positive achievements of the past ten years and affirmed the major goals for the future, the major theme of the meeting being the evolution of the framework. Some typical cooperative activities have result in: (a) new varieties of plants with greater productivity under a range of environmental conditions (b) development and adoptions of improved analytical procedures to track air pollution in major cities where the identification of the major sources will facilitate remediation measures (c) coordinated trials for radiation therapy of cervical cancer and the development of rigorous protocols (d) training of staff in research reactor operation and in the use of research reactors for the study of new materials. The participating countries have committed to reviewing the six existing sub-categories, namely (1) utilization of research reactors, (2,3) application of radiation and radioisotope in the agriculture and the medical fields, (4) public acceptance of nuclear energy, (5) radioactive waste management, and (6) nuclear safety culture. To share knowledge on human resources development within the region and to consider measures for the further development of human resources in relevant fields, a seminar for human resources development, sponsored by Japan, will be held in Japan. The conference will be renamed as (Forum for Nuclear Cooperation in Asia) beginning with the next conference. The Forum for Nuclear Cooperation in Asia will be held in Japan and in a participating country other than Japan in alternating years. To enhance the regional nuclear cooperation activities under this framework, each participating country will register a Coordinator and Project Leaders to facilitate
Regional differences in gender promotion and scholarly productivity in otolaryngology.
Eloy, Jean Anderson; Mady, Leila J; Svider, Peter F; Mauro, Kevin M; Kalyoussef, Evelyne; Setzen, Michael; Baredes, Soly; Chandrasekhar, Sujana S
2014-03-01
To identify whether regional differences exist in gender disparities in scholarly productivity and faculty rank among academic otolaryngologists. Academic otolaryngologists' bibliometric data analyses. Online faculty listings from 98 otolaryngology departments were organized by gender, academic rank, fellowship training status, and institutional location. The Scopus database was used to assess bibliometrics of these otolaryngologists, including the h-index, number of publications, and publication experience. Analysis included 1127 otolaryngologists, 916 men (81.3%) and 211 women (18.7%). Female faculty comprised 15.4% in the Midwest, 18.8% in the Northeast, 21.3% in the South, and 19.0% in the West (P = .44). Overall, men obtained significantly higher senior academic ranks (associate professor or professor) compared to women (59.8% vs. 40.2%, P .05). Gender disparities in academic rank and scholarly productivity exist most notably in the Northeast, where women in otolaryngology are most underrepresented relative to men at senior academic ranks and in scholarly productivity.
Soy protein isolate inhibits hepatic tumor promotion in mice fed a high-fat liquid diet.
Mercer, Kelly E; Pulliam, Casey F; Pedersen, Kim B; Hennings, Leah; Ronis, Martin Jj
2017-03-01
Alcoholic and nonalcoholic fatty liver diseases are risk factors for development of hepatocellular carcinoma, but the underlying mechanisms are poorly understood. On the other hand, ingestion of soy-containing diets may oppose the development of certain cancers. We previously reported that replacing casein with a soy protein isolate reduced tumor promotion in the livers of mice with alcoholic liver disease after feeding a high fat ethanol liquid diet following initiation with diethylnitrosamine. Feeding soy protein isolate inhibited processes that may contribute to tumor promotion including inflammation, sphingolipid signaling, and Wnt/β-catenin signaling. We have extended these studies to characterize liver tumor promotion in a model of nonalcoholic fatty liver disease produced by chronic feeding of high-fat liquid diets in the absence of ethanol. Mice treated with diethylnitrosamine on postnatal day 14 were fed a high-fat liquid diet made with casein or SPI as the sole protein source for 16 weeks in adulthood. Relative to mice fed normal chow, a high fat/casein diet led to increased tumor promotion, hepatocyte proliferation, steatosis, and inflammation. Replacing casein with soy protein isolate counteracted these effects. The high fat diets also resulted in a general increase in transcripts for Wnt/β-catenin pathway components, which may be an important mechanism, whereby hepatic tumorigenesis is promoted. However, soy protein isolate did not block Wnt signaling in this nonalcoholic fatty liver disease model. We conclude that replacing casein with soy protein isolate blocks development of steatosis, inflammation, and tumor promotion in diethylnitrosamine-treated mice fed high fat diets. Impact statement The impact of dietary components on cancer is a topic of great interest for both the general public and the scientific community. Liver cancer is currently the second leading form of cancer deaths worldwide. Our study has addressed the effect of the protein
Kaatz, Glenn W.; Thyagarajan, Rama V.; Seo, Susan M.
2005-01-01
NorA is a Staphylococcus aureus multidrug transporter that confers resistance to structurally distinct compounds. The MgrA global regulatory protein is reported to augment norA expression when mgrA is overexpressed from an undefined plasmid-based promoter. Further details about norA regulatory mechanisms are scant. A chromosomal norA::lacZ transcriptional fusion was constructed in different S. aureus strains, and allele replacement was used to define the relevance of promoter region sequences...
Ndika, Joseph D T; Lusink, Vera; Beaubrun, Claudine; Kanhai, Warsha; Martinez-Munoz, Cristina; Jakobs, Cornelis; Salomons, Gajja S
2014-01-10
Interconversion between phosphocreatine and creatine, catalyzed by creatine kinase is crucial in the supply of ATP to tissues with high energy demand. Creatine's importance has been established by its use as an ergogenic aid in sport, as well as the development of intellectual disability in patients with congenital creatine deficiency. Creatine biosynthesis is complemented by dietary creatine uptake. Intracellular transport of creatine is carried out by a creatine transporter protein (CT1/CRT/CRTR) encoded by the SLC6A8 gene. Most tissues express this gene, with highest levels detected in skeletal muscle and kidney. There are lower levels of the gene detected in colon, brain, heart, testis and prostate. The mechanism(s) by which this regulation occurs is still poorly understood. A duplicated unprocessed pseudogene of SLC6A8-SLC6A10P has been mapped to chromosome 16p11.2 (contains the entire SLC6A8 gene, plus 2293 bp of 5'flanking sequence and its entire 3'UTR). Expression of SLC6A10P has so far only been shown in human testis and brain. It is still unclear as to what is the function of SLC6A10P. In a patient with autism, a chromosomal breakpoint that intersects the 5'flanking region of SLC6A10P was identified; suggesting that SLC6A10P is a non-coding RNA involved in autism. Our aim was to investigate the presence of cis-acting factor(s) that regulate expression of the creatine transporter, as well as to determine if these factors are functionally conserved upstream of the creatine transporter pseudogene. Via gene-specific PCR, cloning and functional luciferase assays we identified a 1104 bp sequence proximal to the mRNA start site of the SLC6A8 gene with promoter activity in five cell types. The corresponding 5'flanking sequence (1050 bp) on the pseudogene also had promoter activity in all 5 cell lines. Surprisingly the pseudogene promoter was stronger than that of its parent gene in 4 of the cell lines tested. To the best of our knowledge, this is the first
Analysis of tissue-specific region in sericin 1 gene promoter of Bombyx mori
Energy Technology Data Exchange (ETDEWEB)
Yan, Liu [College of Biomedical Engineering and Instrument Science, Zhejiang University, Hangzhou 310027 (China); Institute of Biochemistry and Cell Biology, Shanghai Institutes for Biological Sciences, Chinese Academy of Sciences, Shanghai 200031 (China); Lian, Yu [College of Biomedical Engineering and Instrument Science, Zhejiang University, Hangzhou 310027 (China); Zhejiang Province Key Laboratory of Preventive Veterinary Medicine, Institute of Preventive Veterinary Medicine, Zhejiang University, Hangzhou 310029 (China); Xiuyang, Guo [Institute of Biochemistry and Cell Biology, Shanghai Institutes for Biological Sciences, Chinese Academy of Sciences, Shanghai 200031 (China); Tingqing, Guo [Institute of Biochemistry and Cell Biology, Shanghai Institutes for Biological Sciences, Chinese Academy of Sciences, Shanghai 200031 (China); Shengpeng, Wang [Institute of Biochemistry and Cell Biology, Shanghai Institutes for Biological Sciences, Chinese Academy of Sciences, Shanghai 200031 (China); Changde, Lu [Institute of Biochemistry and Cell Biology, Shanghai Institutes for Biological Sciences, Chinese Academy of Sciences, Shanghai 200031 (China)
2006-03-31
The gene encoding sericin 1 (Ser1) of silkworm (Bombyx mori) is specifically expressed in the middle silk gland cells. To identify element involved in this transcription-dependent spatial restriction, truncation of the 5' terminal from the sericin 1 (Ser1) promoter is studied in vivo. A 209 bp DNA sequence upstream of the transcriptional start site (-586 to -378) is found to be responsible for promoting tissue-specific transcription. Analysis of this 209 bp region by overlapping deletion studies showed that a 25 bp region (-500 to -476) suppresses the ectopic expression of the Ser1 promoter. An unknown factor abundant in fat body nuclear extracts is shown to bind to this 25 bp fragment. These results suggest that this 25 bp region and the unknown factor are necessary for determining the tissue-specificity of the Ser1 promoter.
Mutational analysis of the promoter and the coding region of the 5-HT1A gene
Energy Technology Data Exchange (ETDEWEB)
Erdmann, J.; Noethen, M.M.; Shimron-Abarbanell, D. [Univ. of Bonn (Germany)] [and others
1994-09-01
Disturbances of serotonergic pathways have been implicated in many neuropsychiatric disorders. Serotonin (5HT) receptors can be subdivided into at least three major families (5HT1, 5HT2, and 5HT3). Five human 5HT1 receptor subtypes have been cloned, namely 1A, 1D{alpha}, 1D{beta}, 1E, and 1F. Of these, the 5HT1A receptor is the best characterized subtype. In the present study we sought to identify genetic variation in the 5HT1A receptor gene which through alteration of protein function or level of expression might contribute to the genetics of neuropsychiatric diseases. The coding region and the 5{prime} promoter region of the 5HT1A gene from 159 unrelated subjects (45 schizophrenic, 46 bipolar affective, and 43 patients with Tourette`s syndrome, as well as 25 controls) were analyzed using SSCA. SSCA revealed the presence of two mutations both located in the coding region of the 5HT1A receptor gene. The first mutation is a rare silent C{r_arrow}T substitution at nucleotide position 549. The second mutation is characterized by a base pair substitution (A{r_arrow}G) at the first position of codon 28 and results in an amino acid exchange (Ile{r_arrow}Val). Since Val28 was found only in a single schizophrenic patient and in none of the other patients or controls, we decided to extend our samples and to use a restriction assay for screening a further 74 schizophrenic, 95 bipolar affective, and 49 patients with Tourette`s syndrome, as well as 185 controls, for the presence of the mutation. In total, the mutation was found in 2 schizophrenic patients, in 3 bipolars, in 1 Tourette patient, and in 5 controls. To our knowledge the Ile-28-Val substitution reported here is the first natural occuring molecular variant which has been identified for a serotonin receptor so far.
Promoter analysis of the Chilo iridescent virus DNA polymerase and major capsid protein genes
Nalcacioglu, R.; Marks, H.; Vlak, J.M.; Demirbag, Z.; Oers, van M.M.
2003-01-01
The DNA polymerase (DNApol) and major capsid protein (MCP) genes were used as models to study promoter activity in Chilo iridescent virus (CIV). Infection of Bombyx mori SPC-BM-36 cells in the presence of inhibitors of DNA or protein synthesis showed that DNApol, as well as helicase, is an
Epigenetic transgenerational actions of vinclozolin on promoter regions of the sperm epigenome.
Directory of Open Access Journals (Sweden)
Carlos Guerrero-Bosagna
2010-09-01
Full Text Available Previous observations have demonstrated that embryonic exposure to the endocrine disruptor vinclozolin during gonadal sex determination promotes transgenerational adult onset disease such as male infertility, kidney disease, prostate disease, immune abnormalities and tumor development. The current study investigates genome-wide promoter DNA methylation alterations in the sperm of F3 generation rats whose F0 generation mother was exposed to vinclozolin. A methylated DNA immunoprecipitation with methyl-cytosine antibody followed by a promoter tilling microarray (MeDIP-Chip procedure was used to identify 52 different regions with statistically significant altered methylation in the sperm promoter epigenome. Mass spectrometry bisulfite analysis was used to map the CpG DNA methylation and 16 differential DNA methylation regions were confirmed, while the remainder could not be analyzed due to bisulfite technical limitations. Analysis of these validated regions identified a consensus DNA sequence (motif that associated with 75% of the promoters. Interestingly, only 16.8% of a random set of 125 promoters contained this motif. One candidate promoter (Fam111a was found to be due to a copy number variation (CNV and not a methylation change, suggesting initial alterations in the germline epigenome may promote genetic abnormalities such as induced CNV in later generations. This study identifies differential DNA methylation sites in promoter regions three generations after the initial exposure and identifies common genome features present in these regions. In addition to primary epimutations, a potential indirect genetic abnormality was identified, and both are postulated to be involved in the epigenetic transgenerational inheritance observed. This study confirms that an environmental agent has the ability to induce epigenetic transgenerational changes in the sperm epigenome.
Epigenetic transgenerational actions of vinclozolin on promoter regions of the sperm epigenome.
Guerrero-Bosagna, Carlos; Settles, Matthew; Lucker, Ben; Skinner, Michael K
2010-09-30
Previous observations have demonstrated that embryonic exposure to the endocrine disruptor vinclozolin during gonadal sex determination promotes transgenerational adult onset disease such as male infertility, kidney disease, prostate disease, immune abnormalities and tumor development. The current study investigates genome-wide promoter DNA methylation alterations in the sperm of F3 generation rats whose F0 generation mother was exposed to vinclozolin. A methylated DNA immunoprecipitation with methyl-cytosine antibody followed by a promoter tilling microarray (MeDIP-Chip) procedure was used to identify 52 different regions with statistically significant altered methylation in the sperm promoter epigenome. Mass spectrometry bisulfite analysis was used to map the CpG DNA methylation and 16 differential DNA methylation regions were confirmed, while the remainder could not be analyzed due to bisulfite technical limitations. Analysis of these validated regions identified a consensus DNA sequence (motif) that associated with 75% of the promoters. Interestingly, only 16.8% of a random set of 125 promoters contained this motif. One candidate promoter (Fam111a) was found to be due to a copy number variation (CNV) and not a methylation change, suggesting initial alterations in the germline epigenome may promote genetic abnormalities such as induced CNV in later generations. This study identifies differential DNA methylation sites in promoter regions three generations after the initial exposure and identifies common genome features present in these regions. In addition to primary epimutations, a potential indirect genetic abnormality was identified, and both are postulated to be involved in the epigenetic transgenerational inheritance observed. This study confirms that an environmental agent has the ability to induce epigenetic transgenerational changes in the sperm epigenome.
Directory of Open Access Journals (Sweden)
Zhichun Zhang
Full Text Available Mutation of distal-less homeobox 3 (DLX3 is responsible for human tricho-dento-osseous syndrome (TDO with amelogenesis imperfecta, indicating a crucial role of DLX3 in amelogenesis. However, the expression pattern of DLX3 and its specific function in amelogenesis remain largely unknown. The aim of this study was to investigate the effects of DLX3 on enamel matrix protein (EMP genes. By immunohistochemistry assays of mouse tooth germs, stronger immunostaining of DLX3 protein was identified in ameloblasts in the secretory stage than in the pre-secretory and maturation stages, and the same pattern was found for Dlx3 mRNA using Realtime PCR. In a mouse ameloblast cell lineage, forced expression of DLX3 up-regulated the expression of the EMP genes Amelx, Enam, Klk4, and Odam, whereas knockdown of DLX3 down-regulated these four EMP genes. Further, bioinformatics, chromatin immunoprecipitation, and luciferase assays revealed that DLX3 transactivated Enam, Amelx, and Odam through direct binding to their enhancer regions. Particularly, over-expression of mutant-DLX3 (c.571_574delGGGG, responsible for TDO inhibited the activation function of DLX3 on expression levels and promoter activities of the Enam, Amelx, and Odam genes. Together, our data show that DLX3 promotes the expression of the EMP genes Amelx, Enam, Klk4, and Odam in amelogenesis, while mutant-DLX3 disrupts this regulatory function, thus providing insights into the molecular mechanisms underlying the enamel defects of TDO disease.
Identification of functional DNA variants in the constitutive promoter region of MDM2
Directory of Open Access Journals (Sweden)
Lalonde Marie-Eve
2012-09-01
Full Text Available Abstract Although mutations in the oncoprotein murine double minute 2 (MDM2 are rare, MDM2 gene overexpression has been observed in several human tumors. Given that even modest changes in MDM2 levels might influence the p53 tumor suppressor signaling pathway, we postulated that sequence variation in the promoter region of MDM2 could lead to disregulated expression and variation in gene dosage. Two promoters have been reported for MDM2; an internal promoter (P2, which is located near the end of intron 1 and is p53-responsive, and an upstream constitutive promoter (P1, which is p53-independent. Both promoter regions contain DNA variants that could influence the expression levels of MDM2, including the well-studied single nucleotide polymorphism (SNP SNP309, which is located in the promoter P2; i.e., upstream of exon 2. In this report, we screened the promoter P1 for DNA variants and assessed the functional impact of the corresponding SNPs. Using the dbSNP database and genotyping validation in individuals of European descent, we identified three common SNPs (−1494 G > A; indel 40 bp; and −182 C > G. Three major promoter haplotypes were inferred by using these three promoter SNPs together with rs2279744 (SNP309. Following subcloning into a gene reporter system, we found that two of the haplotypes significantly influenced MDM2 promoter activity in a haplotype-specific manner. Site-directed mutagenesis experiments indicated that the 40 bp insertion/deletion variation is causing the observed allelic promoter activity. This study suggests that part of the variability in the MDM2 expression levels could be explained by allelic p53-independent P1 promoter activity.
Directory of Open Access Journals (Sweden)
Xiu-Yun Li
2018-05-01
Full Text Available As a major family of plant-specific transcription factors, SQUAMOSA PROMOTER BINDING PROTEIN-LIKE (SPL genes play vital regulatory roles in plant growth, development and stress responses. In this study, 18 SPL genes were identified and cloned from Betula luminifera. Two zinc finger-like structures and a nuclear location signal (NLS segments were existed in the SBP domains of all BlSPLs. Phylogenetic analysis showed that these genes were clustered into nine groups (group I-IX. The intron/exon structure and motif composition were highly conserved within the same group. 12 of the 18 BlSPLs were experimentally verified as the targets of miR156, and two cleavage sites were detected in these miR156-targeted BlSPL genes. Many putative cis-elements, associated with light, stresses and phytohormones response, were identified in the promoter regions of BlSPLs, suggesting that BlSPL genes are probably involved in important physiological processes and developmental events. Tissue-specific expression analysis showed that miR156-targeted BlSPLs exhibited a more differential expression pattern, while most miR156-nontargeted BlSPLs tended to be constitutively expressed, suggesting the distinct roles of miR156-targeted and nontargeted BlSPLs in development and growth of B. luminifera. Further expression analysis revealed that miR156-targeted BlSPLs were dramatically up-regulated with age, whereas mature BlmiR156 level was apparently declined with age, indicating that miR156/SPL module plays important roles in vegetative phase change of B. luminifera. Moreover, yeast two-hybrid assay indicated that several miR156-targeted and nontargeted BlSPLs could interact with two DELLA proteins (BlRGA and BlRGL, which suggests that certain BlSPLs take part in the GA regulated processes through protein interaction with DELLA proteins. All these results provide an important basis for further exploring the biological functions of BlSPLs in B. luminifera.
Cytosine deletion at AP2-box region of HSP70 promoter and its ...
Indian Academy of Sciences (India)
of thermotolerance in cells (Leung et al. 1996). ... region of HSP70 significantly affected cellular thermotol- erance ... The double PCR-RFLP using ScrFI confirmed the occur- ... suade of HSP70 on defense of proteins related to respiration.
Nuclear pore protein NUP88 activates anaphase-promoting complex to promote aneuploidy
Naylor, R.M.; Jeganathan, K.B.; Cao, X.; Deursen, J.M. van
2016-01-01
The nuclear pore complex protein NUP88 is frequently elevated in aggressive human cancers and correlates with reduced patient survival; however, it is unclear whether and how NUP88 overexpression drives tumorigenesis. Here, we show that mice overexpressing NUP88 are cancer prone and form intestinal
Regional distribution of serotonin transporter protein in postmortem human brain
Energy Technology Data Exchange (ETDEWEB)
Kish, Stephen J. [Human Neurochemical Pathology Laboratory, Centre for Addiction and Mental Health, Toronto, ON, M5T 1R8 (Canada)]. E-mail: Stephen_Kish@CAMH.net; Furukawa, Yoshiaki [Human Neurochemical Pathology Laboratory, Centre for Addiction and Mental Health, Toronto, ON, M5T 1R8 (Canada); Chang Lijan [Human Neurochemical Pathology Laboratory, Centre for Addiction and Mental Health, Toronto, ON, M5T 1R8 (Canada); Tong Junchao [Human Neurochemical Pathology Laboratory, Centre for Addiction and Mental Health, Toronto, ON, M5T 1R8 (Canada); Ginovart, Nathalie [PET Centre, Centre for Addiction and Mental Health, Toronto, ON, M5T 1R8 (Canada); Wilson, Alan [PET Centre, Centre for Addiction and Mental Health, Toronto, ON, M5T 1R8 (Canada); Houle, Sylvain [PET Centre, Centre for Addiction and Mental Health, Toronto, ON, M5T 1R8 (Canada); Meyer, Jeffrey H. [PET Centre, Centre for Addiction and Mental Health, Toronto, ON, M5T 1R8 (Canada)
2005-02-01
Introduction: The primary approach in assessing the status of brain serotonin neurons in human conditions such as major depression and exposure to the illicit drug ecstasy has been the use of neuroimaging procedures involving radiotracers that bind to the serotonin transporter (SERT). However, there has been no consistency in the selection of a 'SERT-free' reference region for the estimation of free and nonspecific binding, as occipital cortex, cerebellum and white matter have all been employed. Objective and Methods: To identify areas of human brain that might have very low SERT levels, we measured, by a semiquantitative Western blotting procedure, SERT protein immunoreactivity throughout the postmortem brain of seven normal adult subjects. Results: Serotonin transporter could be quantitated in all examined brain areas. However, the SERT concentration in cerebellar cortex and white matter were only at trace values, being approximately 20% of average cerebral cortex and 5% of average striatum values. Conclusion: Although none of the examined brain areas are completely free of SERT, human cerebellar cortex has low SERT binding as compared to other examined brain regions, with the exception of white matter. Since the cerebellar cortical SERT binding is not zero, this region will not be a suitable reference region for SERT radioligands with very low free and nonspecific binding. For SERT radioligands with reasonably high free and nonspecific binding, the cerebellar cortex should be a useful reference region, provided other necessary radioligand assumptions are met.
Regional distribution of serotonin transporter protein in postmortem human brain
International Nuclear Information System (INIS)
Kish, Stephen J.; Furukawa, Yoshiaki; Chang Lijan; Tong Junchao; Ginovart, Nathalie; Wilson, Alan; Houle, Sylvain; Meyer, Jeffrey H.
2005-01-01
Introduction: The primary approach in assessing the status of brain serotonin neurons in human conditions such as major depression and exposure to the illicit drug ecstasy has been the use of neuroimaging procedures involving radiotracers that bind to the serotonin transporter (SERT). However, there has been no consistency in the selection of a 'SERT-free' reference region for the estimation of free and nonspecific binding, as occipital cortex, cerebellum and white matter have all been employed. Objective and Methods: To identify areas of human brain that might have very low SERT levels, we measured, by a semiquantitative Western blotting procedure, SERT protein immunoreactivity throughout the postmortem brain of seven normal adult subjects. Results: Serotonin transporter could be quantitated in all examined brain areas. However, the SERT concentration in cerebellar cortex and white matter were only at trace values, being approximately 20% of average cerebral cortex and 5% of average striatum values. Conclusion: Although none of the examined brain areas are completely free of SERT, human cerebellar cortex has low SERT binding as compared to other examined brain regions, with the exception of white matter. Since the cerebellar cortical SERT binding is not zero, this region will not be a suitable reference region for SERT radioligands with very low free and nonspecific binding. For SERT radioligands with reasonably high free and nonspecific binding, the cerebellar cortex should be a useful reference region, provided other necessary radioligand assumptions are met
Xu, Meixiang; Nekhayeva, Ilona; Cross, Courtney E; Rondelli, Catherine M; Wickliffe, Jeffrey K; Abdel-Rahman, Sherif Z
2014-03-01
The O6-methylguanine-DNA methyltransferase gene (MGMT) encodes the direct reversal DNA repair protein that removes alkyl adducts from the O6 position of guanine. Several single-nucleotide polymorphisms (SNPs) exist in the MGMT promoter/enhancer (P/E) region. However, the haplotype structure encompassing these SNPs and their functional/biological significance are currently unknown. We hypothesized that MGMT P/E haplotypes, rather than individual SNPs, alter MGMT transcription and can thus alter human sensitivity to alkylating agents. To identify the haplotype structure encompassing the MGMT P/E region SNPs, we sequenced 104 DNA samples from healthy individuals and inferred the haplotypes using the data generated. We identified eight SNPs in this region, namely T7C (rs180989103), T135G (rs1711646), G290A (rs61859810), C485A (rs1625649), C575A (rs113813075), G666A (rs34180180), C777A (rs34138162) and C1099T (rs16906252). Phylogenetics and Sequence Evolution analysis predicted 21 potential haplotypes that encompass these SNPs ranging in frequencies from 0.000048 to 0.39. Of these, 10 were identified in our study population as 20 paired haplotype combinations. To determine the functional significance of these haplotypes, luciferase reporter constructs representing these haplotypes were transfected into glioblastoma cells and their effect on MGMT promoter activity was determined. Compared with the most common (reference) haplotype 1, seven haplotypes significantly upregulated MGMT promoter activity (18-119% increase; P alkylating agents.
Directory of Open Access Journals (Sweden)
Matsutani Sachiko
2004-08-01
Full Text Available Abstract Background In eukaryotes, RNA polymerase III (RNAP III transcribes the genes for small RNAs like tRNAs, 5S rRNA, and several viral RNAs, and short interspersed repetitive elements (SINEs. The genes for these RNAs and SINEs have internal promoters that consist of two regions. These two regions are called the A and B blocks. The multisubunit transcription factor TFIIIC is required for transcription initiation of RNAP III; in transcription of tRNAs, the B-block binding subunit of TFIIIC recognizes a promoter. Although internal promoter sequences are conserved in eukaryotes, no evidence of homology between the B-block binding subunits of vertebrates and yeasts has been reported previously. Results Here, I reported the results of PSI-BLAST searches using the B-block binding subunits of human and Shizosacchromyces pombe as queries, showing that the same Arabidopsis proteins were hit with low E-values in both searches. Comparison of the convergent iterative alignments obtained by these PSI-BLAST searches revealed that the vertebrate, yeast, and Arabidopsis proteins have similarities in their N-terminal one-third regions. In these regions, there were three domains with conserved sequence similarities, one located in the N-terminal end region. The N-terminal end region of the B-block binding subunit of Saccharomyces cerevisiae is tentatively identified as a HMG box, which is the DNA binding motif. Although I compared the alignment of the N-terminal end regions of the B-block binding subunits, and their homologs, with that of the HMG boxes, it is not clear whether they are related. Conclusion Molecular phylogenetic analyses using the small subunit rRNA and ubiquitous proteins like actin and α-tubulin, show that fungi are more closely related to animals than either is to plants. Interestingly, the results obtained in this study show that, with respect to the B-block binding subunits of TFIIICs, animals appear to be evolutionarily closer to plants
Matsutani, Sachiko
2004-08-09
In eukaryotes, RNA polymerase III (RNAP III) transcribes the genes for small RNAs like tRNAs, 5S rRNA, and several viral RNAs, and short interspersed repetitive elements (SINEs). The genes for these RNAs and SINEs have internal promoters that consist of two regions. These two regions are called the A and B blocks. The multisubunit transcription factor TFIIIC is required for transcription initiation of RNAP III; in transcription of tRNAs, the B-block binding subunit of TFIIIC recognizes a promoter. Although internal promoter sequences are conserved in eukaryotes, no evidence of homology between the B-block binding subunits of vertebrates and yeasts has been reported previously. Here, I reported the results of PSI-BLAST searches using the B-block binding subunits of human and Shizosacchromyces pombe as queries, showing that the same Arabidopsis proteins were hit with low E-values in both searches. Comparison of the convergent iterative alignments obtained by these PSI-BLAST searches revealed that the vertebrate, yeast, and Arabidopsis proteins have similarities in their N-terminal one-third regions. In these regions, there were three domains with conserved sequence similarities, one located in the N-terminal end region. The N-terminal end region of the B-block binding subunit of Saccharomyces cerevisiae is tentatively identified as a HMG box, which is the DNA binding motif. Although I compared the alignment of the N-terminal end regions of the B-block binding subunits, and their homologs, with that of the HMG boxes, it is not clear whether they are related. Molecular phylogenetic analyses using the small subunit rRNA and ubiquitous proteins like actin and alpha-tubulin, show that fungi are more closely related to animals than either is to plants. Interestingly, the results obtained in this study show that, with respect to the B-block binding subunits of TFIIICs, animals appear to be evolutionarily closer to plants than to fungi.
Newton, K; Jorgensen, NM; Wallace, AJ; Buchanan, DD; Lalloo, F; McMahon, RFT; Hill, J; Evans, DG
2016-01-01
Background & Aims Lynch syndrome patients have DNA mismatch repair deficiency and up to 80% life-time risk of colorectal cancer. Screening of mutation carriers reduces colorectal cancer incidence and mortality. Selection for constitutional mutation testing relies on family history (Amsterdam and Bethesda Guidelines) and tumour derived biomarkers. Initial biomarker analysis uses mismatch repair protein immunohistochemistry and microsatellite instability. Abnormalities in either identify mismatch repair deficiency but do not differentiate sporadic epigenetic defects, due to MLH1 promoter region methylation (13% of CRCs) from Lynch Syndrome (4% of CRCs). A diagnostic biomarker capable of making this distinction would be valuable. This study compared two biomarkers in tumours with mismatch repair deficiency; quantification of methylation of the MLH1 promoter region using a novel assay and BRAF c.1799T>A, p.(Val600Glu) mutation status in the identification of constitutional mutations. Methods Tumour DNA was extracted (FFPE tissue) and pyrosequencing used to test for MLH1 promoter methylation and presence of the BRAF c.1799T>A, p.(Val600Glu) mutation 71 CRCs from individuals with pathogenic MLH1 mutations and 73 CRCs with sporadic MLH1 loss. Specificity and sensitivity was compared. Findings Unmethylated MLH1 promoter: sensitivity 94.4% (95% CI 86.2–98.4%), specificity 87.7% (95% CI 77.9–94.2%), Wild-type BRAF (codon 600): sensitivity 65.8% (95% CI 53.7–76.5%), specificity 98.6% (95% CI 92.4–100.0%) for the identification of those with pathogenic MLH1 mutations. Conclusions Quantitative MLH1 promoter region methylation using pyrosequencing is superior to BRAF codon 600 mutation status in identifying constitutional mutations in mismatch repair deficient tumours. PMID:25280751
Protein-protein docking using region-based 3D Zernike descriptors.
Venkatraman, Vishwesh; Yang, Yifeng D; Sael, Lee; Kihara, Daisuke
2009-12-09
Protein-protein interactions are a pivotal component of many biological processes and mediate a variety of functions. Knowing the tertiary structure of a protein complex is therefore essential for understanding the interaction mechanism. However, experimental techniques to solve the structure of the complex are often found to be difficult. To this end, computational protein-protein docking approaches can provide a useful alternative to address this issue. Prediction of docking conformations relies on methods that effectively capture shape features of the participating proteins while giving due consideration to conformational changes that may occur. We present a novel protein docking algorithm based on the use of 3D Zernike descriptors as regional features of molecular shape. The key motivation of using these descriptors is their invariance to transformation, in addition to a compact representation of local surface shape characteristics. Docking decoys are generated using geometric hashing, which are then ranked by a scoring function that incorporates a buried surface area and a novel geometric complementarity term based on normals associated with the 3D Zernike shape description. Our docking algorithm was tested on both bound and unbound cases in the ZDOCK benchmark 2.0 dataset. In 74% of the bound docking predictions, our method was able to find a near-native solution (interface C-alphaRMSD 3D Zernike descriptors are adept in capturing shape complementarity at the protein-protein interface and useful for protein docking prediction. Rigorous benchmark studies show that our docking approach has a superior performance compared to existing methods.
Directory of Open Access Journals (Sweden)
Emily A. Byrd
2017-11-01
Full Text Available Alphaviruses are members of a group of small enveloped RNA viruses that includes important human pathogens such as Chikungunya virus and the equine encephalitis viruses. The virus membrane is covered by a lattice composed of 80 spikes, each a trimer of heterodimers of the E2 and E1 transmembrane proteins. During virus endocytic entry, the E1 glycoprotein mediates the low-pH-dependent fusion of the virus membrane with the endosome membrane, thus initiating virus infection. While much is known about E1 structural rearrangements during membrane fusion, it is unclear how the E1/E2 dimer dissociates, a step required for the fusion reaction. A recent Alphavirus cryo-electron microscopy reconstruction revealed a previously unidentified D subdomain in the E2 ectodomain, close to the virus membrane. A loop within this region, here referred to as the D-loop, contains two highly conserved histidines, H348 and H352, which were hypothesized to play a role in dimer dissociation. We generated Semliki Forest virus mutants containing the single and double alanine substitutions H348A, H352A, and H348/352A. The three D-loop mutations caused a reduction in virus growth ranging from 1.6 to 2 log but did not significantly affect structural protein biosynthesis or transport, dimer stability, virus fusion, or specific infectivity. Instead, growth reduction was due to inhibition of a late stage of virus assembly at the plasma membrane. The virus particles that are produced show reduced thermostability compared to the wild type. We propose the E2 D-loop as a key region in establishing the E1-E2 contacts that drive glycoprotein lattice formation and promote Alphavirus budding from the plasma membrane.
Growing Significance of EU Institutions in Promotion of Inter-regional policies
Directory of Open Access Journals (Sweden)
Ella V. Ermakova
2014-01-01
Full Text Available The article explores the variety of tools and vehicles applied within the EU to expand the prerogative of the regions of the EU member states. The author uses as an example the inter-regional policies in Belgium in respect of the Flemish Region and the Walloon Region. The author analyzes the mechanisms of promotion of external regional relations in Belgium as a means of addressing different problems both on national and all-European level, supporting the arguments and conclusions by examples of relevant EU initiatives. The article details the activities of the EU Regional Committee (RC, the EU advisory body with the powers of political initiative, upholding the principle ofsubsidarity in the implementation of the EU member states' regional policies. The involvement of the Flemish Region and the Walloon Region in the activities of EU RC is described and summarized. As a case study, the article deals with Belgium's rotating six months presidency in the EUin 2010 when the country, which was going through a severe political crisis with no federal government in place, was represented by the two regions. The special focus of the article is on the strategic EU program "Europe2020" and its implementation by the regions of Belgium. There is an account of the initiatives undertaken by the Flemish Region and the Walloon Region within the framework of this program outlining the interaction of the two regions. The author provides a comprehensive analysis of the involvement of the Flemish Region and the Walloon Region with various EU institutions describing how each party achieves the promotion of its regional interests. Within this context, it is a noteworthy development that the Flemish Region is participating in the international program "Pact 2020" on energy all by its own. The article features quotations by Flemish and Walloon political figures which serve as an illustration of the prevailing attitudes in the Belgian society to the process of
Protein Kinase C-ε Promotes EMT in Breast Cancer
Jain, Kirti; Basu, Alakananda
2014-01-01
Protein kinase C (PKC), a family of serine/threonine kinases, plays critical roles in signal transduction and cell regulation. PKCε, a member of the novel PKC family, is known to be a transforming oncogene and a tumor biomarker for aggressive breast cancers. In this study, we examined the involvement of PKCε in epithelial to mesenchymal transition (EMT), the process that leads the way to metastasis. Overexpression of PKCε was sufficient to induce a mesenchymal phenotype in non-tumorigenic mammary epithelial MCF-10 A cells. This was accompanied by a decrease in the epithelial markers, such as E-cadherin, zonula occludens (ZO)-1, and claudin-1, and an increase in mesenchymal marker vimentin. Transforming growth factor β (TGFβ) induced Snail expression and mesenchymal morphology in MCF-10 A cells, and these effects were partially reversed by the PKCε knockdown. PKCε also mediated cell migration and anoikis resistance, which are hallmarks of EMT. Thus, our study demonstrates that PKCε is an important mediator of EMT in breast cancer. PMID:24701121
Directory of Open Access Journals (Sweden)
Vassilis MONASTIRIOTIS
2010-12-01
Full Text Available Studies on the productivity spillovers of FDI have concentrated on the nationalsectoral level. As a result, little is known about the impact of FDI on absolute and relative regional economic performance. In this paper we examine this issue by relying on a unique dataset of over 20,000 Greek firms for the period 2002-2006 covering all sectors of economic activity. We examine the spatial distribution of foreign-owned firms in the country and analyse the effect that their presence – at the local, regional and national levels – has on the productivity of domestic firms. We find strong evidence suggesting that foreignowned firms self-select into regions and sectors of high productivity. Net of this selection effect, the impact of foreign presence on domestic productivity is negative – although at the very local level some positive spillover effects are identifiable. The bulk of the effects concentrate in non-manufacturing activities, high-tech sectors, and medium-sized high-productivity firms. Importantly, this effect is not constant across space however. Productivity spillovers tend to be negative in the regions hosting the main urban areas in the country but positive in smaller and more peripheral regions. In this way, despite the tendency of FDI to concentrate in a limited number of areas within the country – those of the highest level of development – the externalities that FDI activity generates to the local economies appear to be of a rather equilibrating character.
Directory of Open Access Journals (Sweden)
Nannenga Brent L
2011-12-01
Full Text Available Abstract Background Membrane proteins (MPs populate 20-30% of genomes sequenced to date and hold potential as therapeutic targets as well as for practical applications in bionanotechnology. However, MP toxicity and low yields in normally robust expression hosts such as E. coli has curtailed progress in our understanding of their structure and function. Results Using the seven transmembrane segments H. turkmenica deltarhodopsin (HtdR as a reporter, we isolated a spontaneous mutant in the arabinose-inducible PBAD promoter leading to improved cell growth and a twofold increase in the recovery of active HtdR at 37°C. A single transversion in a conserved region of the cyclic AMP receptor protein binding site caused the phenotype by reducing htdR transcript levels by 65%. When the mutant promoter was used in conjunction with a host lacking the molecular chaperone Trigger Factor (Δtig cells, toxicity was further suppressed and the amount of correctly folded HtdR was 4-fold that present in the membranes of control cells. More importantly, while improved growth barely compensated for the reduction in transcription rates when another polytopic membrane protein (N. pharonis sensory rhodopsin II was expressed under control of the mutant promoter in wild type cells, a 4-fold increase in productivity could be achieved in a Δtig host. Conclusions Our system, which combines a downregulated version of the tightly repressed PBAD promoter with a TF-deficient host may prove a valuable alternative to T7-based expression for the production of membrane proteins that have so far remained elusive targets.
Deng, X; Shao, G; Zhang, H-T; Li, C; Zhang, D; Cheng, L; Elzey, B D; Pili, R; Ratliff, T L; Huang, J; Hu, C-D
2017-03-02
Protein arginine methyltransferase 5 (PRMT5) is an emerging epigenetic enzyme that mainly represses transcription of target genes via symmetric dimethylation of arginine residues on histones H4R3, H3R8 and H2AR3. Accumulating evidence suggests that PRMT5 may function as an oncogene to drive cancer cell growth by epigenetic inactivation of several tumor suppressors. Here, we provide evidence that PRMT5 promotes prostate cancer cell growth by epigenetically activating transcription of the androgen receptor (AR) in prostate cancer cells. Knockdown of PRMT5 or inhibition of PRMT5 by a specific inhibitor reduces the expression of AR and suppresses the growth of multiple AR-positive, but not AR-negative, prostate cancer cells. Significantly, knockdown of PRMT5 in AR-positive LNCaP cells completely suppresses the growth of xenograft tumors in mice. Molecular analysis reveals that PRMT5 binds to the proximal promoter region of the AR gene and contributes mainly to the enriched symmetric dimethylation of H4R3 in the same region. Mechanistically, PRMT5 is recruited to the AR promoter by its interaction with Sp1, the major transcription factor responsible for AR transcription, and forms a complex with Brg1, an ATP-dependent chromatin remodeler, on the proximal promoter region of the AR gene. Furthermore, PRMT5 expression in prostate cancer tissues is significantly higher than that in benign prostatic hyperplasia tissues, and PRMT5 expression correlates positively with AR expression at both the protein and mRNA levels. Taken together, our results identify PRMT5 as a novel epigenetic activator of AR in prostate cancer. Given that inhibiting AR transcriptional activity or androgen synthesis remains the major mechanism of action for most existing anti-androgen agents, our findings also raise an interesting possibility that targeting PRMT5 may represent a novel approach for prostate cancer treatment by eliminating AR expression.
Ignatieva, Elena V; Levitsky, Victor G; Yudin, Nikolay S; Moshkin, Mikhail P; Kolchanov, Nikolay A
2014-01-01
The molecular mechanism of olfactory cognition is very complicated. Olfactory cognition is initiated by olfactory receptor proteins (odorant receptors), which are activated by olfactory stimuli (ligands). Olfactory receptors are the initial player in the signal transduction cascade producing a nerve impulse, which is transmitted to the brain. The sensitivity to a particular ligand depends on the expression level of multiple proteins involved in the process of olfactory cognition: olfactory receptor proteins, proteins that participate in signal transduction cascade, etc. The expression level of each gene is controlled by its regulatory regions, and especially, by the promoter [a region of DNA about 100-1000 base pairs long located upstream of the transcription start site (TSS)]. We analyzed single nucleotide polymorphisms using human whole-genome data from the 1000 Genomes Project and revealed an extremely high level of single nucleotide polymorphisms in promoter regions of olfactory receptor genes and HLA genes. We hypothesized that the high level of polymorphisms in olfactory receptor promoters was responsible for the diversity in regulatory mechanisms controlling the expression levels of olfactory receptor proteins. Such diversity of regulatory mechanisms may cause the great variability of olfactory cognition of numerous environmental olfactory stimuli perceived by human beings (air pollutants, human body odors, odors in culinary etc.). In turn, this variability may provide a wide range of emotional and behavioral reactions related to the vast variety of olfactory stimuli.
Directory of Open Access Journals (Sweden)
Elena V. Ignatieva
2014-03-01
Full Text Available The molecular mechanism of olfactory cognition is very complicated. Olfactory cognition is initiated by olfactory receptor proteins (odorant receptors, which are activated by olfactory stimuli (ligands. Olfactory receptors are the initial player in the signal transduction cascade producing a nerve impulse, which is transmitted to the brain. The sensitivity to a particular ligand depends on the expression level of multiple proteins involved in the process of olfactory cognition: olfactory receptor proteins, proteins that participate in signal transduction cascade, etc. The expression level of each gene is controlled by its regulatory regions, and especially, by the promoter (a region of DNA about 100–1000 base pairs long located upstream of the transcription start site. We analyzed single nucleotide polymorphisms using human whole-genome data from the 1000 Genomes Project and revealed an extremely high level of single nucleotide polymorphisms in promoter regions of olfactory receptor genes and HLA genes. We hypothesized that the high level of polymorphisms in olfactory receptor promoters was responsible for the diversity in regulatory mechanisms controlling the expression levels of olfactory receptor proteins. Such diversity of regulatory mechanisms may cause the great variability of olfactory cognition of numerous environmental olfactory stimuli perceived by human beings (air pollutants, human body odors, odors in culinary etc.. In turn, this variability may provide a wide range of emotional and behavioral reactions related to the vast variety of olfactory stimuli.
Moll, Lorna; Ben-Gedalya, Tziona; Reuveni, Hadas; Cohen, Ehud
2016-04-01
The discovery that the alteration of aging by reducing the activity of the insulin/IGF-1 signaling (IIS) cascade protects nematodes and mice from neurodegeneration-linked, toxic protein aggregation (proteotoxicity) raises the prospect that IIS inhibitors bear therapeutic potential to counter neurodegenerative diseases. Recently, we reported that NT219, a highly efficient IGF-1 signaling inhibitor, protects model worms from the aggregation of amyloid β peptide and polyglutamine peptides that are linked to the manifestation of Alzheimer's and Huntington's diseases, respectively. Here, we employed cultured cell systems to investigate whether NT219 promotes protein homeostasis (proteostasis) in mammalian cells and to explore its underlying mechanisms. We found that NT219 enhances the aggregation of misfolded prion protein and promotes its deposition in quality control compartments known as "aggresomes." NT219 also elevates the levels of certain molecular chaperones but, surprisingly, reduces proteasome activity and impairs autophagy. Our findings show that IGF-1 signaling inhibitors in general and NT219 in particular can promote proteostasis in mammalian cells by hyperaggregating hazardous proteins, thereby bearing the potential to postpone the onset and slow the progression of neurodegenerative illnesses in the elderly.-Moll, L., Ben-Gedalya, T., Reuveni, H., Cohen, E. The inhibition of IGF-1 signaling promotes proteostasis by enhancing protein aggregation and deposition. © FASEB.
Role of regional policies in promoting networking and innovation activity of firms
Kirsi Mukkala; Jari Ritsilä
2004-01-01
The success of firms and regions is increasingly defined by their innovation and learning capabilities. It has been emphasized in several studies that a local operational environment may have a positive impact on innovation activity of firms. From policy point of view, the relationship between firms and their local environment is an important research topic. The purpose of this paper is to explore whether there is a demand for regional policy makers in promoting innovative and networking acti...
Peng, Tao; Zhou, Wei; Guo, Feng; Wu, He-shui; Wang, Chun-you; Wang, Li; Yang, Zhi-yong
2017-01-01
Centrosomal protein 55 (CEP55) is a microtubule-bundling protein that participants in cell mitosis. It is overexpressed in several solid tumours and promotes the growth and invasion of cancer cells. However, the role of CEP55 in pancreatic cancer (PANC) remains unclear. Herein, upregulated expression of CEP55 (associated with poor prognosis) was detected in PANC using quantitative real-time reverse transcription PCR, western blotting, and immunohistochemistry. Cell migration, colony formation...
Characterization of the promoter region of the human c-erbB-2 protooncogene
International Nuclear Information System (INIS)
Ishii, S.; Imamoto, F.; Yamanashi, Y.; Toyoshima, K.; Yamamoto, T.
1987-01-01
Three overlapping genomic clones that contain the 5'-terminal portion of the human c-erbB-2 gene (ERBB2) were isolated. The promoter region was identified by nuclease S1 mapping with c-erbB-2 mRNA. Seven transcriptional start sites were identified. DNA sequence analysis showed that the promoter region contains a TATA box and a CAAT box about 30 and 80 base pairs (bp), respectively, upstream of the most downstream RNA initiation site. Two putative binding sites for transcription factor Sp1 were identified about 50 and 110 bp upstream of the CAAT box, and six GGA repeats were found between the CAAT box and the TATA box. This region had strong promoter activity when placed upstream of the bacterial chloramphenicol acetyltransferase gene and transfected into monkey CV-1 cells. These data indicate that the promoter of the human c-erbB-2 protooncogene is different from that of the protooncogene c-erbB-1 (epidermal growth factor receptor gene), which does not contain either a TATA box or a CAAT box. Comparison of the promoter sequences and activities of the two protooncogenes should be helpful in analysis of the regulatory mechanism of expression of their gene products, which are growth-factor receptors
Rampant adaptive evolution in regions of proteins with unknown function in Drosophila simulans.
Directory of Open Access Journals (Sweden)
Alisha K Holloway
2007-10-01
Full Text Available Adaptive protein evolution is pervasive in Drosophila. Genomic studies, thus far, have analyzed each protein as a single entity. However, the targets of adaptive events may be localized to particular parts of proteins, such as protein domains or regions involved in protein folding. We compared the population genetic mechanisms driving sequence polymorphism and divergence in defined protein domains and non-domain regions. Interestingly, we find that non-domain regions of proteins are more frequent targets of directional selection. Protein domains are also evolving under directional selection, but appear to be under stronger purifying selection than non-domain regions. Non-domain regions of proteins clearly play a major role in adaptive protein evolution on a genomic scale and merit future investigations of their functional properties.
TPA-inducible proteins may account for sensitivity to promotion of transformation
International Nuclear Information System (INIS)
Hirano, K.; Smith, B.; Colburn, N.H.
1986-01-01
The preneoplastic JB6 mouse epidermal cell system includes cell lines sensitive (P + ) or resistant (P - ) to tumor promoter induced neoplastic transformation. The authors investigated whether a difference in TPA-inducible proteins may explain this differential sensitivity. The synthesis of a 39 Kd cytoplasmic protein (Major Excreted Protein) was TPA-inducible, but to a similar extent in both P + and P - cells. TPA stimulated phosphorylation but not synthesis of the previously described stress protein pp80 in both P + and P - cells from 1 to 5 hr after treatment. Pulse labelling of P + and P - cells with 35 S-methionine revealed a TPA dependent P + specific transient increase in the synthesis of 58Kd protein. Induction was observed at 1 hr, and returned to basal levels by 4 hr and 20 hr, in nuclear and cytoplasmic fractions, respectively. This protein is not phosphorylated in response to TPA treatment. P + cells differ from P - cells in one or more genes that specify sensitivity to promotion of transformation, designated pro genes. Antibodies to three peptides representing the pro-1 open reading frame were used in immunoprecipitation and Western blotting to isolate the pro-1 gene product. A 43 Kd protein was immunologically responsive to the pro-1 peptide antibodies, and showed an increased signal 40 min after TPA treatment. Since the predicted molecular weight of a pro-1 gene product is only 7 Kd, the possibility of a modification of the protein by poly(ADP-ribosylation) or glycosylation is being investigated
Fauteux, François; Strömvik, Martina V
2009-01-01
Background Accurate computational identification of cis-regulatory motifs is difficult, particularly in eukaryotic promoters, which typically contain multiple short and degenerate DNA sequences bound by several interacting factors. Enrichment in combinations of rare motifs in the promoter sequence of functionally or evolutionarily related genes among several species is an indicator of conserved transcriptional regulatory mechanisms. This provides a basis for the computational identification of cis-regulatory motifs. Results We have used a discriminative seeding DNA motif discovery algorithm for an in-depth analysis of 54 seed storage protein (SSP) gene promoters from three plant families, namely Brassicaceae (mustards), Fabaceae (legumes) and Poaceae (grasses) using backgrounds based on complete sets of promoters from a representative species in each family, namely Arabidopsis (Arabidopsis thaliana (L.) Heynh.), soybean (Glycine max (L.) Merr.) and rice (Oryza sativa L.) respectively. We have identified three conserved motifs (two RY-like and one ACGT-like) in Brassicaceae and Fabaceae SSP gene promoters that are similar to experimentally characterized seed-specific cis-regulatory elements. Fabaceae SSP gene promoter sequences are also enriched in a novel, seed-specific E2Fb-like motif. Conserved motifs identified in Poaceae SSP gene promoters include a GCN4-like motif, two prolamin-box-like motifs and an Skn-1-like motif. Evidence of the presence of a variant of the TATA-box is found in the SSP gene promoters from the three plant families. Motifs discovered in SSP gene promoters were used to score whole-genome sets of promoters from Arabidopsis, soybean and rice. The highest-scoring promoters are associated with genes coding for different subunits or precursors of seed storage proteins. Conclusion Seed storage protein gene promoter motifs are conserved in diverse species, and different plant families are characterized by a distinct combination of conserved motifs
Directory of Open Access Journals (Sweden)
Fauteux François
2009-10-01
Full Text Available Abstract Background Accurate computational identification of cis-regulatory motifs is difficult, particularly in eukaryotic promoters, which typically contain multiple short and degenerate DNA sequences bound by several interacting factors. Enrichment in combinations of rare motifs in the promoter sequence of functionally or evolutionarily related genes among several species is an indicator of conserved transcriptional regulatory mechanisms. This provides a basis for the computational identification of cis-regulatory motifs. Results We have used a discriminative seeding DNA motif discovery algorithm for an in-depth analysis of 54 seed storage protein (SSP gene promoters from three plant families, namely Brassicaceae (mustards, Fabaceae (legumes and Poaceae (grasses using backgrounds based on complete sets of promoters from a representative species in each family, namely Arabidopsis (Arabidopsis thaliana (L. Heynh., soybean (Glycine max (L. Merr. and rice (Oryza sativa L. respectively. We have identified three conserved motifs (two RY-like and one ACGT-like in Brassicaceae and Fabaceae SSP gene promoters that are similar to experimentally characterized seed-specific cis-regulatory elements. Fabaceae SSP gene promoter sequences are also enriched in a novel, seed-specific E2Fb-like motif. Conserved motifs identified in Poaceae SSP gene promoters include a GCN4-like motif, two prolamin-box-like motifs and an Skn-1-like motif. Evidence of the presence of a variant of the TATA-box is found in the SSP gene promoters from the three plant families. Motifs discovered in SSP gene promoters were used to score whole-genome sets of promoters from Arabidopsis, soybean and rice. The highest-scoring promoters are associated with genes coding for different subunits or precursors of seed storage proteins. Conclusion Seed storage protein gene promoter motifs are conserved in diverse species, and different plant families are characterized by a distinct combination
A study of the frequency of methylation of gene promoter regions in ...
Indian Academy of Sciences (India)
2013-04-02
Apr 2, 2013 ... colorectal cancer in the Taiwanese population. CHANG-CHIEH WU1 ... hypermethylation of promoter-region CpG islands is an important ... mismatch repair gene MLH1 plays an important role in dele- ..... Asia Pac. J. Clin.
Cytosine deletion at AP2-box region of HSP70 promoter and its ...
Indian Academy of Sciences (India)
Cytosine deletion at AP2-box region of HSP70 promoter and its influence on semen quality traits in crossbred bulls ... Laboratory, ICAR-Central Institute for Research on Cattle, Meerut 250 001, India; School of Atmospheric Stress Management, ICAR-National Institute of Abiotic Stress Management, Baramati 413 115, India ...
Anti-Restriction Protein, KlcAHS, Promotes Dissemination of Carbapenem Resistance
Directory of Open Access Journals (Sweden)
Xiaofei Jiang
2017-05-01
Full Text Available Carbapenemase-producing Klebsiella pneumoniae (KPC has emerged and spread throughout the world. A retrospective analysis was performed on carbapenem-resistant K. pneumoniae isolated at our teaching hospital during the period 2009–2010, when the initial outbreak occurred. To determine the mechanism(s that underlies the increased infectivity exhibited by KPC, Multilocus Sequence Typing (MLST was conducted. A series of plasmids was also extracted, sequenced and analyzed. Concurrently, the complete sequences of blaKPC−2-harboring plasmids deposited in GenBank were summarized and aligned. The blaKPC−2 and KlcAHS genes in the carbapenem-resistant K. pneumoniae isolates were examined. E. coli strains, carrying different Type I Restriction and Modification (RM systems, were selected to study the interaction between RM systems, anti-RM systems and horizontal gene transfer (HGT. The ST11 clone predominated among 102 carbapenem-resistant K. pneumoniae isolates, all harbored the blaKPC−2 gene; 98% contained the KlcAHS gene. KlcAHS was one of the core genes in the backbone region of most blaKPC−2 carrying plasmids. Type I RM systems in the host bacteria reduced the rate of pHS10842 plasmid transformation by 30- to 40-fold. Presence of the anti-restriction protein, KlcAHS, on the other hand, increased transformation efficiency by 3- to 6-fold. These results indicate that RM systems can significantly restrict HGT. In contrast, KlcAHS can disrupt the RM systems and promote HGT by transformation. These findings suggest that the anti-restriction protein, KlcAHS, represents a novel mechanism that facilitates the increased transfer of blaKPC-2 and KlcAHS-carrying plasmids among K. pneumoniae strains.
Directory of Open Access Journals (Sweden)
Sun JX
2014-05-01
Full Text Available Jingxu Sun,1,* Yongxi Song,1,* Zhenning Wang,1 Guoli Wang,2 Peng Gao,1 Xiaowan Chen,1 Zhaohua Gao,1 Huimian Xu1 1Department of Surgical Oncology and General Surgery, First Hospital of China Medical University, Shenyang, People’s Republic of China; 2Department of Biochemistry and Molecular Biology, China Medical University, Shenyang, People’s Republic of China *These authors contributed equally to this work Background: MicroRNAs are associated with tumor genesis and progression in various carcinomas. MicroRNA-148a (miR-148a was reported to have low expression in gastrointestinal cancers, and might be regulated by promoter region DNA methylation. Methods: Bisulfite-modified sequencing was used to determine the promoter region DNA methylation status of human gastrointestinal cancer cell lines. Expression levels of miR-148a in cell lines treated with 5-aza-2′-deoxycytidine were determined by quantitative real-time polymerase chain reaction. Total DNA was extracted from the tissues of 64 patients with gastric cancer and 51 patients with colorectal cancer. Methylation status was determined by methylation-specific polymerase chain reaction. All statistical analyses were performed with SPSS 17.0 software. Results: The promoter regions of genes in human gastrointestinal cancer cell lines were all hypermethylated, except for HT-29, and the expression of miR-148a tended to be higher than in controls after treatment with 5-aza-2′-deoxycytidine. The methylation-specific polymerase chain reaction results showed that 56.25% of gastric cancer tissues and 19.61% of colorectal cancer tissues were hypermethylated. A strong correlation was found between the expression of miR-148a and the methylation status of promoter regions (P<0.001, chi-square test and Pearson’s correlation. Furthermore, promoter region CpG site hypermethylation of miR-148a was correlated with increased tumor size (P=0.01 in gastric cancer after analyzing the correlation between
Carrara, Paola; Antoninetti, Massimo; Bacai, Hina; Basoni, Anna; Bosc, Christelle; Clave, Magali; Cornacchia, Carmela; L'Astorina, Alba; Monbet, Philippe; Mueller, Bastian; Nicolau, Sonia; Pergola, Nicola; Rampini, Anna; Tramutoli, Valerio; Schumacher, Volker; Wells, Alan; Zepeda Juarez, Jesus; Zolotikova, Svetlana
2013-04-01
which have significant impact on the economy, environment and the quality of life of the citizens To this aim since 2011 the system of Regional Contact Offices (RCOs) was promoted by the EU FP7 DORIS_Net (Downsteam Observatory organized by Regions Active in Space - Network, http://www.doris-net.eu/) project as the regional link to the services provided by the European GMES programme. Since then a first nucleus of 12 pilot European Regions were working together establishing 6 first RCOs around Europe. This paper will present RCOs network goals, achievements and perspectives as well as its planned actions devoted to improve quality of Space Technology products from one side, to promote awareness and use of them by potential end-users (and particularly LRAs), from the other side.
Protein-protein docking using region-based 3D Zernike descriptors
Directory of Open Access Journals (Sweden)
Sael Lee
2009-12-01
Full Text Available Abstract Background Protein-protein interactions are a pivotal component of many biological processes and mediate a variety of functions. Knowing the tertiary structure of a protein complex is therefore essential for understanding the interaction mechanism. However, experimental techniques to solve the structure of the complex are often found to be difficult. To this end, computational protein-protein docking approaches can provide a useful alternative to address this issue. Prediction of docking conformations relies on methods that effectively capture shape features of the participating proteins while giving due consideration to conformational changes that may occur. Results We present a novel protein docking algorithm based on the use of 3D Zernike descriptors as regional features of molecular shape. The key motivation of using these descriptors is their invariance to transformation, in addition to a compact representation of local surface shape characteristics. Docking decoys are generated using geometric hashing, which are then ranked by a scoring function that incorporates a buried surface area and a novel geometric complementarity term based on normals associated with the 3D Zernike shape description. Our docking algorithm was tested on both bound and unbound cases in the ZDOCK benchmark 2.0 dataset. In 74% of the bound docking predictions, our method was able to find a near-native solution (interface C-αRMSD ≤ 2.5 Å within the top 1000 ranks. For unbound docking, among the 60 complexes for which our algorithm returned at least one hit, 60% of the cases were ranked within the top 2000. Comparison with existing shape-based docking algorithms shows that our method has a better performance than the others in unbound docking while remaining competitive for bound docking cases. Conclusion We show for the first time that the 3D Zernike descriptors are adept in capturing shape complementarity at the protein-protein interface and useful for
The LIKE system, a novel protein expression toolbox for Bacillus subtilis based on the liaI promoter
2012-01-01
Background Bacillus subtilis is a very important Gram-positive model organism of high biotechnological relevance, which is widely used as a host for the production of both secreted and cytoplasmic proteins. We developed a novel and efficient expression system, based on the liaI promoter (PliaI) from B. subtilis, which is under control of the LiaRS antibiotic-inducible two-component system. In the absence of a stimulus, this promoter is kept tightly inactive. Upon induction by cell wall antibiotics, it shows an over 100-fold increase in activity within 10 min. Results Based on these traits of PliaI, we developed a novel LiaRS-controlled gene expression system for B. subtilis (the “LIKE" system). Two expression vectors, the integrative pLIKE-int and the replicative pLIKE-rep, were constructed. To enhance the performance of the PliaI-derived system, site-directed mutagenesis was employed to optimize the ribosome binding site and alter its spacing to the initiation codon used for the translational fusion. The impact of these genetic modifications on protein production yield was measured using GFP as a model protein. Moreover, a number of tailored B. subtilis expression strains containing different markerless chromosomal deletions of the liaIH region were constructed to circumvent undesired protein production, enhance the positive autoregulation of the LiaRS system and thereby increase target gene expression strength from the PliaI promoter. Conclusions The LIKE protein expression system is a novel protein expression system, which offers a number of advantages over existing systems. Its major advantages are (i) a tightly switched-off promoter during exponential growth in the absence of a stimulus, (ii) a concentration-dependent activation of PliaI in the presence of suitable inducers, (iii) a very fast but transient response with a very high dynamic range of over 100-fold (up to 1,000-fold) induction, (iv) a choice from a range of well-defined, commercially available
Muhle, Rebecca A; Adjalley, Sophie; Falkard, Brie; Nkrumah, Louis J; Muhle, Michael E; Fidock, David A
2009-11-01
Questions surround the mechanism of mutually exclusive expression by which Plasmodium falciparum mediates activation and silencing of var genes. These encode PfEMP1 proteins, which function as cytoadherent and immunomodulatory molecules at the surface of parasitised erythrocytes. Current evidence suggests that promoter silencing by var introns might play a key role in var gene regulation. To evaluate the impact of cis-acting regulatory regions on var silencing, we generated P. falciparum lines in which luciferase was placed under the control of an UpsA var promoter. By utilising the Bxb1 integrase system, these reporter cassettes were targeted to a genomic region that was not in apposition to var subtelomeric domains. This eliminated possible effects from surrounding telomeric elements and removed the variability inherent in episomal systems. Studies with highly synchronised parasites revealed that the UpsA element possessed minimal activity in comparison with a heterologous (hrp3) promoter. This may result from the integrated UpsA promoter being largely silenced by the neighbouring cg6 promoter. Our analyses also revealed that the DownsA 3' untranslated region further decreased the luciferase activity from both cassettes, whereas the var A intron repressed the UpsA promoter specifically. By applying multivariate analysis over the entire cell cycle, we confirmed the significance of these cis-elements and found the parasite stage to be the major factor regulating UpsA-promoter activity. Additionally, we observed that the UpsA promoter was capable of nucleating reversible silencing that spread to a downstream promoter. We believe these studies are the first to analyse promoter activity of Group A var genes, which have been implicated in severe malaria, and support the model that var introns can further suppress var expression. These data also suggest an important suppressive role for the DownsA terminator. Our findings imply the existence of multiple levels of var
Discrete Ramanujan transform for distinguishing the protein coding regions from other regions.
Hua, Wei; Wang, Jiasong; Zhao, Jian
2014-01-01
Based on the study of Ramanujan sum and Ramanujan coefficient, this paper suggests the concepts of discrete Ramanujan transform and spectrum. Using Voss numerical representation, one maps a symbolic DNA strand as a numerical DNA sequence, and deduces the discrete Ramanujan spectrum of the numerical DNA sequence. It is well known that of discrete Fourier power spectrum of protein coding sequence has an important feature of 3-base periodicity, which is widely used for DNA sequence analysis by the technique of discrete Fourier transform. It is performed by testing the signal-to-noise ratio at frequency N/3 as a criterion for the analysis, where N is the length of the sequence. The results presented in this paper show that the property of 3-base periodicity can be only identified as a prominent spike of the discrete Ramanujan spectrum at period 3 for the protein coding regions. The signal-to-noise ratio for discrete Ramanujan spectrum is defined for numerical measurement. Therefore, the discrete Ramanujan spectrum and the signal-to-noise ratio of a DNA sequence can be used for distinguishing the protein coding regions from the noncoding regions. All the exon and intron sequences in whole chromosomes 1, 2, 3 and 4 of Caenorhabditis elegans have been tested and the histograms and tables from the computational results illustrate the reliability of our method. In addition, we have analyzed theoretically and gotten the conclusion that the algorithm for calculating discrete Ramanujan spectrum owns the lower computational complexity and higher computational accuracy. The computational experiments show that the technique by using discrete Ramanujan spectrum for classifying different DNA sequences is a fast and effective method. Copyright © 2014 Elsevier Ltd. All rights reserved.
Directory of Open Access Journals (Sweden)
Sutapa Datta
Full Text Available An important step in understanding gene regulation is to identify the promoter regions where the transcription factor binding takes place. Predicting a promoter region de novo has been a theoretical goal for many researchers for a long time. There exists a number of in silico methods to predict the promoter region de novo but most of these methods are still suffering from various shortcomings, a major one being the selection of appropriate features of promoter region distinguishing them from non-promoters. In this communication, we have proposed a new composite method that predicts promoter sequences based on the interrelationship between structural profiles of DNA and primary sequence elements of the promoter regions. We have shown that a Context Free Grammar (CFG can formalize the relationships between different primary sequence features and by utilizing the CFG, we demonstrate that an efficient parser can be constructed for extracting these relationships from DNA sequences to distinguish the true promoter sequences from non-promoter sequences. Along with CFG, we have extracted the structural features of the promoter region to improve upon the efficiency of our prediction system. Extensive experiments performed on different datasets reveals that our method is effective in predicting promoter sequences on a genome-wide scale and performs satisfactorily as compared to other promoter prediction techniques.
Datta, Sutapa; Mukhopadhyay, Subhasis
2013-01-01
An important step in understanding gene regulation is to identify the promoter regions where the transcription factor binding takes place. Predicting a promoter region de novo has been a theoretical goal for many researchers for a long time. There exists a number of in silico methods to predict the promoter region de novo but most of these methods are still suffering from various shortcomings, a major one being the selection of appropriate features of promoter region distinguishing them from non-promoters. In this communication, we have proposed a new composite method that predicts promoter sequences based on the interrelationship between structural profiles of DNA and primary sequence elements of the promoter regions. We have shown that a Context Free Grammar (CFG) can formalize the relationships between different primary sequence features and by utilizing the CFG, we demonstrate that an efficient parser can be constructed for extracting these relationships from DNA sequences to distinguish the true promoter sequences from non-promoter sequences. Along with CFG, we have extracted the structural features of the promoter region to improve upon the efficiency of our prediction system. Extensive experiments performed on different datasets reveals that our method is effective in predicting promoter sequences on a genome-wide scale and performs satisfactorily as compared to other promoter prediction techniques. PMID:23437045
Zhou, Jie; Zhang, Haifeng; Meng, Hengkai; Zhu, Yan; Bao, Guanhui; Zhang, Yanping; Li, Yin; Ma, Yanhe
2014-03-28
Cyanobacteria are oxygenic photosynthetic prokaryotes that play important roles in the global carbon cycle. Recently, engineered cyanobacteria capable of producing various small molecules from CO2 have been developed. However, cyanobacteria are seldom considered as factories for producing proteins, mainly because of the lack of efficient strong promoters. Here, we report the discovery and verification of a super-strong promoter P(cpc560), which contains two predicted promoters and 14 predicted transcription factor binding sites (TFBSs). Using P(cpc560), functional proteins were produced at a level of up to 15% of total soluble protein in the cyanobacterium Synechocystis sp. 6803, a level comparable to that produced in Escherichia coli. We demonstrated that the presence of multiple TFBSs in P(cpc560) is crucial for its promoter strength. Genetically transformable cyanobacteria neither have endotoxins nor form inclusion bodies; therefore, P(cpc560) opens the possibility to use cyanobacteria as alternative hosts for producing heterogeneous proteins from CO2 and inorganic nutrients.
van Erpecum, K. J.; Portincasa, P.; Eckhardt, E.; Go, P. M.; vanBerge-Henegouwen, G. P.; Groen, A. K.
1996-01-01
Background & Aims: Ursodeoxycholic acid prevents gallstone formation in selected patients. The aim of this study was to examine whether decreased concentration and nucleation-promoting activity of various proteins contribute to this beneficial effect. Methods: Gallbladder bile of 13 patients with
Kalveram, Birte; Lihoradova, Olga; Ikegami, Tetsuro
2011-07-01
Rift Valley fever virus (RVFV; family Bunyaviridae, genus Phlebovirus) is an important emerging pathogen of humans and ruminants. Its NSs protein has previously been identified as a major virulence factor that suppresses host defense through three distinct mechanisms: it directly inhibits beta interferon (IFN-β) promoter activity, it promotes the degradation of double-stranded RNA-dependent protein kinase (PKR), and it suppresses host transcription by disrupting the assembly of the basal transcription factor TFIIH through sequestration of its p44 subunit. Here, we report that in addition to PKR, NSs also promotes the degradation of the TFIIH subunit p62. Infection of cells with the RVFV MP-12 vaccine strain reduced p62 protein levels to below the detection limit early in the course of infection. This NSs-mediated downregulation of p62 was posttranslational, as it was unaffected by pharmacological inhibition of transcription or translation and MP-12 infection had no effect on p62 mRNA levels. Treatment of cells with proteasome inhibitors but not inhibition of lysosomal acidification or nuclear export resulted in a stabilization of p62 in the presence of NSs. Furthermore, p62 could be coprecipitated with NSs from lysates of infected cells. These data suggest that the RVFV NSs protein is able to interact with the TFIIH subunit p62 inside infected cells and promotes its degradation, which can occur directly in the nucleus.
Ubiquitin-like protein UBL5 promotes the functional integrity of the Fanconi anemia pathway
DEFF Research Database (Denmark)
Oka, Yasuyoshi; Bekker-Jensen, Simon; Mailand, Niels
2015-01-01
in promoting the function of the Fanconi anemia (FA) pathway for repair of DNA interstrand crosslinks (ICLs), mediated by a specific interaction with the central FA pathway component FANCI. UBL5-deficient cells display spliceosome-independent reduction of FANCI protein stability, defective FANCI function...
DEFF Research Database (Denmark)
Rugbjerg, Peter; Knuf, Christoph; Förster, Jochen
2015-01-01
a less leaky Cu2+-inducible promoter based on CUP1. The basal expression level of the new promoter was approx. 61% below the wild-type CUP1 promoter, thus expanding the absolute range of Cu2+-based gene control. The stability of 3vGFP towards direct-repeat recombination was assayed in S. cerevisiae......Green fluorescent proteins (GFPs) are widely used for visualization of proteins to track localization and expression dynamics. However, phenotypically important processes can operate at too low expression levels for routine detection, i.e. be overshadowed by autofluorescence noise. While GFP...... functions well in translational fusions, the use of tandem GFPs to amplify fluorescence signals is currently avoided in Saccharomyces cerevisiae and many other microorganisms due to the risk of loop-out by direct-repeat recombination. We increased GFP fluorescence by translationally fusing three different...
Tobacco arabinogalactan protein NtEPc can promote banana (Musa AAA) somatic embryogenesis.
Shu, H; Xu, L; Li, Z; Li, J; Jin, Z; Chang, S
2014-12-01
Banana is an important tropical fruit worldwide. Parthenocarpy and female sterility made it impossible to improve banana varieties through common hybridization. Genetic transformation for banana improvement is imperative. But the low rate that banana embryogenic callus was induced made the transformation cannot be performed in many laboratories. Finding ways to promote banana somatic embryogenesis is critical for banana genetic transformation. After tobacco arabinogalactan protein gene NtEPc was transformed into Escherichia coli (DE3), the recombinant protein was purified and filter-sterilized. A series of the sterilized protein was added into tissue culture medium. It was found that the number of banana immature male flowers developing embryogenic calli increased significantly in the presence of NtEPc protein compared with the effect of the control medium. Among the treatments, explants cultured on medium containing 10 mg/l of NtEPc protein had the highest chance to develop embryogenic calli. The percentage of lines that developed embryogenic calli on this medium was about 12.5 %. These demonstrated that NtEPc protein can be used to promote banana embryogenesis. This is the first paper that reported that foreign arabinogalactan protein (AGP) could be used to improve banana somatic embryogenesis.
Kolobova, Elena; Roland, Joseph T; Lapierre, Lynne A; Williams, Janice A; Mason, Twila A; Goldenring, James R
2017-12-15
Microtubules in animal cells assemble (nucleate) from both the centrosome and the cis-Golgi cisternae. A-kinase anchor protein 350 kDa (AKAP350A, also called AKAP450/CG-NAP/AKAP9) is a large scaffolding protein located at both the centrosome and Golgi apparatus. Previous findings have suggested that AKAP350 is important for microtubule dynamics at both locations, but how this scaffolding protein assembles microtubule nucleation machinery is unclear. Here, we found that overexpression of the C-terminal third of AKAP350A, enhanced GFP-AKAP350A(2691-3907), induces the formation of multiple microtubule-nucleation centers (MTNCs). Nevertheless, these induced MTNCs lacked "true" centriole proteins, such as Cep135. Mapping analysis with AKAP350A truncations demonstrated that AKAP350A contains discrete regions responsible for promoting or inhibiting the formation of multiple MTNCs. Moreover, GFP-AKAP350A(2691-3907) recruited several pericentriolar proteins to MTNCs, including γ-tubulin, pericentrin, Cep68, Cep170, and Cdk5RAP2. Proteomic analysis indicated that Cdk5RAP2 and Cep170 both interact with the microtubule nucleation-promoting region of AKAP350A, whereas Cep68 interacts with the distal C-terminal AKAP350A region. Yeast two-hybrid assays established a direct interaction of Cep170 with AKAP350A. Super-resolution and deconvolution microscopy analyses were performed to define the association of AKAP350A with centrosomes, and these studies disclosed that AKAP350A spans the bridge between centrioles, co-localizing with rootletin and Cep68 in the linker region. siRNA-mediated depletion of AKAP350A caused displacement of both Cep68 and Cep170 from the centrosome. These results suggest that AKAP350A acts as a scaffold for factors involved in microtubule nucleation at the centrosome and coordinates the assembly of protein complexes associating with the intercentriolar bridge.
Kawaguchi, Koichiro; Kinameri, Ayumi; Suzuki, Shunsuke; Senga, Shogo; Ke, Youqiang; Fujii, Hiroshi
2016-02-15
FABPs (fatty-acid-binding proteins) are a family of low-molecular-mass intracellular lipid-binding proteins consisting of ten isoforms. FABPs are involved in binding and storing hydrophobic ligands such as long-chain fatty acids, as well as transporting these ligands to the appropriate compartments in the cell. FABP5 is overexpressed in multiple types of tumours. Furthermore, up-regulation of FABP5 is strongly associated with poor survival in triple-negative breast cancer. However, the mechanisms underlying the specific up-regulation of the FABP5 gene in these cancers remain poorly characterized. In the present study, we determined that FABP5 has a typical CpG island around its promoter region. The DNA methylation status of the CpG island in the FABP5 promoter of benign prostate cells (PNT2), prostate cancer cells (PC-3, DU-145, 22Rv1 and LNCaP) and human normal or tumour tissue was assessed by bisulfite sequencing analysis, and then confirmed by COBRA (combined bisulfite restriction analysis) and qAMP (quantitative analysis of DNA methylation using real-time PCR). These results demonstrated that overexpression of FABP5 in prostate cancer cells can be attributed to hypomethylation of the CpG island in its promoter region, along with up-regulation of the direct trans-acting factors Sp1 (specificity protein 1) and c-Myc. Together, these mechanisms result in the transcriptional activation of FABP5 expression during human prostate carcinogenesis. Importantly, silencing of Sp1, c-Myc or FABP5 expression led to a significant decrease in cell proliferation, indicating that up-regulation of FABP5 expression by Sp1 and c-Myc is critical for the proliferation of prostate cancer cells. © 2016 Authors; published by Portland Press Limited.
International Nuclear Information System (INIS)
Chattopadhyay, Anasuya; Schmidt, Martin C.; Khan, Saleem A.
2005-01-01
Human papillomaviruses (HPVs) replicate as nuclear plasmids in infected cells. Since the DNA replication machinery is generally conserved between humans and Saccharomyces cerevisiae, we studied whether HPV-1 DNA can replicate in yeast. Plasmids containing a selectable marker (with or without a yeast centromere) and either the full-length HPV-1 genome or various regions of the viral long control region (LCR) and the 3' end of the L1 gene were introduced into S. cerevisiae and their ability to replicate episomally was investigated. Our results show that HPV-1 sequences promote episomal replication of plasmids although the yeast centromere is required for plasmid retention. We have mapped the autonomously replicating sequence activity of HPV-1 DNA to a 450 base-pair sequence (HPV-1 nt 6783-7232) that includes 293 nucleotides from the 5' region of the viral LCR and 157 nucleotides from the 3' end of the L1 gene. The HPV-1 ARS does not include the binding sites for the viral E1 and E2 proteins, and these proteins are dispensable for replication in S. cerevisiae
Directory of Open Access Journals (Sweden)
Stephanie Jemielity
2013-03-01
Full Text Available Human T-cell Immunoglobulin and Mucin-domain containing proteins (TIM1, 3, and 4 specifically bind phosphatidylserine (PS. TIM1 has been proposed to serve as a cellular receptor for hepatitis A virus and Ebola virus and as an entry factor for dengue virus. Here we show that TIM1 promotes infection of retroviruses and virus-like particles (VLPs pseudotyped with a range of viral entry proteins, in particular those from the filovirus, flavivirus, New World arenavirus and alphavirus families. TIM1 also robustly enhanced the infection of replication-competent viruses from the same families, including dengue, Tacaribe, Sindbis and Ross River viruses. All interactions between TIM1 and pseudoviruses or VLPs were PS-mediated, as demonstrated with liposome blocking and TIM1 mutagenesis experiments. In addition, other PS-binding proteins, such as Axl and TIM4, promoted infection similarly to TIM1. Finally, the blocking of PS receptors on macrophages inhibited the entry of Ebola VLPs, suggesting that PS receptors can contribute to infection in physiologically relevant cells. Notably, infection mediated by the entry proteins of Lassa fever virus, influenza A virus and SARS coronavirus was largely unaffected by TIM1 expression. Taken together our data show that TIM1 and related PS-binding proteins promote infection of diverse families of enveloped viruses, and may therefore be useful targets for broad-spectrum antiviral therapies.
Neural regeneration protein is a novel chemoattractive and neuronal survival-promoting factor
International Nuclear Information System (INIS)
Gorba, Thorsten; Bradoo, Privahini; Antonic, Ana; Marvin, Keith; Liu, Dong-Xu; Lobie, Peter E.; Reymann, Klaus G.; Gluckman, Peter D.; Sieg, Frank
2006-01-01
Neurogenesis and neuronal migration are the prerequisites for the development of the central nervous system. We have identified a novel rodent gene encoding for a neural regeneration protein (NRP) with an activity spectrum similar to the chemokine stromal-derived factor (SDF)-1, but with much greater potency. The Nrp gene is encoded as a forward frameshift to the hypothetical alkylated DNA repair protein AlkB. The predicted protein sequence of NRP contains domains with homology to survival-promoting peptide (SPP) and the trefoil protein TFF-1. The Nrp gene is first expressed in neural stem cells and expression continues in glial lineages. Recombinant NRP and NRP-derived peptides possess biological activities including induction of neural migration and proliferation, promotion of neuronal survival, enhancement of neurite outgrowth and promotion of neuronal differentiation from neural stem cells. NRP exerts its effect on neuronal survival by phosphorylation of the ERK1/2 and Akt kinases, whereas NRP stimulation of neural migration depends solely on p44/42 MAP kinase activity. Taken together, the expression profile of Nrp, the existence in its predicted protein structure of domains with similarities to known neuroprotective and migration-inducing factors and the high potency of NRP-derived synthetic peptides acting in femtomolar concentrations suggest it to be a novel gene of relevance in cellular and developmental neurobiology
Wei, Yongwei; Feng, Kurtis; Yao, Xiangjie; Cai, Hui; Li, Junan; Mirza, Anne M; Iorio, Ronald M; Li, Jianrong
2012-11-01
The genus Metapneumovirus within the subfamily Pneumovirinae of the family Paramyxoviridae includes two members, human metapneumovirus (hMPV) and avian metapneumovirus (aMPV), causing respiratory tract infections in humans and birds, respectively. Paramyxoviruses enter host cells by fusing the viral envelope with a host cell membrane. Membrane fusion of hMPV appears to be unique, in that fusion of some hMPV strains requires low pH. Here, we show that the fusion (F) proteins of aMPV promote fusion in the absence of the attachment protein and low pH is not required. Furthermore, there are notable differences in cell-cell fusion among aMPV subtypes. Trypsin was required for cell-cell fusion induced by subtype B but not subtypes A and C. The F protein of aMPV subtype A was highly fusogenic, whereas those from subtypes B and C were not. By construction and evaluation of chimeric F proteins composed of domains from the F proteins of subtypes A and B, we localized a region composed of amino acid residues 170 to 338 in the F protein that is responsible for the hyperfusogenic phenotype of the F from subtype A. Further mutagenesis analysis revealed that residues R295, G297, and K323 in this region collectively contributed to the hyperfusogenicity. Taken together, we have identified a region in the aMPV F protein that modulates the extent of membrane fusion. A model for fusion consistent with these data is presented.
Directory of Open Access Journals (Sweden)
Susanne Schmeier
2009-01-01
Full Text Available The development of international rivers is often perceived as leading to conflicts or even water wars. However, as the development of the Mekong River shows, cooperation has not only prevailed in the last decades, but River Basin Organizations (RBOs, established to mitigate river-related conflicts and/or develop the river basin, have also contributed to the emergence of more general cooperation structures, mainly by creating spill-over effects in other issue-areas, bringing cooperation to policy fields beyond the river itself. This article assesses the contribution of the Mekong River Commission (MRC and the Greater Mekong Sub-Region (GMS to the sustainable development of the Mekong Region as well as to the promotion of regional cooperation in mainland South-East Asia in general. --- Die Entwicklung grenzüberschreitender Flüsse wird oft mit Konflikten oder gar Kriegen um Wasser assoziiert. Wie jedoch die Entwicklung im Mekong-Becken zeigt, waren die vergangenen Jahrzehnte nicht nur von Kooperation gezeichnet, sondern Flussbeckenorganisationen konnten außerdem dazu beitragen, weitreichendere Kooperationsstrukturen zu entwickeln, die sich auf andere Politikfelder ausdehnen. Dieser Artikel beschäftigt sich mit dem Beitrag der Mekong River Commission (MRC und der Greater Mekong Sub-Region (GMS zur nachhaltigen Entwicklung in der Mekong Region sowie zur Förderung allgemeiner regionaler Kooperation im Festländischen Südostasien.
Regional differences in gene expression and promoter usage in aged human brains
Pardo, Luba M.
2013-02-19
To characterize the promoterome of caudate and putamen regions (striatum), frontal and temporal cortices, and hippocampi from aged human brains, we used high-throughput cap analysis of gene expression to profile the transcription start sites and to quantify the differences in gene expression across the 5 brain regions. We also analyzed the extent to which methylation influenced the observed expression profiles. We sequenced more than 71 million cap analysis of gene expression tags corresponding to 70,202 promoter regions and 16,888 genes. More than 7000 transcripts were differentially expressed, mainly because of differential alternative promoter usage. Unexpectedly, 7% of differentially expressed genes were neurodevelopmental transcription factors. Functional pathway analysis on the differentially expressed genes revealed an overrepresentation of several signaling pathways (e.g., fibroblast growth factor and wnt signaling) in hippocampus and striatum. We also found that although 73% of methylation signals mapped within genes, the influence of methylation on the expression profile was small. Our study underscores alternative promoter usage as an important mechanism for determining the regional differences in gene expression at old age.
Combgap Promotes Ovarian Niche Development and Chromatin Association of EcR-Binding Regions in BR-C.
Hitrik, Anna; Popliker, Malka; Gancz, Dana; Mukamel, Zohar; Lifshitz, Aviezer; Schwartzman, Omer; Tanay, Amos; Gilboa, Lilach
2016-11-01
The development of niches for tissue-specific stem cells is an important aspect of stem cell biology. Determination of niche size and niche numbers during organogenesis involves precise control of gene expression. How this is achieved in the context of a complex chromatin landscape is largely unknown. Here we show that the nuclear protein Combgap (Cg) supports correct ovarian niche formation in Drosophila by controlling ecdysone-Receptor (EcR)- mediated transcription and long-range chromatin contacts in the broad locus (BR-C). Both cg and BR-C promote ovarian growth and the development of niches for germ line stem cells. BR-C levels were lower when Combgap was either reduced or over-expressed, indicating an intricate regulation of the BR-C locus by Combgap. Polytene chromosome stains showed that Cg co-localizes with EcR, the major regulator of BR-C, at the BR-C locus and that EcR binding to chromatin was sensitive to changes in Cg levels. Proximity ligation assay indicated that the two proteins could reside in the same complex. Finally, chromatin conformation analysis revealed that EcR-bound regions within BR-C, which span ~30 KBs, contacted each other. Significantly, these contacts were stabilized in an ecdysone- and Combgap-dependent manner. Together, these results highlight Combgap as a novel regulator of chromatin structure that promotes transcription of ecdysone target genes and ovarian niche formation.
Brand Products of Regional Cuisine in the Promotion of Tourism in Roztocze
Directory of Open Access Journals (Sweden)
Bekier-Jaworska Ewa
2015-03-01
Full Text Available Introduction. There has been a trend over the last few years of using specialties of regional cuisine as an independent tourist attraction. The creation of local brands is an important element in the promotion of a given region and it also influences the development of culinary tourism. The aim of the studies conducted was to identify regional dishes - a choice of dishes that could be described as 'brand dishes' and the use of those dishes as tourist attractions in Roztocze. Material and methods. Studies were conducted on a group of students studying tourism and recreation at State Higher School of Vocational Education (PWSZ in Zamość using a questionnaire. Results. The questionnaire provided an assessment of the levels of knowledge of regional cuisine among Polish and Ukrainian students, identified the most characteristic dishes and selected brand products, and helped to arrive at a suitable method of promotion. Conclusions. Nationality, family customs and selection of local restaurants highly influence knowledge of regional cuisine. Interviewees decided that the most outstanding products from Roztocze were Zwierzyniec beer, and Biłgoraj pie. Regional products should be used as a tourist attraction in Roztocze.
Directory of Open Access Journals (Sweden)
Andrew M Edwards
Full Text Available Staphylococcus aureus is a leading cause of bacteraemia, which frequently results in complications such as infective endocarditis, osteomyelitis and exit from the bloodstream to cause metastatic abscesses. Interaction with endothelial cells is critical to these complications and several bacterial proteins have been shown to be involved. The S. aureus extracellular adhesion protein (Eap has many functions, it binds several host glyco-proteins and has both pro- and anti-inflammatory activity. Unfortunately its role in vivo has not been robustly tested to date, due to difficulties in complementing its activity in mutant strains. We previously found Eap to have pro-inflammatory activity, and here show that purified native Eap triggered TNFα release in whole human blood in a dose-dependent manner. This level of TNFα increased adhesion of S. aureus to endothelial cells 4-fold via a mechanism involving protein A on the bacterial surface and gC1qR/p33 on the endothelial cell surface. The contribution this and other Eap activities play in disease severity during bacteraemia was tested by constructing an isogenic set of strains in which the eap gene was inactivated and complemented by inserting an intact copy elsewhere on the bacterial chromosome. Using a murine bacteraemia model we found that Eap expressing strains cause a more severe infection, demonstrating its role in invasive disease.
Tissue-specific interactions between nuclear proteins and the aminopeptidase N promoter
DEFF Research Database (Denmark)
Kärnström, U; Sjöström, H; Norén, O
1991-01-01
Aminopeptidase N/CD13 is a metallopeptidase found in many tissues. Aminopeptidase N activity is high in the small intestinal mucosa, moderate in the liver, and low in the spleen. Using DNase I footprinting and electrophoretic mobility shift assays with nuclear extracts from these tissues, three cis...... elements (DF, LF-B1, UF) were identified in the aminopeptidase N promoter. The DF region (-53 to -30) interacts with the ubiquitously expressed transcription factor Sp1. The LF-B1 region (-85 to -58) interacts with the liver transcription factor LF-B1 (HNF-1) which was detected as well in nuclei from small...... intestinal mucosa. The UF region (-112 to -90) interacts with nuclear factors which seem to be expressed differentially in the liver and the small intestine. Transfection of promoter deletions into HepG2 cells showed that the LF-B1 region is necessary for high expression of the aminopeptidase N gene in liver...
Genome-wide function of H2B ubiquitylation in promoter and genic regions.
Batta, Kiran; Zhang, Zhenhai; Yen, Kuangyu; Goffman, David B; Pugh, B Franklin
2011-11-01
Nucleosomal organization in and around genes may contribute substantially to transcriptional regulation. The contribution of histone modifications to genome-wide nucleosomal organization has not been systematically evaluated. In the present study, we examine the role of H2BK123 ubiquitylation, a key regulator of several histone modifications, on nucleosomal organization at promoter, genic, and transcription termination regions in Saccharomyces cerevisiae. Using high-resolution MNase chromatin immunoprecipitation and sequencing (ChIP-seq), we map nucleosome positioning and occupancy in mutants of the H2BK123 ubiquitylation pathway. We found that H2B ubiquitylation-mediated nucleosome formation and/or stability inhibits the assembly of the transcription machinery at normally quiescent promoters, whereas ubiquitylation within highly active gene bodies promotes transcription elongation. This regulation does not proceed through ubiquitylation-regulated histone marks at H3K4, K36, and K79. Our findings suggest that mechanistically similar functions of H2B ubiquitylation (nucleosome assembly) elicit different functional outcomes on genes depending on its positional context in promoters (repressive) versus transcribed regions (activating).
Chen, Yao-Li; Hung, Man-Hsin; Chu, Pei-Yi; Chao, Tzu-I; Tsai, Ming-Hsien; Chen, Li-Ju; Hsiao, Yung-Jen; Shih, Chih-Ting; Hsieh, Feng-Shu; Chen, Kuen-Feng
2017-08-15
The serine-threonine protein phosphatase family members are known as critical regulators of various cellular functions, such as survival and transformation. Growing evidence suggests that pharmacological manipulation of phosphatase activity exhibits therapeutic benefits. Ser/Thr protein phosphatase 5 (PP5) is known to participate in glucocorticoid receptor (GR) and stress-induced signaling cascades that regulate cell growth and apoptosis, and has been shown to be overexpressed in various human malignant diseases. However, the role of PP5 in hepatocellular carcinoma (HCC) and whether PP5 may be a viable therapeutic target for HCC treatment are unknown. Here, by analyzing HCC clinical samples obtained from 215 patients, we found that overexpression of PP5 is tumor specific and associated with worse clinical outcomes. We further characterized the oncogenic properties of PP5 in HCC cells. Importantly, both silencing of PP5 with lentiviral-mediated short hairpin RNA (shRNA) and chemical inhibition of PP5 phosphatase activity using the natural compound cantharidin/norcantharidin markedly suppressed the growth of HCC cells and tumors in vitro and in vivo. Moreover, we identified AMP-activated protein kinase (AMPK) as a novel downstream target of oncogenic PP5 and demonstrated that the antitumor mechanisms underlying PP5 inhibition involve activation of AMPK signaling. Overall, our results establish a pathological function of PP5 in hepatocarcinogenesis via affecting AMPK signaling and suggest that PP5 inhibition is an attractive therapeutic approach for HCC. Copyright © 2017 Elsevier Inc. All rights reserved.
Restoration of CpG Methylation in The Egf Promoter Region during Rat Liver Regeneration
Deming, Li; Ziwei, Li; Xueqiang, Guo; Cunshuan, Xu
2015-01-01
Epidermal growth factor (EGF) is an important factor for healing after tissue damage in diverse experimental models. It plays an important role in liver regeneration (LR). The objective of this experiment is to investigate the methylation variation of 10 CpG sites in the Egf promoter region and their relevance to Egf expression during rat liver regenera- tion. As a follow up of our previous study, rat liver tissue was collected after rat 2/3 partial hepatectomy (PH) during the re-organization phase (from days 14 to days 28). Liver DNA was extracted and modified by sodium bisulfate. The methylation status of 10 CpG sites in Egf promoter region was determined using bisulfite sequencing polymerase chain reaction (PCR), as BSP method. The results showed that 3 (sites 3, 4 and 9) out of 10 CpG sites have strikingly methylation changes during the re-organization phase compared to the regeneration phase (from 2 hours to 168 hours, P=0.002, 0.048 and 0.018, respectively). Our results showed that methylation modification of CpGs in the Egf promoter region could be restored to the status before PH operation and changes of methylation didn’t affect Egf mRNA expression during the re-organization phase. PMID:26464832
Iwasaki, T; Yamaguchi-Shinozaki, K; Shinozaki, K
1995-05-20
In Arabidopsis thaliana, the induction of a dehydration-responsive gene, rd22, is mediated by abscisic acid (ABA) but the gene does not include any sequence corresponding to the consensus ABA-responsive element (ABRE), RYACGTGGYR, in its promoter region. The cis-regulatory region of the rd22 promoter was identified by monitoring the expression of beta-glucuronidase (GUS) activity in leaves of transgenic tobacco plants transformed with chimeric gene fusions constructed between 5'-deleted promoters of rd22 and the coding region of the GUS reporter gene. A 67-bp nucleotide fragment corresponding to positions -207 to -141 of the rd22 promoter conferred responsiveness to dehydration and ABA on a non-responsive promoter. The 67-bp fragment contains the sequences of the recognition sites for some transcription factors, such as MYC, MYB, and GT-1. The fact that accumulation of rd22 mRNA requires protein synthesis raises the possibility that the expression of rd22 might be regulated by one of these trans-acting protein factors whose de novo synthesis is induced by dehydration or ABA. Although the structure of the RD22 protein is very similar to that of a non-storage seed protein, USP, of Vicia faba, the expression of the GUS gene driven by the rd22 promoter in non-stressed transgenic Arabidopsis plants was found mainly in flowers and bolted stems rather than in seeds.
Growth hormone-promoted tyrosyl phosphorylation of SHC proteins and SHC association with Grb2
DEFF Research Database (Denmark)
VanderKuur, J; Allevato, G; Billestrup, Nils
1995-01-01
. To gain insight into pathways coupling GH receptor (GHR) to MAP kinase activation and signaling molecules that might interact with GHR and its associated tyrosine kinase JAK2, we examined whether SHC and Grb2 proteins serve as signaling molecules for GH. Human GH was shown to promote the rapid tyrosyl...... phosphorylation of 66-, 52-, and 46-kDa SHC proteins in 3T3-F442A fibroblasts. GH also promoted binding of GHR and JAK2 to the SH2 domain of 46/52-kDa SHC protein fused to glutathione S-transferase (GST). Constitutively phosphorylated JAK2, from COS-7 cells transiently transfected with murine JAK2 cDNA, bound......-638 and GHR1-638(Y333,338F), GH stimulated phosphorylation of all 3 SHC proteins whereas GH stimulated phosphorylation of only the 66- and 52-kDa SHC proteins in cells expressing GHR1-454. GH had no effect on SHC phosphorylation in cells expressing GHR1-294 or GHR delta P, the latter lacking amino acids 297...
Clem, Brian F; Hudson, Elizabeth A; Clark, Barbara J
2005-03-01
Steroidogenic acute regulatory protein (StAR) transcription is regulated through cAMP-protein kinase A-dependent mechanisms that involve multiple transcription factors including the cAMP-responsive element binding protein (CREB) family members. Classically, binding of phosphorylated CREB to cis-acting cAMP-responsive elements (5'-TGACGTCA-3') within target gene promoters leads to recruitment of the coactivator CREB binding protein (CBP). Herein we examined the extent of CREB family member phosphorylation on protein-DNA interactions and CBP recruitment with the StAR promoter. Immunoblot analysis revealed that CREB, cAMP-responsive element modulator (CREM), and activating transcription factor (ATF)-1 are expressed in MA-10 mouse Leydig tumor cells, yet only CREB and ATF-1 are phosphorylated. (Bu)2cAMP treatment of MA-10 cells increased CREB phosphorylation approximately 2.3-fold within 30 min but did not change total nuclear CREB expression levels. Using DNA-affinity chromatography, we now show that CREB and ATF-1, but not CREM, interact with the StAR promoter, and this interaction is dependent on the activator protein-1 (AP-1) cis-acting element within the cAMP-responsive region. In addition, (Bu)2cAMP-treatment increased phosphorylated CREB (P-CREB) association with the StAR promoter but did not influence total CREB interaction. In vivo chromatin immunoprecipitation assays demonstrated CREB binding to the StAR proximal promoter is independent of (Bu)2cAMP-treatment, confirming our in vitro analysis. However, (Bu)2cAMP-treatment increased P-CREB and CBP interaction with the StAR promoter, demonstrating for the first time the physical role of P-CREB:DNA interactions in CBP recruitment to the StAR proximal promoter.
RNA-binding proteins ZFP36L1 and ZFP36L2 promote cell quiescence.
Galloway, Alison; Saveliev, Alexander; Łukasiak, Sebastian; Hodson, Daniel J; Bolland, Daniel; Balmanno, Kathryn; Ahlfors, Helena; Monzón-Casanova, Elisa; Mannurita, Sara Ciullini; Bell, Lewis S; Andrews, Simon; Díaz-Muñoz, Manuel D; Cook, Simon J; Corcoran, Anne; Turner, Martin
2016-04-22
Progression through the stages of lymphocyte development requires coordination of the cell cycle. Such coordination ensures genomic integrity while cells somatically rearrange their antigen receptor genes [in a process called variable-diversity-joining (VDJ) recombination] and, upon successful rearrangement, expands the pools of progenitor lymphocytes. Here we show that in developing B lymphocytes, the RNA-binding proteins (RBPs) ZFP36L1 and ZFP36L2 are critical for maintaining quiescence before precursor B cell receptor (pre-BCR) expression and for reestablishing quiescence after pre-BCR-induced expansion. These RBPs suppress an evolutionarily conserved posttranscriptional regulon consisting of messenger RNAs whose protein products cooperatively promote transition into the S phase of the cell cycle. This mechanism promotes VDJ recombination and effective selection of cells expressing immunoglobulin-μ at the pre-BCR checkpoint. Copyright © 2016, American Association for the Advancement of Science.
An essential GT motif in the lamin A promoter mediates activation by CREB-binding protein
International Nuclear Information System (INIS)
Janaki Ramaiah, M.; Parnaik, Veena K.
2006-01-01
Lamin A is an important component of nuclear architecture in mammalian cells. Mutations in the human lamin A gene lead to highly degenerative disorders that affect specific tissues. In studies directed towards understanding the mode of regulation of the lamin A promoter, we have identified an essential GT motif at -55 position by reporter gene assays and mutational analysis. Binding of this sequence to Sp transcription factors has been observed in electrophoretic mobility shift assays and by chromatin immunoprecipitation studies. Further functional analysis by co-expression of recombinant proteins and ChIP assays has shown an important regulatory role for CREB-binding protein in promoter activation, which is mediated by the GT motif
Directory of Open Access Journals (Sweden)
Xian-E Peng
Full Text Available Liver fatty acid-binding protein (L-FABP, also known as fatty acid-binding protein 1 (FABP1, is a key regulator of hepatic lipid metabolism. Elevated FABP1 levels are associated with an increased risk of cardiovascular disease (CVD and metabolic syndromes. In this study, we examine the association of FABP1 gene promoter variants with serum FABP1 and lipid levels in a Chinese population. Four promoter single-nucleotide polymorphisms (SNPs of FABP1 gene were genotyped in a cross-sectional survey of healthy volunteers (n = 1,182 from Fuzhou city of China. Results showed that only the rs2919872 G>A variant was significantly associated with serum TG concentration(P = 0.032.Compared with the rs2919872 G allele, rs2919872 A allele contributed significantly to reduced serum TG concentration, and this allele dramatically decreased the FABP1 promoter activity(P < 0.05. The rs2919872 A allele carriers had considerably lower serum FABP1 levels than G allele carriers (P < 0.01. In the multivariable linear regression analysis, the rs2919872 A allele was negatively associated with serum FABP1 levels (β = -0.320, P = 0.003, while serum TG levels were positively associated with serum FABP1 levels (β = 0.487, P = 0.014. Our data suggest that compared with the rs2919872 G allele, the rs2919872 A allele reduces the transcriptional activity of FABP1 promoter, and thereby may link FABP1 gene variation to TG level in humans.
p16(INK4a) promoter methylation and protein expression in breast fibroadenoma and carcinoma.
Di Vinci, Angela; Perdelli, Luisa; Banelli, Barbara; Salvi, Sandra; Casciano, Ida; Gelvi, Ilaria; Allemanni, Giorgio; Margallo, Edoardo; Gatteschi, Beatrice; Romani, Massimo
2005-04-10
The potential role of p16(INK4a) methylation in breast cancer is controversial whereas there are no data on fibroadenoma. To assess if inactivation of p16(INK4a) by promoter hypermethylation occurs in this hyperproliferative benign breast lesion or, on the contrary, it is strictly related to the carcinogenic process, we have tested the different histological components of 15 cases of fibroadenoma and the intraductal and infiltrating components of 15 cases of carcinoma and their adjacent non-tumoral epithelium. All samples were obtained by laser-assisted microdissection. The relationship between promoter methylation status, immunohistochemical protein expression and ki67 proliferative activity was evaluated for each lesion. Our data demonstrate that hypermethylation of p16(INK4a) promoter is a common event occurring at similar frequency in all the different histological areas of the benign and malignant breast lesions taken into exam. Conversely, protein p16 expression, although heterogeneously distributed within the section, is considerably higher in breast carcinoma as compared to fibroadenoma in both tumoral and non-tumoral epithelia and stroma. The protein localization was almost exclusively nuclear in fibroadenoma and non-tumoral epithelia whereas, in carcinoma, the staining was both nuclear and cytoplasmic or cytoplasmic alone. Furthermore, in a subset of fibroadenoma with higher proliferative activity, p16 protein expression was substantially decreased as compared to those showing lower proliferation. We did not observe this association in carcinomas. Our data demonstrate that the hypermethylation of the p16(INK4a) promoter is not specifically associated with malignancy and that, on the contrary, the overexpression of p16 and its cytoplasmic sequestration is a feature of breast carcinoma. (c) 2004 Wiley-Liss, Inc.
Control of autogenous activation of Herbaspirillum seropedicae nifA promoter by the IHF protein.
Wassem, Roseli; Pedrosa, Fábio O; Yates, Marshall G; Rego, Fabiane G M; Chubatsu, Leda S; Rigo, Liu U; Souza, Emanuel M
2002-07-02
Analysis of the expression of the Herbaspirillum seropedicae nifA promoter in Escherichia coli and Herbaspirillum seropedicae, showed that nifA expression is primarily dependent on NtrC but also required NifA for maximal expression under nitrogen-fixing conditions. Deletion of the IHF (integration host factor)-binding site produced a promoter with two-fold higher activity than the native promoter in the H. seropedicae wild-type strain but not in a nifA strain, indicating that IHF controls NifA auto-activation. IHF is apparently required to prevent overexpression of the NifA protein via auto-activation under nitrogen-fixing conditions in H. seropedicae.
Heiss, Silvia; Hörmann, Angelika; Tauer, Christopher; Sonnleitner, Margot; Egger, Esther; Grabherr, Reingard; Heinl, Stefan
2016-03-10
Engineering lactic acid bacteria (LAB) is of growing importance for food and feed industry as well as for in vivo vaccination or the production of recombinant proteins in food grade organisms. Often, expression of a transgene is only desired at a certain time point or period, e.g. to minimize the metabolic burden for the host cell or to control the expression time span. For this purpose, inducible expression systems are preferred, though cost and availability of the inducing agent must be feasible. We selected the plasmid free strain Lactobacillus plantarum 3NSH for testing and characterization of novel inducible promoters/repressor systems. Their feasibility in recombinant protein production was evaluated. Expression of the reporter protein mCherry was monitored with the BioLector(®) micro-fermentation system. Reporter gene mCherry expression was compared under the control of different promoter/repressor systems: PlacA (an endogenous promoter/repressor system derived from L. plantarum 3NSH), PxylA (a promoter/repressor system derived from Bacillus megaterium DSMZ 319) and PlacSynth (synthetic promoter and codon-optimized repressor gene based on the Escherichia coli lac operon). We observed that PlacA was inducible solely by lactose, but not by non-metabolizable allolactose analoga. PxylA was inducible by xylose, yet showed basal expression under non-induced conditions. Growth on galactose (as compared to exponential growth phase on glucose) reduced basal mCherry expression at non-induced conditions. PlacSynth was inducible with TMG (methyl β-D-thiogalactopyranoside) and IPTG (isopropyl β-D-1-thiogalactopyranoside), but also showed basal expression without inducer. The promoter PlacSynth was used for establishment of a dual plasmid expression system, based on T7 RNA polymerase driven expression in L. plantarum. Comparative Western blot supported BioLector(®) micro-fermentation measurements. Conclusively, overall expression levels were moderate (compared to a
CAGE-defined promoter regions of the genes implicated in Rett Syndrome
DEFF Research Database (Denmark)
Vitezic, Morana; Bertin, Nicolas; Andersson, Robin
2014-01-01
BACKGROUND: Mutations in three functionally diverse genes cause Rett Syndrome. Although the functions of Forkhead box G1 (FOXG1), Methyl CpG binding protein 2 (MECP2) and Cyclin-dependent kinase-like 5 (CDKL5) have been studied individually, not much is known about their relation to each other...... reveal the predominantly used transcription start sites (TSSs) for each gene including novel transcription start sites for FOXG1. We show that FOXG1 expression is poorly correlated with the expression of MECP2 and CDKL5. We identify promoter shapes for each TSS, the predicted location of enhancers...
Governmental promotion of the Information Society in the Spanish Region of Valencia
Directory of Open Access Journals (Sweden)
Emilio Feliu-García, Ph.D.
2011-01-01
Full Text Available Regional spheres are considered essential in the governmental promotion of the Information Society at the international level. The regional initiatives in Spain aim to strengthen and complement the initiatives promoted at the national level. This article analyses ICT penetration in the Valencian Community from 1996 to 2008. The objective is to identify which of the actions carried out by the Valencian Regional Government have had a positive effect on its society.The methodology employed in this study is benchmarking. The selection of indicators is based on the policies evaluation model proposed in the Plan Avanza (Spain’s national Information Society strategy. Data were collected from official statistical sources (like Spain’s National Statistics Institute, INE. Three statistical tests were applied to verify the hypotheses (Pearson’s r2, Chi-square and Student’s t.The results indicate that it is not possible to affirm that the actions implemented by the Valencian Regional Government have had a more positive effect on its society than those implemented by the Spanish Central Government. A reason for this may lie in the specific objectives of the political strategy implemented by the Valencian Government, which has focused primarily on e-Government and does not include enough projects centred on the implementation of new technologies in the private sector. Moreover, the integration of new technologies in everyday life is placed in a second level of importance despite citizens are central actors in the international agenda.
The promotion of regional integration of electricity markets: Lessons for developing countries
International Nuclear Information System (INIS)
Oseni, Musiliu O.; Pollitt, Michael G.
2016-01-01
This paper focuses on how to promote regional cooperation in electricity. We begin by discussing the theory of international trade cooperation in electricity, with a view to discussing what preconditions might be important in facilitating wide area trading across national borders. We then develop lessons based on the comparison of four case studies. These include three regional developing country power pools – the Southern African Power pool (SAPP), West African Power pool (WAPP) and the Central American Power Market (MER). We contrast these with Northern Europe's Nord Pool. These cases highlight both the potential and difficulty of having cross-jurisdictional power pools. In the light of the theory and evidence we present, we draw key lessons in the areas of: preconditions for trading; necessary institutional arrangements; practicalities of timetabling; reasons to be hopeful about future prospects. - Highlights: • This paper focuses on how to promote regional electricity cooperation. • We develop lessons based on comparison of four international case studies. • The cases highlight both the potential and difficulty of power pools. • We identify preconditions, institutional arrangements and timetabling. • We conclude that the future prospects for regional power pools are good.
Growth-promoting effect on iron-sulfur proteins on axenic cultures of Entamoeba dispar
Directory of Open Access Journals (Sweden)
Khalifa S.A.M.
2006-03-01
Full Text Available A growth-promoting factor (GPF that promotes the growth of Entamoeba dispar under axenic culture conditions was found in fractions of mitochondria (Mt, hydrogenosomes (Hg and chloroplasts (Cp obtained from cells of six different protozoan, mammalian and plant species. We were able to extract the GPF from the Cp-rich leaf cells of a plant (spiderwort: Commelina communis L. in an acetone-soluble fraction as a complex of chlorophyll with low molecular weight proteins (molecular weight [MW] approximately 4,600. We also found that on treatment with 0.6 % complexes of 2-mercapthoethanol (2ME, complexes of chlorophyll-a with iron-sulphur (Fe-S proteins (e.g., ferredoxins [Fd] from spinach and Clostridium pasteurianum and noncomplex rubredoxin (Rd from C. pasteurianum have a growth-promoting effect on E. dispar. These findings suggest that E. dispar may lack a sufficient quantity of some essential components of Fe-S proteins, such as Fe-S center.
Quantifying Surface Coal-Mining Patterns to Promote Regional Sustainability in Ordos, Inner Mongolia
Directory of Open Access Journals (Sweden)
Xiaoji Zeng
2018-04-01
Full Text Available Ordos became the new “coal capital” of China within a few decades since the country’s economic reform in 1978, as large-scale surface coal mining dramatically propelled its per capita GDP from being one of the lowest to one of the highest in China, exceeding Hong Kong in 2009. Surface coal-mining areas (SCMAs have continued to expand in this region during recent decades, resulting in serious environmental and socioeconomic consequences. To understand these impacts and promote regional sustainability, quantifying the spatiotemporal patterns of SCMAs is urgently needed. Thus, the main objectives of this study were to quantify the spatiotemporal patterns of SCMAs in the Ordos region from 1990 to 2015, and to examine some of the major environmental and socioeconomic impacts in the study region. We extracted the SCMAs using remote-sensing data, and then quantified their spatiotemporal patterns using landscape metrics. The loss of natural habitat and several socioeconomic indicators were examined in relation to surface coal mining. Our results show that the area of SCMAs increased from 7.12 km2 to 355.95 km2, an increase of nearly 49 times from 1990 to 2015 in the Ordos region. The number of SCMAs in this region increased from 82 to 651, a nearly seven-fold increase. In particular, Zhungeer banner (an administrative division, Yijinhuoluo banner, Dongsheng District and Dalate banner in the north-eastern part of the Ordos region had higher growth rates of SCMAs. The income gap between urban and rural residents increased along with the growth in SCMAs, undermining social equity in the Ordos region. Moreover, the rapid increase in SCMAs resulted in natural habitat loss (including grasslands, forests, and deserts across this region. Thus, we suggest that regional sustainability in Ordos needs to emphasize effective measures to curb large-scale surface coal mining in order to reduce the urban–rural income gap, and to restore degraded natural
DEFF Research Database (Denmark)
Christiansen, H; Hansen, A C; Vijn, I
1996-01-01
The pea genes PsENOD12A and PsENOD12B are expressed in the root hairs shortly after infection with the nitrogen-fixing bacterium Rhizobium leguminosarum bv. viciae or after application of purified Nod factors. A 199 bp promoter fragment of the PsENOD12B gene contains sufficient information for Nod...... factor-induced tissue-specific expression. We have isolated a Vicia sativa cDNA encoding a 1641 amino acid protein, ENBP1, that interacts with the 199 bp ENOD12 promoter. Two different DNA-binding domains were identified in ENBP1. A domain containing six AT-hooks interacts specifically with an AT...... of the ENBP1 transcript in cells expressing ENOD12 strongly suggest that ENBP1 is a transcription factor involved in the regulation of ENOD12. Finally, the C-terminal region of ENBP1 shows strong homology to a protein from rat that is specifically expressed in testis tissue. Udgivelsesdato: 1996-Dec...
Ubiquitin-like protein UBL5 promotes the functional integrity of the Fanconi anemia pathway.
Oka, Yasuyoshi; Bekker-Jensen, Simon; Mailand, Niels
2015-05-12
Ubiquitin and ubiquitin-like proteins (UBLs) function in a wide array of cellular processes. UBL5 is an atypical UBL that does not form covalent conjugates with cellular proteins and which has a known role in modulating pre-mRNA splicing. Here, we report an unexpected involvement of human UBL5 in promoting the function of the Fanconi anemia (FA) pathway for repair of DNA interstrand crosslinks (ICLs), mediated by a specific interaction with the central FA pathway component FANCI. UBL5-deficient cells display spliceosome-independent reduction of FANCI protein stability, defective FANCI function in response to DNA damage and hypersensitivity to ICLs. By mapping the sequence determinants underlying UBL5-FANCI binding, we generated separation-of-function mutants to demonstrate that key aspects of FA pathway function, including FANCI-FANCD2 heterodimerization, FANCD2 and FANCI monoubiquitylation and maintenance of chromosome stability after ICLs, are compromised when the UBL5-FANCI interaction is selectively inhibited by mutations in either protein. Together, our findings establish UBL5 as a factor that promotes the functionality of the FA DNA repair pathway. © 2015 The Authors.
Ho, Steven C L; Yang, Yuansheng
2014-08-01
Promoters are essential on plasmid vectors to initiate transcription of the transgenes when generating therapeutic recombinant proteins expressing mammalian cell lines. High and sustained levels of gene expression are desired during therapeutic protein production while gene expression is useful for cell engineering. As many finely controlled promoters exhibit cell and product specificity, new promoters need to be identified, optimized and carefully evaluated before use. Suitable promoters can be identified using techniques ranging from simple molecular biology methods to modern high-throughput omics screenings. Promoter engineering is often required after identification to either obtain high and sustained expression or to provide a wider range of gene expression. This review discusses some of the available methods to identify and engineer promoters for therapeutic recombinant protein expression in mammalian cells.
Qing, Hua; Aono, Jun; Findeisen, Hannes M; Jones, Karrie L; Heywood, Elizabeth B; Bruemmer, Dennis
2016-06-01
Telomerase reverse transcriptase (TERT) maintains telomeres and is rate limiting for replicative life span. While most somatic tissues silence TERT transcription resulting in telomere shortening, cells derived from cancer or cardiovascular diseases express TERT and activate telomerase. In the present study, we demonstrate that histone deacetylase (HDAC) inhibition induces TERT transcription and promoter activation. At the protein level in contrast, HDAC inhibition decreases TERT protein abundance through enhanced degradation, which decreases telomerase activity and induces senescence. Finally, we demonstrate that HDAC inhibition decreases TERT expression during vascular remodeling in vivo. These data illustrate a differential regulation of TERT transcription and protein stability by HDAC inhibition and suggest that TERT may constitute an important target for the anti-proliferative efficacy of HDAC inhibitors. © 2015 Wiley Periodicals, Inc.
Tumor promoter induced membrane-bound protein kinase C - its influence on hematogenous metastasis
International Nuclear Information System (INIS)
Gopalakrishna, R.; Barsky, S.H.
1987-01-01
A correlation between the amount of membrane-bound detergent-extractable protein kinase C activity in various B16 melanoma sublines (F10, F1, BL6) and their lung metastasizing abilities following intravenous injection was found. The F10 subline which exhibits higher metastasizing ability was found to have higher membrane-bound protein kinase C compared to the lower metastasizing subline, F1. Treatment of F1 cells with 100 nM 12-0 tetradecanoylphorbol-13-acetate (TPA) for 1h resulted in 90% decrease in protein kinase C activity in the cytosol with a concommitent increase in membrane-bound activity. These TPA-treated cells when injected intravenously in C57BL/6 mice produced 6-fold increase in pulmonary metastases compared to untreated F1 cells. However, biologically inactive analogues 4 α-phorbol 12,13-didecanoate and phorbol 13-acetate had no effect on either membrane-bound protein kinase C activity or pulmonary metastases. Treating F1 cells with the second-stage tumor promoter, mezerin, resulted in increase in both membrane association of protein kinase C and also lung metastases. Thus, these results strongly suggests that membrane associated protein kinase C activity influences hematogenous metastasis of these melanoma cells
Total protein and cholesterol concentrations in brain regions of male ...
African Journals Online (AJOL)
The results showed similarities (P>0.05) between the treatments in total protein concentrations in the cerebral cortex, medulla, hypothalamus, amygdala, mesencephalon and hippocampus. Total protein concentrations however differed significantly between diets (P<0.05) in the cerebellum and pons varoli with the lowest ...
Directory of Open Access Journals (Sweden)
Popović Svetlana S.
2011-01-01
Full Text Available Membrane filtration has become one of the major technologies in the food industry. It is widely applied in the dairy industry, and it is mostly used for the concentration and fractionation of milk proteins and for the whey processing. Of all pressure driven membrane processes, ultrafiltration is the most widely used. The major disadvantage of pressure driven membrane processes is severe fouling of membrane during filtration particularly when the fluids containing proteins are processed. Fouling with proteins is complex phenomenon because it occurs at the membrane surface as well as in the pores of membrane, and depends on the operating conditions and on the interactions of proteins and membrane material. In order to reduce fouling of the membrane different techniques have been developed, and one of them relies on the changing of the hydrodynamic conditions in the membrane or module. In this study, influence of twisted tape turbulence promoters on the fouling reduction in cross-flow microfiltration of skim milk was investigated. Twisted tapes with tree characteristic ratios of helix element length to the tape diameter (aspect ratio were studied. It was shown that twisted tapes with different aspect ratios reduce fouling of membrane by a factor of three or more. The presence of twisted tape induces changes in the flow patterns from straight to helicoidally thus producing turbulence flow at the lower cross-flow rates. Turbulence intensification prevents accumulation of proteins at membrane surface enabling reduction in reversible fouling what results in the reduction of overall membrane fouling. The best performance was achieved using a twisted tape with the lowest aspect ratio of 1.0. This promoter reduces fouling seven times at low transmembrane pressure and low cross-flow velocity. The twisted tape with aspect ratio 1.0 induces the most intensive turbulence, the longest helicoidal flow path, and appearance of vortices near the membrane surfaces
Boundary Dpp promotes growth of medial and lateral regions of the Drosophila wing.
Barrio, Lara; Milán, Marco
2017-07-04
The gradient of Decapentaplegic (Dpp) in the Drosophila wing has served as a paradigm to characterize the role of morphogens in regulating patterning. However, the role of this gradient in regulating tissue size is a topic of intense debate as proliferative growth is homogenous. Here, we combined the Gal4/UAS system and a temperature-sensitive Gal80 molecule to induce RNAi-mediated depletion of dpp and characterise the spatial and temporal requirement of Dpp in promoting growth. We show that Dpp emanating from the AP compartment boundary is required throughout development to promote growth by regulating cell proliferation and tissue size. Dpp regulates growth and proliferation rates equally in central and lateral regions of the developing wing appendage and reduced levels of Dpp affects similarly the width and length of the resulting wing. We also present evidence supporting the proposal that graded activity of Dpp is not an absolute requirement for wing growth.
Systematic screening for mutations in the promoter and the coding region of the 5-HT{sub 1A} gene
Energy Technology Data Exchange (ETDEWEB)
Erdmann, J.; Shimron-Abarbanell, D.; Cichon, S. [Univ. of Bonn (Germany)] [and others
1995-10-09
In the present study we sought to identify genetic variation in the 5-HT{sub 1A} receptor gene which through alteration of protein function or level of expression might contribute to the genetic predisposition to neuropsychiatric diseases. Genomic DNA samples from 159 unrelated subjects (including 45 schizophrenic, 46 bipolar affective, and 43 patients with Tourette`s syndrome, as well as 25 healthy controls) were investigated by single-strand conformation analysis. Overlapping PCR (polymerase chain reaction) fragments covered the whole coding sequence as well as the 5{prime} untranslated region of the 5-HT{sub 1A} gene. The region upstream to the coding sequence we investigated contains a functional promoter. We found two rare nucleotide sequence variants. Both mutations are located in the coding region of the gene: a coding mutation (A{yields}G) in nucleotide position 82 which leads to an amino acid exchange (Ile{yields}Val) in position 28 of the receptor protein and a silent mutation (C{yields}T) in nucleotide position 549. The occurrence of the Ile-28-Val substitution was studied in an extended sample of patients (n = 352) and controls (n = 210) but was found in similar frequencies in all groups. Thus, this mutation is unlikely to play a significant role in the genetic predisposition to the diseases investigated. In conclusion, our study does not provide evidence that the 5-HT{sub 1A} gene plays either a major or a minor role in the genetic predisposition to schizophrenia, bipolar affective disorder, or Tourette`s syndrome. 29 refs., 4 figs., 1 tab.
Saify, Khyber; Saadat, Iraj; Saadat, Mostafa
2014-11-30
Within the core promoter region of prodynorphin (PDYN), a 68-bp sequence was found to occur as a polymorphism element, either singular or as tandemly repeated two, three or four times. We report the sequence of a novel allele (5-repeats). Our study revealed the existence of an ancestral nucleotide (A) at 29th position of the VNTR in human. In total, 442 heroin addicts and 799 controls were included in this study. The present findings revealed a male-limited association between VNTR polymorphism and heroin dependence risk. Copyright © 2014 Elsevier Ireland Ltd. All rights reserved.
Directory of Open Access Journals (Sweden)
Manuel Hiss
2017-10-01
Full Text Available The moss Physcomitrella patens is used both as an evo-devo model and biotechnological production system for metabolites and pharmaceuticals. Strong in vivo expression of genes of interest is important for production of recombinant proteins, e.g., selectable markers, fluorescent proteins, or enzymes. In this regard, the choice of the promoter sequence as well as codon usage optimization are two important inside factors to consider in order to obtain optimum protein accumulation level. To reliably quantify fluorescence, we transfected protoplasts with promoter:GFP fusion constructs and measured fluorescence intensity of living protoplasts in a plate reader system. We used the red fluorescent protein mCherry under 2x 35S promoter control as second reporter to normalize for different transfection efficiencies. We derived a novel endogenous promoter and compared deletion variants with exogenous promoters. We used different codon-adapted green fluorescent protein (GFP genes to evaluate the influence of promoter choice and codon optimization on protein accumulation in P. patens, and show that the promoter of the gene of P. patens chlorophyll a/b binding protein lhcsr1 drives expression of GFP in protoplasts significantly (more than twofold better than the commonly used 2x 35S promoter or the rice actin1 promoter. We identified a shortened 677 bp version of the lhcsr1 promoter that retains full activity in protoplasts. The codon optimized GFP yields significantly (more than twofold stronger fluorescence signals and thus demonstrates that adjusting codon usage in P. patens can increase expression strength. In combination, new promotor and codon optimized GFP conveyed sixfold increased fluorescence signal.
Moustafa, Savvina; Karakasiliotis, Ioannis; Mavromara, Penelope
2018-05-01
Viruses often encompass overlapping reading frames and unconventional translation mechanisms in order to maximize the output from a minimum genome and to orchestrate their timely gene expression. Hepatitis C virus (HCV) possesses such an unconventional open reading frame (ORF) within the core-coding region, encoding an additional protein, initially designated ARFP, F, or core+1. Two predominant isoforms of core+1/ARFP have been reported, core+1/L, initiating from codon 26, and core+1/S, initiating from codons 85/87 of the polyprotein coding region. The biological significance of core+1/ARFP expression remains elusive. The aim of the present study was to gain insight into the functional and pathological properties of core+1/ARFP through its interaction with the host cell, combining in vitro and in vivo approaches. Our data provide strong evidence that the core+1/ARFP of HCV-1a stimulates cell proliferation in Huh7-based cell lines expressing either core+1/S or core+1/L isoforms and in transgenic liver disease mouse models expressing core+1/S protein in a liver-specific manner. Both isoforms of core+1/ARFP increase the levels of cyclin D1 and phosphorylated Rb, thus promoting the cell cycle. In addition, core+1/S was found to enhance liver regeneration and oncogenesis in transgenic mice. The induction of the cell cycle together with increased mRNA levels of cell proliferation-related oncogenes in cells expressing the core+1/ARFP proteins argue for an oncogenic potential of these proteins and an important role in HCV-associated pathogenesis. IMPORTANCE This study sheds light on the biological importance of a unique HCV protein. We show here that core+1/ARFP of HCV-1a interacts with the host machinery, leading to acceleration of the cell cycle and enhancement of liver carcinogenesis. This pathological mechanism(s) may complement the action of other viral proteins with oncogenic properties, leading to the development of hepatocellular carcinoma. In addition, given that
Energy Technology Data Exchange (ETDEWEB)
Galzitskaya, Oxana V; Garbuzynskiy, Sergiy O; Lobanov, Michail Yu [Institute of Protein Research, Russian Academy of Sciences, 142290, Pushchino, Moscow Region (Russian Federation)
2007-07-18
The determination of factors that influence conformational changes in proteins is very important for the identification of potentially amyloidogenic and disordered regions in polypeptide chains. In our work we introduce a new parameter, mean packing density, to detect both amyloidogenic and disordered regions in a protein sequence. It has been shown that regions with strong expected packing density are responsible for amyloid formation. Our predictions are consistent with known disease-related amyloidogenic regions for 9 of 12 amyloid-forming proteins and peptides in which the positions of amyloidogenic regions have been revealed experimentally. Our findings support the concept that the mechanism of formation of amyloid fibrils is similar for different peptides and proteins. Moreover, we have demonstrated that regions with weak expected packing density are responsible for the appearance of disordered regions. Our method has been tested on datasets of globular proteins and long disordered protein segments, and it shows improved performance over other widely used methods. Thus, we demonstrate that the expected packing density is a useful value for predicting both disordered and amyloidogenic regions of a protein based on sequence alone. Our results are important for understanding the structural characteristics of protein folding and misfolding.
Butler, Nathaniel M; Hannapel, David J
2012-12-01
Polypyrimidine tract-binding (PTB) proteins are RNA-binding proteins that target specific RNAs for post-transcriptional processing by binding cytosine/uracil motifs. PTBs have established functions in a range of RNA processes including splicing, translation, stability and long-distance transport. Six PTB-like genes identified in potato have been grouped into two clades based on homology to other known plant PTBs. StPTB1 and StPTB6 are closely related to a PTB protein discovered in pumpkin, designated CmRBP50, and contain four canonical RNA-recognition motifs. CmRBP50 is expressed in phloem tissues and functions as the core protein of a phloem-mobile RNA/protein complex. Sequence from the potato genome database was used to clone the upstream sequence of these two PTB genes and analyzed to identify conserved cis-elements. The promoter of StPTB6 was enriched for regulatory elements for light and sucrose induction and defense. Upstream sequence of both PTB genes was fused to β-glucuronidase and monitored in transgenic potato lines. In whole plants, the StPTB1 promoter was most active in leaf veins and petioles, whereas StPTB6 was most active in leaf mesophyll. Both genes are active in new tubers and tuber sprouts. StPTB6 expression was induced in stems and stolon sections in response to sucrose and in leaves or petioles in response to light, heat, drought and mechanical wounding. These results show that CmRBP50-like genes of potato exhibit distinct expression patterns and respond to both developmental and environmental cues.
Li, Gongyu; Yuan, Siming; Zheng, Shihui; Chen, Yuting; Zheng, Zhen; Liu, Yangzhong; Huang, Guangming
2017-12-01
Specific protein-metal interactions (PMIs) fulfill essential functions in cells and organic bodies, and activation of these functions in vivo are mostly modulated by the complex environmental factors, including pH value, small biomolecules, and salts. Specifically, the role of salts in promoting specific PMIs and their competition among various metals has remained untapped mainly due to the difficulty to distinguish nonspecific PMIs from specific PMIs by classic spectroscopic techniques. Herein, we report Hofmeister salts differentially promote the specific PMIs by combining nanoelectrospray ionization mass spectrometry and spectroscopic techniques (fluorescence measurement and circular dichroism). Furthermore, to explore the influence of salts in competitive binding between metalloproteins and various metals, we designed a series of competitive experiments and applied to a well-defined model system, the competitive binding of zinc (II) and arsenic (III) to holo-promyelocytic leukemia protein (PML). These experiments not only provided new insights at the molecular scale as complementary to previous NMR and spectroscopic results, but also deduced the relative binding ability between zinc finger proteins and metals at the molecular scale, which avoids the mass spectrometric titration-based determination of binding constants that is frequently affected and often degraded by variable solution conditions including salt contents. [Figure not available: see fulltext.
Kandasamy, Saveetha; Loganathan, Karthiba; Muthuraj, Raveendran; Duraisamy, Saravanakumar; Seetharaman, Suresh; Thiruvengadam, Raguchander; Ponnusamy, Balasubramanian; Ramasamy, Samiyappan
2009-12-24
Plant Growth Promoting Rhizobacteria (PGPR), Pseudomonas fluorescens strain KH-1 was found to exhibit plant growth promotional activity in rice under both in-vitro and in-vivo conditions. But the mechanism underlying such promotional activity of P. fluorescens is not yet understood clearly. In this study, efforts were made to elucidate the molecular responses of rice plants to P. fluorescens treatment through protein profiling. Two-dimensional polyacrylamide gel electrophoresis strategy was adopted to identify the PGPR responsive proteins and the differentially expressed proteins were analyzed by mass spectrometry. Priming of P. fluorescens, 23 different proteins found to be differentially expressed in rice leaf sheaths and MS analysis revealed the differential expression of some important proteins namely putative p23 co-chaperone, Thioredoxin h- rice, Ribulose-bisphosphate carboxylase large chain precursor, Nucleotide diPhosphate kinase, Proteosome sub unit protein and putative glutathione S-transferase protein. Functional analyses of the differential proteins were reported to be directly or indirectly involved in growth promotion in plants. Thus, this study confirms the primary role of PGPR strain KH-1 in rice plant growth promotion.
Directory of Open Access Journals (Sweden)
Thiruvengadam Raguchander
2009-12-01
Full Text Available Abstract Background Plant Growth Promoting Rhizobacteria (PGPR, Pseudomonas fluorescens strain KH-1 was found to exhibit plant growth promotional activity in rice under both in-vitro and in-vivo conditions. But the mechanism underlying such promotional activity of P. fluorescens is not yet understood clearly. In this study, efforts were made to elucidate the molecular responses of rice plants to P. fluorescens treatment through protein profiling. Two-dimensional polyacrylamide gel electrophoresis strategy was adopted to identify the PGPR responsive proteins and the differentially expressed proteins were analyzed by mass spectrometry. Results Priming of P. fluorescens, 23 different proteins found to be differentially expressed in rice leaf sheaths and MS analysis revealed the differential expression of some important proteins namely putative p23 co-chaperone, Thioredoxin h- rice, Ribulose-bisphosphate carboxylase large chain precursor, Nucleotide diPhosphate kinase, Proteosome sub unit protein and putative glutathione S-transferase protein. Conclusion Functional analyses of the differential proteins were reported to be directly or indirectly involved in growth promotion in plants. Thus, this study confirms the primary role of PGPR strain KH-1 in rice plant growth promotion.
DEFF Research Database (Denmark)
Frikke-Schmidt, R.; Nordestgaard, Børge; Grande, Peer
2008-01-01
Objectives This study was designed to test the hypotheses that single nucleotide polymorphisms ( SNPs), in zinc finger protein 202 ( ZNF202), predict severe atherosclerosis and ischemic heart disease ( IHD). Background ZNF202 is a transcriptional repressor controlling promoter elements in genes...... involved in vascular maintenance and lipid metabolism. Methods We first determined genotype association for 9 ZNF202 SNPs with severe atherosclerosis ( ankle brachial index >0.7 vs. ...,998 controls. Finally, we determined whether g. -660A>G altered transcriptional activity of the ZNF202 promoter in vitro. Results Cross-sectionally, ZNF202 g. -660 GG versus AA homozygosity predicted an odds ratio for severe atherosclerosis of 2.01 ( 95% confidence interval [CI]: 1.34 to 3.01). Prospectively...
Alam, Tanvir; Medvedeva, Yulia A.; Jia, Hui; Brown, James B.; Lipovich, Leonard; Bajic, Vladimir B.
2014-01-01
raise the possibility that, given the historical reliance on protein-coding gene catalogs to define the chromatin states of active promoters, a revision of these chromatin signature profiles to incorporate expressed lncRNA genes is warranted
Directory of Open Access Journals (Sweden)
Dawid Krokowski
2017-12-01
Full Text Available Summary: GADD34, a stress-induced regulatory subunit of the phosphatase PP1, is known to function in hyperosmotic stress through its well-known role in the integrated stress response (ISR pathway. Adaptation to hyperosmotic stress is important for the health of corneal epithelial cells exposed to changes in extracellular osmolarity, with maladaptation leading to dry eye syndrome. This adaptation includes induction of SNAT2, an endoplasmic reticulum (ER-Golgi-processed protein, which helps to reverse the stress-induced loss of cell volume and promote homeostasis through amino acid uptake. Here, we show that GADD34 promotes the processing of proteins synthesized on the ER during hyperosmotic stress independent of its action in the ISR. We show that GADD34/PP1 phosphatase activity reverses hyperosmotic-stress-induced Golgi fragmentation and is important for cis- to trans-Golgi trafficking of SNAT2, thereby promoting SNAT2 plasma membrane localization and function. These results suggest that GADD34 is a protective molecule for ocular diseases such as dry eye syndrome. : Here, Krokowski et al. show that GADD34/PP1 protects the microtubule network, prevents Golgi fragmentation, and preserves protein trafficking independent of its action in the integrated stress response (ISR. In osmoadaptation, GADD34 facilitates trans-Golgi-mediated processing of the endoplasmic reticulum (ER-synthesized amino acid transporter SNAT2, which in turn increases amino acid uptake. Keywords: SNAT2, GADD34, hyperosmotic stress, amino acid transport, Golgi fragmentation, ISR
International Nuclear Information System (INIS)
Sangsuwan, Jiraporn; Wanichpakorn, Supreya; Kedjarune-Leggat, Ureporn
2015-01-01
The objective of this study was to evaluate the effect of translationally controlled tumor protein (TCTP) supplemented in a novel glass ionomer cement (BIO-GIC) on normal human osteoblasts (NHost cells). BIO-GIC was a glass ionomer cement (GIC) modified by adding chitosan and albumin to promote the release of TCTP. NHost cells were seeded on specimens of GIC, GIC + TCTP, BIO-GIC and BIO-GIC + TCTP. Cell proliferation was determined by BrdU assay. It was found that BIO-GIC + TCTP had significantly higher proliferation of cells than other specimens. Bone morphogenetic protein-2 (BMP-2) and osteopontin (OPN) gene expressions assessed by quantitative real time PCR and alkaline phosphatase (ALP) activity were used to determine cell differentiation. Bone cell function was investigated by calcium deposition using alizarin assay. Both BMP-2 and OPN gene expressions of cells cultured on specimens with added TCTP increased gradually up-regulation after day 1 and reached the highest on day 3 then down-regulation on day 7. The ALP activity of cells cultured on BIO-GIC + TCTP for 7 days and calcium content after 14 days were significantly higher than other groups. BIO-GIC + TCTP can promote osteoblast cells proliferation, differentiation and function. - Highlights: • Developed a new GIC by supplementing TCTP in BIO-GIC (GIC with chitosan and albumin) • BIO-GIC + TCTP released a higher amount of TCTP than GIC + TCTP. • BIO-GIC + TCTP promoted cell proliferation higher than other specimens and control. • BIO-GIC + TCTP promoted osteoblasts differentiation and function
Energy Technology Data Exchange (ETDEWEB)
Sangsuwan, Jiraporn [Department of Molecular Biology and Bioinformatics, Center for Genomics and Bioinformatics Research, Faculty of Science, Prince of Songkla University, Hat Yai, Songkhla 90112 (Thailand); Department of Oral Biology and Occlusion, Faculty of Dentistry, Prince of Songkla University, Hat Yai, Songkhla 90112 (Thailand); Wanichpakorn, Supreya; Kedjarune-Leggat, Ureporn [Department of Oral Biology and Occlusion, Faculty of Dentistry, Prince of Songkla University, Hat Yai, Songkhla 90112 (Thailand)
2015-09-01
The objective of this study was to evaluate the effect of translationally controlled tumor protein (TCTP) supplemented in a novel glass ionomer cement (BIO-GIC) on normal human osteoblasts (NHost cells). BIO-GIC was a glass ionomer cement (GIC) modified by adding chitosan and albumin to promote the release of TCTP. NHost cells were seeded on specimens of GIC, GIC + TCTP, BIO-GIC and BIO-GIC + TCTP. Cell proliferation was determined by BrdU assay. It was found that BIO-GIC + TCTP had significantly higher proliferation of cells than other specimens. Bone morphogenetic protein-2 (BMP-2) and osteopontin (OPN) gene expressions assessed by quantitative real time PCR and alkaline phosphatase (ALP) activity were used to determine cell differentiation. Bone cell function was investigated by calcium deposition using alizarin assay. Both BMP-2 and OPN gene expressions of cells cultured on specimens with added TCTP increased gradually up-regulation after day 1 and reached the highest on day 3 then down-regulation on day 7. The ALP activity of cells cultured on BIO-GIC + TCTP for 7 days and calcium content after 14 days were significantly higher than other groups. BIO-GIC + TCTP can promote osteoblast cells proliferation, differentiation and function. - Highlights: • Developed a new GIC by supplementing TCTP in BIO-GIC (GIC with chitosan and albumin) • BIO-GIC + TCTP released a higher amount of TCTP than GIC + TCTP. • BIO-GIC + TCTP promoted cell proliferation higher than other specimens and control. • BIO-GIC + TCTP promoted osteoblasts differentiation and function.
Exogenous fatty acid binding protein 4 promotes human prostate cancer cell progression.
Uehara, Hisanori; Takahashi, Tetsuyuki; Oha, Mina; Ogawa, Hirohisa; Izumi, Keisuke
2014-12-01
Epidemiologic studies have found that obesity is associated with malignant grade and mortality in prostate cancer. Several adipokines have been implicated as putative mediating factors between obesity and prostate cancer. Fatty acid binding protein 4 (FABP4), a member of the cytoplasmic fatty acid binding protein multigene family, was recently identified as a novel adipokine. Although FABP4 is released from adipocytes and mean circulating concentrations of FABP4 are linked with obesity, effects of exogenous FABP4 on prostate cancer progression are unclear. In this study, we examined the effects of exogenous FABP4 on human prostate cancer cell progression. FABP4 treatment promoted serum-induced prostate cancer cell invasion in vitro. Furthermore, oleic acid promoted prostate cancer cell invasion only if FABP4 was present in the medium. These promoting effects were reduced by FABP4 inhibitor, which inhibits FABP4 binding to fatty acids. Immunostaining for FABP4 showed that exogenous FABP4 was taken up into DU145 cells in three-dimensional culture. In mice, treatment with FABP4 inhibitor reduced the subcutaneous growth and lung metastasis of prostate cancer cells. Immunohistochemical analysis showed that the number of apoptotic cells, positive for cleaved caspase-3 and cleaved PARP, was increased in subcutaneous tumors of FABP4 inhibitor-treated mice, as compared with control mice. These results suggest that exogenous FABP4 might promote human prostate cancer cell progression by binding with fatty acids. Additionally, exogenous FABP4 activated the PI3K/Akt pathway, independently of binding to fatty acids. Thus, FABP4 might be a key molecule to understand the mechanisms underlying the obesity-prostate cancer progression link. © 2014 UICC.
Roth Flach, Rachel J; Danai, Laura V; DiStefano, Marina T; Kelly, Mark; Menendez, Lorena Garcia; Jurczyk, Agata; Sharma, Rohit B; Jung, Dae Young; Kim, Jong Hun; Kim, Jason K; Bortell, Rita; Alonso, Laura C; Czech, Michael P
2016-07-29
Previous studies revealed a paradox whereby mitogen-activated protein kinase kinase kinase kinase 4 (Map4k4) acted as a negative regulator of insulin sensitivity in chronically obese mice, yet systemic deletion of Map4k4 did not improve glucose tolerance. Here, we report markedly reduced glucose-responsive plasma insulin and C-peptide levels in whole body Map4k4-depleted mice (M4K4 iKO) as well as an impaired first phase of insulin secretion from islets derived from M4K4 iKO mice ex vivo After long-term high fat diet (HFD), M4K4 iKO mice pancreata also displayed reduced β cell mass, fewer proliferating β cells and reduced islet-specific gene mRNA expression compared with controls, although insulin content was normal. Interestingly, the reduced plasma insulin in M4K4 iKO mice exposed to chronic (16 weeks) HFD was not observed in response to acute HFD challenge or short term treatment with the insulin receptor antagonist S961. Furthermore, the improved insulin sensitivity in obese M4K4 iKO mice was abrogated by high exogenous insulin over the course of a euglycemic clamp study, indicating that hypoinsulinemia promotes insulin sensitivity in chronically obese M4K4 iKO mice. These results demonstrate that protein kinase Map4k4 drives obesity-induced hyperinsulinemia and insulin resistance in part by promoting insulin secretion from β cells in mice. © 2016 by The American Society for Biochemistry and Molecular Biology, Inc.
Wei, Yongwei; Feng, Kurtis; Yao, Xiangjie; Cai, Hui; Li, Junan; Mirza, Anne M.; Iorio, Ronald M.
2012-01-01
The genus Metapneumovirus within the subfamily Pneumovirinae of the family Paramyxoviridae includes two members, human metapneumovirus (hMPV) and avian metapneumovirus (aMPV), causing respiratory tract infections in humans and birds, respectively. Paramyxoviruses enter host cells by fusing the viral envelope with a host cell membrane. Membrane fusion of hMPV appears to be unique, in that fusion of some hMPV strains requires low pH. Here, we show that the fusion (F) proteins of aMPV promote fusion in the absence of the attachment protein and low pH is not required. Furthermore, there are notable differences in cell-cell fusion among aMPV subtypes. Trypsin was required for cell-cell fusion induced by subtype B but not subtypes A and C. The F protein of aMPV subtype A was highly fusogenic, whereas those from subtypes B and C were not. By construction and evaluation of chimeric F proteins composed of domains from the F proteins of subtypes A and B, we localized a region composed of amino acid residues 170 to 338 in the F protein that is responsible for the hyperfusogenic phenotype of the F from subtype A. Further mutagenesis analysis revealed that residues R295, G297, and K323 in this region collectively contributed to the hyperfusogenicity. Taken together, we have identified a region in the aMPV F protein that modulates the extent of membrane fusion. A model for fusion consistent with these data is presented. PMID:22915815
A liver stress-endocrine nexus promotes metabolic integrity during dietary protein dilution
DEFF Research Database (Denmark)
Maida, Adriano; Zota, Annika; Sjøberg, Kim Anker
2016-01-01
of impaired glucose homeostasis independently of obesity and food intake. DPD-mediated metabolic inefficiency and improvement of glucose homeostasis were independent of uncoupling protein 1 (UCP1), but required expression of liver-derived fibroblast growth factor 21 (FGF21) in both lean and obese mice. FGF21...... expression and secretion as well as the associated metabolic remodeling induced by DPD also required induction of liver-integrated stress response-driven nuclear protein 1 (NUPR1). Insufficiency of select nonessential amino acids (NEAAs) was necessary and adequate for NUPR1 and subsequent FGF21 induction...... and secretion in hepatocytes in vitro and in vivo. Taken together, these data indicate that DPD promotes improved glucose homeostasis through an NEAA insufficiency-induced liver NUPR1/FGF21 axis....
Directory of Open Access Journals (Sweden)
Eleanna Stamatakou
Full Text Available Upon arrival at their synaptic targets, axons slow down their growth and extensively remodel before the assembly of presynaptic boutons. Wnt proteins are target-derived secreted factors that promote axonal remodelling and synaptic assembly. In the developing spinal cord, Wnts secreted by motor neurons promote axonal remodelling of NT-3 responsive dorsal root ganglia neurons. Axon remodelling induced by Wnts is characterised by growth cone pausing and enlargement, processes that depend on the re-organisation of microtubules. However, the contribution of the actin cytoskeleton has remained unexplored. Here, we demonstrate that Wnt3a regulates the actin cytoskeleton by rapidly inducing F-actin accumulation in growth cones from rodent DRG neurons through the scaffold protein Dishevelled-1 (Dvl1 and the serine-threonine kinase Gsk3β. Importantly, these changes in actin cytoskeleton occurs before enlargement of the growth cones is evident. Time-lapse imaging shows that Wnt3a increases lamellar protrusion and filopodia velocity. In addition, pharmacological inhibition of actin assembly demonstrates that Wnt3a increases actin dynamics. Through a yeast-two hybrid screen, we identified the actin-binding protein Eps8 as a direct interactor of Dvl1, a scaffold protein crucial for the Wnt signalling pathway. Gain of function of Eps8 mimics Wnt-mediated axon remodelling, whereas Eps8 silencing blocks the axon remodelling activity of Wnt3a. Importantly, blockade of the Dvl1-Eps8 interaction completely abolishes Wnt3a-mediated axonal remodelling. These findings demonstrate a novel role for Wnt-Dvl1 signalling through Eps8 in the regulation of axonal remodeling.
Muhle, Rebecca A.; Adjalley, Sophie; Falkard, Brie; Nkrumah, Louis J.; Muhle, Michael E.; Fidock, David A.
2009-01-01
Questions surround the mechanism of mutually exclusive expression by which Plasmodium falciparum mediates activation and silencing of var genes. These encode PfEMP1 proteins, which function as cytoadherent and immunomodulatory molecules at the surface of parasitized erythrocytes. Current evidence suggests that promoter silencing by var introns might play a key role in var gene regulation. To evaluate the impact of cis-acting regulatory regions on var silencing, we generated P. falciparum lines in which luciferase was placed under the control of an UpsA var promoter. By utilizing the Bxb1 integrase system, these reporter cassettes were targeted to a genomic region that was not in apposition to var sub-telomeric domains. This eliminated possible effects from surrounding telomeric elements and removed the variability inherent in episomal systems. Studies with highly synchronized parasites revealed that the UpsA element possessed minimal activity in comparison with a heterologous (hrp3) promoter. This may well result from the integrated UpsA promoter being largely silenced by the neighboring cg6 promoter. Our analyses also revealed that the DownsA 3’ untranslated region further decreased the luciferase activity from both cassettes, whereas the var A intron repressed the UpsA promoter specifically. By applying multivariate analysis over the entire cell cycle, we confirmed the significance of these cis-elements and found the parasite stage to be the major factor regulating UpsA promoter activity. Additionally, we observed that the UpsA promoter was capable of nucleating reversible silencing that spread to a downstream promoter. We believe these studies are the first to analyze promoter activity of Group A var genes which have been implicated in severe malaria, and support the model that var introns can further suppress var expression. These data also suggest an important suppressive role for the DownsA terminator. Our findings imply the existence of multiple levels of
Villaverde, A; Ventanas, J; Estévez, M
2014-12-01
The role played by curing agents (nitrite, ascorbate) on protein oxidation and Strecker aldehyde formation is studied. To fulfill this objective, increasing concentrations of nitrite (0, 75 and 150ppm) and ascorbate (0, 250 and 500ppm) were added to sausages subjected to a 54day drying process. The concurrence of intense proteolysis, protein carbonylation and formation of Strecker aldehydes during processing of sausages suggests that α-aminoadipic semialdehyde (AAS) and γ-glutamic semialdehyde (GGS) may be implicated in the formation of Strecker aldehydes. The fact that nitrite (150ppm, ingoing amount) significantly promoted the formation of protein carbonyls at early stages of processing and the subsequent formation of Strecker aldehydes provides strength to this hypothesis. Ascorbate (125 and 250ppm) controlled the overall extent of protein carbonylation in sausages without declining the formation of Strecker aldehydes. These results may contribute to understanding the chemistry fundamentals of the positive influence of nitrite on the flavor and overall acceptability of cured muscle foods. Copyright © 2014 Elsevier Ltd. All rights reserved.
The membrane protein LasM Promotes the Culturability of Legionella pneumophila in Water
Directory of Open Access Journals (Sweden)
Laam Li
2016-09-01
Full Text Available The water-borne pathogen Legionella pneumophila (Lp strongly expresses the lpg1659 gene in water. This gene encodes a hypothetical protein predicted to be a membrane protein using in silico analysis. While no conserved domains were identified in Lpg1659, similar proteins are found in many Legionella species and other aquatic bacteria. RT-qPCR showed that lpg1659 is positively regulated by the alternative sigma factor RpoS, which is essential for Lp to survive in water. These observations suggest an important role of this novel protein in the survival of Lp in water. Deletion of lpg1659 did not affect cell morphology, membrane integrity or tolerance to high temperature. Moreover, lpg1659 was dispensable for growth of Lp in rich medium, and during infection of the amoeba Acanthamoeba castellanii and of THP-1 human macrophages. However, deletion of lpg1659 resulted in an early loss of culturability in water, while over-expression of this gene promoted the culturability of Lp. Therefore, these results suggest that lpg1659 is required for Lp to maintain culturability, and possibly long-term survival, in water. Since the loss of culturability observed in the absence of Lpg1659 was complemented by the addition of trace metals into water, this membrane protein is likely a transporter for acquiring essential trace metal for maintaining culturability in water and potentially in other metal-deprived conditions. Given its role in the survival of Lp in water, Lpg1659 was named LasM for Legionella aquatic survival membrane protein.
Hong, Jeum Kyu; Hwang, Byung Kook
2009-01-01
The promoter of the pepper pathogen-induced membrane protein gene CaPIMP1 was analyzed by an Agrobacterium-mediated transient expression assay in tobacco leaves. Several stress-related cis-acting elements (GT-1, W-box and ABRE) are located within the CaPIMP1 promoter. In tobacco leaf tissues transiently transformed with a CaPIMP1 promoter-beta-glucuronidase (GUS) gene fusion, serially 5'-deleted CaPIMP1 promoters were differentially activated by Pseudomonas syringae pv. tabaci, ethylene, methyl jasmonate, abscisic acid, and nitric oxide. The -1,193 bp region of the CaPIMP1 gene promoter sequence exhibited full promoter activity. The -417- and -593 bp promoter regions were sufficient for GUS gene activation by ethylene and methyl jasmonate treatments, respectively. However, CaPIMP1 promoter sequences longer than -793 bp were required for promoter activation by abscisic acid and sodium nitroprusside treatments. CaPIMP1 expression was activated in pepper leaves by treatment with ethylene, methyl jasmonate, abscisic acid, beta-amino-n-butyric acid, NaCl, mechanical wounding, and low temperature, but not with salicylic acid. Overexpression of CaPIMP1 in Arabidopsis conferred hypersensitivity to mannitol, NaCl, and ABA during seed germination but not during seedling development. In contrast, transgenic plants overexpressing CaPIMP1 exhibited enhanced tolerance to oxidative stress induced by methyl viologen during germination and early seedling stages. These results suggest that CaPIMP1 expression may alter responsiveness to environmental stress, as well as to pathogen infection.
Wanka, Franziska; Arentshorst, Mark; Cairns, Timothy C; Jørgensen, Thomas; Ram, Arthur F J; Meyer, Vera
2016-08-20
The filamentous ascomycete Aspergillus niger is used in many industrial processes for the production of enzymes and organic acids by batch and fed-batch cultivation. An alternative technique is continuous cultivation, which promises improved yield and optimized pipeline efficiency. In this work, we have used perfusion (retentostat) cultivation to validate two promoters that are suitable for A. niger continuous cultivation of industrially relevant products. Firstly, promoters of genes encoding either an antifungal protein (Panafp) or putative hydrophobin (PhfbD) were confirmed as active throughout retentostat culture by assessing mRNA and protein levels using a luciferase (mluc) reporter system. This demonstrated the anafp promoter mediates a high but temporally variable expression profile, whereas the hfbD promoter mediates a semi-constant, moderate-to-high protein expression during retentostat culture. In order to assess whether these promoters were suitable to produce heterologous proteins during retentostat cultivation, the secreted antifungal protein (AFP) from Aspergillus giganteus, which has many potential biotechnological applications, was expressed in A. niger during retentostat cultivation. Additionally, this assay was used to concomitantly validate that native secretion signals encoded in anafp and hfbD genes can be harnessed for secretion of heterologous proteins. Afp mRNA and protein abundance were comparable to luciferase measurements throughout retentostat cultivation, validating the use of Panafp and PhfbD for perfusion cultivation. Finally, a gene encoding the highly commercially relevant thermal hysteresis protein (THP) was expressed in this system, which did not yield detectable protein. Both hfbD and anafp promoters are suitable for production of useful products in A. niger during perfusion cultivation. These findings provide a platform for further optimisations for high production of heterologous proteins with industrial relevance.
HCV core protein promotes hepatocyte proliferation and chemoresistance by inhibiting NR4A1
Energy Technology Data Exchange (ETDEWEB)
Tan, Yongsheng, E-mail: yongshengtanwhu@126.com; Li, Yan, E-mail: liyansd2@163.com
2015-10-23
This study investigated the effect of HCV core protein on the proliferation of hepatocytes and hepatocellular carcinoma cells (HCC), the influence of HCV core protein on HCC apoptosis induced by the chemotherapeutic agent cisplatin, and the mechanism through which HCV core protein acts as a potential oncoprotein in HCV-related HCC by measuring the levels of NR4A1 and Runt-related transcription factor 3 (RUNX3), which are associated with tumor suppression and chemotherapy resistance. In the present study, PcDNA3.1-core and RUNX3 siRNA were transfected into LO2 and HepG2 cells using Lipofectamine 2000. LO2-core, HepG2-core, LO2-RUNX3 {sup low} and control cells were treated with different concentrations of cisplatin for 72 h, and cell proliferation and apoptosis were assayed using the CellTiter 96{sup ®}Aqueous Non-Radioactive Cell Proliferation Assay Kit. Western blot and real time PCR analyses were used to detect NR4A1, RUNX3, smad7, Cyclin D1 and BAX. Confocal microscopy was used to determine the levels of NR4A1 in HepG2 and HepG2-core cells. The growth rate of HepG2-core cells was considerably greater than that of HepG2 cells. HCV core protein increased the expression of cyclin D1 and decreased the expressions of NR4A1 and RUNX3. In LO2 – RUNX3 {sup low}, the rate of cell proliferation and the level of cisplatin resistance were the same as in the LO2 -core. These results suggest that HCV core protein decreases the sensitivity of hepatocytes to cisplatin by inhibiting the expression of NR4A1 and promoting the expression of smad7, which negatively regulates the TGF-β pathway. This effect results in down regulation of RUNX3, a target of the TGF-β pathway. Taken together, these findings indicate that in hepatocytes, HCV core protein increases drug resistance and inhibits cell apoptosis by inhibiting the expressions of NR4A1 and RUNX3. - Highlights: • HCV core protein inhibits HepG2 cell sensitivity to cisplatin. • Core expression in HepG2 decreases
HCV core protein promotes hepatocyte proliferation and chemoresistance by inhibiting NR4A1
International Nuclear Information System (INIS)
Tan, Yongsheng; Li, Yan
2015-01-01
This study investigated the effect of HCV core protein on the proliferation of hepatocytes and hepatocellular carcinoma cells (HCC), the influence of HCV core protein on HCC apoptosis induced by the chemotherapeutic agent cisplatin, and the mechanism through which HCV core protein acts as a potential oncoprotein in HCV-related HCC by measuring the levels of NR4A1 and Runt-related transcription factor 3 (RUNX3), which are associated with tumor suppression and chemotherapy resistance. In the present study, PcDNA3.1-core and RUNX3 siRNA were transfected into LO2 and HepG2 cells using Lipofectamine 2000. LO2-core, HepG2-core, LO2-RUNX3 "l"o"w and control cells were treated with different concentrations of cisplatin for 72 h, and cell proliferation and apoptosis were assayed using the CellTiter 96"®Aqueous Non-Radioactive Cell Proliferation Assay Kit. Western blot and real time PCR analyses were used to detect NR4A1, RUNX3, smad7, Cyclin D1 and BAX. Confocal microscopy was used to determine the levels of NR4A1 in HepG2 and HepG2-core cells. The growth rate of HepG2-core cells was considerably greater than that of HepG2 cells. HCV core protein increased the expression of cyclin D1 and decreased the expressions of NR4A1 and RUNX3. In LO2 – RUNX3 "l"o"w, the rate of cell proliferation and the level of cisplatin resistance were the same as in the LO2 -core. These results suggest that HCV core protein decreases the sensitivity of hepatocytes to cisplatin by inhibiting the expression of NR4A1 and promoting the expression of smad7, which negatively regulates the TGF-β pathway. This effect results in down regulation of RUNX3, a target of the TGF-β pathway. Taken together, these findings indicate that in hepatocytes, HCV core protein increases drug resistance and inhibits cell apoptosis by inhibiting the expressions of NR4A1 and RUNX3. - Highlights: • HCV core protein inhibits HepG2 cell sensitivity to cisplatin. • Core expression in HepG2 decreases expression of NR4A1
Nucleotide sequence of the promoter region of the gene encoding chicken Calbindin D28K
Energy Technology Data Exchange (ETDEWEB)
Ferrari, S; Drusiani, E; Battini, R; Fregni, M
1988-01-11
Calbindin D28K (formerly Vitamin D-Dependent Calcium Binding Protein) is a protein induced by 1,25-dihydroxycholecalciferol in several chicken tissues. A chicken genomic DNA library was screened with a synthetic oligonucleotide representing the sequence of Calbindin D18K cDNA from nt 146 to nt 176. The positive clone CBAl extends the 5'-end of the first exon by 451 bp. The sequence of a BamHI-SacII restriction fragment with coordinates -451 + 50 is shown. The BamHI-SacII fragment was subcloned 5' to the CAT gene of pUCCAT. The result is shown of a CAT assay on mouse fibroblasts 3T6 transiently transfected with pUCCAT, pUCCAT containing the BamHI-SacII fragment in the correct or opposite orientation or the SV40 promoter. /sup 14/C-chloramphenicol and its acetyl derivatives generated by purified CAT are also shown. The expression of CAT appears to be constitutive since the enzyme activity is not influenced by the presence (+) or absence (-) of 1,25-dihydroxycholecalciferol in the culture medium.
Gudi, Radhika; Zou, Chaozhong; Dhar, Jayeeta; Gao, Qingshen; Vasu, Chenthamarakshan
2014-05-30
Centriole duplication is the process by which two new daughter centrioles are generated from the proximal end of preexisting mother centrioles. Accurate centriole duplication is important for many cellular and physiological events, including cell division and ciliogenesis. Centrosomal protein 4.1-associated protein (CPAP), centrosomal protein of 152 kDa (CEP152), and centrobin are known to be essential for centriole duplication. However, the precise mechanism by which they contribute to centriole duplication is not known. In this study, we show that centrobin interacts with CEP152 and CPAP, and the centrobin-CPAP interaction is critical for centriole duplication. Although depletion of centrobin from cells did not have an effect on the centriolar levels of CEP152, it caused the disappearance of CPAP from both the preexisting and newly formed centrioles. Moreover, exogenous expression of the CPAP-binding fragment of centrobin also caused the disappearance of CPAP from both the preexisting and newly synthesized centrioles, possibly in a dominant negative manner, thereby inhibiting centriole duplication and the PLK4 overexpression-mediated centrosome amplification. Interestingly, exogenous overexpression of CPAP in the centrobin-depleted cells did not restore CPAP localization to the centrioles. However, restoration of centrobin expression in the centrobin-depleted cells led to the reappearance of centriolar CPAP. Hence, we conclude that centrobin-CPAP interaction is critical for the recruitment of CPAP to procentrioles to promote the elongation of daughter centrioles and for the persistence of CPAP on preexisting mother centrioles. Our study indicates that regulation of CPAP levels on the centrioles by centrobin is critical for preserving the normal size, shape, and number of centrioles in the cell. © 2014 by The American Society for Biochemistry and Molecular Biology, Inc.
Gudi, Radhika; Zou, Chaozhong; Dhar, Jayeeta; Gao, Qingshen; Vasu, Chenthamarakshan
2014-01-01
Centriole duplication is the process by which two new daughter centrioles are generated from the proximal end of preexisting mother centrioles. Accurate centriole duplication is important for many cellular and physiological events, including cell division and ciliogenesis. Centrosomal protein 4.1-associated protein (CPAP), centrosomal protein of 152 kDa (CEP152), and centrobin are known to be essential for centriole duplication. However, the precise mechanism by which they contribute to centriole duplication is not known. In this study, we show that centrobin interacts with CEP152 and CPAP, and the centrobin-CPAP interaction is critical for centriole duplication. Although depletion of centrobin from cells did not have an effect on the centriolar levels of CEP152, it caused the disappearance of CPAP from both the preexisting and newly formed centrioles. Moreover, exogenous expression of the CPAP-binding fragment of centrobin also caused the disappearance of CPAP from both the preexisting and newly synthesized centrioles, possibly in a dominant negative manner, thereby inhibiting centriole duplication and the PLK4 overexpression-mediated centrosome amplification. Interestingly, exogenous overexpression of CPAP in the centrobin-depleted cells did not restore CPAP localization to the centrioles. However, restoration of centrobin expression in the centrobin-depleted cells led to the reappearance of centriolar CPAP. Hence, we conclude that centrobin-CPAP interaction is critical for the recruitment of CPAP to procentrioles to promote the elongation of daughter centrioles and for the persistence of CPAP on preexisting mother centrioles. Our study indicates that regulation of CPAP levels on the centrioles by centrobin is critical for preserving the normal size, shape, and number of centrioles in the cell. PMID:24700465
LINGO-1 promotes lysosomal degradation of amyloid-β protein precursor
Directory of Open Access Journals (Sweden)
Rian de Laat
2015-03-01
Full Text Available Sequential proteolytic cleavages of amyloid-β protein precursor (AβPP by β-secretase and γ-secretase generate amyloid β (Aβ peptides, which are thought to contribute to Alzheimer's disease (AD. Much of this processing occurs in endosomes following endocytosis of AβPP from the plasma membrane. However, this pathogenic mode of processing AβPP may occur in competition with lysosomal degradation of AβPP, a common fate of membrane proteins trafficking through the endosomal system. Following up on published reports that LINGO-1 binds and promotes the amyloidogenic processing of AβPP we have examined the consequences of LINGO-1/AβPP interactions. We report that LINGO-1 and its paralogs, LINGO-2 and LINGO-3, decrease processing of AβPP in the amyloidogenic pathway by promoting lysosomal degradation of AβPP. We also report that LINGO-1 levels are reduced in AD brain, representing a possible pathogenic mechanism stimulating the generation of Aβ peptides in AD.
The role of COMESA in promoting intra-regional agricultural trade: Case study of Sudan
Directory of Open Access Journals (Sweden)
Azharia Abdelbagi Elbushra
2011-06-01
Full Text Available African countries have created many regional trade agreements with the economic objectives of reducing trade barriers and encouraging economic growth. The COMESA is an example of regional integration singed on 1993 by 19 African countries including Sudan. COMESA represents a chance for member countries to enhance their economic and social relations through increasing intra-trade. The objective of this paper is to assess the role of COMESA in promoting intra-regional agricultural trade between Sudan and COMESA countries. A multi-market model with Armington non-linear specification was applied. The paper results showed that there is a great potential for Sudan to increase its agricultural exports to other COMESA countries. The domestic agricultural markets are expected to be hampered by imports surge and increase in competition, while the producers of agricultural export commodities will be better off. In order to compete and benefit from potential in the COMESA markets, the paper recommended improving efficiency in the Sudanese agricultural sector through increasing productivity, lowering cost of production, enhancing marketing services, attaining economies of scale and attracting foreign investment.
Hjelm, Anna; Karyolaimos, Alexandros; Zhang, Zhe; Rujas, Edurne; Vikström, David; Slotboom, Dirk Jan; de Gier, Jan-Willem
Membrane and secretory protein production in Escherichia coli requires precisely controlled production rates to avoid the deleterious saturation of their biogenesis pathways. Based on this requirement, the E. coli L-rhamnose PBAD promoter (PrhaBAD) is often used for membrane and secretory protein
Direct inhibition of TNF-α promoter activity by Fanconi anemia protein FANCD2.
Directory of Open Access Journals (Sweden)
Nobuko Matsushita
Full Text Available Fanconi anemia (FA, an inherited disease, is associated with progressive bone marrow failure, predisposition to cancer, and genomic instability. Genes corresponding to 15 identified FA complementation groups have been cloned, and each gene product functions in the response to DNA damage induced by cross-linking agents and/or in protection against genome instability. Interestingly, overproduction of inflammatory cytokines such as tumor necrosis factor alpha (TNF-α and aberrant activation of NF-κB-dependent transcriptional activity have been observed in FA cells. Here we demonstrated that FANCD2 protein inhibits NF-κB activity in its monoubiquitination-dependent manner. Furthermore, we detected a specific association between FANCD2 and an NF-κB consensus element in the TNF-α promoter by electrophoretic mobility shift assays (EMSA and chromatin immunoprecipitation (ChIP assay. Therefore, we propose FANCD2 deficiency promotes transcriptional activity of the TNF-α promoter and induces overproduction of TNF-which then sustains prolonged inflammatory responses. These results also suggest that artificial modulation of TNFα production could be a promising therapeutic approach to FA.
DEFF Research Database (Denmark)
Peng, Nan; Deng, Ling; Mei, Yuxia
2012-01-01
Despite major progresses in genetic studies of hyperthermophilic archaea, recombinant protein production in these organisms always suffers from low yields and a robust expression system is still in great demand. Here we report a versatile vector that confers high levels of protein expression...... to remove the peptide tags from expressed recombinant proteins. While pEXA employed an araS promoter for protein expression, pSeSD utilized P(araS-SD), an araS derivative promoter carrying an engineered ribosome-binding site (RBS; a Shine-Dalgarno [SD] sequence). We found that P(araS-SD) directed high...... levels of target gene expression. More strikingly, N-terminal amino acid sequencing of recombinant proteins unraveled that the protein synthesized from pEXA-N-lacS lacked the designed 6×His tag and that translation initiation did not start at the ATG codon of the fusion gene. Instead, it started...
Vanacker, J M; Corbau, R; Adelmant, G; Perros, M; Laudet, V; Rommelaere, J
1996-01-01
The promoter of the thyroid hormone receptor alpha gene (c-erbA-1) is activated by the nonstructural protein 1 (NS1) of parvovirus minute virus of mice (prototype strain [MVMp]) in ras-transformed FREJ4 cells that are permissive for lytic MVMp replication. This stimulation may be related to the sensitivity of host cells to MVMp, as it does not take place in parental FR3T3 cells, which are resistant to the parvovirus killing effect. The analysis of a series of deletion and point mutants of the c-erbA-1 promoter led to the identification of an upstream region that is necessary for NS1-driven transactivation. This sequence harbors a putative hormone-responsive element and is sufficient to render a minimal promoter NS1 inducible in FREJ4 but not in FR3T3 cells, and it is involved in distinct interactions with proteins from the respective cell lines. The NS1-responsive element of the c-erbA-1 promoter bears no homology with sequences that were previously reported to be necessary for NS1 DNA binding and transactivation. Altogether, our data point to a novel, cell-specific mechanism of promoter activation by NS1. PMID:8642664
Directory of Open Access Journals (Sweden)
Muyrers Joep PP
2003-01-01
Full Text Available Abstract Background The phage protein pairs, RecE/RecT from Rac or Redα/Redβ from λ, initiate efficient double strand break repair (DSBR in Escherichia coli that has proven very useful for DNA engineering. These phage pairs initiate DSBR either by annealing or by another mechanism that is not defined. Results Here we report that these proteins also mediate single strand oligonucleotide repair (ssOR at high efficiencies. The ssOR activity, unlike DSBR, does not require a phage exonuclease (RecE or Redα but only requires a phage annealing protein (RecT or Redβ. Notably, the P22 phage annealing protein Erf, which does not mediate the same DSBR reactions, also delivers ssOR activity. By altering aspects of the oligonucleotides, we document length and design parameters that affect ssOR efficiency to show a simple relationship to homologies either side of the repair site. Notably, ssOR shows strand bias. Oligonucleotides that can prime lagging strand replication deliver more ssOR than their leading complements. This suggests a model in which the annealing proteins hybridize the oligonucleotides to single stranded regions near the replication fork. We also show that ssOR is a highly efficient way to engineer BACs and can be detected in a eukaryotic cell upon expression of a phage annealing protein. Conclusion Phage annealing proteins can initiate the recombination of single stranded oligonucleotides into endogenous targets in Escherichia coli at very high efficiencies. This expands the repertoire of useful DNA engineering strategies, shows promise for applications in eukaryotic cells, and has implications for the unanswered questions regarding DSBR mediated by RecE/RecT and Redα/Redβ.
Directory of Open Access Journals (Sweden)
J Stephen Dumler
2016-09-01
Full Text Available Anaplasma phagocytophilum, an obligate intracellular prokaryote, infects neutrophils and alters cardinal functions via reprogrammed transcription. Large contiguous regions of neutrophil chromosomes are differentially expressed during infection. Secreted A. phagocytophilum effector AnkA transits into the neutrophil or granulocyte nucleus to complex with DNA in heterochromatin across all chromosomes. AnkA binds to gene promoters to dampen cis-transcription and also has features of matrix attachment region (MAR-binding proteins that regulate three-dimensional chromatin architecture and coordinate transcriptional programs encoded in topologically-associated chromatin domains. We hypothesize that identification of additional AnkA binding sites will better delineate how A. phagocytophilum infection results in reprogramming of the neutrophil genome. Using AnkA-binding ChIP-seq, we showed that AnkA binds broadly throughout all chromosomes in a reproducible pattern, especially at: i intergenic regions predicted to be matrix attachment regions (MARs; ii within predicted lamina-associated domains; and iii at promoters ≤3,000 bp upstream of transcriptional start sites. These findings provide genome-wide support for AnkA as a regulator of cis-gene transcription. Moreover, the dominant mark of AnkA in distal intergenic regions known to be AT-enriched, coupled with frequent enrichment in the nuclear lamina, provides strong support for its role as a MAR-binding protein and genome re-organizer. AnkA must be considered a prime candidate to promote neutrophil reprogramming and subsequent functional changes that belie improved microbial fitness and pathogenicity.
Directory of Open Access Journals (Sweden)
Shira Ninio
2009-01-01
Full Text Available Legionella pneumophila is an opportunistic pathogen that can cause a severe pneumonia called Legionnaires' disease. In the environment, L. pneumophila is found in fresh water reservoirs in a large spectrum of environmental conditions, where the bacteria are able to replicate within a variety of protozoan hosts. To survive within eukaryotic cells, L. pneumophila require a type IV secretion system, designated Dot/Icm, that delivers bacterial effector proteins into the host cell cytoplasm. In recent years, a number of Dot/Icm substrate proteins have been identified; however, the function of most of these proteins remains unknown, and it is unclear why the bacterium maintains such a large repertoire of effectors to promote its survival. Here we investigate a region of the L. pneumophila chromosome that displays a high degree of plasticity among four sequenced L. pneumophila strains. Analysis of GC content suggests that several genes encoded in this region were acquired through horizontal gene transfer. Protein translocation studies establish that this region of genomic plasticity encodes for multiple Dot/Icm effectors. Ectopic expression studies in mammalian cells indicate that one of these substrates, a protein called PieA, has unique effector activities. PieA is an effector that can alter lysosome morphology and associates specifically with vacuoles that support L. pneumophila replication. It was determined that the association of PieA with vacuoles containing L. pneumophila requires modifications to the vacuole mediated by other Dot/Icm effectors. Thus, the localization properties of PieA reveal that the Dot/Icm system has the ability to spatially and temporally control the association of an effector with vacuoles containing L. pneumophila through activities mediated by other effector proteins.
Annotation of the protein coding regions of the equine genome
DEFF Research Database (Denmark)
Hestand, Matthew S.; Kalbfleisch, Theodore S.; Coleman, Stephen J.
2015-01-01
Current gene annotation of the horse genome is largely derived from in silico predictions and cross-species alignments. Only a small number of genes are annotated based on equine EST and mRNA sequences. To expand the number of equine genes annotated from equine experimental evidence, we sequenced m...... and appear to be small errors in the equine reference genome, since they are also identified as homozygous variants by genomic DNA resequencing of the reference horse. Taken together, we provide a resource of equine mRNA structures and protein coding variants that will enhance equine and cross...
Directory of Open Access Journals (Sweden)
Vingron Martin
2008-10-01
Full Text Available Abstract Background More than two thirds of the highly expressed ribosomal protein (RP genes in Saccharomyces cerevisiae contain introns, which is in sharp contrast to the genome-wide five percent intron-containing genes. It is well established that introns carry regulatory sequences and that the transcription of RP genes is extensively and coordinately regulated. Here we test the hypotheses that introns are innately associated with heavily transcribed genes and that introns of RP genes contribute regulatory TF binding sequences. Moreover, we investigate whether promoter features are significantly different between intron-containing and intronless RP genes. Results We find that directly measured transcription rates tend to be lower for intron-containing compared to intronless RP genes. We do not observe any specifically enriched sequence motifs in the introns of RP genes other than those of the branch point and the two splice sites. Comparing the promoters of intron-containing and intronless RP genes, we detect differences in number and position of Rap1-binding and IFHL motifs. Moreover, the analysis of the length distribution and the folding free energies suggest that, at least in a sub-population of RP genes, the 5' untranslated sequences are optimized for regulatory function. Conclusion Our results argue against the direct involvement of introns in the regulation of transcription of highly expressed genes. Moreover, systematic differences in motif distributions suggest that RP transcription factors may act differently on intron-containing and intronless gene promoters. Thus, our findings contribute to the decoding of the RP promoter architecture and may fuel the discussion on the evolution of introns.
DEFF Research Database (Denmark)
Gyan, B A; Goka, B; Cvetkovic, J T
2004-01-01
Immunoglobulin E has been associated with severe malaria suggesting a regulatory role for interleukin (IL)-4 and/or IgE in the pathogenesis of severe malaria. We have investigated possible associations between polymorphisms in the IL-4 repeat region (intron 3) and promoter regions (IL-4 +33CT and...
Mallik, Aritra; Yammani, Raghunatha R
2018-07-20
Obesity and associated metabolic factors are major risk factors for the development of osteoarthritis. Previously, we have shown that the free fatty acid palmitate induces endoplasmic reticulum (ER) stress and induces apoptosis in meniscus cells. However, the molecular mechanisms involved in these effects are not clearly understood. In our current study, we found that palmitate inhibits autophagy by modulating the protein levels of autophagy-related genes-5 (ATG5) that is associated with decreased lipidation of LC3 and increased activation of cleaved caspase 3. Pretreatment of meniscus cells with 4-phenyl butyric acid, a small molecule chemical chaperone that alleviates ER stress, or with MG-132, a proteasome inhibitor, restored normal levels of ATG5 and autophagosome formation, and decreased expression of cleaved caspase 3. Thus, our data suggest that palmitate downregulates autophagy in meniscus cells by degrading ATG5 protein via ER-associated protein degradation, and thus promotes apoptosis. This is the first study to demonstrate that palmitate-induced endoplasmic reticulum stress negatively regulates autophagy. Copyright © 2018 The Authors. Published by Elsevier Inc. All rights reserved.
P-body proteins regulate transcriptional rewiring to promote DNA replication stress resistance.
Loll-Krippleber, Raphael; Brown, Grant W
2017-09-15
mRNA-processing (P-) bodies are cytoplasmic granules that form in eukaryotic cells in response to numerous stresses to serve as sites of degradation and storage of mRNAs. Functional P-bodies are critical for the DNA replication stress response in yeast, yet the repertoire of P-body targets and the mechanisms by which P-bodies promote replication stress resistance are unknown. In this study we identify the complete complement of mRNA targets of P-bodies during replication stress induced by hydroxyurea treatment. The key P-body protein Lsm1 controls the abundance of HHT1, ACF4, ARL3, TMA16, RRS1 and YOX1 mRNAs to prevent their toxic accumulation during replication stress. Accumulation of YOX1 mRNA causes aberrant downregulation of a network of genes critical for DNA replication stress resistance and leads to toxic acetaldehyde accumulation. Our data reveal the scope and the targets of regulation by P-body proteins during the DNA replication stress response.P-bodies form in response to stress and act as sites of mRNA storage and degradation. Here the authors identify the mRNA targets of P-bodies during DNA replication stress, and show that P-body proteins act to prevent toxic accumulation of these target transcripts.
Lee, C A; Silva, M; Siber, A M; Kelly, A J; Galyov, E; McCormick, B A
2000-10-24
In response to Salmonella typhimurium, the intestinal epithelium generates an intense inflammatory response consisting largely of polymorphonuclear leukocytes (neutrophils, PMN) migrating toward and ultimately across the epithelial monolayer into the intestinal lumen. It has been shown that bacterial-epithelial cell interactions elicit the production of inflammatory regulators that promote transepithelial PMN migration. Although S. typhimurium can enter intestinal epithelial cells, bacterial internalization is not required for the signaling mechanisms that induce PMN movement. Here, we sought to determine which S. typhimurium factors and intestinal epithelial signaling pathways elicit the production of PMN chemoattractants by enterocytes. Our results suggest that S. typhimurium activates a protein kinase C-dependent signal transduction pathway that orchestrates transepithelial PMN movement. We show that the type III effector protein, SipA, is not only necessary but is sufficient to induce this proinflammatory response in epithelial cells. Our results force us to reconsider the long-held view that Salmonella effector proteins must be directly delivered into host cells from bacterial cells.
Armadillo Repeat Containing 8α Binds to HRS and Promotes HRS Interaction with Ubiquitinated Proteins
Tomaru, Koji; Ueda, Atsuhisa; Suzuki, Takeyuki; Kobayashi, Nobuaki; Yang, Jun; Yamamoto, Masaki; Takeno, Mitsuhiro; Kaneko, Takeshi; Ishigatsubo, Yoshiaki
2010-01-01
Recently, we reported that a complex with an essential role in the degradation of Fructose-1,6-bisphosphatase in yeast is well conserved in mammalian cells; we named this mammalian complex C-terminal to the Lissencephaly type-1-like homology (CTLH) complex. Although the function of the CTLH complex remains unclear, here we used yeast two-hybrid screening to isolate Hepatocyte growth factor-regulated tyrosine kinase substrate (HRS) as a protein binding to a key component of CTLH complex, Armadillo repeat containing 8 (ARMc8) α. The association was confirmed by a yeast two-hybrid assay and a co-immunoprecipitation assay. The proline-rich domain of HRS was essential for the association. As demonstrated through immunofluorescence microscopy, ARMc8α co-localized with HRS. ARMc8α promoted the interaction of HRS with various ubiquitinated proteins through the ubiquitin-interacting motif. These findings suggest that HRS mediates protein endosomal trafficking partly through its interaction with ARMc8α. PMID:20224683
Invited review: Whey proteins as antioxidants and promoters of cellular antioxidant pathways.
Corrochano, Alberto R; Buckin, Vitaly; Kelly, Phil M; Giblin, Linda
2018-03-28
Oxidative stress contributes to cell injury and aggravates several chronic diseases. Dietary antioxidants help the body to fight against free radicals and, therefore, avoid or reduce oxidative stress. Recently, proteins from milk whey liquid have been described as antioxidants. This review summarizes the evidence that whey products exhibit radical scavenging activity and reducing power. It examines the processing and treatment attempts to increase the antioxidant bioactivity and identifies 1 enzyme, subtilisin, which consistently produces the most potent whey fractions. The review compares whey from different milk sources and puts whey proteins in the context of other known food antioxidants. However, for efficacy, the antioxidant activity of whey proteins must not only survive processing, but also upper gut transit and arrival in the bloodstream, if whey products are to promote antioxidant levels in target organs. Studies reveal that direct cell exposure to whey samples increases intracellular antioxidants such as glutathione. However, the physiological relevance of these in vitro assays is questionable, and evidence is conflicting from dietary intervention trials, with both rats and humans, that whey products can boost cellular antioxidant biomarkers. Copyright © 2018 American Dairy Science Association. Published by Elsevier Inc. All rights reserved.
A protocatechuate biosensor for Pseudomonas putida KT2440 via promoter and protein evolution
Directory of Open Access Journals (Sweden)
Ramesh K. Jha
2018-06-01
Full Text Available Robust fluorescence-based biosensors are emerging as critical tools for high-throughput strain improvement in synthetic biology. Many biosensors are developed in model organisms where sophisticated synthetic biology tools are also well established. However, industrial biochemical production often employs microbes with phenotypes that are advantageous for a target process, and biosensors may fail to directly transition outside the host in which they are developed. In particular, losses in sensitivity and dynamic range of sensing often occur, limiting the application of a biosensor across hosts. Here we demonstrate the optimization of an Escherichia coli-based biosensor in a robust microbial strain for the catabolism of aromatic compounds, Pseudomonas putida KT2440, through a generalizable approach of modulating interactions at the protein-DNA interface in the promoter and the protein-protein dimer interface. The high-throughput biosensor optimization approach demonstrated here is readily applicable towards other allosteric regulators. Keywords: Whole cell biosensor, Aromatic catabolism, Transcription factor, PcaU, Shikimate
Directory of Open Access Journals (Sweden)
Erica Schulz
2010-09-01
Full Text Available Soluble proteins must maintain backbone hydrogen bonds (BHBs water-tight to ensure structural integrity. This protection is often achieved by burying the BHBs or wrapping them through intermolecular associations. On the other hand, water has low coordination resilience, with loss of hydrogen-bonding partnerships carrying significant thermodynamic cost. Thus, a core problem in structural biology is whether natural design actually exploits the water coordination stiffness to seal the backbone in regions that are exposed to the solvent. This work explores the molecular design features that make this type of seal operative, focusing on the side-chain arrangements that shield the protein backbone. We show that an efficient sealing is achieved by adapting the sub-nanoscale surface topography to the stringency of water coordination: an exposed BHB may be kept dry if the local concave curvature is small enough to impede formation of the coordination shell of a penetrating water molecule. Examination of an exhaustive database of uncomplexed proteins reveals that exposed BHBs invariably occur within such sub-nanoscale cavities in native folds, while this level of local ruggedness is absent in other regions. By contrast, BHB exposure in misfolded proteins occurs with larger local curvature promoting backbone hydration and consequently, structure disruption. These findings unravel physical constraints fitting a spatially dependent least-action for water coordination, introduce a molecular design concept, and herald the advent of water-tight peptide-based materials with sufficient backbone exposure to remain flexible.
Directory of Open Access Journals (Sweden)
Dina A Moustafa
Full Text Available Brucella neotomae is not known to be associated with clinical disease in any host species. Previous research suggested that B. neotomae might not express detectable levels of Cu/Zn superoxide dismutase (SOD, a periplasmic enzyme known to be involved in protecting Brucella from oxidative bactericidal effects of host phagocytes. This study was undertaken to investigate the genetic basis for the disparity in SOD expression in B. neotomae. Our Western blot and SOD enzyme assay analyses indicated that B. neotomae does express SOD, but at a substantially reduced level. Nucleotide sequence analysis of region upstream to the sodC gene identified a single-nucleotide insertion in the potential promoter region. The same single-nucleotide insertion was also detected in the sodC promoter of B. suis strain Thomsen, belonging to biovar 2 in which SOD expression was undetectable previously. Examination of the sodC promoter activities using translational fusion constructs with E. coli β-galactosidase demonstrated that the B. neotomae and B. suis biovar 2 promoters were very weak in driving gene expression. Site-directed mutation studies indicated that the insertion of A in the B. neotomae sodC promoter reduced the promoter activity. Increasing the level of SOD expression in B. neotomae through complementation with B. abortus sodC gene did not alter the bacterial survival in J774A.1 macrophage-like cells and in tissues of BALB/c and C57BL/6 mice. These results for the first time demonstrate the occurrence of a single-nucleotide polymorphism affecting promoter function and gene expression in Brucella.
Directory of Open Access Journals (Sweden)
Waqasuddin Khan
Full Text Available Disordered regions of proteins often bind to structured domains, mediating interactions within and between proteins. However, it is difficult to identify a priori the short disordered regions involved in binding. We set out to determine if docking such peptide regions to peptide binding domains would assist in these predictions.We assembled a redundancy reduced dataset of SLiM (Short Linear Motif containing proteins from the ELM database. We selected 84 sequences which had an associated PDB structures showing the SLiM bound to a protein receptor, where the SLiM was found within a 50 residue region of the protein sequence which was predicted to be disordered. First, we investigated the Vina docking scores of overlapping tripeptides from the 50 residue SLiM containing disordered regions of the protein sequence to the corresponding PDB domain. We found only weak discrimination of docking scores between peptides involved in binding and adjacent non-binding peptides in this context (AUC 0.58.Next, we trained a bidirectional recurrent neural network (BRNN using as input the protein sequence, predicted secondary structure, Vina docking score and predicted disorder score. The results were very promising (AUC 0.72 showing that multiple sources of information can be combined to produce results which are clearly superior to any single source.We conclude that the Vina docking score alone has only modest power to define the location of a peptide within a larger protein region known to contain it. However, combining this information with other knowledge (using machine learning methods clearly improves the identification of peptide binding regions within a protein sequence. This approach combining docking with machine learning is primarily a predictor of binding to peptide-binding sites, and is not intended as a predictor of specificity of binding to particular receptors.
Assessment of protein disorder region predictions in CASP10
Monastyrskyy, Bohdan; Kryshtafovych, Andriy; Moult, John; Tramontano, Anna; Fidelis, Krzysztof
2013-01-01
The article presents the assessment of disorder region predictions submitted to CASP10. The evaluation is based on the three measures tested in previous CASPs: (i) balanced accuracy, (ii) the Matthews correlation coefficient for the binary predictions, and (iii) the area under the curve in the receiver operating characteristic (ROC) analysis of predictions using probability annotation. We also performed new analyses such as comparison of the submitted predictions with those obtained with a Naïve disorder prediction method and with predictions from the disorder prediction databases D2P2 and MobiDB. On average, the methods participating in CASP10 demonstrated slightly better performance than those in CASP9.
Assessment of protein disorder region predictions in CASP10
Monastyrskyy, Bohdan
2013-11-22
The article presents the assessment of disorder region predictions submitted to CASP10. The evaluation is based on the three measures tested in previous CASPs: (i) balanced accuracy, (ii) the Matthews correlation coefficient for the binary predictions, and (iii) the area under the curve in the receiver operating characteristic (ROC) analysis of predictions using probability annotation. We also performed new analyses such as comparison of the submitted predictions with those obtained with a Naïve disorder prediction method and with predictions from the disorder prediction databases D2P2 and MobiDB. On average, the methods participating in CASP10 demonstrated slightly better performance than those in CASP9.
International Nuclear Information System (INIS)
Gilmour, D.S.; Lis, J.T.
1986-01-01
By using a protein-DNA cross-linking method, we examined the in vivo distribution of RNA polymerase II on the hsp70 heat shock gene in Drosophila melanogaster Schneider line 2 cells. In heat shock-induced cells, a high level of RNA polymerase II was detected on the entire gene, while in noninduced cells, the RNA polymerase II was confined to the 5' end of the hsp70 gene, predominantly between nucleotides -12 and +65 relative to the start of transcription. This association of RNA polymerase II was apparent whether the cross-linking was performed by a 10-min UV irradiation of chilled cells with mercury vapor lamps or by a 40-microsecond irradiation of cells with a high-energy xenon flash lamp. We hypothesize that RNA polymerase II has access to, and a high affinity for, the promoter region of this gene before induction, and this poised RNA polymerase II may be critical in the mechanism of transcription activation
The nuclear protein Artemis promotes AMPK activation by stabilizing the LKB1–AMPK complex
International Nuclear Information System (INIS)
Nakagawa, Koji; Uehata, Yasuko; Natsuizaka, Mitsuteru; Kohara, Toshihisa; Darmanin, Stephanie; Asaka, Masahiro; Takeda, Hiroshi; Kobayashi, Masanobu
2012-01-01
Highlights: ► The nuclear protein Artemis physically interacts with AMPKα2. ► Artemis co-localizes with AMPKα2 in the nucleus. ► Artemis promotes phosphorylation and activation of AMPK. ► The interaction between AMPKα2 and LKB1 is stabilized by Artemis. -- Abstract: AMP-activated protein kinase (AMPK) is a hetero-trimeric Ser/Thr kinase composed of a catalytic α subunit and regulatory β and γ subunits; it functions as an energy sensor that controls cellular energy homeostasis. In response to an increased cellular AMP/ATP ratio, AMPK is activated by phosphorylation at Thr172 in the α-subunit by upstream AMPK kinases (AMPKKs), including tumor suppressor liver kinase B1 (LKB1). To elucidate more precise molecular mechanisms of AMPK activation, we performed yeast two-hybrid screening and isolated the complementary DNA (cDNA) encoding the nuclear protein Artemis/DNA cross-link repair 1C (DCLRE1C) as an AMPKα2-binding protein. Artemis was found to co-immunoprecipitate with AMPKα2, and the co-localization of Artemis with AMPKα2 in the nucleus was confirmed by immunofluorescence staining in U2OS cells. Moreover, over-expression of Artemis enhanced the phosphorylation of AMPKα2 and the AMPK substrate acetyl-CoA carboxylase (ACC). Conversely, RNAi-mediated knockdown of Artemis reduced AMPK and ACC phosphorylation. In addition, Artemis markedly increased the physical association between AMPKα2 and LKB1. Taken together, these results suggest that Artemis functions as a positive regulator of AMPK signaling by stabilizing the LKB1–AMPK complex.
The nuclear protein Artemis promotes AMPK activation by stabilizing the LKB1-AMPK complex
Energy Technology Data Exchange (ETDEWEB)
Nakagawa, Koji, E-mail: k_nakagawa@pharm.hokudai.ac.jp [Department of Pathophysiology and Therapeutics, Division of Pharmascience, Faculty of Pharmaceutical Sciences, Hokkaido University, N12 W6, Kita-ku, Sapporo, Hokkaido 060-0812 (Japan); Uehata, Yasuko; Natsuizaka, Mitsuteru; Kohara, Toshihisa; Darmanin, Stephanie [Department of Gastroenterology and Hematology, Graduate School of Medicine, Hokkaido University, N15 W7, Kita-ku, Sapporo, Hokkaido 060-8638 (Japan); Asaka, Masahiro [Department of Gastroenterology and Hematology, Graduate School of Medicine, Hokkaido University, N15 W7, Kita-ku, Sapporo, Hokkaido 060-8638 (Japan); Department of Cancer Preventive Medicine, Graduate School of Medicine, Hokkaido University, N15 W7, Kita-ku, Sapporo, Hokkaido 060-8638 (Japan); Takeda, Hiroshi [Department of Pathophysiology and Therapeutics, Division of Pharmascience, Faculty of Pharmaceutical Sciences, Hokkaido University, N12 W6, Kita-ku, Sapporo, Hokkaido 060-0812 (Japan); Department of Gastroenterology and Hematology, Graduate School of Medicine, Hokkaido University, N15 W7, Kita-ku, Sapporo, Hokkaido 060-8638 (Japan); Kobayashi, Masanobu [Department of Cancer Preventive Medicine, Graduate School of Medicine, Hokkaido University, N15 W7, Kita-ku, Sapporo, Hokkaido 060-8638 (Japan); School of Nursing and Social Services, Health Sciences University of Hokkaido, Ishikari-Toubetsu, Hokkaido 061-0293 (Japan)
2012-11-02
Highlights: Black-Right-Pointing-Pointer The nuclear protein Artemis physically interacts with AMPK{alpha}2. Black-Right-Pointing-Pointer Artemis co-localizes with AMPK{alpha}2 in the nucleus. Black-Right-Pointing-Pointer Artemis promotes phosphorylation and activation of AMPK. Black-Right-Pointing-Pointer The interaction between AMPK{alpha}2 and LKB1 is stabilized by Artemis. -- Abstract: AMP-activated protein kinase (AMPK) is a hetero-trimeric Ser/Thr kinase composed of a catalytic {alpha} subunit and regulatory {beta} and {gamma} subunits; it functions as an energy sensor that controls cellular energy homeostasis. In response to an increased cellular AMP/ATP ratio, AMPK is activated by phosphorylation at Thr172 in the {alpha}-subunit by upstream AMPK kinases (AMPKKs), including tumor suppressor liver kinase B1 (LKB1). To elucidate more precise molecular mechanisms of AMPK activation, we performed yeast two-hybrid screening and isolated the complementary DNA (cDNA) encoding the nuclear protein Artemis/DNA cross-link repair 1C (DCLRE1C) as an AMPK{alpha}2-binding protein. Artemis was found to co-immunoprecipitate with AMPK{alpha}2, and the co-localization of Artemis with AMPK{alpha}2 in the nucleus was confirmed by immunofluorescence staining in U2OS cells. Moreover, over-expression of Artemis enhanced the phosphorylation of AMPK{alpha}2 and the AMPK substrate acetyl-CoA carboxylase (ACC). Conversely, RNAi-mediated knockdown of Artemis reduced AMPK and ACC phosphorylation. In addition, Artemis markedly increased the physical association between AMPK{alpha}2 and LKB1. Taken together, these results suggest that Artemis functions as a positive regulator of AMPK signaling by stabilizing the LKB1-AMPK complex.
The Murine Factor H-Related Protein FHR-B Promotes Complement Activation
Directory of Open Access Journals (Sweden)
Marcell Cserhalmi
2017-09-01
Full Text Available Factor H-related (FHR proteins consist of varying number of complement control protein domains that display various degrees of sequence identity to respective domains of the alternative pathway complement inhibitor factor H (FH. While such FHR proteins are described in several species, only human FHRs were functionally investigated. Their biological role is still poorly understood and in part controversial. Recent studies on some of the human FHRs strongly suggest a role for FHRs in enhancing complement activation via competing with FH for binding to certain ligands and surfaces. The aim of the current study was the functional characterization of a murine FHR, FHR-B. To this end, FHR-B was expressed in recombinant form. Recombinant FHR-B bound to human C3b and was able to compete with human FH for C3b binding. FHR-B supported the assembly of functionally active C3bBb alternative pathway C3 convertase via its interaction with C3b. This activity was confirmed by demonstrating C3 activation in murine serum. In addition, FHR-B bound to murine pentraxin 3 (PTX3, and this interaction resulted in murine C3 fragment deposition due to enhanced complement activation in mouse serum. FHR-B also induced C3 deposition on C-reactive protein, the extracellular matrix (ECM extract Matrigel, and endothelial cell-derived ECM when exposed to mouse serum. Moreover, mouse C3 deposition was strongly enhanced on necrotic Jurkat T cells and the mouse B cell line A20 by FHR-B. FHR-B also induced lysis of sheep erythrocytes when incubated in mouse serum with FHR-B added in excess. Altogether, these data demonstrate that, similar to human FHR-1 and FHR-5, mouse FHR-B modulates complement activity by promoting complement activation via interaction with C3b and via competition with murine FH.
Directory of Open Access Journals (Sweden)
Yiwen Xiang
Full Text Available BACKGROUND: Lactic acid, a natural by-product of glycolysis, is produced at excess levels in response to impaired mitochondrial function, high-energy demand, and low oxygen availability. The enzyme involved in the production of β-amyloid peptide (Aβ of Alzheimer's disease, BACE1, functions optimally at lower pH, which led us to investigate a potential role of lactic acid in the processing of amyloid precursor protein (APP. METHODOLOGY/PRINCIPAL FINDINGS: Lactic acid increased levels of Aβ40 and 42, as measured by ELISA, in culture medium of human neuroblastoma cells (SH-SY5Y, whereas it decreased APP metabolites, such as sAPPα. In cell lysates, APP levels were increased and APP was found to interact with ER-chaperones in a perinuclear region, as determined by co-immunoprecipitation and fluorescence microscopy studies. Lactic acid had only a very modest effect on cellular pH, did increase the levels of ER chaperones Grp78 and Grp94 and led to APP aggregate formation reminiscent of aggresomes. CONCLUSIONS/SIGNIFICANCE: These findings suggest that sustained elevations in lactic acid levels could be a risk factor in amyloidogenesis related to Alzheimer's disease through enhanced APP interaction with ER chaperone proteins and aberrant APP processing leading to increased generation of amyloid peptides and APP aggregates.
Gene divergence of homeologous regions associated with a major seed protein content QTL in soybean
Directory of Open Access Journals (Sweden)
Puji eLestari
2013-06-01
Full Text Available Understanding several modes of duplication contributing on the present genome structure is getting an attention because it could be related to numerous agronomically important traits. Since soybean serves as a rich protein source for animal feeds and human consumption, breeding efforts in soybean have been directed toward enhancing seed protein content. The publicly available soybean sequences and its genomically featured elements facilitate comprehending of quantitative trait loci (QTL for seed protein content in concordance with homeologous regions in soybean genome. Although parts of chromosome (Chr 20 and Chr 10 showed synteny, QTLs for seed protein content present only on Chr 20. Using comparative analysis of gene contents in recently duplicated genomic regions harboring QTL for protein/oil content on Chrs 20 and 10, a total of 27 genes are present in duplicated regions of both chromosomes. Notably, 4 tandem duplicates of the putative homeobox protein 22 (HB22 are present only on Chr 20 and this Medicago truncatula homolog expressed in endosperm at seed filling stage. These tandem duplicates could contribute on the protein/oil QTL of Chr 20. Our study suggests that non-shared gene contents within the duplicated genomic regions might lead to absence/presence of QTL related to protein/oil content.
Directory of Open Access Journals (Sweden)
Christoph Aluttis
2014-04-01
Full Text Available The concept of capacity building for public health has gained much attention during the last decade. National as well as international organizations increasingly focus their efforts on capacity building to improve performance in the health sector. During the past two decades, a variety of conceptual frameworks have been developed which describe relevant dimensions for public health capacity. Notably, these frameworks differ in design and conceptualization. This paper therefore reviews the existing conceptual frameworks and integrates them into one framework, which contains the most relevant dimensions for public health capacity at the country or regional level. A comprehensive literature search was performed to identify frameworks addressing public health capacity building at the national or regional level. We content-analysed these frameworks to identify the core dimensions of public health capacity. The dimensions were subsequently synthesized into a set of thematic areas to construct a conceptual framework which describes the most relevant dimensions for capacities at the national or regional level. The systematic review resulted in the identification of seven core domains for public health capacity: resources, organizational structures, workforce, partnerships, leadership and governance, knowledge development and country specific context. Accordingly, these dimensions were used to construct a framework, which describes these core domains more in detail. Our research shows that although there is no generally agreed upon model of public health capacity, a number of key domains for public health and health promotion capacity are consistently recurring in existing frameworks, regardless of their geographical location or thematic area. As only little work on the core concepts of public health capacities has yet taken place, this study adds value to the discourse by identifying these consistencies across existing frameworks and by synthesising
Liao, Wei-Ju; Tsao, Ku-Chi; Yang, Ruey-Bing
2016-03-01
SCUBE1 (S1), a secreted and membrane-bound glycoprotein, has a modular protein structure composed of an N-terminal signal peptide sequence followed by nine epidermal growth factor (EGF)-like repeats, a spacer region and three cysteine-rich (CR) motifs with multiple potential N-linked glycosylation sites, and one CUB domain at the C-terminus. Soluble S1 is a biomarker of platelet activation but an active participant of thrombosis via its adhesive EGF-like repeats, whereas its membrane-associated form acts as a bone morphogenetic protein (BMP) co-receptor in promoting BMP signal activity. However, the mechanism responsible for the membrane tethering and the biological importance of N-glycosylation of S1 remain largely unknown. In the present study, molecular mapping analysis identified a polycationic segment (amino acids 501-550) in the spacer region required for its membrane tethering via electrostatic interactions possibly with the anionic heparan sulfate proteoglycans. Furthermore, deglycosylation by peptide N-glycosidase F treatment revealed that N-glycans within the CR motif are essential for membrane recruitment through lectin-mediated surface retention. Injection of mRNA encoding zebrafish wild-type but not N-glycan-deficient scube1 restores the expression of haematopoietic and erythroid markers (scl and gata1) in scube1-knockdown embryos. We describe novel mechanisms in targeting S1 to the plasma membrane and demonstrate that N-glycans are required for S1 functions during primitive haematopoiesis in zebrafish. © 2016 Authors; published by Portland Press Limited.
International Nuclear Information System (INIS)
Cui Wei; Yin Lingling; Dong Lingyue
2012-01-01
Objective: To clarify the mechanism of immediate early response gene 5 (Ier5) transcription induced by radiation. Methods: Deletant construction, site-specific mutagenesis,electrophoretic mobility shift assay (EMSA) and chromatin immunoprecipitation (ChIP) were used to forecast the promoter region, binding sites and transcription factors of Ier5 gene in HeLa cells. Results: The promoter region of Ier5 gene might be in the region of Ier5 -8 deletant (-408 - -238 bp). The Ier5 gene had two transcription factors of GCF and NFI, and GCF had two binding sites located in the region of -388 - -382 bp and -274 - -270 bp of Ier5 promoter. The binding site of NFI was located in -362 - -357 bp of Ier5 promoter. GCF could inhibit the expression of Ier5 gene and this inhibition was diminished when the radiation dose increased. In contrast, NFI increased the expression of Ier5. Conclusions: The most possible region of Ier5 promoter is from -408 to -238 bp which has two binding sites for the radiosensitivity transcription factors of GCF and NFI that could negatively and positively regulate the expression of Ier5 respectively. (authors)
Wu, Jinxia; Hu, Zhangli; Wang, Chaogang; Li, Shuangfei; Lei, Anping
2008-08-01
To improve the expression efficiency of exogenous genes in Chlamydomonas reinhardtii, a high efficient expression vector was constructed. Green fluorescent protein (GFP) was expressed in C. reinhardtii under the control of promoters: RBCS2 and HSP70A-RBCS2. Efficiency of transformation and expression were compared between two transgenic algae: RBCS2 mediated strain Tran-I and HSP70A-RBCS2 mediated strain Tran-II. Results show that HSP70A-RBCS2 could improve greatly the transformation efficiency by approximately eightfold of RBCS2, and the expression efficiency of GFP in Tran-II was at least double of that in Tran-I. In addition, a threefold increase of GFP in Tran-II was induced by heat shock at 40°C. All of the results demonstrated that HSP70A-RBCS2 was more efficient than RBCS2 in expressing exogenous gene in C. reinhardtii.
Energy Technology Data Exchange (ETDEWEB)
Huerta, Araceli M.; Francino, M. Pilar; Morett, Enrique; Collado-Vides, Julio
2006-03-01
The evolutionary processes operating in the DNA regions that participate in the regulation of gene expression are poorly understood. In Escherichia coli, we have established a sequence pattern that distinguishes regulatory from nonregulatory regions. The density of promoter-like sequences, that are recognizable by RNA polymerase and may function as potential promoters, is high within regulatory regions, in contrast to coding regions and regions located between convergently-transcribed genes. Moreover, functional promoter sites identified experimentally are often found in the subregions of highest density of promoter-like signals, even when individual sites with higher binding affinity for RNA polymerase exist elsewhere within the regulatory region. In order to investigate the generality of this pattern, we have used position weight matrices describing the -35 and -10 promoter boxes of E. coli to search for these motifs in 43 additional genomes belonging to most established bacterial phyla, after specific calibration of the matrices according to the base composition of the noncoding regions of each genome. We have found that all bacterial species analyzed contain similar promoter-like motifs, and that, in most cases, these motifs follow the same genomic distribution observed in E. coli. Differential densities between regulatory and nonregulatory regions are detectable in most bacterial genomes, with the exception of those that have experienced evolutionary extreme genome reduction. Thus, the phylogenetic distribution of this pattern mirrors that of genes and other genomic features that require weak selection to be effective in order to persist. On this basis, we suggest that the loss of differential densities in the reduced genomes of host-restricted pathogens and symbionts is the outcome of a process of genome degradation resulting from the decreased efficiency of purifying selection in highly structured small populations. This implies that the differential
Toro, Carlos A; Wright, Hollis; Aylwin, Carlos F; Ojeda, Sergio R; Lomniczi, Alejandro
2018-01-04
Polycomb group (PcG) proteins control the timing of puberty by repressing the Kiss1 gene in hypothalamic arcuate nucleus (ARC) neurons. Here we identify two members of the Trithorax group (TrxG) of modifiers, mixed-lineage leukemia 1 (MLL1), and 3 (MLL3), as central components of an activating epigenetic machinery that dynamically counteracts PcG repression. Preceding puberty, MLL1 changes the chromatin configuration at the promoters of Kiss1 and Tac3, two genes required for puberty to occur, from repressive to permissive. Concomitantly, MLL3 institutes a chromatin structure that changes the functional status of a Kiss1 enhancer from poised to active. RNAi-mediated, ARC-specific Mll1 knockdown reduced Kiss1 and Tac3 expression, whereas CRISPR-Cas9-directed epigenome silencing of the Kiss1 enhancer selectively reduced Kiss1 activity. Both interventions delay puberty and disrupt reproductive cyclicity. Our results demonstrate that an epigenetic switch from transcriptional repression to activation is crucial to the regulatory mechanism controlling the timing of mammalian puberty.
Yes-Associated Protein (YAP) Promotes the Nuclear Import of p73
International Nuclear Information System (INIS)
Zhang Heng; Wu Shengnan
2011-01-01
p73 has been identified as a structural and functional homolog of the tumor suppressor p53. However, mechanisms that regulate the localization of p73 have not been fully clarified. The Yes-associated protein (YAP) is a transcriptional coactivator. As a transcriptional coactivator, YAP needs to bind transcription factors to stimulate gene expression. p73 is a reported YAP target transcription factors and YAP has been shown to positively regulate p73 in promoting apoptosis. Previous studies show that p73 interacts with YAP through its PPPY motif, and increases p73 transactivation of apoptotic genes. In this study, we focused on YAP's regulation of the localization of p73. After transient transfection into Rat pheochromocytoma (PC12) cells and Human embryonic kidney 293T cells with GFP-YAP and/or YFP-p73, and incubated for 24 hours expression. p73 was fused to YFP to allow the examination of its subcellular localization. When expressed alone, YFP-p73 was distributed throughout the cell. When coexpressed with YAP, nuclear accumulation of YFP-p73 became evident. We quantitated the effect of YAP on the redistribution of YFP-p73 by counting cells with nuclear-only YFP signal. We found that YAP can influence the subcellular distribution of p73. Altogether, coexpression with YAP affected the subcellular distribution of the p73 protein. Our studies attribute a central role to YAP in regulating p73 accumulation and YAP, at least in part, might promote the nuclear import of p73.
Yuan, Hui; Owsiany, Katherine; Sheeja, T.E.; Zhou, Xiangjun; Rodriguez, Caroline; Li, Yongxi; Welsch, Ralf; Chayut, Noam; Yang, Yong; Thannhauser, Theodore W.; Parthasarathy, Mandayam V.; Xu, Qiang; Deng, Xiuxin; Fei, Zhangjun; Schaffer, Ari; Katzir, Nurit; Burger, Joseph; Tadmor, Yaakov; Li, Li
2015-01-01
Carotenoids are crucial for plant growth and human health. The finding of ORANGE (OR) protein as a pivotal regulator of carotenogenesis offers a unique opportunity to comprehensively understand the regulatory mechanisms of carotenoid accumulation and develop crops with enhanced nutritional quality. Here, we demonstrated that alteration of a single amino acid in a wild-type OR greatly enhanced its ability to promote carotenoid accumulation. Whereas overexpression of OR from Arabidopsis (Arabidopsis thaliana; AtOR) or from the agronomically important crop sorghum (Sorghum bicolor; SbOR) increased carotenoid levels up to 2-fold, expression of AtORHis (R90H) or SbORHis (R104H) variants dramatically enhanced carotenoid accumulation by up to 7-fold in the Arabidopsis calli. Moreover, we found that AtORAla (R90A) functioned similarly to AtORHis to promote carotenoid overproduction. Neither AtOR nor AtORHis greatly affected carotenogenic gene expression. AtORHis exhibited similar interactions with phytoene synthase (PSY) as AtOR in posttranscriptionally regulating PSY protein abundance. AtORHis triggered biogenesis of membranous chromoplasts in the Arabidopsis calli, which shared structures similar to chromoplasts found in the curd of the orange cauliflower (Brassica oleracea) mutant. By contrast, AtOR did not cause plastid-type changes in comparison with the controls, but produced plastids containing larger and electron-dense plastoglobuli. The unique ability of AtORHis in mediating chromoplast biogenesis is responsible for its induced carotenoid overproduction. Our study demonstrates ORHis/Ala as powerful tools for carotenoid enrichment in plants, and provides insights into the mechanisms underlying ORHis-regulated carotenoid accumulation. PMID:26224804
Haywood, J; Yammani, R R
2016-05-01
Obesity is the major risk factor for the development of osteoarthritis (OA); however, the mechanisms involved are not clearly understood. Obesity is associated with increased production of adipokine and elevated levels of circulating free fatty acids (FFA). A recent study has shown that saturated fatty acid palmitate induced pro-inflammatory and pro-apoptotic pathways in chondrocytes. Meniscus has been shown to be more susceptible than articular cartilage to catabolic stimuli. Thus, the aim of this study was to determine the effect of FFA (specifically, palmitate) on meniscus cells. Cultured primary porcine meniscus cells were stimulated with 500 μM FFA (palmitate and oleate) for 24 h to induce endoplasmic reticulum (ER) stress. After treatment, cell lysates were prepared and immunoblotted for C/EBP homologous protein (CHOP). To determine the activation of unfolded protein response (UPR) signaling, cell lysates were probed for cJun n-terminal kinase (JNK), cleaved caspase -3 and Xbp-1s, an alternative mRNA splicing product generated due to Ire1α activation. Treatment of isolated primary meniscus cells with palmitate but not oleate induced expression of CHOP and Xbp-1s. Palmitate treatment of meniscus cells also activated JNK and increased expression of caspase-3, thus promoting apoptosis in meniscus cells. Palmitate induces ER stress and promotes apoptotic pathways in meniscus cells. This is the first study to establish ER stress as a key metabolic mechanistic link between obesity and OA, in addition to (or operating with) biomechanical factors. Copyright © 2015 Osteoarthritis Research Society International. Published by Elsevier Ltd. All rights reserved.
International Nuclear Information System (INIS)
Wurm, F.M.; Gwinn, K.A.; Papoulas, O.; Pallavicini, M.; Kingston, R.E.
1987-01-01
After transfection and selection with methotrexate, CHO cell lines were established which contained up to 2000 copies of an expression vector for c-myc protein. The vector contained the Drosophila heat shock protein 70 (hsp70) promoter fused with the coding region of the mouse c-myc gene. Incubation of cells for up to 3 hours at 43 0 C resulted in at least a 100-fold induction of recombinant c-myc mRNA. When cells were shifted back to 37 0 C, within 1 to 4 hours, this RNA was translated into protein to yield about 250 μg per 10 9 cells. Cells died a few hours later, suggesting that high concentrations of intracellular c-myc are cytotoxic. 47 refs., 5 figs
Energy Technology Data Exchange (ETDEWEB)
Cruzeiro, Leonor [CCMAR and FCT, University of Algarve, Campus de Gambelas, 8000 Faro (Portugal)
2005-12-21
The possibility that vibrational excited states (VESs) are the drivers of protein folding and function (the VES hypothesis) is explored to explain the reason why Gln- and Asn-rich proteins are associated with degenerative diseases. The Davydov/Scott model is extended to describe energy transfer from the water solution to the protein and vice versa. Computer simulations show that, on average, Gln and Asn residues lead to an initial larger absorption of energy from the environment to the protein, something that can explain the greater structural instability of prions. The sporadic, inherited and infectious character of prion diseases is discussed in the light of the VES hypothesis. An alternative treatment for prion diseases is suggested.
Secreted Frizzled related protein-4 (sFRP4) promotes epidermal differentiation and apoptosis
International Nuclear Information System (INIS)
Maganga, Richard; Giles, Natalie; Adcroft, Katharine; Unni, Ambili; Keeney, Diane; Wood, Fiona; Fear, Mark; Dharmarajan, Arunasalam
2008-01-01
The skin provides vital protection from infection and dehydration. Maintenance of the skin is through a constant program of proliferation, differentiation and apoptosis of epidermal cells, whereby proliferating cells in the basal layer differentiating to form the keratinized, anucleated stratum corneum. The WNT signalling pathway is known to be important in the skin. WNT signalling has been shown to be important both in epidermal development and in the maintenance and cycling of hair follicles and epidermal stem cells. However, the precise role for this pathway in epidermal differentiation remains unknown. We investigated the role of the WNT signalling inhibitor sFRP4 in epidermal differentiation. sFRP4 is expressed in both normal skin and keratinocytes in culture. Expression of sFRP4 mRNA and protein increases with keratinocyte differentiation and apoptosis, whilst exposure of keratinocytes to exogenous sFRP4 promotes apoptosis and expression of the terminal differentiation marker Involucrin. These data suggest sFRP4 promotes epidermal differentiation.
Directory of Open Access Journals (Sweden)
Fabian Machens
2017-10-01
Full Text Available Orthogonal systems for heterologous protein expression as well as for the engineering of synthetic gene regulatory circuits in hosts like Saccharomyces cerevisiae depend on synthetic transcription factors (synTFs and corresponding cis-regulatory binding sites. We have constructed and characterized a set of synTFs based on either transcription activator-like effectors or CRISPR/Cas9, and corresponding small synthetic promoters (synPs with minimal sequence identity to the host’s endogenous promoters. The resulting collection of functional synTF/synP pairs confers very low background expression under uninduced conditions, while expression output upon induction of the various synTFs covers a wide range and reaches induction factors of up to 400. The broad spectrum of expression strengths that is achieved will be useful for various experimental setups, e.g., the transcriptional balancing of expression levels within heterologous pathways or the construction of artificial regulatory networks. Furthermore, our analyses reveal simple rules that enable the tuning of synTF expression output, thereby allowing easy modification of a given synTF/synP pair. This will make it easier for researchers to construct tailored transcriptional control systems.
The yeast cell fusion protein Prm1p requires covalent dimerization to promote membrane fusion.
Directory of Open Access Journals (Sweden)
Alex Engel
2010-05-01
Full Text Available Prm1p is a multipass membrane protein that promotes plasma membrane fusion during yeast mating. The mechanism by which Prm1p and other putative regulators of developmentally controlled cell-cell fusion events facilitate membrane fusion has remained largely elusive. Here, we report that Prm1p forms covalently linked homodimers. Covalent Prm1p dimer formation occurs via intermolecular disulfide bonds of two cysteines, Cys-120 and Cys-545. PRM1 mutants in which these cysteines have been substituted are fusion defective. These PRM1 mutants are normally expressed, retain homotypic interaction and can traffic to the fusion zone. Because prm1-C120S and prm1-C545S mutants can form covalent dimers when coexpressed with wild-type PRM1, an intermolecular C120-C545 disulfide linkage is inferred. Cys-120 is adjacent to a highly conserved hydrophobic domain. Mutation of a charged residue within this hydrophobic domain abrogates formation of covalent dimers, trafficking to the fusion zone, and fusion-promoting activity. The importance of intermolecular disulfide bonding informs models regarding the mechanism of Prm1-mediated cell-cell fusion.
Directory of Open Access Journals (Sweden)
D.P. Pavoni
2006-09-01
Full Text Available Endemic pemphigus foliaceus (EPF is an autoimmune bullous skin disease characterized by acantholysis and antibodies against a desmosomal protein, desmoglein 1. Genetic and environmental factors contribute to development of this multifactorial disease. HLA class II and some cytokine gene polymorphisms are the only genetic markers thus far known to be associated with susceptibility to or protection from EPF. The cytotoxic T-lymphocyte antigen-4 gene (CTLA4 encodes a key immunoreceptor molecule that regulates and inhibits T-cell proliferation. It participates in the regulatory process controlling autoreactivity and therefore has been considered a strong candidate gene in autoimmune diseases. In the search for genes that might influence EPF pathogenesis, we analyzed variants of the CTLA4 gene in a sample of 118 patients and 291 controls from a Brazilian population. This is the first study investigating the possible role of polymorphisms of the 2q33 chromosomal region in differential susceptibility to pemphigus foliaceus. Promoter region and exon 1 single nucleotide polymorphisms -318 (C,T and 49 (A,G were genotyped using sequence-specific oligonucleotide probes after amplification by the polymerase chain reaction. The allelic and genotypic frequencies did not differ significantly between the patient and the control groups (-318T: 9.8 and 10.9%, 49G: 33.0 and 35.2% were the allelic frequencies in patients and controls, respectively. In addition, no significant difference was found when the patient and control population samples were stratified by the presence of HLA-DRB1 alleles. We conclude that the CTLA4 -318 (C,T and 49 (A,G polymorphisms do not play a major role in EPF development.
Pradhan, Mohan R; Pal, Arumay; Hu, Zhongqiao; Kannan, Srinivasaraghavan; Chee Keong, Kwoh; Lane, David P; Verma, Chandra S
2016-02-01
Aggregation is an irreversible form of protein complexation and often toxic to cells. The process entails partial or major unfolding that is largely driven by hydration. We model the role of hydration in aggregation using "Dehydrons." "Dehydrons" are unsatisfied backbone hydrogen bonds in proteins that seek shielding from water molecules by associating with ligands or proteins. We find that the residues at aggregation interfaces have hydrated backbones, and in contrast to other forms of protein-protein interactions, are under less evolutionary pressure to be conserved. Combining evolutionary conservation of residues and extent of backbone hydration allows us to distinguish regions on proteins associated with aggregation (non-conserved dehydron-residues) from other interaction interfaces (conserved dehydron-residues). This novel feature can complement the existing strategies used to investigate protein aggregation/complexation. © 2015 Wiley Periodicals, Inc.
Prediction of flexible/rigid regions from protein sequences using k-spaced amino acid pairs
Directory of Open Access Journals (Sweden)
Ruan Jishou
2007-04-01
Full Text Available Abstract Background Traditionally, it is believed that the native structure of a protein corresponds to a global minimum of its free energy. However, with the growing number of known tertiary (3D protein structures, researchers have discovered that some proteins can alter their structures in response to a change in their surroundings or with the help of other proteins or ligands. Such structural shifts play a crucial role with respect to the protein function. To this end, we propose a machine learning method for the prediction of the flexible/rigid regions of proteins (referred to as FlexRP; the method is based on a novel sequence representation and feature selection. Knowledge of the flexible/rigid regions may provide insights into the protein folding process and the 3D structure prediction. Results The flexible/rigid regions were defined based on a dataset, which includes protein sequences that have multiple experimental structures, and which was previously used to study the structural conservation of proteins. Sequences drawn from this dataset were represented based on feature sets that were proposed in prior research, such as PSI-BLAST profiles, composition vector and binary sequence encoding, and a newly proposed representation based on frequencies of k-spaced amino acid pairs. These representations were processed by feature selection to reduce the dimensionality. Several machine learning methods for the prediction of flexible/rigid regions and two recently proposed methods for the prediction of conformational changes and unstructured regions were compared with the proposed method. The FlexRP method, which applies Logistic Regression and collocation-based representation with 95 features, obtained 79.5% accuracy. The two runner-up methods, which apply the same sequence representation and Support Vector Machines (SVM and Naïve Bayes classifiers, obtained 79.2% and 78.4% accuracy, respectively. The remaining considered methods are
High genetic diversity in the coat protein and 3' untranslated regions
Indian Academy of Sciences (India)
The 3′ terminal region consisting of the coat protein (CP) coding sequence and 3′ untranslated region (3′UTR) was cloned and sequenced from seven isolates. Sequence comparisons revealed considerable genetic diversity among the isolates in their CP and 3′UTR, making CdMV one of the highly variable members ...
Tian, Tian; Sun, Yanhong; Wu, Huangan; Pei, Jian; Zhang, Jing; Zhang, Yi; Wang, Lu; Li, Bin; Wang, Lihua; Shi, Jiye; Hu, Jun; Fan, Chunhai
2016-01-21
Acupuncture has historically been practiced to treat medical disorders by mechanically stimulating specific acupoints with fine needles. Despite its well-documented efficacy, its biological basis remains largely elusive. In this study, we found that mechanical stimulation at the acupoint of Yanglingquan (GB34) promoted the autophagic clearance of α-synuclein (α-syn), a well known aggregation-prone protein closely related to Parkinson's disease (PD), in the substantia nigra par compacta (SNpc) of the brain in a PD mouse model. We found the protein clearance arose from the activation of the autophagy-lysosome pathway (ALP) in a mammalian target of rapamycin (mTOR)-independent approach. Further, we observed the recovery in the activity of dopaminergic neurons in SNpc, and improvement in the motor function at the behavior level of PD mice. Whereas acupuncture and rapamycin, a chemical mTOR inhibitor, show comparable α-syn clearance and therapeutic effects in the PD mouse model, the latter adopts a distinctly different, mTOR-dependent, autophagy induction process. Due to this fundamental difference, acupuncture may circumvent adverse effects of the rapamycin treatment. The newly discovered connection between acupuncture and autophagy not only provides a new route to understanding the molecular mechanism of acupuncture but also sheds new light on cost-effective and safe therapy of neurodegenerative diseases.
Bone morphogenetic protein-7 promotes chondrogenesis in human amniotic epithelial cells.
Zhou, Junjie; Yu, Guangrong; Cao, Chengfu; Pang, Jinhui; Chen, Xianqi
2011-06-01
Bone morphogenetic proteins (BMPs) play important roles at multiple stages of chondrogenesis. This study was undertaken to investigate the potential role of bone morphogenetic protein-7 (BMP-7) in the differentiation of chondrocytes using tissue engineering techniques. The impact of BMP-7 on human amniotic epithelial cells (hAECs) was tested. The hAECs were treated either with recombinant human BMP-7 cDNA or with transforming growth factor beta 1 (TGF-β1) as a positive control for three weeks in vitro. Cartilaginous differentiation and proliferation were assayed by quantitative RT-PCR, histology, and in situ hybridization. Our results were such that hAECs treated with either BMP-7 or TGF-β1 expressed cartilage markers (aggrecan, Sox9, CEP-68, and type II and X collagens) within three weeks. Compared with a control vector, BMP-7 induced a decrease in type I collagen expression, while the transcription of the cartilage-specific type II collagen remained stable. In induction experiments, BMP-7 transgenic hAECs exhibited the largest amount of matrix synthesis. In conclusion, these data indicate that BMP-7 plays an important role in inducing the production of cartilage by hAECs in vitro. Cartilage differentiation and matrix maturation can be promoted by BMPs in a cartilage engineering paradigm. These properties make BMPs promising tools in the engineering of cartilaginous joint bio-prostheses and as candidate biological agents or genes for cartilage stabilisation.
The Zn Finger protein Iguana impacts Hedgehog signaling by promoting ciliogenesis
Glazer, Andrew; Wilkinson, Alex; Backer, Chelsea B.; Lapan, Sylvain; Gutzman, Jennifer H.; Cheeseman, Iain M.; Reddien, Peter W.
2009-01-01
Hedgehog signaling is critical for metazoan development and requires cilia for pathway activity. The gene iguana was discovered in zebrafish as required for Hedgehog signaling, and encodes a novel Zn finger protein. Planarians are flatworms with robust regenerative capacities and that utilize epidermal cilia for locomotion. RNA interference of Smed-iguana in the planarian S. mediterranea caused cilia loss and failure to regenerate new cilia, but did not cause defects similar to those observed in hedgehog(RNAi) animals. Smed-iguana gene expression was also similar in pattern to the expression of multiple other ciliogenesis genes, but was not required for expression of these ciliogenesis genes. iguana-defective zebrafish had too few motile cilia in pronephric ducts and in Kupffer's vesicle. Kupffer's vesicle promotes left-right asymmetry and iguana mutant embryos had left-right asymmetry defects. Finally, human Iguana proteins (dZIP1 and dZIP1L) localize to the basal bodies of primary cilia and, together, are required for primary cilia formation. Our results indicate that a critical and broadly conserved function for Iguana is in ciliogenesis and that this function has come to be required for Hedgehog signaling in vertebrates. PMID:19852954
Directory of Open Access Journals (Sweden)
Maoyong Fu
Full Text Available Endometrial cancer is the most common gynecologic malignancy diagnosed among women in developed countries. One recent biomarker strongly associated with disease progression and survival is epithelial membrane protein-2 (EMP2, a tetraspan protein known to associate with and modify surface expression of certain integrin isoforms. In this study, we show using a xenograft model system that EMP2 expression is necessary for efficient endometrial tumor formation, and we have started to characterize the mechanism by which EMP2 contributes to this malignant phenotype. In endometrial cancer cells, the focal adhesion kinase (FAK/Src pathway appears to regulate migration as measured through wound healing assays. Manipulation of EMP2 levels in endometrial cancer cells regulates the phosphorylation of FAK and Src, and promotes their distribution into lipid raft domains. Notably, cells with low levels of EMP2 fail to migrate and poorly form tumors in vivo. These findings reveal the pivotal role of EMP2 in endometrial cancer carcinogenesis, and suggest that the association of elevated EMP2 levels with endometrial cancer prognosis may be causally linked to its effect on integrin-mediated signaling.
Geoheritage promotion of Thonon-les-Bains (Fr) region by the development of a geotourism product
Fanguin, Pauline
2014-05-01
Since 2012, the Chablais region (only in France) has acquired the Geopark label. This Geopark contributes to sustainable economic development of the region through geotourism. Moreover, the three Chablais (figure 1) are concerned by an Interreg IV program since 2009 (program of cooperation between European countries). The main objective of this program is to enhance the heritage resources (nature, culture and lifestyle of the region) (www.interreg-francesuisse.org). Therefore, the geotourism offer in this area just waiting to expand. The geodidactics models like the simplification of the scientific content are essential for geoheritage promotion, because this content must be available to a wide audience, allowing thereby the geoheritage recognition. The geotourism permits to apply different models (Cayla et al. 2010, Sellier, 2009) through a wide range of geotourism products, like guide, educational panels, thematic hikes and recently developed, new medias (website, smartphone applications). A geotourism product is based on four areas of questioning and was developed by Martin et al. (2010): (1) site (choice of sites to be valued), (2) public (a family public, good example of heterogeneous public), (3) contents (reasoning on geodidactics models) and (4) support (smartphone application). These four areas are very fundamental before the creation of any geotourism product. These reflexions aim to obtain a mediation product that integrates into geotourism offer of a region and contributes to its development and meets public expectations. New media, such as digital media - smartphone, tablets, website - become geotourism products more and more attractive. In addition, the necessary technologies to develop new media help to integrate a high interactivity potential with the public and thus get their attention. The architecture of this geotourism product is based on the new application developed by the Institute of Geography and sustainability, and the Bureau Relief. One
International Nuclear Information System (INIS)
Wyrwicz, Lucjan S; Koczyk, Grzegorz; Rychlewski, Leszek; Plewczynski, Dariusz
2007-01-01
The annotation of protein folds within newly sequenced genomes is the main target for semi-automated protein structure prediction (virtual structural genomics). A large number of automated methods have been developed recently with very good results in the case of single-domain proteins. Unfortunately, most of these automated methods often fail to properly predict the distant homology between a given multi-domain protein query and structural templates. Therefore a multi-domain protein should be split into domains in order to overcome this limitation. ProteinSplit is designed to identify protein domain boundaries using a novel algorithm that predicts disordered regions in protein sequences. The software utilizes various sequence characteristics to assess the local propensity of a protein to be disordered or ordered in terms of local structure stability. These disordered parts of a protein are likely to create interdomain spacers. Because of its speed and portability, the method was successfully applied to several genome-wide fold annotation experiments. The user can run an automated analysis of sets of proteins or perform semi-automated multiple user projects (saving the results on the server). Additionally the sequences of predicted domains can be sent to the Bioinfo.PL Protein Structure Prediction Meta-Server for further protein three-dimensional structure and function prediction. The program is freely accessible as a web service at http://lucjan.bioinfo.pl/proteinsplit together with detailed benchmark results on the critical assessment of a fully automated structure prediction (CAFASP) set of sequences. The source code of the local version of protein domain boundary prediction is available upon request from the authors
International Nuclear Information System (INIS)
Sheng, Xiumei; Wang, Zhengxin
2016-01-01
Protein arginine methyltransferase 5 (PRMT5) catalyzes the formation of symmetrical dimethylation of arginine residues in proteins. WD repeat domain 77 (WDR77), also known as p44, MEP50, or WD45, forms a stoichiometric complex with PRMT5. The PRMT5/p44 complex is required for cellular proliferation of lung and prostate epithelial cells during earlier stages of development and is re-activated during prostate and lung tumorigenesis. The molecular mechanisms by which PRMT5 and p44 promote cellular proliferation are unknown. Expression of PRMT5 and p44 in lung and prostate cancer cells was silenced and their target genes were identified. The regulation of target genes was validated in various cancer cells during lung development and tumorigenesis. Altered expression of target genes was achieved by ectopic cDNA expression and shRNA-mediated silencing. PRMT5 and p44 regulate expression of a specific set of genes encoding growth and anti-growth factors, including receptor tyrosine kinases and antiproliferative proteins. Genes whose expression was suppressed by PRMT5 and p44 encoded anti-growth factors and inhibited cell growth when ectopically expressed. In contrast, genes whose expression was enhanced by PRMT5 and p44 encoded growth factors and increased cell growth when expressed. Altered expression of target genes is associated with re-activation of PRMT5 and p44 during lung tumorigenesis. Our data provide the molecular basis by which PRMT5 and p44 regulate cell growth and lay a foundation for further investigation of their role in lung tumor initiation. The online version of this article (doi:10.1186/s12885-016-2632-3) contains supplementary material, which is available to authorized users
Sheen, Tamsin R; Jimenez, Alyssa; Wang, Nai-Yu; Banerjee, Anirban; van Sorge, Nina M; Doran, Kelly S
2011-12-01
Streptococcus agalactiae (group B streptococcus [GBS]) is a Gram-positive bacterium found in the female rectovaginal tract and is capable of producing severe disease in susceptible hosts, including newborns and pregnant women. The vaginal tract is considered a major reservoir for GBS, and maternal vaginal colonization poses a significant risk to the newborn; however, little is known about the specific bacterial factors that promote GBS colonization and persistence in the female reproductive tract. We have developed in vitro models of GBS interaction with the human female cervicovaginal tract using human vaginal and cervical epithelial cell lines. Analysis of isogenic mutant GBS strains deficient in cell surface organelles such as pili and serine-rich repeat (Srr) proteins shows that these factors contribute to host cell attachment. As Srr proteins are heavily glycosylated, we confirmed that carbohydrate moieties contribute to the effective interaction of Srr-1 with vaginal epithelial cells. Antibody inhibition assays identified keratin 4 as a possible host receptor for Srr-1. Our findings were further substantiated in an in vivo mouse model of GBS vaginal colonization, where mice inoculated with an Srr-1-deficient mutant exhibited decreased GBS vaginal persistence compared to those inoculated with the wild-type (WT) parental strain. Furthermore, competition experiments in mice showed that WT GBS exhibited a significant survival advantage over the ΔpilA or Δsrr-1 mutant in the vaginal tract. Our results suggest that these GBS surface proteins contribute to vaginal colonization and may offer new insights into the mechanisms of vaginal niche establishment.
Sheen, Tamsin R.; Jimenez, Alyssa; Wang, Nai-Yu; Banerjee, Anirban; van Sorge, Nina M.; Doran, Kelly S.
2011-01-01
Streptococcus agalactiae (group B streptococcus [GBS]) is a Gram-positive bacterium found in the female rectovaginal tract and is capable of producing severe disease in susceptible hosts, including newborns and pregnant women. The vaginal tract is considered a major reservoir for GBS, and maternal vaginal colonization poses a significant risk to the newborn; however, little is known about the specific bacterial factors that promote GBS colonization and persistence in the female reproductive tract. We have developed in vitro models of GBS interaction with the human female cervicovaginal tract using human vaginal and cervical epithelial cell lines. Analysis of isogenic mutant GBS strains deficient in cell surface organelles such as pili and serine-rich repeat (Srr) proteins shows that these factors contribute to host cell attachment. As Srr proteins are heavily glycosylated, we confirmed that carbohydrate moieties contribute to the effective interaction of Srr-1 with vaginal epithelial cells. Antibody inhibition assays identified keratin 4 as a possible host receptor for Srr-1. Our findings were further substantiated in an in vivo mouse model of GBS vaginal colonization, where mice inoculated with an Srr-1-deficient mutant exhibited decreased GBS vaginal persistence compared to those inoculated with the wild-type (WT) parental strain. Furthermore, competition experiments in mice showed that WT GBS exhibited a significant survival advantage over the ΔpilA or Δsrr-1 mutant in the vaginal tract. Our results suggest that these GBS surface proteins contribute to vaginal colonization and may offer new insights into the mechanisms of vaginal niche establishment. PMID:21984789
The double bromodomain protein Brd2 promotes B cell expansion and mitogenesis.
Belkina, Anna C; Blanton, Wanda P; Nikolajczyk, Barbara S; Denis, Gerald V
2014-03-01
Bromodomain-containing transcriptional regulators represent new epigenetic targets in different hematologic malignancies. However, bromodomain-mediated mechanisms that couple histone acetylation to transcription in lymphopoiesis and govern mature lymphocyte mitogenesis are poorly understood. Brd2, a transcriptional coregulator that contains dual bromodomains and an extraterminal domain (the BET family), couples chromatin to cell-cycle progression. We reported previously the first functional characterization of a BET protein as an effector of mammalian mitogenic signal transduction: Eμ-Brd2 Tg mice develop "activated B cell" diffuse large B cell lymphoma. No other animal models exist for genetic or lentiviral expression of BET proteins, hampering testing of novel anti-BET anticancer drugs, such as JQ1. We transduced HSCs with Brd2 lentivirus and reconstituted recipient mice to test the hypothesis that Brd2 regulates hematopoiesis in BM and mitogenesis in the periphery. Forced expression of Brd2 provides an expansion advantage to the donor-derived B cell compartment in BM and increases mature B cell mitogenic responsiveness in vitro. Brd2 binds the cyclin A promoter in B cells, shown by ChIP, and increases cyclin A mRNA and protein levels, and S-phase progression in vitro in mitogen-stimulated primary B cells, but not T cells, reinforcing results from Eμ-Brd2 mice. The small molecule BET inhibitor JQ1 reduces B cell mitogenesis, consistent with the interpretation that BET inhibitors are antiproliferative. Brd2-specific knockdown experiments show that Brd2 is also required for hematopoiesis. We conclude that Brd2 plays a critical, independent role in regulation of mitogenic response genes, particularly cyclin A, in B cells.
Zou, Wei; Ma, Xiangdong; Yang, Hong; Hua, Wei; Chen, Biliang; Cai, Guoqing
2017-03-01
Ovarian cancer is the highest mortality rate of all female reproductive malignancies. Drug resistance is a major cause of treatment failure in malignant tumors. Hepatitis B X-interacting protein acts as an oncoprotein, regulates cell proliferation, and migration in breast cancer. We aimed to investigate the effects and mechanisms of hepatitis B X-interacting protein on resistance to cisplatin in human ovarian cancer cell lines. The mRNA and protein levels of hepatitis B X-interacting protein were detected using RT-PCR and Western blotting in cisplatin-resistant and cisplatin-sensitive tissues, cisplatin-resistant cell lines A2780/CP and SKOV3/CP, and cisplatin-sensitive cell lines A2780 and SKOV3. Cell viability and apoptosis were measured to evaluate cellular sensitivity to cisplatin in A2780/CP cells. Luciferase reporter gene assay was used to determine the relationship between hepatitis B X-interacting protein and CD147. The in vivo function of hepatitis B X-interacting protein on tumor burden was assessed in cisplatin-resistant xenograft models. The results showed that hepatitis B X-interacting protein was highly expressed in ovarian cancer of cisplatin-resistant tissues and cells. Notably, knockdown of hepatitis B X-interacting protein significantly reduced cell viability in A2780/CP compared with cisplatin treatment alone. Hepatitis B X-interacting protein and cisplatin cooperated to induce apoptosis and increase the expression of c-caspase 3 as well as the Bax/Bcl-2 ratio. We confirmed that hepatitis B X-interacting protein up-regulated CD147 at the protein expression and transcriptional levels. Moreover, we found that hepatitis B X-interacting protein was able to activate the CD147 promoter through Sp1. In vivo, depletion of hepatitis B X-interacting protein decreased the tumor volume and weight induced by cisplatin. Taken together, these results indicate that hepatitis B X-interacting protein promotes cisplatin resistance and regulated CD147 via Sp1 in
Directory of Open Access Journals (Sweden)
Patrizia Marinelli
2018-04-01
Full Text Available Oxidatively modified forms of proteins accumulate during aging. Oxidized protein conformers might act as intermediates in the formation of amyloids in age-related disorders. However, it is not known whether this amyloidogenic conversion requires an extensive protein oxidative damage or it can be promoted just by a discrete, localized post-translational modification of certain residues. Here, we demonstrate that the irreversible oxidation of a single free Cys suffices to severely perturb the folding energy landscape of a stable globular protein, compromise its kinetic stability, and lead to the formation of amyloids under physiological conditions. Experiments and simulations converge to indicate that this specific oxidation-promoted protein aggregation requires only local unfolding. Indeed, a large scale analysis indicates that many cellular proteins are at risk of undergoing this kind of deleterious transition; explaining how oxidative stress can impact cell proteostasis and subsequently lead to the onset of pathological states. Keywords: Protein oxidation, Protein misfolding, Protein aggregation, Oxidative stress, Post-translational modification
Directory of Open Access Journals (Sweden)
Álvarez-Morales Ariel
2011-05-01
Full Text Available Abstract Background Pseudomonas syringae pv. phaseolicola, the causal agent of halo blight disease in beans, produces a toxin known as phaseolotoxin, in whose synthesis participate a group of genes organized within the genome in a region known as the "Pht cluster". This region, which is thought to have been acquired by horizontal gene transfer, includes 5 transcriptional units, two monocistronic (argK, phtL and three polycistronic (phtA, phtD, phtM, whose expression is temperature dependent. So far, the regulatory mechanisms involved in phaseolotoxin synthesis have not been elucidated and the only well-established fact is the requirement of low temperatures for its synthesis. In this work, we searched for regulatory proteins that could be involved in phaseolotoxin synthesis, focusing on the regulation of the phtD operon. Results In this study we identified the global regulator IHF (Integration Host Factor, which binds to the promoter region of the phtD operon, exerting a negative effect on the expression of this operon. This is the first regulatory protein identified as part of the phaseolotoxin synthesis system. Our findings suggest that the Pht cluster was similarly regulated in the ancestral cluster by IHF or similar protein, and integrated into the global regulatory mechanism of P. syringae pv. phaseolicola, after the horizontal gene transfer event by using the host IHF protein. Conclusion This study identifies the IHF protein as one element involved in the regulation of phaseolotoxin synthesis in P. syringae pv. phaseolicola NPS3121 and provides new insights into the regulatory mechanisms involved in phaseolotoxin production.
Ansari, Suraiya A.; Paul, Emily; Sommer, Sebastian; Lieleg, Corinna; He, Qiye; Daly, Alexandre Z.; Rode, Kara A.; Barber, Wesley T.; Ellis, Laura C.; LaPorta, Erika; Orzechowski, Amanda M.; Taylor, Emily; Reeb, Tanner; Wong, Jason; Korber, Philipp; Morse, Randall H.
2014-01-01
Transcription by RNA polymerase II (Pol II) in eukaryotes requires the Mediator complex, and often involves chromatin remodeling and histone eviction at active promoters. Here we address the role of Mediator in recruitment of the Swi/Snf chromatin remodeling complex and its role, along with components of the preinitiation complex (PIC), in histone eviction at inducible and constitutively active promoters in the budding yeast Saccharomyces cerevisiae. We show that recruitment of the Swi/Snf chromatin remodeling complex to the induced CHA1 promoter, as well as its association with several constitutively active promoters, depends on the Mediator complex but is independent of Mediator at the induced MET2 and MET6 genes. Although transcriptional activation and histone eviction at CHA1 depends on Swi/Snf, Swi/Snf recruitment is not sufficient for histone eviction at the induced CHA1 promoter. Loss of Swi/Snf activity does not affect histone occupancy of several constitutively active promoters; in contrast, higher histone occupancy is seen at these promoters in Mediator and PIC component mutants. We propose that an initial activator-dependent, nucleosome remodeling step allows PIC components to outcompete histones for occupancy of promoter sequences. We also observe reduced promoter association of Mediator and TATA-binding protein in a Pol II (rpb1-1) mutant, indicating mutually cooperative binding of these components of the transcription machinery and indicating that it is the PIC as a whole whose binding results in stable histone eviction. PMID:24727477
Directory of Open Access Journals (Sweden)
Nelli Babayan
2011-12-01
Full Text Available Building on the model of the enlargement policy, the European Union (EU designed the European Neighbourhood Policy and the Eastern Partnership to further promote its norms and principles. One of the goals of its new policies has been to foster regional cooperation among partner countries and their neighbours. This article specifies the EU’s framework for promoting regional cooperation through the aforementioned policies and discusses its potential impact on the example of the South Caucasus republics of Armenia, Azerbaijan, and Georgia. The South Caucasus has not only been an arena of intraregional conflicts, but has also often been troubled by disputes between its neighbours. This article argues that, due to a lack of proactive and consistent engagement, the EU’s framework risks leaving regional conflicts in the current state of stagnation and without advancement in regional cooperation.
Grunden, A M; Self, W T; Villain, M; Blalock, J E; Shanmugam, K T
1999-08-20
Expression of the modABCD operon in Escherichia coli, which codes for a molybdate-specific transporter, is repressed by ModE in vivo in a molybdate-dependent fashion. In vitro DNase I-footprinting experiments identified three distinct regions of protection by ModE-molybdate on the modA operator/promoter DNA, GTTATATT (-15 to -8; region 1), GCCTACAT (-4 to +4; region 2), and GTTACAT (+8 to +14; region 3). Within the three regions of the protected DNA, a pentamer sequence, TAYAT (Y = C or T), can be identified. DNA-electrophoretic mobility experiments showed that the protected regions 1 and 2 are essential for binding of ModE-molybdate to DNA, whereas the protected region 3 increases the affinity of the DNA to the repressor. The stoichiometry of this interaction was found to be two ModE-molybdate per modA operator DNA. ModE-molybdate at 5 nM completely protected the modABCD operator/promoter DNA from DNase I-catalyzed hydrolysis, whereas ModE alone failed to protect the DNA even at 100 nM. The apparent K(d) for the interaction between the modA operator DNA and ModE-molybdate was 0.3 nM, and the K(d) increased to 8 nM in the absence of molybdate. Among the various oxyanions tested, only tungstate replaced molybdate in the repression of modA by ModE, but the affinity of ModE-tungstate for modABCD operator DNA was 6 times lower than with ModE-molybdate. A mutant ModE(T125I) protein, which repressed modA-lac even in the absence of molybdate, protected the same region of modA operator DNA in the absence of molybdate. The apparent K(d) for the interaction between modA operator DNA and ModE(T125I) was 3 nM in the presence of molybdate and 4 nM without molybdate. The binding of molybdate to ModE resulted in a decrease in fluorescence emission, indicating a conformational change of the protein upon molybdate binding. The fluorescence emission spectra of mutant ModE proteins, ModE(T125I) and ModE(Q216*), were unaffected by molybdate. The molybdate-independent mutant Mod
Energy Technology Data Exchange (ETDEWEB)
Waller, Zoë A.E., E-mail: z.waller@uea.ac.uk; Howell, Lesley A.; MacDonald, Colin J.; O’Connell, Maria A.; Searcey, Mark, E-mail: m.searcey@uea.ac.uk
2014-04-25
Highlights: • Discovery of a G-quadruplex forming sequence in the promoter sequence of Nrf2. • Characterisation of the G-quadruplex by UV, CD and NMR. • Conformational switching of G-quadruplex induced by 9-aminoacridine. - Abstract: The transcription factor nuclear factor (erythroid-derived 2)-like 2 (Nrf2) regulates multiple antioxidants, Phase II detoxification enzymes and other cytoprotective enzymes in cells. Activation of Nrf2 is recognised as being of potential therapeutic benefit in inflammatory-diseases whereas more recently, it has become clear that the inhibition of Nrf2 may have benefit in the alleviation of resistance in some tumour types. A potential G-quadruplex forming sequence was identified in the promoter region of Nrf2, close to a number of putative transcription factor binding sites. Characterisation of the sequence 5’-d[GGGAAGGGAGCAAGGGCGGGAGGG]-3’ using CD spectroscopy, imino proton NMR resonances and UV melting experiments demonstrated the formation of a parallel intramolecular G-quadruplex in the presence of K{sup +} ions. Incubation with 9-aminoacridine ligands induced a switch from antiparallel to parallel forms. The presence of a G-quadruplex forming sequence in the promoter region of Nrf2 suggests an approach to targeting the production of the protein through stabilisation of the structure, thereby avoiding resistance to antitumour drugs.
International Nuclear Information System (INIS)
Sassone-Corsi, P.; Borrelli, E.
1987-01-01
The E1A (early region 1A) oncogene products of adenovirus type 2 trans-activate the other early viral transcription units, as well as some cellular promoters. Using a short-term cotransfection assay in murine NIH 3T3 fibroblasts, we show that c-fos and c-myc promoter activities are stimulated by the E1A proteins, whereas c-Ha-ras transcription is not affected. The product of E1A 13S mRNA is responsible for the trans-activation, whereas the 12S mRNA product has no effect. Analysis of the c-fos promoter sequences required for the E1A stimulation shows that responsive sequences are located between positions -402 and -240 upstream of the transcription initiation site. This same region also contains the c-fos serum-responsive element. Furthermore, transcription of the endogenous c-fos gene in HeLa cells is increased after E1A transfection
Directory of Open Access Journals (Sweden)
Jennifer S. Lee
2016-01-01
Full Text Available Herpesviruses must contend with host cell epigenetic silencing responses acting on their genomes upon entry into the host cell nucleus. In this study, we confirmed that unchromatinized herpes simplex virus 1 (HSV-1 genomes enter primary human foreskin fibroblasts and are rapidly subjected to assembly of nucleosomes and association with repressive heterochromatin modifications such as histone 3 (H3 lysine 9-trimethylation (H3K9me3 and lysine 27-trimethylation (H3K27me3 during the first 1 to 2 h postinfection. Kinetic analysis of the modulation of nucleosomes and heterochromatin modifications over the course of lytic infection demonstrates a progressive removal that coincided with initiation of viral gene expression. We obtained evidence for three phases of heterochromatin removal from an early gene promoter: an initial removal of histones and heterochromatin not dependent on ICP0, a second ICP0-dependent round of removal of H3K9me3 that is independent of viral DNA synthesis, and a third phase of H3K27me3 removal that is dependent on ICP0 and viral DNA synthesis. The presence of ICP0 in transfected cells is also sufficient to promote removal of histones and H3K9me3 modifications of cotransfected genes. Overall, these results show that ICP0 promotes histone removal, a reduction of H3K9me3 modifications, and a later indirect reduction of H3K27me3 modifications following viral early gene expression and DNA synthesis. Therefore, HSV ICP0 promotes the reversal of host epigenetic silencing mechanisms by several mechanisms.
Directory of Open Access Journals (Sweden)
James Dollman
2016-01-01
Full Text Available Rural Australians are less physically active than their metropolitan counterparts, and yet very little is known of the candidate intervention targets for promoting physical activity in rural populations. As rural regions are economically, socially and environmentally diverse, drivers of regular physical activity are likely to vary between regions. This study explored the region-specific correlates of daily walking among middle age and older adults in rural regions with contrasting dominant primary industries. Participants were recruited through print and electronic media, primary care settings and community organisations. Pedometers were worn by 153 adults for at least four days, including a weekend day. A questionnaire identified potential intra-personal, social and environmental correlates of physical activity, according to a social ecological framework. Regression modelling identified independent correlates of daily walking separately in the two study regions. In one region, there were independent correlates of walking from all levels of the social ecological framework. In the other region, significant correlates of daily walking were almost all demographic (age, education and marital status. Participants living alone were less likely to be physically active regardless of region. This study highlights the importance of considering region-specific factors when designing strategies for promoting regular walking among rural adults.
Xie, Hongbo; Vucetic, Slobodan; Iakoucheva, Lilia M; Oldfield, Christopher J; Dunker, A Keith; Uversky, Vladimir N; Obradovic, Zoran
2007-05-01
Identifying relationships between function, amino acid sequence, and protein structure represents a major challenge. In this study, we propose a bioinformatics approach that identifies functional keywords in the Swiss-Prot database that correlate with intrinsic disorder. A statistical evaluation is employed to rank the significance of these correlations. Protein sequence data redundancy and the relationship between protein length and protein structure were taken into consideration to ensure the quality of the statistical inferences. Over 200,000 proteins from the Swiss-Prot database were analyzed using this approach. The predictions of intrinsic disorder were carried out using PONDR VL3E predictor of long disordered regions that achieves an accuracy of above 86%. Overall, out of the 710 Swiss-Prot functional keywords that were each associated with at least 20 proteins, 238 were found to be strongly positively correlated with predicted long intrinsically disordered regions, whereas 302 were strongly negatively correlated with such regions. The remaining 170 keywords were ambiguous without strong positive or negative correlation with the disorder predictions. These functions cover a large variety of biological activities and imply that disordered regions are characterized by a wide functional repertoire. Our results agree well with literature findings, as we were able to find at least one illustrative example of functional disorder or order shown experimentally for the vast majority of keywords showing the strongest positive or negative correlation with intrinsic disorder. This work opens a series of three papers, which enriches the current view of protein structure-function relationships, especially with regards to functionalities of intrinsically disordered proteins, and provides researchers with a novel tool that could be used to improve the understanding of the relationships between protein structure and function. The first paper of the series describes our
Xie, Hongbo; Vucetic, Slobodan; Iakoucheva, Lilia M.; Oldfield, Christopher J.; Dunker, A. Keith; Uversky, Vladimir N.; Obradovic, Zoran
2008-01-01
Identifying relationships between function, amino acid sequence and protein structure represents a major challenge. In this study we propose a bioinformatics approach that identifies functional keywords in the Swiss-Prot database that correlate with intrinsic disorder. A statistical evaluation is employed to rank the significance of these correlations. Protein sequence data redundancy and the relationship between protein length and protein structure were taken into consideration to ensure the quality of the statistical inferences. Over 200,000 proteins from Swiss-Prot database were analyzed using this approach. The predictions of intrinsic disorder were carried out using PONDR VL3E predictor of long disordered regions that achieves an accuracy of above 86%. Overall, out of the 710 Swiss-Prot functional keywords that were each associated with at least 20 proteins, 238 were found to be strongly positively correlated with predicted long intrinsically disordered regions, whereas 302 were strongly negatively correlated with such regions. The remaining 170 keywords were ambiguous without strong positive or negative correlation with the disorder predictions. These functions cover a large variety of biological activities and imply that disordered regions are characterized by a wide functional repertoire. Our results agree well with literature findings, as we were able to find at least one illustrative example of functional disorder or order shown experimentally for the vast majority of keywords showing the strongest positive or negative correlation with intrinsic disorder. This work opens a series of three papers, which enriches the current view of protein structure-function relationships, especially with regards to functionalities of intrinsically disordered proteins and provides researchers with a novel tool that could be used to improve the understanding of the relationships between protein structure and function. The first paper of the series describes our statistical
Light response and potential interacting proteins of a grape flavonoid 3'-hydroxylase gene promoter.
Sun, Run-Ze; Pan, Qiu-Hong; Duan, Chang-Qing; Wang, Jun
2015-12-01
Flavonoid 3'-hydroxylase (F3'H), a member of cytochrome P450 protein family, introduces B-ring hydroxyl group in the 3' position of the flavonoid. In this study, the cDNA sequence of a F3'H gene (VviF3'H), which contains an open reading frame of 1530 bp encoding a polypeptide of 509 amino acids, was cloned and characterized from Vitis vinifera L. cv. Cabernet Sauvignon. VviF3'H showed high homology to known F3'H genes, especially F3'Hs from the V. vinifera reference genome (Pinot Noir) and lotus. Expression profiling analysis using real-time PCR revealed that VviF3'H was ubiquitously expressed in all tested tissues including berries, leaves, flowers, roots, stems and tendrils, suggesting its important physiological role in plant growth and development. Moreover, the transcript level of VviF3'H gene in grape berries was relatively higher at early developmental stages and gradually decreased during véraison, and then increased in the mature phase. In addition, the promoter of VviF3'H was isolated by using TAIL-PCR. Yeast one-hybrid screening of the Cabernet Sauvignon cDNA library and subsequent in vivo/vitro validations revealed the interaction between VviF3'H promoter and several transcription factors, including members of HD-Zip, NAC, MYB and EIN families. A transcriptional regulation mechanism of VviF3'H expression is proposed for the first time. Copyright © 2015 Elsevier Masson SAS. All rights reserved.
Protein kinase C (PKC) isoforms in cancer, tumor promotion and tumor suppression.
Isakov, Noah
2018-02-01
The AGC family of serine/threonine kinases (PKA, PKG, PKC) includes more than 60 members that are critical regulators of numerous cellular functions, including cell cycle and differentiation, morphogenesis, and cell survival and death. Mutation and/or dysregulation of AGC kinases can lead to malignant cell transformation and contribute to the pathogenesis of many human diseases. Members of one subgroup of AGC kinases, the protein kinase C (PKC), have been singled out as critical players in carcinogenesis, following their identification as the intracellular receptors of phorbol esters, which exhibit tumor-promoting activities. This observation attracted the attention of researchers worldwide and led to intense investigations on the role of PKC in cell transformation and the potential use of PKC as therapeutic drug targets in cancer diseases. Studies demonstrated that many cancers had altered expression and/or mutation of specific PKC genes. However, the causal relationships between the changes in PKC gene expression and/or mutation and the direct cause of cancer remain elusive. Independent studies in normal cells demonstrated that activation of PKC is essential for the induction of cell activation and proliferation, differentiation, motility, and survival. Based on these observations and the general assumption that PKC isoforms play a positive role in cell transformation and/or cancer progression, many PKC inhibitors have entered clinical trials but the numerous attempts to target PKC in cancer has so far yielded only very limited success. More recent studies demonstrated that PKC function as tumor suppressors, and suggested that future clinical efforts should focus on restoring, rather than inhibiting, PKC activity. The present manuscript provides some historical perspectives on the tumor promoting function of PKC, reviewing some of the observations linking PKC to cancer progression, and discusses the role of PKC in the pathogenesis of cancer diseases and its
Singh, Pawan; Patil, K Neelakanteshwar; Khanduja, Jasbeer Singh; Kumar, P Sanjay; Williams, Alan; Rossi, Franca; Rizzi, Menico; Davis, Elaine O; Muniyappa, K
2010-06-15
DNA helicases are present in all kingdoms of life and play crucial roles in processes of DNA metabolism such as replication, repair, recombination, and transcription. To date, however, the role of DNA helicases during homologous recombination in mycobacteria remains unknown. In this study, we show that Mycobacterium tuberculosis UvrD1 more efficiently inhibited the strand exchange promoted by its cognate RecA, compared to noncognate Mycobacterium smegmatis or Escherichia coli RecA proteins. The M. tuberculosis UvrD1(Q276R) mutant lacking the helicase and ATPase activities was able to block strand exchange promoted by mycobacterial RecA proteins but not of E. coli RecA. We observed that M. tuberculosis UvrA by itself has no discernible effect on strand exchange promoted by E. coli RecA but impedes the reaction catalyzed by the mycobacterial RecA proteins. Our data also show that M. tuberculosis UvrA and UvrD1 can act together to inhibit strand exchange promoted by mycobacterial RecA proteins. Taken together, these findings raise the possibility that UvrD1 and UvrA might act together in vivo to counter the deleterious effects of RecA nucleoprotein filaments and/or facilitate the dissolution of recombination intermediates. Finally, we provide direct experimental evidence for a physical interaction between M. tuberculosis UvrD1 and RecA on one hand and RecA and UvrA on the other hand. These observations are consistent with a molecular mechanism, whereby M. tuberculosis UvrA and UvrD1, acting together, block DNA strand exchange promoted by cognate and noncognate RecA proteins.
Kawaguchi, Yuka; Nariki, Hiroaki; Kawamoto, Naoko; Kanehiro, Yuichi; Miyazaki, Satoshi; Suzuki, Mari; Magari, Masaki; Tokumitsu, Hiroshi; Kanayama, Naoki
2017-04-01
Activation-induced cytidine deaminase (AID) is essential for diversification of the Ig variable region (IgV). AID is excluded from the nucleus, where it normally functions. However, the molecular mechanisms responsible for regulating AID localization remain to be elucidated. The SR-protein splicing factor SRSF1 is a nucleocytoplasmic shuttling protein, a splicing isoform of which called SRSF1-3, has previously been shown to contribute to IgV diversification in chicken DT40 cells. In this study, we examined whether SRSF1-3 functions in IgV diversification by promoting nuclear localization of AID. AID expressed alone was localized predominantly in the cytoplasm. In contrast, co-expression of AID with SRSF1-3 led to the nuclear accumulation of both AID and SRSF1-3 and the formation of a protein complex that contained them both, although SRSF1-3 was dispensable for nuclear import of AID. Expression of either SRSF1-3 or a C-terminally-truncated AID mutant increased IgV diversification in DT40 cells. However, overexpression of exogenous SRSF1-3 was unable to further enhance IgV diversification in DT40 cells expressing the truncated AID mutant, although SRSF1-3 was able to form a protein complex with the AID mutant. These results suggest that SRSF1-3 promotes nuclear localization of AID probably by forming a nuclear protein complex, which might stabilize nuclear AID and induce IgV diversification in an AID C-terminus-dependent manner. Copyright © 2017 Elsevier Inc. All rights reserved.
Ma'ruf, Anwar; Iswati, Sri; Hidajati, Nove; Damayanti, Ratna
2017-09-01
The long-term objective of this study was to produce STAT synthetic protein in chicken during growth period resulting from the increase of growth hormone (GH) as growth promoter. This study used ten male chicken Lohman from PT. Multibreeder Indonesia. The chicken were kept within batteried cage, with a capacity of one chicken in each cage. The chickens were fed twice a day, at 6 a.m. and 6 p.m. with the amount of feed 10% less than standard. On day 21 the chicken were slaughtered to obtain the samples, i.e., adipose, liver and muscles for the following examinations (1) isolation of STAT-3 signaling protein from adipose, liver and muscles of the chicken, (2) analysis of STAT-3 signaling protein using SDS-PAGE method, and (3) identification of STAT-3 signaling protein using Western blot method by means of protein detection using electrophoresis with polyacrylamide gels. Results of examination on protein in hepatic, muscle and adipose of chickens in growth period revealed that STAT protein was positively present in those tissues. This finding was followed-up with SDS-PAGE examination, from which we found the presence of protein band between the markers of 116 kDa and 14.4 kDa. The protein band was supposedly the STAT-3 protein. To prove that protein band formed was the STAT-3, Western blot examination was conducted using rabbit polyclonal antibody STAT-3. The result showed the formation of the protein band, indicating the presence of reaction between antigen (STAT-3 protein) and STAT-3 protein antibody. In conclusion, STAT-3 protein is present in hepatic, muscular, and adipose tissues, with molecular weight of 59.4 kDa.
DEFF Research Database (Denmark)
Hernandez Castellano, Lorenzo E; Morales-delaNuez, Antonio; Moreno-Indias, Isabel
2013-01-01
of this study, therefore, was to evaluate local and imported carcasses and meat quality in order to promote the consumption of local breeds, using the Canary Islands (Spain) as a model for other subtropical outermost regions. For this study 20 half-carcasses from Palmera breed and 20 imported half...
Shi, H B; Yu, K; Luo, J; Li, J; Tian, H B; Zhu, J J; Sun, Y T; Yao, D W; Xu, H F; Shi, H P; Loor, J J
2015-10-01
Milk fat originates from the secretion of cytosolic lipid droplets (CLD) synthesized within mammary epithelial cells. Adipocyte differentiation-related protein (ADRP; gene symbol PLIN2) is a CLD-binding protein that is crucial for synthesis of mature CLD. Our hypothesis was that ADRP regulates CLD production and metabolism in goat mammary epithelial cells (GMEC) and thus plays a role in determining milk fat content. To understand the role of ADRP in ruminant milk fat metabolism, ADRP (PLIN2) was overexpressed or knocked down in GMEC using an adenovirus system. Immunocytochemical staining revealed that ADRP localized to the surface of CLD. Supplementation with oleic acid (OA) enhanced its colocalization with CLD surface and enhanced lipid accumulation. Overexpression of ADRP increased lipid accumulation and the concentration of triacylglycerol in GMEC. In contrast, morphological examination revealed that knockdown of ADRP decreased lipid accumulation even when OA was supplemented. This response was confirmed by the reduction in mass of cellular TG when ADRP was knocked down. The fact that knockdown of ADRP did not completely eliminate lipid accumulation at a morphological level in GMEC without OA suggests that some other compensatory factors may also aid in the process of CLD formation. The ADRP reversed the decrease of CLD accumulation induced by adipose triglyceride lipase. This is highly suggestive of ADRP promoting triacylglycerol stability within CLD by preventing access to adipose triglyceride lipase. Collectively, these data provide direct in vitro evidence that ADRP plays a key role in CLD formation and stability in GMEC. Copyright © 2015 American Dairy Science Association. Published by Elsevier Inc. All rights reserved.
G Protein-Coupled Receptor 87 (GPR87 Promotes Cell Proliferation in Human Bladder Cancer Cells
Directory of Open Access Journals (Sweden)
Xia Zhang
2015-10-01
Full Text Available G protein-coupled receptor 87 (GPR87 is a newly deorphanized member of the cell surface molecule G protein-coupled receptor family. GPR signaling was shown to play a role in promotion of cell growth and survival, metastasis, and drug resistance. The overexpression of GPR87 has also been reported in many malignant tumors including bladder cancer. The aim of the present study is to examine the effect of silencing GPR87 expression with a replication-deficient recombinant adenoviral vector expressing short hairpin RNA targeting GPR87 (Ad-shGPR87 and to explore the underlying molecular mechanisms in bladder cancer cells. Six GPR87-expressing human bladder cancer cells, HT1197, HT1376, J82, RT112, TCCSUP and UMUC3, were used. Infection with Ad-shGPR87 effectively downregulated the GPR87 expression, and significantly reduced the percentage of viable cells in 4 of 6 cell lines as detected by an MTT assay. Significant inhibition on cell proliferation with Ad-shGPR87 was observed in the wild-type p53 bladder cancer cell lines (HT1197, RT112, TCCSUP and UMUC3, but not in the mutant p53 cells (HT1376 and J82. As represented by a wild-type p53 RT112 cell, Ad-shGPR87 infection significantly enhanced p53 and p21 expression and caused caspase-dependent apoptosis. Furthermore, the treatment with Ad-shGPR87 exerted a significant antitumor effect against the GPR87-expressing RT112 xenografts. GPR87 appeared to be a promising target for gene therapy, and Ad-shGPR87 had strong antitumor effects, specifically anti-proliferative and pro-apoptotic effects, against GPR87-expressing human bladder cancer cells.
Ramis, Ivy Bastos; Vianna, Júlia Silveira; Halicki, Priscila Cristina Bartolomeu; Lara, Caroline; Tadiotto, Thássia Fernanda; da Silva Maciel, João Batista; Gonçalves, Carla Vitola; von Groll, Andrea; Dellagostin, Odir Antônio; da Silva, Pedro Eduardo Almeida
2015-09-29
Helicobacter pylori infection is associated with gastritis, peptic ulcer disease and gastric carcinoma. The severity of damage is determined by the interplay between environmental/behavioral factors, bacterial pathogenicity genes and host genetic polymorphisms that can influence the secretion levels of inflammatory cytokines. Accordingly, this study aimed to identify polymorphisms in the IL-1B and IL-1RN genes and their associations with H. pylori infection, cagA gene of H. pylori, and gastroduodenal diseases. Gastric biopsy samples from 151 patients infected with H. pylori and 76 uninfected individuals were analyzed. H. pylori infection was diagnosed by histology and PCR. Polymorphisms at positions -511, -31 and +3954 of the IL-1B gene were detected by PCR-RFLP, and an analysis of the VNTR polymorphism of the IL-1RN gene was performed by PCR. It was observed that the presence of the T/T genotype at position -511 and the C/C genotype at position -31 were associated with H. pylori infection and with an increased risk of gastritis in H. pylori-positive patients. Additionally, strains from patients H. pylori-positive carrying the cagA gene was significantly related with the T/T genotype at position -511 of IL-1B. No association of polymorphisms at position +3954 of IL-1B and in the IL-1RN with H. pylori infection and with risk of severe gastric diseases was found. We demonstrated that polymorphisms in the promoter region of the IL-1B gene (at positions -511 and -31) are associated with an enhanced risk of H. pylori infection as well as gastritis in H. pylori-positive patients.
DeepCNF-D: Predicting Protein Order/Disorder Regions by Weighted Deep Convolutional Neural Fields
Directory of Open Access Journals (Sweden)
Sheng Wang
2015-07-01
Full Text Available Intrinsically disordered proteins or protein regions are involved in key biological processes including regulation of transcription, signal transduction, and alternative splicing. Accurately predicting order/disorder regions ab initio from the protein sequence is a prerequisite step for further analysis of functions and mechanisms for these disordered regions. This work presents a learning method, weighted DeepCNF (Deep Convolutional Neural Fields, to improve the accuracy of order/disorder prediction by exploiting the long-range sequential information and the interdependency between adjacent order/disorder labels and by assigning different weights for each label during training and prediction to solve the label imbalance issue. Evaluated by the CASP9 and CASP10 targets, our method obtains 0.855 and 0.898 AUC values, which are higher than the state-of-the-art single ab initio predictors.
GBA manager: an online tool for querying low-complexity regions in proteins.
Bandyopadhyay, Nirmalya; Kahveci, Tamer
2010-01-01
Abstract We developed GBA Manager, an online software that facilitates the Graph-Based Algorithm (GBA) we proposed in our earlier work. GBA identifies the low-complexity regions (LCR) of protein sequences. GBA exploits a similarity matrix, such as BLOSUM62, to compute the complexity of the subsequences of the input protein sequence. It uses a graph-based algorithm to accurately compute the regions that have low complexities. GBA Manager is a user friendly web-service that enables online querying of protein sequences using GBA. In addition to querying capabilities of the existing GBA algorithm, GBA Manager computes the p-values of the LCR identified. The p-value gives an estimate of the possibility that the region appears by chance. GBA Manager presents the output in three different understandable formats. GBA Manager is freely accessible at http://bioinformatics.cise.ufl.edu/GBA/GBA.htm .
DEFF Research Database (Denmark)
Madsen, Hans Peter Lynge; Hammer, Karin
1998-01-01
to a phage repressor, a single-stranded DNA-binding protein, a topoisomerase, a Cro-like protein and two other phage proteins of unknown function were detected. The gene arrangement in the early transcribed region of TP901-1 thus consists of two transcriptional units: one from PR containing four genes......, of which at least two (the integrase gene and putative repressor) are needed for lysogeny, and the divergent and longer transcriptional unit from PL, presumably encoding functions required for the lytic life cycle. ORFs with homology to proteins involved in DNA replication were identified on the latter......Transcriptional analysis by Northern blotting identified clusters of early, middle and late transcribed regions of the temperate lactococcal bacteriophage TP901-1 during one-step growth experiments. The latent period was found to be 65 min and the burst size 40 +/- 10. The eight early transcripts...
Sha, H.; Yang, L.; Liu, M.; Xia, S.; Liu, Y.; Liu, F.; Kersten, A.H.; Qi, L.
2014-01-01
The physiological role of the spliced form of X-box–binding protein 1 (XBP1s), a key transcription factor of the endoplasmic reticulum (ER) stress response, in adipose tissue remains largely unknown. In this study, we show that overexpression of XBP1s promotes adiponectin multimerization in
Kalveram, Birte; Lihoradova, Olga; Ikegami, Tetsuro
2011-01-01
Rift Valley fever virus (RVFV; family Bunyaviridae, genus Phlebovirus) is an important emerging pathogen of humans and ruminants. Its NSs protein has previously been identified as a major virulence factor that suppresses host defense through three distinct mechanisms: it directly inhibits beta interferon (IFN-β) promoter activity, it promotes the degradation of double-stranded RNA-dependent protein kinase (PKR), and it suppresses host transcription by disrupting the assembly of the basal transcription factor TFIIH through sequestration of its p44 subunit. Here, we report that in addition to PKR, NSs also promotes the degradation of the TFIIH subunit p62. Infection of cells with the RVFV MP-12 vaccine strain reduced p62 protein levels to below the detection limit early in the course of infection. This NSs-mediated downregulation of p62 was posttranslational, as it was unaffected by pharmacological inhibition of transcription or translation and MP-12 infection had no effect on p62 mRNA levels. Treatment of cells with proteasome inhibitors but not inhibition of lysosomal acidification or nuclear export resulted in a stabilization of p62 in the presence of NSs. Furthermore, p62 could be coprecipitated with NSs from lysates of infected cells. These data suggest that the RVFV NSs protein is able to interact with the TFIIH subunit p62 inside infected cells and promotes its degradation, which can occur directly in the nucleus. PMID:21543505
Zhang, Kang; Su, Lingqia; Duan, Xuguo; Liu, Lina; Wu, Jing
2017-02-20
We recently constructed a Bacillus subtilis strain (CCTCC M 2016536) from which we had deleted the srfC, spoIIAC, nprE, aprE and amyE genes. This strain is capable of robust recombinant protein production and amenable to high-cell-density fermentation. Because the promoter is among the factors that influence the production of target proteins, optimization of the initial promoter, P amyQ from Bacillus amyloliquefaciens, should improve protein expression using this strain. This study was undertaken to develop a new, high-level expression system in B. subtilis CCTCC M 2016536. Using the enzyme β-cyclodextrin glycosyltransferase (β-CGTase) as a reporter protein and B. subtilis CCTCC M 2016536 as the host, nine plasmids equipped with single promoters were screened using shake-flask cultivation. The plasmid containing the P amyQ' promoter produced the greatest extracellular β-CGTase activity; 24.1 U/mL. Subsequently, six plasmids equipped with dual promoters were constructed and evaluated using this same method. The plasmid containing the dual promoter P HpaII -P amyQ' produced the highest extracellular β-CGTase activity (30.5 U/mL) and was relatively glucose repressed. The dual promoter P HpaII -P amyQ' also mediated substantial extracellular pullulanase (90.7 U/mL) and α-CGTase expression (9.5 U/mL) during shake-flask cultivation, demonstrating the general applicability of this system. Finally, the production of β-CGTase using the dual-promoter P HpaII -P amyQ' system was investigated in a 3-L fermenter. Extracellular expression of β-CGTase reached 571.2 U/mL (2.5 mg/mL), demonstrating the potential of this system for use in industrial applications. The dual-promoter P HpaII -P amyQ' system was found to support superior expression of extracellular proteins in B. subtilis CCTCC M 2016536. This system appears generally applicable and is amenable to scale-up.
The novel protein C9orf116 promotes rat liver cell line BRL-3A proliferation.
Directory of Open Access Journals (Sweden)
Chunyan Zhang
Full Text Available Our previous study has proved that the chromosome 9 open reading frame 116 (C9orf116 (NM_001106564.1 was significantly up-regulated in the proliferation phase of liver regeneration. To study its possible physiological function, we analyzed the effect of C9orf116 on BRL-3A cells via over-expression and interference technique. MTT results showed that the cell viability of the interference group was significantly lower than the control group at 48h after transfection (P<0.05, whereas it was significantly higher in the over-expression group (P<0.05. The flow cytometry results showed that C9orf116 knockdown or over-expression had little effect on BRL-3A cell apoptosis. However, the number of cells in division phase (G2/M was significantly reduced in the interference group (P<0.05, but significantly increased in the over-expression group (P<0.01. Furthermore, the expressions of cell proliferation-related genes CCNA2, CCND1 and MYC both at mRNA and protein levels were down-regulated in the interference group and up-regulated in the over-expression group. Therefore, we concluded that C9orf116 may promote cell proliferation by modulating cell cycle transition and the expression of key genes CCNA2, CCND1 and MYC in BRL-3A cells.
Functional evolution in the plant SQUAMOSA-PROMOTER BINDING PROTEIN-LIKE (SPL gene family
Directory of Open Access Journals (Sweden)
Jill Christine Preston
2013-04-01
Full Text Available The SQUAMOSA-PROMOTER BINDING PROTEIN-LIKE (SPL family of transcription factors is functionally diverse, controlling a number of fundamental aspects of plant growth and development, including vegetative phase change, flowering time, branching, and leaf initiation rate. In natural plant populations, variation in flowering time and shoot architecture have major consequences for fitness. Likewise, in crop species, variation in branching and developmental rate impact biomass and yield. Thus, studies aimed at dissecting how the various functions are partitioned among different SPL genes in diverse plant lineages are key to providing insight into the genetic basis of local adaptation and have already garnered attention by crop breeders. Here we use phylogenetic reconstruction to reveal nine major SPL gene lineages, each of which is described in terms of function and diversification. To assess evidence for ancestral and derived functions within each SPL gene lineage, we use ancestral character state reconstructions. Our analyses suggest an emerging pattern of sub-functionalization, neo-functionalization, and possible convergent evolution following both ancient and recent gene duplication. Based on these analyses we suggest future avenues of research that may prove fruitful for elucidating the importance of SPL gene evolution in plant growth and development.
Berberine promotes glucose consumption independently of AMP-activated protein kinase activation.
Directory of Open Access Journals (Sweden)
Miao Xu
Full Text Available Berberine is a plant alkaloid with anti-diabetic action. Activation of AMP-activated protein kinase (AMPK pathway has been proposed as mechanism for berberine's action. This study aimed to examine whether AMPK activation was necessary for berberine's glucose-lowering effect. We found that in HepG2 hepatocytes and C2C12 myotubes, berberine significantly increased glucose consumption and lactate release in a dose-dependent manner. AMPK and acetyl coenzyme A synthetase (ACC phosphorylation were stimulated by 20 µmol/L berberine. Nevertheless, berberine was still effective on stimulating glucose utilization and lactate production, when the AMPK activation was blocked by (1 inhibition of AMPK activity by Compound C, (2 suppression of AMPKα expression by siRNA, and (3 blockade of AMPK pathway by adenoviruses containing dominant-negative forms of AMPKα1/α2. To test the effect of berberine on oxygen consumption, extracellular flux analysis was performed in Seahorse XF24 analyzer. The activity of respiratory chain complex I was almost fully blocked in C2C12 myotubes by berberine. Metformin, as a positive control, showed similar effects as berberine. These results suggest that berberine and metformin promote glucose metabolism by stimulating glycolysis, which probably results from inhibition of mitochondrial respiratory chain complex I, independent of AMPK activation.
Zinc finger protein 598 inhibits cell survival by promoting UV-induced apoptosis.
Yang, Qiaohong; Gupta, Romi
2018-01-19
UV is one of the major causes of DNA damage induced apoptosis. However, cancer cells adopt alternative mechanisms to evade UV-induced apoptosis. To identify factors that protect cancer cells from UV-induced apoptosis, we performed a genome wide short-hairpin RNA (shRNA) screen, which identified Zinc finger protein 598 (ZNF598) as a key regulator of UV-induced apoptosis. Here, we show that UV irradiation transcriptionally upregulates ZNF598 expression. Additionally, ZNF598 knockdown in cancer cells inhibited UV-induced apoptosis. In our study, we observe that ELK1 mRNA level as well as phosphorylated ELK1 levels was up regulated upon UV irradiation, which was necessary for UV irradiation induced upregulation of ZNF598. Cells expressing ELK1 shRNA were also resistant to UV-induced apoptosis, and phenocopy ZNF598 knockdown. Upon further investigation, we found that ZNF598 knockdown inhibits UV-induced apoptotic gene expression, which matches with decrease in percentage of annexin V positive cell. Similarly, ectopic expression of ZNF598 promoted apoptotic gene expression and also increased annexin V positive cells. Collectively, these results demonstrate that ZNF598 is a UV irradiation regulated gene and its loss results in resistance to UV-induced apoptosis.
The human nuclear poly(a-binding protein promotes RNA hyperadenylation and decay.
Directory of Open Access Journals (Sweden)
Stefan M Bresson
Full Text Available Control of nuclear RNA stability is essential for proper gene expression, but the mechanisms governing RNA degradation in mammalian nuclei are poorly defined. In this study, we uncover a mammalian RNA decay pathway that depends on the nuclear poly(A-binding protein (PABPN1, the poly(A polymerases (PAPs, PAPα and PAPγ, and the exosome subunits RRP6 and DIS3. Using a targeted knockdown approach and nuclear RNA reporters, we show that PABPN1 and PAPα, redundantly with PAPγ, generate hyperadenylated decay substrates that are recognized by the exosome and degraded. Poly(A tail extension appears to be necessary for decay, as cordycepin treatment or point mutations in the PAP-stimulating domain of PABPN1 leads to the accumulation of stable transcripts with shorter poly(A tails than controls. Mechanistically, these data suggest that PABPN1-dependent promotion of PAP activity can stimulate nuclear RNA decay. Importantly, efficiently exported RNAs are unaffected by this decay pathway, supporting an mRNA quality control function for this pathway. Finally, analyses of both bulk poly(A tails and specific endogenous transcripts reveals that a subset of nuclear RNAs are hyperadenylated in a PABPN1-dependent fashion, and this hyperadenylation can be either uncoupled or coupled with decay. Our results highlight a complex relationship between PABPN1, PAPα/γ, and nuclear RNA decay, and we suggest that these activities may play broader roles in the regulation of human gene expression.
Santangelo, G M; Tornow, J; McLaughlin, C S; Moldave, K
1991-08-30
Two promoters (A7 and A23), isolated at random from the Saccharomyces cerevisiae genome by virtue of their capacity to activate transcription, are identical to known intergenic bidirectional promoters. Sequence analysis of the genomic DNA adjacent to the A7 promoter identified a split gene encoding ribosomal (r) protein L37, which is homologous to the tRNA-binding r-proteins, L35a (from human and rat) and L32 (from frogs).
Bando, Hiroki; Hisada, Hiromoto; Ishida, Hiroki; Hata, Yoji; Katakura, Yoshio; Kondo, Akihiko
2011-11-01
A novel promoter from a hemolysin-like protein encoding the gene, hlyA, was characterized for protein overexpression in Aspergillus oryzae grown in solid-state culture. Using endo-1,4-β-glucanase from A. oryzae (CelA) as the reporter, promoter activity was found to be higher than that of the α-amylase (amyA) and manganese superoxide dismutase (sodM) genes not only in wheat bran solid-state culture but also in liquid culture. Expression of the A. oryzae endoglucanase CelB and two heterologous endoglucanases (TrEglI and TrEglIII from Trichoderma reesei) under the control of the hlyA promoter were also found to be stronger than under the control of the amyA promoter in A. oryzae grown in wheat bran solid-state culture, suggesting that the hlyA promoter may be useful for the overproduction of other proteins as well. In wheat bran solid-state culture, the productivity of the hlyA promoter in terms of protein produced was high when the cultivation temperature was 30°C or 37°C, when the water content was 0.6 or 0.8 ml/g wheat bran, and from 48 to 72 h after inoculation. Because A. oryzae sporulated actively under these conditions and because hemolysin has been reported to play a role in fungal fruiting body formation, high-level expression of hlyA may be related to sporulation.
Neubauer, Emilie-Fleur; Poole, Angela Z; Neubauer, Philipp; Detournay, Olivier; Tan, Kenneth; Davy, Simon K; Weis, Virginia M
2017-05-08
The mutualistic endosymbiosis between cnidarians and dinoflagellates is mediated by complex inter-partner signaling events, where the host cnidarian innate immune system plays a crucial role in recognition and regulation of symbionts. To date, little is known about the diversity of thrombospondin-type-1 repeat (TSR) domain proteins in basal metazoans or their potential role in regulation of cnidarian-dinoflagellate mutualisms. We reveal a large and diverse repertoire of TSR proteins in seven anthozoan species, and show that in the model sea anemone Aiptasia pallida the TSR domain promotes colonization of the host by the symbiotic dinoflagellate Symbiodinium minutum . Blocking TSR domains led to decreased colonization success, while adding exogenous TSRs resulted in a 'super colonization'. Furthermore, gene expression of TSR proteins was highest at early time-points during symbiosis establishment. Our work characterizes the diversity of cnidarian TSR proteins and provides evidence that these proteins play an important role in the establishment of cnidarian-dinoflagellate symbiosis.
Alam, Tanvir
2014-10-02
Transcriptional regulation of protein-coding genes is increasingly well-understood on a global scale, yet no comparable information exists for long non-coding RNA (lncRNA) genes, which were recently recognized to be as numerous as protein-coding genes in mammalian genomes. We performed a genome-wide comparative analysis of the promoters of human lncRNA and protein-coding genes, finding global differences in specific genetic and epigenetic features relevant to transcriptional regulation. These two groups of genes are hence subject to separate transcriptional regulatory programs, including distinct transcription factor (TF) proteins that significantly favor lncRNA, rather than coding-gene, promoters. We report a specific signature of promoter-proximal transcriptional regulation of lncRNA genes, including several distinct transcription factor binding sites (TFBS). Experimental DNase I hypersensitive site profiles are consistent with active configurations of these lncRNA TFBS sets in diverse human cell types. TFBS ChIP-seq datasets confirm the binding events that we predicted using computational approaches for a subset of factors. For several TFs known to be directly regulated by lncRNAs, we find that their putative TFBSs are enriched at lncRNA promoters, suggesting that the TFs and the lncRNAs may participate in a bidirectional feedback loop regulatory network. Accordingly, cells may be able to modulate lncRNA expression levels independently of mRNA levels via distinct regulatory pathways. Our results also raise the possibility that, given the historical reliance on protein-coding gene catalogs to define the chromatin states of active promoters, a revision of these chromatin signature profiles to incorporate expressed lncRNA genes is warranted in the future.
Tieland, Michael; Beelen, Janne; Laan, Anna C.M.; Poon, Shirley; Groot, de Lisette C.P.G.M.; Seeman, Ego; Wang, Xiaofang; Iuliano, Sandra
2018-01-01
Objective: Although it has been established that sufficient protein is required to maintain good nutritional status and support healthy aging, it is not clear if the pattern of protein consumption may also influence nutritional status, especially in institutionalized elderly who are at risk of
Wolff, Dennis W; Xie, Yan; Deng, Caishu; Gatalica, Zoran; Yang, Mingjie; Wang, Bo; Wang, Jincheng; Lin, Ming-Fong; Abel, Peter W; Tu, Yaping
2012-04-01
G-protein-coupled receptor (GPCR)-stimulated androgen-independent activation of androgen receptor (AR) contributes to acquisition of a hormone-refractory phenotype by prostate cancer. We previously reported that regulator of G-protein signaling (RGS) 2, an inhibitor of GPCRs, inhibits androgen-independent AR activation (Cao et al., Oncogene 2006;25:3719-34). Here, we show reduced RGS2 protein expression in human prostate cancer specimens compared to adjacent normal or hyperplastic tissue. Methylation-specific PCR analysis and bisulfite sequencing indicated that methylation of the CpG island in the RGS2 gene promoter correlated with RGS2 downregulation in prostate cancer. In vitro methylation of this promoter suppressed reporter gene expression in transient transfection studies, whereas reversal of this promoter methylation with 5-aza-2'-deoxycytidine (5-Aza-dC) induced RGS2 reexpression in androgen-independent prostate cancer cells and inhibited their growth under androgen-deficient conditions. Interestingly, the inhibitory effect of 5-Aza-dC was significantly reduced by an RGS2-targeted short hairpin RNA, indicating that reexpressed RGS2 contributed to this growth inhibition. Restoration of RGS2 levels by ectopic expression in androgen-independent prostate cancer cells suppressed growth of xenografts in castrated mice. Thus, RGS2 promoter hypermethylation represses its expression and unmasks a latent pathway for AR transactivation in prostate cancer cells. Targeting this reversible process may provide a new strategy for suppressing prostate cancer progression by reestablishing its androgen sensitivity. Copyright © 2011 UICC.
Li, Y; Chen, J; Zhao, M; Yang, Z; Yue, L; Zhang, X
2017-02-01
To demonstrate the resuscitation-promoting activities of recombinant YeaZ from Vibrio harveyi SF-1. The gene of resuscitation-promoting factor YeaZ was cloned from genomic DNA of V. harveyi SF-1. The gene was expressed in Escherichia coli, and the expressed protein was purified by Ni 2+ -affinity chromatography. A yeaZ mutant was constructed by using the suicide plasmid pNQ705 with homologous recombination. Disruption of yeaZ did not affect cell growth significantly in 2216 E broth at 28°C. The wild-type and mutant viable but nonculturable (VBNC) cells could be resuscitated by temperature upshift method. In addition, the recombinant YeaZ increased the culturable counts from 1·27 × 10 4 CFU per ml and 1·99 × 10 4 CFU per ml to 2·88 × 10 5 CFU per ml and 4·59 × 10 5 CFU per ml, respectively. After the VBNC cells of wild-type and mutant cells were maintained at 4°C for 120 days, no resuscitation was obtained by temperature upshift method, but addition of the recombinant YeaZ promoted the resuscitation of the wild-type and mutant cells, with the culturable cell counts of 1·13 × 10 3 and 1·44 × 10 3 CFU per ml, respectively. Disruption of yeaZ decreased the virulence of V. harveyi in zebrafish. The lethal dose 50% of the yeaZ null mutant was more than 10-fold higher than that of the wild-type cells. The recombinant YeaZ could efficiently promote resuscitation of the wild-type and mutant cells of V. harveyi from VBNC to culturable state. The protein also promoted resuscitation of the VBNC wild-type and mutant cells, which were maintained at 4°C for 120 days and not recovered by temperature upshift method. Disruption of yeaZ decreased the virulence of V. harveyi in zebrafish. Here, we show clear evidence of a resuscitation-promoting factor YeaZ of V. harveyi and the roles in resuscitation of the VBNC cells and its pathogenicity. © 2016 The Society for Applied Microbiology.
Directory of Open Access Journals (Sweden)
Isaacs Richard J
2007-05-01
Full Text Available Abstract Background Topoisomerase IIα has been shown to be down-regulated in doxorubicin-resistant cell lines. The specificity proteins Sp1 and Sp3 have been implicated in regulation of topoisomerase IIα transcription, although the mechanism by which they regulate expression is not fully understood. Sp1 has been shown to bind specifically to both proximal and distal GC elements of the human topoisomerase IIα promoter in vitro, while Sp3 binds only to the distal GC element unless additional flanking sequences are included. While Sp1 is thought to be an activator of human topoisomerase IIα, the functional significance of Sp3 binding is not known. Therefore, we sought to determine the functional relationship between Sp1 and Sp3 binding to the topoisomerase IIα promoter in vivo. We investigated endogenous levels of Sp1, Sp3 and topoisomerase IIα as well as binding of both Sp1 and Sp3 to the GC boxes of the topoisomerase IIα promoter in breast cancer cell lines in vivo after short term doxorubicin exposure. Results Functional effects of Sp1 and Sp3 were studied using transient cotransfection assays using a topoisomerase IIα promoter reporter construct. The in vivo interactions of Sp1 and Sp3 with the GC elements of the topoisomerase IIα promoter were studied in doxorubicin-treated breast cancer cell lines using chromatin immunoprecipitation assays. Relative amounts of endogenous proteins were measured using immunoblotting. In vivo DNA looping mediated by proteins bound at the GC1 and GC2 elements was studied using the chromatin conformation capture assay. Both Sp1 and Sp3 bound to the GC1 and GC2 regions. Sp1 and Sp3 were transcriptional activators and repressors respectively, with Sp3 repression being dominant over Sp1-mediated activation. The GC1 and GC2 elements are linked in vivo to form a loop, thus bringing distal regulatory elements and their cognate transcription factors into close proximity with the transcription start site
Doyle, Joyce; Atkinson-Briggs, Sharon; Atkinson, Petah; Firebrace, Bradley; Calleja, Julie; Reilly, Rachel; Cargo, Margaret; Riley, Therese; Crumpen, Tui; Rowley, Kevin
2016-11-10
Aboriginal Community Controlled Organisations (ACCOs) provide community-focussed and culturally safe services for First Peoples in Australia, including crisis intervention and health promotion activities, in a holistic manner. The ecological model of health promotion goes some way towards describing the complexity of such health programs. The aims of this project were to: 1) identify the aims and purpose of existing health promotion programs conducted by an alliance of ACCOs in northern Victoria, Australia; and 2) evaluate the extent to which these programs are consistent with an ecological model of health promotion, addressing both individual and environmental determinants of health. The project arose from a long history of collaborative research. Three ACCOs and a university formed the Health Promotion Alliance to evaluate their health promotion programs. Local community members were trained in, and contributed to developing culturally sensitive methods for, data collection. Information on the aims and design of 88 health promotion activities making up 12 different programs across the ACCOs was systematically and prospectively collected. There was a wide range of activities addressing environmental and social determinants of health, as well as physical activity, nutrition and weight loss. The design of the great majority of activities had a minimal Western influence and were designed within a local Aboriginal cultural framework. The most common focus of the activities was social connectedness (76 %). Physical activity was represented in two thirds of the activities, and nutrition, weight loss and culture were each a focus of about half of the activities. A modified coding procedure designed to assess the ecological nature of these programs showed that they recruited from multiple settings; targeted a range of individual, social and environmental determinants; and used numerous and innovative strategies to achieve change. First Peoples' health promotion in the
Directory of Open Access Journals (Sweden)
Joyce Doyle
2016-11-01
achieve change. Conclusion First Peoples’ health promotion in the Goulburn-Murray Rivers region encompasses a broad range of social, cultural, lifestyle and community development activities, including reclaiming and strengthening cultural identity and social connectedness as a response to colonisation.
Kizaki, Seiichiro; Zou, Tingting; Li, Yue; Han, Yong-Woon; Suzuki, Yuki; Harada, Yoshie; Sugiyama, Hiroshi
2016-11-07
Tet (ten-eleven translocation) family proteins oxidize 5-methylcytosine (mC) to 5-hydroxymethylcytosine (hmC), 5-formylcytosine (fC), and 5-carboxycytosine (caC), and are suggested to be involved in the active DNA demethylation pathway. In this study, we reconstituted positioned mononucleosomes using CpG-methylated 382 bp DNA containing the Widom 601 sequence and recombinant histone octamer, and subjected the nucleosome to treatment with Tet1 protein. The sites of oxidized methylcytosine were identified by bisulfite sequencing. We found that, for the oxidation reaction, Tet1 protein prefers mCs located in the linker region of the nucleosome compared with those located in the core region. © 2016 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.
International Nuclear Information System (INIS)
Kanelis, Voula; Donaldson, Logan; Muhandiram, D.R.; Rotin, Daniela; Forman-Kay, Julie D.; Kay, Lewis E.
2000-01-01
Many protein-protein interactions involve amino acid sequences containing proline-rich motifs and even poly-proline stretches. The lack of amide protons in such regions complicates assignment, since 1 HN-based triple-resonance assignment strategies cannot be employed. Two such systems that we are currently studying include an SH2 domain from the protein Crk with a region containing 9 prolines in a 14 amino acid sequence, as well as a WW domain that interacts with a proline-rich target. A modified version of the HACAN pulse scheme, originally described by Bax and co-workers [Wang et al. (1995) J. Biomol. NMR, 5, 376-382], and an experiment which correlates the intra-residue 1 H α , 13 C α / 13 C β chemical shifts with the 15 N shift of the subsequent residue are presented and applied to the two systems listed above, allowing sequential assignment of the molecules
International Nuclear Information System (INIS)
Rauscher, Garth H.; Kresovich, Jacob K.; Poulin, Matthew; Yan, Liying; Macias, Virgilia; Mahmoud, Abeer M.; Al-Alem, Umaima; Kajdacsy-Balla, Andre; Wiley, Elizabeth L.; Tonetti, Debra; Ehrlich, Melanie
2015-01-01
Breast cancer formation is associated with frequent changes in DNA methylation but the extent of very early alterations in DNA methylation and the biological significance of cancer-associated epigenetic changes need further elucidation. Pyrosequencing was done on bisulfite-treated DNA from formalin-fixed, paraffin-embedded sections containing invasive tumor and paired samples of histologically normal tissue adjacent to the cancers as well as control reduction mammoplasty samples from unaffected women. The DNA regions studied were promoters (BRCA1, CD44, ESR1, GSTM2, GSTP1, MAGEA1, MSI1, NFE2L3, RASSF1A, RUNX3, SIX3 and TFF1), far-upstream regions (EN1, PAX3, PITX2, and SGK1), introns (APC, EGFR, LHX2, RFX1 and SOX9) and the LINE-1 and satellite 2 DNA repeats. These choices were based upon previous literature or publicly available DNA methylome profiles. The percent methylation was averaged across neighboring CpG sites. Most of the assayed gene regions displayed hypermethylation in cancer vs. adjacent tissue but the TFF1 and MAGEA1 regions were significantly hypomethylated (p ≤0.001). Importantly, six of the 16 regions examined in a large collection of patients (105 – 129) and in 15-18 reduction mammoplasty samples were already aberrantly methylated in adjacent, histologically normal tissue vs. non-cancerous mammoplasty samples (p ≤0.01). In addition, examination of transcriptome and DNA methylation databases indicated that methylation at three non-promoter regions (far-upstream EN1 and PITX2 and intronic LHX2) was associated with higher gene expression, unlike the inverse associations between cancer DNA hypermethylation and cancer-altered gene expression usually reported. These three non-promoter regions also exhibited normal tissue-specific hypermethylation positively associated with differentiation-related gene expression (in muscle progenitor cells vs. many other types of normal cells). The importance of considering the exact DNA region analyzed and the
International Nuclear Information System (INIS)
Zhang, H.; Chen, K.Y.; Liu, A.Y.C.
1987-01-01
The regulation of specific protein synthesis by the phorbol ester tumor promoter, 12-O-tetradecanoyl-phorbol-13-acetate (TPA), was evaluated using the L-8 and C-2 myoblast and the 3T3-L1 fibroblast cell cultures. TPA increased, by 2-4 fold, the synthesis rates of two cytoplasmic proteins with apparent molecular weights of 89,000 and 74,000 as determined by SDS-polyacrylamide gel electrophoresis and autoradiography. The concentration of TPA and the time of incubation needed to elicit this induction was determined to be 10 μg/ml and 20 hrs, respectively. Increasing the concentration of TPA to 100, 200, and 500 ng/ml did not result in a greater magnitude of induction. The possibility that these two TPA-induced proteins may be identical to proteins with similar molecular weights induced under heat-shocked or glucose-starved conditions was evaluated by 1-D and 2-D gel electrophoresis and autoradiography. Results provided evidence that the TPA-induced 89,000- and 74,000-dalton proteins were identical to hsp 89 and hsp 74, 2 out of a set of 8-9 proteins induced under heat shocked conditions. Furthermore, they are identical to two of the set of glucose-regulated proteins induced under a glucose-starved condition
Genome-scale prediction of proteins with long intrinsically disordered regions.
Peng, Zhenling; Mizianty, Marcin J; Kurgan, Lukasz
2014-01-01
Proteins with long disordered regions (LDRs), defined as having 30 or more consecutive disordered residues, are abundant in eukaryotes, and these regions are recognized as a distinct class of biologically functional domains. LDRs facilitate various cellular functions and are important for target selection in structural genomics. Motivated by the lack of methods that directly predict proteins with LDRs, we designed Super-fast predictor of proteins with Long Intrinsically DisordERed regions (SLIDER). SLIDER utilizes logistic regression that takes an empirically chosen set of numerical features, which consider selected physicochemical properties of amino acids, sequence complexity, and amino acid composition, as its inputs. Empirical tests show that SLIDER offers competitive predictive performance combined with low computational cost. It outperforms, by at least a modest margin, a comprehensive set of modern disorder predictors (that can indirectly predict LDRs) and is 16 times faster compared to the best currently available disorder predictor. Utilizing our time-efficient predictor, we characterized abundance and functional roles of proteins with LDRs over 110 eukaryotic proteomes. Similar to related studies, we found that eukaryotes have many (on average 30.3%) proteins with LDRs with majority of proteomes having between 25 and 40%, where higher abundance is characteristic to proteomes that have larger proteins. Our first-of-its-kind large-scale functional analysis shows that these proteins are enriched in a number of cellular functions and processes including certain binding events, regulation of catalytic activities, cellular component organization, biogenesis, biological regulation, and some metabolic and developmental processes. A webserver that implements SLIDER is available at http://biomine.ece.ualberta.ca/SLIDER/. Copyright © 2013 Wiley Periodicals, Inc.
Lateral Organization of Influenza Virus Proteins in the Budozone Region of the Plasma Membrane.
Leser, George P; Lamb, Robert A
2017-05-01
between viral proteins in the plasma membrane. Some proteins, such as HA and M2, inherently cocluster within the membrane, although M2 is found mostly at the periphery of regions of HA, consistent with the proposed role of M2 in scission at the end of budding. The association between some pairs of influenza virus proteins, such as M2 and NP, appears to be brokered by additional influenza virus proteins, in this case M1. HA and NA, while raft associated, reside in distinct domains, reflecting their distributions in the viral membrane. Copyright © 2017 American Society for Microbiology.
Sato, Mitsuhiko P; Makino, Takashi; Kawata, Masakado
2016-02-09
Understanding the evolutionary forces that influence variation in gene regulatory regions in natural populations is an important challenge for evolutionary biology because natural selection for such variations could promote adaptive phenotypic evolution. Recently, whole-genome sequence analyses have identified regulatory regions subject to natural selection. However, these studies could not identify the relationship between sequence variation in the detected regions and change in gene expression levels. We analyzed sequence variations in core promoter regions, which are critical regions for gene regulation in higher eukaryotes, in a natural population of Drosophila melanogaster, and identified core promoter sequence variations associated with differences in gene expression levels subjected to natural selection. Among the core promoter regions whose sequence variation could change transcription factor binding sites and explain differences in expression levels, three core promoter regions were detected as candidates associated with purifying selection or selective sweep and seven as candidates associated with balancing selection, excluding the possibility of linkage between these regions and core promoter regions. CHKov1, which confers resistance to the sigma virus and related insecticides, was identified as core promoter regions that has been subject to selective sweep, although it could not be denied that selection for variation in core promoter regions was due to linked single nucleotide polymorphisms in the regulatory region outside core promoter regions. Nucleotide changes in core promoter regions of CHKov1 caused the loss of two basal transcription factor binding sites and acquisition of one transcription factor binding site, resulting in decreased gene expression levels. Of nine core promoter regions regions associated with balancing selection, brat, and CG9044 are associated with neuromuscular junction development, and Nmda1 are associated with learning
Ansari, Suraiya A; Paul, Emily; Sommer, Sebastian; Lieleg, Corinna; He, Qiye; Daly, Alexandre Z; Rode, Kara A; Barber, Wesley T; Ellis, Laura C; LaPorta, Erika; Orzechowski, Amanda M; Taylor, Emily; Reeb, Tanner; Wong, Jason; Korber, Philipp; Morse, Randall H
2014-05-23
Transcription by RNA polymerase II (Pol II) in eukaryotes requires the Mediator complex, and often involves chromatin remodeling and histone eviction at active promoters. Here we address the role of Mediator in recruitment of the Swi/Snf chromatin remodeling complex and its role, along with components of the preinitiation complex (PIC), in histone eviction at inducible and constitutively active promoters in the budding yeast Saccharomyces cerevisiae. We show that recruitment of the Swi/Snf chromatin remodeling complex to the induced CHA1 promoter, as well as its association with several constitutively active promoters, depends on the Mediator complex but is independent of Mediator at the induced MET2 and MET6 genes. Although transcriptional activation and histone eviction at CHA1 depends on Swi/Snf, Swi/Snf recruitment is not sufficient for histone eviction at the induced CHA1 promoter. Loss of Swi/Snf activity does not affect histone occupancy of several constitutively active promoters; in contrast, higher histone occupancy is seen at these promoters in Mediator and PIC component mutants. We propose that an initial activator-dependent, nucleosome remodeling step allows PIC components to outcompete histones for occupancy of promoter sequences. We also observe reduced promoter association of Mediator and TATA-binding protein in a Pol II (rpb1-1) mutant, indicating mutually cooperative binding of these components of the transcription machinery and indicating that it is the PIC as a whole whose binding results in stable histone eviction. © 2014 by The American Society for Biochemistry and Molecular Biology, Inc.
Directory of Open Access Journals (Sweden)
Aebi Stefan
2008-10-01
Full Text Available Abstract Background The activity of dihydropyrimidine dehydrogenase (DPD, the key enzyme of pyrimidine catabolism, is thought to be an important determinant for the occurrence of severe toxic reactions to 5-fluorouracil (5-FU, which is one of the most commonly prescribed chemotherapeutic agents for the treatment of solid cancers. Genetic variation in the DPD gene (DPYD has been proposed as a main factor for variation in DPD activity in the population. However, only a small proportion of severe toxicities in 5-FU based chemotherapy can be explained with such rare deleterious DPYD mutations resulting in severe enzyme deficiencies. Recently, hypermethylation of the DPYD promoter region has been proposed as an alternative mechanism for DPD deficiency and thus as a major cause of severe 5-FU toxicity. Methods Here, the prognostic significance of this epigenetic marker with respect to severe 5-FU toxicity was assessed in 27 cancer patients receiving 5-FU based chemotherapy, including 17 patients experiencing severe toxic side effects following drug administration, none of which were carriers of a known deleterious DPYD mutation, and ten control patients. The methylation status of the DPYD promoter region in peripheral blood mononuclear cells was evaluated by analysing for each patient between 19 and 30 different clones of a PCR-amplified 209 base pair fragment of the bisulfite-modified DPYD promoter region. The fragments were sequenced to detect bisulfite-induced, methylation-dependent sequence differences. Results No evidence of DPYD promoter methylation was observed in any of the investigated patient samples, whereas in a control experiment, as little as 10% methylated genomic DNA could be detected. Conclusion Our results indicate that DYPD promoter hypermethylation is not of major importance as a prognostic factor for severe toxicity in 5-FU based chemotherapy.
Definition of IgG- and albumin-binding regions of streptococcal protein G.
Akerström, B; Nielsen, E; Björck, L
1987-10-05
Protein G, the immunoglobin G-binding surface protein of group C and G streptococci, also binds serum albumin. The albumin-binding site on protein G is distinct from the immunoglobulin G-binding site. By mild acid hydrolysis of the papain-liberated protein G fragment (35 kDa), a 28-kDa fragment was produced which retained full immunoglobulin G-binding activity (determined by Scatchard plotting) but had lost all albumin-binding capacity. A protein G (65 kDa), isolated after cloning and expression of the protein G gene in Escherichia coli, had comparable affinity to immunoglobulin G (5-10 X 10(10)M-1), but much higher affinity to albumin than the 35- and 28-kDa protein G fragments (31, 2.6, and 0 X 10(9)M-1, respectively). The amino-terminal amino acid sequences of the 65-, 35-, and 28-kDa fragments allowed us to exactly locate the three fragments in an overall sequence map of protein G, based on the partial gene sequences published by Guss et al. (Guss, B., Eliasson, M., Olsson, A., Uhlen, M., Frej, A.-K., Jörnvall, H., Flock, J.-I., and Lindberg, M. (1986) EMBO J. 5, 1567-1575) and Fahnestock et al. (Fahnestock, S. R., Alexander, P., Nagle, J., and Filpula, D. (1986) J. Bacteriol. 167, 870-880). In this map could then be deduced the location of three homologous albumin-binding regions and three homologous immunoglobulin G-binding regions.
Ceglia, Lisa; Harris, Susan S.; Abrams, Steven A.; Rasmussen, Helen M.; Dallal, Gerard E.; Dawson-Hughes, Bess
2009-01-01
Context: Protein is an essential component of muscle and bone. However, the acidic byproducts of protein metabolism may have a negative impact on the musculoskeletal system, particularly in older individuals with declining renal function. Objective: We sought to determine whether adding an alkaline salt, potassium bicarbonate (KHCO3), allows protein to have a more favorable net impact on intermediary indices of muscle and bone conservation than it does in the usual acidic environment. Design: We conducted a 41-d randomized, placebo-controlled, double-blind study of KHCO3 or placebo with a 16-d phase-in and two successive 10-d metabolic diets containing low (0.5 g/kg) or high (1.5 g/kg) protein in random order with a 5-d washout between diets. Setting: The study was conducted in a metabolic research unit. Participants: Nineteen healthy subjects ages 54–82 yr participated. Intervention: KHCO3 (up to 90 mmol/d) or placebo was administered for 41 d. Main Outcome Measures: We measured 24-h urinary nitrogen excretion, IGF-I, 24-h urinary calcium excretion, and fractional calcium absorption. Results: KHCO3 reduced the rise in urinary nitrogen excretion that accompanied an increase in protein intake (P = 0.015) and was associated with higher IGF-I levels on the low-protein diet (P = 0.027) with a similar trend on the high-protein diet (P = 0.050). KHCO3 was also associated with higher fractional calcium absorption on the low-protein diet (P = 0.041) with a similar trend on the high-protein diet (P = 0.064). Conclusions: In older adults, KHCO3 attenuates the protein-induced rise in urinary nitrogen excretion, and this may be mediated by IGF-I. KHCO3 may also promote calcium absorption independent of the dietary protein content. PMID:19050051
Sangar, Vineet; Funk, Cory C; Kusebauch, Ulrike; Campbell, David S; Moritz, Robert L; Price, Nathan D
2014-10-01
Glioblastoma multiforme is a highly invasive and aggressive brain tumor with an invariably poor prognosis. The overexpression of epidermal growth factor receptor (EGFR) is a primary influencer of invasion and proliferation in tumor cells and the constitutively active EGFRvIII mutant, found in 30-65% of Glioblastoma multiforme, confers more aggressive invasion. To better understand how EGFR contributes to tumor aggressiveness, we investigated the effect of EGFR on the secreted levels of 65 rationally selected proteins involved in invasion. We employed selected reaction monitoring targeted mass spectrometry using stable isotope labeled internal peptide standards to quantity proteins in the secretome from five GBM (U87) isogenic cell lines in which EGFR, EGFRvIII, and/or PTEN were expressed. Our results show that cell lines with EGFR overexpression and constitutive EGFRvIII expression differ remarkably in the expression profiles for both secreted and intracellular signaling proteins, and alterations in EGFR signaling result in reproducible changes in concentrations of secreted proteins. Furthermore, the EGFRvIII-expressing mutant cell line secretes the majority of the selected invasion-promoting proteins at higher levels than other cell lines tested. Additionally, the intracellular and extracellular protein measurements indicate elevated oxidative stress in the EGFRvIII-expressing cell line. In conclusion, the results of our study demonstrate that EGFR signaling has a significant effect on the levels of secreted invasion-promoting proteins, likely contributing to the aggressiveness of Glioblastoma multiforme. Further characterization of these proteins may provide candidates for new therapeutic strategies and targets as well as biomarkers for this aggressive disease. © 2014 by The American Society for Biochemistry and Molecular Biology, Inc.
The PLAC1-homology region of the ZP domain is sufficient for protein polymerisation
Directory of Open Access Journals (Sweden)
Litscher Eveline S
2006-04-01
Full Text Available Abstract Background Hundreds of extracellular proteins polymerise into filaments and matrices by using zona pellucida (ZP domains. ZP domain proteins perform highly diverse functions, ranging from structural to receptorial, and mutations in their genes are responsible for a number of severe human diseases. Recently, PLAC1, Oosp1-3, Papillote and CG16798 proteins were identified that share sequence homology with the N-terminal half of the ZP domain (ZP-N, but not with its C-terminal half (ZP-C. The functional significance of this partial conservation is unknown. Results By exploiting a highly engineered bacterial strain, we expressed in soluble form the PLAC1-homology region of mammalian sperm receptor ZP3 as a fusion to maltose binding protein. Mass spectrometry showed that the 4 conserved Cys residues within the ZP-N moiety of the fusion protein adopt the same disulfide bond connectivity as in full-length native ZP3, indicating that it is correctly folded, and electron microscopy and biochemical analyses revealed that it assembles into filaments. Conclusion These findings provide a function for PLAC1-like proteins and, by showing that ZP-N is a biologically active folding unit, prompt a re-evaluation of the architecture of the ZP domain and its polymers. Furthermore, they suggest that ZP-C might play a regulatory role in the assembly of ZP domain protein complexes.
Wang, Nai-Yu; Patras, Kathryn A; Seo, Ho Seong; Cavaco, Courtney K; Rösler, Berenice; Neely, Melody N; Sullam, Paul M; Doran, Kelly S
2014-09-15
Group B streptococcus (GBS) can cause severe disease in susceptible hosts, including newborns, pregnant women, and the elderly. GBS serine-rich repeat (Srr) surface glycoproteins are important adhesins/invasins in multiple host tissues, including the vagina. However, exact molecular mechanisms contributing to their importance in colonization are unknown. We have recently determined that Srr proteins contain a fibrinogen-binding region (BR) and hypothesize that Srr-mediated fibrinogen binding may contribute to GBS cervicovaginal colonization. In this study, we observed that fibrinogen enhanced wild-type GBS attachment to cervical and vaginal epithelium, and that this was dependent on Srr1. Moreover, purified Srr1-BR peptide bound directly to host cells, and peptide administration in vivo reduced GBS recovery from the vaginal tract. Furthermore, a GBS mutant strain lacking only the Srr1 "latching" domain exhibited decreased adherence in vitro and decreased persistence in a mouse model of GBS vaginal colonization, suggesting the importance of Srr-fibrinogen interactions in the female reproductive tract. © The Author 2014. Published by Oxford University Press on behalf of the Infectious Diseases Society of America. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com.
Matsutani Sachiko
2004-01-01
Abstract Background In eukaryotes, RNA polymerase III (RNAP III) transcribes the genes for small RNAs like tRNAs, 5S rRNA, and several viral RNAs, and short interspersed repetitive elements (SINEs). The genes for these RNAs and SINEs have internal promoters that consist of two regions. These two regions are called the A and B blocks. The multisubunit transcription factor TFIIIC is required for transcription initiation of RNAP III; in transcription of tRNAs, the B-block binding subunit of TFII...
Promoting effect of ethanol on dewetting transition in the confined region of melittin tetramer
International Nuclear Information System (INIS)
Ren Xiuping; Zhou Bo; Wang Chunlei
2012-01-01
To study the influence of ethanol molecules on the melittin tetramer folding, we investigated the dewetting transition of the melittin tetramer immersed in pure water and 8% aqueous ethanol solution (mass fraction) by the molecular dynamics simulations. We found that the marked dewetting transitions occurred inside a nanoscale channel of the melittin tetramer both in pure water and in aqueous ethanol solution. Also, ethanol molecules promoted this dewetting transition. We attributed this promoting effect to ethanol molecules which prefer to locate at the liquid-vapor interface and decrease the liquid-vapor surface energy. The results provide insight into the effect of ethanol on the water dewetting phenomena. (authors)
Barnidge, Ellen K; Baker, Elizabeth A; Estlund, Amy; Motton, Freda; Hipp, Pamela R; Brownson, Ross C
2015-06-11
Rural residents are less likely than urban and suburban residents to meet recommendations for nutrition and physical activity. Interventions at the environmental and policy level create environments that support healthy eating and physical activity. Healthier Missouri Communities (Healthier MO) is a community-based research project conducted by the Prevention Research Center in St. Louis with community partners from 12 counties in rural southeast Missouri. We created a regional partnership to leverage resources and enhance environmental and policy interventions to improve nutrition and physical activity in rural southeast Missouri. Partners were engaged in a participatory action planning process that included prioritizing, implementing, and evaluating promising evidence-based interventions to promote nutrition and physical activity. Group interviews were conducted with Healthier MO community partners post intervention to evaluate resource sharing and sustainability efforts of the regional partnership. Community partners identified the benefits and challenges of resource sharing within the regional partnership as well as the opportunities and threats to long-term partnership sustainability. The partners noted that the regional participatory process was difficult, but the benefits outweighed the challenges. Regional rural partnerships may be an effective way to leverage relationships to increase the capacity of rural communities to implement environmental and policy interventions to promote nutrition and physical activity.
Directory of Open Access Journals (Sweden)
Clément Chevalier
2010-03-01
Full Text Available Staphylococcus aureus RNAIII is the intracellular effector of the quorum sensing system that temporally controls a large number of virulence factors including exoproteins and cell-wall-associated proteins. Staphylocoagulase is one major virulence factor, which promotes clotting of human plasma. Like the major cell surface protein A, the expression of staphylocoagulase is strongly repressed by the quorum sensing system at the post-exponential growth phase. Here we used a combination of approaches in vivo and in vitro to analyze the mechanism used by RNAIII to regulate the expression of staphylocoagulase. Our data show that RNAIII represses the synthesis of the protein through a direct binding with the mRNA. Structure mapping shows that two distant regions of RNAIII interact with coa mRNA and that the mRNA harbors a conserved signature as found in other RNAIII-target mRNAs. The resulting complex is composed of an imperfect duplex masking the Shine-Dalgarno sequence of coa mRNA and of a loop-loop interaction occurring downstream in the coding region. The imperfect duplex is sufficient to prevent the formation of the ribosomal initiation complex and to repress the expression of a reporter gene in vivo. In addition, the double-strand-specific endoribonuclease III cleaves the two regions of the mRNA bound to RNAIII that may contribute to the degradation of the repressed mRNA. This study validates another direct target of RNAIII that plays a role in virulence. It also illustrates the diversity of RNAIII-mRNA topologies and how these multiple RNAIII-mRNA interactions would mediate virulence regulation.
Directory of Open Access Journals (Sweden)
Chéreau Denis
2016-07-01
Full Text Available The continuous world population growth induces a total protein demand increase based mainly on plant sources. To meet these global nutritional challenges, existing and innovative dry and wet fractionation processes will have to be combined to better valorise plant protein fraction from pulses and oilseeds. The worldwide success of soy protein isolates originate from the intrinsic qualities of soybean proteins but also from a continuous R&D effort since mid-twenty century. Therefore, the soy protein development model can be applied to protein isolates from diverse pulses and oilseeds meals as rapeseed which has already been recognised as novel food protein in Europe. To boost the delivery of plant proteins, agrofood-industries and academics must pool their respective expertise. Innovative and issue solving R&D projects have to be launched to better valorise pulses and oilseed proteins by (i creating oil extraction processes which preserve native proteins structure; (ii developing novel protein extraction processes from lab up to industrial pilot scale; (iii producing plant protein isolates having comparable foaming, emulsifying or gelling functionality than animal; and (iv generating hydrolysed proteins with high digestibility adapted to human nutrition. It is also essential to initiate research programs to innovate in wet and dry fractionations of plants or to design in vitro models to evaluate proteins digestibility and allergenicity. The increased awareness regarding plant protein valorisation resulted in the creation by agro-industries and academics of the open platform IMPROVE which propose a combination of competencies and equipment to boost market uptake of Plant Based Proteins.
Chéreau Denis; Videcoq Pauline; Ruffieux Cécile; Pichon Lisa; Motte Jean-Charles; Belaid Saliha; Ventureira Jorge; Lopez Michel
2016-01-01
The continuous world population growth induces a total protein demand increase based mainly on plant sources. To meet these global nutritional challenges, existing and innovative dry and wet fractionation processes will have to be combined to better valorise plant protein fraction from pulses and oilseeds. The worldwide success of soy protein isolates originate from the intrinsic qualities of soybean proteins but also from a con...
Directory of Open Access Journals (Sweden)
Schwarzenbach Heidi
2010-06-01
Full Text Available Abstract Background The aim of the current study was to analyze the involvement of methyl-CpG binding proteins (MBDs and histone modifications on the regulation of CD44, Cyclin D2, GLIPR1 and PTEN in different cellular contexts such as the prostate cancer cells DU145 and LNCaP, and the breast cancer cells MCF-7. Since global chromatin changes have been shown to occur in tumours and regions of tumour-associated genes are affected by epigenetic modifications, these may constitute important regulatory mechanisms for the pathogenesis of malignant transformation. Methods In DU145, LNCaP and MCF-7 cells mRNA expression levels of CD44, Cyclin D2, GLIPR1 and PTEN were determined by quantitative RT-PCR at the basal status as well as after treatment with demethylating agent 5-aza-2'-deoxycytidine and/or histone deacetylase inhibitor Trichostatin A. Furthermore, genomic DNA was bisulfite-converted and sequenced. Chromatin immunoprecipitation was performed with the stimulated and unstimulated cells using antibodies for MBD1, MBD2 and MeCP2 as well as 17 different histone antibodies. Results Comparison of the different promoters showed that MeCP2 and MBD2a repressed promoter-specifically Cyclin D2 in all cell lines, whereas in MCF-7 cells MeCP2 repressed cell-specifically all methylated promoters. Chromatin immunoprecipitation showed that all methylated promoters associated with at least one MBD. Treatment of the cells by the demethylating agent 5-aza-2'-deoxycytidine (5-aza-CdR caused dissociation of the MBDs from the promoters. Only MBD1v1 bound and repressed methylation-independently all promoters. Real-time amplification of DNA immunoprecipitated by 17 different antibodies showed a preferential enrichment for methylated lysine of histone H3 (H3K4me1, H3K4me2 and H3K4me3 at the particular promoters. Notably, the silent promoters were associated with unmodified histones which were acetylated following treatment by 5-aza-CdR. Conclusions This study is one
International Nuclear Information System (INIS)
Müller, Imke; Wischnewski, Frank; Pantel, Klaus; Schwarzenbach, Heidi
2010-01-01
The aim of the current study was to analyze the involvement of methyl-CpG binding proteins (MBDs) and histone modifications on the regulation of CD44, Cyclin D2, GLIPR1 and PTEN in different cellular contexts such as the prostate cancer cells DU145 and LNCaP, and the breast cancer cells MCF-7. Since global chromatin changes have been shown to occur in tumours and regions of tumour-associated genes are affected by epigenetic modifications, these may constitute important regulatory mechanisms for the pathogenesis of malignant transformation. In DU145, LNCaP and MCF-7 cells mRNA expression levels of CD44, Cyclin D2, GLIPR1 and PTEN were determined by quantitative RT-PCR at the basal status as well as after treatment with demethylating agent 5-aza-2'-deoxycytidine and/or histone deacetylase inhibitor Trichostatin A. Furthermore, genomic DNA was bisulfite-converted and sequenced. Chromatin immunoprecipitation was performed with the stimulated and unstimulated cells using antibodies for MBD1, MBD2 and MeCP2 as well as 17 different histone antibodies. Comparison of the different promoters showed that MeCP2 and MBD2a repressed promoter-specifically Cyclin D2 in all cell lines, whereas in MCF-7 cells MeCP2 repressed cell-specifically all methylated promoters. Chromatin immunoprecipitation showed that all methylated promoters associated with at least one MBD. Treatment of the cells by the demethylating agent 5-aza-2'-deoxycytidine (5-aza-CdR) caused dissociation of the MBDs from the promoters. Only MBD1v1 bound and repressed methylation-independently all promoters. Real-time amplification of DNA immunoprecipitated by 17 different antibodies showed a preferential enrichment for methylated lysine of histone H3 (H3K4me1, H3K4me2 and H3K4me3) at the particular promoters. Notably, the silent promoters were associated with unmodified histones which were acetylated following treatment by 5-aza-CdR. This study is one of the first to reveal the histone code and MBD profile
Tieland, Michael; Beelen, Janne; Laan, Anna C M; Poon, Shirley; de Groot, Lisette C P G M; Seeman, Ego; Wang, Xiaofang; Iuliano, Sandra
2018-01-01
Although it has been established that sufficient protein is required to maintain good nutritional status and support healthy aging, it is not clear if the pattern of protein consumption may also influence nutritional status, especially in institutionalized elderly who are at risk of malnutrition. Therefore, we aim to determine the association between protein intake distribution and nutritional status in institutionalized elderly people. Cross-sectional study among 481 institutionalized older adults. Dietary data from 481 ambulant elderly people (68.8% female, mean age 87.5 ± 6.3 years) residing in 52 aged-care facilities in Victoria, Australia, were assessed over 2 days using plate waste analysis. Nutritional status was determined using the Mini-Nutritional Assessment tool and serum (n = 208) analyzed for albumin, hemoglobin, and IGF-1. Protein intake distribution was classified as: spread (even distribution across 3 meals, n = 65), pulse (most protein consumed in one meal, n = 72) or intermediate (n = 344). Regression analysis was used to investigate associations. Mean protein intakes were higher in the spread (60.5 ± 2.0 g/d) than intermediate group (56.0 ± 0.8 g/d, P = .037), and tended to be higher than those in the pulse group (55.9 ± 1.9 g/d, P = .097). Residents with an even distribution of protein intake achieved a higher level of the recommended daily intake for protein (96.2 ± 30.0%) than the intermediate (86.3 ± 26.2%, P = .008) and pulse (87.4 ± 30.5%, P = .06) groups, and also achieved a greater level of their estimated energy requirements (intermediate; P = .039, pulse; P = .001). Nutritional status (Mini-Nutritional Assessment score) did not differ between groups (pulse; 20.5 ± 4.5, intermediate; 21.0 ± 2.5, spread; 20.5 ± 3.5), nor did any other indices of nutritional status. Meeting protein requirements is required before protein distribution may influence nutritional status in institutionalized
Fine-tuning of protein domain boundary by minimizing potential coiled coil regions
International Nuclear Information System (INIS)
Iwaya, Naoko; Goda, Natsuko; Unzai, Satoru; Fujiwara, Kenichiro; Tanaka, Toshiki; Tomii, Kentaro; Tochio, Hidehito; Shirakawa, Masahiro; Hiroaki, Hidekazu
2007-01-01
Structural determination of individual protein domains isolated from multidomain proteins is a common approach in the post-genomic era. Novel and thus uncharacterized domains liberated from intact proteins often self-associate due to incorrectly defined domain boundaries. Self-association results in missing signals, poor signal dispersion and a low signal-to-noise ratio in 1 H- 15 N HSQC spectra. We have found that a putative, non-canonical coiled coil region close to a domain boundary can cause transient hydrophobic self-association and monomer-dimer equilibrium in solution. Here we propose a rational method to predict putative coiled coil regions adjacent to the globular core domain using the program COILS. Except for the amino acid sequence, no preexisting knowledge concerning the domain is required. A small number of mutant proteins with a minimized coiled coil region have been rationally designed and tested. The engineered domains exhibit decreased self-association as assessed by 1 H- 15 N HSQC spectra with improved peak dispersion and sharper cross peaks. Two successful examples of isolating novel N-terminal domains from AAA-ATPases are demonstrated. Our method is useful for the experimental determination of domain boundaries suited for structural genomics studies
Fine-tuning of protein domain boundary by minimizing potential coiled coil regions.
Iwaya, Naoko; Goda, Natsuko; Unzai, Satoru; Fujiwara, Kenichiro; Tanaka, Toshiki; Tomii, Kentaro; Tochio, Hidehito; Shirakawa, Masahiro; Hiroaki, Hidekazu
2007-01-01
Structural determination of individual protein domains isolated from multidomain proteins is a common approach in the post-genomic era. Novel and thus uncharacterized domains liberated from intact proteins often self-associate due to incorrectly defined domain boundaries. Self-association results in missing signals, poor signal dispersion and a low signal-to-noise ratio in (1)H-(15)N HSQC spectra. We have found that a putative, non-canonical coiled coil region close to a domain boundary can cause transient hydrophobic self-association and monomer-dimer equilibrium in solution. Here we propose a rational method to predict putative coiled coil regions adjacent to the globular core domain using the program COILS. Except for the amino acid sequence, no preexisting knowledge concerning the domain is required. A small number of mutant proteins with a minimized coiled coil region have been rationally designed and tested. The engineered domains exhibit decreased self-association as assessed by (1)H-(15)N HSQC spectra with improved peak dispersion and sharper cross peaks. Two successful examples of isolating novel N-terminal domains from AAA-ATPases are demonstrated. Our method is useful for the experimental determination of domain boundaries suited for structural genomics studies.
Liu, Mengjie; Duan, Liangwei; Wang, Meifang; Zeng, Hongmei; Liu, Xinqi; Qiu, Dewen
2016-01-01
The protein elicitor MoHrip2, which was extracted from Magnaporthe oryzae as an exocrine protein, triggers the tobacco immune system and enhances blast resistance in rice. However, the detailed mechanisms by which MoHrip2 acts as an elicitor remain unclear. Here, we investigated the structure of MoHrip2 to elucidate its functions based on molecular structure. The three-dimensional structure of MoHrip2 was obtained. Overall, the crystal structure formed a β-barrel structure and showed high similarity to the pathogenesis-related (PR) thaumatin superfamily protein thaumatin-like xylanase inhibitor (TL-XI). To investigate the functional regions responsible for MoHrip2 elicitor activities, the full length and eight truncated proteins were expressed in Escherichia coli and were evaluated for elicitor activity in tobacco. Biological function analysis showed that MoHrip2 triggered the defense system against Botrytis cinerea in tobacco. Moreover, only MoHrip2M14 and other fragments containing the 14 amino acids residues in the middle region of the protein showed the elicitor activity of inducing a hypersensitive response and resistance related pathways, which were similar to that of full-length MoHrip2. These results revealed that the central 14 amino acid residues were essential for anti-pathogenic activity.
Directory of Open Access Journals (Sweden)
Mengjie Liu
2016-07-01
Full Text Available The protein elicitor MoHrip2, which was extracted from Magnaporthe oryzae as an exocrine protein, triggers the tobacco immune system and enhances blast resistance in rice. However, the detailed mechanisms by which MoHrip2 acts as an elicitor remain unclear. Here, we investigated the structure of MoHrip2 to elucidate its functions based on molecular structure. The 3-dimensional structure of MoHrip2 was obtained. Overall, the crystal structure formed a β-barrel structure and showed high similarity to the pathogenesis-related (PR thaumatin superfamily protein thaumatin-like xylanase inhibitor (TL-XI. To investigate the functional regions responsible for MoHrip2 elicitor activities, the full length and 8 truncated proteins were expressed in Escherichia coli and were evaluated for elicitor activity in tobacco. Biological function analysis showed that MoHrip2 triggered the defense system against Botrytis cinerea in tobacco. Moreover, only MoHrip2M14 and other fragments containing the 14 amino acids residues in the middle region of the protein showed the elicitor activity of inducing a hypersensitive response and resistance related pathways, which were similar to that of full-length MoHrip2. These results revealed that the central 14 amino acid residues were essential for anti-pathogenic activity.
Uchida, Shotaro; Sato, Hiroki; Yoneda, Misako; Kai, Chieko
2016-09-01
Nipah virus belongs to the genus Henipavirus in the family Paramyxoviridae, and its RNA genome is larger than those of other paramyxoviruses because it has long untranslated regions (UTRs) in each gene. However, the functions of these UTRs are not fully understood. In this study, we investigated the functions of the 5' UTRs and found that the 5' UTR of the M gene upregulated the translation of a reporter gene. Using an RNA pull-down assay, we showed that eukaryotic elongation factor 1-beta (EEF1B2) interacts with nucleotides 81-100 of the M 5' UTR and specifically enhances its translation efficiency. Our results suggest that the M 5' UTR promotes the production of M protein and viral budding by recruiting EEF1B2.
Babault, Nicolas; Païzis, Christos; Deley, Gaëlle; Guérin-Deremaux, Laetitia; Saniez, Marie-Hélène; Lefranc-Millot, Catherine; Allaert, François A
2015-01-01
The effects of protein supplementation on muscle thickness and strength seem largely dependent on its composition. The current study aimed at comparing the impact of an oral supplementation with vegetable Pea protein (NUTRALYS®) vs. Whey protein and Placebo on biceps brachii muscle thickness and strength after a 12-week resistance training program. One hundred and sixty one males, aged 18 to 35 years were enrolled in the study and underwent 12 weeks of resistance training on upper limb muscles. According to randomization, they were included in the Pea protein (n = 53), Whey protein (n = 54) or Placebo (n = 54) group. All had to take 25 g of the proteins or placebo twice a day during the 12-week training period. Tests were performed on biceps muscles at inclusion (D0), mid (D42) and post training (D84). Muscle thickness was evaluated using ultrasonography, and strength was measured on an isokinetic dynamometer. Results showed a significant time effect for biceps brachii muscle thickness (P Pea, Whey and Placebo, respectively; P Pea group as compared to Placebo whereas there was no difference between Whey and the two other conditions. Muscle strength also increased with time with no statistical difference between groups. In addition to an appropriate training, the supplementation with pea protein promoted a greater increase of muscle thickness as compared to Placebo and especially for people starting or returning to a muscular strengthening. Since no difference was obtained between the two protein groups, vegetable pea proteins could be used as an alternative to Whey-based dietary products. The present trial has been registered at ClinicalTrials.gov (NCT02128516).
Directory of Open Access Journals (Sweden)
Li Mei-zhi
2010-10-01
Full Text Available Abstract Background Recent research shows that polycystic ovary syndrome (PCOS may have an association with low-grade chronic inflammation, and that PCOS may induce an increase in serum interleukin-18 (IL-18 levels. Methods To investigate the polymorphisms of the IL-18 gene promoters with PCOS, two single nucleotide polymorphisms (SNPs in the promoter of the IL-18 gene (at positions -607C/A and -137G/C in 118 Chinese women with PCOS and 79 controls were evaluated using polymerase chain reaction (PCR. Results No significant differences were found in the genotype distribution, allele frequency and haplotype frequency between the PCOS and control groups. Further analysis demonstrated a relationship between IL-18 gene promoter polymorphisms and PCOS insulin resistance (IR. Regarding the -137 allele frequency, G and C allele frequencies were 93.5% and 6.5%, respectively, in the PCOS with IR patients; G and C allele frequencies were 85.4% and 14.6%, respectively, in PCOS patients without IR (chi2 = 3.601, P = 0.048. Conclusions The presence of a polymorphism in the IL-18 gene was found to have no correlation with the occurrence of PCOS. Carriage of the C allele at position -137 in the promoter of the IL-18 gene may play a protective role from the development of PCOS IR.
Evaluation of methylation pattern in promoter region of E-cadherin ...
African Journals Online (AJOL)
user
2011-03-07
Mar 7, 2011 ... promoter methylation in CDH1 gene inactivation in breast cancer, the CpG methylation status of E- ..... 5'CpG island of CDH1 in prostate, lung, liver, bladder, .... and estrogen receptor alpha from Sp1 sites to induce cell cycle.
The effect of mutations in the AmpC promoter region on β-lactam ...
African Journals Online (AJOL)
STORAGESEVER
2008-08-04
Aug 4, 2008 ... between the -10 and -35 boxes affects the resistance of bacteria to β-lactam antibiotics. .... The chromosomal cephalosporinase gene, ampC, of E. .... mutation in the ampC promoter increasing resistance to β-lactams in.
Disease-associated mutations disrupt functionally important regions of intrinsic protein disorder.
Directory of Open Access Journals (Sweden)
Vladimir Vacic
Full Text Available The effects of disease mutations on protein structure and function have been extensively investigated, and many predictors of the functional impact of single amino acid substitutions are publicly available. The majority of these predictors are based on protein structure and evolutionary conservation, following the assumption that disease mutations predominantly affect folded and conserved protein regions. However, the prevalence of the intrinsically disordered proteins (IDPs and regions (IDRs in the human proteome together with their lack of fixed structure and low sequence conservation raise a question about the impact of disease mutations in IDRs. Here, we investigate annotated missense disease mutations and show that 21.7% of them are located within such intrinsically disordered regions. We further demonstrate that 20% of disease mutations in IDRs cause local disorder-to-order transitions, which represents a 1.7-2.7 fold increase compared to annotated polymorphisms and neutral evolutionary substitutions, respectively. Secondary structure predictions show elevated rates of transition from helices and strands into loops and vice versa in the disease mutations dataset. Disease disorder-to-order mutations also influence predicted molecular recognition features (MoRFs more often than the control mutations. The repertoire of disorder-to-order transition mutations is limited, with five most frequent mutations (R→W, R→C, E→K, R→H, R→Q collectively accounting for 44% of all deleterious disorder-to-order transitions. As a proof of concept, we performed accelerated molecular dynamics simulations on a deleterious disorder-to-order transition mutation of tumor protein p63 and, in agreement with our predictions, observed an increased α-helical propensity of the region harboring the mutation. Our findings highlight the importance of mutations in IDRs and refine the traditional structure-centric view of disease mutations. The results of this study
Directory of Open Access Journals (Sweden)
Lu Ying
2004-04-01
Full Text Available Abstract Background TGM1(transglutaminase 1 is an enzyme that crosslinks the cornified envelope of mature keratinocytes. Appropriate expression of the TGM1 gene is crucial for proper keratinocyte function as inactivating mutations lead to the debilitating skin disease, lamellar ichthyosis. TGM1 is also expressed in squamous metaplasia, a consequence in some epithelia of vitamin A deficiency or toxic insult that can lead to neoplasia. An understanding of the regulation of this gene in normal and abnormal differentiation states may contribute to better disease diagnosis and treatment. Methods In vivo requirements for expression of the TGM1 gene were studied by fusing various lengths of promoter DNA to a reporter and injecting the DNA into mouse embryos to generate transgenic animals. Expression of the reporter was ascertained by Western blotting and immunohistochemistry. Further delineation of a transcriptionally important distal region was determined by transfections of progressively shortened or mutated promoter DNA into cultured keratinocytes. Results In vivo analysis of a reporter transgene driven by the TGM1 promoter revealed that 1.6 kilobases, but not 1.1 kilobases, of DNA was sufficient to confer tissue-specific and cell layer-specific expression. This same region was responsible for reporter expression in tissues undergoing squamous metaplasia as a response to vitamin A deprivation. Mutation of a distal promoter AP1 site or proximal promoter CRE site, both identified as important transcriptional elements in transfection assays, did not prevent appropriate expression. Further searching for transcriptional elements using electrophoretic mobility shift (EMSA and transfection assays in cultured keratinocytes identified two Sp1 elements in a transcriptionally active region between -1.6 and -1.4 kilobases. While mutation of either Sp1 site or the AP1 site singly had only a small effect, mutation of all three sites eliminated nearly all the
2017-01-01
Plant- and animal-feeding insects secrete saliva inside their hosts, containing effectors, which may promote nutrient release and suppress immunity. Although for plant pathogenic microbes it is well established that effectors target host proteins to modulate host cell processes and promote disease, the host cell targets of herbivorous insects remain elusive. Here, we show that the existing plant pathogenic microbe effector paradigm can be extended to herbivorous insects in that effector-target interactions inside host cells modify critical host processes to promote plant susceptibility. We showed that the effector Mp1 from Myzus persicae associates with the host Vacuolar Protein Sorting Associated Protein52 (VPS52). Using natural variants, we provide a strong link between effector virulence activity and association with VPS52, and show that the association is highly specific to M. persicae-host interactions. Also, coexpression of Mp1, but not Mp1-like variants, specifically with host VPS52s resulted in effector relocalization to vesicle-like structures that associate with prevacuolar compartments. We show that high VPS52 levels negatively impact virulence, and that aphids are able to reduce VPS52 levels during infestation, indicating that VPS52 is an important virulence target. Our work is an important step forward in understanding, at the molecular level, how a major agricultural pest promotes susceptibility during infestation of crop plants. We give evidence that an herbivorous insect employs effectors that interact with host proteins as part of an effective virulence strategy, and that these effectors likely function in a species-specific manner. PMID:28100451
An Aphid Effector Targets Trafficking Protein VPS52 in a Host-Specific Manner to Promote Virulence.
Rodriguez, Patricia A; Escudero-Martinez, Carmen; Bos, Jorunn I B
2017-03-01
Plant- and animal-feeding insects secrete saliva inside their hosts, containing effectors, which may promote nutrient release and suppress immunity. Although for plant pathogenic microbes it is well established that effectors target host proteins to modulate host cell processes and promote disease, the host cell targets of herbivorous insects remain elusive. Here, we show that the existing plant pathogenic microbe effector paradigm can be extended to herbivorous insects in that effector-target interactions inside host cells modify critical host processes to promote plant susceptibility. We showed that the effector Mp1 from Myzus persicae associates with the host Vacuolar Protein Sorting Associated Protein52 (VPS52). Using natural variants, we provide a strong link between effector virulence activity and association with VPS52, and show that the association is highly specific to M persicae -host interactions. Also, coexpression of Mp1, but not Mp1-like variants, specifically with host VPS52s resulted in effector relocalization to vesicle-like structures that associate with prevacuolar compartments. We show that high VPS52 levels negatively impact virulence, and that aphids are able to reduce VPS52 levels during infestation, indicating that VPS52 is an important virulence target. Our work is an important step forward in understanding, at the molecular level, how a major agricultural pest promotes susceptibility during infestation of crop plants. We give evidence that an herbivorous insect employs effectors that interact with host proteins as part of an effective virulence strategy, and that these effectors likely function in a species-specific manner. © 2017 American Society of Plant Biologists. All Rights Reserved.
Dhar, Jayeeta; Barik, Sailen
2016-12-01
Pneumonia Virus of Mice (PVM) is the only virus that shares the Pneumovirus genus of the Paramyxoviridae family with Respiratory Syncytial Virus (RSV). A deadly mouse pathogen, PVM has the potential to serve as a robust animal model of RSV infection, since human RSV does not fully replicate the human pathology in mice. Like RSV, PVM also encodes two nonstructural proteins that have been implicated to suppress the IFN pathway, but surprisingly, they exhibit no sequence similarity with their RSV equivalents. The molecular mechanism of PVM NS function, therefore, remains unknown. Here, we show that recombinant PVM NS proteins degrade the mouse counterparts of the IFN pathway components. Proteasomal degradation appears to be mediated by ubiquitination promoted by PVM NS proteins. Interestingly, NS proteins of PVM lowered the levels of several ISG (IFN-stimulated gene) proteins as well. These results provide a molecular foundation for the mechanisms by which PVM efficiently subverts the IFN response of the murine cell. They also reveal that in spite of their high sequence dissimilarity, the two pneumoviral NS proteins are functionally and mechanistically similar.
Wang, Shiyan; Tian, Linwei; Zeng, Zhirong; Zhang, Mingdong; Wu, Kaichun; Chen, Minhu; Fan, Daiming; Hu, Pinjin; Sung, Joseph J Y; Yu, Jun
2010-02-05
Nuclear factor of kappa B inhibitor alpha (I kappaB alpha) protein is implicated in regulating a variety of cellular process from inflammation to tumorigenesis. The objective of this study was to investigate the susceptibility of rs2233408 T/C genotype in the promoter region of I kappaB alpha to gastric cancer and the association of this polymorphism with clinicopathologic variables in gastric cancer patients. A population-based case-control study was conducted between 1999 and 2006 in Guangdong Province, China. A total of 564 gastric cancer patients and 566 healthy controls were enrolled in this study. rs2233408 genotypes in I kappaB alpha were analyzed by TaqMan SNP genotyping assay. Both rs2233408 T homozygote (TT) and T heterozygotes (TC and TT) had significantly reduced gastric cancer risk (TT: OR = 0.250, 95% CI = 0.069-0.909, P = 0.035; TC and TT: OR = 0.721, 95% CI = 0.530-0.981, P = 0.037), compared with rs2233408 C homozygote (CC). rs2233408 T heterozygotes were significantly associated with reduced risk of intestinal-type gastric cancer with ORs of 0.648 (95% CI = 0.459-0.916, P = 0.014), but not with the diffuse or mix type of gastric cancer. The association between rs2233408 T heterozygotes and gastric cancer appeared more apparent in the older patients (age>40) (OR = 0.674, 95% CI = 0.484-0.939, P = 0.02). rs2233408 T heterozygotes was associated with non-cardiac gastric cancer (OR = 0.594, 95% CI = 0.411-0.859, P = 0.006), but not with cardiac gastric cancer. However, rs2233408 polymorphism was not associated with the prognosis of gastric cancer patients. I kappaB alpha rs2233408 T heterozygotes were associated with reduced risk of gastric cancer, especially for the development of certain subtypes of gastric cancer in Chinese population.
Directory of Open Access Journals (Sweden)
Sung Joseph JY
2010-02-01
Full Text Available Abstract Background Nuclear factor of kappa B inhibitor alpha (IκBα protein is implicated in regulating a variety of cellular process from inflammation to tumorigenesis. The objective of this study was to investigate the susceptibility of rs2233408 T/C genotype in the promoter region of IκBα to gastric cancer and the association of this polymorphism with clinicopathologic variables in gastric cancer patients. Methods A population-based case-control study was conducted between 1999 and 2006 in Guangdong Province, China. A total of 564 gastric cancer patients and 566 healthy controls were enrolled in this study. rs2233408 genotypes in IκBα were analyzed by TaqMan SNP genotyping assay. Results Both rs2233408 T homozygote (TT and T heterozygotes (TC and TT had significantly reduced gastric cancer risk (TT: OR = 0.250, 95% CI = 0.069-0.909, P = 0.035; TC and TT: OR = 0.721, 95% CI = 0.530-0.981, P = 0.037, compared with rs2233408 C homozygote (CC. rs2233408 T heterozygotes were significantly associated with reduced risk of intestinal-type gastric cancer with ORs of 0.648 (95% CI = 0.459-0.916, P = 0.014, but not with the diffuse or mix type of gastric cancer. The association between rs2233408 T heterozygotes and gastric cancer appeared more apparent in the older patients (age>40 (OR = 0.674, 95% CI = 0.484-0.939, P = 0.02. rs2233408 T heterozygotes was associated with non-cardiac gastric cancer (OR = 0.594, 95% CI = 0.411-0.859, P = 0.006, but not with cardiac gastric cancer. However, rs2233408 polymorphism was not associated with the prognosis of gastric cancer patients. Conclusions IκBα rs2233408 T heterozygotes were associated with reduced risk of gastric cancer, especially for the development of certain subtypes of gastric cancer in Chinese population.
Mishra, Ratnesh Chandra; Grover, Anil
2014-11-01
In Arabidopsis (Arabidopsis thaliana), the At1g74310 locus encodes for caseinolytic protease B-cytoplasmic (ClpB-C)/heat shock protein100 protein (AtClpB-C), which is critical for the acquisition of thermotolerance, and At1g74320 encodes for choline kinase (AtCK2) that catalyzes the first reaction in the Kennedy pathway for phosphatidylcholine biosynthesis. Previous work has established that the knockout mutants of these genes display heat-sensitive phenotypes. While analyzing the AtClpB-C promoter and upstream genomic regions in this study, we noted that AtClpB-C and AtCK2 genes are head-to-head oriented on chromosome 1 of the Arabidopsis genome. Expression analysis showed that transcripts of these genes are rapidly induced in response to heat stress treatment. In stably transformed Arabidopsis plants harboring this intergenic sequence between head-to-head oriented green fluorescent protein and β-glucuronidase reporter genes, both transcripts and proteins of the two reporters were up-regulated upon heat stress. Four heat shock elements were noted in the intergenic region by in silico analysis. In the homozygous transfer DNA insertion mutant Salk_014505, 4,393-bp transfer DNA is inserted at position -517 upstream of ATG of the AtClpB-C gene. As a result, AtCk2 loses proximity to three of the four heat shock elements in the mutant line. Heat-inducible expression of the AtCK2 transcript was completely lost, whereas the expression of AtClpB-C was not affected in the mutant plants. Our results suggest that the 1,329-bp intergenic fragment functions as a heat-inducible bidirectional promoter and the region governing the heat inducibility is possibly shared between the two genes. We propose a model in which AtClpB-C shares its regulatory region with heat-induced choline kinase, which has a possible role in heat signaling. © 2014 American Society of Plant Biologists. All Rights Reserved.
Balakrishnan, Swati; Sarma, Siddhartha P
2017-08-22
Aromatic interactions are an important force in protein folding as they combine the stability of a hydrophobic interaction with the selectivity of a hydrogen bond. Much of our understanding of aromatic interactions comes from "bioinformatics" based analyses of protein structures and from the contribution of these interactions to stabilizing secondary structure motifs in model peptides. In this study, the structural consequences of aromatic interactions on protein folding have been explored in engineered mutants of the molten globule protein apo-cytochrome b 5 . Structural changes from disorder to order due to aromatic interactions in two variants of the protein, viz., WF-cytb5 and FF-cytb5, result in significant long-range secondary and tertiary structure. The results show that 54 and 52% of the residues in WF-cytb5 and FF-cytb5, respectively, occupy ordered regions versus 26% in apo-cytochrome b 5 . The interactions between the aromatic groups are offset-stacked and edge-to-face for the Trp-Phe and Phe-Phe mutants, respectively. Urea denaturation studies indicate that both mutants have a C m higher than that of apo-cytochrome b 5 and are more stable to chaotropic agents than apo-cytochrome b 5 . The introduction of these aromatic residues also results in "trimer" interactions with existing aromatic groups, reaffirming the selectivity of the aromatic interactions. These studies provide insights into the aromatic interactions that drive disorder-to-order transitions in intrinsically disordered regions of proteins and will aid in de novo protein design beyond small peptide scaffolds.
Po, Yang; Cai, Yuzhuo; Lyytinen, Anu; Hölttä, Seppo
2016-01-01
This paper intends to learn from international experiences in order to facilitating China's ongoing regional university transformation with an ultimate goal to enhance the role of university in regional economic development and innovation. In so doing, this paper compares major models of universities of applied sciences (UAS) around the world from…
Directory of Open Access Journals (Sweden)
Min Ju Yi
2017-03-01
Full Text Available PurposeThe most common single nucleotide polymorphism in the IGFBP3 promoter region occurs at position -202. This polymorphic variation occurs frequently and may influence growth hormone responsiveness and somatic growth. However, the effects of IGFBP3 promoter polymorphism on growth in children are unknown.MethodsRestriction fragment length polymorphism-based genotyping of the -202 single nucleotide polymorphism was performed in 146 Korean girls aged between 15 and 16 years, who were selected randomly from the Seoul School Health Promotion Center. The participants were divided into 3 groups (tall, medium, and short according to the height percentile established from normal reference values for Korean children. The serum levels of insulin-like growth factor I (IGF-I and IGF-binding protein-3 (IGFBP-3 were then compared according to genotype.ResultsThe genotype distribution in the participants was 79 AA (54.1%, 60 AC (41.1%, and 7 CC (4.8%. The C allele frequency at the -202 IGFBP3 position was 25.4% in this group. The mean serum IGFBP-3 concentration in girls with the AA genotype was higher than that in girls with the AC genotype in the medium (P=0.047 and short (P=0.035 groups, respectively. There was no difference in the IGF-I to IGFBP-3 molar ratio between the AA and AC genotype groups (P=0.161.ConclusionIn conclusion, the -202 polymorphism in the IGFBP3 promoter region is assumed to affect the serum concentration of IGFBP-3 in children as well as in adults. However, it is unclear whether this affects physical development according to the concentration of IGFBP-3.
International Nuclear Information System (INIS)
Tsukahara, Tomonori; Agawa, Hideyuki; Matsumoto, Sayori; Matsuda, Mizuho; Ueno, Shuichi; Yamashita, Yuki; Yamada, Koichiro; Tanaka, Nobuyuki; Kojima, Katsuhiko; Takeshita, Toshikazu
2006-01-01
Genomic analysis of integration will be important in evaluating the safety of human gene therapy with retroviral vectors. Here, we investigated MLV vector integration sites in human T-cells, since they are amenable to gene transfer studies, and have been used therapeutically in clinical trials. We mapped 340 MLV vector integration sites in the infected human T-cell clones we established. The data showed that MLV preferred integration near the transcription start sites (±5 kb), near CpG islands (±1 kb), and within the first intron of RefSeq genes. We also identified MLV integration hot spots that contained three or more integrations within a 100 kb region. RT-PCR revealed that mRNA-levels of T-cell clones that contained MLV integrations near transcription start sites or introns were dysregulated compared to the uninfected cells. These studies help define the profile of MLV integration in T-cells and the risks associated with MLV-based gene therapy
International Nuclear Information System (INIS)
Ghazal, P.; Lubon, H.; Hennighausen, L.
1988-01-01
Repeat sequence motifs as well as unique sequences between nucleotides -150 and -22 of the human cytomegalovirus immediate-early 1 gene interact in vitro with nuclear proteins. The authors show that a transcriptional element between nucleotides -91 and -65 stimulated promoter activity in vivo and in vitro by binding specific cellular transcription factors. Finally, a common sequence motif, (T)TGG/AC, present in 15 of the determined binding sites suggests a particular class of nuclear factors associated with the immediate-early 1 gene
Nahm, Francis Sahngun; Park, Zee-Yong; Nahm, Sang-Soep; Kim, Yong Chul; Lee, Pyung Bok
2014-01-01
Complex regional pain syndrome (CRPS) is a rare but debilitating pain disorder. Although the exact pathophysiology of CRPS is not fully understood, central and peripheral mechanisms might be involved in the development of this disorder. To reveal the central mechanism of CRPS, we conducted a proteomic analysis of rat cerebrum using the chronic postischemia pain (CPIP) model, a novel experimental model of CRPS. After generating the CPIP animal model, we performed a proteomic analysis of the rat cerebrum using a multidimensional protein identification technology, and screened the proteins differentially expressed between the CPIP and control groups. Results. A total of 155 proteins were differentially expressed between the CPIP and control groups: 125 increased and 30 decreased; expressions of proteins related to cell signaling, synaptic plasticity, regulation of cell proliferation, and cytoskeletal formation were increased in the CPIP group. However, proenkephalin A, cereblon, and neuroserpin were decreased in CPIP group. Altered expression of cerebral proteins in the CPIP model indicates cerebral involvement in the pathogenesis of CRPS. Further study is required to elucidate the roles of these proteins in the development and maintenance of CRPS.
Directory of Open Access Journals (Sweden)
Francis Sahngun Nahm
2014-01-01
Full Text Available Background. Complex regional pain syndrome (CRPS is a rare but debilitating pain disorder. Although the exact pathophysiology of CRPS is not fully understood, central and peripheral mechanisms might be involved in the development of this disorder. To reveal the central mechanism of CRPS, we conducted a proteomic analysis of rat cerebrum using the chronic postischemia pain (CPIP model, a novel experimental model of CRPS. Materials and Methods. After generating the CPIP animal model, we performed a proteomic analysis of the rat cerebrum using a multidimensional protein identification technology, and screened the proteins differentially expressed between the CPIP and control groups. Results. A total of 155 proteins were differentially expressed between the CPIP and control groups: 125 increased and 30 decreased; expressions of proteins related to cell signaling, synaptic plasticity, regulation of cell proliferation, and cytoskeletal formation were increased in the CPIP group. However, proenkephalin A, cereblon, and neuroserpin were decreased in CPIP group. Conclusion. Altered expression of cerebral proteins in the CPIP model indicates cerebral involvement in the pathogenesis of CRPS. Further study is required to elucidate the roles of these proteins in the development and maintenance of CRPS.
Mohammadpur, Ahmad; Rezaei, Mehdi; Sadeghi, Rasoul
2010-05-14
The aim of this qualitative study is to explore the way people using modern health care perceive its consequences in Ouraman-e-Takht region of Iranian Kurdistan. Ouraman-e-Takht is a rural, highly mountainous and dry region located in the southwest Kurdistan province of Iran. Recently, modern health practices have been introduced to the region. The purpose of this study was to investigate, from the Ouramains' point of view, the impact that modern health services and practices have had on the Ouraman traditional way of life. Interview data from respondents were analyzed by using grounded theory. Promoting survival was the core category that explained the impact that modern health practices have had on the Ouraman region. The people of Ouraman interpreted modern health practices as increasing their quality of life and promoting their survival. Results are organized around this core category in a paradigm model consisting of conditions, interactions, and consequences. This model can be used to understand the impact of change from the introduction of modern health on a traditional society.
Mohammadpur, Ahmad; Rezaei, Mehdi; Sadeghi, Rasoul
2010-01-01
The aim of this qualitative study is to explore the way people using modern health care perceive its consequences in Ouraman-e-Takht region of Iranian Kurdistan. Ouraman-e-Takht is a rural, highly mountainous and dry region located in the southwest Kurdistan province of Iran. Recently, modern health practices have been introduced to the region. The purpose of this study was to investigate, from the Ouramains' point of view, the impact that modern health services and practices have had on the Ouraman traditional way of life. Interview data from respondents were analyzed by using grounded theory. Promoting survival was the core category that explained the impact that modern health practices have had on the Ouraman region. The people of Ouraman interpreted modern health practices as increasing their quality of life and promoting their survival. Results are organized around this core category in a paradigm model consisting of conditions, interactions, and consequences. This model can be used to understand the impact of change from the introduction of modern health on a traditional society. PMID:20640020
Deletion of G-protein-coupled receptor 55 promotes obesity by reducing physical activity.
Meadows, A; Lee, J H; Wu, C-S; Wei, Q; Pradhan, G; Yafi, M; Lu, H-C; Sun, Y
2016-03-01
Cannabinoid receptor 1 (CB1) is the best-characterized cannabinoid receptor, and CB1 antagonists are used in clinical trials to treat obesity. Because of the wide range of CB1 functions, the side effects of CB1 antagonists pose serious concerns. G-protein-coupled receptor 55 (GPR55) is an atypical cannabinoid receptor, and its pharmacology and functions are distinct from CB1. GPR55 regulates neuropathic pain, gut, bone, immune functions and motor coordination. GPR55 is expressed in various brain regions and peripheral tissues. However, the roles of GPR55 in energy and glucose homeostasis are unknown. Here we have investigated the roles of GPR55 in energy balance and insulin sensitivity using GPR55-null mice (GPR55(-/-)). Body composition of the mice was measured by EchoMRI. Food intake, feeding behavior, energy expenditure and physical activity of GPR55(-/-) mice were determined by indirect calorimetry. Muscle function was assessed by forced treadmill running test. Insulin sensitivity was evaluated by glucose and insulin tolerance tests. Adipose inflammation was assessed by flow cytometry analysis of adipose tissue macrophages. The expression of inflammatory markers in adipose tissues and orexigenic/anorexigenic peptides in the hypothalamus was also analyzed by real-time PCR. GPR55(-/-) mice had normal total energy intake and feeding pattern (i.e., no changes in meal size, meal number or feeding frequency). Intriguingly, whereas adult GPR55(-/-) mice only showed a modest increase in overall body weight, they exhibited significantly increased fat mass and insulin resistance. The spontaneous locomotor activity of GPR55(-/-) mice was dramatically decreased, whereas resting metabolic rate and non-shivering thermogenesis were unchanged. Moreover, GPR55(-/-) mice exhibited significantly decreased voluntary physical activity, showing reduced running distance on the running wheels, whereas muscle function appeared to be normal. GPR55 has an important role in energy
Directory of Open Access Journals (Sweden)
Simone C de Cassan
2015-07-01
Full Text Available Malaria vaccine development has largely focused on Plasmodium falciparum; however a reawakening to the importance of P. vivax has spurred efforts to develop vaccines against this difficult to treat and at times severe form of relapsing malaria, which constitutes a significant proportion of human malaria cases worldwide. The almost complete dependence of P. vivax red blood cell invasion on the interaction of the P. vivax Duffy-binding protein region II (PvDBP_RII with the human Duffy antigen receptor for chemokines (DARC, makes this antigen an attractive vaccine candidate against blood-stage P. vivax. Here, we generated both preclinical and clinically-compatible adenoviral and poxviral vectored vaccine candidates expressing the Salvador I allele of PvDBP_RII – including human adenovirus serotype 5 (HAdV5, chimpanzee adenovirus serotype 63 (ChAd63 and modified vaccinia virus Ankara (MVA vectors. We report on the antibody and T cell immunogenicity of these vaccines in mice or rabbits, either used alone in a viral vectored prime-boost regime, or in ‘mixed-modality’ adenovirus prime – protein-in-adjuvant boost regimes (using a recombinant protein PvDBP_RII protein antigen formulated in Montanide®ISA720 or Abisco®100 adjuvants. Antibodies induced by these regimes were found to bind to native parasite antigen from P. vivax infected Thai patients and were capable of inhibiting the binding of PvDBP_RII to its receptor DARC using an in vitro binding inhibition assay. In recent years, recombinant ChAd63 and MVA vectors have been quickly translated into human clinical trials for numerous antigens from P. falciparum as well as a growing number of other pathogens. The vectors reported here are immunogenic in small animals, elicit antibodies against PvDBP_RII and have recently entered clinical trials which will provide the first assessment of the safety and immunogenicity of the PvDBP_RII antigen in humans.
DEFF Research Database (Denmark)
Daugbjerg, Signe B; Kahlmeier, Sonja; Racioppi, Francesca
2009-01-01
. Population groups most in need such as people with low levels of physical activity were rarely specifically targeted. Most policies emphasized the importance of an evaluation. However, only about half of them indicated a related intention or requirement. CONCLUSION: In recent years there has been......BACKGROUND: Over the past years there has been increasing interest in physical activity promotion and the development of appropriate policy. So far, there has been no comprehensive overview of the activities taking place in Europe in this area of public health policy. METHODS: Using different...... search methods, 49 national policy documents on physical activity promotion were identified. An analysis grid covering key features was developed for the analysis of the 27 documents published in English. RESULTS: Analysis showed that many general recommendations for policy developments are being...
Directory of Open Access Journals (Sweden)
Sun Yuping
2016-03-01
Full Text Available Labor resource is the necessary productive factor in regional economic development, and one of important indexes to evaluate regional economic competitiveness. The great economic achievement brought by the 30-year reform and opening up of China is due to the fact that China brought the backward advantage of “demographic dividend” into play, promoted the fast development of industrialization and urbanization, and became the second largest economy in the world. The entity of “demographic dividend” is the non-agricultural migrant population, i.e., migrant workers. The transfer employment of migrant workers has typical regional liquidity, and the imbalance of regional economy causes the flow of many migrant workers. In order to achieve harmonious development and coordinated development, underdeveloped areas must understand the character and regulation, adopt positive industrial policy and supportive policy, guide the reasonable flow of migrant workers, and realize the transfer of local employment and citizenization of migrant workers, which can enhance regional economic competitiveness
Olayan, Rawan S.
2012-12-01
In classification problems, it is always important to use the suitable combination of features that will be employed by classifiers. Generating the right combination of features usually results in good classifiers. In the situation when the problem is not well understood, data items are usually described by many features in the hope that some of these may be the relevant or most relevant ones. In this study, we focus on one such problem related to genes implicated in ovarian cancer (OC). We try to recognize two important OC-related gene groups: oncogenes, which support the development and progression of OC, and oncosuppressors, which oppose such tendencies. For this, we use the properties of promoters of these genes. We identified potential “regulatory features” that characterize OC-related oncogenes and oncosuppressors promoters. In our study, we used 211 oncogenes and 39 oncosuppressors. For these, we identified 538 characteristic sequence motifs from their promoters. Promoters are annotated by these motifs and derived feature vectors used to develop classification models. We made a comparison of a number of classification models in their ability to distinguish oncogenes from oncosuppressors. Based on 10-fold cross-validation, the resultant model was able to separate the two classes with sensitivity of 96% and specificity of 100% with the complete set of features. Moreover, we developed another recognition model where we attempted to distinguish oncogenes and oncosuppressors as one group from other OC-related genes. That model achieved accuracy of 82%. We believe that the results of this study will help in discovering other OC-related oncogenes and oncosuppressors not identified as yet.
Olayan, Rawan S.
2012-01-01
In classification problems, it is always important to use the suitable combination of features that will be employed by classifiers. Generating the right combination of features usually results in good classifiers. In the situation when the problem is not well understood, data items are usually described by many features in the hope that some of these may be the relevant or most relevant ones. In this study, we focus on one such problem related to genes implicated in ovarian cancer (OC). We try to recognize two important OC-related gene groups: oncogenes, which support the development and progression of OC, and oncosuppressors, which oppose such tendencies. For this, we use the properties of promoters of these genes. We identified potential “regulatory features” that characterize OC-related oncogenes and oncosuppressors promoters. In our study, we used 211 oncogenes and 39 oncosuppressors. For these, we identified 538 characteristic sequence motifs from their promoters. Promoters are annotated by these motifs and derived feature vectors used to develop classification models. We made a comparison of a number of classification models in their ability to distinguish oncogenes from oncosuppressors. Based on 10-fold cross-validation, the resultant model was able to separate the two classes with sensitivity of 96% and specificity of 100% with the complete set of features. Moreover, we developed another recognition model where we attempted to distinguish oncogenes and oncosuppressors as one group from other OC-related genes. That model achieved accuracy of 82%. We believe that the results of this study will help in discovering other OC-related oncogenes and oncosuppressors not identified as yet.
Yang, Chunrong; Shang, Xueying; Cheng, Lei; Yang, Lei; Liu, Xuefei; Bai, Chunling; Wei, Zhuying; Hua, Jinlian; Li, Guangpeng
2017-01-01
Methylation is an important issue in gene expression regulation and also in the fields of genetics and reproduction. In this study, we created fat-1 transgenic sheep, investigated the fine-mapping and the modulatory mechanisms of promoter methylation. Sheep fetal fibroblasts were transfected by pCAG-fat1-IRES-EGFP. Monoclonal cell line was screened as nuclear donor and carried out nuclear transfer (441 transgenic cloned embryos, 52 synchronism recipient sheep). Six offsprings were obtained. Expressions of exogenous genes fat-1 and EGFP were detectable in 10 examined tissues and upregulated omega-3 fatty acid content. Interestingly, more or less EGFP negative cells were detectable in the positive transgenic fetal skin cells. EGFP negative and positive cells were sorted by flow cytometry, and their methylation status in the whole promoter region (1701 nt) were investigated by bisulphate sequencing. The fine-mapping of methylation in CAG promoter were proposed. The results suggested that exogenous gene expression was determined by the methylation status from 721-1346 nt and modulated by methylation levels at 101, 108 and 115 nt sites in CAG promoter. To clarify the regulatory mechanism of methylation, examination of four DNA methyltransferases (DNMTs) demonstrated that hypermethylation of CAG promoter is mainly maintained by DNMT 1 in EGFP negative cells. Furthermore, investigation of the cell surface antigen CD34, CD45 and CD166 indicated that EGFP positive and negative cells belong to different types. The present study systematically clarified methylation status of CAG promoter in transgenic sheep and regulatory mechanism, which will provide research strategies for gene expression regulation in transgenic animals.
Directory of Open Access Journals (Sweden)
Ruixi Liu
2012-01-01
Full Text Available Objectives. The −420C>G polymorphism located in the resistin gene (RETN promoter has recently been suggested to play a potential role in proinflammatory conditions and cardiovascular disease. This study investigated the association of the RETN promoter polymorphism with Kawasaki disease (KD and its clinical parameters in Chinese children. Methods. We compared patients with complete KD to incomplete KD children. Genotyping of the RETN promoter polymorphism was performed using MassARRAY system, and serum resistin levels were estimated using the sandwich enzyme immunoassay method. Results. There was no significant difference in RETN (−420C>G genotypes between KD and control groups. However, the frequency of the G allele was higher in iKD patients than in cKD children due to a significantly increased frequency of the GG genotypes. Serum levels of resistin were significantly higher in KD patients than in controls regardless of the presence of coronary artery lesions (CALs. Conclusion. The present findings suggest that while resistin may play a role in the pathogenesis of KD, there is no apparent association between CAL and the RETN (−420C>G gene polymorphism in KD children. However, the diagnosis of iKD is challenging but can be supported by the presence of the G allele and the GG genotypes.
Manfredi, L H; Paula-Gomes, S; Zanon, N M; Kettelhut, I C
2017-10-19
Myostatin is a novel negative regulator of skeletal muscle mass. Myostatin expression is also found in heart in a much less extent, but it can be upregulated in pathological conditions, such as heart failure. Myostatin may be involved in inhibiting protein synthesis and/or increasing protein degradation in skeletal and cardiac muscles. Herein, we used cell cultures and isolated muscles from rats to determine protein degradation and synthesis. Muscles incubated with myostatin exhibited an increase in proteolysis with an increase of Atrogin-1, MuRF1 and LC3 genes. Extensor digitorum longus muscles and C2C12 myotubes exhibited a reduction in protein turnover. Cardiomyocytes showed an increase in proteolysis by activating autophagy and the ubiquitin proteasome system, and a decrease in protein synthesis by decreasing P70S6K. The effect of myostatin on protein metabolism is related to fiber type composition, which may be associated to the extent of atrophy mediated effect of myostatin on muscle.
Directory of Open Access Journals (Sweden)
Finan Christopher L
2005-03-01
Full Text Available Abstract Background In Micrococcus luteus growth and resuscitation from starvation-induced dormancy is controlled by the production of a secreted growth factor. This autocrine resuscitation-promoting factor (Rpf is the founder member of a family of proteins found throughout and confined to the actinobacteria (high G + C Gram-positive bacteria. The aim of this work was to search for and characterise a cognate gene family in the firmicutes (low G + C Gram-positive bacteria and obtain information about how they may control bacterial growth and resuscitation. Results In silico analysis of the accessory domains of the Rpf proteins permitted their classification into several subfamilies. The RpfB subfamily is related to a group of firmicute proteins of unknown function, represented by YabE of Bacillus subtilis. The actinobacterial RpfB and firmicute YabE proteins have very similar domain structures and genomic contexts, except that in YabE, the actinobacterial Rpf domain is replaced by another domain, which we have called Sps. Although totally unrelated in both sequence and secondary structure, the Rpf and Sps domains fulfil the same function. We propose that these proteins have undergone "non-orthologous domain displacement", a phenomenon akin to "non-orthologous gene displacement" that has been described previously. Proteins containing the Sps domain are widely distributed throughout the firmicutes and they too fall into a number of distinct subfamilies. Comparative analysis of the accessory domains in the Rpf and Sps proteins, together with their weak similarity to lytic transglycosylases, provide clear evidence that they are muralytic enzymes. Conclusions The results indicate that the firmicute Sps proteins and the actinobacterial Rpf proteins are cognate and that they control bacterial culturability via enzymatic modification of the bacterial cell envelope.
LENUS (Irish Health Repository)
Morgan, Claire C
2010-01-01
ABSTRACT: BACKGROUND: Reproductive proteins are central to the continuation of all mammalian species. The evolution of these proteins has been greatly influenced by environmental pressures induced by pathogens, rival sperm, sexual selection and sexual conflict. Positive selection has been demonstrated in many of these proteins with particular focus on primate lineages. However, the mammalia are a diverse group in terms of mating habits, population sizes and germ line generation times. We have examined the selective pressures at work on a number of novel reproductive proteins across a wide variety of mammalia. RESULTS: We show that selective pressures on reproductive proteins are highly varied. Of the 10 genes analyzed in detail, all contain signatures of positive selection either across specific sites or in specific lineages or a combination of both. Our analysis of SP56 and Col1a1 are entirely novel and the results show positively selected sites present in each gene. Our findings for the Col1a1 gene are suggestive of a link between positive selection and severe disease type. We find evidence in our dataset to suggest that interacting proteins are evolving in symphony: most likely to maintain interacting functionality. CONCLUSION: Our in silico analyses show positively selected sites are occurring near catalytically important regions suggesting selective pressure to maximize efficient fertilization. In those cases where a mechanism of protein function is not fully understood, the sites presented here represent ideal candidates for mutational study. This work has highlighted the widespread rate heterogeneity in mutational rates across the mammalia and specifically has shown that the evolution of reproductive proteins is highly varied depending on the species and interacting partners. We have shown that positive selection and disease are closely linked in the Col1a1 gene.
Rangelands are valued for their capacity to provide diverse suites of ecosystem services, from food production to carbon storage to biological diversity. Although rangelands worldwide share common characteristics, differences among biogeographic regions result in differences in the types of opportun...
Regional differences in gene expression and promoter usage in aged human brains
Pardo, Luba M.; Rizzu, Patrizia; Francescatto, Margherita; Vitezic, Morana; Leday, Gwenaë l G.R.; Sanchez, Javier Simon; Khamis, Abdullah M.; Takahashi, Hazuki; van de Berg, Wilma D.J.; Medvedeva, Yulia A.; van de Wiel, Mark A.; Daub, Carsten O.; Carninci, Piero; Heutink, Peter
2013-01-01
To characterize the promoterome of caudate and putamen regions (striatum), frontal and temporal cortices, and hippocampi from aged human brains, we used high-throughput cap analysis of gene expression to profile the transcription start sites
Members of the heat-shock protein 70 family promote cancer cell growth by distinct mechanisms
DEFF Research Database (Denmark)
Rohde, Mikkel; Daugaard, Mads; Jensen, Mette Hartvig
2005-01-01
Whereas the stress-inducible heat-shock protein 70 (Hsp70) has gained plenty of attention as a putative target for tumor therapy, little is known about the role of other Hsp70 proteins in cancer. Here we present the first thorough analysis of the expression and function of the cytosolic Hsp70...... proteins in human cancer cells and identify Hsp70-2, a protein essential for spermatogenesis, as an important regulator of cancer cell growth. Targeted knock-down of the individual family members by RNA interference revealed that both Hsp70 and Hsp70-2 were required for cancer cell growth, whereas...
Energy Technology Data Exchange (ETDEWEB)
Joshi, J.B. (National Heart, Lung, and Blood Inst., Bethesda, MD (United States)); Dave, H.P.G. (National Inst. of Health, Bethesda, MD (United States))
1992-02-01
Human T-cell lymphotropic virus type I (HTLV-I), an etiologic agent for adult T-cell leukemia, is strongly associated with certain neurological diseases. The HTLV-I genome encodes a protein, Tax{sub 1}, that transactivates viral gene transcription. CD4-positive T helper lymphocytes express the proenkephalin gene, and enkephalins have been implicated as neuroimmunomodulators. The authors have investigated the effect of Tax{sub 1} on the proenkephalin gene promoter in C6 rat glioma cells and demonstrated its transactivation. Analysis using 5{prime} deletion mutants of the promoter region showed that sequences upstream of base pair - 190 are necessary for maximal transactivation. Forskolin, a cAMP modulator, synergistically increased Tax{sub 1}-mediated transactivation of the proenkephalin promoter. Neither Tax{sub 1} transactivation alone nor Tax{sub 1}/cAMP synergism exclusively involved cAMP-responsive elements. Endogenous proenkephalin gene expression increased in Tax{sub 1}-expressing C6 cells. Since HTLV-I infects lymphocytes, which express proenkephalin mRNA, Tax{sub 1} transregulation of proenkephalin expression may provide bidirectional communication between the nervous and immune systems in HTLV-I-related diseases.
Penta Rao, Tamarba; Rajendra Prasad, P.
2018-04-01
Entry region swirl promoters gain importance in industry because of its effectiveness in augmentation of mass and heat transfer augmentation. Design of equipment needs momentum transfer data along with mass or heat transfer data. Hence an experimental investigation was carried out with coaxially placed entry region spiral coil as turbulence promoters on momentum transfer in forced convection flow of electrolyte in circular conduits. Aqueous solution of sodium hydroxide and 0.01 M equimolal Ferri-ferro cyanide system was chosen for the study. The study covered parameters like effect of pitch of the coil, effect of length of the coil, diameter of the coil, diameter of the coil wire, diameter of the annular rod. The promoter is measured by limiting current technique using diffusion controlled electrochemical reactions. The study comprises of evaluation of momentum transfer rates at the outer wall of the electrochemical cell. Pressure drop measurements were also made to obtain the energy consumption pattern. Within the range of variables covered. The results are correlated by the momentum transfer similarity function. Momentum transfer coefficients were evaluated from measured limiting currents. Effect of each parameter was studied in terms of friction factor. A model was developed for momentum transfer. The experimental data on momentum transfer was modeled in terms of momentum transfer function and Reynolds number, geometric parameters.
Directory of Open Access Journals (Sweden)
Dobrovic Alexander
2009-09-01
Full Text Available Abstract Background Succinate dehydrogenase (SDH and fumarate hydratase (FH are tricarboxylic acid (TCA cycle enzymes that are also known to act as tumour suppressor genes. Increased succinate or fumarate levels as a consequence of SDH and FH deficiency inhibit hypoxia inducible factor-1α (HIF-1α prolyl hydroxylases leading to sustained HIF-1α expression in tumours. Since HIF-1α is frequently expressed in breast carcinomas, DNA methylation at the promoter regions of the SDHA, SDHB, SDHC and SDHD and FH genes was evaluated as a possible mechanism in silencing of SDH and FH expression in breast carcinomas. Findings No DNA methylation was identified in the promoter regions of the SDHA, SDHB, SDHC, SDHD and FH genes in 72 breast carcinomas and 10 breast cancer cell lines using methylation-sensitive high resolution melting which detects both homogeneous and heterogeneous methylation. Conclusion These results show that inactivation via DNA methylation of the promoter CpG islands of SDH and FH is unlikely to play a major role in sporadic breast carcinomas.
Region-specific protein misfolding cyclic amplification reproduces brain tropism of prion strains.
Privat, Nicolas; Levavasseur, Etienne; Yildirim, Serfildan; Hannaoui, Samia; Brandel, Jean-Philippe; Laplanche, Jean-Louis; Béringue, Vincent; Seilhean, Danielle; Haïk, Stéphane
2017-10-06
Human prion diseases such as Creutzfeldt-Jakob disease are transmissible brain proteinopathies, characterized by the accumulation of a misfolded isoform of the host cellular prion protein (PrP) in the brain. According to the prion model, prions are defined as proteinaceous infectious particles composed solely of this abnormal isoform of PrP (PrP Sc ). Even in the absence of genetic material, various prion strains can be propagated in experimental models. They can be distinguished by the pattern of disease they produce and especially by the localization of PrP Sc deposits within the brain and the spongiform lesions they induce. The mechanisms involved in this strain-specific targeting of distinct brain regions still are a fundamental, unresolved question in prion research. To address this question, we exploited a prion conversion in vitro assay, protein misfolding cyclic amplification (PMCA), by using experimental scrapie and human prion strains as seeds and specific brain regions from mice and humans as substrates. We show here that region-specific PMCA in part reproduces the specific brain targeting observed in experimental, acquired, and sporadic Creutzfeldt-Jakob diseases. Furthermore, we provide evidence that, in addition to cellular prion protein, other region- and species-specific molecular factors influence the strain-dependent prion conversion process. This important step toward understanding prion strain propagation in the human brain may impact research on the molecular factors involved in protein misfolding and the development of ultrasensitive methods for diagnosing prion disease. © 2017 by The American Society for Biochemistry and Molecular Biology, Inc.
Yilmaz, Lutfu Safak; Atilgan, Ali Rana
2000-09-01
A low-resolution structural model based on the packing geometry of α-carbons is utilized to establish a connection between the flexible and rigid parts of a folded protein. The former commonly recognizes a complementing molecule for making a complex, while the latter manipulates the necessary conformational change for binding. We attempt analytically to distinguish this control architecture that intrinsically exists in globular proteins. First with two-dimensional simple models, then for a native protein, bovine pancreatic trypsin inhibitor, we explicitly demonstrate that inserting fluctuations in tertiary contacts supported by the stable core, one can regulate the displacement of residues on loop regions. The positional fluctuations of the flexible regions are annihilated by the rest of the protein in conformity with the Le Chatelier-Braun principle. The results indicate that the distortion of the principal nonbonded contacts between highly packed residues is accompanied by that of the slavery fluctuations that are widely distributed over the native structure. These positional arrangements do not appear in a reciprocal relation between a perturbation and the associated response; the effect of a movement of residue i on residue j is not equal to that of the same movement of residue j on residue i.
Stanford, Stephanie M; Svensson, Mattias N D; Sacchetti, Cristiano; Pilo, Caila A; Wu, Dennis J; Kiosses, William B; Hellvard, Annelie; Bergum, Brith; Aleman Muench, German R; Elly, Christian; Liu, Yun-Cai; den Hertog, Jeroen; Elson, Ari; Sap, Jan; Mydel, Piotr; Boyle, David L; Corr, Maripat; Firestein, Gary S; Bottini, Nunzio
2016-01-01
OBJECTIVE: During rheumatoid arthritis (RA), fibroblast-like synoviocytes (FLS) critically promote disease pathogenesis by aggressively invading the joint extracellular matrix. The focal adhesion kinase (FAK) signaling pathway is emerging as a contributor to RA FLS anomalous behavior. The receptor
International Nuclear Information System (INIS)
Deng, Lin; Lu, Yuanyuan; Zhao, Xiaodi; Sun, Yi; Shi, Yongquan; Fan, Hongwei; Liu, Changhao; Zhou, Jinfeng; Nie, Yongzhan; Wu, Kaichun; Fan, Daiming; Guo, Xuegang
2013-01-01
Highlights: •Overexpression of Ran in pancreatic cancer was correlated with histological grade. •Downregulation of Ran could induce cell apoptosis and inhibit cell proliferation. •The effects were mediated by cell cycle proteins, Survivin and cleaved Caspase-3. -- Abstract: Ran, a member of the Ras GTPase family, has important roles in nucleocytoplasmic transport. Herein, we detected Ran expression in pancreatic cancer and explored its potential role on tumour progression. Overexpressed Ran in pancreatic cancer tissues was found highly correlated with the histological grade. Downregulation of Ran led to significant suppression of cell proliferation, cell cycle arrest at the G1/S phase and induction of apoptosis. In vivo studies also validated that result. Further studies revealed that those effects were at least partly mediated by the downregulation of Cyclin A, Cyclin D1, Cyclin E, CDK2, CDK4, phospho-Rb and Survivin proteins and up regulation of cleaved Caspase-3
Directory of Open Access Journals (Sweden)
Maseapo P. Mthobeni
2013-02-01
Full Text Available South African communities are still greatly affected by the high rate of infection with HIV or who are living with AIDS, mirrored in the 2008 overall national HIV prevalence of 29.3%(UNAIDS 2010:10. In addressing the challenge, the health system is dependent on community care level workers such as caregivers to render health promotion and education in the homes and communities. The caregivers based in the communities are the ones with first-hand information on what is needed for the success of health promotion programmes. This study, aimed at exploring the challenges faced by the health promoters, described their perceptions regarding a health promotion programme for families with adolescents orphaned as a result of AIDS. Data were collected on the purposively selected participants at the rural Hammanskraal region in South Africa and the research question: ‘What is your perception regarding health promotion programmes for families with adolescents orphaned as a result of AIDS’ was asked and discussed by participants in a focus group interview. Data were analysed using the adapted Tesch method to organize and isolate the main categories, sub-categories and themes. The following main categories were isolated: attitudes of adolescents, effectiveness of home visits, need for health education and limited resources. Based on the findings, it was therefore recommended that health care planners assist in the improvement of health promotion and education by using the community and national media, providing information material and providing access to the internet in order to allow more people, including young people, to access the information.Suid-Afrikaanse gemeenskappe word steeds grootliks beïnvloed deur die hoë vlak van MIV en vigs, soos weerspieël in die algehele nasionale MIV-syfer in 2008 van 29.3% (UNAIDS 2010:10. In die aanspreek van hierdie uitdaging is die gesondheidstelsel afhanklik van gemeenskapsorgwerkers om gesondheidsbevordering
Directory of Open Access Journals (Sweden)
Maseapo P. Mthobeni
2013-02-01
Full Text Available South African communities are still greatly affected by the high rate of infection with HIV or who are living with AIDS, mirrored in the 2008 overall national HIV prevalence of 29.3%(UNAIDS 2010:10. In addressing the challenge, the health system is dependent on community care level workers such as caregivers to render health promotion and education in the homes and communities. The caregivers based in the communities are the ones with first-hand information on what is needed for the success of health promotion programmes. This study, aimed at exploring the challenges faced by the health promoters, described their perceptions regarding a health promotion programme for families with adolescents orphaned as a result of AIDS. Data were collected on the purposively selected participants at the rural Hammanskraal region in South Africa and the research question: ‘What is your perception regarding health promotion programmes for families with adolescents orphaned as a result of AIDS’ was asked and discussed by participants in a focus group interview. Data were analysed using the adapted Tesch method to organize and isolate the main categories, sub-categories and themes. The following main categories were isolated: attitudes of adolescents, effectiveness of home visits, need for health education and limited resources. Based on the findings, it was therefore recommended that health care planners assist in the improvement of health promotion and education by using the community and national media, providing information material and providing access to the internet in order to allow more people, including young people, to access the information. Suid-Afrikaanse gemeenskappe word steeds grootliks beïnvloed deur die hoë vlak van MIV en vigs, soos weerspieël in die algehele nasionale MIV-syfer in 2008 van 29.3% (UNAIDS 2010:10. In die aanspreek van hierdie uitdaging is die gesondheidstelsel afhanklik van gemeenskapsorgwerkers om gesondheidsbevordering
Chen, Xiang; Liu, Xuexiang; Wei, Xiaomou; Meng, Yuming; Liu, Limin; Qin, Shini; Liu, Yanyu; Dai, Shengming
2016-12-01
To comprehensively examine the MICB gene polymorphism and identify its differences in Chinese Yao population from other ethnic groups, we investigated the polymorphism in the 5'-upstream regulation region (5'-URR), coding region (exons 2-4), and the 3'-untranslated region (3'-UTR) of MICB gene by using PCR-SBT method in 125 healthy unrelated Yao individuals in Guangxi Zhuang Autonomous Region. Higher polymorphism was observed in the 5'-URR, nine single nucleotide polymorphisms (SNPs) and a two base pairs deletion at position -139/-138 were found in our study. Only five different variation sites, however, were detected in exons 2-4 and three were observed in the 3'-UTR. The minor allele frequencies of all variants were greater than 5%, except for rs3828916, rs3131639, rs45627734, rs113620316, rs779737471, and the variation at position +11803 in the 3'-UTR. The first nine SNPs of 5'-URR and rs1065075, rs1051788 of the coding region showed significant linkage disequilibrium with each other. Ten different MICB extended haplotypes (EH) encompassing the 5'-URR, exons 2-4, and 3'-UTR were found in this population, and the most frequent was EH1 (23.2%). We provided several evidences for balancing selection effect on the 5'-URR of MICB gene in Yao population. Copyright © 2016 American Society for Histocompatibility and Immunogenetics. Published by Elsevier Inc. All rights reserved.
Smad3 induces atrogin-1, inhibits mTOR and protein synthesis, and promotes muscle atrophy in vivo.
Goodman, Craig A; McNally, Rachel M; Hoffmann, F Michael; Hornberger, Troy A
2013-11-01
Myostatin, a member of the TGF superfamily, is sufficient to induce skeletal muscle atrophy. Myostatin-induced atrophy is associated with increases in E3-ligase atrogin-1 expression and protein degradation and decreases in Akt/mechanistic target of rapamycin (mTOR) signaling and protein synthesis. Myostatin signaling activates the transcription factor Smad3 (Small Mothers Against Decapentaplegic), which has been shown to be necessary for myostatin-induced atrogin-1 expression and atrophy; however, it is not known whether Smad3 is sufficient to induce these events or whether Smad3 simply plays a permissive role. Thus, the aim of this study was to address these questions with an in vivo model. To accomplish this goal, in vivo transfection of plasmid DNA was used to create transient transgenic mouse skeletal muscles, and our results show for the first time that Smad3 expression is sufficient to stimulate atrogin-1 promoter activity, inhibit Akt/mTOR signaling and protein synthesis, and induce muscle fiber atrophy. Moreover, we propose that Akt/mTOR signaling is inhibited by a Smad3-induced decrease in microRNA-29 (miR-29) expression and a subsequent increase in the translation of phosphatase and tensin homolog (PTEN) mRNA. Smad3 is also sufficient to inhibit peroxisome proliferator-activated receptor-γ coactivator-1α (PGC1α) promoter activity and to increase FoxO (Forkhead Box Protein, Subclass O)-mediated signaling and the promoter activity of plasminogen activator inhibitor 1 (PAI-1). Combined, this study provides the first evidence that Smad3 is sufficient to regulate many of the events associated with myostatin-induced atrophy and therefore suggests that Smad3 signaling may be a viable target for therapies aimed at preventing myostatin-induced muscle atrophy.
Hypermethylation of the FANCC and FANCL Promoter Regions in Sporadic Acute Leukaemia
Directory of Open Access Journals (Sweden)
C. J. Hess
2008-01-01
Full Text Available Objective: Inactivation of the FA-BRCA pathway results in chromosomal instability. Fanconi anaemia (FA patients have an inherited defect in this pathway and are strongly predisposed to the development of acute myeloid leukaemia (AML. Studies in sporadic cancers have shown promoter methylation of the FANCF gene in a significant proportion of various solid tumours. However, only a single leukaemic case with methylation of one of the FA-BRCA genes has been described to date, i.e. methylation of FANCF in cell line CHRF-288. We investigated the presence of aberrant methylation in 11 FA-BRCA genes in sporadic cases of leukaemia.
International Nuclear Information System (INIS)
Raccosta, S.; Martorana, V.; Manno, M.; Blanco, M.; Roberts, C.J.
2016-01-01
The role of intermolecular interaction in fibril-forming protein solutions and its relation with molecular conformation are crucial aspects for the control and inhibition of amyloid structures. Here, we study the fibril formation and the protein-protein interactions for two proteins at acidic ph, lysozyme and α-chymotrypsinogen. By using light scattering experiments and the Kirkwood-Buff integral approach, we show how concentration fluctuations are damped even at moderate protein concentrations by the dominant long-ranged electrostatic repulsion, which determines an effective crowded environment. In denaturing conditions, electrostatic repulsion keeps the monomeric solution in a thermodynamically metastable state, which is escaped through kinetically populated conformational sub-states. This explains how electrostatics acts as a gatekeeper in selecting a specific aggregation pathway.
Directory of Open Access Journals (Sweden)
Elvin Shava
2017-11-01
Full Text Available This article examines the implementation of fish farming as an innovative and economic strategy for promoting food security and dietary diversities among vulnerable households in drought risk areas of Zimbabwe. The declining climatic conditions and lack of economic opportunities in Mwenezi district of Zimbabwe attracted the attention of three nongovernmental organisations (NGOs to implement fish farming as an innovative mechanism to stimulate food security and generate employment in the district. The article used a qualitative research approach that includes semi-structured interviews and secondary data. The purposive sampling technique was adopted to interview participants in Mwenezi district who were involved in fish farming to assess and explore the experiences and benefits they derive from such development projects. Results for the article revealed that fish farming was well embraced by local communities as it led to improvements in food security, household income and employment regeneration. The local government including traditional leadership (Chiefs and Headmen’s supported the NGO activities as they benefited local communities. The article concludes that although fish farming was instrumental in regenerating employment, some participants still fail to participate because of laziness and desire to maintain dependency syndrome. The article recommends the NGOs to launch awareness campaigns in rural communities and increase networking with the donor community which is fundamental in attracting sustainable funding. The government can also promote fish farming in vulnerable rural communities by providing funding and capacity building programmes.
Directory of Open Access Journals (Sweden)
Coker Robert H
2012-12-01
Full Text Available Abstract Background Excess adipose tissue and sarcopenia presents a multifaceted clinical challenge that promotes morbidity and mortality in the obese, elderly population. Unfortunately, the mortality risks of muscle loss may outweigh the potential benefits of weight loss in the elderly. We have previously demonstrated the effectiveness of whey protein and essential amino acids towards the preservation of lean tissue, even under the conditions of strict bedrest in the elderly. Methods In the context of caloric restriction-based weight loss, we hypothesized that a similar formulation given as a meal replacement (EAAMR would foster the retention of lean tissue through an increase in the skeletal muscle fractional synthesis rate (FSR. We also proposed that EAAMR would promote the preferential loss of adipose tissue through the increased energy cost of skeletal muscle FSR. We recruited and randomized 12 elderly individuals to an 8 week, caloric restriction diet utilizing equivalent caloric meal replacements (800 kcal/day: 1 EAAMR or a 2 competitive meal replacement (CMR in conjunction with 400 kcal of solid food that totaled 1200 kcal/day designed to induce 7% weight loss. Combined with weekly measurements of total body weight and body composition, we also measured the acute change in the skeletal muscle FSR to EAAMR and CMR. Results By design, both groups lost ~7% of total body weight. While EAAMR did not promote a significant preservation of lean tissue, the reduction in adipose tissue was greater in EAAMR compared to CMR. Interestingly, these results corresponded to an increase in the acute skeletal muscle protein FSR. Conclusion The provision of EAAMR during caloric restriction-induced weight loss promotes the preferential reduction of adipose tissue and the modest loss of lean tissue in the elderly population.
Directory of Open Access Journals (Sweden)
Simrén Magnus
2009-11-01
Full Text Available Abstract Background Oxytocin and the oxytocin receptor have been demonstrated in the gastrointestinal (GI tract and have been shown to exert physiological effects on gut motility. The role for oxytocin in the pathophysiology of GI complaints is unknown. The aim of this study was to examine genetic variations or polymorphism of oxytocin (OXT and its receptor (OXTR genes in patients with GI complaints without visible organic abnormalities. Methods Genetic variants in the OXT promoter region, and in the OXTR gene in DNA samples from 131 rigorously evaluated patients with Irritable Bowel Syndrome (IBS, 408 homozygous subjects referred for lactase (LCT-13910 C>T, rs4988235 genotyping, and 299 asymptomatic blood donors were compared. One polymorphism related to the OXT gene (rs6133010 A>G and 4 related to the OXTR gene (rs1465386 G>T, rs3806675 G>A, rs968389 A>G, rs1042778 G>T were selected for genotyping using Applied Biosystems 7900 HT allele discrimination assays. Results There were no statistically significant differences in the genotype or allele frequencies in any of the SNPs when IBS patients were compared to healthy controls. Among subjects referred for lactase genotyping, the rs6133010 A>G OXT promoter A/G genotype tended to be more common in the 154 non-persistent (27.3% subjects than in the 254 lactase persistant (18.1% subjects and in the healthy controls (19.4% (p = 0.08. When direct comparing, the A/G genotype was less common in the OXT promoter region in controls (p = 0.09 and in subjects with lactase persistence (p = 0.03 compared to subjects with lactase non-persistence. When healthy controls were viewed according to their own LCT-13910 genotypes, the C/C lactase non-persistent controls had a higher frequency for the OXT promoter A/G genotype than LCT-13910 T/T lactase persistent controls (41.2% vs 13.1%. No significant differences in frequencies of the investigated OXTR SNPs were noted in this study. Conclusion The results suggest
Sanz, Ricardo L; Ferraro, Gino B; Girouard, Marie-Pier; Fournier, Alyson E
2017-08-11
IgLONs are members of the immunoglobulin superfamily of cell adhesion proteins implicated in the process of neuronal outgrowth, cell adhesion and subdomain target recognition. IgLONs form homophilic and heterophilic complexes on the cell surface that repress or promote growth depending on the neuronal population, the developmental stage and surface repertoire of IgLON family members. In the present study, we identified a metalloproteinase-dependent mechanism necessary to promote growth in embryonic dorsal root ganglion cells (DRGs). Treatment of embryonic DRG neurons with pan-metalloproteinase inhibitors, tissue inhibitor of metalloproteinase-3, or an inhibitor of ADAM Metallopeptidase Domain 10 (ADAM10) reduces outgrowth from DRG neurons indicating that metalloproteinase activity is important for outgrowth. The IgLON family members Neurotrimin (NTM) and Limbic System-Associated Membrane Protein (LSAMP) were identified as ADAM10 substrates that are shed from the cell surface of DRG neurons. Overexpression of LSAMP and NTM suppresses outgrowth from DRG neurons. Furthermore, LSAMP loss of function decreases the outgrowth sensitivity to an ADAM10 inhibitor. Together our findings support a role for ADAM-dependent shedding of cell surface LSAMP in promoting outgrowth from DRG neurons.
International Nuclear Information System (INIS)
Tao, Yan-Fang; Fang, Fang; Hu, Shao-Yan; Lu, Jun; Cao, Lan; Zhao, Wen-Li; Xiao, Pei-Fang; Li, Zhi-Heng; Wang, Na-Na; Xu, Li-Xiao; Du, Xiao-Juan; Sun, Li-Chao; Li, Yan-Hong; Li, Yi-Ping; Xu, Yun-Yun; Ni, Jian; Wang, Jian; Feng, Xing; Pan, Jian
2015-01-01
Acute myeloid leukemia (AML) is the second-most common form of leukemia in children. Aberrant DNA methylation patterns are a characteristic feature of AML. GATA4 has been suggested to be a tumor suppressor gene regulated by promoter hypermethylation in various types of human cancers although the expression and promoter methylation of GATA4 in pediatric AML is still unclear. Transcriptional expression levels of GATA4 were evaluated by semi-quantitative and real-time PCR. Methylation status was investigated by methylation-specific PCR (MSP) and bisulfate genomic sequencing (BGS). The prognostic significance of GATA4 expression and promoter methylation was assessed in 105 cases of Chinese pediatric acute myeloid leukemia patients with clinical follow-up records. MSP and BGS analysis showed that the GATA4 gene promoter is hypermethylated in AML cells, such as the HL-60 and MV4-11 human myeloid leukemia cell lines. 5-Aza treatment significantly upregulated GATA4 expression in HL-60 and MV4-11 cells. Aberrant methylation of GATA4 was observed in 15.0 % (3/20) of the normal bone marrow control samples compared to 56.2 % (59/105) of the pediatric AML samples. GATA4 transcript levels were significantly decreased in AML patients (33.06 ± 70.94; P = 0.011) compared to normal bone marrow/idiopathic thrombocytopenic purpura controls (116.76 ± 105.39). GATA4 promoter methylation was correlated with patient leukocyte counts (WBC, white blood cells) (P = 0.035) and minimal residual disease MRD (P = 0.031). Kaplan-Meier survival analysis revealed significantly shorter overall survival time in patients with GATA4 promoter methylation (P = 0.014). Epigenetic inactivation of GATA4 by promoter hypermethylation was observed in both AML cell lines and pediatric AML samples; our study implicates GATA4 as a putative tumor suppressor gene in pediatric AML. In addition, our findings imply that GATA4 promoter methylation is correlated with WBC and MRD. Kaplan-Meier survival analysis
Bovine binder-of-sperm protein BSP1 promotes protrusion and nanotube formation from liposomes
International Nuclear Information System (INIS)
Lafleur, Michel; Courtemanche, Lesley; Karlsson, Goeran; Edwards, Katarina; Schwartz, Jean-Louis; Manjunath, Puttaswamy
2010-01-01
Research highlights: → Binder-of-sperm protein 1 (BSP1) modifies the morphology of lipidic vesicles inducing bead necklace-like and thread-like structures. → In the presence of multilamellar liposomes, BSP1 leads to the formation of long nanotubes. → The insertion of BSP1 in the external lipid leaflet of membranes induces local changes in bilayer curvature. -- Abstract: Binder-of-sperm (BSP) proteins interact with sperm membranes and are proposed to extract selectively phosphatidylcholine and cholesterol from these. This change in lipid composition is a key step in sperm capacitation. The present work demonstrates that the interactions between the protein BSP1 and model membranes composed with phosphatidylcholine lead to drastic changes in the morphology of the lipidic self-assemblies. Using cryo-electron microscopy and fluorescence microscopy, we show that, in the presence of the protein, the lipid vesicles elongate, and form bead necklace-like structures that evolve toward small vesicles or thread-like structures. In the presence of multilamellar vesicles, where a large reservoir of lipid is available, the presence of BSP proteins lead to the formation of long nanotubes. Long spiral-like threads, associated with lipid/protein complexes, are also observed. The local curvature of lipid membranes induced by the BSP proteins may be involved in lipid domain formation and the extraction of some lipids during the sperm maturation process.
Hellberg, M E; Moy, G W; Vacquier, V D
2000-03-01
Male-specific proteins have increasingly been reported as targets of positive selection and are of special interest because of the role they may play in the evolution of reproductive isolation. We report the rapid interspecific divergence of cDNA encoding a major acrosomal protein of unknown function (TMAP) of sperm from five species of teguline gastropods. A mitochondrial DNA clock (calibrated by congeneric species divided by the Isthmus of Panama) estimates that these five species diverged 2-10 MYA. Inferred amino acid sequences reveal a propeptide that has diverged rapidly between species. The mature protein has diverged faster still due to high nonsynonymous substitution rates (> 25 nonsynonymous substitutions per site per 10(9) years). cDNA encoding the mature protein (89-100 residues) shows evidence of positive selection (Dn/Ds > 1) for 4 of 10 pairwise species comparisons. cDNA and predicted secondary-structure comparisons suggest that TMAP is neither orthologous nor paralogous to abalone lysin, and thus marks a second, phylogenetically independent, protein subject to strong positive selection in free-spawning marine gastropods. In addition, an internal repeat in one species (Tegula aureotincta) produces a duplicated cleavage site which results in two alternatively processed mature proteins differing by nine amino acid residues. Such alternative processing may provide a mechanism for introducing novel amino acid sequence variation at the amino-termini of proteins. Highly divergent TMAP N-termini from two other tegulines (Tegula regina and Norrisia norrisii) may have originated by such a mechanism.
An evolutionary model for protein-coding regions with conserved RNA structure
DEFF Research Database (Denmark)
Pedersen, Jakob Skou; Forsberg, Roald; Meyer, Irmtraud Margret
2004-01-01
in the RNA structure. The overlap of these fundamental dependencies is sufficient to cause "contagious" context dependencies which cascade across many nucleotide sites. Such large-scale dependencies challenge the use of traditional phylogenetic models in evolutionary inference because they explicitly assume...... components of traditional phylogenetic models. We applied this to a data set of full-genome sequences from the hepatitis C virus where five RNA structures are mapped within the coding region. This allowed us to partition the effects of selection on different structural elements and to test various hypotheses......Here we present a model of nucleotide substitution in protein-coding regions that also encode the formation of conserved RNA structures. In such regions, apparent evolutionary context dependencies exist, both between nucleotides occupying the same codon and between nucleotides forming a base pair...
Kotsaki, Antigoni; Raftogiannis, Maria; Routsi, Christina; Baziaka, Fotini; Kotanidou, Anastasia; Antonopoulou, Anastasia; Orfanos, Stylianos E; Katsenos, Chrisostomos; Koutoukas, Pantelis; Plachouras, Diamantis; Mandragos, Konstantinos; Giamarellos-Bourboulis, Evangelos J
2012-08-01
Debatable findings exist among various studies regarding the impact of single nucleotide polymorphisms (SNPs) within the promoter region of the tumor necrosis factor (TNF) gene for susceptibility to infections. Their impact was investigated in a cohort of mechanically ventilated patients who developed ventilator-associated pneumonia (VAP). Two-hundred and thirteen mechanically ventilated patients who developed VAP were enrolled. Genomic DNA was extracted and SNPs at the -376, -308 and -238 position of the promoter region of the TNF gene were assessed by restriction fragment length polymorphisms. Monocytes were isolated from 47 patients when they developed sepsis and stimulated by bacterial endotoxin for the production of TNFα and of interleukin-6 (IL-6). Patients were divided into two groups; 166 patients bearing only wild-type alleles of all three studied polymorphisms; and 47 patients carrying at least one A allele of the three studied SNPs. Time between start of mechanical ventilation and advent of VAP was significantly shorter in the second group than in the first group (log-rank: 4.416, p: 0.041). When VAP supervened, disease severity did not differ between groups. Stimulation of TNFα and of IL-6 was much greater by monocytes for patients carrying A alleles. Carriage of at least one A allele of the three studied SNPs at the promoter region of the TNF-gene is associated with shorter time to development of VAP but it is not associated with disease severity. Findings may be related with a role of the studied SNPs in the production of pro-inflammatory cytokines. Copyright © 2012 Elsevier Ltd. All rights reserved.
Attey, A; Belyaeva, T; Savery, N; Hoggett, J; Fujita, N; Ishihama, A; Busby, S
1994-10-25
DNAase I footprinting has been used to study open complexes between Escherichia coli RNA polymerase and the galactose operon P1 promoter, both in the absence and the presence of CRP (the cyclic AMP receptor protein, a transcription activator). From the effects of deletion of the C-terminal part of the RNA polymerase alpha subunit, we deduce that alpha binds at the upstream end of both the binary RNA polymerase-galP1 and ternary RNA polymerase-CRP-galP1 complexes. Disruption of the alpha-upstream contact suppresses open complex formation at galP1 at lower temperatures. In ternary RNA polymerase-CRP-galP1 complexes, alpha appears to make direct contact with Activating Region 1 in CRP. DNAase I footprinting has been used to detect and quantify interactions between purified alpha and CRP bound at galP1.
Regional efforts to promote forestry best management practices: a southern success story
Herb Nicholson; John Colberg; Hughes Simpson; Tom Gerow; Wib Owen
2016-01-01
The Southern Group of State Foresters has a long history of water resource protection efforts, providing leadership in BMP development, improvement, and implementation, enhancing state BMP programs, establishing effective partnerships, and standardizing an approach to consistently monitor implementation across the region.
Evaluation of methylation pattern in promoter region of E-cadherin ...
African Journals Online (AJOL)
The epithelial cadherin gene (CDH1) has been identified as a tumor suppressor gene located within the 16q22.1 region. The CDH1 gene encodes a transmembrane glycoprotein involved in cell to cell adhesion and loss of CDH1 expression contributes to increased proliferation, invasion and metastasis in breast carcinoma.
International Nuclear Information System (INIS)
Craft, Willie Warren; Dutch, Rebecca Ellis
2005-01-01
The Hendra virus fusion (HeV F) protein is synthesized as a precursor, F 0 , and proteolytically cleaved into the mature F 1 and F 2 heterodimer, following an HDLVDGVK 109 motif. This cleavage event is required for fusogenic activity. To determine the amino acid requirements for processing of the HeV F protein, we constructed multiple mutants. Individual and simultaneous alanine substitutions of the eight residues immediately upstream of the cleavage site did not eliminate processing. A chimeric SV5 F protein in which the furin site was substituted for the VDGVK 109 motif of the HeV F protein was not processed but was expressed on the cell surface. Another chimeric SV5 F protein containing the HDLVDGVK 109 motif of the HeV F protein underwent partial cleavage. These data indicate that the upstream region can play a role in protease recognition, but is neither absolutely required nor sufficient for efficient processing of the HeV F protein
Sugiyama, Hayami; Takahashi, Kazutoshi; Yamamoto, Takuya; Iwasaki, Mio; Narita, Megumi; Nakamura, Masahiro; Rand, Tim A; Nakagawa, Masato; Watanabe, Akira; Yamanaka, Shinya
2017-01-10
Novel APOBEC1 target 1 (Nat1) (also known as "p97," "Dap5," and "Eif4g2") is a ubiquitously expressed cytoplasmic protein that is homologous to the C-terminal two thirds of eukaryotic translation initiation factor 4G (Eif4g1). We previously showed that Nat1-null mouse embryonic stem cells (mES cells) are resistant to differentiation. In the current study, we found that NAT1 and eIF4G1 share many binding proteins, such as the eukaryotic translation initiation factors eIF3 and eIF4A and ribosomal proteins. However, NAT1 did not bind to eIF4E or poly(A)-binding proteins, which are critical for cap-dependent translation initiation. In contrast, compared with eIF4G1, NAT1 preferentially interacted with eIF2, fragile X mental retardation proteins (FMR), and related proteins and especially with members of the proline-rich and coiled-coil-containing protein 2 (PRRC2) family. We also found that Nat1-null mES cells possess a transcriptional profile similar, although not identical, to the ground state, which is established in wild-type mES cells when treated with inhibitors of the ERK and glycogen synthase kinase 3 (GSK3) signaling pathways. In Nat1-null mES cells, the ERK pathway is suppressed even without inhibitors. Ribosome profiling revealed that translation of mitogen-activated protein kinase kinase kinase 3 (Map3k3) and son of sevenless homolog 1 (Sos1) is suppressed in the absence of Nat1 Forced expression of Map3k3 induced differentiation of Nat1-null mES cells. These data collectively show that Nat1 is involved in the translation of proteins that are required for cell differentiation.
C-terminal region of herpes simplex virus ICP8 protein needed for intranuclear localization
International Nuclear Information System (INIS)
Taylor, Travis J; Knipe, David M.
2003-01-01
The herpes simplex virus single-stranded DNA-binding protein, ICP8, localizes initially to structures in the nucleus called prereplicative sites. As replication proceeds, these sites mature into large globular structures called replication compartments. The details of what signals or proteins are involved in the redistribution of viral and cellular proteins within the nucleus between prereplicative sites and replication compartments are poorly understood; however, we showed previously that the dominant-negative d105 ICP8 does not localize to prereplicative sites and prevents the localization of other viral proteins to prereplicative sites (J. Virol. 74 (2000) 10122). Within the residues deleted in d105 (1083 to 1168), we identified a region between amino acid residues 1080 and 1135 that was predicted by computer models to contain two α-helices, one with considerable amphipathic nature. We used site-specific and random mutagenesis techniques to identify residues or structures within this region that are required for proper ICP8 localization within the nucleus. Proline substitutions in the predicted helix generated ICP8 molecules that did not localize to prereplicative sites and acted as dominant-negative inhibitors. Other substitutions that altered the charged residues in the predicted α-helix to alanine or leucine residues had little or no effect on ICP8 intranuclear localization. The predicted α-helix was dispensable for the interaction of ICP8 with the U L 9 origin-binding protein. We propose that this C-terminal α-helix is required for localization of ICP8 to prereplicative sites by binding viral or cellular factors that target or retain ICP8 at specific intranuclear sites
Koike, Eiko; Yanagisawa, Rie; Takigami, Hidetaka; Takano, Hirohisa
2014-03-01
Polybrominated diphenyl ethers (PBDEs) are widely used as flame retardants in consumer products. Humans can be exposed to PBDEs mainly through the inhalation of air or dust. Thus, PBDEs can affect respiratory and immune systems. In the present study, we investigated whether PBDEs stimulate bronchial epithelial cells. We examined commercial penta-BDE (DE-71), octa-BDE (DE-79), and deca-BDE (DE-83R). Human bronchial epithelial cells (BEAS-2B) were exposed to each PBDE for 24h. Subsequently, the expression of intercellular adhesion molecule-1 (ICAM-1) and proinflammatory cytokines were investigated. DE-71 and DE-79, but not DE-83R, significantly increased the expression of ICAM-1, interleukin-6 (IL-6), and IL-8 in BEAS-2B. Because these remarkable effects were observed with DE-71, we further investigated the underlying intracellular mechanisms. DE-71 promoted epidermal growth factor receptor (EGFR) phosphorylation. Inhibitors of EGFR-selective tyrosine kinase and p38 mitogen-activated protein kinase effectively blocked the increase of IL-6 and IL-8. Furthermore, antagonists of thyroid hormone receptor and aryl hydrocarbon receptor significantly suppressed the increase in IL-6 and/or IL-8 production. In conclusion, penta- and octa-BDE, but not deca-BDE, might promote the expression of proinflammatory proteins in bronchial epithelial cells possibly by activating protein kinases and/or stimulating nuclear receptors related to subsequent activation of transcriptional factors. Copyright © 2013 Elsevier Ltd. All rights reserved.
Directory of Open Access Journals (Sweden)
Anna C. Maurer
2018-05-01
Full Text Available Summary: The adeno-associated virus (AAV vector is a preferred delivery platform for in vivo gene therapy. Natural and engineered variations of the AAV capsid affect a plurality of phenotypes relevant to gene therapy, including vector production and host tropism. Fundamental to these aspects is the mechanism of AAV capsid assembly. Here, the role of the viral co-factor assembly-activating protein (AAP was evaluated in 12 naturally occurring AAVs and 9 putative ancestral capsid intermediates. The results demonstrate increased capsid protein stability and VP-VP interactions in the presence of AAP. The capsid’s dependence on AAP can be partly overcome by strengthening interactions between monomers within the assembly, as illustrated by the transfer of a minimal motif defined by a phenotype-to-phylogeny mapping method. These findings suggest that the emergence of AAP within the Dependovirus genus relaxes structural constraints on AAV assembly in favor of increasing the degrees of freedom for the capsid to evolve. : Maurer et al. describe a phenotype-to-phylogeny mapping strategy correlating phenotypic variation in AAVs to a reconstructed phylogeny, revealing capsid structure-function relationships relevant to that phenotype. Dependence on the viral co-factor AAP for capsid assembly is examined, and capsid functional motifs, in addition to mechanistic roles of AAP, are elucidated. Keywords: AAV, AAP, adeno-associated virus, capsid assembly, manufacturing, capsid, vector engineering, structure-function, gene therapy
Directory of Open Access Journals (Sweden)
Bernd eKuhn
2012-07-01
Full Text Available Recording of identified neuronal network activity using genetically encoded calcium indicators (GECIs requires labeling that is cell type-specific and bright enough for the detection of functional signals. However, specificity and strong expression are often not achievable using the same promoter. Here we present a combinatorial approach for targeted expression and single-cell-level quantification in which a weak promoter is used to drive trans-amplification under a strong general promoter. We demonstrated this approach using recombinant adeno-associated viruses (rAAVs to deliver the sequence of the GECI D3cpv in the mouse cerebellar cortex. Direct expression under the human synapsin promoter (hSYN led to high levels of expression (50-100 µM in five interneuron types of the cerebellar cortex but not in Purkinje cells (PCs (≤10 μM, yielding sufficient contrast to allow functional signals to be recorded from somata and processes in awake animals using two-photon microscopy. When the hSYN promoter was used to drive expression of the tetracycline transactivator (tTA, a second rAAV containing the bidirectional TET promoter (Ptetbi could drive strong D3cpv expression in PCs (10-300 µM, enough to allow reliable complex spike detection in the dendritic arbor. An amplified approach should be of use in monitoring neural processing in selected cell types and boosting expression of optogenetic probes. Additionally, we overcome cell toxicity associated with rAAV injection and/or local GECI overexpression by combining the virus injection with systemic pre-injection of hyperosmotic D-mannitol, and by this double the time window for functional imaging.
DEFF Research Database (Denmark)
Goltermann, Lise; Good, Liam; Bentin, Thomas
2013-01-01
For almost half of a century, we have known that aminoglycoside antibiotics corrupt ribosomes, causing translational misreading, yet it remains unclear whether or not misreading triggers protein misfolding, and possible effects of chaperone action on drug susceptibilities are poorly understood...
Churchward-Venne, Tyler A; Murphy, Caoileann H; Longland, Thomas M; Phillips, Stuart M
2013-08-01
Amino acids are major nutrient regulators of muscle protein turnover. After protein ingestion, hyperaminoacidemia stimulates increased rates of skeletal muscle protein synthesis, suppresses muscle protein breakdown, and promotes net muscle protein accretion for several hours. These acute observations form the basis for strategized protein intake to promote lean mass accretion, or prevent lean mass loss over the long term. However, factors such as protein dose, protein source, and timing of intake are important in mediating the anabolic effects of amino acids on skeletal muscle and must be considered within the context of evaluating the reported efficacy of long-term studies investigating protein supplementation as part of a dietary strategy to promote lean mass accretion and/or prevent lean mass loss. Current research suggests that dietary protein supplementation can augment resistance exercise-mediated gains in skeletal muscle mass and strength and can preserve skeletal muscle mass during periods of diet-induced energy restriction. Perhaps less appreciated, protein supplementation can augment resistance training-mediated gains in skeletal muscle mass even in individuals habitually consuming 'adequate' (i.e., >0.8 g kg⁻¹ day⁻¹) protein. Additionally, overfeeding energy with moderate to high-protein intake (15-25 % protein or 1.8-3.0 g kg⁻¹ day⁻¹) is associated with lean, but not fat mass accretion, when compared to overfeeding energy with low protein intake (5 % protein or ~0.68 g kg⁻¹ day⁻¹). Amino acids represent primary nutrient regulators of skeletal muscle anabolism, capable of enhancing lean mass accretion with resistance exercise and attenuating the loss of lean mass during periods of energy deficit, although factors such as protein dose, protein source, and timing of intake are likely important in mediating these effects.
Directory of Open Access Journals (Sweden)
Bat-Erdene Jugder
2016-07-01
Full Text Available Hydrogenases are metalloenzymes that reversibly catalyse the oxidation or production of molecular hydrogen (H2. Amongst a number of promising candidates for application in the oxidation of H2 is a soluble [Ni–Fe] uptake hydrogenase (SH produced by Cupriavidus necator H16. In the present study, molecular characterisation of the SH operon, responsible for functional SH synthesis, was investigated by developing a green fluorescent protein (GFP reporter system to characterise PSH promoter activity using several gene cloning approaches. A PSH promoter-gfp fusion was successfully constructed and inducible GFP expression driven by the PSH promoter under de-repressing conditions in heterotrophic growth media was demonstrated in the recombinant C. necator H16 cells. Here we report the first successful fluorescent reporter system to study PSH promoter activity in C. necator H16. The fusion construct allowed for the design of a simple screening assay to evaluate PSH activity. Furthermore, the constructed reporter system can serve as a model to develop a rapid fluorescent based reporter for subsequent small-scale process optimisation experiments for SH expression.
Constraints on lateral gene transfer in promoting fimbrial usher protein diversity and function.
Stubenrauch, Christopher J; Dougan, Gordon; Lithgow, Trevor; Heinz, Eva
2017-11-01
Fimbriae are long, adhesive structures widespread throughout members of the family Enterobacteriaceae. They are multimeric extrusions, which are moved out of the bacterial cell through an integral outer membrane protein called usher. The complex folding mechanics of the usher protein were recently revealed to be catalysed by the membrane-embedded translocation and assembly module (TAM). Here, we examine the diversity of usher proteins across a wide range of extraintestinal (ExPEC) and enteropathogenic (EPEC) Escherichia coli , and further focus on a so far undescribed chaperone-usher system, with this usher referred to as UshC. The fimbrial system containing UshC is distributed across a discrete set of EPEC types, including model strains like E2348/67, as well as ExPEC ST131, currently the most prominent multi-drug-resistant uropathogenic E. coli strain worldwide. Deletion of the TAM from a naive strain of E. coli results in a drastic time delay in folding of UshC, which can be observed for a protein from EPEC as well as for two introduced proteins from related organisms, Yersinia and Enterobacter We suggest that this models why the TAM machinery is essential for efficient folding of proteins acquired via lateral gene transfer. © 2017 The Authors.
Directory of Open Access Journals (Sweden)
L.H. Manfredi
2017-10-01
Full Text Available Myostatin is a novel negative regulator of skeletal muscle mass. Myostatin expression is also found in heart in a much less extent, but it can be upregulated in pathological conditions, such as heart failure. Myostatin may be involved in inhibiting protein synthesis and/or increasing protein degradation in skeletal and cardiac muscles. Herein, we used cell cultures and isolated muscles from rats to determine protein degradation and synthesis. Muscles incubated with myostatin exhibited an increase in proteolysis with an increase of Atrogin-1, MuRF1 and LC3 genes. Extensor digitorum longus muscles and C2C12 myotubes exhibited a reduction in protein turnover. Cardiomyocytes showed an increase in proteolysis by activating autophagy and the ubiquitin proteasome system, and a decrease in protein synthesis by decreasing P70S6K. The effect of myostatin on protein metabolism is related to fiber type composition, which may be associated to the extent of atrophy mediated effect of myostatin on muscle.
Lee, Catherine A.; Silva, Milton; Siber, Andrew M.; Kelly, Aaron J.; Galyov, Edouard; McCormick, Beth A.
2000-01-01
In response to Salmonella typhimurium, the intestinal epithelium generates an intense inflammatory response consisting largely of polymorphonuclear leukocytes (neutrophils, PMN) migrating toward and ultimately across the epithelial monolayer into the intestinal lumen. It has been shown that bacterial-epithelial cell interactions elicit the production of inflammatory regulators that promote transepithelial PMN migration. Although S. typhimurium can enter intestinal ...
Directory of Open Access Journals (Sweden)
VIVIAN WILHELM
2003-01-01
Full Text Available The genes encoding the heat shock proteins HSP10 and HSP16 of the salmon pathogen Piscirickettsia salmonis have been isolated and sequenced. The HSP10 coding sequence is located in an open reading frame of 291 base pairs encoding 96 aminoacids. The HSP16 coding region was isolated as a 471 base pair fragment encoding a protein of 156 aminoacids. The deduced aminoacid sequences of both proteins show a significant homology to the respective protein from other prokaryotic organisms. Both proteins were expressed in E. coli as fusion proteins with thioredoxin and purified by chromatography on Ni-column. A rabbit serum against P. salmonis total proteins reacts with the recombinant HSP10 and HSP16 proteins. Similar reactivity was determined by ELISA using serum from salmon infected with P. salmonis. The possibility of formulating a vaccine containing these two proteins is discussed
Preliminary structural studies on the leucine-zipper homology region of the human protein Bap31
Energy Technology Data Exchange (ETDEWEB)
Mukasa, Takashi; Santelli, Eugenio [Program on Infectious Diseases, Center for Inflammation and Infectious Diseases, The Burnham Institute for Medical Research, 10901 North Torrey Pines Road, La Jolla, CA 92037 (United States); Reed, John C. [Program on Apoptosis, Cancer Center, The Burnham Institute for Medical Research, 10901 North Torrey Pines Road, La Jolla, CA 92037 (United States); Pascual, Jaime, E-mail: pascual@burnham.org [Program on Infectious Diseases, Center for Inflammation and Infectious Diseases, The Burnham Institute for Medical Research, 10901 North Torrey Pines Road, La Jolla, CA 92037 (United States)
2007-04-01
A leucine-zipper with properties as apoptotic regulator in the ER has been crystallized. X-ray data to 2.5 Å resolution were collected, molecular replacement solutions were identified and refinement has been started. B-cell receptor-associated protein 31 (Bap31) is an integral membrane protein located in the endoplasmic reticulum (ER) that participates in the transport and quality control of membrane proteins and plays a role in determining cell sensitivity to ER stress and apoptosis. Its cytoplasmic region contains two target sites for caspase cleavage in certain apoptotic pathways. Here, the subcloning, expression, purification and crystallization of the Homo sapiens Bap31 leucine-zipper C-terminal fragment, which spans residues Gly160–Glu246, are reported. An N-terminally His-tagged protein was overexpressed in Escherichia coli and purified by chromatographic methods. X-ray diffraction data were collected in-house to 2.5 Å resolution. Crystals belong to space group P6{sub 1}22/P6{sub 5}22, with unit-cell parameters a = b = 70.7, c = 80.6 Å. Data analysis indicates the presence of one molecule per asymmetric unit.
Preliminary structural studies on the leucine-zipper homology region of the human protein Bap31
International Nuclear Information System (INIS)
Mukasa, Takashi; Santelli, Eugenio; Reed, John C.; Pascual, Jaime
2007-01-01
A leucine-zipper with properties as apoptotic regulator in the ER has been crystallized. X-ray data to 2.5 Å resolution were collected, molecular replacement solutions were identified and refinement has been started. B-cell receptor-associated protein 31 (Bap31) is an integral membrane protein located in the endoplasmic reticulum (ER) that participates in the transport and quality control of membrane proteins and plays a role in determining cell sensitivity to ER stress and apoptosis. Its cytoplasmic region contains two target sites for caspase cleavage in certain apoptotic pathways. Here, the subcloning, expression, purification and crystallization of the Homo sapiens Bap31 leucine-zipper C-terminal fragment, which spans residues Gly160–Glu246, are reported. An N-terminally His-tagged protein was overexpressed in Escherichia coli and purified by chromatographic methods. X-ray diffraction data were collected in-house to 2.5 Å resolution. Crystals belong to space group P6 1 22/P6 5 22, with unit-cell parameters a = b = 70.7, c = 80.6 Å. Data analysis indicates the presence of one molecule per asymmetric unit
Wang, Yajie; Wu, Fengyi; Pan, Haining; Zheng, Wenzhong; Feng, Chi; Wang, Yunfu; Deng, Zixin; Wang, Lianrong; Luo, Jie; Chen, Shi
2016-02-29
Alzheimer's disease (AD) is characterized by amyloid-β (Aβ) deposition in the brain. Aβ plaques are produced through sequential β/γ cleavage of amyloid precursor protein (APP), of which there are three main APP isoforms: APP695, APP751 and APP770. KPI-APPs (APP751 and APP770) are known to be elevated in AD, but the reason remains unclear. Transcription activator-like (TAL) effector nucleases (TALENs) induce mutations with high efficiency at specific genomic loci, and it is thus possible to knock out specific regions using TALENs. In this study, we designed and expressed TALENs specific for the C-terminus of APP in HeLa cells, in which KPI-APPs are predominantly expressed. The KPI-APP mutants lack a 12-aa region that encompasses a 5-aa trans-membrane (TM) region and 7-aa juxta-membrane (JM) region. The mutated KPI-APPs exhibited decreased mitochondrial localization. In addition, mitochondrial morphology was altered, resulting in an increase in spherical mitochondria in the mutant cells through the disruption of the balance between fission and fusion. Mitochondrial dysfunction, including decreased ATP levels, disrupted mitochondrial membrane potential, increased ROS generation and impaired mitochondrial dehydrogenase activity, was also found. These results suggest that specific regions of KPI-APPs are important for mitochondrial localization and function.
Epigenetic changes within the promoter region of the HLA-G gene in ovarian tumors
Directory of Open Access Journals (Sweden)
Matyunina Lilya V
2008-05-01
Full Text Available Abstract Background Previous findings have suggested that epigenetic-mediated HLA-G expression in tumor cells may be associated with resistance to host immunosurveillance. To explore the potential role of DNA methylation on HLA-G expression in ovarian cancer, we correlated differences in HLA-G expression with methylation changes within the HLA-G regulatory region in an ovarian cancer cell line treated with 5-aza-deoxycytidine (5-aza-dC and in malignant and benign ovarian tumor samples and ovarian surface epithelial cells (OSE isolated from patients with normal ovaries. Results A region containing an intact hypoxia response element (HRE remained completely methylated in the cell line after treatment with 5-aza-dC and was completely methylated in all of the ovarian tumor (malignant and benign samples examined, but only variably methylated in normal OSE samples. HLA-G expression was significantly increased in the 5-aza-dC treated cell line but no significant difference was detected between the tumor and OSE samples examined. Conclusion Since HRE is the binding site of a known repressor of HLA-G expression (HIF-1, we hypothesize that methylation of the region surrounding the HRE may help maintain the potential for expression of HLA-G in ovarian tumors. The fact that no correlation exists between methylation and HLA-G gene expression between ovarian tumor samples and OSE, suggests that changes in methylation may be necessary but not sufficient for HLA-G expression in ovarian cancer.
Directory of Open Access Journals (Sweden)
Cleidson Nogueira Dias
2014-12-01
Full Text Available This research paper examines the importance of inter-organizational network management as a government policy tool to promote regional development. This pattern requires Federal Government intervention so as to compensate for the imbalance that this causes and to guarantee that economic growth resulting from government actions leads to development in all regions of the country, thereby avoiding the traditional mechanisms of wealth concentration. For this, a methodology of content analysis was used based on a relevant public policy aimed at promoting development within Brazil and by analyzing the data collected in relation to the current theory related to strategy, local development and inter-organizational networks in general. The analysis results show that, when the policy studied in this work, applied in the federal network of professional education, science & technology, was implemented the networks had a positive influence on the outcome of the policy objectives and represented an extremely powerful support tool, being one of the most important factors to boost development.
Saeed, Sadia; Tremp, Annie Z; Dessens, Johannes T
2012-10-01
Malaria parasites express a conserved family of LCCL-lectin adhesive-like domain proteins (LAPs) that have essential functions in sporozoite transmission. In Plasmodium falciparum all six family members are expressed in gametocytes and form a multi-protein complex. Intriguingly, knockout of P. falciparum LCCL proteins adversely affects expression of other family members at protein, but not at mRNA level, a phenomenon termed co-dependent expression. Here, we investigate this in Plasmodium berghei by crossing a PbLAP1 null mutant parasite with a parasite line expressing GFP-tagged PbLAP3 that displays strong fluorescence in gametocytes. Selected and validated double mutants show normal synthesis and subcellular localization of PbLAP3::GFP. However, GFP-based fluorescence is dramatically reduced without PbLAP1 present, indicating that PbLAP1 and PbLAP3 interact. Moreover, absence of PbLAP1 markedly reduces the half-life of PbLAP3, consistent with a scenario of misfolding. These findings unveil a potential mechanism of conformational interdependence that facilitates assembly and stability of the functional LCCL protein complex. Copyright © 2012 Elsevier B.V. All rights reserved.
Markov analysis of alpha-helical, beta-sheet and random coil regions of proteins
International Nuclear Information System (INIS)
Macchiato, M.; Tramontano, A.
1983-01-01
The rules up to now used to predict the spatial configuration of proteins from their primary structure are mostly based on the recurrence analysis of some doublets, triplets and so on of contiguous amino acids, but they do not take into account the correlation characteristics of the whole amino acid sequence. A statistical analysis of amino acid sequences for the alpha-helical, beta-sheet and random coil regions of about twenty proteins with known secondary structure by considering correlations effects has been carried out. The obtained results demonstrate that these sequences are at least a second-order Markov chain, i.e. they appear as if they were generated by a source that remembers at least the two aminoacids before the one being generated and that these two previous symbols influence the present choice
Export Promotion Aims and Reality: A Comparison of the Iberian, Baltic and Central European Region
Directory of Open Access Journals (Sweden)
Éltető Andrea
2017-06-01
Full Text Available As a consequence of the international crisis in 2008-2009, the role of exports in economic growth came into focus in most countries. Exports of EU Member States gained momentum from 2010 onward but with certain changes in their structure and direction. In several countries, the turn towards non-EU areas, such as China or Latin America was part of the state export strategy. On the one hand, our article describes these foreign trade strategies and their institutional framework of the Iberian, Baltic and Central European governments, detecting possible similarities. On the other hand, we analyse recent export data. This way we can get a picture on the structure and direction of exports of periphery economies and this can be compared to the aims of the given states. Our hypothesis is that there is a gap between the reality and the intentions of the governments. The size of this gap varies and is influenced by certain factors such as the different involvement of multinational companies in foreign trade or the different economic structure of these countries. In our paper we list which countries adopted a government strategy and with what aim. We provide a short literature review on state trade promotion policies and discuss these policies and their institutions in the Baltic, Visegrád and Iberian countries.
Directory of Open Access Journals (Sweden)
Shane D. Sykes
2015-01-01
Full Text Available The intrauterine renin angiotensin system (RAS is implicated in placentation and labour onset. Here we investigate whether promoter methylation of RAS genes changes with gestation or labour and if it affects gene expression. Early gestation amnion and placenta were studied, as were term amnion, decidua, and placenta collected before labour (at elective caesarean section or after spontaneous labour and delivery. The expression and degree of methylation of the prorenin receptor (ATP6AP2, angiotensin converting enzyme (ACE, angiotensin II type 1 receptor (AGTR1, and two proteases that can activate prorenin (kallikrein, KLK1, and cathepsin D, CTSD were measured by qPCR and a DNA methylation array. There was no effect of gestation or labour on the methylation of RAS genes and CTSD. Amnion and decidua displayed strong correlations between the percent hypermethylation of RAS genes and CTSD, suggestive of global methylation. There were no correlations between the degree of methylation and mRNA abundance of any genes studied. KLK1 was the most methylated gene and the proportion of hypermethylated KLK1 alleles was lower in placenta than decidua. The presence of intermediate methylated alleles of KLK1 in early gestation placenta and in amnion after labour suggests that KLK1 methylation is uniquely dynamic in these tissues.
International Nuclear Information System (INIS)
Kayaalti, Zeliha; Mergen, Goerkem; Soeylemezoglu, Tuelin
2010-01-01
Metallothioneins (MTs) are metal-binding, low molecular weight proteins and are involved in pathophysiological processes like metabolism of essential metals, metal ion homeostasis and detoxification of heavy metals. Metallothionein expression is induced by various heavy metals especially cadmium, mercury and zinc; MTs suppress toxicity of heavy metals by binding themselves to these metals. The aim of this study was to investigate the association between the - 5 A/G metallothionein 2A (MT2A) single nucleotide polymorphism (SNP) and Cd, Zn and Cu levels in the renal cortex from autopsy cases. MT2A core promoter region - 5 A/G SNP was analyzed by PCR-RFLP method using 114 autopsy kidney tissues and the genotype frequencies of this polymorphism were found as 87.7% homozygote typical (AA), 11.4% heterozygote (AG) and 0.9% homozygote atypical (GG). In order to assess the Cd, Zn and Cu levels in the same autopsy kidney tissues, a dual atomic absorption spectrophotometer system was used and the average levels of Cd, Zn and Cu were measured as 95.54 ± 65.58 μg/g, 181.20 ± 87.72 μg/g and 17.14 ± 16.28 μg/g, respectively. As a result, no statistical association was found between the - 5 A/G SNP in the MT2A gene and the Zn and Cu levels in the renal cortex (p > 0.05), but considerably high accumulation of Cd was monitored for individuals having AG (151.24 ± 60.21 μg/g) and GG genotypes (153.09 μg/g) compared with individuals having AA genotype (87.72 ± 62.98 μg/g) (p < 0.05). These results show that the core promoter region polymorphism of metallothionein 2A increases the accumulation of Cd in human renal cortex.
El-Awa, Fatimah M S; El Naga, Randa Abou; Labib, Sahar; Latif, Nisreen Abdel
2018-04-05
Tobacco use and placement of tobacco products in television (TV) productions and movies is a way to promote tobacco use while avoiding tobacco advertising bans that exist in most countries. The fact that such productions are broadcast widely and viewed by millions, including children and young people, is of concern. This paper reviews the evidence on the use of tobacco advertising, promotion and sponsorship (TAPS) in TV and films in the Eastern Mediterranean Region and the ways to combat it. Evidence from Egypt shows considerable and increasing use of tobacco products by actors on screen, including female actors, in programmes aired during Ramadan in 2015-2017. A study of Iranian movies in 2015 showed that tobacco scenes in Iranian movies were increasing. In 2014, the WHO Regional Office for the Eastern Mediterranean held a consultative meeting on TAPS in drama. The consultation recommended regulating the tobacco presence in movies and TV through complete implementation of Article 13 of the WHO FCTC, and raising the issue to the WHO FCTC Conference of the Parties. In 2016, the Conference of the Parties called on parties to consider scaling up the implementation of WHO FCTC Article 13 and monitoring the use of TAPS in entertainment media in accordance with national legislation. A comprehensive approach is essential to end the tobacco industry's use of TV productions and movies to promote their products. Copyright © World Health Organization (WHO) 2018. Some rights reserved. This work is available under the CC BY-NC-SA 3.0 IGO license (https://creativecommons.org/licenses/by-nc-sa/3.0/igo).
OPAL: prediction of MoRF regions in intrinsically disordered protein sequences.
Sharma, Ronesh; Raicar, Gaurav; Tsunoda, Tatsuhiko; Patil, Ashwini; Sharma, Alok
2018-06-01
Intrinsically disordered proteins lack stable 3-dimensional structure and play a crucial role in performing various biological functions. Key to their biological function are the molecular recognition features (MoRFs) located within long disordered regions. Computationally identifying these MoRFs from disordered protein sequences is a challenging task. In this study, we present a new MoRF predictor, OPAL, to identify MoRFs in disordered protein sequences. OPAL utilizes two independent sources of information computed using different component predictors. The scores are processed and combined using common averaging method. The first score is computed using a component MoRF predictor which utilizes composition and sequence similarity of MoRF and non-MoRF regions to detect MoRFs. The second score is calculated using half-sphere exposure (HSE), solvent accessible surface area (ASA) and backbone angle information of the disordered protein sequence, using information from the amino acid properties of flanks surrounding the MoRFs to distinguish MoRF and non-MoRF residues. OPAL is evaluated using test sets that were previously used to evaluate MoRF predictors, MoRFpred, MoRFchibi and MoRFchibi-web. The results demonstrate that OPAL outperforms all the available MoRF predictors and is the most accurate predictor available for MoRF prediction. It is available at http://www.alok-ai-lab.com/tools/opal/. ashwini@hgc.jp or alok.sharma@griffith.edu.au. Supplementary data are available at Bioinformatics online.
Different regions of the newcastle disease virus fusion protein modulate pathogenicity.
Directory of Open Access Journals (Sweden)
Sandra Heiden
Full Text Available Newcastle disease virus (NDV, also designated as Avian paramyxovirus type 1 (APMV-1, is the causative agent of a notifiable disease of poultry but it exhibits different pathogenicity dependent on the virus strain. The molecular basis for this variability is not fully understood. The efficiency of activation of the fusion protein (F is determined by presence or absence of a polybasic amino acid sequence at an internal proteolytic cleavage site which is a major determinant of NDV virulence. However, other determinants of pathogenicity must exist since APMV-1 of high (velogenic, intermediate (mesogenic and low (lentogenic virulence specify a polybasic F cleavage site. We aimed at elucidation of additional virulence determinants by constructing a recombinant virus that consists of a lentogenic NDV Clone 30 backbone and the F protein gene from a mesogenic pigeon paramyxovirus-1 (PPMV-1 isolate with an intracerebral pathogenicity index (ICPI of 1.1 specifying the polybasic sequence R-R-K-K-R*F motif at the cleavage site. The resulting virus was characterized by an ICPI of 0.6, indicating a lentogenic pathotype. In contrast, alteration of the cleavage site G-R-Q-G-R*L of the lentogenic Clone 30 to R-R-K-K-R*F resulted in a recombinant virus with an ICPI of 1.36 which was higher than that of parental PPMV-1. Substitution of different regions of the F protein of Clone 30 by those of PPMV-1, while maintaining the polybasic amino acid sequence at the F cleavage site, resulted in recombinant viruses with ICPIs ranging from 0.59 to 1.36 suggesting that virulence is modulated by regions of the F protein other than the polybasic cleavage site.
Cloning and analysis of the promoter region of the human fibronectin gene
International Nuclear Information System (INIS)
Dean, D.C.; Bowlus, C.L.; Bourgeois, S.
1987-01-01
Human fibronectin (FN) genomic clones were isolated by screening a human genomic library with a 75-base oligonucleotide. The sequence of the oligonucleotide corresponds to a region near the 5' end of the human FN cDNA clone pFH6 that contains the amino-terminal coding sequences but does not extend to the 5' end of the mRNA. The 5' end of the FN gene is found on a 3.7-kilobase-pair EcoRI fragment that contains about 2.7 kilobase pairs of flanking sequence. The first exon is 414 base pairs long, with a 5' untranslated region of 267 base pairs. As deduced on the basis of the position of the initiation codon, FN is synthesized with a 31-residue amino acid extension on the amion terminus that is not present in the mature polypeptide. This amino-terminal extension appears to contain both a signal peptide and a propeptide. The first 200 base pairs of 5'-flanking sequence is very G+C rich. Upstream of this the sequence becomes relatively A+T rich. The sequence ATATAA is found at -25 and the sequence CAAT is present at -150. The sequence GGGGCGGGGC at -102 exhibits homology to the binding site for the transcription factor SP1, and the sequence TGACGTCA at -173 exhibits homology to 5'-flanking sequences important for induction by cAMP
The metastasis-promoting S100A4 protein confers neuroprotection in brain injury
DEFF Research Database (Denmark)
Dmytriyeva, Oksana; Pankratova, Stanislava; Owczarek, Sylwia
2012-01-01
and downregulating the neuroprotective protein metallothionein I+II. We identify two neurotrophic motifs in S100A4 and show that these motifs are neuroprotective in animal models of brain trauma. Finally, we find that S100A4 rescues neurons via the Janus kinase/STAT pathway and, partially, the interleukin-10......Identification of novel pro-survival factors in the brain is paramount for developing neuroprotective therapies. The multifunctional S100 family proteins have important roles in many human diseases and are also upregulated by brain injury. However, S100 functions in the nervous system remain...... unclear. Here we show that the S100A4 protein, mostly studied in cancer, is overexpressed in the damaged human and rodent brain and released from stressed astrocytes. Genetic deletion of S100A4 exacerbates neuronal loss after brain trauma or excitotoxicity, increasing oxidative cell damage...
Montoya, Gonzalo; Arenas, Jesús; Romo, Enrique; Zeichner-David, Margarita; Alvarez, Marco; Narayanan, A Sampath; Velázquez, Ulises; Mercado, Gabriela; Arzate, Higinio
2014-12-01
Cementum extracellular matrix is similar to other mineralized tissues; however, this unique tissue contains molecules only present in cementum. A cDNA of these molecules, cementum attachment protein (hrPTPLa/CAP) was cloned and expressed in a prokaryotic system. This molecule is an alternative splicing of protein tyrosine phosphatase-like A (PTPLa). In this study, we wanted to determine the structural and functional characteristics of this protein. Our results indicate that hrPTPLa/CAP contains a 43.2% α-helix, 8.9% β-sheet, 2% β-turn and 45.9% random coil secondary structure. Dynamic light scattering shows that this molecule has a size distribution of 4.8 nm and aggregates as an estimated mass of 137 kDa species. AFM characterization and FE-SEM studies indicate that this protein self-assembles into nanospheres with sizes ranging from 7.0 to 27 nm in diameter. Functional studies demonstrate that hrPTPLa/CAP promotes hydroxyapatite crystal nucleation: EDS analysis revealed that hrPTPLa/CAP-induced crystals had a 1.59 ± 0.06 Ca/P ratio. Further confirmation with MicroRaman spectrometry and TEM confirm the presence of hydroxyapatite. In vivo studies using critical-size defects in rat cranium showed that hrPTPLa/CAP promoted 73% ± 2.19% and 87% ± 1.97% new bone formation at 4 and 8 weeks respectively. Although originally identified in cementum, PTPLa/CAP is very effective at inducing bone repair and healing and therefore this novel molecule has a great potential to be used for mineralized tissue bioengineering and tissue regeneration. Copyright © 2014 Elsevier Inc. All rights reserved.
Kosmotropic anions promote conversion of recombinant prion protein into a PrPSc-like misfolded form.
Directory of Open Access Journals (Sweden)
Rodrigo Diaz-Espinoza
Full Text Available Prions are self-propagating proteins involved in transmissible spongiform encephalopaties in mammals. An aberrant conformation with amyloid-like features of a cell surface protein, termed prion protein (PrP, is thought to be the essential component of the infectious particle, though accessory co-factor molecules such as lipids and nucleotides may be involved. The cellular co-factors and environmental conditions implicated in PrP misfolding are not completely understood. To address this issue, several studies have been done inducing misfolding of recombinant PrP (recPrP into classical amyloid structures using partially denaturing conditions. In this work, we report that misfolding of recPrP into PrP(Sc-like aggregates can be induced by simply incubating the protein in the presence of kosmotropic salts at concentrations that are known to retain or increase the stability of the protein. We used a simple experimental reaction (protein, buffer and salts submitted to agitation/incubation cycles at physiological temperature and pH. The formation of protease resistant-recPrP was time and salt-concentration dependent and required the presence of kosmotropic anions such as F(- or SO(4(-2. The molecular weights of the protease resistant recPrP fragments are reminiscent of those found in degradation assays of bona fide PrP(Sc. The aggregates also exhibited PrP(Sc-like ultrastructural features including rod-shape morphology under electron microscope, high beta-sheet content and thioflavin-T positive signal. The formation of recPrP aggregates with PrP(Sc biochemical features under conditions closer to physiological in the absence of organic co-factor molecules provides a simple setup that may prove helpful to understand the molecular mechanism of PrP misfolding.
Bøhle, Liv Anette; Brede, Dag Anders; Diep, Dzung B; Holo, Helge; Nes, Ingolf F
2010-11-01
The intestinal flora of mammals contains lactic acid bacteria (LAB) that may provide positive health effects for the host. Such bacteria are referred to as probiotic bacteria. From a pig, we have isolated a Lactobacillus reuteri strain that produces an antimicrobial peptide (AMP). The peptide was purified and characterized, and it was unequivocally shown that the AMP was a well-defined degradation product obtained from the mucus adhesion-promoting protein (MapA); it was therefore termed AP48-MapA. This finding demonstrates how large proteins might inherit unexpected pleiotropic functions by conferring antimicrobial capacities on the producer. The MapA/AP48-MapA system is the first example where a large protein of an intestinal LAB is shown to give rise to such an AMP. It is also of particular interest that the protein that provides this AMP is associated with the binding of the bacterium producing it to the surface/lining of the gut. This finding gives us new perspective on how some probiotic bacteria may successfully compete in this environment and thereby contribute to a healthy microbiota.
Bøhle, Liv Anette; Brede, Dag Anders; Diep, Dzung B.; Holo, Helge; Nes, Ingolf F.
2010-01-01
The intestinal flora of mammals contains lactic acid bacteria (LAB) that may provide positive health effects for the host. Such bacteria are referred to as probiotic bacteria. From a pig, we have isolated a Lactobacillus reuteri strain that produces an antimicrobial peptide (AMP). The peptide was purified and characterized, and it was unequivocally shown that the AMP was a well-defined degradation product obtained from the mucus adhesion-promoting protein (MapA); it was therefore termed AP48-MapA. This finding demonstrates how large proteins might inherit unexpected pleiotropic functions by conferring antimicrobial capacities on the producer. The MapA/AP48-MapA system is the first example where a large protein of an intestinal LAB is shown to give rise to such an AMP. It is also of particular interest that the protein that provides this AMP is associated with the binding of the bacterium producing it to the surface/lining of the gut. This finding gives us new perspective on how some probiotic bacteria may successfully compete in this environment and thereby contribute to a healthy microbiota. PMID:20833791
Yan, Wang; Chen, Zhao-Ying; Chen, Jia-Qi; Chen, Hui-Min
2018-02-19
Long non-coding RNA nuclear paraspeckle assembly transcript 1 (lncRNA NEAT1) was found to be closely related to the pathological changes in brain and nervous system. However, the role of NEAT1 and its potential mechanism in Parkinson's disease (PD) largely remain uncharacterized. In this study, PD mouse model was established by intraperitoneal injection of MPTP. The numbers of TH + neurons, NEAT1 expression and the level of PINK1, LC3-II, LC3-I protein were assessed in PD mice. SH-SY5Y cells were treated with MPP + as PD cell model. RNA pull-down assay was used to identify the interaction between NEAT1 and PINK1 in vitro. The endogenous expression of NEAT1 was modified by lentiviral vector carrying interference sequence for NEAT1 in vivo. The numbers of TH + neurons significantly decreased in PD mice compared with the control. The expressions of NEAT1, PINK1 protein and LC3-II/LC3-I level were increased by MPTP in vitro and in vivo. Moreover, NEAT1 positively regulated the protein level of PINK1 through inhibition of PINK1 protein degradation. And NEAT1 mediated the effects of MPP + on SH-SY5Y cells through stabilization of PINK1 protein. The results of in vivo experiments revealed that NEAT1 knockdown could effectively suppress MPTP-induced autophagy in vivo that alleviated dopaminergic neuronal injury. LncRNA NEAT1 promoted the MPTP-induced autophagy in PD through stabilization of PINK1 protein. Copyright © 2017 Elsevier Inc. All rights reserved.
Ikegami, Tetsuro; Narayanan, Krishna; Won, Sungyong; Kamitani, Wataru; Peters, C J; Makino, Shinji
2009-02-01
Rift Valley fever virus (RVFV) (genus Phlebovirus, family Bunyaviridae) is a negative-stranded RNA virus with a tripartite genome. RVFV is transmitted by mosquitoes and causes fever and severe hemorrhagic illness among humans, and fever and high rates of abortions in livestock. A nonstructural RVFV NSs protein inhibits the transcription of host mRNAs, including interferon-beta mRNA, and is a major virulence factor. The present study explored a novel function of the RVFV NSs protein by testing the replication of RVFV lacking the NSs gene in the presence of actinomycin D (ActD) or alpha-amanitin, both of which served as a surrogate of the host mRNA synthesis suppression function of the NSs. In the presence of the host-transcriptional inhibitors, the replication of RVFV lacking the NSs protein, but not that carrying NSs, induced double-stranded RNA-dependent protein kinase (PKR)-mediated eukaryotic initiation factor (eIF)2alpha phosphorylation, leading to the suppression of host and viral protein translation. RVFV NSs promoted post-transcriptional downregulation of PKR early in the course of the infection and suppressed the phosphorylated eIF2alpha accumulation. These data suggested that a combination of RVFV replication and NSs-induced host transcriptional suppression induces PKR-mediated eIF2alpha phosphorylation, while the NSs facilitates efficient viral translation by downregulating PKR and inhibiting PKR-mediated eIF2alpha phosphorylation. Thus, the two distinct functions of the NSs, i.e., the suppression of host transcription, including that of type I interferon mRNAs, and the downregulation of PKR, work together to prevent host innate antiviral functions, allowing efficient replication and survival of RVFV in infected mammalian hosts.
Directory of Open Access Journals (Sweden)
Tetsuro Ikegami
2009-02-01
Full Text Available Rift Valley fever virus (RVFV (genus Phlebovirus, family Bunyaviridae is a negative-stranded RNA virus with a tripartite genome. RVFV is transmitted by mosquitoes and causes fever and severe hemorrhagic illness among humans, and fever and high rates of abortions in livestock. A nonstructural RVFV NSs protein inhibits the transcription of host mRNAs, including interferon-beta mRNA, and is a major virulence factor. The present study explored a novel function of the RVFV NSs protein by testing the replication of RVFV lacking the NSs gene in the presence of actinomycin D (ActD or alpha-amanitin, both of which served as a surrogate of the host mRNA synthesis suppression function of the NSs. In the presence of the host-transcriptional inhibitors, the replication of RVFV lacking the NSs protein, but not that carrying NSs, induced double-stranded RNA-dependent protein kinase (PKR-mediated eukaryotic initiation factor (eIF2alpha phosphorylation, leading to the suppression of host and viral protein translation. RVFV NSs promoted post-transcriptional downregulation of PKR early in the course of the infection and suppressed the phosphorylated eIF2alpha accumulation. These data suggested that a combination of RVFV replication and NSs-induced host transcriptional suppression induces PKR-mediated eIF2alpha phosphorylation, while the NSs facilitates efficient viral translation by downregulating PKR and inhibiting PKR-mediated eIF2alpha phosphorylation. Thus, the two distinct functions of the NSs, i.e., the suppression of host transcription, including that of type I interferon mRNAs, and the downregulation of PKR, work together to prevent host innate antiviral functions, allowing efficient replication and survival of RVFV in infected mammalian hosts.
Efforts to promote regional security dialogue and cooperation in the North Pacific
International Nuclear Information System (INIS)
Mason, P.
1994-01-01
Indifference to the new realities of the post-cold war era does nothing to preserve the traditional priorities laid down in the Final Document of the first special session on disarmament. On the contrary, such attitudes directly contribute to the trend towards marginalization which began when publics no longer feared the threat of a nuclear holocaust. It is believed that the expertise of forty years of multilateral arms control and disarmament efforts is directly relevant to the broader efforts of the international community to restore, maintain and promote international peace and security. Who can deny that confidence-building is central to preventive diplomacy? Or that the arms control component-from disarming to demobilization-is not equally central to peace operations whether they be traditional peace-keeping or post-conflict peace-building? Indeed the success or failure of the disarmament aspect of a peace operation is often critical to its overall success-Somalia surely being one recent sad example. The multilateral disarmament community must apply itself more directly and systematically to these broader problems - just as the United Nations Secretariat has increasingly begun to do - or risk indifference from Governments forced to make tough choices against a range of competing priorities. It is undeniably true that the post-cold war has significantly increased the potential for the international community to negotiate historic new multilateral disarmament treaties. And this window of opportunity must be utilized to the fullest. At the same time, due account must be taken of the hard fact that, for an increasing number of countries, expensive obligations in relation to advanced unconventional weapons which neither they nor their neighbours seek to possess may count for less than practical assistance in finding solutions to more parochial, but no less urgent, problems
Levine, A Joan; Phipps, Amanda I; Baron, John A; Buchanan, Daniel D; Ahnen, Dennis J; Cohen, Stacey A; Lindor, Noralane M; Newcomb, Polly A; Rosty, Christophe; Haile, Robert W; Laird, Peter W; Weisenberger, Daniel J
2016-01-01
The CpG island methylator phenotype (CIMP) is a major molecular pathway in colorectal cancer. Approximately 25% to 60% of CIMP tumors are microsatellite unstable (MSI-H) due to DNA hypermethylation of the MLH1 gene promoter. Our aim was to determine if the distributions of clinicopathologic factors in CIMP-positive tumors with MLH1 DNA methylation differed from those in CIMP-positive tumors without DNA methylation of MLH1. We assessed the associations between age, sex, tumor-site, MSI status BRAF and KRAS mutations, and family colorectal cancer history with MLH1 methylation status in a large population-based sample of CIMP-positive colorectal cancers defined by a 5-marker panel using unconditional logistic regression to assess the odds of MLH1 methylation by study variables. Subjects with CIMP-positive tumors without MLH1 methylation were significantly younger, more likely to be male, and more likely to have distal colon or rectal primaries and the MSI-L phenotype. CIMP-positive MLH1-unmethylated tumors were significantly less likely than CIMP-positive MLH1-methylated tumors to harbor a BRAF V600E mutation and significantly more likely to harbor a KRAS mutation. MLH1 methylation was associated with significantly better overall survival (HR, 0.50; 95% confidence interval, 0.31-0.82). These data suggest that MLH1 methylation in CIMP-positive tumors is not a completely random event and implies that there are environmental or genetic determinants that modify the probability that MLH1 will become methylated during CIMP pathogenesis. MLH1 DNA methylation status should be taken into account in etiologic studies. ©2015 American Association for Cancer Research.
Levine, A. Joan; Phipps, Amanda I.; Baron, John A.; Buchanan, Daniel D.; Ahnen, Dennis J.; Cohen, Stacey A.; Lindor, Noralane M.; Newcomb, Polly A.; Rosty, Christophe; Haile, Robert W.; Laird, Peter W.; Weisenberger, Daniel J.
2015-01-01
Background The CpG Island Methylator Phenotype (CIMP) is a major molecular pathway in colorectal cancer (CRC). Approximately 25% to 60% of CIMP tumors are microsatellite unstable (MSI-H) due to DNA hypermethylation of the MLH1 gene promoter. Our aim was to determine if the distributions of clinicopathologic factors in CIMP-positive tumors with MLH1 DNA methylation differed from those in CIMP-positive tumors without DNA methylation of MLH1. Methods We assessed the associations between age, sex, tumor-site, MSI status BRAF and KRAS mutations and family CRC history with MLH1 methylation status in a large population-based sample of CIMP-positive CRCs defined by a 5-marker panel using unconditional logistic regression to assess the odds of MLH1 methylation by study variables. Results Subjects with CIMP-positive tumors without MLH1 methylation were significantly younger, more likely to be male, more likely to have distal colon or rectal primaries and the MSI-L phenotype. CIMP-positive MLH1-unmethylated tumors were significantly less likely than CIMP-positive MLH1-methylated tumors to harbor a BRAF V600E mutation and significantly more likely to harbor a KRAS mutation. MLH1 methylation was associated with significantly better overall survival (HR=0.50; 95% Confidence Interval (0.31, 0.82)). Conclusions These data suggest that MLH1 methylation in CIMP-positive tumors is not a completely random event and implies that there are environmental or genetic determinants that modify the probability that MLH1 will become methylated during CIMP pathogenesis. Impact MLH1 DNA methylation status should be taken into account in etiologic studies. PMID:26512054
International Nuclear Information System (INIS)
Rovnak, Joel; Hronek, Brett W.; Ryan, Sean O.; Cai, Sumin; Quackenbush, Sandra L.
2005-01-01
Walleye dermal sarcoma virus (WDSV) is a complex retrovirus associated with seasonal dermal sarcomas. Developing tumors have low levels of accessory gene transcripts, A1 and B, and regressing tumors have high levels of full-length and spliced transcripts. Transcript A1 encodes a retroviral cyclin (rv-cyclin) with limited homology to host cyclins. The rv-cyclin is physically linked to components of the transcriptional co-activator complex, Mediator, and regulates transcription. In walleye fibroblasts, it inhibits the WDSV promoter independently of cis-acting DNA sequences. The rv-cyclin activates transcription from GAL4 promoters when fused to the GAL4 DNA binding domain. A 30 a.a. activation domain in the carboxy region can be inactivated by single point mutations, and these mutations diminish the ability of the rv-cyclin to inhibit the WDSV promoter. When fused to glutathione S-transferase, the rv-cyclin, its carboxy region, and the activation domain pull down components of transcription complexes from nuclear extracts, and pulldown is lost by mutation of the activation domain
Promoting Vehicle to Grid (V2G) in the Nordic Region
DEFF Research Database (Denmark)
Kester, Johannes; Noel, Lance; Zarazua de Rubens, Gerardo
2018-01-01
Vehicle to Grid (V2G) holds the promise of cheap, flexible, and fast-responding storage through the use of electric vehicle batteries. Unfortunately, infrastructure, battery degradation and consumer awareness are only some of the challenges to a faster development of this technology. This paper...... offers a qualitative comparative analysis that draws on a subsample of 227 semistructured interviews on electric vehicles with both transportation and electricity experts from 201 institutions and 17 cities within the Nordic region to discuss the reasoning and arguments behind V2G incentives and policy...... mechanisms. A frequency analysis of the most coded V2G responses favoured an update of the electricity market regulation – in particular in relation to electricity taxation and aggregator markets – and support for pilot projects. However, the analysis overall implies that V2G, in contrast to EVs...
Cis-acting elements in the promoter region of the human aldolase C gene.
Buono, P; de Conciliis, L; Olivetta, E; Izzo, P; Salvatore, F
1993-08-16
We investigated the cis-acting sequences involved in the expression of the human aldolase C gene by transient transfections into human neuroblastoma cells (SKNBE). We demonstrate that 420 bp of the 5'-flanking DNA direct at high efficiency the transcription of the CAT reporter gene. A deletion between -420 bp and -164 bp causes a 60% decrease of CAT activity. Gel shift and DNase I footprinting analyses revealed four protected elements: A, B, C and D. Competition analyses indicate that Sp1 or factors sharing a similar sequence specificity bind to elements A and B, but not to elements C and D. Sequence analysis shows a half palindromic ERE motif (GGTCA), in elements B and D. Region D binds a transactivating factor which appears also essential to stabilize the initiation complex.
Levy-Apter, Einat; Finkelshtein, Eynat; Vemulapalli, Vidyasiri; Li, Shawn S-C; Bedford, Mark T; Elson, Ari
2014-12-26
The non-receptor isoform of protein-tyrosine phosphatase ϵ (cyt-PTPe) supports adhesion of bone-resorbing osteoclasts by activating Src downstream of integrins. Loss of cyt-PTPe reduces Src activity in osteoclasts, reduces resorption of mineralized matrix both in vivo and in cell culture, and induces mild osteopetrosis in young female PTPe KO mice. Activation of Src by cyt-PTPe is dependent upon this phosphatase undergoing phosphorylation at its C-terminal Tyr-638 by partially active Src. To understand how cyt-PTPe activates Src, we screened 73 Src homology 2 (SH2) domains for binding to Tyr(P)-638 of cyt-PTPe. The SH2 domain of GRB2 bound Tyr(P)-638 of cyt-PTPe most prominently, whereas the Src SH2 domain did not bind at all, suggesting that GRB2 may link PTPe with downstream molecules. Further studies indicated that GRB2 is required for activation of Src by cyt-PTPe in osteoclast-like cells (OCLs) in culture. Overexpression of GRB2 in OCLs increased activating phosphorylation of Src at Tyr-416 and of cyt-PTPe at Tyr-638; opposite results were obtained when GRB2 expression was reduced by shRNA or by gene inactivation. Phosphorylation of cyt-PTPe at Tyr-683 and its association with GRB2 are integrin-driven processes in OCLs, and cyt-PTPe undergoes autodephosphorylation at Tyr-683, thus limiting Src activation by integrins. Reduced GRB2 expression also reduced the ability of bone marrow precursors to differentiate into OCLs and reduced the fraction of OCLs in which podosomal adhesion structures assume organization typical of active, resorbing cells. We conclude that GRB2 physically links cyt-PTPe with Src and enables cyt-PTPe to activate Src downstream of activated integrins in OCLs. © 2014 by The American Society for Biochemistry and Molecular Biology, Inc.
RNA-binding protein PSPC1 promotes the differentiation-dependent nuclear export of adipocyte RNAs
DEFF Research Database (Denmark)
Wang, Jiexin; Rajbhandari, Prashant; Damianov, Andrey
2017-01-01
A highly orchestrated gene expression program establishes the properties that define mature adipocytes, but the contribution of posttranscriptional factors to the adipocyte phenotype is poorly understood. Here we have shown that the RNA-binding protein PSPC1, a component of the paraspeckle complex...
Identification of evolutionarily invariant sequences in the protein C gene promoter
Spek, C. A.; Bertina, R. M.; Reitsma, P. H.
1998-01-01
Recent studies on human protein C gene expression have revealed the presence of three transcription factor binding sites in close proximity to the transcription start site. Binding sites for the liver-enriched hepatocyte nuclear factors 1 and 3 (HNF-1 and HNF-3, respectively) are located immediately
Ito, Tomohiro; Maeda, Takahiro; Goto, Kazunori; Miura, Takehito; Wakame, Koji; Nishioka, Hiroshi; Sato, Atsuya
2014-03-01
A novel enzyme-treated asparagus extract (ETAS) has been developed as a functional material produced from asparagus stem. Studies were conducted to determine the effect of ETAS on heat shock protein 70 (HSP70) expression and alleviation of stress. HeLa cells were treated with ETAS, and HSP70 mRNA and protein levels were measured using a reverse transcription-polymerase chain reaction (RT-PCR) assay and an enzyme-linked immunosorbent assay (ELISA), respectively. ETAS showed significant increases in HSP70 mRNA at more than 0.125 mg/mL and the protein at more than 1.0 mg/mL. The antistress effect was evaluated in a murine sleep-deprivation model. A sleep-deprivation stress load resulted in elevation of blood corticosterone and lipid peroxide concentrations, while supplementation with ETAS at 200 and 1000 mg/kg body weight was associated with significantly reduced levels of both stress markers, which were in the normal range. The HSP70 protein expression level in mice subjected to sleep-deprivation stress and supplemented with ETAS was significantly enhanced in stomach, liver, and kidney, compared to ETAS-untreated mice. A preliminary and small-sized human study was conducted among healthy volunteers consuming up to 150 mg/d of ETAS daily for 7 d. The mRNA expression of HSP70 in peripheral leukocytes was significantly elevated at intakes of 100 or 150 mg/d, compared to their baseline levels. Since HSP70 is known to be a stress-related protein and its induction leads to cytoprotection, the present results suggest that ETAS might exert antistress effects under stressful conditions, resulting from enhancement of HSP70 expression. © 2014 Institute of Food Technologists®
Wise, Randi; Duhachek-Muggy, Sara; Qi, Yue; Zolkiewski, Michal; Zolkiewska, Anna
2016-06-01
Metastatic breast cancer cells are exposed to stress of detachment from the extracellular matrix (ECM). Cultured breast cancer cells that survive this stress and are capable of anchorage-independent proliferation form mammospheres. The purpose of this study was to explore a link between mammosphere growth, ECM gene expression, and the protein quality control system in the endoplasmic reticulum (ER). We compared the mRNA and protein levels of ER folding factors in SUM159PT and MCF10DCIS.com breast cancer cells grown as mammospheres versus adherent conditions. Publicly available gene expression data for mammospheres formed by primary breast cancer cells and for circulating tumor cells (CTCs) were analyzed to assess the status of ECM/ER folding factor genes in clinically relevant samples. Knock-down of selected protein disulfide isomerase (PDI) family members was performed to examine their roles in SUM159PT mammosphere growth. We found that cells grown as mammospheres had elevated expression of ECM genes and ER folding quality control genes. CTC gene expression data for an index patient indicated that upregulation of ECM and ER folding factor genes occurred at the time of acquired therapy resistance and disease progression. Knock-down of PDI, ERp44, or ERp57, three members of the PDI family with elevated protein levels in mammospheres, in SUM159PT cells partially inhibited the mammosphere growth. Thus, breast cancer cell survival and growth under detachment conditions require enhanced assistance of the ER protein folding machinery. Targeting ER folding factors, in particular members of the PDI family, may improve the therapeutic outcomes in metastatic breast cancer.
Staines, Katherine A; Prideaux, Matt; Allen, Steve; Buttle, David J; Pitsillides, Andrew A; Farquharson, Colin
2016-06-01
The transmembrane glycoprotein E11 is considered critical in early osteoblast-osteocyte transitions (osteocytogenesis), however its function and regulatory mechanisms are still unknown. Using the late osteoblast MLO-A5 cell line we reveal increased E11 protein/mRNA expression (P < 0.001) concomitant with extensive osteocyte dendrite formation and matrix mineralization (P < 0.001). Transfection with E11 significantly increased mRNA levels (P < 0.001), but immunoblotting failed to detect any correlative increases in E11 protein levels, suggestive of post-translational degradation. We found that exogenous treatment of MLO-A5 and osteocytic IDG-SW3 cells with 10 μM ALLN (calpain and proteasome inhibitor) stabilized E11 protein levels and induced a profound increase in osteocytic dendrite formation (P < 0.001). Treatment with other calpain inhibitors failed to promote sim