Protein Hydrolysates as Promoters of Non-Haem Iron Absorption

Directory of Open Access Journals (Sweden)

Yanan Li

2017-06-01

Full Text Available Iron (Fe is an essential micronutrient for human growth and health. Organic iron is an excellent iron supplement due to its bioavailability. Both amino acids and peptides improve iron bioavailability and absorption and are therefore valuable components of iron supplements. This review focuses on protein hydrolysates as potential promoters of iron absorption. The ability of protein hydrolysates to chelate iron is thought to be a key attribute for the promotion of iron absorption. Iron-chelatable protein hydrolysates are categorized by their absorption forms: amino acids, di- and tri-peptides and polypeptides. Their structural characteristics, including their size and amino acid sequence, as well as the presence of special amino acids, influence their iron chelation abilities and bioavailabilities. Protein hydrolysates promote iron absorption by keeping iron soluble, reducing ferric iron to ferrous iron, and promoting transport across cell membranes into the gut. We also discuss the use and relative merits of protein hydrolysates as iron supplements.

Aggregation propensity of critical regions of the protein Tau

Science.gov (United States)

Muthee, Micaiah; Ahmed, Azka; Larini, Luca

The Alzheimer's disease is an irreversible, progressive brain disorder that slowly destroys memory and thinking skills, which eventually leads to the ability to not able to carry out the simplest tasks. The Alzheimer's disease is characterized by the formation of protein aggregates both within and outside of the brain's cells, the neurons. Within the neurons, the aggregation of the protein tau leads to the destruction of the microtubules in the axon of the neuron. Tau belongs to a group of proteins referred to as Microtubule-Associated Proteins. It is extremely flexible and is classified as an intrinsically unstructured protein due to its low propensity to form secondary structure. Tau promotes tubulin assembly into microtubules thereby stabilizing the cytoskeleton of the axon of the neurons. The microtubule binding region of tau consists of 4 pseudo-repeats. In this study, we will focus on the aggregation propensity of two fragments. In this study we will focus on the PHF43 fragment that contains the third pseudo-repeat and has been shown experimentally to aggregate readily. Another fragment that contains the second pseudo-repeat will be considered as well. Mutations in this region are associated with various form of dementia and for this reason we will consider the mutant P301L.

Promoter polymorphisms in two overlapping 6p25 genes implicate mitochondrial proteins in cognitive deficit in schizophrenia.

LENUS (Irish Health Repository)

Jablensky, A

2011-10-04

In a previous study, we detected a 6p25-p24 region linked to schizophrenia in families with high composite cognitive deficit (CD) scores, a quantitative trait integrating multiple cognitive measures. Association mapping of a 10 Mb interval identified a 260 kb region with a cluster of single-nucleotide polymorphisms (SNPs) significantly associated with CD scores and memory performance. The region contains two colocalising genes, LYRM4 and FARS2, both encoding mitochondrial proteins. The two tagging SNPs with strongest evidence of association were located around the overlapping putative promoters, with rs2224391 predicted to alter a transcription factor binding site (TFBS). Sequencing the promoter region identified 22 SNPs, many predicted to affect TFBSs, in a tight linkage disequilibrium block. Luciferase reporter assays confirmed promoter activity in the predicted promoter region, and demonstrated marked downregulation of expression in the LYRM4 direction under the haplotype comprising the minor alleles of promoter SNPs, which however is not driven by rs2224391. Experimental evidence from LYRM4 expression in lymphoblasts, gel-shift assays and modelling of DNA breathing dynamics pointed to two adjacent promoter SNPs, rs7752203-rs4141761, as the functional variants affecting expression. Their C-G alleles were associated with higher transcriptional activity and preferential binding of nuclear proteins, whereas the G-A combination had opposite effects and was associated with poor memory and high CD scores. LYRM4 is a eukaryote-specific component of the mitochondrial biogenesis of Fe-S clusters, essential cofactors in multiple processes, including oxidative phosphorylation. LYRM4 downregulation may be one of the mechanisms involved in inefficient oxidative phosphorylation and oxidative stress, increasingly recognised as contributors to schizophrenia pathogenesis.Molecular Psychiatry advance online publication, 4 October 2011; doi:10.1038\\/mp.2011.129.

Two negative cis-regulatory regions involved in fruit-specific promoter activity from watermelon (Citrullus vulgaris S.).

Science.gov (United States)

Yin, Tao; Wu, Hanying; Zhang, Shanglong; Lu, Hongyu; Zhang, Lingxiao; Xu, Yong; Chen, Daming; Liu, Jingmei

2009-01-01

A 1.8 kb 5'-flanking region of the large subunit of ADP-glucose pyrophosphorylase, isolated from watermelon (Citrullus vulgaris S.), has fruit-specific promoter activity in transgenic tomato plants. Two negative regulatory regions, from -986 to -959 and from -472 to -424, were identified in this promoter region by fine deletion analyses. Removal of both regions led to constitutive expression in epidermal cells. Gain-of-function experiments showed that these two regions were sufficient to inhibit RFP (red fluorescent protein) expression in transformed epidermal cells when fused to the cauliflower mosaic virus (CaMV) 35S minimal promoter. Gel mobility shift experiments demonstrated the presence of leaf nuclear factors that interact with these two elements. A TCCAAAA motif was identified in these two regions, as well as one in the reverse orientation, which was confirmed to be a novel specific cis-element. A quantitative beta-glucuronidase (GUS) activity assay of stable transgenic tomato plants showed that the activities of chimeric promoters harbouring only one of the two cis-elements, or both, were approximately 10-fold higher in fruits than in leaves. These data confirm that the TCCAAAA motif functions as a fruit-specific element by inhibiting gene expression in leaves.

[Health-Promoting Schools Regional Initiative of the Americas].

Science.gov (United States)

Ippolito-Shepherd, Josefa; Cerqueira, Maria Teresa; Ortega, Diana Patricia

2005-01-01

In Latin America, comprehensive health promotion programmes and activities are being implemented in the school setting, which take into account the conceptual framework of the Health-Promoting Schools Regional Initiative of the Pan American Health Organization, Regional office of the World Health Organization (PAHO/WHO). These programmes help to strengthen the working relationships between the health and education sectors. The Health-Promoting Schools Regional Initiative, officially launched by PAHO/WHO in 1995, aims to form future generations to have the knowledge, abilities, and skills necessary for promoting and caring for their health and that of their family and community, as well as to create and maintain healthy environments and communities. The Initiative focuses on three main components: comprehensive health education, the creation and maintenance of healthy physical and psychosocial environments, and the access to health and nutrition services, mental health, and active life. In 2001, PAHO conducted a survey in 19 Latin American countries to assess the status and trends of Health-Promoting Schools in the Region, for the appropriate regional, subregional, and national planning of pertinent health promotion and health education programmes and activities. The results of this survey provided information about policies and national plans, multisectoral coordination mechanisms for the support of health promotion in the school settings, the formation and participation in national and international networks of Health-Promoting Schools and about the level of dissemination of the strategy. For the successful development of Health-Promoting Schools is essential to involve the society as a whole, in order to mobilise human resources and materials necessary for implementing health promotion in the school settings. Thus, the constitution and consolidation of networks has been a facilitating mechanism for the exchange of ideas, resources and experiences to strengthen

The CytR repressor antagonizes cyclic AMP-cyclic AMP receptor protein activation of the deoCp2 promoter of Escherichia coli K-12

DEFF Research Database (Denmark)

Søgaard-Andersen, L; Martinussen, J; Møllegaard, N E

1990-01-01

We have investigated the regulation of the Escherichia coli deoCp2 promoter by the CytR repressor and the cyclic AMP (cAMP) receptor protein (CRP) complexed to cAMP. Promoter regions controlled by these two proteins characteristically contain tandem cAMP-CRP binding sites. Here we show that (i) Cyt...

Gel shift analysis of the empA promoter region in Vibrio anguillarum

Directory of Open Access Journals (Sweden)

Denkin Steven M

2004-10-01

Full Text Available Abstract Background The induction of metalloprotease encoded by empA in Vibrio anguillarum occurs at high cell density in salmon intestinal mucus. Previously we have shown that there are significant differences in empA expression in two strains of V. anguillarum, M93Sm and NB10. It is hypothesized that differences in empA regulation are due to differences in binding of regulatory elements. Results Two strains of V. anguillarum, M93Sm and NB10, were examined and compared for the presence of DNA regulatory proteins that bind to and control the empA promoter region. Gel mobility shift assays, using a digoxigenin (DIG-labeled oligomer containing a lux box-like element and the promoter for empA, were done to demonstrate the presence of a DNA-binding protein. Protein extracts from NB10 cells incubated in Luria Bertani broth + 2% NaCl (LB20, nine salts solution + 200 μg/ml mucus (NSSM, 3M (marine minimal medium, or NSS resulted in a gel mobility shift. No gel mobility shift was seen when protein extracts from either LB20- or NSSM-grown M93Sm cells were mixed with the DIG-labeled empA oligomer. The azocasein assay detected protease activity in all incubation conditions for NB10 culture supernatants. In contrast, protease activity was detected in M93Sm culture supernatants only when incubated in NSSM. Since the luxR homologue in V. anguillarum, vanT, has been cloned, sequenced, and shown to be required for protease activity, we wanted to determine if vanT mutants of NB10 exhibit the same gel shift observed in the wild-type. Site-directed mutagenesis was used to create vanT mutants in V. anguillarum M93Sm and NB10 to test whether VanT is involved with the gel mobility shift. Both vanT mutants, M02 and NB02, did not produce protease activity in any conditions. However, protein extracts from NB02 incubated in each condition still exhibited a gel shift when mixed with the DIG-labeled empA oligomer. Conclusions The data demonstrate that protein extracts of V

CDH1 promoter hypermethylation and E-cadherin protein expression in infiltrating breast cancer

DEFF Research Database (Denmark)

Caldeira, José Roberto F; Prando, Erika C; Quevedo, Francisco C

2006-01-01

prognosis, and metastasis. Differential CpG island methylation in the promoter region of the CDH1 gene might be an alternative way for the loss of expression and function of E-cadherin, leading to loss of tissue integrity, an essential step in tumor progression. METHODS: The aim of our study was to assess...... not statistically significant, the levels of E-cadherin expression tended to diminish with the CDH1 promoter region methylation. In the group of 71 ductal cancinomas, most of the cases of showing CDH1 hypermethylation also presented reduced levels of expression of ER and PgR proteins, and a possible association......BACKGROUND: The E-cadherin gene (CDH1) maps, at chromosome 16q22.1, a region often associated with loss of heterozygosity (LOH) in human breast cancer. LOH at this site is thought to lead to loss of function of this tumor suppressor gene and was correlated with decreased disease-free survival, poor...

New PAH gene promoter KLF1 and 3'-region C/EBPalpha motifs influence transcription in vitro.

Science.gov (United States)

Klaassen, Kristel; Stankovic, Biljana; Kotur, Nikola; Djordjevic, Maja; Zukic, Branka; Nikcevic, Gordana; Ugrin, Milena; Spasovski, Vesna; Srzentic, Sanja; Pavlovic, Sonja; Stojiljkovic, Maja

2017-02-01

Phenylketonuria (PKU) is a metabolic disease caused by mutations in the phenylalanine hydroxylase (PAH) gene. Although the PAH genotype remains the main determinant of PKU phenotype severity, genotype-phenotype inconsistencies have been reported. In this study, we focused on unanalysed sequences in non-coding PAH gene regions to assess their possible influence on the PKU phenotype. We transiently transfected HepG2 cells with various chloramphenicol acetyl transferase (CAT) reporter constructs which included PAH gene non-coding regions. Selected non-coding regions were indicated by in silico prediction to contain transcription factor binding sites. Furthermore, electrophoretic mobility shift assay (EMSA) and supershift assays were performed to identify which transcriptional factors were engaged in the interaction. We found novel KLF1 motif in the PAH promoter, which decreases CAT activity by 50 % in comparison to basal transcription in vitro. The cytosine at the c.-170 promoter position creates an additional binding site for the protein complex involving KLF1 transcription factor. Moreover, we assessed for the first time the role of a multivariant variable number tandem repeat (VNTR) region located in the 3'-region of the PAH gene. We found that the VNTR3, VNTR7 and VNTR8 constructs had approximately 60 % of CAT activity. The regulation is mediated by the C/EBPalpha transcription factor, present in protein complex binding to VNTR3. Our study highlighted two novel promoter KLF1 and 3'-region C/EBPalpha motifs in the PAH gene which decrease transcription in vitro and, thus, could be considered as PAH expression modifiers. New transcription motifs in non-coding regions will contribute to better understanding of the PKU phenotype complexity and may become important for the optimisation of PKU treatment.

Health issues of whey proteins: 3. gut health promotion

NARCIS (Netherlands)

Gertjan Schaafsma

2007-01-01

This paper reviews the potential of whey protein to promote gut health. The high digestibility and specific amino acid composition of whey protein, as present in whey powder, whey protein concentrate and whey protein isolate, explain why ingestion of whey protein will exert this beneficial effect.

TALE factors poise promoters for activation by Hox proteins.

Science.gov (United States)

Choe, Seong-Kyu; Ladam, Franck; Sagerström, Charles G

2014-01-27

Hox proteins form complexes with TALE cofactors from the Pbx and Prep/Meis families to control transcription, but it remains unclear how Hox:TALE complexes function. Examining a Hoxb1b:TALE complex that regulates zebrafish hoxb1a transcription, we find maternally deposited TALE proteins at the hoxb1a promoter already during blastula stages. These TALE factors recruit histone-modifying enzymes to promote an active chromatin profile at the hoxb1a promoter and also recruit RNA polymerase II (RNAPII) and P-TEFb. However, in the presence of TALE factors, RNAPII remains phosphorylated on serine 5 and hoxb1a transcription is inefficient. By gastrula stages, Hoxb1b binds together with TALE factors to the hoxb1a promoter. This triggers P-TEFb-mediated transitioning of RNAPII to the serine 2-phosphorylated form and efficient hoxb1a transcription. We conclude that TALE factors access promoters during early embryogenesis to poise them for activation but that Hox proteins are required to trigger efficient transcription. Copyright © 2014 Elsevier Inc. All rights reserved.

Toscana virus NSs protein promotes degradation of double-stranded RNA-dependent protein kinase.

Science.gov (United States)

Kalveram, Birte; Ikegami, Tetsuro

2013-04-01

Toscana virus (TOSV), which is transmitted by Phlebotomus spp. sandflies, is a major etiologic agent of aseptic meningitis and encephalitis in the Mediterranean. Like other members of the genus Phlebovirus of the family Bunyaviridae, TOSV encodes a nonstructural protein (NSs) in its small RNA segment. Although the NSs of Rift Valley fever virus (RVFV) has been identified as an important virulence factor, which suppresses host general transcription, inhibits transcription from the beta interferon promoter, and promotes the proteasomal degradation of double-stranded RNA-dependent protein kinase (PKR), little is known about the functions of NSs proteins encoded by less-pathogenic members of this genus. In this study we report that TOSV is able to downregulate PKR with similar efficiency as RVFV, while infection with the other phleboviruses-i.e., Punta Toro virus, sandfly fever Sicilian virus, or Frijoles virus-has no effect on cellular PKR levels. In contrast to RVFV, however, cellular transcription remains unaffected during TOSV infection. TOSV NSs protein promotes the proteasome-dependent downregulation of PKR and is able to interact with kinase-inactive PKR in infected cells.

Inhibition of SNW1 association with spliceosomal proteins promotes apoptosis in breast cancer cells

International Nuclear Information System (INIS)

Sato, Naoki; Maeda, Masao; Sugiyama, Mai; Ito, Satoko; Hyodo, Toshinori; Masuda, Akio; Tsunoda, Nobuyuki; Kokuryo, Toshio; Hamaguchi, Michinari; Nagino, Masato; Senga, Takeshi

2015-01-01

RNA splicing is a fundamental process for protein synthesis. Recent studies have reported that drugs that inhibit splicing have cytotoxic effects on various tumor cell lines. In this report, we demonstrate that depletion of SNW1, a component of the spliceosome, induces apoptosis in breast cancer cells. Proteomics and biochemical analyses revealed that SNW1 directly associates with other spliceosome components, including EFTUD2 (Snu114) and SNRNP200 (Brr2). The SKIP region of SNW1 interacted with the N-terminus of EFTUD2 as well as two independent regions in the C-terminus of SNRNP200. Similar to SNW1 depletion, knockdown of EFTUD2 increased the numbers of apoptotic cells. Furthermore, we demonstrate that exogenous expression of either the SKIP region of SNW1 or the N-terminus region of EFTUD2 significantly promoted cellular apoptosis. Our results suggest that the inhibition of SNW1 or its associating proteins may be a novel therapeutic strategy for cancer treatment

Health issues of whey proteins: 3. Gut health promotion

NARCIS (Netherlands)

Schaafsma, G.

2007-01-01

This paper reviews the potential of whey protein to promote gut health. The high digestibility and specific amino acid composition of whey protei, as present in whey powder, whey protein concentrate and whey protein isolate, explain why ingestion of whey protein will exert this beneficial effect.

Characterization of a Lactococcus lactis promoter for heterologous protein production

Directory of Open Access Journals (Sweden)

Christian E. Ogaugwu

2018-03-01

Full Text Available Constitutively active promoter elements for heterologous protein production in Lactococcus lactis are scarce. Here, the promoter of the PTS-IIC gene cluster from L. lactis NZ3900 is described. This promoter was cloned upstream of an enhanced green fluorescent protein, GFPmut3a, and transformed into L. lactis. Transformants produced up to 13.5 μg of GFPmut3a per milliliter of log phase cells. Addition of cellobiose further increased the production of GFPmut3a by up to two-fold when compared to glucose. Analysis of mutations at two specific positions in the PTS-IIC promoter showed that a ‘T’ to ‘G’ mutation within the −35 element resulted in constitutive expression in glucose, while a ‘C’ at nucleotide 7 in the putative cre site enhanced promoter activity in cellobiose. Finally, this PTS-IIC promoter is capable of mediating protein expression in Bacillus subtilis and Escherichia coli Nissle 1917, suggesting the potential for future biotechnological applications of this element and its derivatives.

Analysis of polymorphisms in the promoter region and protein levels of interleukin-6 gene among gout patients.

Science.gov (United States)

Tsai, P-C; Chen, C-J; Lai, H-M; Chang, S-J

2008-01-01

To explore the associations between the polymorphisms and protein levels of interleukin-6 (IL-6) gene and gout disease. A total of 120 male gout patients and 184 healthy controls were enrolled. Each patient was matched with 1-2 gout-free controls by age within three years. Four polymorphisms in the promoter of IL-6 gene, including -597G/A, -572C/G, -373A(m)T(n), and -174G/C, and the IL-6 levels were analyzed. The clinical characteristics and biochemical markers in plasma were measured, including age of gout onset, duration of gout history, tophus number, gout attack frequency, uric acid, total cholesterol, triglycerides and creatinine. The mean IL-6 level for gout patients was 9.80 (+/-11.76 pg/ml) which showed no significant difference from the controls (7.06+/-7.58 pg/ml, p=0.230). When the IL-6 levels were dichotomized according to the median value (5 pg/ml), there were significantly higher proportions of the gout patients (59.66%) than controls (44%) with high IL-6 levels (OR=1.88, 95% CI=1.17-3.02, p=0.008). Unique genotype was found at polymorphisms -174G/C and -597G/A. Neither the polymorphisms -572C/G nor -373A(m)T(n) in the genotype or allele distributions showed a significant association related to clinical characteristics, biochemical markers, IL-6 levels or gout disease (all p>0.05). Those with gout disease have greater proportions of high IL-6 levels in plasma than controls, and there is no significant association between the four polymorphisms in the promoter region of IL-6 gene and gout disease.

Discovery and Evaluation of Polymorphisms in the and Promoter Regions for Risk of Korean Lung Cancer

Directory of Open Access Journals (Sweden)

Jae Sook Sung

2012-09-01

Full Text Available AKT is a signal transduction protein that plays a central role in the tumorigenesis. There are 3 mammalian isoforms of this serine/threonine protein kinase-AKT1, AKT2, and AKT3-showing a broad tissue distribution. We first discovered 2 novel polymorphisms (AKT2 -9826 C/G and AKT3 -811 A/G, and we confirmed 6 known polymorphisms (AKT2 -9473 C/T, AKT2 -9151 C/T, AKT2 -9025 C/T, AKT2 -8618G/A, AKT3 -675 A/-, and AKT3 -244 C/T of the AKT2 and AKT3 promoter region in 24 blood samples of Korean lung cancer patients using direct sequencing. To evaluate the role of AKT2 and AKT3 polymorphisms in the risk of Korean lung cancer, genotypes of the AKT2 and AKT3 polymorphisms (AKT2 -9826 C/G, AKT2 -9473 C/T, AKT2 -9151 C/T, AKT2 -9025 C/T, AKT2 -8618G/A, and AKT3 -675 A/- were determined in 360 lung cancer patients and 360 normal controls. Statistical analyses revealed that the genotypes and haplotypes in the AKT2 and AKT3 promoter regions were not significantly associated with the risk of lung cancer in the Korean population. These results suggest that polymorphisms of the AKT2 and AKT3 promoter regions do not contribute to the genetic susceptibility to lung cancer in the Korean population.

The C-terminal region of A-kinase anchor protein 350 (AKAP350A) enables formation of microtubule-nucleation centers and interacts with pericentriolar proteins.

Science.gov (United States)

Kolobova, Elena; Roland, Joseph T; Lapierre, Lynne A; Williams, Janice A; Mason, Twila A; Goldenring, James R

2017-12-15

Microtubules in animal cells assemble (nucleate) from both the centrosome and the cis-Golgi cisternae. A-kinase anchor protein 350 kDa (AKAP350A, also called AKAP450/CG-NAP/AKAP9) is a large scaffolding protein located at both the centrosome and Golgi apparatus. Previous findings have suggested that AKAP350 is important for microtubule dynamics at both locations, but how this scaffolding protein assembles microtubule nucleation machinery is unclear. Here, we found that overexpression of the C-terminal third of AKAP350A, enhanced GFP-AKAP350A(2691-3907), induces the formation of multiple microtubule-nucleation centers (MTNCs). Nevertheless, these induced MTNCs lacked "true" centriole proteins, such as Cep135. Mapping analysis with AKAP350A truncations demonstrated that AKAP350A contains discrete regions responsible for promoting or inhibiting the formation of multiple MTNCs. Moreover, GFP-AKAP350A(2691-3907) recruited several pericentriolar proteins to MTNCs, including γ-tubulin, pericentrin, Cep68, Cep170, and Cdk5RAP2. Proteomic analysis indicated that Cdk5RAP2 and Cep170 both interact with the microtubule nucleation-promoting region of AKAP350A, whereas Cep68 interacts with the distal C-terminal AKAP350A region. Yeast two-hybrid assays established a direct interaction of Cep170 with AKAP350A. Super-resolution and deconvolution microscopy analyses were performed to define the association of AKAP350A with centrosomes, and these studies disclosed that AKAP350A spans the bridge between centrioles, co-localizing with rootletin and Cep68 in the linker region. siRNA-mediated depletion of AKAP350A caused displacement of both Cep68 and Cep170 from the centrosome. These results suggest that AKAP350A acts as a scaffold for factors involved in microtubule nucleation at the centrosome and coordinates the assembly of protein complexes associating with the intercentriolar bridge.

Large-scale chromatin immunoprecipitation with promoter sequence microarray analysis of the interaction of the NSs protein of Rift Valley fever virus with regulatory DNA regions of the host genome.

Science.gov (United States)

Benferhat, Rima; Josse, Thibaut; Albaud, Benoit; Gentien, David; Mansuroglu, Zeyni; Marcato, Vasco; Souès, Sylvie; Le Bonniec, Bernard; Bouloy, Michèle; Bonnefoy, Eliette

2012-10-01

Rift Valley fever virus (RVFV) is a highly pathogenic Phlebovirus that infects humans and ruminants. Initially confined to Africa, RVFV has spread outside Africa and presently represents a high risk to other geographic regions. It is responsible for high fatality rates in sheep and cattle. In humans, RVFV can induce hepatitis, encephalitis, retinitis, or fatal hemorrhagic fever. The nonstructural NSs protein that is the major virulence factor is found in the nuclei of infected cells where it associates with cellular transcription factors and cofactors. In previous work, we have shown that NSs interacts with the promoter region of the beta interferon gene abnormally maintaining the promoter in a repressed state. In this work, we performed a genome-wide analysis of the interactions between NSs and the host genome using a genome-wide chromatin immunoprecipitation combined with promoter sequence microarray, the ChIP-on-chip technique. Several cellular promoter regions were identified as significantly interacting with NSs, and the establishment of NSs interactions with these regions was often found linked to deregulation of expression of the corresponding genes. Among annotated NSs-interacting genes were present not only genes regulating innate immunity and inflammation but also genes regulating cellular pathways that have not yet been identified as targeted by RVFV. Several of these pathways, such as cell adhesion, axonal guidance, development, and coagulation were closely related to RVFV-induced disorders. In particular, we show in this work that NSs targeted and modified the expression of genes coding for coagulation factors, demonstrating for the first time that this hemorrhagic virus impairs the host coagulation cascade at the transcriptional level.

DNA Methylation Analysis of BRD1 Promoter Regions and the Schizophrenia rs138880 Risk Allele.

Directory of Open Access Journals (Sweden)

Mads Dyrvig

Full Text Available The bromodomain containing 1 gene, BRD1 is essential for embryogenesis and CNS development. It encodes a protein that participates in histone modifying complexes and thereby regulates the expression of a large number of genes. Genetic variants in the BRD1 locus show association with schizophrenia and bipolar disorder and risk alleles in the promoter region correlate with reduced BRD1 expression. Insights into the transcriptional regulation of BRD1 and the pathogenic mechanisms associated with BRD1 risk variants, however, remain sparse. By studying transcripts in human HeLa and SH-SY5Y cells we provide evidence for differences in relative expression of BRD1 transcripts with three alternative 5' UTRs (exon 1C, 1B, and 1A. We further show that expression of these transcript variants covaries negatively with DNA methylation proportions in their upstream promoter regions suggesting that promoter usage might be regulated by DNA methylation. In line with findings that the risk allele of the rs138880 SNP in the BRD1 promoter region correlates with reduced BRD1 expression, we find that it is also associated with moderate regional BRD1 promoter hypermethylation in both adipose tissue and blood. Importantly, we demonstrate by inspecting available DNA methylation and expression data that these regions undergo changes in methylation during fetal brain development and that differences in their methylation proportions in fetal compared to postnatal frontal cortex correlate significantly with BRD1 expression. These findings suggest that BRD1 may be dysregulated in both the developing and mature brain of risk allele carriers. Finally, we demonstrate that commonly used mood stabilizers Lithium, Valproate, and Carbamazepine affect the expression of BRD1 in SH-SY5Y cells. Altogether this study indicates a link between genetic risk and epigenetic dysregulation of BRD1 which raises interesting perspectives for targeting the mechanisms pharmacologically.

Functional analysis of bipartite begomovirus coat protein promoter sequences

International Nuclear Information System (INIS)

Lacatus, Gabriela; Sunter, Garry

2008-01-01

We demonstrate that the AL2 gene of Cabbage leaf curl virus (CaLCuV) activates the CP promoter in mesophyll and acts to derepress the promoter in vascular tissue, similar to that observed for Tomato golden mosaic virus (TGMV). Binding studies indicate that sequences mediating repression and activation of the TGMV and CaLCuV CP promoter specifically bind different nuclear factors common to Nicotiana benthamiana, spinach and tomato. However, chromatin immunoprecipitation demonstrates that TGMV AL2 can interact with both sequences independently. Binding of nuclear protein(s) from different crop species to viral sequences conserved in both bipartite and monopartite begomoviruses, including TGMV, CaLCuV, Pepper golden mosaic virus and Tomato yellow leaf curl virus suggests that bipartite begomoviruses bind common host factors to regulate the CP promoter. This is consistent with a model in which AL2 interacts with different components of the cellular transcription machinery that bind viral sequences important for repression and activation of begomovirus CP promoters

Similarities in transcription factor IIIC subunits that bind to the posterior regions of internal promoters for RNA polymerase III

Directory of Open Access Journals (Sweden)

Matsutani Sachiko

2004-08-01

Full Text Available Abstract Background In eukaryotes, RNA polymerase III (RNAP III transcribes the genes for small RNAs like tRNAs, 5S rRNA, and several viral RNAs, and short interspersed repetitive elements (SINEs. The genes for these RNAs and SINEs have internal promoters that consist of two regions. These two regions are called the A and B blocks. The multisubunit transcription factor TFIIIC is required for transcription initiation of RNAP III; in transcription of tRNAs, the B-block binding subunit of TFIIIC recognizes a promoter. Although internal promoter sequences are conserved in eukaryotes, no evidence of homology between the B-block binding subunits of vertebrates and yeasts has been reported previously. Results Here, I reported the results of PSI-BLAST searches using the B-block binding subunits of human and Shizosacchromyces pombe as queries, showing that the same Arabidopsis proteins were hit with low E-values in both searches. Comparison of the convergent iterative alignments obtained by these PSI-BLAST searches revealed that the vertebrate, yeast, and Arabidopsis proteins have similarities in their N-terminal one-third regions. In these regions, there were three domains with conserved sequence similarities, one located in the N-terminal end region. The N-terminal end region of the B-block binding subunit of Saccharomyces cerevisiae is tentatively identified as a HMG box, which is the DNA binding motif. Although I compared the alignment of the N-terminal end regions of the B-block binding subunits, and their homologs, with that of the HMG boxes, it is not clear whether they are related. Conclusion Molecular phylogenetic analyses using the small subunit rRNA and ubiquitous proteins like actin and α-tubulin, show that fungi are more closely related to animals than either is to plants. Interestingly, the results obtained in this study show that, with respect to the B-block binding subunits of TFIIICs, animals appear to be evolutionarily closer to plants

Similarities in transcription factor IIIC subunits that bind to the posterior regions of internal promoters for RNA polymerase III.

Science.gov (United States)

Matsutani, Sachiko

2004-08-09

In eukaryotes, RNA polymerase III (RNAP III) transcribes the genes for small RNAs like tRNAs, 5S rRNA, and several viral RNAs, and short interspersed repetitive elements (SINEs). The genes for these RNAs and SINEs have internal promoters that consist of two regions. These two regions are called the A and B blocks. The multisubunit transcription factor TFIIIC is required for transcription initiation of RNAP III; in transcription of tRNAs, the B-block binding subunit of TFIIIC recognizes a promoter. Although internal promoter sequences are conserved in eukaryotes, no evidence of homology between the B-block binding subunits of vertebrates and yeasts has been reported previously. Here, I reported the results of PSI-BLAST searches using the B-block binding subunits of human and Shizosacchromyces pombe as queries, showing that the same Arabidopsis proteins were hit with low E-values in both searches. Comparison of the convergent iterative alignments obtained by these PSI-BLAST searches revealed that the vertebrate, yeast, and Arabidopsis proteins have similarities in their N-terminal one-third regions. In these regions, there were three domains with conserved sequence similarities, one located in the N-terminal end region. The N-terminal end region of the B-block binding subunit of Saccharomyces cerevisiae is tentatively identified as a HMG box, which is the DNA binding motif. Although I compared the alignment of the N-terminal end regions of the B-block binding subunits, and their homologs, with that of the HMG boxes, it is not clear whether they are related. Molecular phylogenetic analyses using the small subunit rRNA and ubiquitous proteins like actin and alpha-tubulin, show that fungi are more closely related to animals than either is to plants. Interestingly, the results obtained in this study show that, with respect to the B-block binding subunits of TFIIICs, animals appear to be evolutionarily closer to plants than to fungi.

Cyclic adenosine 3',5'-monophosphate (cAMP) enhances cAMP-responsive element binding (CREB) protein phosphorylation and phospho-CREB interaction with the mouse steroidogenic acute regulatory protein gene promoter.

Science.gov (United States)

Clem, Brian F; Hudson, Elizabeth A; Clark, Barbara J

2005-03-01

Steroidogenic acute regulatory protein (StAR) transcription is regulated through cAMP-protein kinase A-dependent mechanisms that involve multiple transcription factors including the cAMP-responsive element binding protein (CREB) family members. Classically, binding of phosphorylated CREB to cis-acting cAMP-responsive elements (5'-TGACGTCA-3') within target gene promoters leads to recruitment of the coactivator CREB binding protein (CBP). Herein we examined the extent of CREB family member phosphorylation on protein-DNA interactions and CBP recruitment with the StAR promoter. Immunoblot analysis revealed that CREB, cAMP-responsive element modulator (CREM), and activating transcription factor (ATF)-1 are expressed in MA-10 mouse Leydig tumor cells, yet only CREB and ATF-1 are phosphorylated. (Bu)2cAMP treatment of MA-10 cells increased CREB phosphorylation approximately 2.3-fold within 30 min but did not change total nuclear CREB expression levels. Using DNA-affinity chromatography, we now show that CREB and ATF-1, but not CREM, interact with the StAR promoter, and this interaction is dependent on the activator protein-1 (AP-1) cis-acting element within the cAMP-responsive region. In addition, (Bu)2cAMP-treatment increased phosphorylated CREB (P-CREB) association with the StAR promoter but did not influence total CREB interaction. In vivo chromatin immunoprecipitation assays demonstrated CREB binding to the StAR proximal promoter is independent of (Bu)2cAMP-treatment, confirming our in vitro analysis. However, (Bu)2cAMP-treatment increased P-CREB and CBP interaction with the StAR promoter, demonstrating for the first time the physical role of P-CREB:DNA interactions in CBP recruitment to the StAR proximal promoter.

Identification of a cis-regulatory region of a gene in Arabidopsis thaliana whose induction by dehydration is mediated by abscisic acid and requires protein synthesis.

Science.gov (United States)

Iwasaki, T; Yamaguchi-Shinozaki, K; Shinozaki, K

1995-05-20

In Arabidopsis thaliana, the induction of a dehydration-responsive gene, rd22, is mediated by abscisic acid (ABA) but the gene does not include any sequence corresponding to the consensus ABA-responsive element (ABRE), RYACGTGGYR, in its promoter region. The cis-regulatory region of the rd22 promoter was identified by monitoring the expression of beta-glucuronidase (GUS) activity in leaves of transgenic tobacco plants transformed with chimeric gene fusions constructed between 5'-deleted promoters of rd22 and the coding region of the GUS reporter gene. A 67-bp nucleotide fragment corresponding to positions -207 to -141 of the rd22 promoter conferred responsiveness to dehydration and ABA on a non-responsive promoter. The 67-bp fragment contains the sequences of the recognition sites for some transcription factors, such as MYC, MYB, and GT-1. The fact that accumulation of rd22 mRNA requires protein synthesis raises the possibility that the expression of rd22 might be regulated by one of these trans-acting protein factors whose de novo synthesis is induced by dehydration or ABA. Although the structure of the RD22 protein is very similar to that of a non-storage seed protein, USP, of Vicia faba, the expression of the GUS gene driven by the rd22 promoter in non-stressed transgenic Arabidopsis plants was found mainly in flowers and bolted stems rather than in seeds.

Mammalian amyloidogenic proteins promote prion nucleation in yeast.

Science.gov (United States)

Chandramowlishwaran, Pavithra; Sun, Meng; Casey, Kristin L; Romanyuk, Andrey V; Grizel, Anastasiya V; Sopova, Julia V; Rubel, Aleksandr A; Nussbaum-Krammer, Carmen; Vorberg, Ina M; Chernoff, Yury O

2018-03-02

Fibrous cross-β aggregates (amyloids) and their transmissible forms (prions) cause diseases in mammals (including humans) and control heritable traits in yeast. Initial nucleation of a yeast prion by transiently overproduced prion-forming protein or its (typically, QN-rich) prion domain is efficient only in the presence of another aggregated (in most cases, QN-rich) protein. Here, we demonstrate that a fusion of the prion domain of yeast protein Sup35 to some non-QN-rich mammalian proteins, associated with amyloid diseases, promotes nucleation of Sup35 prions in the absence of pre-existing aggregates. In contrast, both a fusion of the Sup35 prion domain to a multimeric non-amyloidogenic protein and the expression of a mammalian amyloidogenic protein that is not fused to the Sup35 prion domain failed to promote prion nucleation, further indicating that physical linkage of a mammalian amyloidogenic protein to the prion domain of a yeast protein is required for the nucleation of a yeast prion. Biochemical and cytological approaches confirmed the nucleation of protein aggregates in the yeast cell. Sequence alterations antagonizing or enhancing amyloidogenicity of human amyloid-β (associated with Alzheimer's disease) and mouse prion protein (associated with prion diseases), respectively, antagonized or enhanced nucleation of a yeast prion by these proteins. The yeast-based prion nucleation assay, developed in our work, can be employed for mutational dissection of amyloidogenic proteins. We anticipate that it will aid in the identification of chemicals that influence initial amyloid nucleation and in searching for new amyloidogenic proteins in a variety of proteomes. © 2018 by The American Society for Biochemistry and Molecular Biology, Inc.

Genome-wide analysis of regions similar to promoters of histone genes

KAUST Repository

Chowdhary, Rajesh

2010-05-28

Background: The purpose of this study is to: i) develop a computational model of promoters of human histone-encoding genes (shortly histone genes), an important class of genes that participate in various critical cellular processes, ii) use the model so developed to identify regions across the human genome that have similar structure as promoters of histone genes; such regions could represent potential genomic regulatory regions, e.g. promoters, of genes that may be coregulated with histone genes, and iii/ identify in this way genes that have high likelihood of being coregulated with the histone genes.Results: We successfully developed a histone promoter model using a comprehensive collection of histone genes. Based on leave-one-out cross-validation test, the model produced good prediction accuracy (94.1% sensitivity, 92.6% specificity, and 92.8% positive predictive value). We used this model to predict across the genome a number of genes that shared similar promoter structures with the histone gene promoters. We thus hypothesize that these predicted genes could be coregulated with histone genes. This hypothesis matches well with the available gene expression, gene ontology, and pathways data. Jointly with promoters of the above-mentioned genes, we found a large number of intergenic regions with similar structure as histone promoters.Conclusions: This study represents one of the most comprehensive computational analyses conducted thus far on a genome-wide scale of promoters of human histone genes. Our analysis suggests a number of other human genes that share a high similarity of promoter structure with the histone genes and thus are highly likely to be coregulated, and consequently coexpressed, with the histone genes. We also found that there are a large number of intergenic regions across the genome with their structures similar to promoters of histone genes. These regions may be promoters of yet unidentified genes, or may represent remote control regions that

Phosphorylation of stress protein pp80 is related to promotion of transformation

International Nuclear Information System (INIS)

Smith, B.M.; Gindhart, T.D.; Hirano, K.; Colburn, N.H.

1986-01-01

The JB6 mouse epidermal cell system is an in vitro model of late stage promotion, and includes cell lines sensitive (P+) or resistant (P-) to phorbol ester-induced anchorage independent transformation, and transformed (T/sub x/) lines. Certain promoter-induced changes in phosphoproteins, identified by gel electrophoresis, are unique to cells of one phenotype, and occur only with specific promoters. An 80Kd protein is inversely correlated with phenotype: P- cells have a constitutively higher level (p 35 S-methionine. pp80 shares properties with the 80Kd heat stress protein: molecular weight relative abundance, and isoelectric point (4.5). Pharmacological analogs of calcium, the lanthanides, promote transformation of JB6 cells, but have no effect on phosphorylation of the 80Kd protein. If pp80 is on the promotion pathway, it is limited to a specific subset of transformation promoters

Core Promoter Structure in the Oomycete Phytophthora infestans

Science.gov (United States)

McLeod, Adele; Smart, Christine D.; Fry, William E.

2004-01-01

We have investigated the core promoter structure of the oomycete Phytophthora infestans. The transcriptional start sites (TSS) of three previously characterized P. infestans genes, Piexo1, Piexo3, and Piendo1, were determined by primer extension analyses. The TSS regions were homologous to a previously identified 16-nucleotide (nt) core sequence that overlaps the TSS in most oomycete genes. The core promoter regions of Piexo1 and Piendo1 were investigated by using a transient protoplast expression assay and the reporter gene β-glucuronidase. Mutational analyses of the promoters of Piexo1 and Piendo1 showed that there is a putative core promoter element encompassing the TSS (−2 to + 5) that has high sequence and functional homology to a known core promoter element present in other eukaryotes, the initiator element (Inr). Downstream and flanking the Inr is a highly conserved oomycete promoter region (+7 to + 15), hereafter referred to as FPR (flanking promoter region), which is also important for promoter function. The importance of the 19-nt core promoter region (Inr and FPR) in Piexo1 and Piendo1 was further investigated through electrophoretic mobility shift assays (EMSA). The EMSA studies showed that (i) both core promoters were able to specifically bind a protein or protein complex in a P. infestans whole-cell protein extract and (ii) the same mutations that reduced binding of the EMSA complex also reduced β-glucuronidase (GUS) levels in transient expression assays. The consistency of results obtained using two different assays (GUS transient assays [in vivo] and EMSA studies [in vitro]) supports a convergence of inference about the relative importance of specific nucleotides within the 19-nt core promoter region. PMID:14871940

Absence of mutation at the 5'-upstream promoter region of the TPM4 gene from cardiac mutant axolotl (Ambystoma mexicanum).

Science.gov (United States)

Denz, Christopher R; Zhang, Chi; Jia, Pingping; Du, Jianfeng; Huang, Xupei; Dube, Syamalima; Thomas, Anish; Poiesz, Bernard J; Dube, Dipak K

2011-09-01

Tropomyosins are a family of actin-binding proteins that show cell-specific diversity by a combination of multiple genes and alternative RNA splicing. Of the 4 different tropomyosin genes, TPM4 plays a pivotal role in myofibrillogenesis as well as cardiac contractility in amphibians. In this study, we amplified and sequenced the upstream regulatory region of the TPM4 gene from both normal and mutant axolotl hearts. To identify the cis-elements that are essential for the expression of the TPM4, we created various deletion mutants of the TPM4 promoter DNA, inserted the deleted segments into PGL3 vector, and performed promoter-reporter assay using luciferase as the reporter gene. Comparison of sequences of the promoter region of the TPM4 gene from normal and mutant axolotl revealed no mutations in the promoter sequence of the mutant TPM4 gene. CArG box elements that are generally involved in controlling the expression of several other muscle-specific gene promoters were not found in the upstream regulatory region of the TPM4 gene. In deletion experiments, loss of activity of the reporter gene was noted upon deletion which was then restored upon further deletion suggesting the presence of both positive and negative cis-elements in the upstream regulatory region of the TPM4 gene. We believe that this is the first axolotl promoter that has ever been cloned and studied with clear evidence that it functions in mammalian cell lines. Although striated muscle-specific cis-acting elements are absent from the promoter region of TPM4 gene, our results suggest the presence of positive and negative cis-elements in the promoter region, which in conjunction with positive and negative trans-elements may be involved in regulating the expression of TPM4 gene in a tissue-specific manner.

Functional dissection of Streptococcus pyogenes M5 protein: the hypervariable region is essential for virulence.

Directory of Open Access Journals (Sweden)

Johan Waldemarsson

Full Text Available The surface-localized M protein of Streptococcus pyogenes is a major virulence factor that inhibits phagocytosis, as determined ex vivo. Because little is known about the role of M protein in vivo we analyzed the contribution of different M protein regions to virulence, using the fibrinogen (Fg-binding M5 protein and a mouse model of acute invasive infection. This model was suitable, because M5 is required for mouse virulence and binds mouse and human Fg equally well, as shown here. Mixed infection experiments with wild type bacteria demonstrated that mutants lacking the N-terminal hypervariable region (HVR or the Fg-binding B-repeat region were strongly attenuated, while a mutant lacking the conserved C-repeats was only slightly attenuated. Because the HVR of M5 is not required for phagocytosis resistance, our data imply that this HVR plays a major but unknown role during acute infection. The B-repeat region is required for phagocytosis resistance and specifically binds Fg, suggesting that it promotes virulence by binding Fg. However, B-repeat mutants were attenuated even in Fg-deficient mice, implying that the B-repeats may have a second function, in addition to Fg-binding. These data demonstrate that two distinct M5 regions, including the HVR, are essential to virulence during the early stages of an infection. In particular, our data provide the first in vivo evidence that the HVR of an M protein plays a major role in virulence, focusing interest on the molecular role of this region.

Identification and annotation of promoter regions in microbial

Indian Academy of Sciences (India)

2007-06-15

Jun 15, 2007 ... Analysis of various predicted structural properties of promoter regions in prokaryotic as well as eukaryotic genomes had earlier indicated that they have several common features, such as lower stability, higher curvature and less bendability, when compared with their neighboring regions. Based on the ...

Tumour MLH1 promoter region methylation testing is an effective prescreen for Lynch Syndrome (HNPCC).

Science.gov (United States)

Newton, K; Jorgensen, N M; Wallace, A J; Buchanan, D D; Lalloo, F; McMahon, R F T; Hill, J; Evans, D G

2014-12-01

Lynch syndrome (LS) patients have DNA mismatch repair deficiency and up to 80% lifetime risk of colorectal cancer (CRC). Screening of mutation carriers reduces CRC incidence and mortality. Selection for constitutional mutation testing relies on family history (Amsterdam and Bethesda Guidelines) and tumour-derived biomarkers. Initial biomarker analysis uses mismatch repair protein immunohistochemistry and microsatellite instability. Abnormalities in either identify mismatch repair deficiency but do not differentiate sporadic epigenetic defects, due to MLH1 promoter region methylation (13% of CRCs) from LS (4% of CRCs). A diagnostic biomarker capable of making this distinction would be valuable. This study compared two biomarkers in tumours with mismatch repair deficiency; quantification of methylation of the MLH1 promoter region using a novel assay and BRAF c.1799T>A, p.(Val600Glu) mutation status in the identification of constitutional mutations. Tumour DNA was extracted (formalin fixed, paraffin embedded, FFPE tissue) and pyrosequencing used to test for MLH1 promoter methylation and presence of the BRAF c.1799T>A, p.(Val600Glu) mutation 71 CRCs from individuals with pathogenic MLH1 mutations and 73 CRCs with sporadic MLH1 loss. Specificity and sensitivity was compared. Unmethylated MLH1 promoter: sensitivity 94.4% (95% CI 86.2% to 98.4%), specificity 87.7% (95% CI 77.9% to 94.2%), Wild-type BRAF (codon 600): sensitivity 65.8% (95% CI 53.7% to 76.5%), specificity 98.6% (95% CI 92.4% to 100.0%) for the identification of those with pathogenic MLH1 mutations. Quantitative MLH1 promoter region methylation using pyrosequencing is superior to BRAF codon 600 mutation status in identifying constitutional mutations in mismatch repair deficient tumours. Published by the BMJ Publishing Group Limited. For permission to use (where not already granted under a licence) please go to http://group.bmj.com/group/rights-licensing/permissions.

The LIKE system, a novel protein expression toolbox for Bacillus subtilis based on the liaI promoter

Science.gov (United States)

2012-01-01

Background Bacillus subtilis is a very important Gram-positive model organism of high biotechnological relevance, which is widely used as a host for the production of both secreted and cytoplasmic proteins. We developed a novel and efficient expression system, based on the liaI promoter (PliaI) from B. subtilis, which is under control of the LiaRS antibiotic-inducible two-component system. In the absence of a stimulus, this promoter is kept tightly inactive. Upon induction by cell wall antibiotics, it shows an over 100-fold increase in activity within 10 min. Results Based on these traits of PliaI, we developed a novel LiaRS-controlled gene expression system for B. subtilis (the “LIKE" system). Two expression vectors, the integrative pLIKE-int and the replicative pLIKE-rep, were constructed. To enhance the performance of the PliaI-derived system, site-directed mutagenesis was employed to optimize the ribosome binding site and alter its spacing to the initiation codon used for the translational fusion. The impact of these genetic modifications on protein production yield was measured using GFP as a model protein. Moreover, a number of tailored B. subtilis expression strains containing different markerless chromosomal deletions of the liaIH region were constructed to circumvent undesired protein production, enhance the positive autoregulation of the LiaRS system and thereby increase target gene expression strength from the PliaI promoter. Conclusions The LIKE protein expression system is a novel protein expression system, which offers a number of advantages over existing systems. Its major advantages are (i) a tightly switched-off promoter during exponential growth in the absence of a stimulus, (ii) a concentration-dependent activation of PliaI in the presence of suitable inducers, (iii) a very fast but transient response with a very high dynamic range of over 100-fold (up to 1,000-fold) induction, (iv) a choice from a range of well-defined, commercially available

Genetic basis of olfactory cognition: extremely high level of DNA sequence polymorphism in promoter regions of the human olfactory receptor genes revealed using the 1000 Genomes Project dataset.

Science.gov (United States)

Ignatieva, Elena V; Levitsky, Victor G; Yudin, Nikolay S; Moshkin, Mikhail P; Kolchanov, Nikolay A

2014-01-01

The molecular mechanism of olfactory cognition is very complicated. Olfactory cognition is initiated by olfactory receptor proteins (odorant receptors), which are activated by olfactory stimuli (ligands). Olfactory receptors are the initial player in the signal transduction cascade producing a nerve impulse, which is transmitted to the brain. The sensitivity to a particular ligand depends on the expression level of multiple proteins involved in the process of olfactory cognition: olfactory receptor proteins, proteins that participate in signal transduction cascade, etc. The expression level of each gene is controlled by its regulatory regions, and especially, by the promoter [a region of DNA about 100-1000 base pairs long located upstream of the transcription start site (TSS)]. We analyzed single nucleotide polymorphisms using human whole-genome data from the 1000 Genomes Project and revealed an extremely high level of single nucleotide polymorphisms in promoter regions of olfactory receptor genes and HLA genes. We hypothesized that the high level of polymorphisms in olfactory receptor promoters was responsible for the diversity in regulatory mechanisms controlling the expression levels of olfactory receptor proteins. Such diversity of regulatory mechanisms may cause the great variability of olfactory cognition of numerous environmental olfactory stimuli perceived by human beings (air pollutants, human body odors, odors in culinary etc.). In turn, this variability may provide a wide range of emotional and behavioral reactions related to the vast variety of olfactory stimuli.

ESR1 gene promoter region methylation in free circulating DNA and its correlation with estrogen receptor protein expression in tumor tissue in breast cancer patients

International Nuclear Information System (INIS)

Martínez-Galán, Joaquina; Ríos, Sandra; Delgado, Juan Ramón; Torres-Torres, Blanca; Núñez, María Isabel; López-Peñalver, Jesús; Del Moral, Rosario; Ruiz De Almodóvar, José Mariano; Menjón, Salomón; Concha, Ángel; Chamorro, Clara

2014-01-01

Tumor expression of estrogen receptor (ER) is an important marker of prognosis, and is predictive of response to endocrine therapy in breast cancer. Several studies have observed that epigenetic events, such methylation of cytosines and deacetylation of histones, are involved in the complex mechanisms that regulate promoter transcription. However, the exact interplay of these factors in transcription activity is not well understood. In this study, we explored the relationship between ER expression status in tumor tissue samples and the methylation of the 5′ CpG promoter region of the estrogen receptor gene (ESR1) isolated from free circulating DNA (fcDNA) in plasma samples from breast cancer patients. Patients (n = 110) with non-metastatic breast cancer had analyses performed of ER expression (luminal phenotype in tumor tissue, by immunohistochemistry method), and the ESR1-DNA methylation status (fcDNA in plasma, by quantitative methylation specific PCR technique). Our results showed a significant association between presence of methylated ESR1 in patients with breast cancer and ER negative status in the tumor tissue (p = 0.0179). There was a trend towards a higher probability of ESR1-methylation in those phenotypes with poor prognosis i.e. 80% of triple negative patients, 60% of HER2 patients, compared to 28% and 5.9% of patients with better prognosis such as luminal A and luminal B, respectively. Silencing, by methylation, of the promoter region of the ESR1 affects the expression of the estrogen receptor protein in tumors of breast cancer patients; high methylation of ESR1-DNA is associated with estrogen receptor negative status which, in turn, may be implicated in the patient’s resistance to hormonal treatment in breast cancer. As such, epigenetic markers in plasma may be of interest as new targets for anticancer therapy, especially with respect to endocrine treatment

SCOWLP classification: Structural comparison and analysis of protein binding regions

Directory of Open Access Journals (Sweden)

Anders Gerd

2008-01-01

Full Text Available Abstract Background Detailed information about protein interactions is critical for our understanding of the principles governing protein recognition mechanisms. The structures of many proteins have been experimentally determined in complex with different ligands bound either in the same or different binding regions. Thus, the structural interactome requires the development of tools to classify protein binding regions. A proper classification may provide a general view of the regions that a protein uses to bind others and also facilitate a detailed comparative analysis of the interacting information for specific protein binding regions at atomic level. Such classification might be of potential use for deciphering protein interaction networks, understanding protein function, rational engineering and design. Description Protein binding regions (PBRs might be ideally described as well-defined separated regions that share no interacting residues one another. However, PBRs are often irregular, discontinuous and can share a wide range of interacting residues among them. The criteria to define an individual binding region can be often arbitrary and may differ from other binding regions within a protein family. Therefore, the rational behind protein interface classification should aim to fulfil the requirements of the analysis to be performed. We extract detailed interaction information of protein domains, peptides and interfacial solvent from the SCOWLP database and we classify the PBRs of each domain family. For this purpose, we define a similarity index based on the overlapping of interacting residues mapped in pair-wise structural alignments. We perform our classification with agglomerative hierarchical clustering using the complete-linkage method. Our classification is calculated at different similarity cut-offs to allow flexibility in the analysis of PBRs, feature especially interesting for those protein families with conflictive binding regions

Epigenetic transgenerational actions of vinclozolin on promoter regions of the sperm epigenome.

Directory of Open Access Journals (Sweden)

Carlos Guerrero-Bosagna

2010-09-01

Full Text Available Previous observations have demonstrated that embryonic exposure to the endocrine disruptor vinclozolin during gonadal sex determination promotes transgenerational adult onset disease such as male infertility, kidney disease, prostate disease, immune abnormalities and tumor development. The current study investigates genome-wide promoter DNA methylation alterations in the sperm of F3 generation rats whose F0 generation mother was exposed to vinclozolin. A methylated DNA immunoprecipitation with methyl-cytosine antibody followed by a promoter tilling microarray (MeDIP-Chip procedure was used to identify 52 different regions with statistically significant altered methylation in the sperm promoter epigenome. Mass spectrometry bisulfite analysis was used to map the CpG DNA methylation and 16 differential DNA methylation regions were confirmed, while the remainder could not be analyzed due to bisulfite technical limitations. Analysis of these validated regions identified a consensus DNA sequence (motif that associated with 75% of the promoters. Interestingly, only 16.8% of a random set of 125 promoters contained this motif. One candidate promoter (Fam111a was found to be due to a copy number variation (CNV and not a methylation change, suggesting initial alterations in the germline epigenome may promote genetic abnormalities such as induced CNV in later generations. This study identifies differential DNA methylation sites in promoter regions three generations after the initial exposure and identifies common genome features present in these regions. In addition to primary epimutations, a potential indirect genetic abnormality was identified, and both are postulated to be involved in the epigenetic transgenerational inheritance observed. This study confirms that an environmental agent has the ability to induce epigenetic transgenerational changes in the sperm epigenome.

Epigenetic transgenerational actions of vinclozolin on promoter regions of the sperm epigenome.

Science.gov (United States)

Guerrero-Bosagna, Carlos; Settles, Matthew; Lucker, Ben; Skinner, Michael K

2010-09-30

Previous observations have demonstrated that embryonic exposure to the endocrine disruptor vinclozolin during gonadal sex determination promotes transgenerational adult onset disease such as male infertility, kidney disease, prostate disease, immune abnormalities and tumor development. The current study investigates genome-wide promoter DNA methylation alterations in the sperm of F3 generation rats whose F0 generation mother was exposed to vinclozolin. A methylated DNA immunoprecipitation with methyl-cytosine antibody followed by a promoter tilling microarray (MeDIP-Chip) procedure was used to identify 52 different regions with statistically significant altered methylation in the sperm promoter epigenome. Mass spectrometry bisulfite analysis was used to map the CpG DNA methylation and 16 differential DNA methylation regions were confirmed, while the remainder could not be analyzed due to bisulfite technical limitations. Analysis of these validated regions identified a consensus DNA sequence (motif) that associated with 75% of the promoters. Interestingly, only 16.8% of a random set of 125 promoters contained this motif. One candidate promoter (Fam111a) was found to be due to a copy number variation (CNV) and not a methylation change, suggesting initial alterations in the germline epigenome may promote genetic abnormalities such as induced CNV in later generations. This study identifies differential DNA methylation sites in promoter regions three generations after the initial exposure and identifies common genome features present in these regions. In addition to primary epimutations, a potential indirect genetic abnormality was identified, and both are postulated to be involved in the epigenetic transgenerational inheritance observed. This study confirms that an environmental agent has the ability to induce epigenetic transgenerational changes in the sperm epigenome.

Soy protein isolate inhibits hepatic tumor promotion in mice fed a high-fat liquid diet.

Science.gov (United States)

Mercer, Kelly E; Pulliam, Casey F; Pedersen, Kim B; Hennings, Leah; Ronis, Martin Jj

2017-03-01

Alcoholic and nonalcoholic fatty liver diseases are risk factors for development of hepatocellular carcinoma, but the underlying mechanisms are poorly understood. On the other hand, ingestion of soy-containing diets may oppose the development of certain cancers. We previously reported that replacing casein with a soy protein isolate reduced tumor promotion in the livers of mice with alcoholic liver disease after feeding a high fat ethanol liquid diet following initiation with diethylnitrosamine. Feeding soy protein isolate inhibited processes that may contribute to tumor promotion including inflammation, sphingolipid signaling, and Wnt/β-catenin signaling. We have extended these studies to characterize liver tumor promotion in a model of nonalcoholic fatty liver disease produced by chronic feeding of high-fat liquid diets in the absence of ethanol. Mice treated with diethylnitrosamine on postnatal day 14 were fed a high-fat liquid diet made with casein or SPI as the sole protein source for 16 weeks in adulthood. Relative to mice fed normal chow, a high fat/casein diet led to increased tumor promotion, hepatocyte proliferation, steatosis, and inflammation. Replacing casein with soy protein isolate counteracted these effects. The high fat diets also resulted in a general increase in transcripts for Wnt/β-catenin pathway components, which may be an important mechanism, whereby hepatic tumorigenesis is promoted. However, soy protein isolate did not block Wnt signaling in this nonalcoholic fatty liver disease model. We conclude that replacing casein with soy protein isolate blocks development of steatosis, inflammation, and tumor promotion in diethylnitrosamine-treated mice fed high fat diets. Impact statement The impact of dietary components on cancer is a topic of great interest for both the general public and the scientific community. Liver cancer is currently the second leading form of cancer deaths worldwide. Our study has addressed the effect of the protein

Unveiling DNA structural properties of promoter regions of ...

Indian Academy of Sciences (India)

Aditya Kumar

Unveiling DNA structural properties of promoter regions of prokaryotic transcriptome and their role in gene expression. Aditya Kumar. Assistant Professor. Molecular Biology & Biotechnology. Tezpur University. Tezpur – 784028, Assam ...

Genetic basis of olfactory cognition: extremely high level of DNA sequence polymorphism in promoter regions of the human olfactory receptor genes revealed using the 1000 Genomes Project dataset

Directory of Open Access Journals (Sweden)

Elena V. Ignatieva

2014-03-01

Full Text Available The molecular mechanism of olfactory cognition is very complicated. Olfactory cognition is initiated by olfactory receptor proteins (odorant receptors, which are activated by olfactory stimuli (ligands. Olfactory receptors are the initial player in the signal transduction cascade producing a nerve impulse, which is transmitted to the brain. The sensitivity to a particular ligand depends on the expression level of multiple proteins involved in the process of olfactory cognition: olfactory receptor proteins, proteins that participate in signal transduction cascade, etc. The expression level of each gene is controlled by its regulatory regions, and especially, by the promoter (a region of DNA about 100–1000 base pairs long located upstream of the transcription start site. We analyzed single nucleotide polymorphisms using human whole-genome data from the 1000 Genomes Project and revealed an extremely high level of single nucleotide polymorphisms in promoter regions of olfactory receptor genes and HLA genes. We hypothesized that the high level of polymorphisms in olfactory receptor promoters was responsible for the diversity in regulatory mechanisms controlling the expression levels of olfactory receptor proteins. Such diversity of regulatory mechanisms may cause the great variability of olfactory cognition of numerous environmental olfactory stimuli perceived by human beings (air pollutants, human body odors, odors in culinary etc.. In turn, this variability may provide a wide range of emotional and behavioral reactions related to the vast variety of olfactory stimuli.

Localization of a Region in the Fusion Protein of Avian Metapneumovirus That Modulates Cell-Cell Fusion

Science.gov (United States)

Wei, Yongwei; Feng, Kurtis; Yao, Xiangjie; Cai, Hui; Li, Junan; Mirza, Anne M.; Iorio, Ronald M.

2012-01-01

The genus Metapneumovirus within the subfamily Pneumovirinae of the family Paramyxoviridae includes two members, human metapneumovirus (hMPV) and avian metapneumovirus (aMPV), causing respiratory tract infections in humans and birds, respectively. Paramyxoviruses enter host cells by fusing the viral envelope with a host cell membrane. Membrane fusion of hMPV appears to be unique, in that fusion of some hMPV strains requires low pH. Here, we show that the fusion (F) proteins of aMPV promote fusion in the absence of the attachment protein and low pH is not required. Furthermore, there are notable differences in cell-cell fusion among aMPV subtypes. Trypsin was required for cell-cell fusion induced by subtype B but not subtypes A and C. The F protein of aMPV subtype A was highly fusogenic, whereas those from subtypes B and C were not. By construction and evaluation of chimeric F proteins composed of domains from the F proteins of subtypes A and B, we localized a region composed of amino acid residues 170 to 338 in the F protein that is responsible for the hyperfusogenic phenotype of the F from subtype A. Further mutagenesis analysis revealed that residues R295, G297, and K323 in this region collectively contributed to the hyperfusogenicity. Taken together, we have identified a region in the aMPV F protein that modulates the extent of membrane fusion. A model for fusion consistent with these data is presented. PMID:22915815

Localization of a region in the fusion protein of avian metapneumovirus that modulates cell-cell fusion.

Science.gov (United States)

Wei, Yongwei; Feng, Kurtis; Yao, Xiangjie; Cai, Hui; Li, Junan; Mirza, Anne M; Iorio, Ronald M; Li, Jianrong

2012-11-01

The genus Metapneumovirus within the subfamily Pneumovirinae of the family Paramyxoviridae includes two members, human metapneumovirus (hMPV) and avian metapneumovirus (aMPV), causing respiratory tract infections in humans and birds, respectively. Paramyxoviruses enter host cells by fusing the viral envelope with a host cell membrane. Membrane fusion of hMPV appears to be unique, in that fusion of some hMPV strains requires low pH. Here, we show that the fusion (F) proteins of aMPV promote fusion in the absence of the attachment protein and low pH is not required. Furthermore, there are notable differences in cell-cell fusion among aMPV subtypes. Trypsin was required for cell-cell fusion induced by subtype B but not subtypes A and C. The F protein of aMPV subtype A was highly fusogenic, whereas those from subtypes B and C were not. By construction and evaluation of chimeric F proteins composed of domains from the F proteins of subtypes A and B, we localized a region composed of amino acid residues 170 to 338 in the F protein that is responsible for the hyperfusogenic phenotype of the F from subtype A. Further mutagenesis analysis revealed that residues R295, G297, and K323 in this region collectively contributed to the hyperfusogenicity. Taken together, we have identified a region in the aMPV F protein that modulates the extent of membrane fusion. A model for fusion consistent with these data is presented.

Tumour MLH1 promoter region methylation testing is an effective pre-screen for Lynch Syndrome (HNPCC)

Science.gov (United States)

Newton, K; Jorgensen, NM; Wallace, AJ; Buchanan, DD; Lalloo, F; McMahon, RFT; Hill, J; Evans, DG

2016-01-01

Background & Aims Lynch syndrome patients have DNA mismatch repair deficiency and up to 80% life-time risk of colorectal cancer. Screening of mutation carriers reduces colorectal cancer incidence and mortality. Selection for constitutional mutation testing relies on family history (Amsterdam and Bethesda Guidelines) and tumour derived biomarkers. Initial biomarker analysis uses mismatch repair protein immunohistochemistry and microsatellite instability. Abnormalities in either identify mismatch repair deficiency but do not differentiate sporadic epigenetic defects, due to MLH1 promoter region methylation (13% of CRCs) from Lynch Syndrome (4% of CRCs). A diagnostic biomarker capable of making this distinction would be valuable. This study compared two biomarkers in tumours with mismatch repair deficiency; quantification of methylation of the MLH1 promoter region using a novel assay and BRAF c.1799T>A, p.(Val600Glu) mutation status in the identification of constitutional mutations. Methods Tumour DNA was extracted (FFPE tissue) and pyrosequencing used to test for MLH1 promoter methylation and presence of the BRAF c.1799T>A, p.(Val600Glu) mutation 71 CRCs from individuals with pathogenic MLH1 mutations and 73 CRCs with sporadic MLH1 loss. Specificity and sensitivity was compared. Findings Unmethylated MLH1 promoter: sensitivity 94.4% (95% CI 86.2–98.4%), specificity 87.7% (95% CI 77.9–94.2%), Wild-type BRAF (codon 600): sensitivity 65.8% (95% CI 53.7–76.5%), specificity 98.6% (95% CI 92.4–100.0%) for the identification of those with pathogenic MLH1 mutations. Conclusions Quantitative MLH1 promoter region methylation using pyrosequencing is superior to BRAF codon 600 mutation status in identifying constitutional mutations in mismatch repair deficient tumours. PMID:25280751

Social Media Marketing as a tool for promoting the regional investment portals

Directory of Open Access Journals (Sweden)

Alisa Yu. Fadeyeva

2016-01-01

Full Text Available Objective to investigate the potential of Social Media Marketing as a tool for promoting regional investment portals in the information environment to identify the most effective ways of its implementation and to determine the level of mastering of this tool by the Russian regions. Methods general scientific methods observation comparison analysis induction deduction analogy classification. Results the analysis showed that today Social Media Marketing is an essential tool for interaction with the investment community and one of the most effective ways to promote the regional portal which allows to increase the knowledge of and loyalty to the brand to increase the targeted website traffic to increase the awareness of investors about the specific features of the portal and the regional development agenciesrsquo functioning to promptly receive information about the investment environment and to establish contacts with investors. At the same time the study of SMMactivity in the Russian regions revealed a very low level of quality of communication with investors through social networks. Scientific novelty for the first time the article investigates the significance and makes the comparative analysis of the Social Media Marketing channels with regard to investment promotion agencies as well as the results of the regional structures functioning for effective communication through social networks. Practical significance the main results of the research can be used by the regional investment agencies in order to promote their websites increase the quality of communication with investors and promote the investment attractiveness of the region as a whole. nbsp

Effect of Promoter Region Mutations and mgrA Overexpression on Transcription of norA, Which Encodes a Staphylococcus aureus Multidrug Efflux Transporter

OpenAIRE

Kaatz, Glenn W.; Thyagarajan, Rama V.; Seo, Susan M.

2005-01-01

NorA is a Staphylococcus aureus multidrug transporter that confers resistance to structurally distinct compounds. The MgrA global regulatory protein is reported to augment norA expression when mgrA is overexpressed from an undefined plasmid-based promoter. Further details about norA regulatory mechanisms are scant. A chromosomal norA::lacZ transcriptional fusion was constructed in different S. aureus strains, and allele replacement was used to define the relevance of promoter region sequences...

Prefoldin Promotes Proteasomal Degradation of Cytosolic Proteins with Missense Mutations by Maintaining Substrate Solubility.

Directory of Open Access Journals (Sweden)

Sophie A Comyn

2016-07-01

Full Text Available Misfolded proteins challenge the ability of cells to maintain protein homeostasis and can accumulate into toxic protein aggregates. As a consequence, cells have adopted a number of protein quality control pathways to prevent protein aggregation, promote protein folding, and target terminally misfolded proteins for degradation. In this study, we employed a thermosensitive allele of the yeast Guk1 guanylate kinase as a model misfolded protein to investigate degradative protein quality control pathways. We performed a flow cytometry based screen to identify factors that promote proteasomal degradation of proteins misfolded as the result of missense mutations. In addition to the E3 ubiquitin ligase Ubr1, we identified the prefoldin chaperone subunit Gim3 as an important quality control factor. Whereas the absence of GIM3 did not impair proteasomal function or the ubiquitination of the model substrate, it led to the accumulation of the poorly soluble model substrate in cellular inclusions that was accompanied by delayed degradation. We found that Gim3 interacted with the Guk1 mutant allele and propose that prefoldin promotes the degradation of the unstable model substrate by maintaining the solubility of the misfolded protein. We also demonstrated that in addition to the Guk1 mutant, prefoldin can stabilize other misfolded cytosolic proteins containing missense mutations.

Genome-wide Anaplasma phagocytophilum AnkA-DNA interactions are enriched in intergenic regions and gene promoters and correlate with infection-induced differential gene expression.

Directory of Open Access Journals (Sweden)

J Stephen Dumler

2016-09-01

Full Text Available Anaplasma phagocytophilum, an obligate intracellular prokaryote, infects neutrophils and alters cardinal functions via reprogrammed transcription. Large contiguous regions of neutrophil chromosomes are differentially expressed during infection. Secreted A. phagocytophilum effector AnkA transits into the neutrophil or granulocyte nucleus to complex with DNA in heterochromatin across all chromosomes. AnkA binds to gene promoters to dampen cis-transcription and also has features of matrix attachment region (MAR-binding proteins that regulate three-dimensional chromatin architecture and coordinate transcriptional programs encoded in topologically-associated chromatin domains. We hypothesize that identification of additional AnkA binding sites will better delineate how A. phagocytophilum infection results in reprogramming of the neutrophil genome. Using AnkA-binding ChIP-seq, we showed that AnkA binds broadly throughout all chromosomes in a reproducible pattern, especially at: i intergenic regions predicted to be matrix attachment regions (MARs; ii within predicted lamina-associated domains; and iii at promoters ≤3,000 bp upstream of transcriptional start sites. These findings provide genome-wide support for AnkA as a regulator of cis-gene transcription. Moreover, the dominant mark of AnkA in distal intergenic regions known to be AT-enriched, coupled with frequent enrichment in the nuclear lamina, provides strong support for its role as a MAR-binding protein and genome re-organizer. AnkA must be considered a prime candidate to promote neutrophil reprogramming and subsequent functional changes that belie improved microbial fitness and pathogenicity.

Enhanced expression of membrane proteins in E. coli with a PBAD promoter mutant: synergies with chaperone pathway engineering strategies

Directory of Open Access Journals (Sweden)

Nannenga Brent L

2011-12-01

Full Text Available Abstract Background Membrane proteins (MPs populate 20-30% of genomes sequenced to date and hold potential as therapeutic targets as well as for practical applications in bionanotechnology. However, MP toxicity and low yields in normally robust expression hosts such as E. coli has curtailed progress in our understanding of their structure and function. Results Using the seven transmembrane segments H. turkmenica deltarhodopsin (HtdR as a reporter, we isolated a spontaneous mutant in the arabinose-inducible PBAD promoter leading to improved cell growth and a twofold increase in the recovery of active HtdR at 37°C. A single transversion in a conserved region of the cyclic AMP receptor protein binding site caused the phenotype by reducing htdR transcript levels by 65%. When the mutant promoter was used in conjunction with a host lacking the molecular chaperone Trigger Factor (Δtig cells, toxicity was further suppressed and the amount of correctly folded HtdR was 4-fold that present in the membranes of control cells. More importantly, while improved growth barely compensated for the reduction in transcription rates when another polytopic membrane protein (N. pharonis sensory rhodopsin II was expressed under control of the mutant promoter in wild type cells, a 4-fold increase in productivity could be achieved in a Δtig host. Conclusions Our system, which combines a downregulated version of the tightly repressed PBAD promoter with a TF-deficient host may prove a valuable alternative to T7-based expression for the production of membrane proteins that have so far remained elusive targets.

The promoter of the pepper pathogen-induced membrane protein gene CaPIMP1 mediates environmental stress responses in plants.

Science.gov (United States)

Hong, Jeum Kyu; Hwang, Byung Kook

2009-01-01

The promoter of the pepper pathogen-induced membrane protein gene CaPIMP1 was analyzed by an Agrobacterium-mediated transient expression assay in tobacco leaves. Several stress-related cis-acting elements (GT-1, W-box and ABRE) are located within the CaPIMP1 promoter. In tobacco leaf tissues transiently transformed with a CaPIMP1 promoter-beta-glucuronidase (GUS) gene fusion, serially 5'-deleted CaPIMP1 promoters were differentially activated by Pseudomonas syringae pv. tabaci, ethylene, methyl jasmonate, abscisic acid, and nitric oxide. The -1,193 bp region of the CaPIMP1 gene promoter sequence exhibited full promoter activity. The -417- and -593 bp promoter regions were sufficient for GUS gene activation by ethylene and methyl jasmonate treatments, respectively. However, CaPIMP1 promoter sequences longer than -793 bp were required for promoter activation by abscisic acid and sodium nitroprusside treatments. CaPIMP1 expression was activated in pepper leaves by treatment with ethylene, methyl jasmonate, abscisic acid, beta-amino-n-butyric acid, NaCl, mechanical wounding, and low temperature, but not with salicylic acid. Overexpression of CaPIMP1 in Arabidopsis conferred hypersensitivity to mannitol, NaCl, and ABA during seed germination but not during seedling development. In contrast, transgenic plants overexpressing CaPIMP1 exhibited enhanced tolerance to oxidative stress induced by methyl viologen during germination and early seedling stages. These results suggest that CaPIMP1 expression may alter responsiveness to environmental stress, as well as to pathogen infection.

Discovery of a super-strong promoter enables efficient production of heterologous proteins in cyanobacteria.

Science.gov (United States)

Zhou, Jie; Zhang, Haifeng; Meng, Hengkai; Zhu, Yan; Bao, Guanhui; Zhang, Yanping; Li, Yin; Ma, Yanhe

2014-03-28

Cyanobacteria are oxygenic photosynthetic prokaryotes that play important roles in the global carbon cycle. Recently, engineered cyanobacteria capable of producing various small molecules from CO2 have been developed. However, cyanobacteria are seldom considered as factories for producing proteins, mainly because of the lack of efficient strong promoters. Here, we report the discovery and verification of a super-strong promoter P(cpc560), which contains two predicted promoters and 14 predicted transcription factor binding sites (TFBSs). Using P(cpc560), functional proteins were produced at a level of up to 15% of total soluble protein in the cyanobacterium Synechocystis sp. 6803, a level comparable to that produced in Escherichia coli. We demonstrated that the presence of multiple TFBSs in P(cpc560) is crucial for its promoter strength. Genetically transformable cyanobacteria neither have endotoxins nor form inclusion bodies; therefore, P(cpc560) opens the possibility to use cyanobacteria as alternative hosts for producing heterogeneous proteins from CO2 and inorganic nutrients.

Understanding the molecular basis of plant growth promotional effect of Pseudomonas fluorescens on rice through protein profiling.

Science.gov (United States)

Kandasamy, Saveetha; Loganathan, Karthiba; Muthuraj, Raveendran; Duraisamy, Saravanakumar; Seetharaman, Suresh; Thiruvengadam, Raguchander; Ponnusamy, Balasubramanian; Ramasamy, Samiyappan

2009-12-24

Plant Growth Promoting Rhizobacteria (PGPR), Pseudomonas fluorescens strain KH-1 was found to exhibit plant growth promotional activity in rice under both in-vitro and in-vivo conditions. But the mechanism underlying such promotional activity of P. fluorescens is not yet understood clearly. In this study, efforts were made to elucidate the molecular responses of rice plants to P. fluorescens treatment through protein profiling. Two-dimensional polyacrylamide gel electrophoresis strategy was adopted to identify the PGPR responsive proteins and the differentially expressed proteins were analyzed by mass spectrometry. Priming of P. fluorescens, 23 different proteins found to be differentially expressed in rice leaf sheaths and MS analysis revealed the differential expression of some important proteins namely putative p23 co-chaperone, Thioredoxin h- rice, Ribulose-bisphosphate carboxylase large chain precursor, Nucleotide diPhosphate kinase, Proteosome sub unit protein and putative glutathione S-transferase protein. Functional analyses of the differential proteins were reported to be directly or indirectly involved in growth promotion in plants. Thus, this study confirms the primary role of PGPR strain KH-1 in rice plant growth promotion.

Identification and annotation of promoter regions in microbial ...

Indian Academy of Sciences (India)

PRAKASH KUMAR

2007-06-15

Jun 15, 2007 ... It remains important, not only to detect rarely expressed genes but also for ... well as in identifying genes associated with rRNA, tRNA and ... DNA stability; free energy calculation; promoter; upstream and downstream region.

Isolation and characterization of an ubiquitin extension protein gene (JcUEP) promoter from Jatropha curcas.

Science.gov (United States)

Tao, Yan-Bin; He, Liang-Liang; Niu, Long-Jian; Xu, Zeng-Fu

2015-04-01

The JcUEP promoter is active constitutively in the bio-fuel plant Jatropha curcas , and is an alternative to the widely used CaMV35S promoter for driving constitutive overexpression of transgenes in Jatropha. Well-characterized promoters are required for transgenic breeding of Jatropha curcas, a biofuel feedstock with great potential for production of bio-diesel and bio-jet fuel. In this study, an ubiquitin extension protein gene from Jatropha, designated JcUEP, was identified to be ubiquitously expressed. Thus, we isolated a 1.2 kb fragment of the 5' flanking region of JcUEP and evaluated its activity as a constitutive promoter in Arabidopsis and Jatropha using the β-glucuronidase (GUS) reporter gene. As expected, histochemical GUS assay showed that the JcUEP promoter was active in all Arabidopsis and Jatropha tissues tested. We also compared the activity of the JcUEP promoter with that of the cauliflower mosaic virus 35S (CaMV35S) promoter, a well-characterized constitutive promoter conferring strong transgene expression in dicot species, in various tissues of Jatropha. In a fluorometric GUS assay, the two promoters showed similar activities in stems, mature leaves and female flowers; while the CaMV35S promoter was more effective than the JcUEP promoter in other tissues, especially young leaves and inflorescences. In addition, the JcUEP promoter retained its activity under stress conditions in low temperature, high salt, dehydration and exogenous ABA treatments. These results suggest that the plant-derived JcUEP promoter could be an alternative to the CaMV35S promoter for driving constitutive overexpression of transgenes in Jatropha and other plants.

Assessing the effects of data selection and representation on the development of reliable E. coli sigma 70 promoter region predictors.

Directory of Open Access Journals (Sweden)

Mostafa M Abbas

Full Text Available As the number of sequenced bacterial genomes increases, the need for rapid and reliable tools for the annotation of functional elements (e.g., transcriptional regulatory elements becomes more desirable. Promoters are the key regulatory elements, which recruit the transcriptional machinery through binding to a variety of regulatory proteins (known as sigma factors. The identification of the promoter regions is very challenging because these regions do not adhere to specific sequence patterns or motifs and are difficult to determine experimentally. Machine learning represents a promising and cost-effective approach for computational identification of prokaryotic promoter regions. However, the quality of the predictors depends on several factors including: i training data; ii data representation; iii classification algorithms; iv evaluation procedures. In this work, we create several variants of E. coli promoter data sets and utilize them to experimentally examine the effect of these factors on the predictive performance of E. coli σ70 promoter models. Our results suggest that under some combinations of the first three criteria, a prediction model might perform very well on cross-validation experiments while its performance on independent test data is drastically very poor. This emphasizes the importance of evaluating promoter region predictors using independent test data, which corrects for the over-optimistic performance that might be estimated using the cross-validation procedure. Our analysis of the tested models shows that good prediction models often perform well despite how the non-promoter data was obtained. On the other hand, poor prediction models seems to be more sensitive to the choice of non-promoter sequences. Interestingly, the best performing sequence-based classifiers outperform the best performing structure-based classifiers on both cross-validation and independent test performance evaluation experiments. Finally, we propose a

Promoter analysis of the Chilo iridescent virus DNA polymerase and major capsid protein genes

International Nuclear Information System (INIS)

Nalcacioglu, Remziye; Marks, Hendrik; Vlak, Just M.; Demirbag, Zihni; Oers, Monique M. van

2003-01-01

The DNA polymerase (DNApol) and major capsid protein (MCP) genes were used as models to study promoter activity in Chilo iridescent virus (CIV). Infection of Bombyx mori SPC-BM-36 cells in the presence of inhibitors of DNA or protein synthesis showed that DNApol, as well as helicase, is an immediate-early gene and confirmed that the major capsid protein (MCP) is a late gene. Transcription of DNApol initiated 35 nt upstream and that of MCP 14 nt upstream of the translational start site. In a luciferase reporter gene assay both promoters were active only when cells were infected with CIV. For DNApol sequences between position -27 and -6, relative to the transcriptional start site, were essential for promoter activity. Furthermore, mutation of a G within the sequence TTGTTTT located just upstream of the DNApol transcription initiation site reduced the promoter activity by 25%. Sequences crucial for MCP promoter activity are located between positions -53 and -29

The cancer-promoting gene fatty acid-binding protein 5 (FABP5) is epigenetically regulated during human prostate carcinogenesis.

Science.gov (United States)

Kawaguchi, Koichiro; Kinameri, Ayumi; Suzuki, Shunsuke; Senga, Shogo; Ke, Youqiang; Fujii, Hiroshi

2016-02-15

FABPs (fatty-acid-binding proteins) are a family of low-molecular-mass intracellular lipid-binding proteins consisting of ten isoforms. FABPs are involved in binding and storing hydrophobic ligands such as long-chain fatty acids, as well as transporting these ligands to the appropriate compartments in the cell. FABP5 is overexpressed in multiple types of tumours. Furthermore, up-regulation of FABP5 is strongly associated with poor survival in triple-negative breast cancer. However, the mechanisms underlying the specific up-regulation of the FABP5 gene in these cancers remain poorly characterized. In the present study, we determined that FABP5 has a typical CpG island around its promoter region. The DNA methylation status of the CpG island in the FABP5 promoter of benign prostate cells (PNT2), prostate cancer cells (PC-3, DU-145, 22Rv1 and LNCaP) and human normal or tumour tissue was assessed by bisulfite sequencing analysis, and then confirmed by COBRA (combined bisulfite restriction analysis) and qAMP (quantitative analysis of DNA methylation using real-time PCR). These results demonstrated that overexpression of FABP5 in prostate cancer cells can be attributed to hypomethylation of the CpG island in its promoter region, along with up-regulation of the direct trans-acting factors Sp1 (specificity protein 1) and c-Myc. Together, these mechanisms result in the transcriptional activation of FABP5 expression during human prostate carcinogenesis. Importantly, silencing of Sp1, c-Myc or FABP5 expression led to a significant decrease in cell proliferation, indicating that up-regulation of FABP5 expression by Sp1 and c-Myc is critical for the proliferation of prostate cancer cells. © 2016 Authors; published by Portland Press Limited.

Sequence analysis of the Epstein-Barr virus (EBV) latent membrane protein-1 gene and promoter region

DEFF Research Database (Denmark)

Sandvej, Kristian; Gratama, J W; Munch, M

1997-01-01

Sequence variations in the Epstein-Barr virus (EBV) encoded latent membrane protein-1 (LMP-1) gene have been described in a Chinese nasopharyngeal carcinoma-derived isolate (CAO), and in viral isolates from various EBV-associated tumors. It has been suggested that these genetic changes, which...... include loss of a Xho I restriction site (position 169425) and a C-terminal 30-base pair (bp) deletion (position 168287-168256), define EBV genotypes associated with increased tumorigenicity or with disease among particular geographic populations. To determine the frequency of LMP-1 variations in European...... wild-type virus isolates, we sequenced the LMP-1 promoter and gene in EBV from lymphoblastoid cell lines from healthy carriers and patients without EBV-associated disease. Sequence changes were often present, and defined at least four main groups of viral isolates, which we designate Groups A through D...

Identification of a 450-bp region of human papillomavirus type 1 that promotes episomal replication in Saccharomyces cerevisiae

International Nuclear Information System (INIS)

Chattopadhyay, Anasuya; Schmidt, Martin C.; Khan, Saleem A.

2005-01-01

Human papillomaviruses (HPVs) replicate as nuclear plasmids in infected cells. Since the DNA replication machinery is generally conserved between humans and Saccharomyces cerevisiae, we studied whether HPV-1 DNA can replicate in yeast. Plasmids containing a selectable marker (with or without a yeast centromere) and either the full-length HPV-1 genome or various regions of the viral long control region (LCR) and the 3' end of the L1 gene were introduced into S. cerevisiae and their ability to replicate episomally was investigated. Our results show that HPV-1 sequences promote episomal replication of plasmids although the yeast centromere is required for plasmid retention. We have mapped the autonomously replicating sequence activity of HPV-1 DNA to a 450 base-pair sequence (HPV-1 nt 6783-7232) that includes 293 nucleotides from the 5' region of the viral LCR and 157 nucleotides from the 3' end of the L1 gene. The HPV-1 ARS does not include the binding sites for the viral E1 and E2 proteins, and these proteins are dispensable for replication in S. cerevisiae

Understanding the molecular basis of plant growth promotional effect of Pseudomonas fluorescens on rice through protein profiling

Directory of Open Access Journals (Sweden)

Thiruvengadam Raguchander

2009-12-01

Full Text Available Abstract Background Plant Growth Promoting Rhizobacteria (PGPR, Pseudomonas fluorescens strain KH-1 was found to exhibit plant growth promotional activity in rice under both in-vitro and in-vivo conditions. But the mechanism underlying such promotional activity of P. fluorescens is not yet understood clearly. In this study, efforts were made to elucidate the molecular responses of rice plants to P. fluorescens treatment through protein profiling. Two-dimensional polyacrylamide gel electrophoresis strategy was adopted to identify the PGPR responsive proteins and the differentially expressed proteins were analyzed by mass spectrometry. Results Priming of P. fluorescens, 23 different proteins found to be differentially expressed in rice leaf sheaths and MS analysis revealed the differential expression of some important proteins namely putative p23 co-chaperone, Thioredoxin h- rice, Ribulose-bisphosphate carboxylase large chain precursor, Nucleotide diPhosphate kinase, Proteosome sub unit protein and putative glutathione S-transferase protein. Conclusion Functional analyses of the differential proteins were reported to be directly or indirectly involved in growth promotion in plants. Thus, this study confirms the primary role of PGPR strain KH-1 in rice plant growth promotion.

Neural regeneration protein is a novel chemoattractive and neuronal survival-promoting factor

International Nuclear Information System (INIS)

Gorba, Thorsten; Bradoo, Privahini; Antonic, Ana; Marvin, Keith; Liu, Dong-Xu; Lobie, Peter E.; Reymann, Klaus G.; Gluckman, Peter D.; Sieg, Frank

2006-01-01

Neurogenesis and neuronal migration are the prerequisites for the development of the central nervous system. We have identified a novel rodent gene encoding for a neural regeneration protein (NRP) with an activity spectrum similar to the chemokine stromal-derived factor (SDF)-1, but with much greater potency. The Nrp gene is encoded as a forward frameshift to the hypothetical alkylated DNA repair protein AlkB. The predicted protein sequence of NRP contains domains with homology to survival-promoting peptide (SPP) and the trefoil protein TFF-1. The Nrp gene is first expressed in neural stem cells and expression continues in glial lineages. Recombinant NRP and NRP-derived peptides possess biological activities including induction of neural migration and proliferation, promotion of neuronal survival, enhancement of neurite outgrowth and promotion of neuronal differentiation from neural stem cells. NRP exerts its effect on neuronal survival by phosphorylation of the ERK1/2 and Akt kinases, whereas NRP stimulation of neural migration depends solely on p44/42 MAP kinase activity. Taken together, the expression profile of Nrp, the existence in its predicted protein structure of domains with similarities to known neuroprotective and migration-inducing factors and the high potency of NRP-derived synthetic peptides acting in femtomolar concentrations suggest it to be a novel gene of relevance in cellular and developmental neurobiology

Business networking for SMEs as a means to promote regional competitiveness: A Theoretical Framework

OpenAIRE

Vitor Braga

2004-01-01

The competitiveness of regions, as a means of promoting the competitiveness of a country as a whole, has been one of the main topics on the agenda of policy makers over the last decades. Several attempts at promoting competitiveness have been made with different degrees of success. In most cases, public investment in the regions was perceived as the solution to promote regional competitiveness and top-down policies were implemented. However, competitiveness also has an important dimension tha...

The inhibition of IGF-1 signaling promotes proteostasis by enhancing protein aggregation and deposition.

Science.gov (United States)

Moll, Lorna; Ben-Gedalya, Tziona; Reuveni, Hadas; Cohen, Ehud

2016-04-01

The discovery that the alteration of aging by reducing the activity of the insulin/IGF-1 signaling (IIS) cascade protects nematodes and mice from neurodegeneration-linked, toxic protein aggregation (proteotoxicity) raises the prospect that IIS inhibitors bear therapeutic potential to counter neurodegenerative diseases. Recently, we reported that NT219, a highly efficient IGF-1 signaling inhibitor, protects model worms from the aggregation of amyloid β peptide and polyglutamine peptides that are linked to the manifestation of Alzheimer's and Huntington's diseases, respectively. Here, we employed cultured cell systems to investigate whether NT219 promotes protein homeostasis (proteostasis) in mammalian cells and to explore its underlying mechanisms. We found that NT219 enhances the aggregation of misfolded prion protein and promotes its deposition in quality control compartments known as "aggresomes." NT219 also elevates the levels of certain molecular chaperones but, surprisingly, reduces proteasome activity and impairs autophagy. Our findings show that IGF-1 signaling inhibitors in general and NT219 in particular can promote proteostasis in mammalian cells by hyperaggregating hazardous proteins, thereby bearing the potential to postpone the onset and slow the progression of neurodegenerative illnesses in the elderly.-Moll, L., Ben-Gedalya, T., Reuveni, H., Cohen, E. The inhibition of IGF-1 signaling promotes proteostasis by enhancing protein aggregation and deposition. © FASEB.

Tobacco arabinogalactan protein NtEPc can promote banana (Musa AAA) somatic embryogenesis.

Science.gov (United States)

Shu, H; Xu, L; Li, Z; Li, J; Jin, Z; Chang, S

2014-12-01

Banana is an important tropical fruit worldwide. Parthenocarpy and female sterility made it impossible to improve banana varieties through common hybridization. Genetic transformation for banana improvement is imperative. But the low rate that banana embryogenic callus was induced made the transformation cannot be performed in many laboratories. Finding ways to promote banana somatic embryogenesis is critical for banana genetic transformation. After tobacco arabinogalactan protein gene NtEPc was transformed into Escherichia coli (DE3), the recombinant protein was purified and filter-sterilized. A series of the sterilized protein was added into tissue culture medium. It was found that the number of banana immature male flowers developing embryogenic calli increased significantly in the presence of NtEPc protein compared with the effect of the control medium. Among the treatments, explants cultured on medium containing 10 mg/l of NtEPc protein had the highest chance to develop embryogenic calli. The percentage of lines that developed embryogenic calli on this medium was about 12.5 %. These demonstrated that NtEPc protein can be used to promote banana embryogenesis. This is the first paper that reported that foreign arabinogalactan protein (AGP) could be used to improve banana somatic embryogenesis.

Identifying and engineering promoters for high level and sustainable therapeutic recombinant protein production in cultured mammalian cells.

Science.gov (United States)

Ho, Steven C L; Yang, Yuansheng

2014-08-01

Promoters are essential on plasmid vectors to initiate transcription of the transgenes when generating therapeutic recombinant proteins expressing mammalian cell lines. High and sustained levels of gene expression are desired during therapeutic protein production while gene expression is useful for cell engineering. As many finely controlled promoters exhibit cell and product specificity, new promoters need to be identified, optimized and carefully evaluated before use. Suitable promoters can be identified using techniques ranging from simple molecular biology methods to modern high-throughput omics screenings. Promoter engineering is often required after identification to either obtain high and sustained expression or to provide a wider range of gene expression. This review discusses some of the available methods to identify and engineer promoters for therapeutic recombinant protein expression in mammalian cells.

Protein arginine methyltransferase 5 functions as an epigenetic activator of the androgen receptor to promote prostate cancer cell growth.

Science.gov (United States)

Deng, X; Shao, G; Zhang, H-T; Li, C; Zhang, D; Cheng, L; Elzey, B D; Pili, R; Ratliff, T L; Huang, J; Hu, C-D

2017-03-02

Protein arginine methyltransferase 5 (PRMT5) is an emerging epigenetic enzyme that mainly represses transcription of target genes via symmetric dimethylation of arginine residues on histones H4R3, H3R8 and H2AR3. Accumulating evidence suggests that PRMT5 may function as an oncogene to drive cancer cell growth by epigenetic inactivation of several tumor suppressors. Here, we provide evidence that PRMT5 promotes prostate cancer cell growth by epigenetically activating transcription of the androgen receptor (AR) in prostate cancer cells. Knockdown of PRMT5 or inhibition of PRMT5 by a specific inhibitor reduces the expression of AR and suppresses the growth of multiple AR-positive, but not AR-negative, prostate cancer cells. Significantly, knockdown of PRMT5 in AR-positive LNCaP cells completely suppresses the growth of xenograft tumors in mice. Molecular analysis reveals that PRMT5 binds to the proximal promoter region of the AR gene and contributes mainly to the enriched symmetric dimethylation of H4R3 in the same region. Mechanistically, PRMT5 is recruited to the AR promoter by its interaction with Sp1, the major transcription factor responsible for AR transcription, and forms a complex with Brg1, an ATP-dependent chromatin remodeler, on the proximal promoter region of the AR gene. Furthermore, PRMT5 expression in prostate cancer tissues is significantly higher than that in benign prostatic hyperplasia tissues, and PRMT5 expression correlates positively with AR expression at both the protein and mRNA levels. Taken together, our results identify PRMT5 as a novel epigenetic activator of AR in prostate cancer. Given that inhibiting AR transcriptional activity or androgen synthesis remains the major mechanism of action for most existing anti-androgen agents, our findings also raise an interesting possibility that targeting PRMT5 may represent a novel approach for prostate cancer treatment by eliminating AR expression.

Analysis of tissue-specific region in sericin 1 gene promoter of Bombyx mori

Energy Technology Data Exchange (ETDEWEB)

Yan, Liu [College of Biomedical Engineering and Instrument Science, Zhejiang University, Hangzhou 310027 (China); Institute of Biochemistry and Cell Biology, Shanghai Institutes for Biological Sciences, Chinese Academy of Sciences, Shanghai 200031 (China); Lian, Yu [College of Biomedical Engineering and Instrument Science, Zhejiang University, Hangzhou 310027 (China); Zhejiang Province Key Laboratory of Preventive Veterinary Medicine, Institute of Preventive Veterinary Medicine, Zhejiang University, Hangzhou 310029 (China); Xiuyang, Guo [Institute of Biochemistry and Cell Biology, Shanghai Institutes for Biological Sciences, Chinese Academy of Sciences, Shanghai 200031 (China); Tingqing, Guo [Institute of Biochemistry and Cell Biology, Shanghai Institutes for Biological Sciences, Chinese Academy of Sciences, Shanghai 200031 (China); Shengpeng, Wang [Institute of Biochemistry and Cell Biology, Shanghai Institutes for Biological Sciences, Chinese Academy of Sciences, Shanghai 200031 (China); Changde, Lu [Institute of Biochemistry and Cell Biology, Shanghai Institutes for Biological Sciences, Chinese Academy of Sciences, Shanghai 200031 (China)

2006-03-31

The gene encoding sericin 1 (Ser1) of silkworm (Bombyx mori) is specifically expressed in the middle silk gland cells. To identify element involved in this transcription-dependent spatial restriction, truncation of the 5' terminal from the sericin 1 (Ser1) promoter is studied in vivo. A 209 bp DNA sequence upstream of the transcriptional start site (-586 to -378) is found to be responsible for promoting tissue-specific transcription. Analysis of this 209 bp region by overlapping deletion studies showed that a 25 bp region (-500 to -476) suppresses the ectopic expression of the Ser1 promoter. An unknown factor abundant in fat body nuclear extracts is shown to bind to this 25 bp fragment. These results suggest that this 25 bp region and the unknown factor are necessary for determining the tissue-specificity of the Ser1 promoter.

High-level extracellular protein production in Bacillus subtilis using an optimized dual-promoter expression system.

Science.gov (United States)

Zhang, Kang; Su, Lingqia; Duan, Xuguo; Liu, Lina; Wu, Jing

2017-02-20

We recently constructed a Bacillus subtilis strain (CCTCC M 2016536) from which we had deleted the srfC, spoIIAC, nprE, aprE and amyE genes. This strain is capable of robust recombinant protein production and amenable to high-cell-density fermentation. Because the promoter is among the factors that influence the production of target proteins, optimization of the initial promoter, P amyQ from Bacillus amyloliquefaciens, should improve protein expression using this strain. This study was undertaken to develop a new, high-level expression system in B. subtilis CCTCC M 2016536. Using the enzyme β-cyclodextrin glycosyltransferase (β-CGTase) as a reporter protein and B. subtilis CCTCC M 2016536 as the host, nine plasmids equipped with single promoters were screened using shake-flask cultivation. The plasmid containing the P amyQ' promoter produced the greatest extracellular β-CGTase activity; 24.1 U/mL. Subsequently, six plasmids equipped with dual promoters were constructed and evaluated using this same method. The plasmid containing the dual promoter P HpaII -P amyQ' produced the highest extracellular β-CGTase activity (30.5 U/mL) and was relatively glucose repressed. The dual promoter P HpaII -P amyQ' also mediated substantial extracellular pullulanase (90.7 U/mL) and α-CGTase expression (9.5 U/mL) during shake-flask cultivation, demonstrating the general applicability of this system. Finally, the production of β-CGTase using the dual-promoter P HpaII -P amyQ' system was investigated in a 3-L fermenter. Extracellular expression of β-CGTase reached 571.2 U/mL (2.5 mg/mL), demonstrating the potential of this system for use in industrial applications. The dual-promoter P HpaII -P amyQ' system was found to support superior expression of extracellular proteins in B. subtilis CCTCC M 2016536. This system appears generally applicable and is amenable to scale-up.

Direct and indirect effects in the regulation of overlapping promoters

DEFF Research Database (Denmark)

Bendtsen, Kristian Moss; Erdossy, Janos; Csiszovski, Zsolt

2011-01-01

promoter database we found that ~14% of the identified 'forward' promoters overlap with a promoter oriented in the opposite direction. In this article we combine a mathematical model with experimental analysis of synthetic regulatory regions to investigate interference of overlapping promoters. We find...... that promoter interference depends on the characteristics of overlapping promoters. The model predicts that promoter strength and interference can be regulated separately, which provides unique opportunities for regulation. Our experimental data suggest that in principle any DNA binding protein can be used......Optimal response to environmental stimuli often requires activation of certain genes and repression of others. Dual function regulatory proteins play a key role in the differential regulation of gene expression. While repression can be achieved by any DNA binding protein through steric occlusion...

A novel type of DNA-binding protein interacts with a conserved sequence in an early nodulin ENOD12 promoter

DEFF Research Database (Denmark)

Christiansen, H; Hansen, A C; Vijn, I

1996-01-01

The pea genes PsENOD12A and PsENOD12B are expressed in the root hairs shortly after infection with the nitrogen-fixing bacterium Rhizobium leguminosarum bv. viciae or after application of purified Nod factors. A 199 bp promoter fragment of the PsENOD12B gene contains sufficient information for Nod...... factor-induced tissue-specific expression. We have isolated a Vicia sativa cDNA encoding a 1641 amino acid protein, ENBP1, that interacts with the 199 bp ENOD12 promoter. Two different DNA-binding domains were identified in ENBP1. A domain containing six AT-hooks interacts specifically with an AT...... of the ENBP1 transcript in cells expressing ENOD12 strongly suggest that ENBP1 is a transcription factor involved in the regulation of ENOD12. Finally, the C-terminal region of ENBP1 shows strong homology to a protein from rat that is specifically expressed in testis tissue. Udgivelsesdato: 1996-Dec...

Modeling disordered regions in proteins using Rosetta.

Directory of Open Access Journals (Sweden)

Ray Yu-Ruei Wang

Full Text Available Protein structure prediction methods such as Rosetta search for the lowest energy conformation of the polypeptide chain. However, the experimentally observed native state is at a minimum of the free energy, rather than the energy. The neglect of the missing configurational entropy contribution to the free energy can be partially justified by the assumption that the entropies of alternative folded states, while very much less than unfolded states, are not too different from one another, and hence can be to a first approximation neglected when searching for the lowest free energy state. The shortcomings of current structure prediction methods may be due in part to the breakdown of this assumption. Particularly problematic are proteins with significant disordered regions which do not populate single low energy conformations even in the native state. We describe two approaches within the Rosetta structure modeling methodology for treating such regions. The first does not require advance knowledge of the regions likely to be disordered; instead these are identified by minimizing a simple free energy function used previously to model protein folding landscapes and transition states. In this model, residues can be either completely ordered or completely disordered; they are considered disordered if the gain in entropy outweighs the loss of favorable energetic interactions with the rest of the protein chain. The second approach requires identification in advance of the disordered regions either from sequence alone using for example the DISOPRED server or from experimental data such as NMR chemical shifts. During Rosetta structure prediction calculations the disordered regions make only unfavorable repulsive contributions to the total energy. We find that the second approach has greater practical utility and illustrate this with examples from de novo structure prediction, NMR structure calculation, and comparative modeling.

TPA-inducible proteins may account for sensitivity to promotion of transformation

International Nuclear Information System (INIS)

Hirano, K.; Smith, B.; Colburn, N.H.

1986-01-01

The preneoplastic JB6 mouse epidermal cell system includes cell lines sensitive (P + ) or resistant (P - ) to tumor promoter induced neoplastic transformation. The authors investigated whether a difference in TPA-inducible proteins may explain this differential sensitivity. The synthesis of a 39 Kd cytoplasmic protein (Major Excreted Protein) was TPA-inducible, but to a similar extent in both P + and P - cells. TPA stimulated phosphorylation but not synthesis of the previously described stress protein pp80 in both P + and P - cells from 1 to 5 hr after treatment. Pulse labelling of P + and P - cells with 35 S-methionine revealed a TPA dependent P + specific transient increase in the synthesis of 58Kd protein. Induction was observed at 1 hr, and returned to basal levels by 4 hr and 20 hr, in nuclear and cytoplasmic fractions, respectively. This protein is not phosphorylated in response to TPA treatment. P + cells differ from P - cells in one or more genes that specify sensitivity to promotion of transformation, designated pro genes. Antibodies to three peptides representing the pro-1 open reading frame were used in immunoprecipitation and Western blotting to isolate the pro-1 gene product. A 43 Kd protein was immunologically responsive to the pro-1 peptide antibodies, and showed an increased signal 40 min after TPA treatment. Since the predicted molecular weight of a pro-1 gene product is only 7 Kd, the possibility of a modification of the protein by poly(ADP-ribosylation) or glycosylation is being investigated

Growth-promoting effect on iron-sulfur proteins on axenic cultures of Entamoeba dispar

Directory of Open Access Journals (Sweden)

Khalifa S.A.M.

2006-03-01

Full Text Available A growth-promoting factor (GPF that promotes the growth of Entamoeba dispar under axenic culture conditions was found in fractions of mitochondria (Mt, hydrogenosomes (Hg and chloroplasts (Cp obtained from cells of six different protozoan, mammalian and plant species. We were able to extract the GPF from the Cp-rich leaf cells of a plant (spiderwort: Commelina communis L. in an acetone-soluble fraction as a complex of chlorophyll with low molecular weight proteins (molecular weight [MW] approximately 4,600. We also found that on treatment with 0.6 % complexes of 2-mercapthoethanol (2ME, complexes of chlorophyll-a with iron-sulphur (Fe-S proteins (e.g., ferredoxins [Fd] from spinach and Clostridium pasteurianum and noncomplex rubredoxin (Rd from C. pasteurianum have a growth-promoting effect on E. dispar. These findings suggest that E. dispar may lack a sufficient quantity of some essential components of Fe-S proteins, such as Fe-S center.

A var gene promoter implicated in severe malaria nucleates silencing and is regulated by 3' untranslated region and intronic cis-elements.

Science.gov (United States)

Muhle, Rebecca A; Adjalley, Sophie; Falkard, Brie; Nkrumah, Louis J; Muhle, Michael E; Fidock, David A

2009-11-01

Questions surround the mechanism of mutually exclusive expression by which Plasmodium falciparum mediates activation and silencing of var genes. These encode PfEMP1 proteins, which function as cytoadherent and immunomodulatory molecules at the surface of parasitised erythrocytes. Current evidence suggests that promoter silencing by var introns might play a key role in var gene regulation. To evaluate the impact of cis-acting regulatory regions on var silencing, we generated P. falciparum lines in which luciferase was placed under the control of an UpsA var promoter. By utilising the Bxb1 integrase system, these reporter cassettes were targeted to a genomic region that was not in apposition to var subtelomeric domains. This eliminated possible effects from surrounding telomeric elements and removed the variability inherent in episomal systems. Studies with highly synchronised parasites revealed that the UpsA element possessed minimal activity in comparison with a heterologous (hrp3) promoter. This may result from the integrated UpsA promoter being largely silenced by the neighbouring cg6 promoter. Our analyses also revealed that the DownsA 3' untranslated region further decreased the luciferase activity from both cassettes, whereas the var A intron repressed the UpsA promoter specifically. By applying multivariate analysis over the entire cell cycle, we confirmed the significance of these cis-elements and found the parasite stage to be the major factor regulating UpsA-promoter activity. Additionally, we observed that the UpsA promoter was capable of nucleating reversible silencing that spread to a downstream promoter. We believe these studies are the first to analyse promoter activity of Group A var genes, which have been implicated in severe malaria, and support the model that var introns can further suppress var expression. These data also suggest an important suppressive role for the DownsA terminator. Our findings imply the existence of multiple levels of var

Perspectives on Promoting Regional Renewable Energy Research and Development

International Nuclear Information System (INIS)

Dresselhaus, M.

2008-01-01

Recent discussions at the Washington International Renewable Energy Conference (WIREC), hosted in March 2008 by the United States Government, with nearly 9000 participants including 103 ministers from 126 countries, concluded that a major acceleration in the adoption of renewable energy technologies was needed by mid-century. Because of different climatic conditions and societal preferences, regional cooperation is expected to play a major role in the efficient adoption of appropriate renewable energy technologies, and countries with special expertise in specific technologies seem eager to collaborate internationally to promote global goals in renewable energy. A review will be given of what we learned from this conference about renewable energy research and development strategies with a special focus given to using this basic knowledge base to promote the development of renewable energy technologies appropriate to specific regions of the world.(author)

Rampant adaptive evolution in regions of proteins with unknown function in Drosophila simulans.

Directory of Open Access Journals (Sweden)

Alisha K Holloway

2007-10-01

Full Text Available Adaptive protein evolution is pervasive in Drosophila. Genomic studies, thus far, have analyzed each protein as a single entity. However, the targets of adaptive events may be localized to particular parts of proteins, such as protein domains or regions involved in protein folding. We compared the population genetic mechanisms driving sequence polymorphism and divergence in defined protein domains and non-domain regions. Interestingly, we find that non-domain regions of proteins are more frequent targets of directional selection. Protein domains are also evolving under directional selection, but appear to be under stronger purifying selection than non-domain regions. Non-domain regions of proteins clearly play a major role in adaptive protein evolution on a genomic scale and merit future investigations of their functional properties.

An analysis of the binding of repressor protein ModE to modABCD (molybdate transport) operator/promoter DNA of Escherichia coli.

Science.gov (United States)

Grunden, A M; Self, W T; Villain, M; Blalock, J E; Shanmugam, K T

1999-08-20

Expression of the modABCD operon in Escherichia coli, which codes for a molybdate-specific transporter, is repressed by ModE in vivo in a molybdate-dependent fashion. In vitro DNase I-footprinting experiments identified three distinct regions of protection by ModE-molybdate on the modA operator/promoter DNA, GTTATATT (-15 to -8; region 1), GCCTACAT (-4 to +4; region 2), and GTTACAT (+8 to +14; region 3). Within the three regions of the protected DNA, a pentamer sequence, TAYAT (Y = C or T), can be identified. DNA-electrophoretic mobility experiments showed that the protected regions 1 and 2 are essential for binding of ModE-molybdate to DNA, whereas the protected region 3 increases the affinity of the DNA to the repressor. The stoichiometry of this interaction was found to be two ModE-molybdate per modA operator DNA. ModE-molybdate at 5 nM completely protected the modABCD operator/promoter DNA from DNase I-catalyzed hydrolysis, whereas ModE alone failed to protect the DNA even at 100 nM. The apparent K(d) for the interaction between the modA operator DNA and ModE-molybdate was 0.3 nM, and the K(d) increased to 8 nM in the absence of molybdate. Among the various oxyanions tested, only tungstate replaced molybdate in the repression of modA by ModE, but the affinity of ModE-tungstate for modABCD operator DNA was 6 times lower than with ModE-molybdate. A mutant ModE(T125I) protein, which repressed modA-lac even in the absence of molybdate, protected the same region of modA operator DNA in the absence of molybdate. The apparent K(d) for the interaction between modA operator DNA and ModE(T125I) was 3 nM in the presence of molybdate and 4 nM without molybdate. The binding of molybdate to ModE resulted in a decrease in fluorescence emission, indicating a conformational change of the protein upon molybdate binding. The fluorescence emission spectra of mutant ModE proteins, ModE(T125I) and ModE(Q216*), were unaffected by molybdate. The molybdate-independent mutant Mod

Mycobacterium tuberculosis UvrD1 and UvrA proteins suppress DNA strand exchange promoted by cognate and noncognate RecA proteins.

Science.gov (United States)

Singh, Pawan; Patil, K Neelakanteshwar; Khanduja, Jasbeer Singh; Kumar, P Sanjay; Williams, Alan; Rossi, Franca; Rizzi, Menico; Davis, Elaine O; Muniyappa, K

2010-06-15

DNA helicases are present in all kingdoms of life and play crucial roles in processes of DNA metabolism such as replication, repair, recombination, and transcription. To date, however, the role of DNA helicases during homologous recombination in mycobacteria remains unknown. In this study, we show that Mycobacterium tuberculosis UvrD1 more efficiently inhibited the strand exchange promoted by its cognate RecA, compared to noncognate Mycobacterium smegmatis or Escherichia coli RecA proteins. The M. tuberculosis UvrD1(Q276R) mutant lacking the helicase and ATPase activities was able to block strand exchange promoted by mycobacterial RecA proteins but not of E. coli RecA. We observed that M. tuberculosis UvrA by itself has no discernible effect on strand exchange promoted by E. coli RecA but impedes the reaction catalyzed by the mycobacterial RecA proteins. Our data also show that M. tuberculosis UvrA and UvrD1 can act together to inhibit strand exchange promoted by mycobacterial RecA proteins. Taken together, these findings raise the possibility that UvrD1 and UvrA might act together in vivo to counter the deleterious effects of RecA nucleoprotein filaments and/or facilitate the dissolution of recombination intermediates. Finally, we provide direct experimental evidence for a physical interaction between M. tuberculosis UvrD1 and RecA on one hand and RecA and UvrA on the other hand. These observations are consistent with a molecular mechanism, whereby M. tuberculosis UvrA and UvrD1, acting together, block DNA strand exchange promoted by cognate and noncognate RecA proteins.

Porcine MYF6 gene: sequence, homology analysis, and variation in the promoter region.

Science.gov (United States)

Wyszyńska-Koko, J; Kurył, J

2004-01-01

MYF6 gene codes for the bHLH transcription factor belonging to MyoD family. Its expression accompanies the processes of differentiation and maturation of myotubes during embriogenesis and continues on a relatively high level after birth, affecting the muscle phenotype. The porcine MYF6 gene was amplified and sequenced and compared with MYF6 gene sequences of other species. The amino acid sequence was deduced and an interspecies homology analysis was performed. Myf-6 protein shows a high conservation among species of 99 and 97% identity when comparing pig with cow and human, respectively, and of 93% when comparing pig with mouse and rat. The single nucleotide polymorphism (SNP) was revealed within the promoter region, which appeared to be T --> C transition recognized by a MspI restriction enzyme.

Regional differences in gene expression and promoter usage in aged human brains

KAUST Repository

Pardo, Luba M.

2013-02-19

To characterize the promoterome of caudate and putamen regions (striatum), frontal and temporal cortices, and hippocampi from aged human brains, we used high-throughput cap analysis of gene expression to profile the transcription start sites and to quantify the differences in gene expression across the 5 brain regions. We also analyzed the extent to which methylation influenced the observed expression profiles. We sequenced more than 71 million cap analysis of gene expression tags corresponding to 70,202 promoter regions and 16,888 genes. More than 7000 transcripts were differentially expressed, mainly because of differential alternative promoter usage. Unexpectedly, 7% of differentially expressed genes were neurodevelopmental transcription factors. Functional pathway analysis on the differentially expressed genes revealed an overrepresentation of several signaling pathways (e.g., fibroblast growth factor and wnt signaling) in hippocampus and striatum. We also found that although 73% of methylation signals mapped within genes, the influence of methylation on the expression profile was small. Our study underscores alternative promoter usage as an important mechanism for determining the regional differences in gene expression at old age.

Seed storage protein gene promoters contain conserved DNA motifs in Brassicaceae, Fabaceae and Poaceae

Science.gov (United States)

Fauteux, François; Strömvik, Martina V

2009-01-01

Background Accurate computational identification of cis-regulatory motifs is difficult, particularly in eukaryotic promoters, which typically contain multiple short and degenerate DNA sequences bound by several interacting factors. Enrichment in combinations of rare motifs in the promoter sequence of functionally or evolutionarily related genes among several species is an indicator of conserved transcriptional regulatory mechanisms. This provides a basis for the computational identification of cis-regulatory motifs. Results We have used a discriminative seeding DNA motif discovery algorithm for an in-depth analysis of 54 seed storage protein (SSP) gene promoters from three plant families, namely Brassicaceae (mustards), Fabaceae (legumes) and Poaceae (grasses) using backgrounds based on complete sets of promoters from a representative species in each family, namely Arabidopsis (Arabidopsis thaliana (L.) Heynh.), soybean (Glycine max (L.) Merr.) and rice (Oryza sativa L.) respectively. We have identified three conserved motifs (two RY-like and one ACGT-like) in Brassicaceae and Fabaceae SSP gene promoters that are similar to experimentally characterized seed-specific cis-regulatory elements. Fabaceae SSP gene promoter sequences are also enriched in a novel, seed-specific E2Fb-like motif. Conserved motifs identified in Poaceae SSP gene promoters include a GCN4-like motif, two prolamin-box-like motifs and an Skn-1-like motif. Evidence of the presence of a variant of the TATA-box is found in the SSP gene promoters from the three plant families. Motifs discovered in SSP gene promoters were used to score whole-genome sets of promoters from Arabidopsis, soybean and rice. The highest-scoring promoters are associated with genes coding for different subunits or precursors of seed storage proteins. Conclusion Seed storage protein gene promoter motifs are conserved in diverse species, and different plant families are characterized by a distinct combination of conserved motifs

Seed storage protein gene promoters contain conserved DNA motifs in Brassicaceae, Fabaceae and Poaceae

Directory of Open Access Journals (Sweden)

Fauteux François

2009-10-01

Full Text Available Abstract Background Accurate computational identification of cis-regulatory motifs is difficult, particularly in eukaryotic promoters, which typically contain multiple short and degenerate DNA sequences bound by several interacting factors. Enrichment in combinations of rare motifs in the promoter sequence of functionally or evolutionarily related genes among several species is an indicator of conserved transcriptional regulatory mechanisms. This provides a basis for the computational identification of cis-regulatory motifs. Results We have used a discriminative seeding DNA motif discovery algorithm for an in-depth analysis of 54 seed storage protein (SSP gene promoters from three plant families, namely Brassicaceae (mustards, Fabaceae (legumes and Poaceae (grasses using backgrounds based on complete sets of promoters from a representative species in each family, namely Arabidopsis (Arabidopsis thaliana (L. Heynh., soybean (Glycine max (L. Merr. and rice (Oryza sativa L. respectively. We have identified three conserved motifs (two RY-like and one ACGT-like in Brassicaceae and Fabaceae SSP gene promoters that are similar to experimentally characterized seed-specific cis-regulatory elements. Fabaceae SSP gene promoter sequences are also enriched in a novel, seed-specific E2Fb-like motif. Conserved motifs identified in Poaceae SSP gene promoters include a GCN4-like motif, two prolamin-box-like motifs and an Skn-1-like motif. Evidence of the presence of a variant of the TATA-box is found in the SSP gene promoters from the three plant families. Motifs discovered in SSP gene promoters were used to score whole-genome sets of promoters from Arabidopsis, soybean and rice. The highest-scoring promoters are associated with genes coding for different subunits or precursors of seed storage proteins. Conclusion Seed storage protein gene promoter motifs are conserved in diverse species, and different plant families are characterized by a distinct combination

Growing Significance of EU Institutions in Promotion of Inter-regional policies

Directory of Open Access Journals (Sweden)

Ella V. Ermakova

2014-01-01

Full Text Available The article explores the variety of tools and vehicles applied within the EU to expand the prerogative of the regions of the EU member states. The author uses as an example the inter-regional policies in Belgium in respect of the Flemish Region and the Walloon Region. The author analyzes the mechanisms of promotion of external regional relations in Belgium as a means of addressing different problems both on national and all-European level, supporting the arguments and conclusions by examples of relevant EU initiatives. The article details the activities of the EU Regional Committee (RC, the EU advisory body with the powers of political initiative, upholding the principle ofsubsidarity in the implementation of the EU member states' regional policies. The involvement of the Flemish Region and the Walloon Region in the activities of EU RC is described and summarized. As a case study, the article deals with Belgium's rotating six months presidency in the EUin 2010 when the country, which was going through a severe political crisis with no federal government in place, was represented by the two regions. The special focus of the article is on the strategic EU program "Europe2020" and its implementation by the regions of Belgium. There is an account of the initiatives undertaken by the Flemish Region and the Walloon Region within the framework of this program outlining the interaction of the two regions. The author provides a comprehensive analysis of the involvement of the Flemish Region and the Walloon Region with various EU institutions describing how each party achieves the promotion of its regional interests. Within this context, it is a noteworthy development that the Flemish Region is participating in the international program "Pact 2020" on energy all by its own. The article features quotations by Flemish and Walloon political figures which serve as an illustration of the prevailing attitudes in the Belgian society to the process of

TIM-family proteins promote infection of multiple enveloped viruses through virion-associated phosphatidylserine.

Directory of Open Access Journals (Sweden)

Stephanie Jemielity

2013-03-01

Full Text Available Human T-cell Immunoglobulin and Mucin-domain containing proteins (TIM1, 3, and 4 specifically bind phosphatidylserine (PS. TIM1 has been proposed to serve as a cellular receptor for hepatitis A virus and Ebola virus and as an entry factor for dengue virus. Here we show that TIM1 promotes infection of retroviruses and virus-like particles (VLPs pseudotyped with a range of viral entry proteins, in particular those from the filovirus, flavivirus, New World arenavirus and alphavirus families. TIM1 also robustly enhanced the infection of replication-competent viruses from the same families, including dengue, Tacaribe, Sindbis and Ross River viruses. All interactions between TIM1 and pseudoviruses or VLPs were PS-mediated, as demonstrated with liposome blocking and TIM1 mutagenesis experiments. In addition, other PS-binding proteins, such as Axl and TIM4, promoted infection similarly to TIM1. Finally, the blocking of PS receptors on macrophages inhibited the entry of Ebola VLPs, suggesting that PS receptors can contribute to infection in physiologically relevant cells. Notably, infection mediated by the entry proteins of Lassa fever virus, influenza A virus and SARS coronavirus was largely unaffected by TIM1 expression. Taken together our data show that TIM1 and related PS-binding proteins promote infection of diverse families of enveloped viruses, and may therefore be useful targets for broad-spectrum antiviral therapies.

Multi-protein delivery by nanodiamonds promotes bone formation.

Science.gov (United States)

Moore, L; Gatica, M; Kim, H; Osawa, E; Ho, D

2013-11-01

Bone morphogenetic proteins (BMPs) are well-studied regulators of cartilage and bone development that have been Food and Drug Administration (FDA)-approved for the promotion of bone formation in certain procedures. BMPs are seeing more use in oral and maxillofacial surgeries because of recent FDA approval of InFUSE(®) for sinus augmentation and localized alveolar ridge augmentation. However, the utility of BMPs in medical and dental applications is limited by the delivery method. Currently, BMPs are delivered to the surgical site by the implantation of bulky collagen sponges. Here we evaluate the potential of detonation nanodiamonds (NDs) as a delivery vehicle for BMP-2 and basic fibroblast growth factor (bFGF). Nanodiamonds are biocompatible, 4- to 5-nm carbon nanoparticles that have previously been used to deliver a wide variety of molecules, including proteins and peptides. We find that both BMP-2 and bFGF are readily loaded onto NDs by physisorption, forming a stable colloidal solution, and are triggered to release in slightly acidic conditions. Simultaneous delivery of BMP-2 and bFGF by ND induces differentiation and proliferation in osteoblast progenitor cells. Overall, we find that NDs provide an effective injectable alternative for the delivery of BMP-2 and bFGF to promote bone formation.

Highly active promoters and native secretion signals for protein production during extremely low growth rates in Aspergillus niger.

Science.gov (United States)

Wanka, Franziska; Arentshorst, Mark; Cairns, Timothy C; Jørgensen, Thomas; Ram, Arthur F J; Meyer, Vera

2016-08-20

The filamentous ascomycete Aspergillus niger is used in many industrial processes for the production of enzymes and organic acids by batch and fed-batch cultivation. An alternative technique is continuous cultivation, which promises improved yield and optimized pipeline efficiency. In this work, we have used perfusion (retentostat) cultivation to validate two promoters that are suitable for A. niger continuous cultivation of industrially relevant products. Firstly, promoters of genes encoding either an antifungal protein (Panafp) or putative hydrophobin (PhfbD) were confirmed as active throughout retentostat culture by assessing mRNA and protein levels using a luciferase (mluc) reporter system. This demonstrated the anafp promoter mediates a high but temporally variable expression profile, whereas the hfbD promoter mediates a semi-constant, moderate-to-high protein expression during retentostat culture. In order to assess whether these promoters were suitable to produce heterologous proteins during retentostat cultivation, the secreted antifungal protein (AFP) from Aspergillus giganteus, which has many potential biotechnological applications, was expressed in A. niger during retentostat cultivation. Additionally, this assay was used to concomitantly validate that native secretion signals encoded in anafp and hfbD genes can be harnessed for secretion of heterologous proteins. Afp mRNA and protein abundance were comparable to luciferase measurements throughout retentostat cultivation, validating the use of Panafp and PhfbD for perfusion cultivation. Finally, a gene encoding the highly commercially relevant thermal hysteresis protein (THP) was expressed in this system, which did not yield detectable protein. Both hfbD and anafp promoters are suitable for production of useful products in A. niger during perfusion cultivation. These findings provide a platform for further optimisations for high production of heterologous proteins with industrial relevance.

Combination of the Endogenous lhcsr1 Promoter and Codon Usage Optimization Boosts Protein Expression in the Moss Physcomitrella patens

Directory of Open Access Journals (Sweden)

Manuel Hiss

2017-10-01

Full Text Available The moss Physcomitrella patens is used both as an evo-devo model and biotechnological production system for metabolites and pharmaceuticals. Strong in vivo expression of genes of interest is important for production of recombinant proteins, e.g., selectable markers, fluorescent proteins, or enzymes. In this regard, the choice of the promoter sequence as well as codon usage optimization are two important inside factors to consider in order to obtain optimum protein accumulation level. To reliably quantify fluorescence, we transfected protoplasts with promoter:GFP fusion constructs and measured fluorescence intensity of living protoplasts in a plate reader system. We used the red fluorescent protein mCherry under 2x 35S promoter control as second reporter to normalize for different transfection efficiencies. We derived a novel endogenous promoter and compared deletion variants with exogenous promoters. We used different codon-adapted green fluorescent protein (GFP genes to evaluate the influence of promoter choice and codon optimization on protein accumulation in P. patens, and show that the promoter of the gene of P. patens chlorophyll a/b binding protein lhcsr1 drives expression of GFP in protoplasts significantly (more than twofold better than the commonly used 2x 35S promoter or the rice actin1 promoter. We identified a shortened 677 bp version of the lhcsr1 promoter that retains full activity in protoplasts. The codon optimized GFP yields significantly (more than twofold stronger fluorescence signals and thus demonstrates that adjusting codon usage in P. patens can increase expression strength. In combination, new promotor and codon optimized GFP conveyed sixfold increased fluorescence signal.

Promoter trans-activation of protooncogenes c-fos and c-myc, but not c-Ha-ras, by products of adenovirus early region 1A

International Nuclear Information System (INIS)

Sassone-Corsi, P.; Borrelli, E.

1987-01-01

The E1A (early region 1A) oncogene products of adenovirus type 2 trans-activate the other early viral transcription units, as well as some cellular promoters. Using a short-term cotransfection assay in murine NIH 3T3 fibroblasts, we show that c-fos and c-myc promoter activities are stimulated by the E1A proteins, whereas c-Ha-ras transcription is not affected. The product of E1A 13S mRNA is responsible for the trans-activation, whereas the 12S mRNA product has no effect. Analysis of the c-fos promoter sequences required for the E1A stimulation shows that responsive sequences are located between positions -402 and -240 upstream of the transcription initiation site. This same region also contains the c-fos serum-responsive element. Furthermore, transcription of the endogenous c-fos gene in HeLa cells is increased after E1A transfection

DNA methylation of PTEN gene promoter region is not correlated ...

African Journals Online (AJOL)

Tumor suppressor gene PTEN plays an important role in cell cycle. Disorder of PTEN protein can cause cell growth and division in an uncontrolled way, which can lead to the formation of tumors. It has been proven that epigenetic mechanisms, such as promoter hypermethylation, may account for inactivation of PTEN in a ...

The 75-kilodalton cytoplasmic Chlamydia trachomatis L2 polypeptide is a DnaK-like protein

DEFF Research Database (Denmark)

Birkelund, Svend; Lundemose, AG; Christiansen, Gunna

1990-01-01

,980-base-pair open reading frame revealed 94% homology with a 75-kilodalton protein from C. trachomatis serovar D and 57% homology with the DnaK proteins of E. coli and of Bacillus megaterium, while amino acid homology with human heat shock protein 70 (hsp70) was 42%. The promoter region was identified......The gene coding for the 75-kilodalton cytoplasmic Chlamydia trachomatis L2 polypeptide has been cloned in Escherichia coli, and the nucleotide sequence has been determined. The cloned DNA fragment contained the coding region as well as the putative promoter. The deduced amino acid sequence of the 1...... by computer search and by primer extension of mRNA synthesized in recombinant E. coli. The promoter region which differed from the putative promoter region in serovar D was shown to be a mixed promoter type in which the -10 region showed a regular TATA box configuration while the -35 region showed high...

A var gene promoter implicated in severe malaria nucleates silencing and is regulated by 3’ untranslated region and intronic cis-elements

Science.gov (United States)

Muhle, Rebecca A.; Adjalley, Sophie; Falkard, Brie; Nkrumah, Louis J.; Muhle, Michael E.; Fidock, David A.

2009-01-01

Questions surround the mechanism of mutually exclusive expression by which Plasmodium falciparum mediates activation and silencing of var genes. These encode PfEMP1 proteins, which function as cytoadherent and immunomodulatory molecules at the surface of parasitized erythrocytes. Current evidence suggests that promoter silencing by var introns might play a key role in var gene regulation. To evaluate the impact of cis-acting regulatory regions on var silencing, we generated P. falciparum lines in which luciferase was placed under the control of an UpsA var promoter. By utilizing the Bxb1 integrase system, these reporter cassettes were targeted to a genomic region that was not in apposition to var sub-telomeric domains. This eliminated possible effects from surrounding telomeric elements and removed the variability inherent in episomal systems. Studies with highly synchronized parasites revealed that the UpsA element possessed minimal activity in comparison with a heterologous (hrp3) promoter. This may well result from the integrated UpsA promoter being largely silenced by the neighboring cg6 promoter. Our analyses also revealed that the DownsA 3’ untranslated region further decreased the luciferase activity from both cassettes, whereas the var A intron repressed the UpsA promoter specifically. By applying multivariate analysis over the entire cell cycle, we confirmed the significance of these cis-elements and found the parasite stage to be the major factor regulating UpsA promoter activity. Additionally, we observed that the UpsA promoter was capable of nucleating reversible silencing that spread to a downstream promoter. We believe these studies are the first to analyze promoter activity of Group A var genes which have been implicated in severe malaria, and support the model that var introns can further suppress var expression. These data also suggest an important suppressive role for the DownsA terminator. Our findings imply the existence of multiple levels of

LINGO-1 promotes lysosomal degradation of amyloid-β protein precursor

Directory of Open Access Journals (Sweden)

Rian de Laat

2015-03-01

Full Text Available Sequential proteolytic cleavages of amyloid-β protein precursor (AβPP by β-secretase and γ-secretase generate amyloid β (Aβ peptides, which are thought to contribute to Alzheimer's disease (AD. Much of this processing occurs in endosomes following endocytosis of AβPP from the plasma membrane. However, this pathogenic mode of processing AβPP may occur in competition with lysosomal degradation of AβPP, a common fate of membrane proteins trafficking through the endosomal system. Following up on published reports that LINGO-1 binds and promotes the amyloidogenic processing of AβPP we have examined the consequences of LINGO-1/AβPP interactions. We report that LINGO-1 and its paralogs, LINGO-2 and LINGO-3, decrease processing of AβPP in the amyloidogenic pathway by promoting lysosomal degradation of AβPP. We also report that LINGO-1 levels are reduced in AD brain, representing a possible pathogenic mechanism stimulating the generation of Aβ peptides in AD.

A composite method based on formal grammar and DNA structural features in detecting human polymerase II promoter region.

Directory of Open Access Journals (Sweden)

Sutapa Datta

Full Text Available An important step in understanding gene regulation is to identify the promoter regions where the transcription factor binding takes place. Predicting a promoter region de novo has been a theoretical goal for many researchers for a long time. There exists a number of in silico methods to predict the promoter region de novo but most of these methods are still suffering from various shortcomings, a major one being the selection of appropriate features of promoter region distinguishing them from non-promoters. In this communication, we have proposed a new composite method that predicts promoter sequences based on the interrelationship between structural profiles of DNA and primary sequence elements of the promoter regions. We have shown that a Context Free Grammar (CFG can formalize the relationships between different primary sequence features and by utilizing the CFG, we demonstrate that an efficient parser can be constructed for extracting these relationships from DNA sequences to distinguish the true promoter sequences from non-promoter sequences. Along with CFG, we have extracted the structural features of the promoter region to improve upon the efficiency of our prediction system. Extensive experiments performed on different datasets reveals that our method is effective in predicting promoter sequences on a genome-wide scale and performs satisfactorily as compared to other promoter prediction techniques.

A Composite Method Based on Formal Grammar and DNA Structural Features in Detecting Human Polymerase II Promoter Region

Science.gov (United States)

Datta, Sutapa; Mukhopadhyay, Subhasis

2013-01-01

An important step in understanding gene regulation is to identify the promoter regions where the transcription factor binding takes place. Predicting a promoter region de novo has been a theoretical goal for many researchers for a long time. There exists a number of in silico methods to predict the promoter region de novo but most of these methods are still suffering from various shortcomings, a major one being the selection of appropriate features of promoter region distinguishing them from non-promoters. In this communication, we have proposed a new composite method that predicts promoter sequences based on the interrelationship between structural profiles of DNA and primary sequence elements of the promoter regions. We have shown that a Context Free Grammar (CFG) can formalize the relationships between different primary sequence features and by utilizing the CFG, we demonstrate that an efficient parser can be constructed for extracting these relationships from DNA sequences to distinguish the true promoter sequences from non-promoter sequences. Along with CFG, we have extracted the structural features of the promoter region to improve upon the efficiency of our prediction system. Extensive experiments performed on different datasets reveals that our method is effective in predicting promoter sequences on a genome-wide scale and performs satisfactorily as compared to other promoter prediction techniques. PMID:23437045

Influence of promoter/enhancer region haplotypes on MGMT transcriptional regulation: a potential biomarker for human sensitivity to alkylating agents.

Science.gov (United States)

Xu, Meixiang; Nekhayeva, Ilona; Cross, Courtney E; Rondelli, Catherine M; Wickliffe, Jeffrey K; Abdel-Rahman, Sherif Z

2014-03-01

The O6-methylguanine-DNA methyltransferase gene (MGMT) encodes the direct reversal DNA repair protein that removes alkyl adducts from the O6 position of guanine. Several single-nucleotide polymorphisms (SNPs) exist in the MGMT promoter/enhancer (P/E) region. However, the haplotype structure encompassing these SNPs and their functional/biological significance are currently unknown. We hypothesized that MGMT P/E haplotypes, rather than individual SNPs, alter MGMT transcription and can thus alter human sensitivity to alkylating agents. To identify the haplotype structure encompassing the MGMT P/E region SNPs, we sequenced 104 DNA samples from healthy individuals and inferred the haplotypes using the data generated. We identified eight SNPs in this region, namely T7C (rs180989103), T135G (rs1711646), G290A (rs61859810), C485A (rs1625649), C575A (rs113813075), G666A (rs34180180), C777A (rs34138162) and C1099T (rs16906252). Phylogenetics and Sequence Evolution analysis predicted 21 potential haplotypes that encompass these SNPs ranging in frequencies from 0.000048 to 0.39. Of these, 10 were identified in our study population as 20 paired haplotype combinations. To determine the functional significance of these haplotypes, luciferase reporter constructs representing these haplotypes were transfected into glioblastoma cells and their effect on MGMT promoter activity was determined. Compared with the most common (reference) haplotype 1, seven haplotypes significantly upregulated MGMT promoter activity (18-119% increase; P alkylating agents.

The isoelectric region of proteins: a systematic analysis.

Directory of Open Access Journals (Sweden)

Michael Widmann

Full Text Available BACKGROUND: Binding of proteins in ion exchange chromatography is dominated by electrostatic interactions and can be tuned by adjusting pH and ionic strength of the solvent. Therefore, the isoelectric region (IER, the pH region of almost zero charge near the pI, has been used to predict the binding properties of proteins. PRINCIPAL FINDINGS: Usually the IER is small and binding and elution is carried out at pH values near to the pI. However, some proteins with an extended IER have been shown to bind and elute far away from its pI. To analyze factors that mediate the size of the IER and to identify proteins with an extended IER, two protein families consisting of more than 7000 proteins were systematically investigated. Most proteins were found to have a small IER and thus are expected to bind or elute near to their pI, while only a small fraction of less than 2% had a large IER. CONCLUSIONS: Only four factors, the number of histidines, the pI, the number of titratable amino acids and the ratio of acidic to basic residues, are sufficient to reliably classify proteins by their IER based on their sequence only, and thus to predict their binding and elution behaviour in ion exchange chromatography.

Transcriptional factor DLX3 promotes the gene expression of enamel matrix proteins during amelogenesis.

Science.gov (United States)

Zhang, Zhichun; Tian, Hua; Lv, Ping; Wang, Weiping; Jia, Zhuqing; Wang, Sainan; Zhou, Chunyan; Gao, Xuejun

2015-01-01

Mutation of distal-less homeobox 3 (DLX3) is responsible for human tricho-dento-osseous syndrome (TDO) with amelogenesis imperfecta, indicating a crucial role of DLX3 in amelogenesis. However, the expression pattern of DLX3 and its specific function in amelogenesis remain largely unknown. The aim of this study was to investigate the effects of DLX3 on enamel matrix protein (EMP) genes. By immunohistochemistry assays of mouse tooth germs, stronger immunostaining of DLX3 protein was identified in ameloblasts in the secretory stage than in the pre-secretory and maturation stages, and the same pattern was found for Dlx3 mRNA using Realtime PCR. In a mouse ameloblast cell lineage, forced expression of DLX3 up-regulated the expression of the EMP genes Amelx, Enam, Klk4, and Odam, whereas knockdown of DLX3 down-regulated these four EMP genes. Further, bioinformatics, chromatin immunoprecipitation, and luciferase assays revealed that DLX3 transactivated Enam, Amelx, and Odam through direct binding to their enhancer regions. Particularly, over-expression of mutant-DLX3 (c.571_574delGGGG, responsible for TDO) inhibited the activation function of DLX3 on expression levels and promoter activities of the Enam, Amelx, and Odam genes. Together, our data show that DLX3 promotes the expression of the EMP genes Amelx, Enam, Klk4, and Odam in amelogenesis, while mutant-DLX3 disrupts this regulatory function, thus providing insights into the molecular mechanisms underlying the enamel defects of TDO disease.

Functional dissection of a napin gene promoter: identification of promoter elements required for embryo and endosperm-specific transcription.

Science.gov (United States)

Ellerström, M; Stålberg, K; Ezcurra, I; Rask, L

1996-12-01

The promoter region (-309 to +44) of the Brassica napus storage protein gene napA was studied in transgenic tobacco by successive 5' as well as internal deletions fused to the reporter gene GUS (beta-glucuronidase). The expression in the two main tissues of the seed, the endosperm and the embryo, was shown to be differentially regulated. This tissue-specific regulation within the seed was found to affect the developmental expression during seed development. The region between -309 to -152, which has a large effect on quantitative expression, was shown to harbour four elements regulating embryo and one regulating endosperm expression. This region also displayed enhancer activity. Deletion of eight bp from position -152 to position -144 totally abolished the activity of the napA promoter. This deletion disrupted a cis element with similarity to an ABA-responsive element (ABRE) overlapping with an E-box, demonstrating its crucial importance for quantitative expression. An internal deletion of the region -133 to -120, resulted in increased activity in both leaves and endosperm and a decreased activity in the embryo. Within this region, a cis element similar to the (CA)n element, found in other storage protein promoters, was identified. This suggest that the (CA)n element is important for conferring seed specificity by serving both as an activator and a repressor element.

The mitochondrial outer membrane protein MDI promotes local protein synthesis and mtDNA replication.

Science.gov (United States)

Zhang, Yi; Chen, Yong; Gucek, Marjan; Xu, Hong

2016-05-17

Early embryonic development features rapid nuclear DNA replication cycles, but lacks mtDNA replication. To meet the high-energy demands of embryogenesis, mature oocytes are furnished with vast amounts of mitochondria and mtDNA However, the cellular machinery driving massive mtDNA replication in ovaries remains unknown. Here, we describe a Drosophila AKAP protein, MDI that recruits a translation stimulator, La-related protein (Larp), to the mitochondrial outer membrane in ovaries. The MDI-Larp complex promotes the synthesis of a subset of nuclear-encoded mitochondrial proteins by cytosolic ribosomes on the mitochondrial surface. MDI-Larp's targets include mtDNA replication factors, mitochondrial ribosomal proteins, and electron-transport chain subunits. Lack of MDI abolishes mtDNA replication in ovaries, which leads to mtDNA deficiency in mature eggs. Targeting Larp to the mitochondrial outer membrane independently of MDI restores local protein synthesis and rescues the phenotypes of mdi mutant flies. Our work suggests that a selective translational boost by the MDI-Larp complex on the outer mitochondrial membrane might be essential for mtDNA replication and mitochondrial biogenesis during oogenesis. Published 2016. This article is a U.S. Government work and is in the public domain in the USA.

Transactivation of a cellular promoter by the NS1 protein of the parvovirus minute virus of mice through a putative hormone-responsive element.

Science.gov (United States)

Vanacker, J M; Corbau, R; Adelmant, G; Perros, M; Laudet, V; Rommelaere, J

1996-01-01

The promoter of the thyroid hormone receptor alpha gene (c-erbA-1) is activated by the nonstructural protein 1 (NS1) of parvovirus minute virus of mice (prototype strain [MVMp]) in ras-transformed FREJ4 cells that are permissive for lytic MVMp replication. This stimulation may be related to the sensitivity of host cells to MVMp, as it does not take place in parental FR3T3 cells, which are resistant to the parvovirus killing effect. The analysis of a series of deletion and point mutants of the c-erbA-1 promoter led to the identification of an upstream region that is necessary for NS1-driven transactivation. This sequence harbors a putative hormone-responsive element and is sufficient to render a minimal promoter NS1 inducible in FREJ4 but not in FR3T3 cells, and it is involved in distinct interactions with proteins from the respective cell lines. The NS1-responsive element of the c-erbA-1 promoter bears no homology with sequences that were previously reported to be necessary for NS1 DNA binding and transactivation. Altogether, our data point to a novel, cell-specific mechanism of promoter activation by NS1. PMID:8642664

Distinct Prion Domain Sequences Ensure Efficient Amyloid Propagation by Promoting Chaperone Binding or Processing In Vivo.

Directory of Open Access Journals (Sweden)

Christine R Langlois

2016-11-01

Full Text Available Prions are a group of proteins that can adopt a spectrum of metastable conformations in vivo. These alternative states change protein function and are self-replicating and transmissible, creating protein-based elements of inheritance and infectivity. Prion conformational flexibility is encoded in the amino acid composition and sequence of the protein, which dictate its ability not only to form an ordered aggregate known as amyloid but also to maintain and transmit this structure in vivo. But, while we can effectively predict amyloid propensity in vitro, the mechanism by which sequence elements promote prion propagation in vivo remains unclear. In yeast, propagation of the [PSI+] prion, the amyloid form of the Sup35 protein, has been linked to an oligopeptide repeat region of the protein. Here, we demonstrate that this region is composed of separable functional elements, the repeats themselves and a repeat proximal region, which are both required for efficient prion propagation. Changes in the numbers of these elements do not alter the physical properties of Sup35 amyloid, but their presence promotes amyloid fragmentation, and therefore maintenance, by molecular chaperones. Rather than acting redundantly, our observations suggest that these sequence elements make complementary contributions to prion propagation, with the repeat proximal region promoting chaperone binding to and the repeats promoting chaperone processing of Sup35 amyloid.

Molecular Characterization of SQUAMOSA PROMOTER BINDING PROTEIN-LIKE (SPL Gene Family in Betula luminifera

Directory of Open Access Journals (Sweden)

Xiu-Yun Li

2018-05-01

Full Text Available As a major family of plant-specific transcription factors, SQUAMOSA PROMOTER BINDING PROTEIN-LIKE (SPL genes play vital regulatory roles in plant growth, development and stress responses. In this study, 18 SPL genes were identified and cloned from Betula luminifera. Two zinc finger-like structures and a nuclear location signal (NLS segments were existed in the SBP domains of all BlSPLs. Phylogenetic analysis showed that these genes were clustered into nine groups (group I-IX. The intron/exon structure and motif composition were highly conserved within the same group. 12 of the 18 BlSPLs were experimentally verified as the targets of miR156, and two cleavage sites were detected in these miR156-targeted BlSPL genes. Many putative cis-elements, associated with light, stresses and phytohormones response, were identified in the promoter regions of BlSPLs, suggesting that BlSPL genes are probably involved in important physiological processes and developmental events. Tissue-specific expression analysis showed that miR156-targeted BlSPLs exhibited a more differential expression pattern, while most miR156-nontargeted BlSPLs tended to be constitutively expressed, suggesting the distinct roles of miR156-targeted and nontargeted BlSPLs in development and growth of B. luminifera. Further expression analysis revealed that miR156-targeted BlSPLs were dramatically up-regulated with age, whereas mature BlmiR156 level was apparently declined with age, indicating that miR156/SPL module plays important roles in vegetative phase change of B. luminifera. Moreover, yeast two-hybrid assay indicated that several miR156-targeted and nontargeted BlSPLs could interact with two DELLA proteins (BlRGA and BlRGL, which suggests that certain BlSPLs take part in the GA regulated processes through protein interaction with DELLA proteins. All these results provide an important basis for further exploring the biological functions of BlSPLs in B. luminifera.

Characterization of the promoter region of the human c-erbB-2 protooncogene

International Nuclear Information System (INIS)

Ishii, S.; Imamoto, F.; Yamanashi, Y.; Toyoshima, K.; Yamamoto, T.

1987-01-01

Three overlapping genomic clones that contain the 5'-terminal portion of the human c-erbB-2 gene (ERBB2) were isolated. The promoter region was identified by nuclease S1 mapping with c-erbB-2 mRNA. Seven transcriptional start sites were identified. DNA sequence analysis showed that the promoter region contains a TATA box and a CAAT box about 30 and 80 base pairs (bp), respectively, upstream of the most downstream RNA initiation site. Two putative binding sites for transcription factor Sp1 were identified about 50 and 110 bp upstream of the CAAT box, and six GGA repeats were found between the CAAT box and the TATA box. This region had strong promoter activity when placed upstream of the bacterial chloramphenicol acetyltransferase gene and transfected into monkey CV-1 cells. These data indicate that the promoter of the human c-erbB-2 protooncogene is different from that of the protooncogene c-erbB-1 (epidermal growth factor receptor gene), which does not contain either a TATA box or a CAAT box. Comparison of the promoter sequences and activities of the two protooncogenes should be helpful in analysis of the regulatory mechanism of expression of their gene products, which are growth-factor receptors

Combgap Promotes Ovarian Niche Development and Chromatin Association of EcR-Binding Regions in BR-C.

Science.gov (United States)

Hitrik, Anna; Popliker, Malka; Gancz, Dana; Mukamel, Zohar; Lifshitz, Aviezer; Schwartzman, Omer; Tanay, Amos; Gilboa, Lilach

2016-11-01

The development of niches for tissue-specific stem cells is an important aspect of stem cell biology. Determination of niche size and niche numbers during organogenesis involves precise control of gene expression. How this is achieved in the context of a complex chromatin landscape is largely unknown. Here we show that the nuclear protein Combgap (Cg) supports correct ovarian niche formation in Drosophila by controlling ecdysone-Receptor (EcR)- mediated transcription and long-range chromatin contacts in the broad locus (BR-C). Both cg and BR-C promote ovarian growth and the development of niches for germ line stem cells. BR-C levels were lower when Combgap was either reduced or over-expressed, indicating an intricate regulation of the BR-C locus by Combgap. Polytene chromosome stains showed that Cg co-localizes with EcR, the major regulator of BR-C, at the BR-C locus and that EcR binding to chromatin was sensitive to changes in Cg levels. Proximity ligation assay indicated that the two proteins could reside in the same complex. Finally, chromatin conformation analysis revealed that EcR-bound regions within BR-C, which span ~30 KBs, contacted each other. Significantly, these contacts were stabilized in an ecdysone- and Combgap-dependent manner. Together, these results highlight Combgap as a novel regulator of chromatin structure that promotes transcription of ecdysone target genes and ovarian niche formation.

Selection for Unequal Densities of Sigma70 Promoter-like Signalsin Different Regions of Large Bacterial Genomes

Energy Technology Data Exchange (ETDEWEB)

Huerta, Araceli M.; Francino, M. Pilar; Morett, Enrique; Collado-Vides, Julio

2006-03-01

The evolutionary processes operating in the DNA regions that participate in the regulation of gene expression are poorly understood. In Escherichia coli, we have established a sequence pattern that distinguishes regulatory from nonregulatory regions. The density of promoter-like sequences, that are recognizable by RNA polymerase and may function as potential promoters, is high within regulatory regions, in contrast to coding regions and regions located between convergently-transcribed genes. Moreover, functional promoter sites identified experimentally are often found in the subregions of highest density of promoter-like signals, even when individual sites with higher binding affinity for RNA polymerase exist elsewhere within the regulatory region. In order to investigate the generality of this pattern, we have used position weight matrices describing the -35 and -10 promoter boxes of E. coli to search for these motifs in 43 additional genomes belonging to most established bacterial phyla, after specific calibration of the matrices according to the base composition of the noncoding regions of each genome. We have found that all bacterial species analyzed contain similar promoter-like motifs, and that, in most cases, these motifs follow the same genomic distribution observed in E. coli. Differential densities between regulatory and nonregulatory regions are detectable in most bacterial genomes, with the exception of those that have experienced evolutionary extreme genome reduction. Thus, the phylogenetic distribution of this pattern mirrors that of genes and other genomic features that require weak selection to be effective in order to persist. On this basis, we suggest that the loss of differential densities in the reduced genomes of host-restricted pathogens and symbionts is the outcome of a process of genome degradation resulting from the decreased efficiency of purifying selection in highly structured small populations. This implies that the differential

Isolation of a novel promoter for efficient protein expression by Aspergillus oryzae in solid-state culture.

Science.gov (United States)

Bando, Hiroki; Hisada, Hiromoto; Ishida, Hiroki; Hata, Yoji; Katakura, Yoshio; Kondo, Akihiko

2011-11-01

A novel promoter from a hemolysin-like protein encoding the gene, hlyA, was characterized for protein overexpression in Aspergillus oryzae grown in solid-state culture. Using endo-1,4-β-glucanase from A. oryzae (CelA) as the reporter, promoter activity was found to be higher than that of the α-amylase (amyA) and manganese superoxide dismutase (sodM) genes not only in wheat bran solid-state culture but also in liquid culture. Expression of the A. oryzae endoglucanase CelB and two heterologous endoglucanases (TrEglI and TrEglIII from Trichoderma reesei) under the control of the hlyA promoter were also found to be stronger than under the control of the amyA promoter in A. oryzae grown in wheat bran solid-state culture, suggesting that the hlyA promoter may be useful for the overproduction of other proteins as well. In wheat bran solid-state culture, the productivity of the hlyA promoter in terms of protein produced was high when the cultivation temperature was 30°C or 37°C, when the water content was 0.6 or 0.8 ml/g wheat bran, and from 48 to 72 h after inoculation. Because A. oryzae sporulated actively under these conditions and because hemolysin has been reported to play a role in fungal fruiting body formation, high-level expression of hlyA may be related to sporulation.

Mechanosensitive promoter region in the human HB-GAM gene

DEFF Research Database (Denmark)

Liedert, Astrid; Kassem, Moustapha; Claes, Lutz

2009-01-01

Mechanical loading is essential for maintaining bone mass in the adult skeleton. However, the underlying process of the transfer of the physical stimulus into a biochemical response, which is termed mechanotransduction is poorly understood. Mechanotransduction results in the modulation of gene...... cells. Analysis of the human HB-GAM gene upstream regulatory region with luciferase reporter gene assays revealed that the upregulation of HB-GAM expression occurred at the transcriptional level and was mainly dependent on the HB-GAM promoter region most upstream containing three potential AP-1 binding...

Activation of mitochondrial promoter PH-binding protein in a radio-resistant Chinese hamster cell strain associated with Bcl-2

International Nuclear Information System (INIS)

Roychoudhury, Paromita; Ghosh, Utpal; Bhattacharyya, Nitai P.; Chaudhuri, Keya

2006-01-01

The cellular response to ionizing radiation is mediated by a complex interaction of number of proteins involving different pathways. Previously, we have shown that up regulation of mitochondrial genes ND1, ND4, and COX1 transcribed from the heavy strand promoter (P H ) has been increased in a radio-resistant cell strain designated as M5 in comparison with the parental Chinese hamster V79 cells. These genes are also up regulated in Chinese hamster V79 cells VB13 that express exogenous human Bcl2. In the present study, the expression of the gene ND6 that is expressed from the light strand promoter (P L ) was found to be similar in both the cell lines, as determined by RT-PCR. To test the possibility that this differential expression of mitochondrial genes under these two promoters was mediated by differences in proteins' affinity to interact with these promoters, we have carried out electrophoretic mobility shift assay (EMSA) using mitochondrial cell extracts from these two cell lines. Our result of these experiments revealed that two different proteins formed complex with the synthetic promoters and higher amount of protein from M5 cell extracts interacted with the P H promoter in comparison to that observed with cell extracts from Chinese hamster V79 cells. The promoter-specific differential binding of proteins was also observed in VB13. These results showed that differential mitochondrial gene expression observed earlier in the radio-resistant M5 cells was due to enhanced interaction proteins with the promoters P H and mediated by the expression of Bcl2

Protein-protein docking using region-based 3D Zernike descriptors.

Science.gov (United States)

Venkatraman, Vishwesh; Yang, Yifeng D; Sael, Lee; Kihara, Daisuke

2009-12-09

Protein-protein interactions are a pivotal component of many biological processes and mediate a variety of functions. Knowing the tertiary structure of a protein complex is therefore essential for understanding the interaction mechanism. However, experimental techniques to solve the structure of the complex are often found to be difficult. To this end, computational protein-protein docking approaches can provide a useful alternative to address this issue. Prediction of docking conformations relies on methods that effectively capture shape features of the participating proteins while giving due consideration to conformational changes that may occur. We present a novel protein docking algorithm based on the use of 3D Zernike descriptors as regional features of molecular shape. The key motivation of using these descriptors is their invariance to transformation, in addition to a compact representation of local surface shape characteristics. Docking decoys are generated using geometric hashing, which are then ranked by a scoring function that incorporates a buried surface area and a novel geometric complementarity term based on normals associated with the 3D Zernike shape description. Our docking algorithm was tested on both bound and unbound cases in the ZDOCK benchmark 2.0 dataset. In 74% of the bound docking predictions, our method was able to find a near-native solution (interface C-alphaRMSD 3D Zernike descriptors are adept in capturing shape complementarity at the protein-protein interface and useful for protein docking prediction. Rigorous benchmark studies show that our docking approach has a superior performance compared to existing methods.

Tissue-specific interactions between nuclear proteins and the aminopeptidase N promoter

DEFF Research Database (Denmark)

Kärnström, U; Sjöström, H; Norén, O

1991-01-01

Aminopeptidase N/CD13 is a metallopeptidase found in many tissues. Aminopeptidase N activity is high in the small intestinal mucosa, moderate in the liver, and low in the spleen. Using DNase I footprinting and electrophoretic mobility shift assays with nuclear extracts from these tissues, three cis...... elements (DF, LF-B1, UF) were identified in the aminopeptidase N promoter. The DF region (-53 to -30) interacts with the ubiquitously expressed transcription factor Sp1. The LF-B1 region (-85 to -58) interacts with the liver transcription factor LF-B1 (HNF-1) which was detected as well in nuclei from small...... intestinal mucosa. The UF region (-112 to -90) interacts with nuclear factors which seem to be expressed differentially in the liver and the small intestine. Transfection of promoter deletions into HepG2 cells showed that the LF-B1 region is necessary for high expression of the aminopeptidase N gene in liver...

Sequence-specific capture of protein-DNA complexes for mass spectrometric protein identification.

Directory of Open Access Journals (Sweden)

Cheng-Hsien Wu

Full Text Available The regulation of gene transcription is fundamental to the existence of complex multicellular organisms such as humans. Although it is widely recognized that much of gene regulation is controlled by gene-specific protein-DNA interactions, there presently exists little in the way of tools to identify proteins that interact with the genome at locations of interest. We have developed a novel strategy to address this problem, which we refer to as GENECAPP, for Global ExoNuclease-based Enrichment of Chromatin-Associated Proteins for Proteomics. In this approach, formaldehyde cross-linking is employed to covalently link DNA to its associated proteins; subsequent fragmentation of the DNA, followed by exonuclease digestion, produces a single-stranded region of the DNA that enables sequence-specific hybridization capture of the protein-DNA complex on a solid support. Mass spectrometric (MS analysis of the captured proteins is then used for their identification and/or quantification. We show here the development and optimization of GENECAPP for an in vitro model system, comprised of the murine insulin-like growth factor-binding protein 1 (IGFBP1 promoter region and FoxO1, a member of the forkhead rhabdomyosarcoma (FoxO subfamily of transcription factors, which binds specifically to the IGFBP1 promoter. This novel strategy provides a powerful tool for studies of protein-DNA and protein-protein interactions.

A Legionella pneumophila effector protein encoded in a region of genomic plasticity binds to Dot/Icm-modified vacuoles.

Directory of Open Access Journals (Sweden)

Shira Ninio

2009-01-01

Full Text Available Legionella pneumophila is an opportunistic pathogen that can cause a severe pneumonia called Legionnaires' disease. In the environment, L. pneumophila is found in fresh water reservoirs in a large spectrum of environmental conditions, where the bacteria are able to replicate within a variety of protozoan hosts. To survive within eukaryotic cells, L. pneumophila require a type IV secretion system, designated Dot/Icm, that delivers bacterial effector proteins into the host cell cytoplasm. In recent years, a number of Dot/Icm substrate proteins have been identified; however, the function of most of these proteins remains unknown, and it is unclear why the bacterium maintains such a large repertoire of effectors to promote its survival. Here we investigate a region of the L. pneumophila chromosome that displays a high degree of plasticity among four sequenced L. pneumophila strains. Analysis of GC content suggests that several genes encoded in this region were acquired through horizontal gene transfer. Protein translocation studies establish that this region of genomic plasticity encodes for multiple Dot/Icm effectors. Ectopic expression studies in mammalian cells indicate that one of these substrates, a protein called PieA, has unique effector activities. PieA is an effector that can alter lysosome morphology and associates specifically with vacuoles that support L. pneumophila replication. It was determined that the association of PieA with vacuoles containing L. pneumophila requires modifications to the vacuole mediated by other Dot/Icm effectors. Thus, the localization properties of PieA reveal that the Dot/Icm system has the ability to spatially and temporally control the association of an effector with vacuoles containing L. pneumophila through activities mediated by other effector proteins.

Intergenic sequence between Arabidopsis caseinolytic protease B-cytoplasmic/heat shock protein100 and choline kinase genes functions as a heat-inducible bidirectional promoter.

Science.gov (United States)

Mishra, Ratnesh Chandra; Grover, Anil

2014-11-01

In Arabidopsis (Arabidopsis thaliana), the At1g74310 locus encodes for caseinolytic protease B-cytoplasmic (ClpB-C)/heat shock protein100 protein (AtClpB-C), which is critical for the acquisition of thermotolerance, and At1g74320 encodes for choline kinase (AtCK2) that catalyzes the first reaction in the Kennedy pathway for phosphatidylcholine biosynthesis. Previous work has established that the knockout mutants of these genes display heat-sensitive phenotypes. While analyzing the AtClpB-C promoter and upstream genomic regions in this study, we noted that AtClpB-C and AtCK2 genes are head-to-head oriented on chromosome 1 of the Arabidopsis genome. Expression analysis showed that transcripts of these genes are rapidly induced in response to heat stress treatment. In stably transformed Arabidopsis plants harboring this intergenic sequence between head-to-head oriented green fluorescent protein and β-glucuronidase reporter genes, both transcripts and proteins of the two reporters were up-regulated upon heat stress. Four heat shock elements were noted in the intergenic region by in silico analysis. In the homozygous transfer DNA insertion mutant Salk_014505, 4,393-bp transfer DNA is inserted at position -517 upstream of ATG of the AtClpB-C gene. As a result, AtCk2 loses proximity to three of the four heat shock elements in the mutant line. Heat-inducible expression of the AtCK2 transcript was completely lost, whereas the expression of AtClpB-C was not affected in the mutant plants. Our results suggest that the 1,329-bp intergenic fragment functions as a heat-inducible bidirectional promoter and the region governing the heat inducibility is possibly shared between the two genes. We propose a model in which AtClpB-C shares its regulatory region with heat-induced choline kinase, which has a possible role in heat signaling. © 2014 American Society of Plant Biologists. All Rights Reserved.

SRSF1-3 contributes to diversification of the immunoglobulin variable region gene by promoting accumulation of AID in the nucleus.

Science.gov (United States)

Kawaguchi, Yuka; Nariki, Hiroaki; Kawamoto, Naoko; Kanehiro, Yuichi; Miyazaki, Satoshi; Suzuki, Mari; Magari, Masaki; Tokumitsu, Hiroshi; Kanayama, Naoki

2017-04-01

Activation-induced cytidine deaminase (AID) is essential for diversification of the Ig variable region (IgV). AID is excluded from the nucleus, where it normally functions. However, the molecular mechanisms responsible for regulating AID localization remain to be elucidated. The SR-protein splicing factor SRSF1 is a nucleocytoplasmic shuttling protein, a splicing isoform of which called SRSF1-3, has previously been shown to contribute to IgV diversification in chicken DT40 cells. In this study, we examined whether SRSF1-3 functions in IgV diversification by promoting nuclear localization of AID. AID expressed alone was localized predominantly in the cytoplasm. In contrast, co-expression of AID with SRSF1-3 led to the nuclear accumulation of both AID and SRSF1-3 and the formation of a protein complex that contained them both, although SRSF1-3 was dispensable for nuclear import of AID. Expression of either SRSF1-3 or a C-terminally-truncated AID mutant increased IgV diversification in DT40 cells. However, overexpression of exogenous SRSF1-3 was unable to further enhance IgV diversification in DT40 cells expressing the truncated AID mutant, although SRSF1-3 was able to form a protein complex with the AID mutant. These results suggest that SRSF1-3 promotes nuclear localization of AID probably by forming a nuclear protein complex, which might stabilize nuclear AID and induce IgV diversification in an AID C-terminus-dependent manner. Copyright © 2017 Elsevier Inc. All rights reserved.

Predicting binding within disordered protein regions to structurally characterised peptide-binding domains.

Directory of Open Access Journals (Sweden)

Waqasuddin Khan

Full Text Available Disordered regions of proteins often bind to structured domains, mediating interactions within and between proteins. However, it is difficult to identify a priori the short disordered regions involved in binding. We set out to determine if docking such peptide regions to peptide binding domains would assist in these predictions.We assembled a redundancy reduced dataset of SLiM (Short Linear Motif containing proteins from the ELM database. We selected 84 sequences which had an associated PDB structures showing the SLiM bound to a protein receptor, where the SLiM was found within a 50 residue region of the protein sequence which was predicted to be disordered. First, we investigated the Vina docking scores of overlapping tripeptides from the 50 residue SLiM containing disordered regions of the protein sequence to the corresponding PDB domain. We found only weak discrimination of docking scores between peptides involved in binding and adjacent non-binding peptides in this context (AUC 0.58.Next, we trained a bidirectional recurrent neural network (BRNN using as input the protein sequence, predicted secondary structure, Vina docking score and predicted disorder score. The results were very promising (AUC 0.72 showing that multiple sources of information can be combined to produce results which are clearly superior to any single source.We conclude that the Vina docking score alone has only modest power to define the location of a peptide within a larger protein region known to contain it. However, combining this information with other knowledge (using machine learning methods clearly improves the identification of peptide binding regions within a protein sequence. This approach combining docking with machine learning is primarily a predictor of binding to peptide-binding sites, and is not intended as a predictor of specificity of binding to particular receptors.

Identification of a single-nucleotide insertion in the promoter region affecting the sodC promoter activity in Brucella neotomae.

Directory of Open Access Journals (Sweden)

Dina A Moustafa

Full Text Available Brucella neotomae is not known to be associated with clinical disease in any host species. Previous research suggested that B. neotomae might not express detectable levels of Cu/Zn superoxide dismutase (SOD, a periplasmic enzyme known to be involved in protecting Brucella from oxidative bactericidal effects of host phagocytes. This study was undertaken to investigate the genetic basis for the disparity in SOD expression in B. neotomae. Our Western blot and SOD enzyme assay analyses indicated that B. neotomae does express SOD, but at a substantially reduced level. Nucleotide sequence analysis of region upstream to the sodC gene identified a single-nucleotide insertion in the potential promoter region. The same single-nucleotide insertion was also detected in the sodC promoter of B. suis strain Thomsen, belonging to biovar 2 in which SOD expression was undetectable previously. Examination of the sodC promoter activities using translational fusion constructs with E. coli β-galactosidase demonstrated that the B. neotomae and B. suis biovar 2 promoters were very weak in driving gene expression. Site-directed mutation studies indicated that the insertion of A in the B. neotomae sodC promoter reduced the promoter activity. Increasing the level of SOD expression in B. neotomae through complementation with B. abortus sodC gene did not alter the bacterial survival in J774A.1 macrophage-like cells and in tissues of BALB/c and C57BL/6 mice. These results for the first time demonstrate the occurrence of a single-nucleotide polymorphism affecting promoter function and gene expression in Brucella.

Clinical significance of promoter region hypermethylation of microRNA-148a in gastrointestinal cancers

Directory of Open Access Journals (Sweden)

Sun JX

2014-05-01

Full Text Available Jingxu Sun,1,* Yongxi Song,1,* Zhenning Wang,1 Guoli Wang,2 Peng Gao,1 Xiaowan Chen,1 Zhaohua Gao,1 Huimian Xu1 1Department of Surgical Oncology and General Surgery, First Hospital of China Medical University, Shenyang, People’s Republic of China; 2Department of Biochemistry and Molecular Biology, China Medical University, Shenyang, People’s Republic of China *These authors contributed equally to this work Background: MicroRNAs are associated with tumor genesis and progression in various carcinomas. MicroRNA-148a (miR-148a was reported to have low expression in gastrointestinal cancers, and might be regulated by promoter region DNA methylation. Methods: Bisulfite-modified sequencing was used to determine the promoter region DNA methylation status of human gastrointestinal cancer cell lines. Expression levels of miR-148a in cell lines treated with 5-aza-2′-deoxycytidine were determined by quantitative real-time polymerase chain reaction. Total DNA was extracted from the tissues of 64 patients with gastric cancer and 51 patients with colorectal cancer. Methylation status was determined by methylation-specific polymerase chain reaction. All statistical analyses were performed with SPSS 17.0 software. Results: The promoter regions of genes in human gastrointestinal cancer cell lines were all hypermethylated, except for HT-29, and the expression of miR-148a tended to be higher than in controls after treatment with 5-aza-2′-deoxycytidine. The methylation-specific polymerase chain reaction results showed that 56.25% of gastric cancer tissues and 19.61% of colorectal cancer tissues were hypermethylated. A strong correlation was found between the expression of miR-148a and the methylation status of promoter regions (P<0.001, chi-square test and Pearson’s correlation. Furthermore, promoter region CpG site hypermethylation of miR-148a was correlated with increased tumor size (P=0.01 in gastric cancer after analyzing the correlation between

Expected packing density allows prediction of both amyloidogenic and disordered regions in protein chains

Energy Technology Data Exchange (ETDEWEB)

Galzitskaya, Oxana V; Garbuzynskiy, Sergiy O; Lobanov, Michail Yu [Institute of Protein Research, Russian Academy of Sciences, 142290, Pushchino, Moscow Region (Russian Federation)

2007-07-18

The determination of factors that influence conformational changes in proteins is very important for the identification of potentially amyloidogenic and disordered regions in polypeptide chains. In our work we introduce a new parameter, mean packing density, to detect both amyloidogenic and disordered regions in a protein sequence. It has been shown that regions with strong expected packing density are responsible for amyloid formation. Our predictions are consistent with known disease-related amyloidogenic regions for 9 of 12 amyloid-forming proteins and peptides in which the positions of amyloidogenic regions have been revealed experimentally. Our findings support the concept that the mechanism of formation of amyloid fibrils is similar for different peptides and proteins. Moreover, we have demonstrated that regions with weak expected packing density are responsible for the appearance of disordered regions. Our method has been tested on datasets of globular proteins and long disordered protein segments, and it shows improved performance over other widely used methods. Thus, we demonstrate that the expected packing density is a useful value for predicting both disordered and amyloidogenic regions of a protein based on sequence alone. Our results are important for understanding the structural characteristics of protein folding and misfolding.

Transcriptional factor DLX3 promotes the gene expression of enamel matrix proteins during amelogenesis.

Directory of Open Access Journals (Sweden)

Zhichun Zhang

Full Text Available Mutation of distal-less homeobox 3 (DLX3 is responsible for human tricho-dento-osseous syndrome (TDO with amelogenesis imperfecta, indicating a crucial role of DLX3 in amelogenesis. However, the expression pattern of DLX3 and its specific function in amelogenesis remain largely unknown. The aim of this study was to investigate the effects of DLX3 on enamel matrix protein (EMP genes. By immunohistochemistry assays of mouse tooth germs, stronger immunostaining of DLX3 protein was identified in ameloblasts in the secretory stage than in the pre-secretory and maturation stages, and the same pattern was found for Dlx3 mRNA using Realtime PCR. In a mouse ameloblast cell lineage, forced expression of DLX3 up-regulated the expression of the EMP genes Amelx, Enam, Klk4, and Odam, whereas knockdown of DLX3 down-regulated these four EMP genes. Further, bioinformatics, chromatin immunoprecipitation, and luciferase assays revealed that DLX3 transactivated Enam, Amelx, and Odam through direct binding to their enhancer regions. Particularly, over-expression of mutant-DLX3 (c.571_574delGGGG, responsible for TDO inhibited the activation function of DLX3 on expression levels and promoter activities of the Enam, Amelx, and Odam genes. Together, our data show that DLX3 promotes the expression of the EMP genes Amelx, Enam, Klk4, and Odam in amelogenesis, while mutant-DLX3 disrupts this regulatory function, thus providing insights into the molecular mechanisms underlying the enamel defects of TDO disease.

Growth hormone-promoted tyrosyl phosphorylation of SHC proteins and SHC association with Grb2

DEFF Research Database (Denmark)

VanderKuur, J; Allevato, G; Billestrup, Nils

1995-01-01

. To gain insight into pathways coupling GH receptor (GHR) to MAP kinase activation and signaling molecules that might interact with GHR and its associated tyrosine kinase JAK2, we examined whether SHC and Grb2 proteins serve as signaling molecules for GH. Human GH was shown to promote the rapid tyrosyl...... phosphorylation of 66-, 52-, and 46-kDa SHC proteins in 3T3-F442A fibroblasts. GH also promoted binding of GHR and JAK2 to the SH2 domain of 46/52-kDa SHC protein fused to glutathione S-transferase (GST). Constitutively phosphorylated JAK2, from COS-7 cells transiently transfected with murine JAK2 cDNA, bound......-638 and GHR1-638(Y333,338F), GH stimulated phosphorylation of all 3 SHC proteins whereas GH stimulated phosphorylation of only the 66- and 52-kDa SHC proteins in cells expressing GHR1-454. GH had no effect on SHC phosphorylation in cells expressing GHR1-294 or GHR delta P, the latter lacking amino acids 297...

Brand Products of Regional Cuisine in the Promotion of Tourism in Roztocze

Directory of Open Access Journals (Sweden)

Bekier-Jaworska Ewa

2015-03-01

Full Text Available Introduction. There has been a trend over the last few years of using specialties of regional cuisine as an independent tourist attraction. The creation of local brands is an important element in the promotion of a given region and it also influences the development of culinary tourism. The aim of the studies conducted was to identify regional dishes - a choice of dishes that could be described as 'brand dishes' and the use of those dishes as tourist attractions in Roztocze. Material and methods. Studies were conducted on a group of students studying tourism and recreation at State Higher School of Vocational Education (PWSZ in Zamość using a questionnaire. Results. The questionnaire provided an assessment of the levels of knowledge of regional cuisine among Polish and Ukrainian students, identified the most characteristic dishes and selected brand products, and helped to arrive at a suitable method of promotion. Conclusions. Nationality, family customs and selection of local restaurants highly influence knowledge of regional cuisine. Interviewees decided that the most outstanding products from Roztocze were Zwierzyniec beer, and Biłgoraj pie. Regional products should be used as a tourist attraction in Roztocze.

Sub-nanoscale surface ruggedness provides a water-tight seal for exposed regions in soluble protein structure.

Directory of Open Access Journals (Sweden)

Erica Schulz

2010-09-01

Full Text Available Soluble proteins must maintain backbone hydrogen bonds (BHBs water-tight to ensure structural integrity. This protection is often achieved by burying the BHBs or wrapping them through intermolecular associations. On the other hand, water has low coordination resilience, with loss of hydrogen-bonding partnerships carrying significant thermodynamic cost. Thus, a core problem in structural biology is whether natural design actually exploits the water coordination stiffness to seal the backbone in regions that are exposed to the solvent. This work explores the molecular design features that make this type of seal operative, focusing on the side-chain arrangements that shield the protein backbone. We show that an efficient sealing is achieved by adapting the sub-nanoscale surface topography to the stringency of water coordination: an exposed BHB may be kept dry if the local concave curvature is small enough to impede formation of the coordination shell of a penetrating water molecule. Examination of an exhaustive database of uncomplexed proteins reveals that exposed BHBs invariably occur within such sub-nanoscale cavities in native folds, while this level of local ruggedness is absent in other regions. By contrast, BHB exposure in misfolded proteins occurs with larger local curvature promoting backbone hydration and consequently, structure disruption. These findings unravel physical constraints fitting a spatially dependent least-action for water coordination, introduce a molecular design concept, and herald the advent of water-tight peptide-based materials with sufficient backbone exposure to remain flexible.

Promoter Analysis Reveals Globally Differential Regulation of Human Long Non-Coding RNA and Protein-Coding Genes

KAUST Repository

Alam, Tanvir

2014-10-02

Transcriptional regulation of protein-coding genes is increasingly well-understood on a global scale, yet no comparable information exists for long non-coding RNA (lncRNA) genes, which were recently recognized to be as numerous as protein-coding genes in mammalian genomes. We performed a genome-wide comparative analysis of the promoters of human lncRNA and protein-coding genes, finding global differences in specific genetic and epigenetic features relevant to transcriptional regulation. These two groups of genes are hence subject to separate transcriptional regulatory programs, including distinct transcription factor (TF) proteins that significantly favor lncRNA, rather than coding-gene, promoters. We report a specific signature of promoter-proximal transcriptional regulation of lncRNA genes, including several distinct transcription factor binding sites (TFBS). Experimental DNase I hypersensitive site profiles are consistent with active configurations of these lncRNA TFBS sets in diverse human cell types. TFBS ChIP-seq datasets confirm the binding events that we predicted using computational approaches for a subset of factors. For several TFs known to be directly regulated by lncRNAs, we find that their putative TFBSs are enriched at lncRNA promoters, suggesting that the TFs and the lncRNAs may participate in a bidirectional feedback loop regulatory network. Accordingly, cells may be able to modulate lncRNA expression levels independently of mRNA levels via distinct regulatory pathways. Our results also raise the possibility that, given the historical reliance on protein-coding gene catalogs to define the chromatin states of active promoters, a revision of these chromatin signature profiles to incorporate expressed lncRNA genes is warranted in the future.

Identification of functional DNA variants in the constitutive promoter region of MDM2

Directory of Open Access Journals (Sweden)

Lalonde Marie-Eve

2012-09-01

Full Text Available Abstract Although mutations in the oncoprotein murine double minute 2 (MDM2 are rare, MDM2 gene overexpression has been observed in several human tumors. Given that even modest changes in MDM2 levels might influence the p53 tumor suppressor signaling pathway, we postulated that sequence variation in the promoter region of MDM2 could lead to disregulated expression and variation in gene dosage. Two promoters have been reported for MDM2; an internal promoter (P2, which is located near the end of intron 1 and is p53-responsive, and an upstream constitutive promoter (P1, which is p53-independent. Both promoter regions contain DNA variants that could influence the expression levels of MDM2, including the well-studied single nucleotide polymorphism (SNP SNP309, which is located in the promoter P2; i.e., upstream of exon 2. In this report, we screened the promoter P1 for DNA variants and assessed the functional impact of the corresponding SNPs. Using the dbSNP database and genotyping validation in individuals of European descent, we identified three common SNPs (−1494 G > A; indel 40 bp; and −182 C > G. Three major promoter haplotypes were inferred by using these three promoter SNPs together with rs2279744 (SNP309. Following subcloning into a gene reporter system, we found that two of the haplotypes significantly influenced MDM2 promoter activity in a haplotype-specific manner. Site-directed mutagenesis experiments indicated that the 40 bp insertion/deletion variation is causing the observed allelic promoter activity. This study suggests that part of the variability in the MDM2 expression levels could be explained by allelic p53-independent P1 promoter activity.

A combinatorial approach to synthetic transcription factor-promoter combinations for yeast strain engineering

DEFF Research Database (Denmark)

Dossani, Zain Y.; Apel, Amanda Reider; Szmidt-Middleton, Heather

2018-01-01

regions, we have built a library of hybrid promoters that are regulated by a synthetic transcription factor. The hybrid promoters consist of native S. cerevisiae promoters, in which the operator regions have been replaced with sequences that are recognized by the bacterial LexA DNA binding protein....... Correspondingly, the synthetic transcription factor (TF) consists of the DNA binding domain of the LexA protein, fused with the human estrogen binding domain and the viral activator domain, VP16. The resulting system with a bacterial DNA binding domain avoids the transcription of native S. cerevisiae genes...... levels, using the same synthetic TF and a given estradiol. This set of promoters, in combination with our synthetic TF, has the potential to regulate numerous genes or pathways simultaneously, to multiple desired levels, in a single strain....

A single cysteine post-translational oxidation suffices to compromise globular proteins kinetic stability and promote amyloid formation

Directory of Open Access Journals (Sweden)

Patrizia Marinelli

2018-04-01

Full Text Available Oxidatively modified forms of proteins accumulate during aging. Oxidized protein conformers might act as intermediates in the formation of amyloids in age-related disorders. However, it is not known whether this amyloidogenic conversion requires an extensive protein oxidative damage or it can be promoted just by a discrete, localized post-translational modification of certain residues. Here, we demonstrate that the irreversible oxidation of a single free Cys suffices to severely perturb the folding energy landscape of a stable globular protein, compromise its kinetic stability, and lead to the formation of amyloids under physiological conditions. Experiments and simulations converge to indicate that this specific oxidation-promoted protein aggregation requires only local unfolding. Indeed, a large scale analysis indicates that many cellular proteins are at risk of undergoing this kind of deleterious transition; explaining how oxidative stress can impact cell proteostasis and subsequently lead to the onset of pathological states. Keywords: Protein oxidation, Protein misfolding, Protein aggregation, Oxidative stress, Post-translational modification

Promoter analysis of the Chilo iridescent virus DNA polymerase and major capsid protein genes

NARCIS (Netherlands)

Nalcacioglu, R.; Marks, H.; Vlak, J.M.; Demirbag, Z.; Oers, van M.M.

2003-01-01

The DNA polymerase (DNApol) and major capsid protein (MCP) genes were used as models to study promoter activity in Chilo iridescent virus (CIV). Infection of Bombyx mori SPC-BM-36 cells in the presence of inhibitors of DNA or protein synthesis showed that DNApol, as well as helicase, is an

A genome-wide analysis of promoter-mediated phenotypic noise in Escherichia coli.

Directory of Open Access Journals (Sweden)

Olin K Silander

2012-01-01

Full Text Available Gene expression is subject to random perturbations that lead to fluctuations in the rate of protein production. As a consequence, for any given protein, genetically identical organisms living in a constant environment will contain different amounts of that particular protein, resulting in different phenotypes. This phenomenon is known as "phenotypic noise." In bacterial systems, previous studies have shown that, for specific genes, both transcriptional and translational processes affect phenotypic noise. Here, we focus on how the promoter regions of genes affect noise and ask whether levels of promoter-mediated noise are correlated with genes' functional attributes, using data for over 60% of all promoters in Escherichia coli. We find that essential genes and genes with a high degree of evolutionary conservation have promoters that confer low levels of noise. We also find that the level of noise cannot be attributed to the evolutionary time that different genes have spent in the genome of E. coli. In contrast to previous results in eukaryotes, we find no association between promoter-mediated noise and gene expression plasticity. These results are consistent with the hypothesis that, in bacteria, natural selection can act to reduce gene expression noise and that some of this noise is controlled through the sequence of the promoter region alone.

Use of a transfected and amplified Drosophila heat shock promoter construction for inducible production of toxic mouse c-myc proteins in CHO cells

International Nuclear Information System (INIS)

Wurm, F.M.; Gwinn, K.A.; Papoulas, O.; Pallavicini, M.; Kingston, R.E.

1987-01-01

After transfection and selection with methotrexate, CHO cell lines were established which contained up to 2000 copies of an expression vector for c-myc protein. The vector contained the Drosophila heat shock protein 70 (hsp70) promoter fused with the coding region of the mouse c-myc gene. Incubation of cells for up to 3 hours at 43 0 C resulted in at least a 100-fold induction of recombinant c-myc mRNA. When cells were shifted back to 37 0 C, within 1 to 4 hours, this RNA was translated into protein to yield about 250 μg per 10 9 cells. Cells died a few hours later, suggesting that high concentrations of intracellular c-myc are cytotoxic. 47 refs., 5 figs

Natural selection in a population of Drosophila melanogaster explained by changes in gene expression caused by sequence variation in core promoter regions.

Science.gov (United States)

Sato, Mitsuhiko P; Makino, Takashi; Kawata, Masakado

2016-02-09

Understanding the evolutionary forces that influence variation in gene regulatory regions in natural populations is an important challenge for evolutionary biology because natural selection for such variations could promote adaptive phenotypic evolution. Recently, whole-genome sequence analyses have identified regulatory regions subject to natural selection. However, these studies could not identify the relationship between sequence variation in the detected regions and change in gene expression levels. We analyzed sequence variations in core promoter regions, which are critical regions for gene regulation in higher eukaryotes, in a natural population of Drosophila melanogaster, and identified core promoter sequence variations associated with differences in gene expression levels subjected to natural selection. Among the core promoter regions whose sequence variation could change transcription factor binding sites and explain differences in expression levels, three core promoter regions were detected as candidates associated with purifying selection or selective sweep and seven as candidates associated with balancing selection, excluding the possibility of linkage between these regions and core promoter regions. CHKov1, which confers resistance to the sigma virus and related insecticides, was identified as core promoter regions that has been subject to selective sweep, although it could not be denied that selection for variation in core promoter regions was due to linked single nucleotide polymorphisms in the regulatory region outside core promoter regions. Nucleotide changes in core promoter regions of CHKov1 caused the loss of two basal transcription factor binding sites and acquisition of one transcription factor binding site, resulting in decreased gene expression levels. Of nine core promoter regions regions associated with balancing selection, brat, and CG9044 are associated with neuromuscular junction development, and Nmda1 are associated with learning

Anti-Restriction Protein, KlcAHS, Promotes Dissemination of Carbapenem Resistance

Directory of Open Access Journals (Sweden)

Xiaofei Jiang

2017-05-01

Full Text Available Carbapenemase-producing Klebsiella pneumoniae (KPC has emerged and spread throughout the world. A retrospective analysis was performed on carbapenem-resistant K. pneumoniae isolated at our teaching hospital during the period 2009–2010, when the initial outbreak occurred. To determine the mechanism(s that underlies the increased infectivity exhibited by KPC, Multilocus Sequence Typing (MLST was conducted. A series of plasmids was also extracted, sequenced and analyzed. Concurrently, the complete sequences of blaKPC−2-harboring plasmids deposited in GenBank were summarized and aligned. The blaKPC−2 and KlcAHS genes in the carbapenem-resistant K. pneumoniae isolates were examined. E. coli strains, carrying different Type I Restriction and Modification (RM systems, were selected to study the interaction between RM systems, anti-RM systems and horizontal gene transfer (HGT. The ST11 clone predominated among 102 carbapenem-resistant K. pneumoniae isolates, all harbored the blaKPC−2 gene; 98% contained the KlcAHS gene. KlcAHS was one of the core genes in the backbone region of most blaKPC−2 carrying plasmids. Type I RM systems in the host bacteria reduced the rate of pHS10842 plasmid transformation by 30- to 40-fold. Presence of the anti-restriction protein, KlcAHS, on the other hand, increased transformation efficiency by 3- to 6-fold. These results indicate that RM systems can significantly restrict HGT. In contrast, KlcAHS can disrupt the RM systems and promote HGT by transformation. These findings suggest that the anti-restriction protein, KlcAHS, represents a novel mechanism that facilitates the increased transfer of blaKPC-2 and KlcAHS-carrying plasmids among K. pneumoniae strains.

Hepatitis B virus X protein suppresses caveolin-1 expression in hepatocellular carcinoma by regulating DNA methylation

International Nuclear Information System (INIS)

Yan, Jun; Lu, Qian; Dong, Jiahong; Li, Xiaowu; Ma, Kuansheng; Cai, Lei

2012-01-01

To understand the molecular mechanisms of caveolin-1 downregulation by hepatitis B virus X protein (HBx). The DNA methylation status of the caveolin-1 promoter was examined by nested methylation-specific PCR of 33 hepatitis B virus (HBV)-infected hepatocellular carcinoma (HCC) samples. The SMMC-7721 hepatoma cell line was transfected with a recombinant HBx adenoviral vector, and the effects of HBx protein on caveolin-1 expression and promoter methylation were examined and confirmed by sequencing. A reporter gene containing the caveolin-1 promoter region was constructed, and the effects of HBx on the transcriptional activity of the promoter were also studied. Methylation of the caveolin-1 promoter was detected in 84.8% (28/33) of HBV-infected HCC samples. Expression of caveolin-1 was significantly downregulated (P = 0.022), and multiple CpG sites in the promoter region of caveolin-1 were methylated in SMMC-7721 cells after HBx transfection. Transfected HBx significantly suppressed caveolin-1 promoter activity (P = 0.001). HBx protein induces methylation of the caveolin-1 promoter region and suppresses its expression

NSs protein of rift valley fever virus promotes posttranslational downregulation of the TFIIH subunit p62.

Science.gov (United States)

Kalveram, Birte; Lihoradova, Olga; Ikegami, Tetsuro

2011-07-01

Rift Valley fever virus (RVFV; family Bunyaviridae, genus Phlebovirus) is an important emerging pathogen of humans and ruminants. Its NSs protein has previously been identified as a major virulence factor that suppresses host defense through three distinct mechanisms: it directly inhibits beta interferon (IFN-β) promoter activity, it promotes the degradation of double-stranded RNA-dependent protein kinase (PKR), and it suppresses host transcription by disrupting the assembly of the basal transcription factor TFIIH through sequestration of its p44 subunit. Here, we report that in addition to PKR, NSs also promotes the degradation of the TFIIH subunit p62. Infection of cells with the RVFV MP-12 vaccine strain reduced p62 protein levels to below the detection limit early in the course of infection. This NSs-mediated downregulation of p62 was posttranslational, as it was unaffected by pharmacological inhibition of transcription or translation and MP-12 infection had no effect on p62 mRNA levels. Treatment of cells with proteasome inhibitors but not inhibition of lysosomal acidification or nuclear export resulted in a stabilization of p62 in the presence of NSs. Furthermore, p62 could be coprecipitated with NSs from lysates of infected cells. These data suggest that the RVFV NSs protein is able to interact with the TFIIH subunit p62 inside infected cells and promotes its degradation, which can occur directly in the nucleus.

Analysis of an osmotically regulated pathogenesis-related osmotin gene promoter.

Science.gov (United States)

Raghothama, K G; Liu, D; Nelson, D E; Hasegawa, P M; Bressan, R A

1993-12-01

Osmotin is a small (24 kDa), basic, pathogenesis-related protein, that accumulates during adaptation of tobacco (Nicotiana tabacum) cells to osmotic stress. There are more than 10 inducers that activate the osmotin gene in various plant tissues. The osmotin promoter contains several sequences bearing a high degree of similarity to ABRE, as-1 and E-8 cis element sequences. Gel retardation studies indicated the presence of at least two regions in the osmotin promoter that show specific interactions with nuclear factors isolated from cultured cells or leaves. The abundance of these binding factors increased in response to salt, ABA and ethylene. Nuclear factors protected a 35 bp sequence of the promoter from DNase I digestion. Different 5' deletions of the osmotin promoter cloned into a promoter-less GUSNOS plasmid (pBI 201) were used in transient expression studies with a Biolistic gun. The transient expression studies revealed the presence of three distinct regions in the osmotin promoter. The promoter sequence from -108 to -248 bp is absolutely required for reporter gene activity, followed by a long stretch (up to -1052) of enhancer-like sequence and then a sequence upstream of -1052, which appears to contain negative elements. The responses to ABA, ethylene, salt, desiccation and wounding appear to be associated with the -248 bp sequence of the promoter. This region also contains a putative ABRE (CACTGTG) core element. Activation of the osmotin gene by various inducers is discussed in view of antifungal activity of the osmotin protein.

Evaluation of novel inducible promoter/repressor systems for recombinant protein expression in Lactobacillus plantarum.

Science.gov (United States)

Heiss, Silvia; Hörmann, Angelika; Tauer, Christopher; Sonnleitner, Margot; Egger, Esther; Grabherr, Reingard; Heinl, Stefan

2016-03-10

Engineering lactic acid bacteria (LAB) is of growing importance for food and feed industry as well as for in vivo vaccination or the production of recombinant proteins in food grade organisms. Often, expression of a transgene is only desired at a certain time point or period, e.g. to minimize the metabolic burden for the host cell or to control the expression time span. For this purpose, inducible expression systems are preferred, though cost and availability of the inducing agent must be feasible. We selected the plasmid free strain Lactobacillus plantarum 3NSH for testing and characterization of novel inducible promoters/repressor systems. Their feasibility in recombinant protein production was evaluated. Expression of the reporter protein mCherry was monitored with the BioLector(®) micro-fermentation system. Reporter gene mCherry expression was compared under the control of different promoter/repressor systems: PlacA (an endogenous promoter/repressor system derived from L. plantarum 3NSH), PxylA (a promoter/repressor system derived from Bacillus megaterium DSMZ 319) and PlacSynth (synthetic promoter and codon-optimized repressor gene based on the Escherichia coli lac operon). We observed that PlacA was inducible solely by lactose, but not by non-metabolizable allolactose analoga. PxylA was inducible by xylose, yet showed basal expression under non-induced conditions. Growth on galactose (as compared to exponential growth phase on glucose) reduced basal mCherry expression at non-induced conditions. PlacSynth was inducible with TMG (methyl β-D-thiogalactopyranoside) and IPTG (isopropyl β-D-1-thiogalactopyranoside), but also showed basal expression without inducer. The promoter PlacSynth was used for establishment of a dual plasmid expression system, based on T7 RNA polymerase driven expression in L. plantarum. Comparative Western blot supported BioLector(®) micro-fermentation measurements. Conclusively, overall expression levels were moderate (compared to a

Genome-wide function of H2B ubiquitylation in promoter and genic regions.

Science.gov (United States)

Batta, Kiran; Zhang, Zhenhai; Yen, Kuangyu; Goffman, David B; Pugh, B Franklin

2011-11-01

Nucleosomal organization in and around genes may contribute substantially to transcriptional regulation. The contribution of histone modifications to genome-wide nucleosomal organization has not been systematically evaluated. In the present study, we examine the role of H2BK123 ubiquitylation, a key regulator of several histone modifications, on nucleosomal organization at promoter, genic, and transcription termination regions in Saccharomyces cerevisiae. Using high-resolution MNase chromatin immunoprecipitation and sequencing (ChIP-seq), we map nucleosome positioning and occupancy in mutants of the H2BK123 ubiquitylation pathway. We found that H2B ubiquitylation-mediated nucleosome formation and/or stability inhibits the assembly of the transcription machinery at normally quiescent promoters, whereas ubiquitylation within highly active gene bodies promotes transcription elongation. This regulation does not proceed through ubiquitylation-regulated histone marks at H3K4, K36, and K79. Our findings suggest that mechanistically similar functions of H2B ubiquitylation (nucleosome assembly) elicit different functional outcomes on genes depending on its positional context in promoters (repressive) versus transcribed regions (activating).

Characterization of a putative cis-regulatory element that controls transcriptional activity of the pig uroplakin II gene promoter

International Nuclear Information System (INIS)

Kwon, Deug-Nam; Park, Mi-Ryung; Park, Jong-Yi; Cho, Ssang-Goo; Park, Chankyu; Oh, Jae-Wook; Song, Hyuk; Kim, Jae-Hwan; Kim, Jin-Hoi

2011-01-01

Highlights: → The sequences of -604 to -84 bp of the pUPII promoter contained the region of a putative negative cis-regulatory element. → The core promoter was located in the 5F-1. → Transcription factor HNF4 can directly bind in the pUPII core promoter region, which plays a critical role in controlling promoter activity. → These features of the pUPII promoter are fundamental to development of a target-specific vector. -- Abstract: Uroplakin II (UPII) is a one of the integral membrane proteins synthesized as a major differentiation product of mammalian urothelium. UPII gene expression is bladder specific and differentiation dependent, but little is known about its transcription response elements and molecular mechanism. To identify the cis-regulatory elements in the pig UPII (pUPII) gene promoter region, we constructed pUPII 5' upstream region deletion mutants and demonstrated that each of the deletion mutants participates in controlling the expression of the pUPII gene in human bladder carcinoma RT4 cells. We also identified a new core promoter region and putative negative cis-regulatory element within a minimal promoter region. In addition, we showed that hepatocyte nuclear factor 4 (HNF4) can directly bind in the pUPII core promoter (5F-1) region, which plays a critical role in controlling promoter activity. Transient cotransfection experiments showed that HNF4 positively regulates pUPII gene promoter activity. Thus, the binding element and its binding protein, HNF4 transcription factor, may be involved in the mechanism that specifically regulates pUPII gene transcription.

Protein-protein docking using region-based 3D Zernike descriptors

Directory of Open Access Journals (Sweden)

Sael Lee

2009-12-01

Full Text Available Abstract Background Protein-protein interactions are a pivotal component of many biological processes and mediate a variety of functions. Knowing the tertiary structure of a protein complex is therefore essential for understanding the interaction mechanism. However, experimental techniques to solve the structure of the complex are often found to be difficult. To this end, computational protein-protein docking approaches can provide a useful alternative to address this issue. Prediction of docking conformations relies on methods that effectively capture shape features of the participating proteins while giving due consideration to conformational changes that may occur. Results We present a novel protein docking algorithm based on the use of 3D Zernike descriptors as regional features of molecular shape. The key motivation of using these descriptors is their invariance to transformation, in addition to a compact representation of local surface shape characteristics. Docking decoys are generated using geometric hashing, which are then ranked by a scoring function that incorporates a buried surface area and a novel geometric complementarity term based on normals associated with the 3D Zernike shape description. Our docking algorithm was tested on both bound and unbound cases in the ZDOCK benchmark 2.0 dataset. In 74% of the bound docking predictions, our method was able to find a near-native solution (interface C-αRMSD ≤ 2.5 Å within the top 1000 ranks. For unbound docking, among the 60 complexes for which our algorithm returned at least one hit, 60% of the cases were ranked within the top 2000. Comparison with existing shape-based docking algorithms shows that our method has a better performance than the others in unbound docking while remaining competitive for bound docking cases. Conclusion We show for the first time that the 3D Zernike descriptors are adept in capturing shape complementarity at the protein-protein interface and useful for

Exploiting nucleotide composition to engineer promoters.

Directory of Open Access Journals (Sweden)

Manfred G Grabherr

Full Text Available The choice of promoter is a critical step in optimizing the efficiency and stability of recombinant protein production in mammalian cell lines. Artificial promoters that provide stable expression across cell lines and can be designed to the desired strength constitute an alternative to the use of viral promoters. Here, we show how the nucleotide characteristics of highly active human promoters can be modelled via the genome-wide frequency distribution of short motifs: by overlapping motifs that occur infrequently in the genome, we constructed contiguous sequence that is rich in GC and CpGs, both features of known promoters, but lacking homology to real promoters. We show that snippets from this sequence, at 100 base pairs or longer, drive gene expression in vitro in a number of mammalian cells, and are thus candidates for use in protein production. We further show that expression is driven by the general transcription factors TFIIB and TFIID, both being ubiquitously present across cell types, which results in less tissue- and species-specific regulation compared to the viral promoter SV40. We lastly found that the strength of a promoter can be tuned up and down by modulating the counts of GC and CpGs in localized regions. These results constitute a "proof-of-concept" for custom-designing promoters that are suitable for biotechnological and medical applications.

A synthetic arabinose-inducible promoter confers high levels of recombinant protein expression in hyperthermophilic archaeon Sulfolobus islandicus

DEFF Research Database (Denmark)

Peng, Nan; Deng, Ling; Mei, Yuxia

2012-01-01

Despite major progresses in genetic studies of hyperthermophilic archaea, recombinant protein production in these organisms always suffers from low yields and a robust expression system is still in great demand. Here we report a versatile vector that confers high levels of protein expression...... to remove the peptide tags from expressed recombinant proteins. While pEXA employed an araS promoter for protein expression, pSeSD utilized P(araS-SD), an araS derivative promoter carrying an engineered ribosome-binding site (RBS; a Shine-Dalgarno [SD] sequence). We found that P(araS-SD) directed high...... levels of target gene expression. More strikingly, N-terminal amino acid sequencing of recombinant proteins unraveled that the protein synthesized from pEXA-N-lacS lacked the designed 6×His tag and that translation initiation did not start at the ATG codon of the fusion gene. Instead, it started...

Activation of the skeletal alpha-actin promoter during muscle regeneration.

Science.gov (United States)

Marsh, D R; Carson, J A; Stewart, L N; Booth, F W

1998-11-01

Little is known concerning promoter regulation of genes in regenerating skeletal muscles. In young rats, recovery of muscle mass and protein content is complete within 21 days. During the initial 5-10 days of regeneration, mRNA abundance for IGF-I, myogenin and MyoD have been shown to be dramatically increased. The skeletal alpha-actin promoter contains E box and serum response element (SRE) regulatory regions which are directly or indirectly activated by myogenin (or MyoD) and IGF-I proteins, respectively. We hypothesized that the skeletal alpha-actin promoter activity would increase during muscle regeneration, and that this induction would occur before muscle protein content returned to normal. Total protein content and the percentage content of skeletal alpha-actin protein was diminished at 4 and 8 days and re-accumulation had largely occurred by 16 days post-bupivacaine injection. Skeletal alpha-actin mRNA per whole muscle was decreased at day 8, and thereafter returned to control values. During regeneration at day 8, luciferase activity (a reporter of promoter activity) directed by -424 skeletal alpha-actin and -99 skeletal alpha-actin promoter constructs was increased by 700% and 250% respectively; however, at day 16, skeletal alpha-actin promoter activities were similar to control values. Thus, initial activation of the skeletal alpha-actin promoter is associated with regeneration of skeletal muscle, despite not being sustained during the later stages of regrowth. The proximal SRE of the skeletal alpha-actin promoter was not sufficient to confer a regeneration-induced promoter activation, despite increased serum response factor protein binding to this regulatory element in electrophoretic mobility shift assays. Skeletal alpha-actin promoter induction during regeneration is due to a combination of regulatory elements, at least including the SRE and E box.

Molecular characterization of the sweet potato peroxidase SWPA4 promoter which responds to abiotic stresses and pathogen infection.

Science.gov (United States)

Ryu, Sun-Hwa; Kim, Yun-Hee; Kim, Cha Young; Park, Soo-Young; Kwon, Suk-Yoon; Lee, Haeng-Soon; Kwak, Sang-Soo

2009-04-01

Previously, the swpa4 peroxidase gene has been shown to be inducible by a variety of abiotic stresses and pathogenic infections in sweet potato (Ipomoea batatas). To elucidate its regulatory mechanism at the transcriptional level under various stress conditions, we isolated and characterized the promoter region (2374 bp) of swpa4 (referred to as SWPA4). We performed a transient expression assay in tobacco protoplasts with deletions from the 5'-end of SWPA4 promoter fused to the beta-glucuronidase (GUS) reporter gene. The -1408 and -374 bp deletions relative to the transcription start site (+1) showed 8 and 4.5 times higher GUS expression than the cauliflower mosaic virus 35S promoter, respectively. In addition, transgenic tobacco plants expressing GUS under the control of -2374, -1408 or -374 bp region of SWPA4 promoter were generated and studied in various tissues under abiotic stresses and pathogen infection. Gel mobility shift assays revealed that nuclear proteins from sweet potato cultured cells specifically interacted with 60-bp fragment (-178/-118) in -374 bp promoter region. In silico analysis indicated that four kinds of cis-acting regulatory sequences, reactive oxygen species-related element activator protein 1 (AP1), CCAAT/enhancer-binding protein alpha element, ethylene-responsive element (ERE) and heat-shock element, are present in the -60 bp region (-178/-118), suggesting that the -60 bp region might be associated with stress inducibility of the SWPA4 promoter.

Recombination-stable multimeric green fluorescent protein for characterization of weak promoter outputs in Saccharomyces cerevisiae

DEFF Research Database (Denmark)

Rugbjerg, Peter; Knuf, Christoph; Förster, Jochen

2015-01-01

a less leaky Cu2+-inducible promoter based on CUP1. The basal expression level of the new promoter was approx. 61% below the wild-type CUP1 promoter, thus expanding the absolute range of Cu2+-based gene control. The stability of 3vGFP towards direct-repeat recombination was assayed in S. cerevisiae......Green fluorescent proteins (GFPs) are widely used for visualization of proteins to track localization and expression dynamics. However, phenotypically important processes can operate at too low expression levels for routine detection, i.e. be overshadowed by autofluorescence noise. While GFP...... functions well in translational fusions, the use of tandem GFPs to amplify fluorescence signals is currently avoided in Saccharomyces cerevisiae and many other microorganisms due to the risk of loop-out by direct-repeat recombination. We increased GFP fluorescence by translationally fusing three different...

Expression, purification, and functional analysis of the C-terminal domain of Herbaspirillum seropedicae NifA protein.

Science.gov (United States)

Monteiro, Rose A; Souza, Emanuel M; Geoffrey Yates, M; Steffens, M Berenice R; Pedrosa, Fábio O; Chubatsu, Leda S

2003-02-01

The Herbaspirillum seropedicae NifA protein is responsible for nif gene expression. The C-terminal domain of the H. seropedicae NifA protein, fused to a His-Tag sequence (His-Tag-C-terminal), was over-expressed and purified by metal-affinity chromatography to yield a highly purified and active protein. Band-shift assays showed that the NifA His-Tag-C-terminal bound specifically to the H. seropedicae nifB promoter region in vitro. In vivo analysis showed that this protein inhibited the Central + C-terminal domains of NifA protein from activating the nifH promoter of K. pneumoniae in Escherichia coli, indicating that the protein must be bound to the NifA-binding site (UAS site) at the nifH promoter region to activate transcription. Copyright 2002 Elsevier Science (USA)

The promotion of regional integration of electricity markets: Lessons for developing countries

International Nuclear Information System (INIS)

Oseni, Musiliu O.; Pollitt, Michael G.

2016-01-01

This paper focuses on how to promote regional cooperation in electricity. We begin by discussing the theory of international trade cooperation in electricity, with a view to discussing what preconditions might be important in facilitating wide area trading across national borders. We then develop lessons based on the comparison of four case studies. These include three regional developing country power pools – the Southern African Power pool (SAPP), West African Power pool (WAPP) and the Central American Power Market (MER). We contrast these with Northern Europe's Nord Pool. These cases highlight both the potential and difficulty of having cross-jurisdictional power pools. In the light of the theory and evidence we present, we draw key lessons in the areas of: preconditions for trading; necessary institutional arrangements; practicalities of timetabling; reasons to be hopeful about future prospects. - Highlights: • This paper focuses on how to promote regional electricity cooperation. • We develop lessons based on comparison of four international case studies. • The cases highlight both the potential and difficulty of power pools. • We identify preconditions, institutional arrangements and timetabling. • We conclude that the future prospects for regional power pools are good.

Centrosomal protein 55 activates NF-?B signalling and promotes pancreatic cancer cells aggressiveness

OpenAIRE

Peng, Tao; Zhou, Wei; Guo, Feng; Wu, He-shui; Wang, Chun-you; Wang, Li; Yang, Zhi-yong

2017-01-01

Centrosomal protein 55 (CEP55) is a microtubule-bundling protein that participants in cell mitosis. It is overexpressed in several solid tumours and promotes the growth and invasion of cancer cells. However, the role of CEP55 in pancreatic cancer (PANC) remains unclear. Herein, upregulated expression of CEP55 (associated with poor prognosis) was detected in PANC using quantitative real-time reverse transcription PCR, western blotting, and immunohistochemistry. Cell migration, colony formation...

Genome-scale prediction of proteins with long intrinsically disordered regions.

Science.gov (United States)

Peng, Zhenling; Mizianty, Marcin J; Kurgan, Lukasz

2014-01-01

Proteins with long disordered regions (LDRs), defined as having 30 or more consecutive disordered residues, are abundant in eukaryotes, and these regions are recognized as a distinct class of biologically functional domains. LDRs facilitate various cellular functions and are important for target selection in structural genomics. Motivated by the lack of methods that directly predict proteins with LDRs, we designed Super-fast predictor of proteins with Long Intrinsically DisordERed regions (SLIDER). SLIDER utilizes logistic regression that takes an empirically chosen set of numerical features, which consider selected physicochemical properties of amino acids, sequence complexity, and amino acid composition, as its inputs. Empirical tests show that SLIDER offers competitive predictive performance combined with low computational cost. It outperforms, by at least a modest margin, a comprehensive set of modern disorder predictors (that can indirectly predict LDRs) and is 16 times faster compared to the best currently available disorder predictor. Utilizing our time-efficient predictor, we characterized abundance and functional roles of proteins with LDRs over 110 eukaryotic proteomes. Similar to related studies, we found that eukaryotes have many (on average 30.3%) proteins with LDRs with majority of proteomes having between 25 and 40%, where higher abundance is characteristic to proteomes that have larger proteins. Our first-of-its-kind large-scale functional analysis shows that these proteins are enriched in a number of cellular functions and processes including certain binding events, regulation of catalytic activities, cellular component organization, biogenesis, biological regulation, and some metabolic and developmental processes. A webserver that implements SLIDER is available at http://biomine.ece.ualberta.ca/SLIDER/. Copyright © 2013 Wiley Periodicals, Inc.

p16(INK4a) promoter methylation and protein expression in breast fibroadenoma and carcinoma.

Science.gov (United States)

Di Vinci, Angela; Perdelli, Luisa; Banelli, Barbara; Salvi, Sandra; Casciano, Ida; Gelvi, Ilaria; Allemanni, Giorgio; Margallo, Edoardo; Gatteschi, Beatrice; Romani, Massimo

2005-04-10

The potential role of p16(INK4a) methylation in breast cancer is controversial whereas there are no data on fibroadenoma. To assess if inactivation of p16(INK4a) by promoter hypermethylation occurs in this hyperproliferative benign breast lesion or, on the contrary, it is strictly related to the carcinogenic process, we have tested the different histological components of 15 cases of fibroadenoma and the intraductal and infiltrating components of 15 cases of carcinoma and their adjacent non-tumoral epithelium. All samples were obtained by laser-assisted microdissection. The relationship between promoter methylation status, immunohistochemical protein expression and ki67 proliferative activity was evaluated for each lesion. Our data demonstrate that hypermethylation of p16(INK4a) promoter is a common event occurring at similar frequency in all the different histological areas of the benign and malignant breast lesions taken into exam. Conversely, protein p16 expression, although heterogeneously distributed within the section, is considerably higher in breast carcinoma as compared to fibroadenoma in both tumoral and non-tumoral epithelia and stroma. The protein localization was almost exclusively nuclear in fibroadenoma and non-tumoral epithelia whereas, in carcinoma, the staining was both nuclear and cytoplasmic or cytoplasmic alone. Furthermore, in a subset of fibroadenoma with higher proliferative activity, p16 protein expression was substantially decreased as compared to those showing lower proliferation. We did not observe this association in carcinomas. Our data demonstrate that the hypermethylation of the p16(INK4a) promoter is not specifically associated with malignancy and that, on the contrary, the overexpression of p16 and its cytoplasmic sequestration is a feature of breast carcinoma. (c) 2004 Wiley-Liss, Inc.

Ubiquitin-like protein UBL5 promotes the functional integrity of the Fanconi anemia pathway.

Science.gov (United States)

Oka, Yasuyoshi; Bekker-Jensen, Simon; Mailand, Niels

2015-05-12

Ubiquitin and ubiquitin-like proteins (UBLs) function in a wide array of cellular processes. UBL5 is an atypical UBL that does not form covalent conjugates with cellular proteins and which has a known role in modulating pre-mRNA splicing. Here, we report an unexpected involvement of human UBL5 in promoting the function of the Fanconi anemia (FA) pathway for repair of DNA interstrand crosslinks (ICLs), mediated by a specific interaction with the central FA pathway component FANCI. UBL5-deficient cells display spliceosome-independent reduction of FANCI protein stability, defective FANCI function in response to DNA damage and hypersensitivity to ICLs. By mapping the sequence determinants underlying UBL5-FANCI binding, we generated separation-of-function mutants to demonstrate that key aspects of FA pathway function, including FANCI-FANCD2 heterodimerization, FANCD2 and FANCI monoubiquitylation and maintenance of chromosome stability after ICLs, are compromised when the UBL5-FANCI interaction is selectively inhibited by mutations in either protein. Together, our findings establish UBL5 as a factor that promotes the functionality of the FA DNA repair pathway. © 2015 The Authors.

Study on the binding sites of radiosensitivity associated transcription factor in the promoter region of Ier5 gene

International Nuclear Information System (INIS)

Cui Wei; Yin Lingling; Dong Lingyue

2012-01-01

Objective: To clarify the mechanism of immediate early response gene 5 (Ier5) transcription induced by radiation. Methods: Deletant construction, site-specific mutagenesis,electrophoretic mobility shift assay (EMSA) and chromatin immunoprecipitation (ChIP) were used to forecast the promoter region, binding sites and transcription factors of Ier5 gene in HeLa cells. Results: The promoter region of Ier5 gene might be in the region of Ier5 -8 deletant (-408 - -238 bp). The Ier5 gene had two transcription factors of GCF and NFI, and GCF had two binding sites located in the region of -388 - -382 bp and -274 - -270 bp of Ier5 promoter. The binding site of NFI was located in -362 - -357 bp of Ier5 promoter. GCF could inhibit the expression of Ier5 gene and this inhibition was diminished when the radiation dose increased. In contrast, NFI increased the expression of Ier5. Conclusions: The most possible region of Ier5 promoter is from -408 to -238 bp which has two binding sites for the radiosensitivity transcription factors of GCF and NFI that could negatively and positively regulate the expression of Ier5 respectively. (authors)

Tailoring Escherichia coli for the L-rhamnose PBAD promoter-based production of membrane and secretory proteins

NARCIS (Netherlands)

Hjelm, Anna; Karyolaimos, Alexandros; Zhang, Zhe; Rujas, Edurne; Vikström, David; Slotboom, Dirk Jan; de Gier, Jan-Willem

Membrane and secretory protein production in Escherichia coli requires precisely controlled production rates to avoid the deleterious saturation of their biogenesis pathways. Based on this requirement, the E. coli L-rhamnose PBAD promoter (PrhaBAD) is often used for membrane and secretory protein

Ursodeoxycholic acid reduces protein levels and nucleation-promoting activity in human gallbladder bile

NARCIS (Netherlands)

van Erpecum, K. J.; Portincasa, P.; Eckhardt, E.; Go, P. M.; vanBerge-Henegouwen, G. P.; Groen, A. K.

1996-01-01

Background & Aims: Ursodeoxycholic acid prevents gallstone formation in selected patients. The aim of this study was to examine whether decreased concentration and nucleation-promoting activity of various proteins contribute to this beneficial effect. Methods: Gallbladder bile of 13 patients with

High-level intracellular expression of heterologous proteins in Brevibacillus choshinensis SP3 under the control of a xylose inducible promoter

Directory of Open Access Journals (Sweden)

D’Urzo Nunzia

2013-02-01

Full Text Available Abstract Background In past years research has focused on the development of alternative Gram positive bacterial expression systems to produce industrially relevant proteins. Brevibacillus choshinensis is an easy to handle non-sporulating bacterium, lacking extracellular proteases, that has been already shown to provide a high level of recombinant protein expression. One major drawback, limiting the applicability of the Brevibacillus expression system, is the absence of expression vectors based on inducible promoters. Here we used the PxylA inducible promoter, commonly employed in other Bacillae expression systems, in Brevibacillus. Results Using GFP, α-amylase and TcdA-GT as model proteins, high level of intracellular protein expression (up to 250 mg/L for the GFP was achieved in Brevibacillus, using the pHis1522 vector carrying the B. megaterium xylose-inducible promoter (PxylA. The GFP expression yields were more than 25 fold higher than those reported for B. megaterium carrying the same vector. All the tested proteins show significant increment in their expression levels (2-10 folds than those obtained using the available plasmids based on the P2 constitutive promoter. Conclusion Combining the components of two different commercially available Gram positive expression systems, such as Brevibacillus (from Takara Bio and B. megaterium (from Mobitec, we demonstrate that vectors based on the B. megaterium PxylA xylose inducible promoter can be successfully used to induce high level of intracellular expression of heterologous proteins in Brevibacillus.

Ku proteins function as corepressors to regulate farnesoid X receptor-mediated gene expression

International Nuclear Information System (INIS)

Ohno, Masae; Kunimoto, Masaaki; Nishizuka, Makoto; Osada, Shigehiro; Imagawa, Masayoshi

2009-01-01

The farnesoid X receptor (FXR; NR1H4) is a member of the nuclear receptor superfamily and regulates the expression of genes involved in enterohepatic circulation and the metabolism of bile acids. Based on functional analyses, nuclear receptors are divided into regions A-F. To explore the cofactors interacting with FXR, we performed a pull-down assay using GST-fused to the N-terminal A/B region and the C region, which are required for the ligand-independent transactivation and DNA-binding, respectively, of FXR, and nuclear extracts from HeLa cells. We identified DNA-dependent protein kinase catalytic subunit (DNA-PKcs), Ku80, and Ku70 as FXR associated factors. These proteins are known to have an important role in DNA repair, recombination, and transcription. DNA-PKcs mainly interacted with the A/B region of FXR, whereas the Ku proteins interacted with the C region and with the D region (hinge region). Chromatin immunoprecipitation assays revealed that the Ku proteins associated with FXR on the bile salt export pump (BSEP) promoter. Furthermore, we demonstrated that ectopic expression of the Ku proteins decreased the promoter activity and expression of BSEP gene mediated by FXR. These results suggest that the Ku proteins function as corepressors for FXR.

Identification and characterisation of a G-quadruplex forming sequence in the promoter region of nuclear factor (erythroid-derived 2)-like 2 (Nrf2)

Energy Technology Data Exchange (ETDEWEB)

Waller, Zoë A.E., E-mail: z.waller@uea.ac.uk; Howell, Lesley A.; MacDonald, Colin J.; O’Connell, Maria A.; Searcey, Mark, E-mail: m.searcey@uea.ac.uk

2014-04-25

Highlights: • Discovery of a G-quadruplex forming sequence in the promoter sequence of Nrf2. • Characterisation of the G-quadruplex by UV, CD and NMR. • Conformational switching of G-quadruplex induced by 9-aminoacridine. - Abstract: The transcription factor nuclear factor (erythroid-derived 2)-like 2 (Nrf2) regulates multiple antioxidants, Phase II detoxification enzymes and other cytoprotective enzymes in cells. Activation of Nrf2 is recognised as being of potential therapeutic benefit in inflammatory-diseases whereas more recently, it has become clear that the inhibition of Nrf2 may have benefit in the alleviation of resistance in some tumour types. A potential G-quadruplex forming sequence was identified in the promoter region of Nrf2, close to a number of putative transcription factor binding sites. Characterisation of the sequence 5’-d[GGGAAGGGAGCAAGGGCGGGAGGG]-3’ using CD spectroscopy, imino proton NMR resonances and UV melting experiments demonstrated the formation of a parallel intramolecular G-quadruplex in the presence of K{sup +} ions. Incubation with 9-aminoacridine ligands induced a switch from antiparallel to parallel forms. The presence of a G-quadruplex forming sequence in the promoter region of Nrf2 suggests an approach to targeting the production of the protein through stabilisation of the structure, thereby avoiding resistance to antitumour drugs.

Systematic search for the Cra-binding promoters using genomic SELEX system.

Science.gov (United States)

Shimada, Tomohiro; Fujita, Nobuyuki; Maeda, Michihisa; Ishihama, Akira

2005-09-01

Cra (or FruR), a global transcription factor with both repression and activation activities, controls a large number of the genes for glycolysis and gluconeogenesis. To get insights into the entire network of transcription regulation of the E. coli genome by Cra, we isolated a set of Cra-binding sequences using an improved method of genomic SELEX. From the DNA sequences of 97 independently isolated DNA fragments by SELEX, the Cra-binding sequences were identified in a total of ten regions on the E. coli genome, including promoters of six known genes and four hitherto-unidentified genes. All six known promoters are repressed by Cra, but none of the activation-type promoters were cloned after two cyles of SELEX, because the Cra-binding affinity to the repression-type promoters is higher than the activation-type promoters, as determined by the quantitative gel shift assay. Of a total of four newly identified Cra-binding sequences, two are associated with promoter regions of the gapA (glyceraldehyde 3-phosphate dehydrogenase) and eno (enolase) genes, both involved in sugar metabolism. The regulation of newly identified genes by Cra was confirmed by the in vivo promoter strength assay using a newly developed TFP (two-fluorescent protein) vector for promoter assay or by in vitro transcription assay in the presence of Cra protein.

Discrete Ramanujan transform for distinguishing the protein coding regions from other regions.

Science.gov (United States)

Hua, Wei; Wang, Jiasong; Zhao, Jian

2014-01-01

Based on the study of Ramanujan sum and Ramanujan coefficient, this paper suggests the concepts of discrete Ramanujan transform and spectrum. Using Voss numerical representation, one maps a symbolic DNA strand as a numerical DNA sequence, and deduces the discrete Ramanujan spectrum of the numerical DNA sequence. It is well known that of discrete Fourier power spectrum of protein coding sequence has an important feature of 3-base periodicity, which is widely used for DNA sequence analysis by the technique of discrete Fourier transform. It is performed by testing the signal-to-noise ratio at frequency N/3 as a criterion for the analysis, where N is the length of the sequence. The results presented in this paper show that the property of 3-base periodicity can be only identified as a prominent spike of the discrete Ramanujan spectrum at period 3 for the protein coding regions. The signal-to-noise ratio for discrete Ramanujan spectrum is defined for numerical measurement. Therefore, the discrete Ramanujan spectrum and the signal-to-noise ratio of a DNA sequence can be used for distinguishing the protein coding regions from the noncoding regions. All the exon and intron sequences in whole chromosomes 1, 2, 3 and 4 of Caenorhabditis elegans have been tested and the histograms and tables from the computational results illustrate the reliability of our method. In addition, we have analyzed theoretically and gotten the conclusion that the algorithm for calculating discrete Ramanujan spectrum owns the lower computational complexity and higher computational accuracy. The computational experiments show that the technique by using discrete Ramanujan spectrum for classifying different DNA sequences is a fast and effective method. Copyright © 2014 Elsevier Ltd. All rights reserved.

A study of the frequency of methylation of gene promoter regions in ...

Indian Academy of Sciences (India)

2013-04-02

Apr 2, 2013 ... colorectal cancer in the Taiwanese population. CHANG-CHIEH WU1 ... hypermethylation of promoter-region CpG islands is an important ... mismatch repair gene MLH1 plays an important role in dele- ..... Asia Pac. J. Clin.

Hepatitis B X-interacting protein promotes cisplatin resistance and regulates CD147 via Sp1 in ovarian cancer.

Science.gov (United States)

Zou, Wei; Ma, Xiangdong; Yang, Hong; Hua, Wei; Chen, Biliang; Cai, Guoqing

2017-03-01

Ovarian cancer is the highest mortality rate of all female reproductive malignancies. Drug resistance is a major cause of treatment failure in malignant tumors. Hepatitis B X-interacting protein acts as an oncoprotein, regulates cell proliferation, and migration in breast cancer. We aimed to investigate the effects and mechanisms of hepatitis B X-interacting protein on resistance to cisplatin in human ovarian cancer cell lines. The mRNA and protein levels of hepatitis B X-interacting protein were detected using RT-PCR and Western blotting in cisplatin-resistant and cisplatin-sensitive tissues, cisplatin-resistant cell lines A2780/CP and SKOV3/CP, and cisplatin-sensitive cell lines A2780 and SKOV3. Cell viability and apoptosis were measured to evaluate cellular sensitivity to cisplatin in A2780/CP cells. Luciferase reporter gene assay was used to determine the relationship between hepatitis B X-interacting protein and CD147. The in vivo function of hepatitis B X-interacting protein on tumor burden was assessed in cisplatin-resistant xenograft models. The results showed that hepatitis B X-interacting protein was highly expressed in ovarian cancer of cisplatin-resistant tissues and cells. Notably, knockdown of hepatitis B X-interacting protein significantly reduced cell viability in A2780/CP compared with cisplatin treatment alone. Hepatitis B X-interacting protein and cisplatin cooperated to induce apoptosis and increase the expression of c-caspase 3 as well as the Bax/Bcl-2 ratio. We confirmed that hepatitis B X-interacting protein up-regulated CD147 at the protein expression and transcriptional levels. Moreover, we found that hepatitis B X-interacting protein was able to activate the CD147 promoter through Sp1. In vivo, depletion of hepatitis B X-interacting protein decreased the tumor volume and weight induced by cisplatin. Taken together, these results indicate that hepatitis B X-interacting protein promotes cisplatin resistance and regulated CD147 via Sp1 in

Promoting resuscitation of viable but nonculturable cells of Vibrio harveyi by a resuscitation-promoting factor-like protein YeaZ.

Science.gov (United States)

Li, Y; Chen, J; Zhao, M; Yang, Z; Yue, L; Zhang, X

2017-02-01

To demonstrate the resuscitation-promoting activities of recombinant YeaZ from Vibrio harveyi SF-1. The gene of resuscitation-promoting factor YeaZ was cloned from genomic DNA of V. harveyi SF-1. The gene was expressed in Escherichia coli, and the expressed protein was purified by Ni 2+ -affinity chromatography. A yeaZ mutant was constructed by using the suicide plasmid pNQ705 with homologous recombination. Disruption of yeaZ did not affect cell growth significantly in 2216 E broth at 28°C. The wild-type and mutant viable but nonculturable (VBNC) cells could be resuscitated by temperature upshift method. In addition, the recombinant YeaZ increased the culturable counts from 1·27 × 10 4  CFU per ml and 1·99 × 10 4 CFU per ml to 2·88 × 10 5  CFU per ml and 4·59 × 10 5 CFU per ml, respectively. After the VBNC cells of wild-type and mutant cells were maintained at 4°C for 120 days, no resuscitation was obtained by temperature upshift method, but addition of the recombinant YeaZ promoted the resuscitation of the wild-type and mutant cells, with the culturable cell counts of 1·13 × 10 3 and 1·44 × 10 3 CFU per ml, respectively. Disruption of yeaZ decreased the virulence of V. harveyi in zebrafish. The lethal dose 50% of the yeaZ null mutant was more than 10-fold higher than that of the wild-type cells. The recombinant YeaZ could efficiently promote resuscitation of the wild-type and mutant cells of V. harveyi from VBNC to culturable state. The protein also promoted resuscitation of the VBNC wild-type and mutant cells, which were maintained at 4°C for 120 days and not recovered by temperature upshift method. Disruption of yeaZ decreased the virulence of V. harveyi in zebrafish. Here, we show clear evidence of a resuscitation-promoting factor YeaZ of V. harveyi and the roles in resuscitation of the VBNC cells and its pathogenicity. © 2016 The Society for Applied Microbiology.

An essential GT motif in the lamin A promoter mediates activation by CREB-binding protein

International Nuclear Information System (INIS)

Janaki Ramaiah, M.; Parnaik, Veena K.

2006-01-01

Lamin A is an important component of nuclear architecture in mammalian cells. Mutations in the human lamin A gene lead to highly degenerative disorders that affect specific tissues. In studies directed towards understanding the mode of regulation of the lamin A promoter, we have identified an essential GT motif at -55 position by reporter gene assays and mutational analysis. Binding of this sequence to Sp transcription factors has been observed in electrophoretic mobility shift assays and by chromatin immunoprecipitation studies. Further functional analysis by co-expression of recombinant proteins and ChIP assays has shown an important regulatory role for CREB-binding protein in promoter activation, which is mediated by the GT motif

Promoters of Escherichia coli versus promoter islands: function and structure comparison.

Directory of Open Access Journals (Sweden)

Valeriy V Panyukov

Full Text Available Expression of bacterial genes takes place under the control of RNA polymerase with exchangeable σ-subunits and multiple transcription factors. A typical promoter region contains one or several overlapping promoters. In the latter case promoters have the same or different σ-specificity and are often subjected to different regulatory stimuli. Genes, transcribed from multiple promoters, have on average higher expression levels. However, recently in the genome of Escherichia coli we found 78 regions with an extremely large number of potential transcription start points (promoter islands, PIs. It was shown that all PIs interact with RNA polymerase in vivo and are able to form transcriptionally competent open complexes both in vitro and in vivo but their transcriptional activity measured by oligonucleotide microarrays was very low, if any. Here we confirmed transcriptional defectiveness of PIs by analyzing the 5'-end specific RNA-seq data, but showed their ability to produce short oligos (9-14 bases. This combination of functional properties indicated a deliberate suppression of transcriptional activity within PIs. According to our data this suppression may be due to a specific conformation of the DNA double helix, which provides an ideal platform for interaction with both RNA polymerase and the histone-like nucleoid protein H-NS. The genomic DNA of E.coli contains therefore several dozen sites optimized by evolution for staying in a heterochromatin-like state. Since almost all promoter islands are associated with horizontally acquired genes, we offer them as specific components of bacterial evolution involved in acquisition of foreign genetic material by turning off the expression of toxic or useless aliens or by providing optimal promoter for beneficial genes. The putative molecular mechanism underlying the appearance of promoter islands within recipient genomes is discussed.

Staphylococcus aureus RNAIII binds to two distant regions of coa mRNA to arrest translation and promote mRNA degradation.

Directory of Open Access Journals (Sweden)

Clément Chevalier

2010-03-01

Full Text Available Staphylococcus aureus RNAIII is the intracellular effector of the quorum sensing system that temporally controls a large number of virulence factors including exoproteins and cell-wall-associated proteins. Staphylocoagulase is one major virulence factor, which promotes clotting of human plasma. Like the major cell surface protein A, the expression of staphylocoagulase is strongly repressed by the quorum sensing system at the post-exponential growth phase. Here we used a combination of approaches in vivo and in vitro to analyze the mechanism used by RNAIII to regulate the expression of staphylocoagulase. Our data show that RNAIII represses the synthesis of the protein through a direct binding with the mRNA. Structure mapping shows that two distant regions of RNAIII interact with coa mRNA and that the mRNA harbors a conserved signature as found in other RNAIII-target mRNAs. The resulting complex is composed of an imperfect duplex masking the Shine-Dalgarno sequence of coa mRNA and of a loop-loop interaction occurring downstream in the coding region. The imperfect duplex is sufficient to prevent the formation of the ribosomal initiation complex and to repress the expression of a reporter gene in vivo. In addition, the double-strand-specific endoribonuclease III cleaves the two regions of the mRNA bound to RNAIII that may contribute to the degradation of the repressed mRNA. This study validates another direct target of RNAIII that plays a role in virulence. It also illustrates the diversity of RNAIII-mRNA topologies and how these multiple RNAIII-mRNA interactions would mediate virulence regulation.

Exogenous fatty acid binding protein 4 promotes human prostate cancer cell progression.

Science.gov (United States)

Uehara, Hisanori; Takahashi, Tetsuyuki; Oha, Mina; Ogawa, Hirohisa; Izumi, Keisuke

2014-12-01

Epidemiologic studies have found that obesity is associated with malignant grade and mortality in prostate cancer. Several adipokines have been implicated as putative mediating factors between obesity and prostate cancer. Fatty acid binding protein 4 (FABP4), a member of the cytoplasmic fatty acid binding protein multigene family, was recently identified as a novel adipokine. Although FABP4 is released from adipocytes and mean circulating concentrations of FABP4 are linked with obesity, effects of exogenous FABP4 on prostate cancer progression are unclear. In this study, we examined the effects of exogenous FABP4 on human prostate cancer cell progression. FABP4 treatment promoted serum-induced prostate cancer cell invasion in vitro. Furthermore, oleic acid promoted prostate cancer cell invasion only if FABP4 was present in the medium. These promoting effects were reduced by FABP4 inhibitor, which inhibits FABP4 binding to fatty acids. Immunostaining for FABP4 showed that exogenous FABP4 was taken up into DU145 cells in three-dimensional culture. In mice, treatment with FABP4 inhibitor reduced the subcutaneous growth and lung metastasis of prostate cancer cells. Immunohistochemical analysis showed that the number of apoptotic cells, positive for cleaved caspase-3 and cleaved PARP, was increased in subcutaneous tumors of FABP4 inhibitor-treated mice, as compared with control mice. These results suggest that exogenous FABP4 might promote human prostate cancer cell progression by binding with fatty acids. Additionally, exogenous FABP4 activated the PI3K/Akt pathway, independently of binding to fatty acids. Thus, FABP4 might be a key molecule to understand the mechanisms underlying the obesity-prostate cancer progression link. © 2014 UICC.

Integration Host Factor (IHF binds to the promoter region of the phtD operon involved in phaseolotoxin synthesis in P. syringae pv. phaseolicola NPS3121

Directory of Open Access Journals (Sweden)

Álvarez-Morales Ariel

2011-05-01

Full Text Available Abstract Background Pseudomonas syringae pv. phaseolicola, the causal agent of halo blight disease in beans, produces a toxin known as phaseolotoxin, in whose synthesis participate a group of genes organized within the genome in a region known as the "Pht cluster". This region, which is thought to have been acquired by horizontal gene transfer, includes 5 transcriptional units, two monocistronic (argK, phtL and three polycistronic (phtA, phtD, phtM, whose expression is temperature dependent. So far, the regulatory mechanisms involved in phaseolotoxin synthesis have not been elucidated and the only well-established fact is the requirement of low temperatures for its synthesis. In this work, we searched for regulatory proteins that could be involved in phaseolotoxin synthesis, focusing on the regulation of the phtD operon. Results In this study we identified the global regulator IHF (Integration Host Factor, which binds to the promoter region of the phtD operon, exerting a negative effect on the expression of this operon. This is the first regulatory protein identified as part of the phaseolotoxin synthesis system. Our findings suggest that the Pht cluster was similarly regulated in the ancestral cluster by IHF or similar protein, and integrated into the global regulatory mechanism of P. syringae pv. phaseolicola, after the horizontal gene transfer event by using the host IHF protein. Conclusion This study identifies the IHF protein as one element involved in the regulation of phaseolotoxin synthesis in P. syringae pv. phaseolicola NPS3121 and provides new insights into the regulatory mechanisms involved in phaseolotoxin production.

NSs Protein of Rift Valley Fever Virus Promotes Posttranslational Downregulation of the TFIIH Subunit p62▿

Science.gov (United States)

Kalveram, Birte; Lihoradova, Olga; Ikegami, Tetsuro

2011-01-01

Rift Valley fever virus (RVFV; family Bunyaviridae, genus Phlebovirus) is an important emerging pathogen of humans and ruminants. Its NSs protein has previously been identified as a major virulence factor that suppresses host defense through three distinct mechanisms: it directly inhibits beta interferon (IFN-β) promoter activity, it promotes the degradation of double-stranded RNA-dependent protein kinase (PKR), and it suppresses host transcription by disrupting the assembly of the basal transcription factor TFIIH through sequestration of its p44 subunit. Here, we report that in addition to PKR, NSs also promotes the degradation of the TFIIH subunit p62. Infection of cells with the RVFV MP-12 vaccine strain reduced p62 protein levels to below the detection limit early in the course of infection. This NSs-mediated downregulation of p62 was posttranslational, as it was unaffected by pharmacological inhibition of transcription or translation and MP-12 infection had no effect on p62 mRNA levels. Treatment of cells with proteasome inhibitors but not inhibition of lysosomal acidification or nuclear export resulted in a stabilization of p62 in the presence of NSs. Furthermore, p62 could be coprecipitated with NSs from lysates of infected cells. These data suggest that the RVFV NSs protein is able to interact with the TFIIH subunit p62 inside infected cells and promotes its degradation, which can occur directly in the nucleus. PMID:21543505

Early Involvement of Death-Associated Protein Kinase Promoter Hypermethylation in the Carcinogenesis of Barrett's Esophageal Adenocarcinoma and Its Association with Clinical Progression

Directory of Open Access Journals (Sweden)

Doerthe Kuester

2007-03-01

Full Text Available Esophageal Barrett's adenocarcinoma (BA develops through a multistage process, which is associated with the transcriptional silencing of tumor-suppressor genes by promoter CpG island hypermethylation. In this study, we explored the promoter hypermethylation and protein expression of proapoptotic deathassociated protein kinase (DAPK during the multistep Barrett's carcinogenesis cascade. Early BA and paired samples of premalignant lesions of 61 patients were analyzed by methylation-specific polymerase chain reaction and immunohistochemistry. For the association of clinicopathological markers and protein expression, an immunohistochemical tissue microarray analysis of 66 additional BAs of advanced tumor stages was performed. Hypermethylation of DAPK promoter was detected in 20% of normal mucosa, 50% of Barrett's metaplasia, 53% of dysplasia, and 60% of adenocarcinomas, and resulted in a marked decrease in DAPK protein expression (P < .01. The loss of DAPK protein was significantly associated with advanced depth of tumor invasion and advanced tumor stages (P < .001. Moreover, the severity of reflux esophagitis correlated significantly with the hypermethylation rate of the DAPK promoter (P < .003. Thus, we consider DAPK inactivation by promoter hypermethylation as an early event in Barrett's carcinogenesis and suggest that a decreased protein expression of DAPK likely plays a role in the development and progression of BA.

Functions of the CCCH type zinc finger protein OsGZF1 in regulation of the seed storage protein GluB-1 from rice

NARCIS (Netherlands)

Chen, Y.; Sun, A.; Wang, M.; Zhu, Z.; Ouwerkerk, P.B.F.

2014-01-01

Glutelins are the most abundant storage proteins in rice grain and can make up to 80 % of total protein content. The promoter region of GluB-1, one of the glutelin genes in rice, has been intensively used as a model to understand regulation of seed-storage protein accumulation. In this study, we

A-type nuclear lamins act as transcriptional repressors when targeted to promoters

International Nuclear Information System (INIS)

Lee, Damian C.; Welton, K. Linnea; Smith, Erica D.; Kennedy, Brian K.

2009-01-01

Regions of heterochromatin are often found at the periphery of the mammalian nucleus, juxtaposed to the nuclear lamina. Genes in these regions are likely maintained in a transcriptionally silent state, although other locations at the nuclear periphery associated with nuclear pores are sites of active transcription. As primary components of the nuclear lamina, A- and B-type nuclear lamins are intermediate filament proteins that interact with DNA, histones and known transcriptional repressors, leading to speculation that they may promote establishment of repressive domains. However, no direct evidence of a role for nuclear lamins in transcriptional repression has been reported. Here we find that human lamin A, when expressed in yeast and cultured human cells as a fusion protein to the Gal4 DNA-binding domain (DBD), can mediate robust transcriptional repression of promoters with Gal4 binding sites. Full repression by lamin A requires both the coiled-coil rod domain and the C-terminal tail domain. In human cells, other intermediate filament proteins such as lamin B and vimentin are unable to confer robust repression as Gal4-DBD fusions, indicating that this property is specific to A-type nuclear lamins. These findings indicate that A-type lamins can promote transcriptional repression when in proximity of a promoter

Control of autogenous activation of Herbaspirillum seropedicae nifA promoter by the IHF protein.

Science.gov (United States)

Wassem, Roseli; Pedrosa, Fábio O; Yates, Marshall G; Rego, Fabiane G M; Chubatsu, Leda S; Rigo, Liu U; Souza, Emanuel M

2002-07-02

Analysis of the expression of the Herbaspirillum seropedicae nifA promoter in Escherichia coli and Herbaspirillum seropedicae, showed that nifA expression is primarily dependent on NtrC but also required NifA for maximal expression under nitrogen-fixing conditions. Deletion of the IHF (integration host factor)-binding site produced a promoter with two-fold higher activity than the native promoter in the H. seropedicae wild-type strain but not in a nifA strain, indicating that IHF controls NifA auto-activation. IHF is apparently required to prevent overexpression of the NifA protein via auto-activation under nitrogen-fixing conditions in H. seropedicae.

An Aphid Effector Targets Trafficking Protein VPS52 in a Host-Specific Manner to Promote Virulence.

Science.gov (United States)

Rodriguez, Patricia A; Escudero-Martinez, Carmen; Bos, Jorunn I B

2017-03-01

Plant- and animal-feeding insects secrete saliva inside their hosts, containing effectors, which may promote nutrient release and suppress immunity. Although for plant pathogenic microbes it is well established that effectors target host proteins to modulate host cell processes and promote disease, the host cell targets of herbivorous insects remain elusive. Here, we show that the existing plant pathogenic microbe effector paradigm can be extended to herbivorous insects in that effector-target interactions inside host cells modify critical host processes to promote plant susceptibility. We showed that the effector Mp1 from Myzus persicae associates with the host Vacuolar Protein Sorting Associated Protein52 (VPS52). Using natural variants, we provide a strong link between effector virulence activity and association with VPS52, and show that the association is highly specific to M persicae -host interactions. Also, coexpression of Mp1, but not Mp1-like variants, specifically with host VPS52s resulted in effector relocalization to vesicle-like structures that associate with prevacuolar compartments. We show that high VPS52 levels negatively impact virulence, and that aphids are able to reduce VPS52 levels during infestation, indicating that VPS52 is an important virulence target. Our work is an important step forward in understanding, at the molecular level, how a major agricultural pest promotes susceptibility during infestation of crop plants. We give evidence that an herbivorous insect employs effectors that interact with host proteins as part of an effective virulence strategy, and that these effectors likely function in a species-specific manner. © 2017 American Society of Plant Biologists. All Rights Reserved.

Role of regional policies in promoting networking and innovation activity of firms

OpenAIRE

Kirsi Mukkala; Jari Ritsilä

2004-01-01

The success of firms and regions is increasingly defined by their innovation and learning capabilities. It has been emphasized in several studies that a local operational environment may have a positive impact on innovation activity of firms. From policy point of view, the relationship between firms and their local environment is an important research topic. The purpose of this paper is to explore whether there is a demand for regional policy makers in promoting innovative and networking acti...

Prediction of flexible/rigid regions from protein sequences using k-spaced amino acid pairs

Directory of Open Access Journals (Sweden)

Ruan Jishou

2007-04-01

Full Text Available Abstract Background Traditionally, it is believed that the native structure of a protein corresponds to a global minimum of its free energy. However, with the growing number of known tertiary (3D protein structures, researchers have discovered that some proteins can alter their structures in response to a change in their surroundings or with the help of other proteins or ligands. Such structural shifts play a crucial role with respect to the protein function. To this end, we propose a machine learning method for the prediction of the flexible/rigid regions of proteins (referred to as FlexRP; the method is based on a novel sequence representation and feature selection. Knowledge of the flexible/rigid regions may provide insights into the protein folding process and the 3D structure prediction. Results The flexible/rigid regions were defined based on a dataset, which includes protein sequences that have multiple experimental structures, and which was previously used to study the structural conservation of proteins. Sequences drawn from this dataset were represented based on feature sets that were proposed in prior research, such as PSI-BLAST profiles, composition vector and binary sequence encoding, and a newly proposed representation based on frequencies of k-spaced amino acid pairs. These representations were processed by feature selection to reduce the dimensionality. Several machine learning methods for the prediction of flexible/rigid regions and two recently proposed methods for the prediction of conformational changes and unstructured regions were compared with the proposed method. The FlexRP method, which applies Logistic Regression and collocation-based representation with 95 features, obtained 79.5% accuracy. The two runner-up methods, which apply the same sequence representation and Support Vector Machines (SVM and Naïve Bayes classifiers, obtained 79.2% and 78.4% accuracy, respectively. The remaining considered methods are

Sequence organization and control of transcription in the bacteriophage T4 tRNA region.

Science.gov (United States)

Broida, J; Abelson, J

1985-10-05

Bacteriophage T4 contains genes for eight transfer RNAs and two stable RNAs of unknown function. These are found in two clusters at 70 X 10(3) base-pairs on the T4 genetic map. To understand the control of transcription in this region we have completed the sequencing of 5000 base-pairs in this region. The sequence contains a part of gene 3, gene 1, gene 57, internal protein I, the tRNA genes and five open reading frames which most likely code for heretofore unidentified proteins. We have used subclones of the region to investigate the kinetics of transcription in vivo. The results show that transcription in this region consists of overlapping early, middle and late transcripts. Transcription is directed from two early promoters, one or two middle promoters and perhaps two late promoters. This region contains all of the features that are seen in T4 transcription and as such is a good place to study the phenomenon in more detail.

Promoting regional mobility

DEFF Research Database (Denmark)

Jensen, Anne

Pricing of transport has been part of EU's common transport policy since this gained momentum in the early 1990s. Since then, it has been closely connected to the trans-European transport network (TEN-T) and to rising demands of efficient mobility systems at a local, regional and Community scale....... Development of pricing policies is contested at Community level and has taken place in a clash between different policy rationalities. Significantly though, the effects of the pricing policies are closely related to regional mobility systems, e.g. through financing large trans-border infrastructure projects...... and establishing common technical charging systems thus changing the conditions for regional mobility. This paper explores how policies of infrastructure pricing shape new ways of governing mobility which influences trans-border, regional policy-making. The key findings are that there is a tendency to include...

Hepatitis C Virus core+1/ARF Protein Modulates the Cyclin D1/pRb Pathway and Promotes Carcinogenesis.

Science.gov (United States)

Moustafa, Savvina; Karakasiliotis, Ioannis; Mavromara, Penelope

2018-05-01

Viruses often encompass overlapping reading frames and unconventional translation mechanisms in order to maximize the output from a minimum genome and to orchestrate their timely gene expression. Hepatitis C virus (HCV) possesses such an unconventional open reading frame (ORF) within the core-coding region, encoding an additional protein, initially designated ARFP, F, or core+1. Two predominant isoforms of core+1/ARFP have been reported, core+1/L, initiating from codon 26, and core+1/S, initiating from codons 85/87 of the polyprotein coding region. The biological significance of core+1/ARFP expression remains elusive. The aim of the present study was to gain insight into the functional and pathological properties of core+1/ARFP through its interaction with the host cell, combining in vitro and in vivo approaches. Our data provide strong evidence that the core+1/ARFP of HCV-1a stimulates cell proliferation in Huh7-based cell lines expressing either core+1/S or core+1/L isoforms and in transgenic liver disease mouse models expressing core+1/S protein in a liver-specific manner. Both isoforms of core+1/ARFP increase the levels of cyclin D1 and phosphorylated Rb, thus promoting the cell cycle. In addition, core+1/S was found to enhance liver regeneration and oncogenesis in transgenic mice. The induction of the cell cycle together with increased mRNA levels of cell proliferation-related oncogenes in cells expressing the core+1/ARFP proteins argue for an oncogenic potential of these proteins and an important role in HCV-associated pathogenesis. IMPORTANCE This study sheds light on the biological importance of a unique HCV protein. We show here that core+1/ARFP of HCV-1a interacts with the host machinery, leading to acceleration of the cell cycle and enhancement of liver carcinogenesis. This pathological mechanism(s) may complement the action of other viral proteins with oncogenic properties, leading to the development of hepatocellular carcinoma. In addition, given that

Production of soluble mammalian proteins in Escherichia coli: identification of protein features that correlate with successful expression

Directory of Open Access Journals (Sweden)

Perera Rajika L

2004-12-01

Full Text Available Abstract Background In the search for generic expression strategies for mammalian protein families several bacterial expression vectors were examined for their ability to promote high yields of soluble protein. Proteins studied included cell surface receptors (Ephrins and Eph receptors, CD44, kinases (EGFR-cytoplasmic domain, CDK2 and 4, proteases (MMP1, CASP2, signal transduction proteins (GRB2, RAF1, HRAS and transcription factors (GATA2, Fli1, Trp53, Mdm2, JUN, FOS, MAD, MAX. Over 400 experiments were performed where expression of 30 full-length proteins and protein domains were evaluated with 6 different N-terminal and 8 C-terminal fusion partners. Expression of an additional set of 95 mammalian proteins was also performed to test the conclusions of this study. Results Several protein features correlated with soluble protein expression yield including molecular weight and the number of contiguous hydrophobic residues and low complexity regions. There was no relationship between successful expression and protein pI, grand average of hydropathicity (GRAVY, or sub-cellular location. Only small globular cytoplasmic proteins with an average molecular weight of 23 kDa did not require a solubility enhancing tag for high level soluble expression. Thioredoxin (Trx and maltose binding protein (MBP were the best N-terminal protein fusions to promote soluble expression, but MBP was most effective as a C-terminal fusion. 63 of 95 mammalian proteins expressed at soluble levels of greater than 1 mg/l as N-terminal H10-MBP fusions and those that failed possessed, on average, a higher molecular weight and greater number of contiguous hydrophobic amino acids and low complexity regions. Conclusions By analysis of the protein features identified here, this study will help predict which mammalian proteins and domains can be successfully expressed in E. coli as soluble product and also which are best targeted for a eukaryotic expression system. In some cases

Distribution of protein components of wheat from different regions

African Journals Online (AJOL)

kesiena

2012-06-07

Jun 7, 2012 ... The distribution of wheat protein components in different regions was researched to ..... properties of wheat gliadins II. effects on dynamic rheoligical ... fractions properties of wheat dough depending on molecular size and.

Structure of the gene for human β2-adrenergic receptor: expression and promoter characterization

International Nuclear Information System (INIS)

Emorine, L.J.; Marullo, S.; Delavier-Klutchko, C.; Kaveri, S.V.; Durieu-Trautmann, O.; Strosberg, A.D.

1987-01-01

The genomic gene coding for the human β 2 -adrenergic receptor (β 2 AR) from A431 epidermoid cells has been isolated. Transfection of the gene into eukaryotic cells restores a fully active receptor/GTP-binding protein/adenylate cyclase complex with β 2 AR properties. Southern blot analyses with β 2 AR-specific probes show that a single β 2 AR gene is common to various human tissues and that its flanking sequences are highly conserved among humans and between man and rabbit, mouse, and hamster. Functional significance of these regions is supported by the presence of a promoter region (including mRNA cap sites, two TATA boxes, a CAAT box, and three G + C-rich regions that resemble binding sites for transcription factor Sp1) 200-300 base pairs 5' to the translation initiation codon. In the 3' flanking region, sequences homologous to glucocorticoid-response elements might be responsible for the increased expression of the β 2 AR gene observed after treatment of the transfected cells with hydrocortisone. In addition, 5' to the promoter region, an open reading frame encodes a 251-residue polypeptide that displays striking homologies with protein kinases and other nucleotide-binding proteins

Transactivation of the proenkephalin gene promoter by the Tax sub 1 protein of human T-cell lymphotropic virus type I

Energy Technology Data Exchange (ETDEWEB)

Joshi, J.B. (National Heart, Lung, and Blood Inst., Bethesda, MD (United States)); Dave, H.P.G. (National Inst. of Health, Bethesda, MD (United States))

1992-02-01

Human T-cell lymphotropic virus type I (HTLV-I), an etiologic agent for adult T-cell leukemia, is strongly associated with certain neurological diseases. The HTLV-I genome encodes a protein, Tax{sub 1}, that transactivates viral gene transcription. CD4-positive T helper lymphocytes express the proenkephalin gene, and enkephalins have been implicated as neuroimmunomodulators. The authors have investigated the effect of Tax{sub 1} on the proenkephalin gene promoter in C6 rat glioma cells and demonstrated its transactivation. Analysis using 5{prime} deletion mutants of the promoter region showed that sequences upstream of base pair - 190 are necessary for maximal transactivation. Forskolin, a cAMP modulator, synergistically increased Tax{sub 1}-mediated transactivation of the proenkephalin promoter. Neither Tax{sub 1} transactivation alone nor Tax{sub 1}/cAMP synergism exclusively involved cAMP-responsive elements. Endogenous proenkephalin gene expression increased in Tax{sub 1}-expressing C6 cells. Since HTLV-I infects lymphocytes, which express proenkephalin mRNA, Tax{sub 1} transregulation of proenkephalin expression may provide bidirectional communication between the nervous and immune systems in HTLV-I-related diseases.

Epigenetic repression of regulator of G-protein signaling 2 promotes androgen-independent prostate cancer cell growth.

Science.gov (United States)

Wolff, Dennis W; Xie, Yan; Deng, Caishu; Gatalica, Zoran; Yang, Mingjie; Wang, Bo; Wang, Jincheng; Lin, Ming-Fong; Abel, Peter W; Tu, Yaping

2012-04-01

G-protein-coupled receptor (GPCR)-stimulated androgen-independent activation of androgen receptor (AR) contributes to acquisition of a hormone-refractory phenotype by prostate cancer. We previously reported that regulator of G-protein signaling (RGS) 2, an inhibitor of GPCRs, inhibits androgen-independent AR activation (Cao et al., Oncogene 2006;25:3719-34). Here, we show reduced RGS2 protein expression in human prostate cancer specimens compared to adjacent normal or hyperplastic tissue. Methylation-specific PCR analysis and bisulfite sequencing indicated that methylation of the CpG island in the RGS2 gene promoter correlated with RGS2 downregulation in prostate cancer. In vitro methylation of this promoter suppressed reporter gene expression in transient transfection studies, whereas reversal of this promoter methylation with 5-aza-2'-deoxycytidine (5-Aza-dC) induced RGS2 reexpression in androgen-independent prostate cancer cells and inhibited their growth under androgen-deficient conditions. Interestingly, the inhibitory effect of 5-Aza-dC was significantly reduced by an RGS2-targeted short hairpin RNA, indicating that reexpressed RGS2 contributed to this growth inhibition. Restoration of RGS2 levels by ectopic expression in androgen-independent prostate cancer cells suppressed growth of xenografts in castrated mice. Thus, RGS2 promoter hypermethylation represses its expression and unmasks a latent pathway for AR transactivation in prostate cancer cells. Targeting this reversible process may provide a new strategy for suppressing prostate cancer progression by reestablishing its androgen sensitivity. Copyright © 2011 UICC.

Functional analysis of the rice rubisco activase promoter in transgenic Arabidopsis

Energy Technology Data Exchange (ETDEWEB)

Yang, Zhipan; Lu, Qingtao; Wen, Xiaogang [Key Laboratory of Photobiology, Institute of Botany, Chinese Academy of Sciences, Beijing 100093 (China); Chen, Fan [Key Laboratory of Molecular and Developmental Biology, Institute of Genetics and Developmental Biology, Chinese Academy of Sciences, Beijing 100080 (China); Lu, Congming, E-mail: lucm@ibcas.ac.cn [Key Laboratory of Photobiology, Institute of Botany, Chinese Academy of Sciences, Beijing 100093 (China)

2012-02-17

Highlights: Black-Right-Pointing-Pointer Rice rubisco activase promoter was analyzed in transgenic Arabidopsis system. Black-Right-Pointing-Pointer Region conferring tissue specific and light inducible expression of Rca was identified. Black-Right-Pointing-Pointer -58 to +43 bp region mediates tissue-specific expression of rice Rca. Black-Right-Pointing-Pointer Light inducible expression of rice Rca is mediated by -297 to -58 bp region. Black-Right-Pointing-Pointer Rice nuclear proteins bind specifically with the light inducible region. -- Abstract: To gain a better understanding of the regulatory mechanism of the rice rubisco activase (Rca) gene, variants of the Rca gene promoter (one full-length and four deletion mutants) fused to the coding region of the bacterial reporter gene {beta}-glucuronidase (GUS) were introduced into Arabidopsis via Agrobacterium-mediated transformation. Our results show that a 340 bp fragment spanning from -297 to +43 bp relative to the transcription initiation site is enough to promote tissue-specific and light-inducible expression of the rice Rca gene as done by the full-length promoter (-1428 to +43 bp). Further deletion analysis indicated that the region conferring tissue-specificity of Rca expression is localized within a 105 bp fragment from -58 to +43 bp, while light-inducible expression of Rca is mediated by the region from -297 to -58 bp. Gel shift assays and competition experiments demonstrated that rice nuclear proteins bind specifically with the fragment conferring light responsiveness at more than one binding site. This implies that multiple cis-elements may be involved in light-induced expression of the rice Rca gene. These works provide a useful reference for understanding transcriptional regulation mechanism of the rice Rca gene, and lay a strong foundation for further detection of related cis-elements and trans-factors.

Functional analysis of the rice rubisco activase promoter in transgenic Arabidopsis

International Nuclear Information System (INIS)

Yang, Zhipan; Lu, Qingtao; Wen, Xiaogang; Chen, Fan; Lu, Congming

2012-01-01

Highlights: ► Rice rubisco activase promoter was analyzed in transgenic Arabidopsis system. ► Region conferring tissue specific and light inducible expression of Rca was identified. ► −58 to +43 bp region mediates tissue-specific expression of rice Rca. ► Light inducible expression of rice Rca is mediated by −297 to −58 bp region. ► Rice nuclear proteins bind specifically with the light inducible region. -- Abstract: To gain a better understanding of the regulatory mechanism of the rice rubisco activase (Rca) gene, variants of the Rca gene promoter (one full-length and four deletion mutants) fused to the coding region of the bacterial reporter gene β-glucuronidase (GUS) were introduced into Arabidopsis via Agrobacterium-mediated transformation. Our results show that a 340 bp fragment spanning from −297 to +43 bp relative to the transcription initiation site is enough to promote tissue-specific and light-inducible expression of the rice Rca gene as done by the full-length promoter (−1428 to +43 bp). Further deletion analysis indicated that the region conferring tissue-specificity of Rca expression is localized within a 105 bp fragment from −58 to +43 bp, while light-inducible expression of Rca is mediated by the region from −297 to −58 bp. Gel shift assays and competition experiments demonstrated that rice nuclear proteins bind specifically with the fragment conferring light responsiveness at more than one binding site. This implies that multiple cis-elements may be involved in light-induced expression of the rice Rca gene. These works provide a useful reference for understanding transcriptional regulation mechanism of the rice Rca gene, and lay a strong foundation for further detection of related cis-elements and trans-factors.

Systematic screening for mutations in the promoter and the coding region of the 5-HT{sub 1A} gene

Energy Technology Data Exchange (ETDEWEB)

Erdmann, J.; Shimron-Abarbanell, D.; Cichon, S. [Univ. of Bonn (Germany)] [and others

1995-10-09

In the present study we sought to identify genetic variation in the 5-HT{sub 1A} receptor gene which through alteration of protein function or level of expression might contribute to the genetic predisposition to neuropsychiatric diseases. Genomic DNA samples from 159 unrelated subjects (including 45 schizophrenic, 46 bipolar affective, and 43 patients with Tourette`s syndrome, as well as 25 healthy controls) were investigated by single-strand conformation analysis. Overlapping PCR (polymerase chain reaction) fragments covered the whole coding sequence as well as the 5{prime} untranslated region of the 5-HT{sub 1A} gene. The region upstream to the coding sequence we investigated contains a functional promoter. We found two rare nucleotide sequence variants. Both mutations are located in the coding region of the gene: a coding mutation (A{yields}G) in nucleotide position 82 which leads to an amino acid exchange (Ile{yields}Val) in position 28 of the receptor protein and a silent mutation (C{yields}T) in nucleotide position 549. The occurrence of the Ile-28-Val substitution was studied in an extended sample of patients (n = 352) and controls (n = 210) but was found in similar frequencies in all groups. Thus, this mutation is unlikely to play a significant role in the genetic predisposition to the diseases investigated. In conclusion, our study does not provide evidence that the 5-HT{sub 1A} gene plays either a major or a minor role in the genetic predisposition to schizophrenia, bipolar affective disorder, or Tourette`s syndrome. 29 refs., 4 figs., 1 tab.

Nucleopolis for promoting the nuclear excellence of the Normandy region

International Nuclear Information System (INIS)

2016-01-01

Nucleopolis is the Norman economic pole dedicated to nuclear energy, nuclear medicine and nuclear safety, it gathers about 70 enterprises whatever their sizes, research laboratories and teaching or training units. Nucleopolis was founded in 2009 with the economic development of the region as a unique purpose. Nucleopolis will ease the access of its members to local, national and international markets through actions of networking and by promoting innovations and skill development. Nucleopolis proposes to its members a series of services around 4 departments: Nucleo'Network to promote networking between the members themselves and between the members and major contractors; Nucleo'Business to propose assistance in national and international business; Nucleo'Competence to propose adequate training to its members to upgrade their skills and Nucleo'Innovation to foster collaborative work between its members on innovative projects. (A.C.)

Restoration of CpG Methylation in The Egf Promoter Region during Rat Liver Regeneration

Science.gov (United States)

Deming, Li; Ziwei, Li; Xueqiang, Guo; Cunshuan, Xu

2015-01-01

Epidermal growth factor (EGF) is an important factor for healing after tissue damage in diverse experimental models. It plays an important role in liver regeneration (LR). The objective of this experiment is to investigate the methylation variation of 10 CpG sites in the Egf promoter region and their relevance to Egf expression during rat liver regenera- tion. As a follow up of our previous study, rat liver tissue was collected after rat 2/3 partial hepatectomy (PH) during the re-organization phase (from days 14 to days 28). Liver DNA was extracted and modified by sodium bisulfate. The methylation status of 10 CpG sites in Egf promoter region was determined using bisulfite sequencing polymerase chain reaction (PCR), as BSP method. The results showed that 3 (sites 3, 4 and 9) out of 10 CpG sites have strikingly methylation changes during the re-organization phase compared to the regeneration phase (from 2 hours to 168 hours, P=0.002, 0.048 and 0.018, respectively). Our results showed that methylation modification of CpGs in the Egf promoter region could be restored to the status before PH operation and changes of methylation didn’t affect Egf mRNA expression during the re-organization phase. PMID:26464832

Identification of DNA-binding proteins that interact with the 5'-flanking region of the human D-amino acid oxidase gene by pull-down assay coupled with two-dimensional gel electrophoresis and mass spectrometry.

Science.gov (United States)

Tran, Diem Hong; Shishido, Yuji; Chung, Seong Pil; Trinh, Huong Thi Thanh; Yorita, Kazuko; Sakai, Takashi; Fukui, Kiyoshi

2015-12-10

D-Amino acid oxidase (DAO) is a flavoenzyme that metabolizes D-amino acids and is expected to be a promising therapeutic target of schizophrenia and glioblastoma. The study of DNA-binding proteins has yielded much information in the regulation of transcription and other biological processes. However, proteins interacting with DAO gene have not been elucidated. Our assessment of human DAO promoter activity using luciferase reporter system indicated the 5'-flanking region of this gene (-4289 bp from transcription initiation site) has a regulatory sequence for gene expression, which is regulated by multi-protein complexes interacting with this region. By using pull-down assay coupled with two-dimensional gel electrophoresis and mass spectrometry, we identified six proteins binding to the 5'-flanking region of the human DAO gene (zinc finger C2HC domain-containing protein 1A; histidine-tRNA ligase, cytoplasmic; molybdenum cofactor biosynthesis protein; 60S ribosomal protein L37; calponin-1; calmodulin binding protein and heterogeneous nuclear ribonucleoprotein A2/B1). These preliminary results will contribute to the advance in the understanding of the potential factors associated with the regulatory mechanism of DAO expression. Copyright © 2015 Elsevier B.V. All rights reserved.

GBA manager: an online tool for querying low-complexity regions in proteins.

Science.gov (United States)

Bandyopadhyay, Nirmalya; Kahveci, Tamer

2010-01-01

Abstract We developed GBA Manager, an online software that facilitates the Graph-Based Algorithm (GBA) we proposed in our earlier work. GBA identifies the low-complexity regions (LCR) of protein sequences. GBA exploits a similarity matrix, such as BLOSUM62, to compute the complexity of the subsequences of the input protein sequence. It uses a graph-based algorithm to accurately compute the regions that have low complexities. GBA Manager is a user friendly web-service that enables online querying of protein sequences using GBA. In addition to querying capabilities of the existing GBA algorithm, GBA Manager computes the p-values of the LCR identified. The p-value gives an estimate of the possibility that the region appears by chance. GBA Manager presents the output in three different understandable formats. GBA Manager is freely accessible at http://bioinformatics.cise.ufl.edu/GBA/GBA.htm .

Promoter activity of polypyrimidine tract-binding protein genes of potato responds to environmental cues.

Science.gov (United States)

Butler, Nathaniel M; Hannapel, David J

2012-12-01

Polypyrimidine tract-binding (PTB) proteins are RNA-binding proteins that target specific RNAs for post-transcriptional processing by binding cytosine/uracil motifs. PTBs have established functions in a range of RNA processes including splicing, translation, stability and long-distance transport. Six PTB-like genes identified in potato have been grouped into two clades based on homology to other known plant PTBs. StPTB1 and StPTB6 are closely related to a PTB protein discovered in pumpkin, designated CmRBP50, and contain four canonical RNA-recognition motifs. CmRBP50 is expressed in phloem tissues and functions as the core protein of a phloem-mobile RNA/protein complex. Sequence from the potato genome database was used to clone the upstream sequence of these two PTB genes and analyzed to identify conserved cis-elements. The promoter of StPTB6 was enriched for regulatory elements for light and sucrose induction and defense. Upstream sequence of both PTB genes was fused to β-glucuronidase and monitored in transgenic potato lines. In whole plants, the StPTB1 promoter was most active in leaf veins and petioles, whereas StPTB6 was most active in leaf mesophyll. Both genes are active in new tubers and tuber sprouts. StPTB6 expression was induced in stems and stolon sections in response to sucrose and in leaves or petioles in response to light, heat, drought and mechanical wounding. These results show that CmRBP50-like genes of potato exhibit distinct expression patterns and respond to both developmental and environmental cues.

Ubiquitin-like protein UBL5 promotes the functional integrity of the Fanconi anemia pathway

DEFF Research Database (Denmark)

Oka, Yasuyoshi; Bekker-Jensen, Simon; Mailand, Niels

2015-01-01

in promoting the function of the Fanconi anemia (FA) pathway for repair of DNA interstrand crosslinks (ICLs), mediated by a specific interaction with the central FA pathway component FANCI. UBL5-deficient cells display spliceosome-independent reduction of FANCI protein stability, defective FANCI function...

Promoter-wide hypermethylation of the ribosomal RNA gene promoter in the suicide brain.

Directory of Open Access Journals (Sweden)

Patrick O McGowan

Full Text Available BACKGROUND: Alterations in gene expression in the suicide brain have been reported and for several genes DNA methylation as an epigenetic regulator is thought to play a role. rRNA genes, that encode ribosomal RNA, are the backbone of the protein synthesis machinery and levels of rRNA gene promoter methylation determine rRNA transcription. METHODOLOGY/PRINCIPAL FINDINGS: We test here by sodium bisulfite mapping of the rRNA promoter and quantitative real-time PCR of rRNA expression the hypothesis that epigenetic differences in critical loci in the brain are involved in the pathophysiology of suicide. Suicide subjects in this study were selected for a history of early childhood neglect/abuse, which is associated with decreased hippocampal volume and cognitive impairments. rRNA was significantly hypermethylated throughout the promoter and 5' regulatory region in the brain of suicide subjects, consistent with reduced rRNA expression in the hippocampus. This difference in rRNA methylation was not evident in the cerebellum and occurred in the absence of genome-wide changes in methylation, as assessed by nearest neighbor. CONCLUSIONS/SIGNIFICANCE: This is the first study to show aberrant regulation of the protein synthesis machinery in the suicide brain. The data implicate the epigenetic modulation of rRNA in the pathophysiology of suicide.

Governmental promotion of the Information Society in the Spanish Region of Valencia

Directory of Open Access Journals (Sweden)

Emilio Feliu-García, Ph.D.

2011-01-01

Full Text Available Regional spheres are considered essential in the governmental promotion of the Information Society at the international level. The regional initiatives in Spain aim to strengthen and complement the initiatives promoted at the national level. This article analyses ICT penetration in the Valencian Community from 1996 to 2008. The objective is to identify which of the actions carried out by the Valencian Regional Government have had a positive effect on its society.The methodology employed in this study is benchmarking. The selection of indicators is based on the policies evaluation model proposed in the Plan Avanza (Spain’s national Information Society strategy. Data were collected from official statistical sources (like Spain’s National Statistics Institute, INE. Three statistical tests were applied to verify the hypotheses (Pearson’s r2, Chi-square and Student’s t.The results indicate that it is not possible to affirm that the actions implemented by the Valencian Regional Government have had a more positive effect on its society than those implemented by the Spanish Central Government. A reason for this may lie in the specific objectives of the political strategy implemented by the Valencian Government, which has focused primarily on e-Government and does not include enough projects centred on the implementation of new technologies in the private sector. Moreover, the integration of new technologies in everyday life is placed in a second level of importance despite citizens are central actors in the international agenda.

Methods for promoting wound healing and muscle regeneration with the cell signaling protein nell1

Energy Technology Data Exchange (ETDEWEB)

Culiat, Cymbeline T.

2018-03-20

The present invention provides methods for promoting wound healing and treating muscle atrophy in a mammal in need. The method comprises administering to the mammal a Nell1 protein or a Nell1 nucleic acid molecule.

Methods for promoting wound healing and muscle regeneration with the cell signaling protein Nell1

Science.gov (United States)

Culiat, Cymbeline T [Oak Ridge, TN

2011-03-22

The present invention provides methods for promoting wound healing and treating muscle atrophy in a mammal in need. The method comprises administering to the mammal a Nell1 protein or a Nell1 nucleic acid molecule.

Screening a yeast promoter library leads to the isolation of the RP29/L32 and SNR17B/RPL37A divergent promoters and the discovery of a gene encoding ribosomal protein L37.

Science.gov (United States)

Santangelo, G M; Tornow, J; McLaughlin, C S; Moldave, K

1991-08-30

Two promoters (A7 and A23), isolated at random from the Saccharomyces cerevisiae genome by virtue of their capacity to activate transcription, are identical to known intergenic bidirectional promoters. Sequence analysis of the genomic DNA adjacent to the A7 promoter identified a split gene encoding ribosomal (r) protein L37, which is homologous to the tRNA-binding r-proteins, L35a (from human and rat) and L32 (from frogs).

Gene divergence of homeologous regions associated with a major seed protein content QTL in soybean

Directory of Open Access Journals (Sweden)

Puji eLestari

2013-06-01

Full Text Available Understanding several modes of duplication contributing on the present genome structure is getting an attention because it could be related to numerous agronomically important traits. Since soybean serves as a rich protein source for animal feeds and human consumption, breeding efforts in soybean have been directed toward enhancing seed protein content. The publicly available soybean sequences and its genomically featured elements facilitate comprehending of quantitative trait loci (QTL for seed protein content in concordance with homeologous regions in soybean genome. Although parts of chromosome (Chr 20 and Chr 10 showed synteny, QTLs for seed protein content present only on Chr 20. Using comparative analysis of gene contents in recently duplicated genomic regions harboring QTL for protein/oil content on Chrs 20 and 10, a total of 27 genes are present in duplicated regions of both chromosomes. Notably, 4 tandem duplicates of the putative homeobox protein 22 (HB22 are present only on Chr 20 and this Medicago truncatula homolog expressed in endosperm at seed filling stage. These tandem duplicates could contribute on the protein/oil QTL of Chr 20. Our study suggests that non-shared gene contents within the duplicated genomic regions might lead to absence/presence of QTL related to protein/oil content.

Synthetic cold-inducible promoter enhances recombinant protein accumulation during Agrobacterium-mediated transient expression in Nicotiana excelsior at chilling temperatures.

Science.gov (United States)

Gerasymenko, I M; Sheludko, Y V

2017-07-01

To exploit cold-inducible biochemical processes beneficial for foreign mRNA transcription, translation and storage, as well as protein product stability, during Agrobacterium-mediated transient expression. The efficiency of three different 5'-regulatory sequences to achieve transient expression of the GFP-based reporter gene under chilling conditions (6-8 °C since the 3rd day post inoculation) was compared. We studied the upstream sequences of a cold-inducible Arabidopsis thaliana cor15a gene, the core element of 35S CaMV promoter fused to the TMV omega 5'-UTR, and the synthetic promoter including the 35S core sequence and two binding sites for cold-inducible CBF transcription factors (P_DRE::35S). Cultivation of plants transiently expressing reporter gene under control of the synthetic P_DRE::35S promoter under chilling conditions since the 3rd dpi led to the reliably higher reporter accumulation as compared to the other tested regulatory sequences under chilling or greenhouse conditions. Reporter protein fluorescence under chilling conditions using P_DRE::35S reached 160% as compared to the transient expression in the greenhouse. Period of transient expression considerably extended if plants were cultivated at chilling temperature since the 3rd dpi: reporter protein fluorescence reached its maximum at the 20th dpi and was detected in leaves up to the 65th dpi. The enhanced protein accumulation at low temperature was accompanied by the prolonged period of corresponding mRNA accumulation. Transient expression under chilling conditions using synthetic cold-inducible promoter enhances target protein accumulation and may decrease greenhouse heating expenses.

Specific variants in the MLH1 gene region may drive DNA methylation, loss of protein expression, and MSI-H colorectal cancer.

Directory of Open Access Journals (Sweden)

Miralem Mrkonjic

Full Text Available We previously identified an association between a mismatch repair gene, MLH1, promoter SNP (rs1800734 and microsatellite unstable (MSI-H colorectal cancers (CRCs in two samples. The current study expanded on this finding as we explored the genetic basis of DNA methylation in this region of chromosome 3. We hypothesized that specific polymorphisms in the MLH1 gene region predispose it to DNA methylation, resulting in the loss of MLH1 gene expression, mismatch-repair function, and consequently to genome-wide microsatellite instability.We first tested our hypothesis in one sample from Ontario (901 cases, 1,097 controls and replicated major findings in two additional samples from Newfoundland and Labrador (479 cases, 336 controls and from Seattle (591 cases, 629 controls. Logistic regression was used to test for association between SNPs in the region of MLH1 and CRC, MSI-H CRC, MLH1 gene expression in CRC, and DNA methylation in CRC. The association between rs1800734 and MSI-H CRCs, previously reported in Ontario and Newfoundland, was replicated in the Seattle sample. Two additional SNPs, in strong linkage disequilibrium with rs1800734, showed strong associations with MLH1 promoter methylation, loss of MLH1 protein, and MSI-H CRC in all three samples. The logistic regression model of MSI-H CRC that included MLH1-promoter-methylation status and MLH1 immunohistochemistry status fit most parsimoniously in all three samples combined. When rs1800734 was added to this model, its effect was not statistically significant (P-value  = 0.72 vs. 2.3×10(-4 when the SNP was examined alone.The observed association of rs1800734 with MSI-H CRC occurs through its effect on the MLH1 promoter methylation, MLH1 IHC deficiency, or both.

RNA-binding proteins ZFP36L1 and ZFP36L2 promote cell quiescence.

Science.gov (United States)

Galloway, Alison; Saveliev, Alexander; Łukasiak, Sebastian; Hodson, Daniel J; Bolland, Daniel; Balmanno, Kathryn; Ahlfors, Helena; Monzón-Casanova, Elisa; Mannurita, Sara Ciullini; Bell, Lewis S; Andrews, Simon; Díaz-Muñoz, Manuel D; Cook, Simon J; Corcoran, Anne; Turner, Martin

2016-04-22

Progression through the stages of lymphocyte development requires coordination of the cell cycle. Such coordination ensures genomic integrity while cells somatically rearrange their antigen receptor genes [in a process called variable-diversity-joining (VDJ) recombination] and, upon successful rearrangement, expands the pools of progenitor lymphocytes. Here we show that in developing B lymphocytes, the RNA-binding proteins (RBPs) ZFP36L1 and ZFP36L2 are critical for maintaining quiescence before precursor B cell receptor (pre-BCR) expression and for reestablishing quiescence after pre-BCR-induced expansion. These RBPs suppress an evolutionarily conserved posttranscriptional regulon consisting of messenger RNAs whose protein products cooperatively promote transition into the S phase of the cell cycle. This mechanism promotes VDJ recombination and effective selection of cells expressing immunoglobulin-μ at the pre-BCR checkpoint. Copyright © 2016, American Association for the Advancement of Science.

Fine-tuning of protein domain boundary by minimizing potential coiled coil regions

International Nuclear Information System (INIS)

Iwaya, Naoko; Goda, Natsuko; Unzai, Satoru; Fujiwara, Kenichiro; Tanaka, Toshiki; Tomii, Kentaro; Tochio, Hidehito; Shirakawa, Masahiro; Hiroaki, Hidekazu

2007-01-01

Structural determination of individual protein domains isolated from multidomain proteins is a common approach in the post-genomic era. Novel and thus uncharacterized domains liberated from intact proteins often self-associate due to incorrectly defined domain boundaries. Self-association results in missing signals, poor signal dispersion and a low signal-to-noise ratio in 1 H- 15 N HSQC spectra. We have found that a putative, non-canonical coiled coil region close to a domain boundary can cause transient hydrophobic self-association and monomer-dimer equilibrium in solution. Here we propose a rational method to predict putative coiled coil regions adjacent to the globular core domain using the program COILS. Except for the amino acid sequence, no preexisting knowledge concerning the domain is required. A small number of mutant proteins with a minimized coiled coil region have been rationally designed and tested. The engineered domains exhibit decreased self-association as assessed by 1 H- 15 N HSQC spectra with improved peak dispersion and sharper cross peaks. Two successful examples of isolating novel N-terminal domains from AAA-ATPases are demonstrated. Our method is useful for the experimental determination of domain boundaries suited for structural genomics studies

Fine-tuning of protein domain boundary by minimizing potential coiled coil regions.

Science.gov (United States)

Iwaya, Naoko; Goda, Natsuko; Unzai, Satoru; Fujiwara, Kenichiro; Tanaka, Toshiki; Tomii, Kentaro; Tochio, Hidehito; Shirakawa, Masahiro; Hiroaki, Hidekazu

2007-01-01

Structural determination of individual protein domains isolated from multidomain proteins is a common approach in the post-genomic era. Novel and thus uncharacterized domains liberated from intact proteins often self-associate due to incorrectly defined domain boundaries. Self-association results in missing signals, poor signal dispersion and a low signal-to-noise ratio in (1)H-(15)N HSQC spectra. We have found that a putative, non-canonical coiled coil region close to a domain boundary can cause transient hydrophobic self-association and monomer-dimer equilibrium in solution. Here we propose a rational method to predict putative coiled coil regions adjacent to the globular core domain using the program COILS. Except for the amino acid sequence, no preexisting knowledge concerning the domain is required. A small number of mutant proteins with a minimized coiled coil region have been rationally designed and tested. The engineered domains exhibit decreased self-association as assessed by (1)H-(15)N HSQC spectra with improved peak dispersion and sharper cross peaks. Two successful examples of isolating novel N-terminal domains from AAA-ATPases are demonstrated. Our method is useful for the experimental determination of domain boundaries suited for structural genomics studies.

An Aphid Effector Targets Trafficking Protein VPS52 in a Host-Specific Manner to Promote Virulence1[OPEN

Science.gov (United States)

2017-01-01

Plant- and animal-feeding insects secrete saliva inside their hosts, containing effectors, which may promote nutrient release and suppress immunity. Although for plant pathogenic microbes it is well established that effectors target host proteins to modulate host cell processes and promote disease, the host cell targets of herbivorous insects remain elusive. Here, we show that the existing plant pathogenic microbe effector paradigm can be extended to herbivorous insects in that effector-target interactions inside host cells modify critical host processes to promote plant susceptibility. We showed that the effector Mp1 from Myzus persicae associates with the host Vacuolar Protein Sorting Associated Protein52 (VPS52). Using natural variants, we provide a strong link between effector virulence activity and association with VPS52, and show that the association is highly specific to M. persicae-host interactions. Also, coexpression of Mp1, but not Mp1-like variants, specifically with host VPS52s resulted in effector relocalization to vesicle-like structures that associate with prevacuolar compartments. We show that high VPS52 levels negatively impact virulence, and that aphids are able to reduce VPS52 levels during infestation, indicating that VPS52 is an important virulence target. Our work is an important step forward in understanding, at the molecular level, how a major agricultural pest promotes susceptibility during infestation of crop plants. We give evidence that an herbivorous insect employs effectors that interact with host proteins as part of an effective virulence strategy, and that these effectors likely function in a species-specific manner. PMID:28100451

An Alphavirus E2 Membrane-Proximal Domain Promotes Envelope Protein Lateral Interactions and Virus Budding

Directory of Open Access Journals (Sweden)

Emily A. Byrd

2017-11-01

Full Text Available Alphaviruses are members of a group of small enveloped RNA viruses that includes important human pathogens such as Chikungunya virus and the equine encephalitis viruses. The virus membrane is covered by a lattice composed of 80 spikes, each a trimer of heterodimers of the E2 and E1 transmembrane proteins. During virus endocytic entry, the E1 glycoprotein mediates the low-pH-dependent fusion of the virus membrane with the endosome membrane, thus initiating virus infection. While much is known about E1 structural rearrangements during membrane fusion, it is unclear how the E1/E2 dimer dissociates, a step required for the fusion reaction. A recent Alphavirus cryo-electron microscopy reconstruction revealed a previously unidentified D subdomain in the E2 ectodomain, close to the virus membrane. A loop within this region, here referred to as the D-loop, contains two highly conserved histidines, H348 and H352, which were hypothesized to play a role in dimer dissociation. We generated Semliki Forest virus mutants containing the single and double alanine substitutions H348A, H352A, and H348/352A. The three D-loop mutations caused a reduction in virus growth ranging from 1.6 to 2 log but did not significantly affect structural protein biosynthesis or transport, dimer stability, virus fusion, or specific infectivity. Instead, growth reduction was due to inhibition of a late stage of virus assembly at the plasma membrane. The virus particles that are produced show reduced thermostability compared to the wild type. We propose the E2 D-loop as a key region in establishing the E1-E2 contacts that drive glycoprotein lattice formation and promote Alphavirus budding from the plasma membrane.

High CpG island methylation ofp16 gene and loss of p16 protein ...

Indian Academy of Sciences (India)

Navya

employed to detect CpG island methylation in p16 promoter region and ... of Fallot;p16 gene;p16 protein;CpG islands;Methylation;Promoter regions ..... Our findings that p16 has a role in heart development is ... Asian Pac J Cancer Prev 15, 75-84. .... phenotype in colorectal cancer using a large population-based sample.

Electrostatics and N-glycan-mediated membrane tethering of SCUBE1 is critical for promoting bone morphogenetic protein signalling.

Science.gov (United States)

Liao, Wei-Ju; Tsao, Ku-Chi; Yang, Ruey-Bing

2016-03-01

SCUBE1 (S1), a secreted and membrane-bound glycoprotein, has a modular protein structure composed of an N-terminal signal peptide sequence followed by nine epidermal growth factor (EGF)-like repeats, a spacer region and three cysteine-rich (CR) motifs with multiple potential N-linked glycosylation sites, and one CUB domain at the C-terminus. Soluble S1 is a biomarker of platelet activation but an active participant of thrombosis via its adhesive EGF-like repeats, whereas its membrane-associated form acts as a bone morphogenetic protein (BMP) co-receptor in promoting BMP signal activity. However, the mechanism responsible for the membrane tethering and the biological importance of N-glycosylation of S1 remain largely unknown. In the present study, molecular mapping analysis identified a polycationic segment (amino acids 501-550) in the spacer region required for its membrane tethering via electrostatic interactions possibly with the anionic heparan sulfate proteoglycans. Furthermore, deglycosylation by peptide N-glycosidase F treatment revealed that N-glycans within the CR motif are essential for membrane recruitment through lectin-mediated surface retention. Injection of mRNA encoding zebrafish wild-type but not N-glycan-deficient scube1 restores the expression of haematopoietic and erythroid markers (scl and gata1) in scube1-knockdown embryos. We describe novel mechanisms in targeting S1 to the plasma membrane and demonstrate that N-glycans are required for S1 functions during primitive haematopoiesis in zebrafish. © 2016 Authors; published by Portland Press Limited.

RADX interacts with single-stranded DNA to promote replication fork stability

DEFF Research Database (Denmark)

Schubert, Lisa; Ho, Teresa; Hoffmann, Saskia

2017-01-01

Single-stranded DNA (ssDNA) regions form as an intermediate in many DNA-associated transactions. Multiple cellular proteins interact with ssDNA via the oligonucleotide/oligosaccharide-binding (OB) fold domain. The heterotrimeric, multi-OB fold domain-containing Replication Protein A (RPA) complex...... ssDNA-binding activities is critical for avoiding these defects. Our findings establish RADX as an important component of cellular pathways that promote DNA replication integrity under basal and stressful conditions by means of multiple ssDNA-binding proteins....

Unique nonstructural proteins of Pneumonia Virus of Mice (PVM) promote degradation of interferon (IFN) pathway components and IFN-stimulated gene proteins.

Science.gov (United States)

Dhar, Jayeeta; Barik, Sailen

2016-12-01

Pneumonia Virus of Mice (PVM) is the only virus that shares the Pneumovirus genus of the Paramyxoviridae family with Respiratory Syncytial Virus (RSV). A deadly mouse pathogen, PVM has the potential to serve as a robust animal model of RSV infection, since human RSV does not fully replicate the human pathology in mice. Like RSV, PVM also encodes two nonstructural proteins that have been implicated to suppress the IFN pathway, but surprisingly, they exhibit no sequence similarity with their RSV equivalents. The molecular mechanism of PVM NS function, therefore, remains unknown. Here, we show that recombinant PVM NS proteins degrade the mouse counterparts of the IFN pathway components. Proteasomal degradation appears to be mediated by ubiquitination promoted by PVM NS proteins. Interestingly, NS proteins of PVM lowered the levels of several ISG (IFN-stimulated gene) proteins as well. These results provide a molecular foundation for the mechanisms by which PVM efficiently subverts the IFN response of the murine cell. They also reveal that in spite of their high sequence dissimilarity, the two pneumoviral NS proteins are functionally and mechanistically similar.

A liver stress-endocrine nexus promotes metabolic integrity during dietary protein dilution

DEFF Research Database (Denmark)

Maida, Adriano; Zota, Annika; Sjøberg, Kim Anker

2016-01-01

of impaired glucose homeostasis independently of obesity and food intake. DPD-mediated metabolic inefficiency and improvement of glucose homeostasis were independent of uncoupling protein 1 (UCP1), but required expression of liver-derived fibroblast growth factor 21 (FGF21) in both lean and obese mice. FGF21...... expression and secretion as well as the associated metabolic remodeling induced by DPD also required induction of liver-integrated stress response-driven nuclear protein 1 (NUPR1). Insufficiency of select nonessential amino acids (NEAAs) was necessary and adequate for NUPR1 and subsequent FGF21 induction...... and secretion in hepatocytes in vitro and in vivo. Taken together, these data indicate that DPD promotes improved glucose homeostasis through an NEAA insufficiency-induced liver NUPR1/FGF21 axis....

Mechanism of protein splicing of the Pyrococcus abyssi lon protease intein

International Nuclear Information System (INIS)

O'Brien, Kevin M.; Schufreider, Ann K.; McGill, Melissa A.; O'Brien, Kathryn M.; Reitter, Julie N.; Mills, Kenneth V.

2010-01-01

Research highlights: → The Pyrococcus abyssi lon protease intein promotes efficient protein splicing. → Inteins with mutations that interfere with individual steps of splicing do not promote unproductive side reactions. → The intein splices with Lys in place of the highly conserved penultimate His. → The intein is flanked by a Gly-rich region at its C terminus that may increase the efficiency of the third step of splicing, Asn cyclization coupled to peptide bond cleavage. -- Abstract: Protein splicing is a post-translational process by which an intervening polypeptide, the intein, excises itself from the flanking polypeptides, the exteins, coupled to ligation of the exteins. The lon protease of Pyrococcus abyssi (Pab) is interrupted by an intein. When over-expressed as a fusion protein in Escherichia coli, the Pab lon protease intein can promote efficient protein splicing. Mutations that block individual steps of splicing generally do not lead to unproductive side reactions, suggesting that the intein tightly coordinates the splicing process. The intein can splice, although it has Lys in place of the highly conserved penultimate His, and mutants of the intein in the C-terminal region lead to the accumulation of stable branched-ester intermediate.

Regulation of calretinin in malignant mesothelioma is mediated by septin 7 binding to the CALB2 promoter.

Science.gov (United States)

Blum, Walter; Pecze, László; Rodriguez, Janine Wörthmüller; Steinauer, Martine; Schwaller, Beat

2018-04-27

The calcium-binding protein calretinin (gene name: CALB2) is currently considered as the most sensitive and specific marker for the diagnosis of malignant mesothelioma (MM). MM is a very aggressive tumor strongly linked to asbestos exposure and with no existing cure so far. The mechanisms of calretinin regulation, as well as its distinct function in MM are still poorly understood. We searched for transcription factors binding to the CALB2 promoter and modulating calretinin expression. For this, DNA-binding assays followed by peptide shotgun-mass spectroscopy analyses were used. CALB2 promoter activity was assessed by dual-luciferase reporter assays. Furthermore, we analyzed the effects of CALB2 promoter-binding proteins by lentiviral-mediated overexpression or down-regulation of identified proteins in MM cells. The modulation of expression of such proteins by butyrate was determined by subsequent Western blot analysis. Immunohistochemical analysis of embryonic mouse lung tissue served to verify the simultaneous co-expression of calretinin and proteins interacting with the CALB2 promoter during early development. Finally, direct interactions of calretinin with target proteins were evidenced by co-immunoprecipitation experiments. Septin 7 was identified as a butyrate-dependent transcription factor binding to a CALB2 promoter region containing butyrate-responsive elements (BRE) resulting in decreased calretinin expression. Accordingly, septin 7 overexpression decreased calretinin expression levels in MM cells. The regulation was found to operate bi-directionally, i.e. calretinin overexpression also decreased septin 7 levels. During murine embryonic development calretinin and septin 7 were found to be co-expressed in embryonic mesenchyme and undifferentiated mesothelial cells. In MM cells, calretinin and septin 7 colocalized during cytokinesis in distinct regions of the cleavage furrow and in the midbody region of mitotic cells. Co-immunoprecipitation experiments

Disease-associated mutations disrupt functionally important regions of intrinsic protein disorder.

Directory of Open Access Journals (Sweden)

Vladimir Vacic

Full Text Available The effects of disease mutations on protein structure and function have been extensively investigated, and many predictors of the functional impact of single amino acid substitutions are publicly available. The majority of these predictors are based on protein structure and evolutionary conservation, following the assumption that disease mutations predominantly affect folded and conserved protein regions. However, the prevalence of the intrinsically disordered proteins (IDPs and regions (IDRs in the human proteome together with their lack of fixed structure and low sequence conservation raise a question about the impact of disease mutations in IDRs. Here, we investigate annotated missense disease mutations and show that 21.7% of them are located within such intrinsically disordered regions. We further demonstrate that 20% of disease mutations in IDRs cause local disorder-to-order transitions, which represents a 1.7-2.7 fold increase compared to annotated polymorphisms and neutral evolutionary substitutions, respectively. Secondary structure predictions show elevated rates of transition from helices and strands into loops and vice versa in the disease mutations dataset. Disease disorder-to-order mutations also influence predicted molecular recognition features (MoRFs more often than the control mutations. The repertoire of disorder-to-order transition mutations is limited, with five most frequent mutations (R→W, R→C, E→K, R→H, R→Q collectively accounting for 44% of all deleterious disorder-to-order transitions. As a proof of concept, we performed accelerated molecular dynamics simulations on a deleterious disorder-to-order transition mutation of tumor protein p63 and, in agreement with our predictions, observed an increased α-helical propensity of the region harboring the mutation. Our findings highlight the importance of mutations in IDRs and refine the traditional structure-centric view of disease mutations. The results of this study

CAGE-defined promoter regions of the genes implicated in Rett Syndrome

DEFF Research Database (Denmark)

Vitezic, Morana; Bertin, Nicolas; Andersson, Robin

2014-01-01

BACKGROUND: Mutations in three functionally diverse genes cause Rett Syndrome. Although the functions of Forkhead box G1 (FOXG1), Methyl CpG binding protein 2 (MECP2) and Cyclin-dependent kinase-like 5 (CDKL5) have been studied individually, not much is known about their relation to each other...... reveal the predominantly used transcription start sites (TSSs) for each gene including novel transcription start sites for FOXG1. We show that FOXG1 expression is poorly correlated with the expression of MECP2 and CDKL5. We identify promoter shapes for each TSS, the predicted location of enhancers...

Fanconi anemia core complex gene promoters harbor conserved transcription regulatory elements.

Science.gov (United States)

Meier, Daniel; Schindler, Detlev

2011-01-01

The Fanconi anemia (FA) gene family is a recent addition to the complex network of proteins that respond to and repair certain types of DNA damage in the human genome. Since little is known about the regulation of this novel group of genes at the DNA level, we characterized the promoters of the eight genes (FANCA, B, C, E, F, G, L and M) that compose the FA core complex. The promoters of these genes show the characteristic attributes of housekeeping genes, such as a high GC content and CpG islands, a lack of TATA boxes and a low conservation. The promoters functioned in a monodirectional way and were, in their most active regions, comparable in strength to the SV40 promoter in our reporter plasmids. They were also marked by a distinctive transcriptional start site (TSS). In the 5' region of each promoter, we identified a region that was able to negatively regulate the promoter activity in HeLa and HEK 293 cells in isolation. The central and 3' regions of the promoter sequences harbor binding sites for several common and rare transcription factors, including STAT, SMAD, E2F, AP1 and YY1, which indicates that there may be cross-connections to several established regulatory pathways. Electrophoretic mobility shift assays and siRNA experiments confirmed the shared regulatory responses between the prominent members of the TGF-β and JAK/STAT pathways and members of the FA core complex. Although the promoters are not well conserved, they share region and sequence specific regulatory motifs and transcription factor binding sites (TBFs), and we identified a bi-partite nature to these promoters. These results support a hypothesis based on the co-evolution of the FA core complex genes that was expanded to include their promoters.

Fanconi anemia core complex gene promoters harbor conserved transcription regulatory elements.

Directory of Open Access Journals (Sweden)

Daniel Meier

Full Text Available The Fanconi anemia (FA gene family is a recent addition to the complex network of proteins that respond to and repair certain types of DNA damage in the human genome. Since little is known about the regulation of this novel group of genes at the DNA level, we characterized the promoters of the eight genes (FANCA, B, C, E, F, G, L and M that compose the FA core complex. The promoters of these genes show the characteristic attributes of housekeeping genes, such as a high GC content and CpG islands, a lack of TATA boxes and a low conservation. The promoters functioned in a monodirectional way and were, in their most active regions, comparable in strength to the SV40 promoter in our reporter plasmids. They were also marked by a distinctive transcriptional start site (TSS. In the 5' region of each promoter, we identified a region that was able to negatively regulate the promoter activity in HeLa and HEK 293 cells in isolation. The central and 3' regions of the promoter sequences harbor binding sites for several common and rare transcription factors, including STAT, SMAD, E2F, AP1 and YY1, which indicates that there may be cross-connections to several established regulatory pathways. Electrophoretic mobility shift assays and siRNA experiments confirmed the shared regulatory responses between the prominent members of the TGF-β and JAK/STAT pathways and members of the FA core complex. Although the promoters are not well conserved, they share region and sequence specific regulatory motifs and transcription factor binding sites (TBFs, and we identified a bi-partite nature to these promoters. These results support a hypothesis based on the co-evolution of the FA core complex genes that was expanded to include their promoters.

Association of a Human FABP1 Gene Promoter Region Polymorphism with Altered Serum Triglyceride Levels.

Directory of Open Access Journals (Sweden)

Xian-E Peng

Full Text Available Liver fatty acid-binding protein (L-FABP, also known as fatty acid-binding protein 1 (FABP1, is a key regulator of hepatic lipid metabolism. Elevated FABP1 levels are associated with an increased risk of cardiovascular disease (CVD and metabolic syndromes. In this study, we examine the association of FABP1 gene promoter variants with serum FABP1 and lipid levels in a Chinese population. Four promoter single-nucleotide polymorphisms (SNPs of FABP1 gene were genotyped in a cross-sectional survey of healthy volunteers (n = 1,182 from Fuzhou city of China. Results showed that only the rs2919872 G>A variant was significantly associated with serum TG concentration(P = 0.032.Compared with the rs2919872 G allele, rs2919872 A allele contributed significantly to reduced serum TG concentration, and this allele dramatically decreased the FABP1 promoter activity(P < 0.05. The rs2919872 A allele carriers had considerably lower serum FABP1 levels than G allele carriers (P < 0.01. In the multivariable linear regression analysis, the rs2919872 A allele was negatively associated with serum FABP1 levels (β = -0.320, P = 0.003, while serum TG levels were positively associated with serum FABP1 levels (β = 0.487, P = 0.014. Our data suggest that compared with the rs2919872 G allele, the rs2919872 A allele reduces the transcriptional activity of FABP1 promoter, and thereby may link FABP1 gene variation to TG level in humans.

GADD34 Function in Protein Trafficking Promotes Adaptation to Hyperosmotic Stress in Human Corneal Cells

Directory of Open Access Journals (Sweden)

Dawid Krokowski

2017-12-01

Full Text Available Summary: GADD34, a stress-induced regulatory subunit of the phosphatase PP1, is known to function in hyperosmotic stress through its well-known role in the integrated stress response (ISR pathway. Adaptation to hyperosmotic stress is important for the health of corneal epithelial cells exposed to changes in extracellular osmolarity, with maladaptation leading to dry eye syndrome. This adaptation includes induction of SNAT2, an endoplasmic reticulum (ER-Golgi-processed protein, which helps to reverse the stress-induced loss of cell volume and promote homeostasis through amino acid uptake. Here, we show that GADD34 promotes the processing of proteins synthesized on the ER during hyperosmotic stress independent of its action in the ISR. We show that GADD34/PP1 phosphatase activity reverses hyperosmotic-stress-induced Golgi fragmentation and is important for cis- to trans-Golgi trafficking of SNAT2, thereby promoting SNAT2 plasma membrane localization and function. These results suggest that GADD34 is a protective molecule for ocular diseases such as dry eye syndrome. : Here, Krokowski et al. show that GADD34/PP1 protects the microtubule network, prevents Golgi fragmentation, and preserves protein trafficking independent of its action in the integrated stress response (ISR. In osmoadaptation, GADD34 facilitates trans-Golgi-mediated processing of the endoplasmic reticulum (ER-synthesized amino acid transporter SNAT2, which in turn increases amino acid uptake. Keywords: SNAT2, GADD34, hyperosmotic stress, amino acid transport, Golgi fragmentation, ISR

Promoter Engineering Reveals the Importance of Heptameric Direct Repeats for DNA Binding by Streptomyces Antibiotic Regulatory Protein-Large ATP-Binding Regulator of the LuxR Family (SARP-LAL) Regulators in Streptomyces natalensis.

Science.gov (United States)

Barreales, Eva G; Vicente, Cláudia M; de Pedro, Antonio; Santos-Aberturas, Javier; Aparicio, Jesús F

2018-05-15

The biosynthesis of small-size polyene macrolides is ultimately controlled by a couple of transcriptional regulators that act in a hierarchical way. A Streptomyces antibiotic regulatory protein-large ATP-binding regulator of the LuxR family (SARP-LAL) regulator binds the promoter of a PAS-LuxR regulator-encoding gene and activates its transcription, and in turn, the gene product of the latter activates transcription from various promoters of the polyene gene cluster directly. The primary operator of PimR, the archetype of SARP-LAL regulators, contains three heptameric direct repeats separated by four-nucleotide spacers, but the regulator can also bind a secondary operator with only two direct repeats separated by a 3-nucleotide spacer, both located in the promoter region of its unique target gene, pimM A similar arrangement of operators has been identified for PimR counterparts encoded by gene clusters for different antifungal secondary metabolites, including not only polyene macrolides but peptidyl nucleosides, phoslactomycins, or cycloheximide. Here, we used promoter engineering and quantitative transcriptional analyses to determine the contributions of the different heptameric repeats to transcriptional activation and final polyene production. Optimized promoters have thus been developed. Deletion studies and electrophoretic mobility assays were used for the definition of DNA-binding boxes formed by 22-nucleotide sequences comprising two conserved heptameric direct repeats separated by four-nucleotide less conserved spacers. The cooperative binding of PimR SARP appears to be the mechanism involved in the binding of regulator monomers to operators, and at least two protein monomers are required for efficient binding. IMPORTANCE Here, we have shown that a modulation of the production of the antifungal pimaricin in Streptomyces natalensis can be accomplished via promoter engineering of the PAS-LuxR transcriptional activator pimM The expression of this gene is

Increase in Bacterial Colony Formation from a Permafrost Ice Wedge Dosed with a Tomitella biformata Recombinant Resuscitation-Promoting Factor Protein.

Science.gov (United States)

Puspita, Indun Dewi; Kitagawa, Wataru; Kamagata, Yoichi; Tanaka, Michiko; Nakatsu, Cindy H

2015-01-01

Resuscitation-promoting factor (Rpf) is a protein that has been found in a number of different Actinobacteria species and has been shown to promote the growth of active cells and resuscitate dormant (non-dividing) cells. We previously reported the biological activity of an Rpf protein in Tomitella biformata AHU 1821(T), an Actinobacteria isolated from a permafrost ice wedge. This protein is excreted outside the cell; however, few studies have investigated its contribution in environmental samples to the growth or resuscitation of bacteria other than the original host. Therefore, the aim of the present study was to determine whether Rpf from T. biformata impacted the cultivation of other bacteria from the permafrost ice wedge from which it was originally isolated. All experiments used recombinant Rpf proteins produced using a Rhodococcus erythropolis expression system. Dilutions of melted surface sterilized ice wedge samples mixed with different doses of the purified recombinant Rpf (rRpf) protein indicated that the highest concentration tested, 1250 pM, had a significantly (p permafrost sediments. The results of the present study demonstrated that rRpf not only promoted the growth of T. biformata from which it was isolated, but also enhanced colony formation by another Actinobacteria in an environmental sample.

Baculovirus display of fusion protein of Peste des petits ruminants virus and hemagglutination protein of Rinderpest virus and immunogenicity of the displayed proteins in mouse model

International Nuclear Information System (INIS)

Masmudur Rahman, Md.; Shaila, M.S.; Gopinathan, Karumathil P.

2003-01-01

Recombinant Bombyx mori nucleopolyhedroviruses (BmNPV) displaying the immunodominant ectodomains of fusion glycoprotein (F) of Peste des petitis ruminants virus (PPRV) and the hemagglutinin protein (H) of Rinderpest virus (RPV), on the budded virions as well as the surface of the infected host cells have been constructed. The F and H protein sequences were inserted in-frame within the amino-terminal region of BmNPV envelope glycoprotein GP64 expressing under the strong viral polyhedrin (polh) promoter. We improved the recombinant virus selection in BmNPV by incorporating the green fluorescent protein gene (gfp) as selection marker under a separate promoter within the transfer cassette harboring the desired genes. Following infection of the insect larvae or the host-derived BmN cells with these recombinant BmNPVs, the expressed GP64 fusion proteins were displayed on the host cell surface and the budded virions. The antigenic epitopes of the recombinant proteins were properly displayed and the recombinant virus particles induced immune response in mice against PPRV or RPV

High genetic diversity in the coat protein and 3' untranslated regions

Indian Academy of Sciences (India)

The 3′ terminal region consisting of the coat protein (CP) coding sequence and 3′ untranslated region (3′UTR) was cloned and sequenced from seven isolates. Sequence comparisons revealed considerable genetic diversity among the isolates in their CP and 3′UTR, making CdMV one of the highly variable members ...

Tumor promoter induced membrane-bound protein kinase C - its influence on hematogenous metastasis

International Nuclear Information System (INIS)

Gopalakrishna, R.; Barsky, S.H.

1987-01-01

A correlation between the amount of membrane-bound detergent-extractable protein kinase C activity in various B16 melanoma sublines (F10, F1, BL6) and their lung metastasizing abilities following intravenous injection was found. The F10 subline which exhibits higher metastasizing ability was found to have higher membrane-bound protein kinase C compared to the lower metastasizing subline, F1. Treatment of F1 cells with 100 nM 12-0 tetradecanoylphorbol-13-acetate (TPA) for 1h resulted in 90% decrease in protein kinase C activity in the cytosol with a concommitent increase in membrane-bound activity. These TPA-treated cells when injected intravenously in C57BL/6 mice produced 6-fold increase in pulmonary metastases compared to untreated F1 cells. However, biologically inactive analogues 4 α-phorbol 12,13-didecanoate and phorbol 13-acetate had no effect on either membrane-bound protein kinase C activity or pulmonary metastases. Treating F1 cells with the second-stage tumor promoter, mezerin, resulted in increase in both membrane association of protein kinase C and also lung metastases. Thus, these results strongly suggests that membrane associated protein kinase C activity influences hematogenous metastasis of these melanoma cells

Promoter Analysis Reveals Globally Differential Regulation of Human Long Non-Coding RNA and Protein-Coding Genes

KAUST Repository

Alam, Tanvir; Medvedeva, Yulia A.; Jia, Hui; Brown, James B.; Lipovich, Leonard; Bajic, Vladimir B.

2014-01-01

raise the possibility that, given the historical reliance on protein-coding gene catalogs to define the chromatin states of active promoters, a revision of these chromatin signature profiles to incorporate expressed lncRNA genes is warranted

Embryogenesis-promoting factors in rat serum.

Science.gov (United States)

Katoh, M; Kimura, R; Shoji, R

1998-06-15

Regarding whole rat embryo cultures in vitro, rat serum as a culture medium is known to support the normal growth of rat embryos in the organogenesis phase. The purpose of the present study was to isolate the embryogenesis-promoting factors from rat serum as a first step in the development of a defined serum-free medium for a whole embryo culture system. Pooled rat serum after heat inactivation was fractionated into three major peaks (frA, containing a region of void volume, frB, and frC) by gel filtration. The 9.5-day rat embryos that were cultivated for 48 hr in essential salt medium containing frB (with a molecular size range of 100-500 kDa) revealed normal growth. Three proteins (27 kDa, 76 kDa, and 190 kDa) that had the embryogenesis-promoting effects were isolated from 3-hr delayed centrifuged rat serum by the ion exchange chromatography. The 76-kDa protein was found to be rat transferrin by immunoblotting. The 27-kDa protein was identified as apo-AI (the major apoprotein of high-density lipoprotein) by immunoblotting. High-density lipoprotein obtained from pooled rat serum by a NaBr density gradient ultracentrifugation was found to have a positive effect on embryogenesis. The 10-kDa protein was also identified as alpha 1-inhibitor 3 by immunoblotting. In addition, the embryogenesis-promoting effect of the fraction containing 27-kDa and 190-kDa proteins declined within a short period of storage at -20 degrees C. This decrease was countered by supplementing its fraction (D-2) with albumin isolated from rat serum. These results in the present study suggest that transferrin, high-density lipoprotein, and alpha 1-inhibitor 3 in rat serum may be embryogenesis-promoting factors, and that albumin appeared to play a role in the embryogenesis of rat embryos in whole embryo cultures.

Cytosine deletion at AP2-box region of HSP70 promoter and its ...

Indian Academy of Sciences (India)

Cytosine deletion at AP2-box region of HSP70 promoter and its influence on semen quality traits in crossbred bulls ... Laboratory, ICAR-Central Institute for Research on Cattle, Meerut 250 001, India; School of Atmospheric Stress Management, ICAR-National Institute of Abiotic Stress Management, Baramati 413 115, India ...

“Fear or Love Thy Neighbour”? The EU Framework for Promoting Regional Cooperation in the South Caucasus

Directory of Open Access Journals (Sweden)

Nelli Babayan

2011-12-01

Full Text Available Building on the model of the enlargement policy, the European Union (EU designed the European Neighbourhood Policy and the Eastern Partnership to further promote its norms and principles. One of the goals of its new policies has been to foster regional cooperation among partner countries and their neighbours. This article specifies the EU’s framework for promoting regional cooperation through the aforementioned policies and discusses its potential impact on the example of the South Caucasus republics of Armenia, Azerbaijan, and Georgia. The South Caucasus has not only been an arena of intraregional conflicts, but has also often been troubled by disputes between its neighbours. This article argues that, due to a lack of proactive and consistent engagement, the EU’s framework risks leaving regional conflicts in the current state of stagnation and without advancement in regional cooperation.

Features of cryptic promoters and their varied reliance on bromodomain-containing factors.

Directory of Open Access Journals (Sweden)

Samantha G Pattenden

Full Text Available The Set2-Rpd3S pathway is important for the control of transcription memory. Mutation of components of this pathway results in cryptic transcription initiation within the coding region of approximately 30% of yeast genes. Specifically, deletion of the Set2 histone methyltransferase or Rco1, a component of the Rpd3S histone deacetylase complex leads to hyperacetylation of certain open reading frames (ORFs. We used this mutant as a system to study the role of histone modifications and co-activator recruitment in preinitiation complex (PIC formation. Specifically, we looked at the dependence of promoters on the bromodomain-containing RSC complex and the Bdf1 protein. We found that the dependence of cryptic promoters for these proteins varied. Overall, our data indicate that cryptic promoters are independently regulated, and their activation is dependent on factors that govern gene activation at canonical promoters.

Expression analysis of four flower-specific promoters of Brassica spp ...

African Journals Online (AJOL)

The 5'-flanking region of ca. 1200 bp upstream of the translation start site (TSS) of a putative cell wall protein gene was cloned from Brassica campestris, B. chinensis, B. napus and B. oleracea, and transferred to tobacco via Agrobacterium-mediation after fused to promoter-less beta-glucuronidase (GUS) reporter gene.

Definition of IgG- and albumin-binding regions of streptococcal protein G.

Science.gov (United States)

Akerström, B; Nielsen, E; Björck, L

1987-10-05

Protein G, the immunoglobin G-binding surface protein of group C and G streptococci, also binds serum albumin. The albumin-binding site on protein G is distinct from the immunoglobulin G-binding site. By mild acid hydrolysis of the papain-liberated protein G fragment (35 kDa), a 28-kDa fragment was produced which retained full immunoglobulin G-binding activity (determined by Scatchard plotting) but had lost all albumin-binding capacity. A protein G (65 kDa), isolated after cloning and expression of the protein G gene in Escherichia coli, had comparable affinity to immunoglobulin G (5-10 X 10(10)M-1), but much higher affinity to albumin than the 35- and 28-kDa protein G fragments (31, 2.6, and 0 X 10(9)M-1, respectively). The amino-terminal amino acid sequences of the 65-, 35-, and 28-kDa fragments allowed us to exactly locate the three fragments in an overall sequence map of protein G, based on the partial gene sequences published by Guss et al. (Guss, B., Eliasson, M., Olsson, A., Uhlen, M., Frej, A.-K., Jörnvall, H., Flock, J.-I., and Lindberg, M. (1986) EMBO J. 5, 1567-1575) and Fahnestock et al. (Fahnestock, S. R., Alexander, P., Nagle, J., and Filpula, D. (1986) J. Bacteriol. 167, 870-880). In this map could then be deduced the location of three homologous albumin-binding regions and three homologous immunoglobulin G-binding regions.

Region-specific protein misfolding cyclic amplification reproduces brain tropism of prion strains.

Science.gov (United States)

Privat, Nicolas; Levavasseur, Etienne; Yildirim, Serfildan; Hannaoui, Samia; Brandel, Jean-Philippe; Laplanche, Jean-Louis; Béringue, Vincent; Seilhean, Danielle; Haïk, Stéphane

2017-10-06

Human prion diseases such as Creutzfeldt-Jakob disease are transmissible brain proteinopathies, characterized by the accumulation of a misfolded isoform of the host cellular prion protein (PrP) in the brain. According to the prion model, prions are defined as proteinaceous infectious particles composed solely of this abnormal isoform of PrP (PrP Sc ). Even in the absence of genetic material, various prion strains can be propagated in experimental models. They can be distinguished by the pattern of disease they produce and especially by the localization of PrP Sc deposits within the brain and the spongiform lesions they induce. The mechanisms involved in this strain-specific targeting of distinct brain regions still are a fundamental, unresolved question in prion research. To address this question, we exploited a prion conversion in vitro assay, protein misfolding cyclic amplification (PMCA), by using experimental scrapie and human prion strains as seeds and specific brain regions from mice and humans as substrates. We show here that region-specific PMCA in part reproduces the specific brain targeting observed in experimental, acquired, and sporadic Creutzfeldt-Jakob diseases. Furthermore, we provide evidence that, in addition to cellular prion protein, other region- and species-specific molecular factors influence the strain-dependent prion conversion process. This important step toward understanding prion strain propagation in the human brain may impact research on the molecular factors involved in protein misfolding and the development of ultrasensitive methods for diagnosing prion disease. © 2017 by The American Society for Biochemistry and Molecular Biology, Inc.

Influence of The -202 A/C insulin-like growth factor-binding protein-3 promoter polymorphism on individual variation in height in Korean girls

Directory of Open Access Journals (Sweden)

Min Ju Yi

2017-03-01

Full Text Available PurposeThe most common single nucleotide polymorphism in the IGFBP3 promoter region occurs at position -202. This polymorphic variation occurs frequently and may influence growth hormone responsiveness and somatic growth. However, the effects of IGFBP3 promoter polymorphism on growth in children are unknown.MethodsRestriction fragment length polymorphism-based genotyping of the -202 single nucleotide polymorphism was performed in 146 Korean girls aged between 15 and 16 years, who were selected randomly from the Seoul School Health Promotion Center. The participants were divided into 3 groups (tall, medium, and short according to the height percentile established from normal reference values for Korean children. The serum levels of insulin-like growth factor I (IGF-I and IGF-binding protein-3 (IGFBP-3 were then compared according to genotype.ResultsThe genotype distribution in the participants was 79 AA (54.1%, 60 AC (41.1%, and 7 CC (4.8%. The C allele frequency at the -202 IGFBP3 position was 25.4% in this group. The mean serum IGFBP-3 concentration in girls with the AA genotype was higher than that in girls with the AC genotype in the medium (P=0.047 and short (P=0.035 groups, respectively. There was no difference in the IGF-I to IGFBP-3 molar ratio between the AA and AC genotype groups (P=0.161.ConclusionIn conclusion, the -202 polymorphism in the IGFBP3 promoter region is assumed to affect the serum concentration of IGFBP-3 in children as well as in adults. However, it is unclear whether this affects physical development according to the concentration of IGFBP-3.

Impact of Environmental Factors on Bacteriocin Promoter Activity in Gut-Derived Lactobacillus salivarius.

Science.gov (United States)

Guinane, Caitriona M; Piper, Clare; Draper, Lorraine A; O'Connor, Paula M; Hill, Colin; Ross, R Paul; Cotter, Paul D

2015-11-01

Bacteriocin production is regarded as a desirable probiotic trait that aids in colonization and persistence in the gastrointestinal tract (GIT). Strains of Lactobacillus salivarius, a species associated with the GIT, are regarded as promising probiotic candidates and have a number of associated bacteriocins documented to date. These include multiple class IIb bacteriocins (salivaricin T, salivaricin P, and ABP-118) and the class IId bacteriocin bactofencin A, which show activity against medically important pathogens. However, the production of a bacteriocin in laboratory media does not ensure production under stressful environmental conditions, such as those encountered within the GIT. To allow this issue to be addressed, the promoter regions located upstream of the structural genes encoding the L. salivarius bacteriocins mentioned above were fused to a number of reporter proteins (green fluorescent protein [GFP], red fluorescent protein [RFP], and luciferase [Lux]). Of these, only transcriptional fusions to GFP generated signals of sufficient strength to enable the study of promoter activity in L. salivarius. While analysis of the class IIb bacteriocin promoter regions indicated relatively weak GFP expression, assessment of the promoter of the antistaphylococcal bacteriocin bactofencin A revealed a strong promoter that is most active in the absence of the antimicrobial peptide and is positively induced in the presence of mild environmental stresses, including simulated gastric fluid. Taken together, these data provide information on factors that influence bacteriocin production, which will assist in the development of strategies to optimize in vivo and in vitro production of these antimicrobials. Copyright © 2015, American Society for Microbiology. All Rights Reserved.

Influence of twisted tape turbulence promoter on fouling reduction in microfiltration of milk proteins

Directory of Open Access Journals (Sweden)

Popović Svetlana S.

2011-01-01

Full Text Available Membrane filtration has become one of the major technologies in the food industry. It is widely applied in the dairy industry, and it is mostly used for the concentration and fractionation of milk proteins and for the whey processing. Of all pressure driven membrane processes, ultrafiltration is the most widely used. The major disadvantage of pressure driven membrane processes is severe fouling of membrane during filtration particularly when the fluids containing proteins are processed. Fouling with proteins is complex phenomenon because it occurs at the membrane surface as well as in the pores of membrane, and depends on the operating conditions and on the interactions of proteins and membrane material. In order to reduce fouling of the membrane different techniques have been developed, and one of them relies on the changing of the hydrodynamic conditions in the membrane or module. In this study, influence of twisted tape turbulence promoters on the fouling reduction in cross-flow microfiltration of skim milk was investigated. Twisted tapes with tree characteristic ratios of helix element length to the tape diameter (aspect ratio were studied. It was shown that twisted tapes with different aspect ratios reduce fouling of membrane by a factor of three or more. The presence of twisted tape induces changes in the flow patterns from straight to helicoidally thus producing turbulence flow at the lower cross-flow rates. Turbulence intensification prevents accumulation of proteins at membrane surface enabling reduction in reversible fouling what results in the reduction of overall membrane fouling. The best performance was achieved using a twisted tape with the lowest aspect ratio of 1.0. This promoter reduces fouling seven times at low transmembrane pressure and low cross-flow velocity. The twisted tape with aspect ratio 1.0 induces the most intensive turbulence, the longest helicoidal flow path, and appearance of vortices near the membrane surfaces

Multiple 5' ends of human cytomegalovirus UL57 transcripts identify a complex, cycloheximide-resistant promoter region that activates oriLyt

International Nuclear Information System (INIS)

Kiehl, Anita; Huang, Lili; Franchi, David; Anders, David G.

2003-01-01

The human cytomegalovirus (HCMV) UL57 gene lies adjacent to HCMV oriLyt, from which it is separated by an organizationally conserved, mostly noncoding region that is thought to both regulate UL57 expression and activate oriLyt function. However, the UL57 promoter has not been studied. We determined the 5' ends of UL57 transcripts toward an understanding of the potential relationship between UL57 expression and oriLyt activation. The results presented here identified three distinct 5' ends spread over 800 bp, at nt 90302, 90530, and 91138; use of these sites exhibited differential sensitivity to phosphonoformic acid treatment. Interestingly, a 10-kb UL57 transcript accumulated in cycloheximide-treated infected cells, even though other early transcripts were not detectable. However, the 10-kb transcript did not accumulate in cells treated with the more stringent translation inhibitor anisomycin. Consistent with the notion that the identified 5' ends arise from distinct transcription start sites, the sequences upstream of sites I and II functioned as promoters responsive to HCMV infection in transient assays. However, the origin-proximal promoter region III required downstream sequences for transcriptional activity. Mutation of candidate core promoter elements suggested that promoter III is regulated by an initiator region (Inr) and a downstream promoter element. Finally, a 42-bp sequence containing the candidate Inr activated a minimal oriLyt core construct in transient replication assays. Thus, these studies showed that a large, complex promoter region with novel features controls UL57 expression, and identified a sequence that regulates both UL57 transcription and oriLyt activation

Cloning and characterization of the promoter regions from the parent and paralogous creatine transporter genes.

Science.gov (United States)

Ndika, Joseph D T; Lusink, Vera; Beaubrun, Claudine; Kanhai, Warsha; Martinez-Munoz, Cristina; Jakobs, Cornelis; Salomons, Gajja S

2014-01-10

Interconversion between phosphocreatine and creatine, catalyzed by creatine kinase is crucial in the supply of ATP to tissues with high energy demand. Creatine's importance has been established by its use as an ergogenic aid in sport, as well as the development of intellectual disability in patients with congenital creatine deficiency. Creatine biosynthesis is complemented by dietary creatine uptake. Intracellular transport of creatine is carried out by a creatine transporter protein (CT1/CRT/CRTR) encoded by the SLC6A8 gene. Most tissues express this gene, with highest levels detected in skeletal muscle and kidney. There are lower levels of the gene detected in colon, brain, heart, testis and prostate. The mechanism(s) by which this regulation occurs is still poorly understood. A duplicated unprocessed pseudogene of SLC6A8-SLC6A10P has been mapped to chromosome 16p11.2 (contains the entire SLC6A8 gene, plus 2293 bp of 5'flanking sequence and its entire 3'UTR). Expression of SLC6A10P has so far only been shown in human testis and brain. It is still unclear as to what is the function of SLC6A10P. In a patient with autism, a chromosomal breakpoint that intersects the 5'flanking region of SLC6A10P was identified; suggesting that SLC6A10P is a non-coding RNA involved in autism. Our aim was to investigate the presence of cis-acting factor(s) that regulate expression of the creatine transporter, as well as to determine if these factors are functionally conserved upstream of the creatine transporter pseudogene. Via gene-specific PCR, cloning and functional luciferase assays we identified a 1104 bp sequence proximal to the mRNA start site of the SLC6A8 gene with promoter activity in five cell types. The corresponding 5'flanking sequence (1050 bp) on the pseudogene also had promoter activity in all 5 cell lines. Surprisingly the pseudogene promoter was stronger than that of its parent gene in 4 of the cell lines tested. To the best of our knowledge, this is the first

AML1/ETO trans-activates c-KIT expression through the long range interaction between promoter and intronic enhancer.

Science.gov (United States)

Tian, Ying; Wang, Genjie; Hu, Qingzhu; Xiao, Xichun; Chen, Shuxia

2018-04-01

The AML1/ETO onco-fusion protein is crucial for the genesis of t(8;21) acute myeloid leukemia (AML) and is well documented as a transcriptional repressor through dominant-negative effect. However, little is known about the transactivation mechanism of AML1/ETO. Through large cohort of patient's expression level data analysis and a series of experimental validation, we report here that AML1/ETO transactivates c-KIT expression through directly binding to and mediating the long-range interaction between the promoter and intronic enhancer regions of c-KIT. Gene expression analyses verify that c-KIT expression is significantly high in t(8;21) AML. Further ChIP-seq analysis and motif scanning identify two regulatory regions located in the promoter and intronic enhancer region of c-KIT, respectively. Both regions are enriched by co-factors of AML1/ETO, such as AML1, CEBPe, c-Jun, and c-Fos. Further luciferase reporter assays show that AML1/ETO trans-activates c-KIT promoter activity through directly recognizing the AML1 motif and the co-existence of co-factors. The induction of c-KIT promoter activity is reinforced with the existence of intronic enhancer region. Furthermore, ChIP-3C-qPCR assays verify that AML1/ETO mediates the formation of DNA-looping between the c-KIT promoter and intronic enhancer region through the long-range interaction. Collectively, our data uncover a novel transcriptional activity mechanism of AML1/ETO and enrich our knowledge of the onco-fusion protein mediated transcription regulation. © 2017 Wiley Periodicals, Inc.

The Disordered C-Terminus of Yeast Hsf1 Contains a Cryptic Low-Complexity Amyloidogenic Region

Directory of Open Access Journals (Sweden)

Jordi Pujols

2018-05-01

Full Text Available Response mechanisms to external stress rely on networks of proteins able to activate specific signaling pathways to ensure the maintenance of cell proteostasis. Many of the proteins mediating this kind of response contain intrinsically disordered regions, which lack a defined structure, but still are able to interact with a wide range of clients that modulate the protein function. Some of these interactions are mediated by specific short sequences embedded in the longer disordered regions. Because the physicochemical properties that promote functional and abnormal interactions are similar, it has been shown that, in globular proteins, aggregation-prone and binding regions tend to overlap. It could be that the same principle applies for disordered protein regions. In this context, we show here that a predicted low-complexity interacting region in the disordered C-terminus of the stress response master regulator heat shock factor 1 (Hsf1 protein corresponds to a cryptic amyloid region able to self-assemble into fibrillary structures resembling those found in neurodegenerative disorders.

The Disordered C-Terminus of Yeast Hsf1 Contains a Cryptic Low-Complexity Amyloidogenic Region.

Science.gov (United States)

Pujols, Jordi; Santos, Jaime; Pallarès, Irantzu; Ventura, Salvador

2018-05-06

Response mechanisms to external stress rely on networks of proteins able to activate specific signaling pathways to ensure the maintenance of cell proteostasis. Many of the proteins mediating this kind of response contain intrinsically disordered regions, which lack a defined structure, but still are able to interact with a wide range of clients that modulate the protein function. Some of these interactions are mediated by specific short sequences embedded in the longer disordered regions. Because the physicochemical properties that promote functional and abnormal interactions are similar, it has been shown that, in globular proteins, aggregation-prone and binding regions tend to overlap. It could be that the same principle applies for disordered protein regions. In this context, we show here that a predicted low-complexity interacting region in the disordered C-terminus of the stress response master regulator heat shock factor 1 (Hsf1) protein corresponds to a cryptic amyloid region able to self-assemble into fibrillary structures resembling those found in neurodegenerative disorders.

DOF-binding sites additively contribute to guard cell-specificity of AtMYB60 promoter

Directory of Open Access Journals (Sweden)

Cominelli Eleonora

2011-11-01

Full Text Available Abstract Background We previously demonstrated that the Arabidopsis thaliana AtMYB60 protein is an R2R3MYB transcription factor required for stomatal opening. AtMYB60 is specifically expressed in guard cells and down-regulated at the transcriptional levels by the phytohormone ABA. Results To investigate the molecular mechanisms governing AtMYB60 expression, its promoter was dissected through deletion and mutagenesis analyses. By studying different versions of AtMYB60 promoter::GUS reporter fusions in transgenic plants we were able to demonstrate a modular organization for the AtMYB60 promoter. Particularly we defined: a minimal promoter sufficient to confer guard cell-specific activity to the reporter gene; the distinct roles of different DOF-binding sites organised in a cluster in the minimal promoter in determining guard cell-specific expression; the promoter regions responsible for the enhancement of activity in guard cells; a promoter region responsible for the negative transcriptional regulation by ABA. Moreover from the analysis of single and multiple mutants we could rule out the involvement of a group of DOF proteins, known as CDFs, already characterised for their involvement in flowering time, in the regulation of AtMYB60 expression. Conclusions These findings shed light on the regulation of gene expression in guard cells and provide new promoter modules as useful tools for manipulating gene expression in guard cells, both for physiological studies and future biotechnological applications.

Genetic variants in promoters and coding regions of the muscle glycogen synthase and the insulin-responsive GLUT4 genes in NIDDM

DEFF Research Database (Denmark)

Bjørbaek, C; Echwald, Søren Morgenthaler; Hubricht, P

1994-01-01

To examine the hypothesis that variants in the regulatory or coding regions of the glycogen synthase (GS) and insulin-responsive glucose transporter (GLUT4) genes contribute to insulin-resistant glucose processing of muscle from non-insulin-dependent diabetes mellitus (NIDDM) patients, promoter...... volunteers. By applying inverse polymerase chain reaction and direct DNA sequencing, 532 base pairs (bp) of the GS promoter were identified and the transcriptional start site determined by primer extension. SSCP scanning of the promoter region detected five single nucleotide substitutions, positioned at 42......'-untranslated region, and the coding region of the GLUT4 gene showed four polymorphisms, all single nucleotide substitutions, positioned at -581, 1, 30, and 582. None of the three changes in the regulatory region of the gene had any major influence on expression of the GLUT4 gene in muscle. The variant at 582...

Transcriptional analysis of the jamaicamide gene cluster from the marine cyanobacterium Lyngbya majuscula and identification of possible regulatory proteins

Directory of Open Access Journals (Sweden)

Dorrestein Pieter C

2009-12-01

Full Text Available Abstract Background The marine cyanobacterium Lyngbya majuscula is a prolific producer of bioactive secondary metabolites. Although biosynthetic gene clusters encoding several of these compounds have been identified, little is known about how these clusters of genes are transcribed or regulated, and techniques targeting genetic manipulation in Lyngbya strains have not yet been developed. We conducted transcriptional analyses of the jamaicamide gene cluster from a Jamaican strain of Lyngbya majuscula, and isolated proteins that could be involved in jamaicamide regulation. Results An unusually long untranslated leader region of approximately 840 bp is located between the jamaicamide transcription start site (TSS and gene cluster start codon. All of the intergenic regions between the pathway ORFs were transcribed into RNA in RT-PCR experiments; however, a promoter prediction program indicated the possible presence of promoters in multiple intergenic regions. Because the functionality of these promoters could not be verified in vivo, we used a reporter gene assay in E. coli to show that several of these intergenic regions, as well as the primary promoter preceding the TSS, are capable of driving β-galactosidase production. A protein pulldown assay was also used to isolate proteins that may regulate the jamaicamide pathway. Pulldown experiments using the intergenic region upstream of jamA as a DNA probe isolated two proteins that were identified by LC-MS/MS. By BLAST analysis, one of these had close sequence identity to a regulatory protein in another cyanobacterial species. Protein comparisons suggest a possible correlation between secondary metabolism regulation and light dependent complementary chromatic adaptation. Electromobility shift assays were used to evaluate binding of the recombinant proteins to the jamaicamide promoter region. Conclusion Insights into natural product regulation in cyanobacteria are of significant value to drug discovery

Yes-Associated Protein (YAP) Promotes the Nuclear Import of p73

International Nuclear Information System (INIS)

Zhang Heng; Wu Shengnan

2011-01-01

p73 has been identified as a structural and functional homolog of the tumor suppressor p53. However, mechanisms that regulate the localization of p73 have not been fully clarified. The Yes-associated protein (YAP) is a transcriptional coactivator. As a transcriptional coactivator, YAP needs to bind transcription factors to stimulate gene expression. p73 is a reported YAP target transcription factors and YAP has been shown to positively regulate p73 in promoting apoptosis. Previous studies show that p73 interacts with YAP through its PPPY motif, and increases p73 transactivation of apoptotic genes. In this study, we focused on YAP's regulation of the localization of p73. After transient transfection into Rat pheochromocytoma (PC12) cells and Human embryonic kidney 293T cells with GFP-YAP and/or YFP-p73, and incubated for 24 hours expression. p73 was fused to YFP to allow the examination of its subcellular localization. When expressed alone, YFP-p73 was distributed throughout the cell. When coexpressed with YAP, nuclear accumulation of YFP-p73 became evident. We quantitated the effect of YAP on the redistribution of YFP-p73 by counting cells with nuclear-only YFP signal. We found that YAP can influence the subcellular distribution of p73. Altogether, coexpression with YAP affected the subcellular distribution of the p73 protein. Our studies attribute a central role to YAP in regulating p73 accumulation and YAP, at least in part, might promote the nuclear import of p73.

c-Myc activates BRCA1 gene expression through distal promoter elements in breast cancer cells

International Nuclear Information System (INIS)

Chen, Yinghua; Xu, Jinhua; Borowicz, Stanley; Collins, Cindy; Huo, Dezheng; Olopade, Olufunmilayo I

2011-01-01

The BRCA1 gene plays an important role in the maintenance of genomic stability. BRCA1 inactivation contributes to breast cancer tumorigenesis. An increasing number of transcription factors have been shown to regulate BRCA1 expression. c-Myc can act as a transcriptional activator, regulating up to 15% of all genes in the human genome and results from a high throughput screen suggest that BRCA1 is one of its targets. In this report, we used cultured breast cancer cells to examine the mechanisms of transcriptional activation of BRCA1 by c-Myc. c-Myc was depleted using c-Myc-specific siRNAs in cultured breast cancer cells. BRCA1 mRNA expression and BRCA1 protein expression were determined by quantitative RT-PCR and western blot, respectively and BRCA1 promoter activities were examined under these conditions. DNA sequence analysis was conducted to search for high similarity to E boxes in the BRCA1 promoter region. The association of c-Myc with the BRCA1 promoter in vivo was tested by a chromatin immunoprecipitation assay. We investigated the function of the c-Myc binding site in the BRCA1 promoter region by a promoter assay with nucleotide substitutions in the putative E boxes. BRCA1-dependent DNA repair activities were measured by a GFP-reporter assay. Depletion of c-Myc was found to be correlated with reduced expression levels of BRCA1 mRNA and BRCA1 protein. Depletion of c-Myc decreased BRCA1 promoter activity, while ectopically expressed c-Myc increased BRCA1 promoter activity. In the distal BRCA1 promoter, DNA sequence analysis revealed two tandem clusters with high similarity, and each cluster contained a possible c-Myc binding site. c-Myc bound to these regions in vivo. Nucleotide substitutions in the c-Myc binding sites in these regions abrogated c-Myc-dependent promoter activation. Furthermore, breast cancer cells with reduced BRCA1 expression due to depletion of c-Myc exhibited impaired DNA repair activity. The distal BRCA1 promoter region is associated with c

Insulators form gene loops by interacting with promoters in Drosophila.

Science.gov (United States)

Erokhin, Maksim; Davydova, Anna; Kyrchanova, Olga; Parshikov, Alexander; Georgiev, Pavel; Chetverina, Darya

2011-09-01

Chromatin insulators are regulatory elements involved in the modulation of enhancer-promoter communication. The 1A2 and Wari insulators are located immediately downstream of the Drosophila yellow and white genes, respectively. Using an assay based on the yeast GAL4 activator, we have found that both insulators are able to interact with their target promoters in transgenic lines, forming gene loops. The existence of an insulator-promoter loop is confirmed by the fact that insulator proteins could be detected on the promoter only in the presence of an insulator in the transgene. The upstream promoter regions, which are required for long-distance stimulation by enhancers, are not essential for promoter-insulator interactions. Both insulators support basal activity of the yellow and white promoters in eyes. Thus, the ability of insulators to interact with promoters might play an important role in the regulation of basal gene transcription.

Translationally controlled tumor protein supplemented chitosan modified glass ionomer cement promotes osteoblast proliferation and function

Energy Technology Data Exchange (ETDEWEB)

Sangsuwan, Jiraporn [Department of Molecular Biology and Bioinformatics, Center for Genomics and Bioinformatics Research, Faculty of Science, Prince of Songkla University, Hat Yai, Songkhla 90112 (Thailand); Department of Oral Biology and Occlusion, Faculty of Dentistry, Prince of Songkla University, Hat Yai, Songkhla 90112 (Thailand); Wanichpakorn, Supreya; Kedjarune-Leggat, Ureporn [Department of Oral Biology and Occlusion, Faculty of Dentistry, Prince of Songkla University, Hat Yai, Songkhla 90112 (Thailand)

2015-09-01

The objective of this study was to evaluate the effect of translationally controlled tumor protein (TCTP) supplemented in a novel glass ionomer cement (BIO-GIC) on normal human osteoblasts (NHost cells). BIO-GIC was a glass ionomer cement (GIC) modified by adding chitosan and albumin to promote the release of TCTP. NHost cells were seeded on specimens of GIC, GIC + TCTP, BIO-GIC and BIO-GIC + TCTP. Cell proliferation was determined by BrdU assay. It was found that BIO-GIC + TCTP had significantly higher proliferation of cells than other specimens. Bone morphogenetic protein-2 (BMP-2) and osteopontin (OPN) gene expressions assessed by quantitative real time PCR and alkaline phosphatase (ALP) activity were used to determine cell differentiation. Bone cell function was investigated by calcium deposition using alizarin assay. Both BMP-2 and OPN gene expressions of cells cultured on specimens with added TCTP increased gradually up-regulation after day 1 and reached the highest on day 3 then down-regulation on day 7. The ALP activity of cells cultured on BIO-GIC + TCTP for 7 days and calcium content after 14 days were significantly higher than other groups. BIO-GIC + TCTP can promote osteoblast cells proliferation, differentiation and function. - Highlights: • Developed a new GIC by supplementing TCTP in BIO-GIC (GIC with chitosan and albumin) • BIO-GIC + TCTP released a higher amount of TCTP than GIC + TCTP. • BIO-GIC + TCTP promoted cell proliferation higher than other specimens and control. • BIO-GIC + TCTP promoted osteoblasts differentiation and function.

Translationally controlled tumor protein supplemented chitosan modified glass ionomer cement promotes osteoblast proliferation and function

International Nuclear Information System (INIS)

Sangsuwan, Jiraporn; Wanichpakorn, Supreya; Kedjarune-Leggat, Ureporn

2015-01-01

The objective of this study was to evaluate the effect of translationally controlled tumor protein (TCTP) supplemented in a novel glass ionomer cement (BIO-GIC) on normal human osteoblasts (NHost cells). BIO-GIC was a glass ionomer cement (GIC) modified by adding chitosan and albumin to promote the release of TCTP. NHost cells were seeded on specimens of GIC, GIC + TCTP, BIO-GIC and BIO-GIC + TCTP. Cell proliferation was determined by BrdU assay. It was found that BIO-GIC + TCTP had significantly higher proliferation of cells than other specimens. Bone morphogenetic protein-2 (BMP-2) and osteopontin (OPN) gene expressions assessed by quantitative real time PCR and alkaline phosphatase (ALP) activity were used to determine cell differentiation. Bone cell function was investigated by calcium deposition using alizarin assay. Both BMP-2 and OPN gene expressions of cells cultured on specimens with added TCTP increased gradually up-regulation after day 1 and reached the highest on day 3 then down-regulation on day 7. The ALP activity of cells cultured on BIO-GIC + TCTP for 7 days and calcium content after 14 days were significantly higher than other groups. BIO-GIC + TCTP can promote osteoblast cells proliferation, differentiation and function. - Highlights: • Developed a new GIC by supplementing TCTP in BIO-GIC (GIC with chitosan and albumin) • BIO-GIC + TCTP released a higher amount of TCTP than GIC + TCTP. • BIO-GIC + TCTP promoted cell proliferation higher than other specimens and control. • BIO-GIC + TCTP promoted osteoblasts differentiation and function

A protocatechuate biosensor for Pseudomonas putida KT2440 via promoter and protein evolution

Directory of Open Access Journals (Sweden)

Ramesh K. Jha

2018-06-01

Full Text Available Robust fluorescence-based biosensors are emerging as critical tools for high-throughput strain improvement in synthetic biology. Many biosensors are developed in model organisms where sophisticated synthetic biology tools are also well established. However, industrial biochemical production often employs microbes with phenotypes that are advantageous for a target process, and biosensors may fail to directly transition outside the host in which they are developed. In particular, losses in sensitivity and dynamic range of sensing often occur, limiting the application of a biosensor across hosts. Here we demonstrate the optimization of an Escherichia coli-based biosensor in a robust microbial strain for the catabolism of aromatic compounds, Pseudomonas putida KT2440, through a generalizable approach of modulating interactions at the protein-DNA interface in the promoter and the protein-protein dimer interface. The high-throughput biosensor optimization approach demonstrated here is readily applicable towards other allosteric regulators. Keywords: Whole cell biosensor, Aromatic catabolism, Transcription factor, PcaU, Shikimate

The system of Regional Contact Offices for promoting GMES services and the use of Space Technologies in European Regions.

Science.gov (United States)

Carrara, Paola; Antoninetti, Massimo; Bacai, Hina; Basoni, Anna; Bosc, Christelle; Clave, Magali; Cornacchia, Carmela; L'Astorina, Alba; Monbet, Philippe; Mueller, Bastian; Nicolau, Sonia; Pergola, Nicola; Rampini, Anna; Tramutoli, Valerio; Schumacher, Volker; Wells, Alan; Zepeda Juarez, Jesus; Zolotikova, Svetlana

2013-04-01

which have significant impact on the economy, environment and the quality of life of the citizens To this aim since 2011 the system of Regional Contact Offices (RCOs) was promoted by the EU FP7 DORIS_Net (Downsteam Observatory organized by Regions Active in Space - Network, http://www.doris-net.eu/) project as the regional link to the services provided by the European GMES programme. Since then a first nucleus of 12 pilot European Regions were working together establishing 6 first RCOs around Europe. This paper will present RCOs network goals, achievements and perspectives as well as its planned actions devoted to improve quality of Space Technology products from one side, to promote awareness and use of them by potential end-users (and particularly LRAs), from the other side.

A point mutation in the DNA-binding domain of HPV-2 E2 protein increases its DNA-binding capacity and reverses its transcriptional regulatory activity on the viral early promoter

Directory of Open Access Journals (Sweden)

Gao Chen

2012-02-01

Full Text Available Abstract Background The human papillomavirus (HPV E2 protein is a multifunctional DNA-binding protein. The transcriptional activity of HPV E2 is mediated by binding to its specific binding sites in the upstream regulatory region of the HPV genomes. Previously we reported a HPV-2 variant from a verrucae vulgaris patient with huge extensive clustered cutaneous, which have five point mutations in its E2 ORF, L118S, S235P, Y287H, S293R and A338V. Under the control of HPV-2 LCR, co-expression of the mutated HPV E2 induced an increased activity on the viral early promoter. In the present study, a series of mammalian expression plasmids encoding E2 proteins with one to five amino acid (aa substitutions for these mutations were constructed and transfected into HeLa, C33A and SiHa cells. Results CAT expression assays indicated that the enhanced promoter activity was due to the co-expressions of the E2 constructs containing A338V mutation within the DNA-binding domain. Western blots analysis demonstrated that the transiently transfected E2 expressing plasmids, regardless of prototype or the A338V mutant, were continuously expressed in the cells. To study the effect of E2 mutations on its DNA-binding activity, a serial of recombinant E2 proteins with various lengths were expressed and purified. Electrophoresis mobility shift assays (EMSA showed that the binding affinity of E2 protein with A338V mutation to both an artificial probe with two E2 binding sites or HPV-2 and HPV-16 promoter-proximal LCR sequences were significantly stronger than that of the HPV-2 prototype E2. Furthermore, co-expression of the construct containing A338V mutant exhibited increased activities on heterologous HPV-16 early promoter P97 than that of prototype E2. Conclusions These results suggest that the mutation from Ala to Val at aa 338 is critical for E2 DNA-binding and its transcriptional regulation.

Cytosine deletion at AP2-box region of HSP70 promoter and its ...

Indian Academy of Sciences (India)

of thermotolerance in cells (Leung et al. 1996). ... region of HSP70 significantly affected cellular thermotol- erance ... The double PCR-RFLP using ScrFI confirmed the occur- ... suade of HSP70 on defense of proteins related to respiration.

Datin, a yeast poly(dA:dT)-binding protein, behaves as an activator of the wild-type ILV1 promoter and interacts synergistically with Reb1p

DEFF Research Database (Denmark)

Moreira, José Manuel Alfonso; Remacle, J E; Kielland-Brandt, Morten

1998-01-01

A cis-acting element required for GCN4-independent basal-level transcription of ILV1 was previously identified in our laboratories as a binding site for the REB1 protein (Reb1p). Further deletion analysis of the ILV1 promoter region identified a second element also required for GCN4-independent...... basal-level ILV1 expression. This second element is an A.T-rich tract (26 As out of 32 nucleotides) situated 15 bp downstream of the Reb1p-binding site. Deletion of both the Reblp site and the poly(dA:dT) element totally eliminates basal activity of the ILV1 promoter. We show that the two elements act...... synergistically to control ILV1 expression and that the synergistic effect is distance dependent. We demonstrate that (i) datin (Dat1p), the only known poly (dA:dT)-binding protein in yeast, specifically binds to the ILV1 poly(dA:dT) element in vitro; (ii) Dat1p functions as a trans-activating factor in the ILV1...

Characterization and functional analysis of the Paralichthys olivaceus prdm1 gene promoter.

Science.gov (United States)

Li, Peizhen; Wang, Bo; Cao, Dandan; Liu, Yuezhong; Zhang, Quanqi; Wang, Xubo

2017-10-01

PR domain containing protein 1 (Prdm1) is a transcriptional repressor identified in various species and plays multiple important roles in immune response and embryonic development. However, little is known about the transcriptional regulation of the prdm1 gene. This study aims to characterize the promoter of Paralichthys olivaceus prdm1 (Po-prdm1) gene and determine the regulatory mechanism of Po-prdm1 expression. A 2000bp-long 5'-flanking region (translation initiation site designated as +1) of the Po-prdm1 gene was isolated and characterized. The regulatory elements in this fragment were then investigated and many putative transcription factor (TF) binding sites involved in immunity and multiple tissue development were identified. A 5'-deletion analysis was then conducted, and the ability of the deletion mutants to promote luciferase and green fluorescent protein (GFP) expression in a flounder gill cell line was examined. The results revealed that the minimal promoter is located in the region between -446 and -13bp, and the region between -1415 and -13bp enhanced the promoter activity. Site-directed mutation analysis was subsequently performed on the putative regulatory elements sites, and the results indicated that FOXP1, MSX and BCL6 binding sites play negative functional roles in the regulation of the Po-prdm1 expression in FG cells. In vivo analysis demonstrated that a GFP reporter gene containing 1.4kb-long promoter fragment (-1415/-13) was expressed in the head and trunk muscle fibres of transient transgenic zebrafish embryos. Our study provided the basic information for the exploration of Po-prdm1 regulation and expression. Copyright © 2017 Elsevier Inc. All rights reserved.

ProteinSplit: splitting of multi-domain proteins using prediction of ordered and disordered regions in protein sequences for virtual structural genomics

International Nuclear Information System (INIS)

Wyrwicz, Lucjan S; Koczyk, Grzegorz; Rychlewski, Leszek; Plewczynski, Dariusz

2007-01-01

The annotation of protein folds within newly sequenced genomes is the main target for semi-automated protein structure prediction (virtual structural genomics). A large number of automated methods have been developed recently with very good results in the case of single-domain proteins. Unfortunately, most of these automated methods often fail to properly predict the distant homology between a given multi-domain protein query and structural templates. Therefore a multi-domain protein should be split into domains in order to overcome this limitation. ProteinSplit is designed to identify protein domain boundaries using a novel algorithm that predicts disordered regions in protein sequences. The software utilizes various sequence characteristics to assess the local propensity of a protein to be disordered or ordered in terms of local structure stability. These disordered parts of a protein are likely to create interdomain spacers. Because of its speed and portability, the method was successfully applied to several genome-wide fold annotation experiments. The user can run an automated analysis of sets of proteins or perform semi-automated multiple user projects (saving the results on the server). Additionally the sequences of predicted domains can be sent to the Bioinfo.PL Protein Structure Prediction Meta-Server for further protein three-dimensional structure and function prediction. The program is freely accessible as a web service at http://lucjan.bioinfo.pl/proteinsplit together with detailed benchmark results on the critical assessment of a fully automated structure prediction (CAFASP) set of sequences. The source code of the local version of protein domain boundary prediction is available upon request from the authors

Direct inhibition of TNF-α promoter activity by Fanconi anemia protein FANCD2.

Directory of Open Access Journals (Sweden)

Nobuko Matsushita

Full Text Available Fanconi anemia (FA, an inherited disease, is associated with progressive bone marrow failure, predisposition to cancer, and genomic instability. Genes corresponding to 15 identified FA complementation groups have been cloned, and each gene product functions in the response to DNA damage induced by cross-linking agents and/or in protection against genome instability. Interestingly, overproduction of inflammatory cytokines such as tumor necrosis factor alpha (TNF-α and aberrant activation of NF-κB-dependent transcriptional activity have been observed in FA cells. Here we demonstrated that FANCD2 protein inhibits NF-κB activity in its monoubiquitination-dependent manner. Furthermore, we detected a specific association between FANCD2 and an NF-κB consensus element in the TNF-α promoter by electrophoretic mobility shift assays (EMSA and chromatin immunoprecipitation (ChIP assay. Therefore, we propose FANCD2 deficiency promotes transcriptional activity of the TNF-α promoter and induces overproduction of TNF-which then sustains prolonged inflammatory responses. These results also suggest that artificial modulation of TNFα production could be a promising therapeutic approach to FA.

DeepCNF-D: Predicting Protein Order/Disorder Regions by Weighted Deep Convolutional Neural Fields

Directory of Open Access Journals (Sweden)

Sheng Wang

2015-07-01

Full Text Available Intrinsically disordered proteins or protein regions are involved in key biological processes including regulation of transcription, signal transduction, and alternative splicing. Accurately predicting order/disorder regions ab initio from the protein sequence is a prerequisite step for further analysis of functions and mechanisms for these disordered regions. This work presents a learning method, weighted DeepCNF (Deep Convolutional Neural Fields, to improve the accuracy of order/disorder prediction by exploiting the long-range sequential information and the interdependency between adjacent order/disorder labels and by assigning different weights for each label during training and prediction to solve the label imbalance issue. Evaluated by the CASP9 and CASP10 targets, our method obtains 0.855 and 0.898 AUC values, which are higher than the state-of-the-art single ab initio predictors.

Mapping of the methylation pattern of the hMSH2 promoter in colon cancer, using bisulfite genomic sequencing

Directory of Open Access Journals (Sweden)

Zhang Hua

2006-08-01

Full Text Available Abstract The detailed methylation status of CpG sites in the promoter region of hMSH2 gene has yet not to be reported. We have mapped the complete methylation status of the hMSH2 promoter, a region that contains 75 CpG sites, using bisulfite genomic sequencing in 60 primary colorectal cancers. And the expression of hMSH2 was detected by immunohistochemistry. The hypermethylation of hMSH2 was detected in 18.33% (11/60 of tumor tissues. The protein of hMSH2 was detected in 41.67% (25/60 of tumor tissues. No hypermethylation of hMSH2 was detected in normal tissues. The protein of hMSH2 was detected in all normal tissues. Our study demonstrated that hMSH2 hypermethylation and protein expression were associated with the development of colorectal cancer.

Relationship between promoter methylation & tissue expression of MGMT gene in ovarian cancer

Directory of Open Access Journals (Sweden)

V Shilpa

2014-01-01

Full Text Available Background & objectives: Epigenetic alterations, in addition to multiple gene abnormalities, are involved in the genesis and progression of human cancers. Aberrant methylation of CpG islands within promoter regions is associated with transcriptional inactivation of various tumour suppressor genes. O 6 -methyguanine-DNA methyltransferase (MGMT is a DNA repair gene that removes mutagenic and cytotoxic adducts from the O 6 -position of guanine induced by alkylating agents. MGMT promoter hypermethylation and reduced expression has been found in some primary human carcinomas. We studied DNA methylation of CpG islands of the MGMT gene and its relation with MGMT protein expression in human epithelial ovarian carcinoma. Methods: A total of 88 epithelial ovarian cancer (EOC tissue samples, 14 low malignant potential (LMP tumours and 20 benign ovarian tissue samples were analysed for MGMT promoter methylation by nested methylation-specific polymerase chain reaction (MSP after bisulphite modification of DNA. A subset of 64 EOC samples, 10 LMP and benign tumours and five normal ovarian tissue samples were analysed for protein expression by immunohistochemistry. Results: The methylation frequencies of the MGMT gene promoter were found to be 29.5, 28.6 and 20 per cent for EOC samples, LMP tumours and benign cases, respectively. Positive protein expression was observed in 93.8 per cent of EOC and 100 per cent in LMP, benign tumours and normal ovarian tissue samples. Promoter hypermethylation with loss of protein expression was seen only in one case of EOC. Interpretation & conclusions: Our results suggest that MGMT promoter hypermethylation does not always reflect gene expression.

Differential Regulation of Telomerase Reverse Transcriptase Promoter Activation and Protein Degradation by Histone Deacetylase Inhibition.

Science.gov (United States)

Qing, Hua; Aono, Jun; Findeisen, Hannes M; Jones, Karrie L; Heywood, Elizabeth B; Bruemmer, Dennis

2016-06-01

Telomerase reverse transcriptase (TERT) maintains telomeres and is rate limiting for replicative life span. While most somatic tissues silence TERT transcription resulting in telomere shortening, cells derived from cancer or cardiovascular diseases express TERT and activate telomerase. In the present study, we demonstrate that histone deacetylase (HDAC) inhibition induces TERT transcription and promoter activation. At the protein level in contrast, HDAC inhibition decreases TERT protein abundance through enhanced degradation, which decreases telomerase activity and induces senescence. Finally, we demonstrate that HDAC inhibition decreases TERT expression during vascular remodeling in vivo. These data illustrate a differential regulation of TERT transcription and protein stability by HDAC inhibition and suggest that TERT may constitute an important target for the anti-proliferative efficacy of HDAC inhibitors. © 2015 Wiley Periodicals, Inc.

Development of a keratinocyte-based screening model for antipsoriatic drugs using green fluorescent protein under the control of an endogenous promoter.

Science.gov (United States)

Pol, Arno; van Ruissen, Fred; Schalkwijk, Joost

2002-08-01

Inflamed epidermis (psoriasis, wound healing, ultraviolet-irradiated skin) harbors keratinocytes that are hyperproliferative and display an abnormal differentiation program. A distinct feature of this so-called regenerative maturation pathway is the expression of proteins such as the cytokeratins CK6, CK16, and CK17 and the antiinflammatory protein SKALP/elafin. These proteins are absent in normal skin but highly induced in lesional psoriatic skin. Expression of these genes can be used as a surrogate marker for psoriasis in drug-screening procedures of large compound libraries. The aim of this study was to develop a keratinocyte cell line that contained a reporter gene under the control of a psoriasis-associated endogenous promoter and demonstrate its use in an assay suitable for screening. We generated a stably transfected keratinocyte cell line that expresses enhanced green fluorescent protein (EGFP), under the control of a 0.8-kb fragment derived from the promoter of the SKALP/elafin gene, which confers high levels of tissue-specific expression at the mRNA level. Induction of the SKALP promoter by tumor necrosis factor-alpha resulted in increased expression levels of the secreted SKALP-EGFP fusion protein as assessed by direct readout of fluorescence and fluorescence polarization in 96-well cell culture plates. The fold stimulation of the reporter gene was comparable to that of the endogenous SKALP gene as assessed by enzyme-linked immunosorbent assay. Although the dynamic range of the screening system is limited, the small standard deviation yields a Z factor of 0.49. This indicates that the assay is suitable as a high-throughput screen, and provides proof of the concept that a secreted EGFP fusion protein under the control of a physiologically relevant endogenous promoter can be used as a fluorescence-based high-throughput screen for differentiation-modifying or antiinflammatory compounds that act via the keratinocyte.

Direct ATP photolabeling of Escherichia coli recA proteins: identification of regions required for ATP binding

International Nuclear Information System (INIS)

Banks, G.R.; Sedgwick, S.G.

1986-01-01

When the Escherichia coli RecA protein is UV irradiated in the presence of [alpha- 32 P]ATP, a labeled protein--ATP adduct is formed. All the experimental evidence indicates that, in forming such an adduct, the ATP becomes specifically immobilized in the catalytically relevant ATP binding site. The adduct can also be identified after irradiation of E. coli cell lysates in a similar manner. This direct ATP photolabeling of RecA proteins has been used to identify regions of the polypeptide chain involved in the binding of ATP. The photolabeling of a RecA protein that lacks wild-type carboxy-terminal amino acids is not detectable. A RecA protein in which the amino-terminal sequence NH2-Ala-Ile-Asp-Glu-Asn- is replaced by NH2-Thr-Met-Ile-Thr-Asn-Ser-Ser-Ser- is only about 5% as efficiently photolabeled as the wild-type protein. Both of these RecA protein constructions, however, contain all the elements previously implicated, directly or indirectly, in the binding of ATP. ATP-photolabeled RecA protein has also been chemically cleaved at specific amino acids in order to identify regions of the polypeptide chain to which the nucleotide becomes covalently photolinked. The evidence is consistent with a region comprising amino acids 116-170. Thus, this work and that of others suggest that several disparate regions of the unfolded polypeptide chain may combine to form the ATP binding site upon protein folding or may influence binding through long-range effects

RNA polymerase II interacts with the promoter region of the noninduced hsp70 gene in Drosophila melanogaster cells

International Nuclear Information System (INIS)

Gilmour, D.S.; Lis, J.T.

1986-01-01

By using a protein-DNA cross-linking method, we examined the in vivo distribution of RNA polymerase II on the hsp70 heat shock gene in Drosophila melanogaster Schneider line 2 cells. In heat shock-induced cells, a high level of RNA polymerase II was detected on the entire gene, while in noninduced cells, the RNA polymerase II was confined to the 5' end of the hsp70 gene, predominantly between nucleotides -12 and +65 relative to the start of transcription. This association of RNA polymerase II was apparent whether the cross-linking was performed by a 10-min UV irradiation of chilled cells with mercury vapor lamps or by a 40-microsecond irradiation of cells with a high-energy xenon flash lamp. We hypothesize that RNA polymerase II has access to, and a high affinity for, the promoter region of this gene before induction, and this poised RNA polymerase II may be critical in the mechanism of transcription activation

Regional Cooperation Efforts in the Mekong River Basin: Mitigating river-related security threats and promoting regional development

Directory of Open Access Journals (Sweden)

Susanne Schmeier

2009-01-01

Full Text Available The development of international rivers is often perceived as leading to conflicts or even water wars. However, as the development of the Mekong River shows, cooperation has not only prevailed in the last decades, but River Basin Organizations (RBOs, established to mitigate river-related conflicts and/or develop the river basin, have also contributed to the emergence of more general cooperation structures, mainly by creating spill-over effects in other issue-areas, bringing cooperation to policy fields beyond the river itself. This article assesses the contribution of the Mekong River Commission (MRC and the Greater Mekong Sub-Region (GMS to the sustainable development of the Mekong Region as well as to the promotion of regional cooperation in mainland South-East Asia in general. --- Die Entwicklung grenzüberschreitender Flüsse wird oft mit Konflikten oder gar Kriegen um Wasser assoziiert. Wie jedoch die Entwicklung im Mekong-Becken zeigt, waren die vergangenen Jahrzehnte nicht nur von Kooperation gezeichnet, sondern Flussbeckenorganisationen konnten außerdem dazu beitragen, weitreichendere Kooperationsstrukturen zu entwickeln, die sich auf andere Politikfelder ausdehnen. Dieser Artikel beschäftigt sich mit dem Beitrag der Mekong River Commission (MRC und der Greater Mekong Sub-Region (GMS zur nachhaltigen Entwicklung in der Mekong Region sowie zur Förderung allgemeiner regionaler Kooperation im Festländischen Südostasien.

Protein Determinants of Meiotic DNA Break Hotspots

Science.gov (United States)

Fowler, Kyle R.; Gutiérrez-Velasco, Susana

2013-01-01

SUMMARY Meiotic recombination, crucial for proper chromosome segregation and genome evolution, is initiated by programmed DNA double-strand breaks (DSBs) in yeasts and likely all sexually reproducing species. In fission yeast, DSBs occur up to hundreds of times more frequently at special sites, called hotspots, than in other regions of the genome. What distinguishes hotspots from cold regions is an unsolved problem, although transcription factors determine some hotspots. We report the discovery that three coiled-coil proteins – Rec25, Rec27, and Mug20 – bind essentially all hotspots with unprecedented specificity even without DSB formation. These small proteins are components of linear elements, are related to synaptonemal complex proteins, and are essential for nearly all DSBs at most hotspots. Our results indicate these hotspot determinants activate or stabilize the DSB-forming protein Rec12 (Spo11 homolog) rather than promote its binding to hotspots. We propose a new paradigm for hotspot determination and crossover control by linear element proteins. PMID:23395004

IQ-domain GTPase-activating protein 1 promotes the malignant phenotype of invasive ductal breast carcinoma via canonical Wnt pathway.

Science.gov (United States)

Zhao, Huan-Yu; Han, Yang; Wang, Jian; Yang, Lian-He; Zheng, Xiao-Ying; Du, Jiang; Wu, Guang-Ping; Wang, En-Hua

2017-06-01

IQ-domain GTPase-activating protein 1 is a scaffolding protein with multidomain which plays a role in modulating dishevelled (Dvl) nuclear translocation in canonical Wnt pathway. However, the biological function and mechanism of IQ-domain GTPase-activating protein 1 in invasive ductal carcinoma (IDC) remain unknown. In this study, we found that IQ-domain GTPase-activating protein 1 expression was elevated in invasive ductal carcinoma, which was positively correlated with tumor grade, lymphatic metastasis, and poor prognosis. Coexpression of IQ-domain GTPase-activating protein 1 and Dvl in the nucleus and cytoplasm of invasive ductal carcinoma was significantly correlated but not in the membrane. Postoperative survival in the patients with their coexpression in the nucleus and cytoplasm was obviously lower than that without coexpression. The positive expression rates of c-myc and cyclin D1 were significantly higher in the patients with nuclear coexpression of Dvl and IQ-domain GTPase-activating protein 1 than that with cytoplasmic coexpression, correlating with poor prognosis. IQ-domain GTPase-activating protein 1 significantly enhanced cell proliferation and invasion in invasive ductal carcinoma cell lines by interacting with Dvl in cytoplasm to promote Dvl nuclear translocation so as to upregulate the expression of c-myc and cyclin D1. Collectively, our data suggest that IQ-domain GTPase-activating protein 1 may promote the malignant phenotype of invasive ductal carcinoma via canonical Wnt signaling, and it could be used as a potential prognostic biomarker for breast cancer patients.

Invited review: Whey proteins as antioxidants and promoters of cellular antioxidant pathways.

Science.gov (United States)

Corrochano, Alberto R; Buckin, Vitaly; Kelly, Phil M; Giblin, Linda

2018-03-28

Oxidative stress contributes to cell injury and aggravates several chronic diseases. Dietary antioxidants help the body to fight against free radicals and, therefore, avoid or reduce oxidative stress. Recently, proteins from milk whey liquid have been described as antioxidants. This review summarizes the evidence that whey products exhibit radical scavenging activity and reducing power. It examines the processing and treatment attempts to increase the antioxidant bioactivity and identifies 1 enzyme, subtilisin, which consistently produces the most potent whey fractions. The review compares whey from different milk sources and puts whey proteins in the context of other known food antioxidants. However, for efficacy, the antioxidant activity of whey proteins must not only survive processing, but also upper gut transit and arrival in the bloodstream, if whey products are to promote antioxidant levels in target organs. Studies reveal that direct cell exposure to whey samples increases intracellular antioxidants such as glutathione. However, the physiological relevance of these in vitro assays is questionable, and evidence is conflicting from dietary intervention trials, with both rats and humans, that whey products can boost cellular antioxidant biomarkers. Copyright © 2018 American Dairy Science Association. Published by Elsevier Inc. All rights reserved.

DisoMCS: Accurately Predicting Protein Intrinsically Disordered Regions Using a Multi-Class Conservative Score Approach.

Directory of Open Access Journals (Sweden)

Zhiheng Wang

Full Text Available The precise prediction of protein intrinsically disordered regions, which play a crucial role in biological procedures, is a necessary prerequisite to further the understanding of the principles and mechanisms of protein function. Here, we propose a novel predictor, DisoMCS, which is a more accurate predictor of protein intrinsically disordered regions. The DisoMCS bases on an original multi-class conservative score (MCS obtained by sequence-order/disorder alignment. Initially, near-disorder regions are defined on fragments located at both the terminus of an ordered region connecting a disordered region. Then the multi-class conservative score is generated by sequence alignment against a known structure database and represented as order, near-disorder and disorder conservative scores. The MCS of each amino acid has three elements: order, near-disorder and disorder profiles. Finally, the MCS is exploited as features to identify disordered regions in sequences. DisoMCS utilizes a non-redundant data set as the training set, MCS and predicted secondary structure as features, and a conditional random field as the classification algorithm. In predicted near-disorder regions a residue is determined as an order or a disorder according to the optimized decision threshold. DisoMCS was evaluated by cross-validation, large-scale prediction, independent tests and CASP (Critical Assessment of Techniques for Protein Structure Prediction tests. All results confirmed that DisoMCS was very competitive in terms of accuracy of prediction when compared with well-established publicly available disordered region predictors. It also indicated our approach was more accurate when a query has higher homologous with the knowledge database.The DisoMCS is available at http://cal.tongji.edu.cn/disorder/.

Intracellular high mobility group B1 protein (HMGB1) represses HIV-1 LTR-directed transcription in a promoter- and cell-specific manner

International Nuclear Information System (INIS)

Naghavi, Mojgan H.; Nowak, Piotr; Andersson, Jan; Soennerborg, Anders; Yang Huan; Tracey, Kevin J.; Vahlne, Anders

2003-01-01

We investigated whether the high mobility group B 1 (HMGB1), an abundant nuclear protein in all mammalian cells, affects HIV-1 transcription. Intracellular expression of human HMGB1 repressed HIV-1 gene expression in epithelial cells. This inhibitory effect of HMGB1 was caused by repression of long terminal repeat (LTR)-mediated transcription. Other viral promoters/enhancers, including simian virus 40 or cytomegalovirus, were not inhibited by HMGB1. In addition, HMGB1 inhibition of HIV-1 subtype C expression was dependent on the number of NFκB sites in the LTR region. The inhibitory effect of HMGB1 on viral gene expression observed in HeLa cells was confirmed by an upregulation of viral replication in the presence of antisense HMGB1 in monocytic cells. In contrast to what was found in HeLa cells and monocytic cells, endogenous HMGB1 expression did not affect HIV-1 replication in unstimulated Jurkat cells. Thus, intracellular HMGB1 affects HIV-1 LTR-directed transcription in a promoter- and cell-specific manner

Graduate Management Project (GMP) Retrospective Analysis of Promotional Mediums for Tricare Prime in Tricare Region 11

National Research Council Canada - National Science Library

Carpenter, Steven

1997-01-01

This study provides retrospective market research information about the population who enrolled in TRICARE Prime in TRICARE Region 11 and the advertising mediums used to promote enrollment in the TRICARE Prime program...

Spermatogenesis-related ring finger gene ZNF230 promoter: identification and functional analysis

DEFF Research Database (Denmark)

Xu, Wenming; Zhang, Sizhong; Qiu, Weimin

2009-01-01

reporter Plasmids. Overexpression and site-directed mutation test were used to characterize the cis-element. The results showed ZNF230 gene promoter to be GC rich and not contain a TATA box. Deletion analysis of the 5'-flanking region of ZNF230 in HEK293 cells indicated that the sequence encompassing from...... nt -131 to +152 has a basal transcriptional activity. Site-directed mutation test and mithramycin A treatment demonstrated that the ZNF230 promoter contained a functional Sp1 site. Overexpression of the Sox5 protein activated the promoter activity. A 312-bp fragment surrounding the transcription...

Role of protein and amino acids in promoting lean mass accretion with resistance exercise and attenuating lean mass loss during energy deficit in humans.

Science.gov (United States)

Churchward-Venne, Tyler A; Murphy, Caoileann H; Longland, Thomas M; Phillips, Stuart M

2013-08-01

Amino acids are major nutrient regulators of muscle protein turnover. After protein ingestion, hyperaminoacidemia stimulates increased rates of skeletal muscle protein synthesis, suppresses muscle protein breakdown, and promotes net muscle protein accretion for several hours. These acute observations form the basis for strategized protein intake to promote lean mass accretion, or prevent lean mass loss over the long term. However, factors such as protein dose, protein source, and timing of intake are important in mediating the anabolic effects of amino acids on skeletal muscle and must be considered within the context of evaluating the reported efficacy of long-term studies investigating protein supplementation as part of a dietary strategy to promote lean mass accretion and/or prevent lean mass loss. Current research suggests that dietary protein supplementation can augment resistance exercise-mediated gains in skeletal muscle mass and strength and can preserve skeletal muscle mass during periods of diet-induced energy restriction. Perhaps less appreciated, protein supplementation can augment resistance training-mediated gains in skeletal muscle mass even in individuals habitually consuming 'adequate' (i.e., >0.8 g kg⁻¹ day⁻¹) protein. Additionally, overfeeding energy with moderate to high-protein intake (15-25 % protein or 1.8-3.0 g kg⁻¹ day⁻¹) is associated with lean, but not fat mass accretion, when compared to overfeeding energy with low protein intake (5 % protein or ~0.68 g kg⁻¹ day⁻¹). Amino acids represent primary nutrient regulators of skeletal muscle anabolism, capable of enhancing lean mass accretion with resistance exercise and attenuating the loss of lean mass during periods of energy deficit, although factors such as protein dose, protein source, and timing of intake are likely important in mediating these effects.

Smad3 induces atrogin-1, inhibits mTOR and protein synthesis, and promotes muscle atrophy in vivo.

Science.gov (United States)

Goodman, Craig A; McNally, Rachel M; Hoffmann, F Michael; Hornberger, Troy A

2013-11-01

Myostatin, a member of the TGF superfamily, is sufficient to induce skeletal muscle atrophy. Myostatin-induced atrophy is associated with increases in E3-ligase atrogin-1 expression and protein degradation and decreases in Akt/mechanistic target of rapamycin (mTOR) signaling and protein synthesis. Myostatin signaling activates the transcription factor Smad3 (Small Mothers Against Decapentaplegic), which has been shown to be necessary for myostatin-induced atrogin-1 expression and atrophy; however, it is not known whether Smad3 is sufficient to induce these events or whether Smad3 simply plays a permissive role. Thus, the aim of this study was to address these questions with an in vivo model. To accomplish this goal, in vivo transfection of plasmid DNA was used to create transient transgenic mouse skeletal muscles, and our results show for the first time that Smad3 expression is sufficient to stimulate atrogin-1 promoter activity, inhibit Akt/mTOR signaling and protein synthesis, and induce muscle fiber atrophy. Moreover, we propose that Akt/mTOR signaling is inhibited by a Smad3-induced decrease in microRNA-29 (miR-29) expression and a subsequent increase in the translation of phosphatase and tensin homolog (PTEN) mRNA. Smad3 is also sufficient to inhibit peroxisome proliferator-activated receptor-γ coactivator-1α (PGC1α) promoter activity and to increase FoxO (Forkhead Box Protein, Subclass O)-mediated signaling and the promoter activity of plasminogen activator inhibitor 1 (PAI-1). Combined, this study provides the first evidence that Smad3 is sufficient to regulate many of the events associated with myostatin-induced atrophy and therefore suggests that Smad3 signaling may be a viable target for therapies aimed at preventing myostatin-induced muscle atrophy.

Protein Kinase Mitogen-activated Protein Kinase Kinase Kinase Kinase 4 (MAP4K4) Promotes Obesity-induced Hyperinsulinemia.

Science.gov (United States)

Roth Flach, Rachel J; Danai, Laura V; DiStefano, Marina T; Kelly, Mark; Menendez, Lorena Garcia; Jurczyk, Agata; Sharma, Rohit B; Jung, Dae Young; Kim, Jong Hun; Kim, Jason K; Bortell, Rita; Alonso, Laura C; Czech, Michael P

2016-07-29

Previous studies revealed a paradox whereby mitogen-activated protein kinase kinase kinase kinase 4 (Map4k4) acted as a negative regulator of insulin sensitivity in chronically obese mice, yet systemic deletion of Map4k4 did not improve glucose tolerance. Here, we report markedly reduced glucose-responsive plasma insulin and C-peptide levels in whole body Map4k4-depleted mice (M4K4 iKO) as well as an impaired first phase of insulin secretion from islets derived from M4K4 iKO mice ex vivo After long-term high fat diet (HFD), M4K4 iKO mice pancreata also displayed reduced β cell mass, fewer proliferating β cells and reduced islet-specific gene mRNA expression compared with controls, although insulin content was normal. Interestingly, the reduced plasma insulin in M4K4 iKO mice exposed to chronic (16 weeks) HFD was not observed in response to acute HFD challenge or short term treatment with the insulin receptor antagonist S961. Furthermore, the improved insulin sensitivity in obese M4K4 iKO mice was abrogated by high exogenous insulin over the course of a euglycemic clamp study, indicating that hypoinsulinemia promotes insulin sensitivity in chronically obese M4K4 iKO mice. These results demonstrate that protein kinase Map4k4 drives obesity-induced hyperinsulinemia and insulin resistance in part by promoting insulin secretion from β cells in mice. © 2016 by The American Society for Biochemistry and Molecular Biology, Inc.

Hypothyroidism coordinately and transiently affects myelin protein gene expression in most rat brain regions during postnatal development.

Science.gov (United States)

Ibarrola, N; Rodríguez-Peña, A

1997-03-28

To assess the role of thyroid hormone on myelin gene expression, we have studied the effect of hypothyroidism on the mRNA steady state levels for the major myelin protein genes: myelin basic protein (MBP), proteolipid protein (PLP), myelin-associated glycoprotein (MAG) and 2':3'-cyclic nucleotide 3'-phosphodiesterase (CNP) in different rat brain regions, during the first postnatal month. We found that hypothyroidism reduces the levels of every myelin protein transcript, with striking differences between the different brain regions. Thus, in the more caudal regions, the effect of hypothyroidism was extremely modest, being only evident at the earlier stages of myelination. In contrast, in the striatum and the cerebral cortex the important decrease in the myelin protein transcripts is maintained beyond the first postnatal month. Therefore, thyroid hormone modulates in a synchronous fashion the expression of the myelin genes and the length of its effect depends on the brain region. On the other hand, hyperthyroidism leads to an increase of the major myelin protein transcripts above control values. Finally, lack of thyroid hormone does not change the expression of the oligodendrocyte progenitor-specific gene, the platelet derived growth factor receptor alpha.

Adipocyte spliced form of X-box-binding protein 1 promotes adiponectin multimerization and systemic glucose homeostasis

NARCIS (Netherlands)

Sha, H.; Yang, L.; Liu, M.; Xia, S.; Liu, Y.; Liu, F.; Kersten, A.H.; Qi, L.

2014-01-01

The physiological role of the spliced form of X-box–binding protein 1 (XBP1s), a key transcription factor of the endoplasmic reticulum (ER) stress response, in adipose tissue remains largely unknown. In this study, we show that overexpression of XBP1s promotes adiponectin multimerization in

The Effect of Salts in Promoting Specific and Competitive Interactions between Zinc Finger Proteins and Metals

Science.gov (United States)

Li, Gongyu; Yuan, Siming; Zheng, Shihui; Chen, Yuting; Zheng, Zhen; Liu, Yangzhong; Huang, Guangming

2017-12-01

Specific protein-metal interactions (PMIs) fulfill essential functions in cells and organic bodies, and activation of these functions in vivo are mostly modulated by the complex environmental factors, including pH value, small biomolecules, and salts. Specifically, the role of salts in promoting specific PMIs and their competition among various metals has remained untapped mainly due to the difficulty to distinguish nonspecific PMIs from specific PMIs by classic spectroscopic techniques. Herein, we report Hofmeister salts differentially promote the specific PMIs by combining nanoelectrospray ionization mass spectrometry and spectroscopic techniques (fluorescence measurement and circular dichroism). Furthermore, to explore the influence of salts in competitive binding between metalloproteins and various metals, we designed a series of competitive experiments and applied to a well-defined model system, the competitive binding of zinc (II) and arsenic (III) to holo-promyelocytic leukemia protein (PML). These experiments not only provided new insights at the molecular scale as complementary to previous NMR and spectroscopic results, but also deduced the relative binding ability between zinc finger proteins and metals at the molecular scale, which avoids the mass spectrometric titration-based determination of binding constants that is frequently affected and often degraded by variable solution conditions including salt contents. [Figure not available: see fulltext.

Protein profiles of serum, brain regions and hypophyses of pubertal ...

African Journals Online (AJOL)

The effects of dietary fumonisin B1 (FB1 ), a toxin produced mainly by Fusarium verticillioides and F. proliferatum that grow on maize worldwide, on protein profiles of serum, brain regions and hypophyses were studied in 24 male Large White weanling pigs randomly divided into four groups (n = 6). In a completely ...

Expression of Tau Pathology-Related Proteins in Different Brain Regions: A Molecular Basis of Tau Pathogenesis.

Science.gov (United States)

Hu, Wen; Wu, Feng; Zhang, Yanchong; Gong, Cheng-Xin; Iqbal, Khalid; Liu, Fei

2017-01-01

Microtubule-associated protein tau is hyperphosphorylated and aggregated in affected neurons in Alzheimer disease (AD) brains. The tau pathology starts from the entorhinal cortex (EC), spreads to the hippocampus and frontal and temporal cortices, and finally to all isocortex areas, but the cerebellum is spared from tau lesions. The molecular basis of differential vulnerability of different brain regions to tau pathology is not understood. In the present study, we analyzed brain regional expressions of tau and tau pathology-related proteins. We found that tau was hyperphosphorylated at multiple sites in the frontal cortex (FC), but not in the cerebellum, from AD brain. The level of tau expression in the cerebellum was about 1/4 of that seen in the frontal and temporal cortices in human brain. In the rat brain, the expression level of tau with three microtubule-binding repeats (3R-tau) was comparable in the hippocampus, EC, FC, parietal-temporal cortex (PTC), occipital-temporal cortex (OTC), striatum, thalamus, olfactory bulb (OB) and cerebellum. However, the expression level of 4R-tau was the highest in the EC and the lowest in the cerebellum. Tau phosphatases, kinases, microtubule-related proteins and other tau pathology-related proteins were also expressed in a region-specific manner in the rat brain. These results suggest that higher levels of tau and tau kinases in the EC and low levels of these proteins in the cerebellum may accounts for the vulnerability and resistance of these representative brain regions to the development of tau pathology, respectively. The present study provides the regional expression profiles of tau and tau pathology-related proteins in the brain, which may help understand the brain regional vulnerability to tau pathology in neurodegenerative tauopathies.

Wnt Signalling Promotes Actin Dynamics during Axon Remodelling through the Actin-Binding Protein Eps8.

Directory of Open Access Journals (Sweden)

Eleanna Stamatakou

Full Text Available Upon arrival at their synaptic targets, axons slow down their growth and extensively remodel before the assembly of presynaptic boutons. Wnt proteins are target-derived secreted factors that promote axonal remodelling and synaptic assembly. In the developing spinal cord, Wnts secreted by motor neurons promote axonal remodelling of NT-3 responsive dorsal root ganglia neurons. Axon remodelling induced by Wnts is characterised by growth cone pausing and enlargement, processes that depend on the re-organisation of microtubules. However, the contribution of the actin cytoskeleton has remained unexplored. Here, we demonstrate that Wnt3a regulates the actin cytoskeleton by rapidly inducing F-actin accumulation in growth cones from rodent DRG neurons through the scaffold protein Dishevelled-1 (Dvl1 and the serine-threonine kinase Gsk3β. Importantly, these changes in actin cytoskeleton occurs before enlargement of the growth cones is evident. Time-lapse imaging shows that Wnt3a increases lamellar protrusion and filopodia velocity. In addition, pharmacological inhibition of actin assembly demonstrates that Wnt3a increases actin dynamics. Through a yeast-two hybrid screen, we identified the actin-binding protein Eps8 as a direct interactor of Dvl1, a scaffold protein crucial for the Wnt signalling pathway. Gain of function of Eps8 mimics Wnt-mediated axon remodelling, whereas Eps8 silencing blocks the axon remodelling activity of Wnt3a. Importantly, blockade of the Dvl1-Eps8 interaction completely abolishes Wnt3a-mediated axonal remodelling. These findings demonstrate a novel role for Wnt-Dvl1 signalling through Eps8 in the regulation of axonal remodeling.

Hpa1 harpin needs nitroxyl terminus to promote vegetative growth and leaf photosynthesis in Arabidopsis.

Science.gov (United States)

Li, Xiaojie; Han, Liping; Zhao, Yanying; You, Zhenzhen; Dong, Hansong; Zhang, Chunling

2014-03-01

Hpa1 is a harpin protein produced by Xanthomonas oryzae, an important bacterial pathogen of rice, and has the growth-promoting activity in plants. To understand the molecular basis for the function of Hpa1, we generated an inactive variant protein, Hpa1 delta NT, by deleting the nitroxyl-terminal region of the Hpa1 sequence and compared Hpa1 delta NT with the full-length protein in terms of the effects on vegetative growth and related physiological responses in Arabidopsis. When Hpa1 was applied to plants, it acted to enhance the vegetative growth but did not affect the floral development. Enhanced plant growth was accompanied by induced expression of growth-promoting genes in plant leaves. The growth-promoting activity of Hpa1 was further correlated with a physiological consequence shown as promoted leaf photosynthesis as a result of facilitated CO2 conduction through leaf stomata and mesophyll cells. On the contrary, plant growth, growth-promoting gene expression, and the physiological consequence changed little in response to the Hpa1 delta NT treatment. These analyses suggest that Hpa1 requires the nitroxyl-terminus to facilitate CO2 transport inside leaf cells and promote leaf photosynthesis and vegetative growth of the plant.

Functional anthology of intrinsic disorder. 1. Biological processes and functions of proteins with long disordered regions.

Science.gov (United States)

Xie, Hongbo; Vucetic, Slobodan; Iakoucheva, Lilia M; Oldfield, Christopher J; Dunker, A Keith; Uversky, Vladimir N; Obradovic, Zoran

2007-05-01

Identifying relationships between function, amino acid sequence, and protein structure represents a major challenge. In this study, we propose a bioinformatics approach that identifies functional keywords in the Swiss-Prot database that correlate with intrinsic disorder. A statistical evaluation is employed to rank the significance of these correlations. Protein sequence data redundancy and the relationship between protein length and protein structure were taken into consideration to ensure the quality of the statistical inferences. Over 200,000 proteins from the Swiss-Prot database were analyzed using this approach. The predictions of intrinsic disorder were carried out using PONDR VL3E predictor of long disordered regions that achieves an accuracy of above 86%. Overall, out of the 710 Swiss-Prot functional keywords that were each associated with at least 20 proteins, 238 were found to be strongly positively correlated with predicted long intrinsically disordered regions, whereas 302 were strongly negatively correlated with such regions. The remaining 170 keywords were ambiguous without strong positive or negative correlation with the disorder predictions. These functions cover a large variety of biological activities and imply that disordered regions are characterized by a wide functional repertoire. Our results agree well with literature findings, as we were able to find at least one illustrative example of functional disorder or order shown experimentally for the vast majority of keywords showing the strongest positive or negative correlation with intrinsic disorder. This work opens a series of three papers, which enriches the current view of protein structure-function relationships, especially with regards to functionalities of intrinsically disordered proteins, and provides researchers with a novel tool that could be used to improve the understanding of the relationships between protein structure and function. The first paper of the series describes our

Eukaryotic elongation factor 1-beta interacts with the 5' untranslated region of the M gene of Nipah virus to promote mRNA translation.

Science.gov (United States)

Uchida, Shotaro; Sato, Hiroki; Yoneda, Misako; Kai, Chieko

2016-09-01

Nipah virus belongs to the genus Henipavirus in the family Paramyxoviridae, and its RNA genome is larger than those of other paramyxoviruses because it has long untranslated regions (UTRs) in each gene. However, the functions of these UTRs are not fully understood. In this study, we investigated the functions of the 5' UTRs and found that the 5' UTR of the M gene upregulated the translation of a reporter gene. Using an RNA pull-down assay, we showed that eukaryotic elongation factor 1-beta (EEF1B2) interacts with nucleotides 81-100 of the M 5' UTR and specifically enhances its translation efficiency. Our results suggest that the M 5' UTR promotes the production of M protein and viral budding by recruiting EEF1B2.

The membrane protein LasM Promotes the Culturability of Legionella pneumophila in Water

Directory of Open Access Journals (Sweden)

Laam Li

2016-09-01

Full Text Available The water-borne pathogen Legionella pneumophila (Lp strongly expresses the lpg1659 gene in water. This gene encodes a hypothetical protein predicted to be a membrane protein using in silico analysis. While no conserved domains were identified in Lpg1659, similar proteins are found in many Legionella species and other aquatic bacteria. RT-qPCR showed that lpg1659 is positively regulated by the alternative sigma factor RpoS, which is essential for Lp to survive in water. These observations suggest an important role of this novel protein in the survival of Lp in water. Deletion of lpg1659 did not affect cell morphology, membrane integrity or tolerance to high temperature. Moreover, lpg1659 was dispensable for growth of Lp in rich medium, and during infection of the amoeba Acanthamoeba castellanii and of THP-1 human macrophages. However, deletion of lpg1659 resulted in an early loss of culturability in water, while over-expression of this gene promoted the culturability of Lp. Therefore, these results suggest that lpg1659 is required for Lp to maintain culturability, and possibly long-term survival, in water. Since the loss of culturability observed in the absence of Lpg1659 was complemented by the addition of trace metals into water, this membrane protein is likely a transporter for acquiring essential trace metal for maintaining culturability in water and potentially in other metal-deprived conditions. Given its role in the survival of Lp in water, Lpg1659 was named LasM for Legionella aquatic survival membrane protein.

TAIL1: an isthmin-like gene, containing type 1 thrombospondin-repeat and AMOP domain, mapped to ARVD1 critical region.

Science.gov (United States)

Rossi, Valeria; Beffagna, Giorgia; Rampazzo, Alessandra; Bauce, Barbara; Danieli, Gian Antonio

2004-06-23

Isthmins represent a novel family of vertebrate secreted proteins containing one copy of the thrombospondin type 1 repeat (TSR), which in mammals is shared by several proteins with diverse biological functions, including cell adhesion, angiogenesis, and patterning of developing nervous system. We have determined the genomic organization of human TAIL1 (thrombospondin and AMOP containing isthmin-like 1), a novel isthmin-like gene encoding a protein that contains a TSR and a C-terminal AMOP domain (adhesion-associated domain in MUC4 and other proteins), characteristic of extracellular proteins involved in adhesion processes. TAIL1 gene encompasses more than 24.4 kb. Analysis of the DNA sequence surrounding the putative transcriptional start region revealed a TATA-less promoter located in a CpG island. Several consensus binding sites for the transcription factors Sp1 and MZF-1 were identified in this promoter region. In humans, TAIL1 gene is located on chromosome 14q24.3 within ARVD1 (arrhythmogenic right ventricular dysplasia/cardiomyopathy, type 1) critical region; preliminary evidence suggests that it is expressed in several tissues, showing multiple alternative splicing.

Construction of a ColD cda Promoter-Based SOS-Green Fluorescent Protein Whole-Cell Biosensor with Higher Sensitivity toward Genotoxic Compounds than Constructs Based on recA, umuDC, or sulA Promoters

DEFF Research Database (Denmark)

Norman, Anders; Hansen, Lars Hestbjerg; Sørensen, Søren Johannes

2005-01-01

Four different green fluorescent protein (GFP)-based whole-cell biosensors were created based on the DNA damage inducible SOS response of Escherichia coli in order to evaluate the sensitivity of individual SOS promoters toward genotoxic substances. Treatment with the known carcinogen N-methyl-N'-......Four different green fluorescent protein (GFP)-based whole-cell biosensors were created based on the DNA damage inducible SOS response of Escherichia coli in order to evaluate the sensitivity of individual SOS promoters toward genotoxic substances. Treatment with the known carcinogen N......-cell biosensor which is not only able to detect minute levels of genotoxins but, due to its use of the green fluorescent protein, also a reporter system which should be applicable in high-throughput screening assays as well as a wide variety of in situ detection studies....

Functional promoter variant in zinc finger protein 202 predicts severe atherosclerosis and ischemic heart disease

DEFF Research Database (Denmark)

Frikke-Schmidt, R.; Nordestgaard, Børge; Grande, Peer

2008-01-01

Objectives This study was designed to test the hypotheses that single nucleotide polymorphisms ( SNPs), in zinc finger protein 202 ( ZNF202), predict severe atherosclerosis and ischemic heart disease ( IHD). Background ZNF202 is a transcriptional repressor controlling promoter elements in genes...... involved in vascular maintenance and lipid metabolism. Methods We first determined genotype association for 9 ZNF202 SNPs with severe atherosclerosis ( ankle brachial index >0.7 vs. ...,998 controls. Finally, we determined whether g. -660A>G altered transcriptional activity of the ZNF202 promoter in vitro. Results Cross-sectionally, ZNF202 g. -660 GG versus AA homozygosity predicted an odds ratio for severe atherosclerosis of 2.01 ( 95% confidence interval [CI]: 1.34 to 3.01). Prospectively...

Junction region of EWS-FLI1 fusion protein has a dominant negative effect in Ewing's sarcoma in vitro.

Science.gov (United States)

Jully, Babu; Vijayalakshmi, Ramshankar; Gopal, Gopisetty; Sabitha, Kesavan; Rajkumar, Thangarajan

2012-11-12

Ewing's sarcoma is a malignancy characterized by a specific 11:22 chromosomal translocation which generates a novel EWS-FLI1 fusion protein functioning as an aberrant transcription factor. In the present study, we have further characterized the junction region of the EWS-FLI1 fusion protein. In-silico model of EWS-FLI1 fusion protein was analysed for ligand binding sites, and a putative region (amino acid (aa) 251-343 of the type 1 fusion protein) in the vicinity of the fusion junction was cloned and expressed using bacterial expression. The recombinant protein was characterized by Circular Dichroism (CD). We then expressed aa 251-280 ectopically in Ewing's sarcoma cell-line and its effect on cell proliferation, tumorigenicity and expression of EWS-FLI1 target genes were analysed. Our modelling analysis indicated that Junction region (aa 251-343) encompasses potential ligand biding sites in the EWS-FLI1 protein and when expressed in bacteria was present as soluble form. Ectopically expressing this region in Ewing's sarcoma cells inhibited tumorigenicity, and EWS-FLI1 target genes indicating a dominant negative biological effect. Junction region can be exploited further as target for drug development in future to specifically target EWS-FLI1 in Ewing's Sarcoma.

The artificial zinc finger coding gene 'Jazz' binds the utrophin promoter and activates transcription.

Science.gov (United States)

Corbi, N; Libri, V; Fanciulli, M; Tinsley, J M; Davies, K E; Passananti, C

2000-06-01

Up-regulation of utrophin gene expression is recognized as a plausible therapeutic approach in the treatment of Duchenne muscular dystrophy (DMD). We have designed and engineered new zinc finger-based transcription factors capable of binding and activating transcription from the promoter of the dystrophin-related gene, utrophin. Using the recognition 'code' that proposes specific rules between zinc finger primary structure and potential DNA binding sites, we engineered a new gene named 'Jazz' that encodes for a three-zinc finger peptide. Jazz belongs to the Cys2-His2 zinc finger type and was engineered to target the nine base pair DNA sequence: 5'-GCT-GCT-GCG-3', present in the promoter region of both the human and mouse utrophin gene. The entire zinc finger alpha-helix region, containing the amino acid positions that are crucial for DNA binding, was specifically chosen on the basis of the contacts more frequently represented in the available list of the 'code'. Here we demonstrate that Jazz protein binds specifically to the double-stranded DNA target, with a dissociation constant of about 32 nM. Band shift and super-shift experiments confirmed the high affinity and specificity of Jazz protein for its DNA target. Moreover, we show that chimeric proteins, named Gal4-Jazz and Sp1-Jazz, are able to drive the transcription of a test gene from the human utrophin promoter.

OPAL: prediction of MoRF regions in intrinsically disordered protein sequences.

Science.gov (United States)

Sharma, Ronesh; Raicar, Gaurav; Tsunoda, Tatsuhiko; Patil, Ashwini; Sharma, Alok

2018-06-01

Intrinsically disordered proteins lack stable 3-dimensional structure and play a crucial role in performing various biological functions. Key to their biological function are the molecular recognition features (MoRFs) located within long disordered regions. Computationally identifying these MoRFs from disordered protein sequences is a challenging task. In this study, we present a new MoRF predictor, OPAL, to identify MoRFs in disordered protein sequences. OPAL utilizes two independent sources of information computed using different component predictors. The scores are processed and combined using common averaging method. The first score is computed using a component MoRF predictor which utilizes composition and sequence similarity of MoRF and non-MoRF regions to detect MoRFs. The second score is calculated using half-sphere exposure (HSE), solvent accessible surface area (ASA) and backbone angle information of the disordered protein sequence, using information from the amino acid properties of flanks surrounding the MoRFs to distinguish MoRF and non-MoRF residues. OPAL is evaluated using test sets that were previously used to evaluate MoRF predictors, MoRFpred, MoRFchibi and MoRFchibi-web. The results demonstrate that OPAL outperforms all the available MoRF predictors and is the most accurate predictor available for MoRF prediction. It is available at http://www.alok-ai-lab.com/tools/opal/. ashwini@hgc.jp or alok.sharma@griffith.edu.au. Supplementary data are available at Bioinformatics online.

Chromatin immunoprecipitation assays revealed CREB and serine 133 phospho-CREB binding to the CART gene proximal promoter.

Science.gov (United States)

Rogge, George A; Shen, Li-Ling; Kuhar, Michael J

2010-07-16

Both over expression of cyclic AMP response element binding protein (CREB) in the nucleus accumbens (NAc), and intra-accumbal injection of cocaine- and amphetamine-regulated transcript (CART) peptides, have been shown to decrease cocaine reward. Also, over expression of CREB in the rat NAc increased CART mRNA and peptide levels, but it is not known if this was due to a direct action of P-CREB on the CART gene promoter. The goal of this study was to test if CREB and P-CREB bound directly to the CRE site in the CART promoter, using chromatin immunoprecipitation (ChIP) assays. ChIP assay with anti-CREB antibodies showed an enrichment of the CART promoter fragment containing the CRE region over IgG precipitated material, a non-specific control. Forskolin, which was known to increase CART mRNA levels in GH3 cells, was utilized to show that the drug increased levels of P-CREB protein and P-CREB binding to the CART promoter CRE-containing region. A region of the c-Fos promoter containing a CRE cis-regulatory element was previously shown to bind P-CREB, and it was used here as a positive control. These data suggest that the effects of CREB over expression on blunting cocaine reward could be, at least in part, attributed to the increased expression of the CART gene by direct interaction of P-CREB with the CART promoter CRE site, rather than by some indirect action. Copyright (c) 2010 Elsevier B.V. All rights reserved.

A distal region of the human TGM1 promoter is required for expression in transgenic mice and cultured keratinocytes

Directory of Open Access Journals (Sweden)

Lu Ying

2004-04-01

Full Text Available Abstract Background TGM1(transglutaminase 1 is an enzyme that crosslinks the cornified envelope of mature keratinocytes. Appropriate expression of the TGM1 gene is crucial for proper keratinocyte function as inactivating mutations lead to the debilitating skin disease, lamellar ichthyosis. TGM1 is also expressed in squamous metaplasia, a consequence in some epithelia of vitamin A deficiency or toxic insult that can lead to neoplasia. An understanding of the regulation of this gene in normal and abnormal differentiation states may contribute to better disease diagnosis and treatment. Methods In vivo requirements for expression of the TGM1 gene were studied by fusing various lengths of promoter DNA to a reporter and injecting the DNA into mouse embryos to generate transgenic animals. Expression of the reporter was ascertained by Western blotting and immunohistochemistry. Further delineation of a transcriptionally important distal region was determined by transfections of progressively shortened or mutated promoter DNA into cultured keratinocytes. Results In vivo analysis of a reporter transgene driven by the TGM1 promoter revealed that 1.6 kilobases, but not 1.1 kilobases, of DNA was sufficient to confer tissue-specific and cell layer-specific expression. This same region was responsible for reporter expression in tissues undergoing squamous metaplasia as a response to vitamin A deprivation. Mutation of a distal promoter AP1 site or proximal promoter CRE site, both identified as important transcriptional elements in transfection assays, did not prevent appropriate expression. Further searching for transcriptional elements using electrophoretic mobility shift (EMSA and transfection assays in cultured keratinocytes identified two Sp1 elements in a transcriptionally active region between -1.6 and -1.4 kilobases. While mutation of either Sp1 site or the AP1 site singly had only a small effect, mutation of all three sites eliminated nearly all the

E2F/Rb Family Proteins Mediate Interferon Induced Repression of Adenovirus Immediate Early Transcription to Promote Persistent Viral Infection.

Directory of Open Access Journals (Sweden)

Yueting Zheng

2016-01-01

Full Text Available Interferons (IFNs are cytokines that have pleiotropic effects and play important roles in innate and adaptive immunity. IFNs have broad antiviral properties and function by different mechanisms. IFNs fail to inhibit wild-type Adenovirus (Ad replication in established cancer cell lines. In this study, we analyzed the effects of IFNs on Ad replication in normal human cells. Our data demonstrate that both IFNα and IFNγ blocked wild-type Ad5 replication in primary human bronchial epithelial cells (NHBEC and TERT-immortalized normal human diploid fibroblasts (HDF-TERT. IFNs inhibited the replication of divergent adenoviruses. The inhibition of Ad5 replication by IFNα and IFNγ is the consequence of repression of transcription of the E1A immediate early gene product. Both IFNα and IFNγ impede the association of the transactivator GABP with the E1A enhancer region during the early phase of infection. The repression of E1A expression by IFNs requires a conserved E2F binding site in the E1A enhancer, and IFNs increased the enrichment of the E2F-associated pocket proteins, Rb and p107, at the E1A enhancer in vivo. PD0332991 (Pabociclib, a specific CDK4/6 inhibitor, dephosphoryles pocket proteins to promote their interaction with E2Fs and inhibited wild-type Ad5 replication dependent on the conserved E2F binding site. Consistent with this result, expression of the small E1A oncoprotein, which abrogates E2F/pocket protein interactions, rescued Ad replication in the presence of IFNα or IFNγ. Finally, we established a persistent Ad infection model in vitro and demonstrated that IFNγ suppresses productive Ad replication in a manner dependent on the E2F binding site in the E1A enhancer. This is the first study that probes the molecular basis of persistent adenovirus infection and reveals a novel mechanism by which adenoviruses utilize IFN signaling to suppress lytic virus replication and to promote persistent infection.

Region-specific differences in bioenergetic proteins and protein response to acute high fat diet in brains of low and high capacity runner rats.

Science.gov (United States)

Gan, Li; Ma, Delin; Li, Min; Yang, Fu-Chen; Rogers, Robert S; Wheatley, Joshua L; Koch, Lauren G; Britton, Steven L; Thyfault, John P; Geiger, Paige C; Stanford, John A

2018-05-01

Aerobic capacity is a strong predictor of mortality. Low capacity runner (LCR) rats exhibit reduced mitochondrial function in peripheral organs. A high fat diet (HFD) can worsen metabolic phenotype in LCR rats. Little is known about metabolic changes in the brains of these rats, however. This study examined protein markers of mitochondrial function and metabolism as a function of aerobic running capacity and an acute HFD in four brain regions: the striatum, hippocampus, hypothalamus, and substantia nigra. After 3 days HFD or chow diets, we measured peroxisome proliferator-activated receptor-γ coactivator 1α (PGC1-α), nuclear respiratory factors 1 (Nrf-1), mitochondrial transcription factor A (TFAM), and phosphorylated (activated) AMP-activated protein kinase (p-AMPK) protein levels in the four brain regions. LCR rats exhibited lower levels of mitochondrial proteins (PGC1-α, Nrf-1, TFAM), and greater p-AMPK, in striatum, but not in the other brain regions. Mitochondrial protein levels were greater in HFD LCR striatum, while p-AMPK was lower in this group. Markers of lower mitochondrial biogenesis and increased metabolic demand were limited to the LCR striatum, which nevertheless maintained the capacity to respond to an acute HFD challenge. Copyright © 2018 Elsevier B.V. All rights reserved.

P-body proteins regulate transcriptional rewiring to promote DNA replication stress resistance.

Science.gov (United States)

Loll-Krippleber, Raphael; Brown, Grant W

2017-09-15

mRNA-processing (P-) bodies are cytoplasmic granules that form in eukaryotic cells in response to numerous stresses to serve as sites of degradation and storage of mRNAs. Functional P-bodies are critical for the DNA replication stress response in yeast, yet the repertoire of P-body targets and the mechanisms by which P-bodies promote replication stress resistance are unknown. In this study we identify the complete complement of mRNA targets of P-bodies during replication stress induced by hydroxyurea treatment. The key P-body protein Lsm1 controls the abundance of HHT1, ACF4, ARL3, TMA16, RRS1 and YOX1 mRNAs to prevent their toxic accumulation during replication stress. Accumulation of YOX1 mRNA causes aberrant downregulation of a network of genes critical for DNA replication stress resistance and leads to toxic acetaldehyde accumulation. Our data reveal the scope and the targets of regulation by P-body proteins during the DNA replication stress response.P-bodies form in response to stress and act as sites of mRNA storage and degradation. Here the authors identify the mRNA targets of P-bodies during DNA replication stress, and show that P-body proteins act to prevent toxic accumulation of these target transcripts.

Facile promoter deletion in Escherichia coli in response to leaky expression of very robust and benign proteins from common expression vectors

Directory of Open Access Journals (Sweden)

Kawe Martin

2009-01-01

Full Text Available Abstract Background Overexpression of proteins in Escherichia coli is considered routine today, at least when the protein is soluble and not otherwise toxic for the host. We report here that the massive overproduction of even such "benign" proteins can cause surprisingly efficient promoter deletions in the expression plasmid, leading to the growth of only non-producers, when expression is not well repressed in the newly transformed bacterial cell. Because deletion is so facile, it might impact on high-throughput protein production, e.g. for structural genomics, where not every expression parameter will be monitored. Results We studied the high-level expression of several robust non-toxic proteins using a T5 promoter under lac operator control. Full induction leads to no significant growth retardation. We compared expression from almost identical plasmids with or without the lacI gene together in strains expressing different levels of LacI. Any combination without net overexpression of LacI led to an efficient promoter deletion in the plasmid, although the number of growing colonies and even the plasmid size – all antibiotic-resistant non-producers – was almost normal, and thus the problem not immediately recognizable. However, by assuring sufficient repression during the initial establishment phase of the plasmid, deletion was completely prevented. Conclusion The deletions in the insufficiently repressed system are caused entirely by the burden of high-level translation. Since the E. coli Dps protein, known to protect DNA against stress in the stationary phase, is accumulated in the deletion mutants, the mutation may have taken place during a transient stationary phase. The cause of the deletion is thus distinct from the well known interference of high-level transcription with plasmid replication. The deletion can be entirely prevented by overexpressing LacI, a useful precaution even without any signs of stress caused by the protein.

Increased protein-energy intake promotes anabolism in critically ill infants with viral bronchiolitis: a double‑blind randomised controlled trial

Science.gov (United States)

de Betue, Carlijn T; van Waardenburg, Dick A; Deutz, Nicolaas E; van Eijk, Hans M; van Goudoever, Johannes B; Luiking, Yvette C; Zimmermann, Luc J; Joosten, Koen F

2011-01-01

Objective The preservation of nutritional status and growth is an important aim in critically ill infants, but difficult to achieve due to the metabolic stress response and inadequate nutritional intake, leading to negative protein balance. This study investigated whether increasing protein and energy intakes can promote anabolism. The primary outcome was whole body protein balance, and the secondary outcome was first pass splanchnic phenylalanine extraction (SPEPhe). Design This was a double-blind randomised controlled trial. Infants (n=18) admitted to the paediatric intensive care unit with respiratory failure due to viral bronchiolitis were randomised to continuous enteral feeding with protein and energy enriched formula (PE-formula) (n=8; 3.1±0.3 g protein/kg/24 h, 119±25 kcal/kg/24 h) or standard formula (S-formula) (n=10; 1.7±0.2 g protein/kg/24 h, 84±15 kcal/kg/24 h; equivalent to recommended intakes for healthy infants <6 months). A combined intravenous-enteral phenylalanine stable isotope protocol was used on day 5 after admission to determine whole body protein metabolism and SPEPhe. Results Protein balance was significantly higher with PE-formula than with S-formula (PE-formula: 0.73±0.5 vs S-formula: 0.02±0.6 g/kg/24 h) resulting from significantly increased protein synthesis (PE-formula: 9.6±4.4, S-formula: 5.2±2.3 g/kg/24 h), despite significantly increased protein breakdown (PE-formula: 8.9±4.3, S-formula: 5.2±2.6 g/kg/24 h). SPEPhe was not statistically different between the two groups (PE-formula: 39.8±18.3%, S-formula: 52.4±13.6%). Conclusions Increasing protein and energy intakes promotes protein anabolism in critically ill infants in the first days after admission. Since this is an important target of nutritional support, increased protein and energy intakes should be preferred above standard intakes in these infants. Dutch Trial Register number: NTR 515. PMID:21673183

Down-regulation of human topoisomerase IIα expression correlates with relative amounts of specificity factors Sp1 and Sp3 bound at proximal and distal promoter regions

Directory of Open Access Journals (Sweden)

Isaacs Richard J

2007-05-01

Full Text Available Abstract Background Topoisomerase IIα has been shown to be down-regulated in doxorubicin-resistant cell lines. The specificity proteins Sp1 and Sp3 have been implicated in regulation of topoisomerase IIα transcription, although the mechanism by which they regulate expression is not fully understood. Sp1 has been shown to bind specifically to both proximal and distal GC elements of the human topoisomerase IIα promoter in vitro, while Sp3 binds only to the distal GC element unless additional flanking sequences are included. While Sp1 is thought to be an activator of human topoisomerase IIα, the functional significance of Sp3 binding is not known. Therefore, we sought to determine the functional relationship between Sp1 and Sp3 binding to the topoisomerase IIα promoter in vivo. We investigated endogenous levels of Sp1, Sp3 and topoisomerase IIα as well as binding of both Sp1 and Sp3 to the GC boxes of the topoisomerase IIα promoter in breast cancer cell lines in vivo after short term doxorubicin exposure. Results Functional effects of Sp1 and Sp3 were studied using transient cotransfection assays using a topoisomerase IIα promoter reporter construct. The in vivo interactions of Sp1 and Sp3 with the GC elements of the topoisomerase IIα promoter were studied in doxorubicin-treated breast cancer cell lines using chromatin immunoprecipitation assays. Relative amounts of endogenous proteins were measured using immunoblotting. In vivo DNA looping mediated by proteins bound at the GC1 and GC2 elements was studied using the chromatin conformation capture assay. Both Sp1 and Sp3 bound to the GC1 and GC2 regions. Sp1 and Sp3 were transcriptional activators and repressors respectively, with Sp3 repression being dominant over Sp1-mediated activation. The GC1 and GC2 elements are linked in vivo to form a loop, thus bringing distal regulatory elements and their cognate transcription factors into close proximity with the transcription start site

Regional Differences in Correlates of Daily Walking among Middle Age and Older Australian Rural Adults: Implications for Health Promotion

Directory of Open Access Journals (Sweden)

James Dollman

2016-01-01

Full Text Available Rural Australians are less physically active than their metropolitan counterparts, and yet very little is known of the candidate intervention targets for promoting physical activity in rural populations. As rural regions are economically, socially and environmentally diverse, drivers of regular physical activity are likely to vary between regions. This study explored the region-specific correlates of daily walking among middle age and older adults in rural regions with contrasting dominant primary industries. Participants were recruited through print and electronic media, primary care settings and community organisations. Pedometers were worn by 153 adults for at least four days, including a weekend day. A questionnaire identified potential intra-personal, social and environmental correlates of physical activity, according to a social ecological framework. Regression modelling identified independent correlates of daily walking separately in the two study regions. In one region, there were independent correlates of walking from all levels of the social ecological framework. In the other region, significant correlates of daily walking were almost all demographic (age, education and marital status. Participants living alone were less likely to be physically active regardless of region. This study highlights the importance of considering region-specific factors when designing strategies for promoting regular walking among rural adults.

Osteoponin Promoter Controlled by DNA Methylation: Aberrant Methylation in Cloned Porcine Genome

Directory of Open Access Journals (Sweden)

Chih-Jie Shen

2014-01-01

Full Text Available Cloned animals usually exhibited many defects in physical characteristics or aberrant epigenetic reprogramming, especially in some important organ development. Osteoponin (OPN is an extracellular-matrix protein involved in heart and bone development and diseases. In this study, we investigated the correlation between OPN mRNA and its promoter methylation changes by the 5-aza-dc treatment in fibroblast cell and promoter assay. Aberrant methylation of porcine OPN was frequently found in different tissues of somatic nuclear transferred cloning pigs, and bisulfite sequence data suggested that the OPN promoter region −2615 to −2239 nucleotides (nt may be a crucial regulation DNA element. In pig ear fibroblast cell culture study, the demethylation of OPN promoter was found in dose-dependent response of 5-aza-dc treatment and followed the OPN mRNA reexpression. In cloned pig study, discrepant expression pattern was identified in several cloned pig tissues, especially in brain, heart, and ear. Promoter assay data revealed that four methylated CpG sites presenting in the −2615 to −2239 nt region cause significant downregulation of OPN promoter activity. These data suggested that methylation in the OPN promoter plays a crucial role in the regulation of OPN expression that we found in cloned pigs genome.

The Zn Finger protein Iguana impacts Hedgehog signaling by promoting ciliogenesis

Science.gov (United States)

Glazer, Andrew; Wilkinson, Alex; Backer, Chelsea B.; Lapan, Sylvain; Gutzman, Jennifer H.; Cheeseman, Iain M.; Reddien, Peter W.

2009-01-01

Hedgehog signaling is critical for metazoan development and requires cilia for pathway activity. The gene iguana was discovered in zebrafish as required for Hedgehog signaling, and encodes a novel Zn finger protein. Planarians are flatworms with robust regenerative capacities and that utilize epidermal cilia for locomotion. RNA interference of Smed-iguana in the planarian S. mediterranea caused cilia loss and failure to regenerate new cilia, but did not cause defects similar to those observed in hedgehog(RNAi) animals. Smed-iguana gene expression was also similar in pattern to the expression of multiple other ciliogenesis genes, but was not required for expression of these ciliogenesis genes. iguana-defective zebrafish had too few motile cilia in pronephric ducts and in Kupffer's vesicle. Kupffer's vesicle promotes left-right asymmetry and iguana mutant embryos had left-right asymmetry defects. Finally, human Iguana proteins (dZIP1 and dZIP1L) localize to the basal bodies of primary cilia and, together, are required for primary cilia formation. Our results indicate that a critical and broadly conserved function for Iguana is in ciliogenesis and that this function has come to be required for Hedgehog signaling in vertebrates. PMID:19852954

Quantitative proteomic analysis reveals effects of epidermal growth factor receptor (EGFR) on invasion-promoting proteins secreted by glioblastoma cells.

Science.gov (United States)

Sangar, Vineet; Funk, Cory C; Kusebauch, Ulrike; Campbell, David S; Moritz, Robert L; Price, Nathan D

2014-10-01

Glioblastoma multiforme is a highly invasive and aggressive brain tumor with an invariably poor prognosis. The overexpression of epidermal growth factor receptor (EGFR) is a primary influencer of invasion and proliferation in tumor cells and the constitutively active EGFRvIII mutant, found in 30-65% of Glioblastoma multiforme, confers more aggressive invasion. To better understand how EGFR contributes to tumor aggressiveness, we investigated the effect of EGFR on the secreted levels of 65 rationally selected proteins involved in invasion. We employed selected reaction monitoring targeted mass spectrometry using stable isotope labeled internal peptide standards to quantity proteins in the secretome from five GBM (U87) isogenic cell lines in which EGFR, EGFRvIII, and/or PTEN were expressed. Our results show that cell lines with EGFR overexpression and constitutive EGFRvIII expression differ remarkably in the expression profiles for both secreted and intracellular signaling proteins, and alterations in EGFR signaling result in reproducible changes in concentrations of secreted proteins. Furthermore, the EGFRvIII-expressing mutant cell line secretes the majority of the selected invasion-promoting proteins at higher levels than other cell lines tested. Additionally, the intracellular and extracellular protein measurements indicate elevated oxidative stress in the EGFRvIII-expressing cell line. In conclusion, the results of our study demonstrate that EGFR signaling has a significant effect on the levels of secreted invasion-promoting proteins, likely contributing to the aggressiveness of Glioblastoma multiforme. Further characterization of these proteins may provide candidates for new therapeutic strategies and targets as well as biomarkers for this aggressive disease. © 2014 by The American Society for Biochemistry and Molecular Biology, Inc.

The expression of nifB gene from Herbaspirillum seropedicae is dependent upon the NifA and RpoN proteins.

Science.gov (United States)

Rego, Fabiane G M; Pedrosa, Fábio O; Chubatsu, Leda S; Yates, M Geoffrey; Wassem, Roseli; Steffens, Maria B R; Rigo, Liu U; Souza, Emanuel M

2006-12-01

The putative nifB promoter region of Herbaspirillum seropedicae contained two sequences homologous to NifA-binding site and a -24/-12 type promoter. A nifB::lacZ fusion was assayed in the backgrounds of both Escherichia coli and H. seropedicae. In E. coli, the expression of nifB::lacZ occurred only in the presence of functional rpoN and Klebsiella pneumoniae nifA genes. In addition, the integration host factor (IHF) stimulated the expression of the nifB::lacZ fusion in this background. In H. seropedicae, nifB expression occurred only in the absence of ammonium and under low levels of oxygen, and it was shown to be strictly dependent on NifA. DNA band shift experiments showed that purified K. pneumoniae RpoN and E. coli IHF proteins were capable of binding to the nifB promoter region, and in vivo dimethylsulfate footprinting showed that NifA binds to both NifA-binding sites. These results strongly suggest that the expression of the nifB promoter of H. seropedicae is dependent on the NifA and RpoN proteins and that the IHF protein stimulates NifA activation of nifB promoter.

Engineering Aromatic-Aromatic Interactions To Nucleate Folding in Intrinsically Disordered Regions of Proteins.

Science.gov (United States)

Balakrishnan, Swati; Sarma, Siddhartha P

2017-08-22

Aromatic interactions are an important force in protein folding as they combine the stability of a hydrophobic interaction with the selectivity of a hydrogen bond. Much of our understanding of aromatic interactions comes from "bioinformatics" based analyses of protein structures and from the contribution of these interactions to stabilizing secondary structure motifs in model peptides. In this study, the structural consequences of aromatic interactions on protein folding have been explored in engineered mutants of the molten globule protein apo-cytochrome b 5 . Structural changes from disorder to order due to aromatic interactions in two variants of the protein, viz., WF-cytb5 and FF-cytb5, result in significant long-range secondary and tertiary structure. The results show that 54 and 52% of the residues in WF-cytb5 and FF-cytb5, respectively, occupy ordered regions versus 26% in apo-cytochrome b 5 . The interactions between the aromatic groups are offset-stacked and edge-to-face for the Trp-Phe and Phe-Phe mutants, respectively. Urea denaturation studies indicate that both mutants have a C m higher than that of apo-cytochrome b 5 and are more stable to chaotropic agents than apo-cytochrome b 5 . The introduction of these aromatic residues also results in "trimer" interactions with existing aromatic groups, reaffirming the selectivity of the aromatic interactions. These studies provide insights into the aromatic interactions that drive disorder-to-order transitions in intrinsically disordered regions of proteins and will aid in de novo protein design beyond small peptide scaffolds.

Ectodomain shedding of Limbic System-Associated Membrane Protein (LSAMP) by ADAM Metallopeptidases promotes neurite outgrowth in DRG neurons.

Science.gov (United States)

Sanz, Ricardo L; Ferraro, Gino B; Girouard, Marie-Pier; Fournier, Alyson E

2017-08-11

IgLONs are members of the immunoglobulin superfamily of cell adhesion proteins implicated in the process of neuronal outgrowth, cell adhesion and subdomain target recognition. IgLONs form homophilic and heterophilic complexes on the cell surface that repress or promote growth depending on the neuronal population, the developmental stage and surface repertoire of IgLON family members. In the present study, we identified a metalloproteinase-dependent mechanism necessary to promote growth in embryonic dorsal root ganglion cells (DRGs). Treatment of embryonic DRG neurons with pan-metalloproteinase inhibitors, tissue inhibitor of metalloproteinase-3, or an inhibitor of ADAM Metallopeptidase Domain 10 (ADAM10) reduces outgrowth from DRG neurons indicating that metalloproteinase activity is important for outgrowth. The IgLON family members Neurotrimin (NTM) and Limbic System-Associated Membrane Protein (LSAMP) were identified as ADAM10 substrates that are shed from the cell surface of DRG neurons. Overexpression of LSAMP and NTM suppresses outgrowth from DRG neurons. Furthermore, LSAMP loss of function decreases the outgrowth sensitivity to an ADAM10 inhibitor. Together our findings support a role for ADAM-dependent shedding of cell surface LSAMP in promoting outgrowth from DRG neurons.

Structure of the protein core of the glypican Dally-like and localization of a region important for hedgehog signaling

Energy Technology Data Exchange (ETDEWEB)

Kim, Min-Sung; Saunders, Adam M.; Hamaoka, Brent Y.; Beachy, Philip A.; Leahy, Daniel J. (Stanford-MED); (JHU)

2011-09-20

Glypicans are heparan sulfate proteoglycans that modulate the signaling of multiple growth factors active during animal development, and loss of glypican function is associated with widespread developmental abnormalities. Glypicans consist of a conserved, approximately 45-kDa N-terminal protein core region followed by a stalk region that is tethered to the cell membrane by a glycosyl-phosphatidylinositol anchor. The stalk regions are predicted to be random coil but contain a variable number of attachment sites for heparan sulfate chains. Both the N-terminal protein core and the heparan sulfate attachments are important for glypican function. We report here the 2.4-{angstrom} crystal structure of the N-terminal protein core region of the Drosophila glypican Dally-like (Dlp). This structure reveals an elongated, {alpha}-helical fold for glypican core regions that does not appear homologous to any known structure. The Dlp core protein is required for normal responsiveness to Hedgehog (Hh) signals, and we identify a localized region on the Dlp surface important for mediating its function in Hh signaling. Purified Dlp protein core does not, however, interact appreciably with either Hh or an Hh:Ihog complex.

Genetic recombination is targeted towards gene promoter regions in dogs.

Science.gov (United States)

Auton, Adam; Rui Li, Ying; Kidd, Jeffrey; Oliveira, Kyle; Nadel, Julie; Holloway, J Kim; Hayward, Jessica J; Cohen, Paula E; Greally, John M; Wang, Jun; Bustamante, Carlos D; Boyko, Adam R

2013-01-01

The identification of the H3K4 trimethylase, PRDM9, as the gene responsible for recombination hotspot localization has provided considerable insight into the mechanisms by which recombination is initiated in mammals. However, uniquely amongst mammals, canids appear to lack a functional version of PRDM9 and may therefore provide a model for understanding recombination that occurs in the absence of PRDM9, and thus how PRDM9 functions to shape the recombination landscape. We have constructed a fine-scale genetic map from patterns of linkage disequilibrium assessed using high-throughput sequence data from 51 free-ranging dogs, Canis lupus familiaris. While broad-scale properties of recombination appear similar to other mammalian species, our fine-scale estimates indicate that canine highly elevated recombination rates are observed in the vicinity of CpG rich regions including gene promoter regions, but show little association with H3K4 trimethylation marks identified in spermatocytes. By comparison to genomic data from the Andean fox, Lycalopex culpaeus, we show that biased gene conversion is a plausible mechanism by which the high CpG content of the dog genome could have occurred.

Secreted Frizzled related protein-4 (sFRP4) promotes epidermal differentiation and apoptosis

International Nuclear Information System (INIS)

Maganga, Richard; Giles, Natalie; Adcroft, Katharine; Unni, Ambili; Keeney, Diane; Wood, Fiona; Fear, Mark; Dharmarajan, Arunasalam

2008-01-01

The skin provides vital protection from infection and dehydration. Maintenance of the skin is through a constant program of proliferation, differentiation and apoptosis of epidermal cells, whereby proliferating cells in the basal layer differentiating to form the keratinized, anucleated stratum corneum. The WNT signalling pathway is known to be important in the skin. WNT signalling has been shown to be important both in epidermal development and in the maintenance and cycling of hair follicles and epidermal stem cells. However, the precise role for this pathway in epidermal differentiation remains unknown. We investigated the role of the WNT signalling inhibitor sFRP4 in epidermal differentiation. sFRP4 is expressed in both normal skin and keratinocytes in culture. Expression of sFRP4 mRNA and protein increases with keratinocyte differentiation and apoptosis, whilst exposure of keratinocytes to exogenous sFRP4 promotes apoptosis and expression of the terminal differentiation marker Involucrin. These data suggest sFRP4 promotes epidermal differentiation.

Functional Anthology of Intrinsic Disorder. I. Biological Processes and Functions of Proteins with Long Disordered Regions

Science.gov (United States)

Xie, Hongbo; Vucetic, Slobodan; Iakoucheva, Lilia M.; Oldfield, Christopher J.; Dunker, A. Keith; Uversky, Vladimir N.; Obradovic, Zoran

2008-01-01

Identifying relationships between function, amino acid sequence and protein structure represents a major challenge. In this study we propose a bioinformatics approach that identifies functional keywords in the Swiss-Prot database that correlate with intrinsic disorder. A statistical evaluation is employed to rank the significance of these correlations. Protein sequence data redundancy and the relationship between protein length and protein structure were taken into consideration to ensure the quality of the statistical inferences. Over 200,000 proteins from Swiss-Prot database were analyzed using this approach. The predictions of intrinsic disorder were carried out using PONDR VL3E predictor of long disordered regions that achieves an accuracy of above 86%. Overall, out of the 710 Swiss-Prot functional keywords that were each associated with at least 20 proteins, 238 were found to be strongly positively correlated with predicted long intrinsically disordered regions, whereas 302 were strongly negatively correlated with such regions. The remaining 170 keywords were ambiguous without strong positive or negative correlation with the disorder predictions. These functions cover a large variety of biological activities and imply that disordered regions are characterized by a wide functional repertoire. Our results agree well with literature findings, as we were able to find at least one illustrative example of functional disorder or order shown experimentally for the vast majority of keywords showing the strongest positive or negative correlation with intrinsic disorder. This work opens a series of three papers, which enriches the current view of protein structure-function relationships, especially with regards to functionalities of intrinsically disordered proteins and provides researchers with a novel tool that could be used to improve the understanding of the relationships between protein structure and function. The first paper of the series describes our statistical

The Murine Factor H-Related Protein FHR-B Promotes Complement Activation

Directory of Open Access Journals (Sweden)

Marcell Cserhalmi

2017-09-01

Full Text Available Factor H-related (FHR proteins consist of varying number of complement control protein domains that display various degrees of sequence identity to respective domains of the alternative pathway complement inhibitor factor H (FH. While such FHR proteins are described in several species, only human FHRs were functionally investigated. Their biological role is still poorly understood and in part controversial. Recent studies on some of the human FHRs strongly suggest a role for FHRs in enhancing complement activation via competing with FH for binding to certain ligands and surfaces. The aim of the current study was the functional characterization of a murine FHR, FHR-B. To this end, FHR-B was expressed in recombinant form. Recombinant FHR-B bound to human C3b and was able to compete with human FH for C3b binding. FHR-B supported the assembly of functionally active C3bBb alternative pathway C3 convertase via its interaction with C3b. This activity was confirmed by demonstrating C3 activation in murine serum. In addition, FHR-B bound to murine pentraxin 3 (PTX3, and this interaction resulted in murine C3 fragment deposition due to enhanced complement activation in mouse serum. FHR-B also induced C3 deposition on C-reactive protein, the extracellular matrix (ECM extract Matrigel, and endothelial cell-derived ECM when exposed to mouse serum. Moreover, mouse C3 deposition was strongly enhanced on necrotic Jurkat T cells and the mouse B cell line A20 by FHR-B. FHR-B also induced lysis of sheep erythrocytes when incubated in mouse serum with FHR-B added in excess. Altogether, these data demonstrate that, similar to human FHR-1 and FHR-5, mouse FHR-B modulates complement activity by promoting complement activation via interaction with C3b and via competition with murine FH.

Temporal transcription of the lactococcal temperate phage TP901-1 and DNA sequence of the early promoter region

DEFF Research Database (Denmark)

Madsen, Hans Peter Lynge; Hammer, Karin

1998-01-01

to a phage repressor, a single-stranded DNA-binding protein, a topoisomerase, a Cro-like protein and two other phage proteins of unknown function were detected. The gene arrangement in the early transcribed region of TP901-1 thus consists of two transcriptional units: one from PR containing four genes......, of which at least two (the integrase gene and putative repressor) are needed for lysogeny, and the divergent and longer transcriptional unit from PL, presumably encoding functions required for the lytic life cycle. ORFs with homology to proteins involved in DNA replication were identified on the latter......Transcriptional analysis by Northern blotting identified clusters of early, middle and late transcribed regions of the temperate lactococcal bacteriophage TP901-1 during one-step growth experiments. The latent period was found to be 65 min and the burst size 40 +/- 10. The eight early transcripts...

Expression of the nifA gene of Herbaspirillum seropedicae: role of the NtrC and NifA binding sites and of the -24/-12 promoter element.

Science.gov (United States)

Souza, E M; Pedrosa, F O; Rigo, L U; Machado, H B; Yates, M G

2000-06-01

The nifA promoter of Herbaspirillum seropedicae contains potential NtrC, NifA and IHF binding sites together with a -12/-24 sigma(N)-dependent promoter. This region has now been investigated by deletion mutagenesis for the effect of NtrC and NifA on the expression of a nifA::lacZ fusion. A 5' end to the RNA was identified at position 641, 12 bp downstream from the -12/-24 promoter. Footprinting experiments showed that the G residues at positions -26 and -9 are hypermethylated, and that the region from -10 to +10 is partially melted under nitrogen-fixing conditions, confirming that this is the active nifA promoter. In H. seropedicae nifA expression from the sigma(N)-dependent promoter is repressed by fixed nitrogen but not by oxygen and is probably activated by the NtrC protein. NifA protein is apparently not essential for nifA expression but it can still bind the NifA upstream activating sequence.

Exploring DNA methylation changes in promoter, intragenic, and intergenic regions as early and late events in breast cancer formation

International Nuclear Information System (INIS)

Rauscher, Garth H.; Kresovich, Jacob K.; Poulin, Matthew; Yan, Liying; Macias, Virgilia; Mahmoud, Abeer M.; Al-Alem, Umaima; Kajdacsy-Balla, Andre; Wiley, Elizabeth L.; Tonetti, Debra; Ehrlich, Melanie

2015-01-01

Breast cancer formation is associated with frequent changes in DNA methylation but the extent of very early alterations in DNA methylation and the biological significance of cancer-associated epigenetic changes need further elucidation. Pyrosequencing was done on bisulfite-treated DNA from formalin-fixed, paraffin-embedded sections containing invasive tumor and paired samples of histologically normal tissue adjacent to the cancers as well as control reduction mammoplasty samples from unaffected women. The DNA regions studied were promoters (BRCA1, CD44, ESR1, GSTM2, GSTP1, MAGEA1, MSI1, NFE2L3, RASSF1A, RUNX3, SIX3 and TFF1), far-upstream regions (EN1, PAX3, PITX2, and SGK1), introns (APC, EGFR, LHX2, RFX1 and SOX9) and the LINE-1 and satellite 2 DNA repeats. These choices were based upon previous literature or publicly available DNA methylome profiles. The percent methylation was averaged across neighboring CpG sites. Most of the assayed gene regions displayed hypermethylation in cancer vs. adjacent tissue but the TFF1 and MAGEA1 regions were significantly hypomethylated (p ≤0.001). Importantly, six of the 16 regions examined in a large collection of patients (105 – 129) and in 15-18 reduction mammoplasty samples were already aberrantly methylated in adjacent, histologically normal tissue vs. non-cancerous mammoplasty samples (p ≤0.01). In addition, examination of transcriptome and DNA methylation databases indicated that methylation at three non-promoter regions (far-upstream EN1 and PITX2 and intronic LHX2) was associated with higher gene expression, unlike the inverse associations between cancer DNA hypermethylation and cancer-altered gene expression usually reported. These three non-promoter regions also exhibited normal tissue-specific hypermethylation positively associated with differentiation-related gene expression (in muscle progenitor cells vs. many other types of normal cells). The importance of considering the exact DNA region analyzed and the

Promoting survival: A grounded theory study of consequences of modern health practices in Ouramanat region of Iranian Kurdistan.

Science.gov (United States)

Mohammadpur, Ahmad; Rezaei, Mehdi; Sadeghi, Rasoul

2010-05-14

The aim of this qualitative study is to explore the way people using modern health care perceive its consequences in Ouraman-e-Takht region of Iranian Kurdistan. Ouraman-e-Takht is a rural, highly mountainous and dry region located in the southwest Kurdistan province of Iran. Recently, modern health practices have been introduced to the region. The purpose of this study was to investigate, from the Ouramains' point of view, the impact that modern health services and practices have had on the Ouraman traditional way of life. Interview data from respondents were analyzed by using grounded theory. Promoting survival was the core category that explained the impact that modern health practices have had on the Ouraman region. The people of Ouraman interpreted modern health practices as increasing their quality of life and promoting their survival. Results are organized around this core category in a paradigm model consisting of conditions, interactions, and consequences. This model can be used to understand the impact of change from the introduction of modern health on a traditional society.

Promoting survival: A grounded theory study of consequences of modern health practices in Ouramanat region of Iranian Kurdistan

Science.gov (United States)

Mohammadpur, Ahmad; Rezaei, Mehdi; Sadeghi, Rasoul

2010-01-01

The aim of this qualitative study is to explore the way people using modern health care perceive its consequences in Ouraman-e-Takht region of Iranian Kurdistan. Ouraman-e-Takht is a rural, highly mountainous and dry region located in the southwest Kurdistan province of Iran. Recently, modern health practices have been introduced to the region. The purpose of this study was to investigate, from the Ouramains' point of view, the impact that modern health services and practices have had on the Ouraman traditional way of life. Interview data from respondents were analyzed by using grounded theory. Promoting survival was the core category that explained the impact that modern health practices have had on the Ouraman region. The people of Ouraman interpreted modern health practices as increasing their quality of life and promoting their survival. Results are organized around this core category in a paradigm model consisting of conditions, interactions, and consequences. This model can be used to understand the impact of change from the introduction of modern health on a traditional society. PMID:20640020

Pea proteins oral supplementation promotes muscle thickness gains during resistance training: a double-blind, randomized, Placebo-controlled clinical trial vs. Whey protein.

Science.gov (United States)

Babault, Nicolas; Païzis, Christos; Deley, Gaëlle; Guérin-Deremaux, Laetitia; Saniez, Marie-Hélène; Lefranc-Millot, Catherine; Allaert, François A

2015-01-01

The effects of protein supplementation on muscle thickness and strength seem largely dependent on its composition. The current study aimed at comparing the impact of an oral supplementation with vegetable Pea protein (NUTRALYS®) vs. Whey protein and Placebo on biceps brachii muscle thickness and strength after a 12-week resistance training program. One hundred and sixty one males, aged 18 to 35 years were enrolled in the study and underwent 12 weeks of resistance training on upper limb muscles. According to randomization, they were included in the Pea protein (n = 53), Whey protein (n = 54) or Placebo (n = 54) group. All had to take 25 g of the proteins or placebo twice a day during the 12-week training period. Tests were performed on biceps muscles at inclusion (D0), mid (D42) and post training (D84). Muscle thickness was evaluated using ultrasonography, and strength was measured on an isokinetic dynamometer. Results showed a significant time effect for biceps brachii muscle thickness (P Pea, Whey and Placebo, respectively; P Pea group as compared to Placebo whereas there was no difference between Whey and the two other conditions. Muscle strength also increased with time with no statistical difference between groups. In addition to an appropriate training, the supplementation with pea protein promoted a greater increase of muscle thickness as compared to Placebo and especially for people starting or returning to a muscular strengthening. Since no difference was obtained between the two protein groups, vegetable pea proteins could be used as an alternative to Whey-based dietary products. The present trial has been registered at ClinicalTrials.gov (NCT02128516).

Phorbol ester tumor promoter induced the synthesis of two major cytoplasmic proteins: identity with two proteins induced under heat-shocked and glucose-starved conditions

International Nuclear Information System (INIS)

Zhang, H.; Chen, K.Y.; Liu, A.Y.C.

1987-01-01

The regulation of specific protein synthesis by the phorbol ester tumor promoter, 12-O-tetradecanoyl-phorbol-13-acetate (TPA), was evaluated using the L-8 and C-2 myoblast and the 3T3-L1 fibroblast cell cultures. TPA increased, by 2-4 fold, the synthesis rates of two cytoplasmic proteins with apparent molecular weights of 89,000 and 74,000 as determined by SDS-polyacrylamide gel electrophoresis and autoradiography. The concentration of TPA and the time of incubation needed to elicit this induction was determined to be 10 μg/ml and 20 hrs, respectively. Increasing the concentration of TPA to 100, 200, and 500 ng/ml did not result in a greater magnitude of induction. The possibility that these two TPA-induced proteins may be identical to proteins with similar molecular weights induced under heat-shocked or glucose-starved conditions was evaluated by 1-D and 2-D gel electrophoresis and autoradiography. Results provided evidence that the TPA-induced 89,000- and 74,000-dalton proteins were identical to hsp 89 and hsp 74, 2 out of a set of 8-9 proteins induced under heat shocked conditions. Furthermore, they are identical to two of the set of glucose-regulated proteins induced under a glucose-starved condition

Regulatory elements in the promoter region of the rat gene encoding the acyl-CoA-binding protein

DEFF Research Database (Denmark)

Elholm, M; Bjerking, G; Knudsen, J

1996-01-01

for the ACBP DR-1 element. Addition of peroxisome proliferators (PP) to H4IIEC3 rat hepatoma cells led to an increase in the ACBP mRNA level, indicating that the DR-1 element could be a functional peroxisome proliferator responsive element (PPRE). Analysis of the ACBP promoter by transient transfection showed...

Junction region of EWS-FLI1 fusion protein has a dominant negative effect in Ewing’s Sarcoma in vitro

International Nuclear Information System (INIS)

Jully, Babu; Vijayalakshmi, Ramshankar; Gopal, Gopisetty; Sabitha, Kesavan; Rajkumar, Thangarajan

2012-01-01

Ewing’s sarcoma is a malignancy characterized by a specific 11:22 chromosomal translocation which generates a novel EWS-FLI1 fusion protein functioning as an aberrant transcription factor. In the present study, we have further characterized the junction region of the EWS-FLI1 fusion protein. In-silico model of EWS-FLI1 fusion protein was analysed for ligand binding sites, and a putative region (amino acid (aa) 251–343 of the type 1 fusion protein) in the vicinity of the fusion junction was cloned and expressed using bacterial expression. The recombinant protein was characterized by Circular Dichroism (CD). We then expressed aa 251–280 ectopically in Ewing’s sarcoma cell-line and its effect on cell proliferation, tumorigenicity and expression of EWS-FLI1 target genes were analysed. Our modelling analysis indicated that Junction region (aa 251–343) encompasses potential ligand biding sites in the EWS-FLI1 protein and when expressed in bacteria was present as soluble form. Ectopically expressing this region in Ewing’s sarcoma cells inhibited tumorigenicity, and EWS-FLI1 target genes indicating a dominant negative biological effect. Junction region can be exploited further as target for drug development in future to specifically target EWS-FLI1 in Ewing’s Sarcoma

Pengaruh Penggunaan Formalin terhadap Kerusakan Protein Daging Ikan Tuna (Thunus sp)

OpenAIRE

Apituley, Daniel A. N.

2012-01-01

Formaldehyde is used on handling and processing of fishery product by some fisher at some coastal region of Indonesia was one that promotes protein oxidation and modification of protein structure of fish meat which give direct impact on nutritional quality of fish primarily the amino acids. This experiment was done in vitro experiment by using model of protein preparat of red and white meat of tuna. The purpose of this research was to study the effect of formaldehyde concentration and impact ...

Two memory associated genes regulated by amyloid precursor protein intracellular domain ovel insights into the pathogenesis of learning and memory impairment in Alzheimer's disease

Institute of Scientific and Technical Information of China (English)

Chuandong Zheng; Xi Gu; Zhimei Zhong; Rui Zhu; Tianming Gao; Fang Wang

2012-01-01

In this study, we employed chromatin immunoprecipitation, a useful method for studying the locations of transcription factors bound to specific DNA regions in specific cells, to investigate amyloid precursor protein intracellular domain binding sites in chromatin DNA from hippocampal neurons of rats, and to screen out five putative genes associated with the learning and memory functions. The promoter regions of the calcium/calmodulin-dependent protein kinase II alpha and glutamate receptor-2 genes were amplified by PCR from DNA products immunoprecipitated by amyloid precursor protein intracellular domain. An electrophoretic mobility shift assay and western blot analysis suggested that the promoter regions of these two genes associated with learning and memory were bound by amyloid precursor protein intracellular domain (in complex form). Our experimental findings indicate that the amyloid precursor protein intracellular domain is involved in the transcriptional regulation of learning- and memory-associated genes in hippocampal neurons. These data may provide new insights into the molecular mechanism underlying the symptoms of progressive memory loss in Alzheimer's disease.

[Association between serum aluminium level and methylation of amyloid precursor protein gene in workers engaged in aluminium electrolysis].

Science.gov (United States)

Yang, X J; Yuan, Y Z; Niu, Q

2016-04-20

To investigate the association between serum aluminium level and methylation of the promoter region of amyloid precursor protein (APP)gene in workers engaged in aluminium electrolysis. In 2012, 366 electrolysis workers in an aluminium factory were enrolled as exposure group (working years >10 and age >40 years)and divided into low-exposure group and high-exposure group based on the median serum aluminium level. Meanwhile, 102 workers in a cement plant not exposed to aluminium were enrolled as control group. Graphite furnace atomic absorption spectrometry was used to measure serum aluminium level, methylation specific PCR was used to measure the methylation rate of the promoter region of APP gene, and ELI-SA was used to measure the protein expression of APP in lymphocytes in peripheral blood. The exposure group had a significantly higher serum aluminium level than the control group (45.07 μg/L vs 30.51 μg/L, P0.05). The multivariate logistic regression analysis showed that with reference to the control group, low aluminium exposure (OR=1.86, 95% CI 1.67~3.52)and high aluminium exposure (OR=2.98, 95% CI 1.97~4.15)were risk factors for a reduced methylation rate of the promoter region of APP gene. Reduced methylation of the promoter region of APP gene may be associated with increased serum aluminium level, and downregulated methylation of the promoter region of APP gene may accelerate APP gene transcription.

DNA-binding properties of the Bacillus subtilis and Aeribacillus pallidus AC6 σ(D) proteins.

Science.gov (United States)

Sevim, Elif; Gaballa, Ahmed; Beldüz, A Osman; Helmann, John D

2011-01-01

σ(D) proteins from Aeribacillus pallidus AC6 and Bacillus subtilis bound specifically, albeit weakly, to promoter DNA even in the absence of core RNA polymerase. Binding required a conserved CG motif within the -10 element, and this motif is known to be recognized by σ region 2.4 and critical for promoter activity.

Identification and characterization of a gibberellin-regulated protein, which is ASR5, in the basal region of rice leaf sheaths.

Science.gov (United States)

Takasaki, Hironori; Mahmood, Tariq; Matsuoka, Makoto; Matsumoto, Hiroshi; Komatsu, Setsuko

2008-04-01

Gibberellins (GAs) regulate growth and development in higher plants. To identify GA-regulated proteins during rice leaf sheath elongation, a proteomic approach was used. Proteins from the basal region of leaf sheath in rice seedling treated with GA(3) were analyzed by fluorescence two-dimensional difference gel electrophoresis. The levels of abscisic acid-stress-ripening-inducible 5 protein (ASR5), elongation factor-1 beta, translationally controlled tumor protein, fructose-bisphosphate aldolase and a novel protein increased; whereas the level of RuBisCO subunit binding-protein decreased by GA(3) treatment. ASR5 out of these six proteins was significantly regulated by GA(3) at the protein level but not at the mRNA level in the basal region of leaf sheaths. Since this protein is regulated not only by abscisic acid but also by GA(3), these results indicate that ASR5 might be involved in plant growth in addition to stress in the basal regions of leaf sheaths.

Wetting of nonconserved residue-backbones: A feature indicative of aggregation associated regions of proteins.

Science.gov (United States)

Pradhan, Mohan R; Pal, Arumay; Hu, Zhongqiao; Kannan, Srinivasaraghavan; Chee Keong, Kwoh; Lane, David P; Verma, Chandra S

2016-02-01

Aggregation is an irreversible form of protein complexation and often toxic to cells. The process entails partial or major unfolding that is largely driven by hydration. We model the role of hydration in aggregation using "Dehydrons." "Dehydrons" are unsatisfied backbone hydrogen bonds in proteins that seek shielding from water molecules by associating with ligands or proteins. We find that the residues at aggregation interfaces have hydrated backbones, and in contrast to other forms of protein-protein interactions, are under less evolutionary pressure to be conserved. Combining evolutionary conservation of residues and extent of backbone hydration allows us to distinguish regions on proteins associated with aggregation (non-conserved dehydron-residues) from other interaction interfaces (conserved dehydron-residues). This novel feature can complement the existing strategies used to investigate protein aggregation/complexation. © 2015 Wiley Periodicals, Inc.

Bombyx mori E26 transformation-specific 2 (BmEts2), an Ets family protein, represses Bombyx mori Rels (BmRels)-mediated promoter activation of antimicrobial peptide genes in the silkworm Bombyx mori.

Science.gov (United States)

Tanaka, H; Sagisaka, A; Suzuki, N; Yamakawa, M

2016-10-01

E26 transformation-specific (Ets) family transcription factors are known to play roles in various biological phenomena, including immunity, in vertebrates. However, the mechanisms by which Ets proteins contribute to immunity in invertebrates remain poorly understood. In this study, we identified a cDNA encoding BmEts2, which is a putative orthologue of Drosophila Yan and human translocation-ets-leukemia/Ets-variant gene 6, from the silkworm Bombyx mori. Expression of the BmEts2 gene was significantly increased in the fat bodies of silkworm larvae in response to injection with Escherichia coli and Staphylococcus aureus. BmEts2 overexpression dramatically repressed B. mori Rels (BmRels)-mediated promoter activation of antimicrobial peptide genes in silkworm cells. Conversely, gene knockdown of BmEts2 significantly enhanced BmRels activity. In addition, two κB sites located on the 5' upstream region of cecropin B1 were found to be involved in the repression of BmRels-mediated promoter activation. Protein-competition analysis further demonstrated that BmEts2 competitively inhibited binding of BmRels to κB sites. Overall, BmEts2 acts as a repressor of BmRels-mediated transactivation of antimicrobial protein genes by inhibiting the binding of BmRels to κB sites. © 2016 The Royal Entomological Society.

Transport proteins promoting Escherichia coli pathogenesis

Science.gov (United States)

Tang, Fengyi; Saier, Milton H.

2014-01-01

Escherichia coli is a genetically diverse species infecting hundreds of millions of people worldwide annually. We examined seven well-characterized E. coli pathogens causing urinary tract infections, gastroenteritis, pyelonephritis and haemorrhagic colitis. Their transport proteins were identified and compared with each other and a non-pathogenic E. coli K12 strain to identify transport proteins related to pathogenesis. Each pathogen possesses a unique set of protein secretion systems for export to the cell surface or for injecting effector proteins into host cells. Pathogens have increased numbers of iron siderophore receptors and ABC iron uptake transporters, but the numbers and types of low-affinity secondary iron carriers were uniform in all strains. The presence of outer membrane iron complex receptors and high-affinity ABC iron uptake systems correlated, suggesting co-evolution. Each pathovar encodes a different set of pore-forming toxins and virulence-related outer membrane proteins lacking in K12. Intracellular pathogens proved to have a characteristically distinctive set of nutrient uptake porters, different from those of extracellular pathogens. The results presented in this report provide information about transport systems relevant to various types of E. coli pathogenesis that can be exploited in future basic and applied studies. PMID:24747185

Transport proteins promoting Escherichia coli pathogenesis.

Science.gov (United States)

Tang, Fengyi; Saier, Milton H

2014-01-01

Escherichia coli is a genetically diverse species infecting hundreds of millions of people worldwide annually. We examined seven well-characterized E. coli pathogens causing urinary tract infections, gastroenteritis, pyelonephritis and haemorrhagic colitis. Their transport proteins were identified and compared with each other and a non-pathogenic E. coli K12 strain to identify transport proteins related to pathogenesis. Each pathogen possesses a unique set of protein secretion systems for export to the cell surface or for injecting effector proteins into host cells. Pathogens have increased numbers of iron siderophore receptors and ABC iron uptake transporters, but the numbers and types of low-affinity secondary iron carriers were uniform in all strains. The presence of outer membrane iron complex receptors and high-affinity ABC iron uptake systems correlated, suggesting co-evolution. Each pathovar encodes a different set of pore-forming toxins and virulence-related outer membrane proteins lacking in K12. Intracellular pathogens proved to have a characteristically distinctive set of nutrient uptake porters, different from those of extracellular pathogens. The results presented in this report provide information about transport systems relevant to various types of E. coli pathogenesis that can be exploited in future basic and applied studies. Copyright © 2014 Elsevier Ltd. All rights reserved.

Allelic polymorphisms in the repeat and promoter regions of the interleukin-4 gene and malaria severity in Ghanaian children

DEFF Research Database (Denmark)

Gyan, B A; Goka, B; Cvetkovic, J T

2004-01-01

Immunoglobulin E has been associated with severe malaria suggesting a regulatory role for interleukin (IL)-4 and/or IgE in the pathogenesis of severe malaria. We have investigated possible associations between polymorphisms in the IL-4 repeat region (intron 3) and promoter regions (IL-4 +33CT and...

A secreted Salmonella protein induces a proinflammatory response in epithelial cells, which promotes neutrophil migration.

Science.gov (United States)

Lee, C A; Silva, M; Siber, A M; Kelly, A J; Galyov, E; McCormick, B A

2000-10-24

In response to Salmonella typhimurium, the intestinal epithelium generates an intense inflammatory response consisting largely of polymorphonuclear leukocytes (neutrophils, PMN) migrating toward and ultimately across the epithelial monolayer into the intestinal lumen. It has been shown that bacterial-epithelial cell interactions elicit the production of inflammatory regulators that promote transepithelial PMN migration. Although S. typhimurium can enter intestinal epithelial cells, bacterial internalization is not required for the signaling mechanisms that induce PMN movement. Here, we sought to determine which S. typhimurium factors and intestinal epithelial signaling pathways elicit the production of PMN chemoattractants by enterocytes. Our results suggest that S. typhimurium activates a protein kinase C-dependent signal transduction pathway that orchestrates transepithelial PMN movement. We show that the type III effector protein, SipA, is not only necessary but is sufficient to induce this proinflammatory response in epithelial cells. Our results force us to reconsider the long-held view that Salmonella effector proteins must be directly delivered into host cells from bacterial cells.

Armadillo Repeat Containing 8α Binds to HRS and Promotes HRS Interaction with Ubiquitinated Proteins

Science.gov (United States)

Tomaru, Koji; Ueda, Atsuhisa; Suzuki, Takeyuki; Kobayashi, Nobuaki; Yang, Jun; Yamamoto, Masaki; Takeno, Mitsuhiro; Kaneko, Takeshi; Ishigatsubo, Yoshiaki

2010-01-01

Recently, we reported that a complex with an essential role in the degradation of Fructose-1,6-bisphosphatase in yeast is well conserved in mammalian cells; we named this mammalian complex C-terminal to the Lissencephaly type-1-like homology (CTLH) complex. Although the function of the CTLH complex remains unclear, here we used yeast two-hybrid screening to isolate Hepatocyte growth factor-regulated tyrosine kinase substrate (HRS) as a protein binding to a key component of CTLH complex, Armadillo repeat containing 8 (ARMc8) α. The association was confirmed by a yeast two-hybrid assay and a co-immunoprecipitation assay. The proline-rich domain of HRS was essential for the association. As demonstrated through immunofluorescence microscopy, ARMc8α co-localized with HRS. ARMc8α promoted the interaction of HRS with various ubiquitinated proteins through the ubiquitin-interacting motif. These findings suggest that HRS mediates protein endosomal trafficking partly through its interaction with ARMc8α. PMID:20224683

Specific DNA binding of a potential transcriptional regulator, inosine 5'-monophosphate dehydrogenase-related protein VII, to the promoter region of a methyl coenzyme m reductase I-encoding operon retrieved from Methanothermobacter thermautotrophicus strain DeltaH.

Science.gov (United States)

Shinzato, Naoya; Enoki, Miho; Sato, Hiroaki; Nakamura, Kohei; Matsui, Toru; Kamagata, Yoichi

2008-10-01

Two methyl coenzyme M reductases (MCRs) encoded by the mcr and mrt operons of the hydrogenotrophic methanogen Methanothermobacter thermautotrophicus DeltaH are expressed in response to H(2) availability. In the present study, cis elements and trans-acting factors responsible for the gene expression of MCRs were investigated by using electrophoretic mobility shift assay (EMSA) and affinity particle purification. A survey of their operator regions by EMSA with protein extracts from mrt-expressing cultures restricted them to 46- and 41-bp-long mcr and mrt upstream regions, respectively. Affinity particle purification of DNA-binding proteins conjugated with putative operator regions resulted in the retrieval of a protein attributed to IMP dehydrogenase-related protein VII (IMPDH VII). IMPDH VII is predicted to have a winged helix-turn-helix DNA-binding motif and two cystathionine beta-synthase domains, and it has been suspected to be an energy-sensing module. EMSA with oligonucleotide probes with unusual sequences showed that the binding site of IMPDH VII mostly overlaps the factor B-responsible element-TATA box of the mcr operon. The results presented here suggest that IMPDH VII encoded by MTH126 is a plausible candidate for the transcriptional regulator of the mcr operon in this methanogen.

Autoregulation of transcription of the hupA gene in Escherichia coli: evidence for steric hindrance of the functional promoter domains induced by HU.

Science.gov (United States)

Kohno, K; Yasuzawa, K; Hirose, M; Kano, Y; Goshima, N; Tanaka, H; Imamoto, F

1994-06-01

The molecular mechanism of autoregulation of expression of the hupA gene in Escherichia coli was examined. The promoter of the gene contains a palindromic sequence with the potential to form a cruciform DNA structure in which the -35 sequence lies at the base of the stem and the -10 sequence forms a single-stranded loop. An artificial promoter lacking the palindrome, which was constructed by replacing a 10 nucleotide repeat for the predicted cruciform arm by a sequence in the opposite orientation, was not subject to HU-repression. DNA relaxation induced by deleting HU proteins and/or inhibiting DNA gyrase in cells results in increased expression from the hupA promoter. We propose that initiation of transcription of the hupA gene is negatively regulated by steric hindrance of the functional promoter domains for formation of the cruciform configuration, which is facilitated at least in part by negative supercoiling of the hupA promoter DNA region. The promoter region of the hupB gene also contains a palindromic sequence that can assume a cruciform configuration. Negative regulation of this gene by HU proteins may occur by a mechanism similar to that operating for the hupA gene.

Comparative Molecular Dynamics Simulations of Mitogen-Activated Protein Kinase-Activated Protein Kinase 5

Directory of Open Access Journals (Sweden)

Inger Lindin

2014-03-01

Full Text Available The mitogen-activated protein kinase-activated protein kinase MK5 is a substrate of the mitogen-activated protein kinases p38, ERK3 and ERK4. Cell culture and animal studies have demonstrated that MK5 is involved in tumour suppression and promotion, embryogenesis, anxiety, cell motility and cell cycle regulation. In the present study, homology models of MK5 were used for molecular dynamics (MD simulations of: (1 MK5 alone; (2 MK5 in complex with an inhibitor; and (3 MK5 in complex with the interaction partner p38α. The calculations showed that the inhibitor occupied the active site and disrupted the intramolecular network of amino acids. However, intramolecular interactions consistent with an inactive protein kinase fold were not formed. MD with p38α showed that not only the p38 docking region, but also amino acids in the activation segment, αH helix, P-loop, regulatory phosphorylation region and the C-terminal of MK5 may be involved in forming a very stable MK5-p38α complex, and that p38α binding decreases the residual fluctuation of the MK5 model. Electrostatic Potential Surface (EPS calculations of MK5 and p38α showed that electrostatic interactions are important for recognition and binding.

Penta- and octa-bromodiphenyl ethers promote proinflammatory protein expression in human bronchial epithelial cells in vitro.

Science.gov (United States)

Koike, Eiko; Yanagisawa, Rie; Takigami, Hidetaka; Takano, Hirohisa

2014-03-01

Polybrominated diphenyl ethers (PBDEs) are widely used as flame retardants in consumer products. Humans can be exposed to PBDEs mainly through the inhalation of air or dust. Thus, PBDEs can affect respiratory and immune systems. In the present study, we investigated whether PBDEs stimulate bronchial epithelial cells. We examined commercial penta-BDE (DE-71), octa-BDE (DE-79), and deca-BDE (DE-83R). Human bronchial epithelial cells (BEAS-2B) were exposed to each PBDE for 24h. Subsequently, the expression of intercellular adhesion molecule-1 (ICAM-1) and proinflammatory cytokines were investigated. DE-71 and DE-79, but not DE-83R, significantly increased the expression of ICAM-1, interleukin-6 (IL-6), and IL-8 in BEAS-2B. Because these remarkable effects were observed with DE-71, we further investigated the underlying intracellular mechanisms. DE-71 promoted epidermal growth factor receptor (EGFR) phosphorylation. Inhibitors of EGFR-selective tyrosine kinase and p38 mitogen-activated protein kinase effectively blocked the increase of IL-6 and IL-8. Furthermore, antagonists of thyroid hormone receptor and aryl hydrocarbon receptor significantly suppressed the increase in IL-6 and/or IL-8 production. In conclusion, penta- and octa-BDE, but not deca-BDE, might promote the expression of proinflammatory proteins in bronchial epithelial cells possibly by activating protein kinases and/or stimulating nuclear receptors related to subsequent activation of transcriptional factors. Copyright © 2013 Elsevier Ltd. All rights reserved.

Analysis of the promoters involved in enterocin AS-48 expression.

Science.gov (United States)

Cebrián, Rubén; Rodríguez-Ruano, Sonia; Martínez-Bueno, Manuel; Valdivia, Eva; Maqueda, Mercedes; Montalbán-López, Manuel

2014-01-01

The enterocin AS-48 is the best characterized antibacterial circular protein in prokaryotes. It is a hydrophobic and cationic bacteriocin, which is ribosomally synthesized by enterococcal cells and post-translationally cyclized by a head-to-tail peptide bond. The production of and immunity towards AS-48 depend upon the coordinated expression of ten genes organized in two operons, as-48ABC (where genes encoding enzymes with processing, secretion, and immunity functions are adjacent to the structural as-48A gene) and as-48C1DD1EFGH. The current study describes the identification of the promoters involved in AS-48 expression. Seven putative promoters have been here amplified, and separately inserted into the promoter-probe vector pTLR1, to create transcriptional fusions with the mCherry gene used as a reporter. The activity of these promoter regions was assessed measuring the expression of the fluorescent mCherry protein using the constitutive pneumococcal promoter PX as a reference. Our results revealed that only three promoters PA, P2(2) and PD1 were recognized in Enterococcus faecalis, Lactococcus lactis and Escherichia coli, in the conditions tested. The maximal fluorescence was obtained with PX in all the strains, followed by the P2(2) promoter, which level of fluorescence was 2-fold compared to PA and 4-fold compared to PD1. Analysis of putative factors influencing the promoter activity in single and double transformants in E. faecalis JH2-2 demonstrated that, in general, a better expression was achieved in presence of pAM401-81. In addition, the P2(2) promoter could be regulated in a negative fashion by genes existing in the native pMB-2 plasmid other than those of the as-48 cluster, while the pH seems to affect differently the as-48 promoter expression.

Analysis of the promoters involved in enterocin AS-48 expression.

Directory of Open Access Journals (Sweden)

Rubén Cebrián

Full Text Available The enterocin AS-48 is the best characterized antibacterial circular protein in prokaryotes. It is a hydrophobic and cationic bacteriocin, which is ribosomally synthesized by enterococcal cells and post-translationally cyclized by a head-to-tail peptide bond. The production of and immunity towards AS-48 depend upon the coordinated expression of ten genes organized in two operons, as-48ABC (where genes encoding enzymes with processing, secretion, and immunity functions are adjacent to the structural as-48A gene and as-48C1DD1EFGH. The current study describes the identification of the promoters involved in AS-48 expression. Seven putative promoters have been here amplified, and separately inserted into the promoter-probe vector pTLR1, to create transcriptional fusions with the mCherry gene used as a reporter. The activity of these promoter regions was assessed measuring the expression of the fluorescent mCherry protein using the constitutive pneumococcal promoter PX as a reference. Our results revealed that only three promoters PA, P2(2 and PD1 were recognized in Enterococcus faecalis, Lactococcus lactis and Escherichia coli, in the conditions tested. The maximal fluorescence was obtained with PX in all the strains, followed by the P2(2 promoter, which level of fluorescence was 2-fold compared to PA and 4-fold compared to PD1. Analysis of putative factors influencing the promoter activity in single and double transformants in E. faecalis JH2-2 demonstrated that, in general, a better expression was achieved in presence of pAM401-81. In addition, the P2(2 promoter could be regulated in a negative fashion by genes existing in the native pMB-2 plasmid other than those of the as-48 cluster, while the pH seems to affect differently the as-48 promoter expression.

Heterologous protein display on the cell surface of lactic acid bacteria mediated by the s-layer protein

Directory of Open Access Journals (Sweden)

Han Lanlan

2011-10-01

Full Text Available Abstract Background Previous studies have revealed that the C-terminal region of the S-layer protein from Lactobacillus is responsible for the cell wall anchoring, which provide an approach for targeting heterologous proteins to the cell wall of lactic acid bacteria (LAB. In this study, we developed a new surface display system in lactic acid bacteria with the C-terminal region of S-layer protein SlpB of Lactobacillus crispatus K2-4-3 isolated from chicken intestine. Results Multiple sequence alignment revealed that the C-terminal region (LcsB of Lb. crispatus K2-4-3 SlpB had a high similarity with the cell wall binding domains SA and CbsA of Lactobacillus acidophilus and Lb. crispatus. To evaluate the potential application as an anchoring protein, the green fluorescent protein (GFP or beta-galactosidase (Gal was fused to the N-terminus of the LcsB region, and the fused proteins were successfully produced in Escherichia coli, respectively. After mixing them with the non-genetically modified lactic acid bacteria cells, the fused GFP-LcsB and Gal-LcsB were functionally associated with the cell surface of various lactic acid bacteria tested. In addition, the binding capacity could be improved by SDS pretreatment. Moreover, both of the fused proteins could simultaneously bind to the surface of a single cell. Furthermore, when the fused DNA fragment of gfp:lcsB was inserted into the Lactococcus lactis expression vector pSec:Leiss:Nuc, the GFP could not be secreted into the medium under the control of the nisA promoter. Western blot, in-gel fluorescence assay, immunofluorescence microscopy and SDS sensitivity analysis confirmed that the GFP was successfully expressed onto the cell surface of L. lactis with the aid of the LcsB anchor. Conclusion The LcsB region can be used as a functional scaffold to target the heterologous proteins to the cell surfaces of lactic acid bacteria in vitro and in vivo, and has also the potential for biotechnological

Synthetic Promoters and Transcription Factors for Heterologous Protein Expression in Saccharomyces cerevisiae

Directory of Open Access Journals (Sweden)

Fabian Machens

2017-10-01

Full Text Available Orthogonal systems for heterologous protein expression as well as for the engineering of synthetic gene regulatory circuits in hosts like Saccharomyces cerevisiae depend on synthetic transcription factors (synTFs and corresponding cis-regulatory binding sites. We have constructed and characterized a set of synTFs based on either transcription activator-like effectors or CRISPR/Cas9, and corresponding small synthetic promoters (synPs with minimal sequence identity to the host’s endogenous promoters. The resulting collection of functional synTF/synP pairs confers very low background expression under uninduced conditions, while expression output upon induction of the various synTFs covers a wide range and reaches induction factors of up to 400. The broad spectrum of expression strengths that is achieved will be useful for various experimental setups, e.g., the transcriptional balancing of expression levels within heterologous pathways or the construction of artificial regulatory networks. Furthermore, our analyses reveal simple rules that enable the tuning of synTF expression output, thereby allowing easy modification of a given synTF/synP pair. This will make it easier for researchers to construct tailored transcriptional control systems.

Sequential assignment of proline-rich regions in proteins: Application to modular binding domain complexes

International Nuclear Information System (INIS)

Kanelis, Voula; Donaldson, Logan; Muhandiram, D.R.; Rotin, Daniela; Forman-Kay, Julie D.; Kay, Lewis E.

2000-01-01

Many protein-protein interactions involve amino acid sequences containing proline-rich motifs and even poly-proline stretches. The lack of amide protons in such regions complicates assignment, since 1 HN-based triple-resonance assignment strategies cannot be employed. Two such systems that we are currently studying include an SH2 domain from the protein Crk with a region containing 9 prolines in a 14 amino acid sequence, as well as a WW domain that interacts with a proline-rich target. A modified version of the HACAN pulse scheme, originally described by Bax and co-workers [Wang et al. (1995) J. Biomol. NMR, 5, 376-382], and an experiment which correlates the intra-residue 1 H α , 13 C α / 13 C β chemical shifts with the 15 N shift of the subsequent residue are presented and applied to the two systems listed above, allowing sequential assignment of the molecules

The DOF transcription factor Dof5.1 influences leaf axial patterning by promoting Revoluta transcription in Arabidopsis

KAUST Repository

Kim, Hyungsae

2010-10-05

Dof proteins are transcription factors that have a conserved single zinc finger DNA-binding domain. In this study, we isolated an activation tagging mutant Dof5.1-D exhibiting an upward-curling leaf phenotype due to enhanced expression of the REV gene that is required for establishing adaxialabaxial polarity. Dof5.1-D plants also had reduced transcript levels for IAA6 and IAA19 genes, indicating an altered auxin biosynthesis in Dof5.1-D. An electrophoretic mobility shift assay using the Dof5.1 DNA-binding motif and the REV promoter region indicated that the DNA-binding domain of Dof5.1 binds to a TAAAGT motif located in the 5′-distal promoter region of the REV promoter. Further, transient and chromatin immunoprecipitation assays verified binding activity of the Dof5.1 DNA-binding motif with the REV promoter. Consistent with binding assays, constitutive over-expression of the Dof5.1 DNA-binding domain in wild-type plants caused a downward-curling phenotype, whereas crossing Dof5.1-D to a rev mutant reverted the upward-curling phenotype of the Dof5.1-D mutant leaf to the wild-type. These results suggest that the Dof5.1 protein directly binds to the REV promoter and thereby regulates adaxialabaxial polarity. © 2010 Blackwell Publishing Ltd.

The DOF transcription factor Dof5.1 influences leaf axial patterning by promoting Revoluta transcription in Arabidopsis

KAUST Repository

Kim, Hyungsae; Kim, Sungjin; Abbasi, Nazia; Bressan, Ray Anthony; Yun, Daejin; Yoo, Sangdong; Kwon, SukYun; Choi, Sangbong

2010-01-01

Dof proteins are transcription factors that have a conserved single zinc finger DNA-binding domain. In this study, we isolated an activation tagging mutant Dof5.1-D exhibiting an upward-curling leaf phenotype due to enhanced expression of the REV gene that is required for establishing adaxialabaxial polarity. Dof5.1-D plants also had reduced transcript levels for IAA6 and IAA19 genes, indicating an altered auxin biosynthesis in Dof5.1-D. An electrophoretic mobility shift assay using the Dof5.1 DNA-binding motif and the REV promoter region indicated that the DNA-binding domain of Dof5.1 binds to a TAAAGT motif located in the 5′-distal promoter region of the REV promoter. Further, transient and chromatin immunoprecipitation assays verified binding activity of the Dof5.1 DNA-binding motif with the REV promoter. Consistent with binding assays, constitutive over-expression of the Dof5.1 DNA-binding domain in wild-type plants caused a downward-curling phenotype, whereas crossing Dof5.1-D to a rev mutant reverted the upward-curling phenotype of the Dof5.1-D mutant leaf to the wild-type. These results suggest that the Dof5.1 protein directly binds to the REV promoter and thereby regulates adaxialabaxial polarity. © 2010 Blackwell Publishing Ltd.

Novel core promoter elements and a cognate transcription factor in the divergent unicellular eukaryote Trichomonas vaginalis.

Science.gov (United States)

Smith, Alias J; Chudnovsky, Lorissa; Simoes-Barbosa, Augusto; Delgadillo-Correa, Maria G; Jonsson, Zophonias O; Wohlschlegel, James A; Johnson, Patricia J

2011-04-01

A highly conserved DNA initiator (Inr) element has been the only core promoter element described in the divergent unicellular eukaryote Trichomonas vaginalis, although genome analyses reveal that only ∼75% of protein-coding genes appear to contain an Inr. In search of another core promoter element(s), a nonredundant database containing 5' untranslated regions of expressed T. vaginalis genes was searched for overrepresented DNA motifs and known eukaryotic core promoter elements. In addition to identifying the Inr, two elements that lack sequence similarity to the known protein-coding gene core promoter, motif 3 (M3) and motif 5 (M5), were identified. Mutational and functional analyses demonstrate that both are novel core promoter elements. M3 [(A/G/T)(A/G)C(G/C)G(T/C)T(T/A/G)] resembles a Myb recognition element (MRE) and is bound specifically by a unique protein with a Myb-like DNA binding domain. The M5 element (CCTTT) overlaps the transcription start site and replaces the Inr as an alternative, gene-specific initiator element. Transcription specifically initiates at the second cytosine within M5, in contrast to characteristic initiation by RNA polymerase II at an adenosine. In promoters that combine M3 with either M5 or Inr, transcription initiation is regulated by the M3 motif.

Novel Core Promoter Elements and a Cognate Transcription Factor in the Divergent Unicellular Eukaryote Trichomonas vaginalis▿

Science.gov (United States)

Smith, Alias J.; Chudnovsky, Lorissa; Simoes-Barbosa, Augusto; Delgadillo-Correa, Maria G.; Jonsson, Zophonias O.; Wohlschlegel, James A.; Johnson, Patricia J.

2011-01-01

A highly conserved DNA initiator (Inr) element has been the only core promoter element described in the divergent unicellular eukaryote Trichomonas vaginalis, although genome analyses reveal that only ∼75% of protein-coding genes appear to contain an Inr. In search of another core promoter element(s), a nonredundant database containing 5′ untranslated regions of expressed T. vaginalis genes was searched for overrepresented DNA motifs and known eukaryotic core promoter elements. In addition to identifying the Inr, two elements that lack sequence similarity to the known protein-coding gene core promoter, motif 3 (M3) and motif 5 (M5), were identified. Mutational and functional analyses demonstrate that both are novel core promoter elements. M3 [(A/G/T)(A/G)C(G/C)G(T/C)T(T/A/G)] resembles a Myb recognition element (MRE) and is bound specifically by a unique protein with a Myb-like DNA binding domain. The M5 element (CCTTT) overlaps the transcription start site and replaces the Inr as an alternative, gene-specific initiator element. Transcription specifically initiates at the second cytosine within M5, in contrast to characteristic initiation by RNA polymerase II at an adenosine. In promoters that combine M3 with either M5 or Inr, transcription initiation is regulated by the M3 motif. PMID:21245378

Building a pseudo-atomic model of the anaphase-promoting complex

International Nuclear Information System (INIS)

Kulkarni, Kiran; Zhang, Ziguo; Chang, Leifu; Yang, Jing; Fonseca, Paula C. A. da; Barford, David

2013-01-01

This article describes an example of molecular replacement in which atomic models are used to interpret electron-density maps determined using single-particle electron-microscopy data. The anaphase-promoting complex (APC/C) is a large E3 ubiquitin ligase that regulates progression through specific stages of the cell cycle by coordinating the ubiquitin-dependent degradation of cell-cycle regulatory proteins. Depending on the species, the active form of the APC/C consists of 14–15 different proteins that assemble into a 20-subunit complex with a mass of approximately 1.3 MDa. A hybrid approach of single-particle electron microscopy and protein crystallography of individual APC/C subunits has been applied to generate pseudo-atomic models of various functional states of the complex. Three approaches for assigning regions of the EM-derived APC/C density map to specific APC/C subunits are described. This information was used to dock atomic models of APC/C subunits, determined either by protein crystallography or homology modelling, to specific regions of the APC/C EM map, allowing the generation of a pseudo-atomic model corresponding to 80% of the entire complex

The homeodomain protein ladybird late regulates synthesis of milk proteins during pregnancy in the tsetse fly (Glossina morsitans.

Directory of Open Access Journals (Sweden)

Geoffrey M Attardo

2014-04-01

Full Text Available Regulation of tissue and development specific gene expression patterns underlies the functional specialization of organs in multi-cellular organisms. In the viviparous tsetse fly (Glossina, the female accessory gland is specialized to generate nutrients in the form of a milk-like secretion to support growth of intrauterine larva. Multiple milk protein genes are expressed specifically in the female accessory gland and are tightly linked with larval development. Disruption of milk protein synthesis deprives developing larvae of nutrients and results in extended larval development and/or in abortion. The ability to cause such a disruption could be utilized as a tsetse control strategy. Here we identify and delineate the regulatory sequence of a major milk protein gene (milk gland protein 1:mgp1 by utilizing a combination of molecular techniques in tsetse, Drosophila transgenics, transcriptomics and in silico sequence analyses. The function of this promoter is conserved between tsetse and Drosophila. In transgenic Drosophila the mgp1 promoter directs reporter gene expression in a tissue and stage specific manner orthologous to that of Glossina. Analysis of the minimal required regulatory region of mgp1, and the regulatory regions of other Glossina milk proteins identified putative homeodomain protein binding sites as the sole common feature. Annotation and expression analysis of Glossina homeodomain proteins identified ladybird late (lbl as being accessory gland/fat body specific and differentially expressed between lactating/non-lactating flies. Knockdown of lbl in tsetse resulted in a significant reduction in transcript abundance of multiple milk protein genes and in a significant loss of fecundity. The role of Lbl in adult reproductive physiology is previously unknown. These results suggest that Lbl is part of a conserved reproductive regulatory system that could have implications beyond tsetse to other vector insects such as mosquitoes. This

Surface Display of the Receptor-Binding Region of the Lactobacillus brevis S-Layer Protein in Lactococcus lactis Provides Nonadhesive Lactococci with the Ability To Adhere to Intestinal Epithelial Cells

OpenAIRE

Åvall-Jääskeläinen, Silja; Lindholm, Agneta; Palva, Airi

2003-01-01

Lactobacillus brevis is a promising lactic acid bacterium for use as a probiotic dietary adjunct and a vaccine vector. The N-terminal region of the S-layer protein (SlpA) of L. brevis ATCC 8287 was recently shown to mediate adhesion to various human cell lines in vitro. In this study, a surface display cassette was constructed on the basis of this SlpA receptor-binding domain, a proteinase spacer, and an autolysin anchor. The cassette was expressed under control of the nisA promoter in Lactoc...

Glucocorticoids facilitate the transcription from the human cytomegalovirus major immediate early promoter in glucocorticoid receptor- and nuclear factor-I-like protein-dependent manner

International Nuclear Information System (INIS)

Inoue-Toyoda, Maki; Kato, Kohsuke; Nagata, Kyosuke; Yoshikawa, Hiroyuki

2015-01-01

Human cytomegalovirus (HCMV) is a common and usually asymptomatic virus agent in healthy individuals. Initiation of HCMV productive infection depends on expression of the major immediate early (MIE) genes. The transcription of HCMV MIE genes is regulated by a diverse set of transcription factors. It was previously reported that productive HCMV infection is triggered probably by elevation of the plasma hydroxycorticoid level. However, it is poorly understood whether the transcription of MIE genes is directly regulated by glucocorticoid. Here, we found that the dexamethasone (DEX), a synthetic glucocorticoid, facilitates the transcription of HCMV MIE genes through the MIE promoter and enhancer in a glucocorticoid receptor (GR)-dependent manner. By competitive EMSA and reporter assays, we revealed that an NF-I like protein is involved in DEX-mediated transcriptional activation of the MIE promoter. Thus, this study supports a notion that the increased level of hydroxycorticoid in the third trimester of pregnancy reactivates HCMV virus production from the latent state. - Highlights: • DEX facilitates the transcription from the HCMV MIE promoter. • GR is involved in DEX-dependent transcription from the HCMV MIE promoter. • A 17 bp repeat is responsible for the HCMV MIE promoter activation by DEX. • An NF-I-like protein is involved in the HCMV MIE promoter activation by DEX

Nitrite promotes protein carbonylation and Strecker aldehyde formation in experimental fermented sausages: are both events connected?

Science.gov (United States)

Villaverde, A; Ventanas, J; Estévez, M

2014-12-01

The role played by curing agents (nitrite, ascorbate) on protein oxidation and Strecker aldehyde formation is studied. To fulfill this objective, increasing concentrations of nitrite (0, 75 and 150ppm) and ascorbate (0, 250 and 500ppm) were added to sausages subjected to a 54day drying process. The concurrence of intense proteolysis, protein carbonylation and formation of Strecker aldehydes during processing of sausages suggests that α-aminoadipic semialdehyde (AAS) and γ-glutamic semialdehyde (GGS) may be implicated in the formation of Strecker aldehydes. The fact that nitrite (150ppm, ingoing amount) significantly promoted the formation of protein carbonyls at early stages of processing and the subsequent formation of Strecker aldehydes provides strength to this hypothesis. Ascorbate (125 and 250ppm) controlled the overall extent of protein carbonylation in sausages without declining the formation of Strecker aldehydes. These results may contribute to understanding the chemistry fundamentals of the positive influence of nitrite on the flavor and overall acceptability of cured muscle foods. Copyright © 2014 Elsevier Ltd. All rights reserved.

Association of Single Nucleotide Polymorphisms in the IL-18 Gene with Production of IL-18 Protein by Mononuclear Cells from Healthy Donors

Directory of Open Access Journals (Sweden)

Khripko Olga Pavlovna

2008-01-01

Full Text Available IL-18 has proinflammatory effects and participates in both innate and adaptive cellular and humoral immunity. A number of SNPs that influence IL-18 production are found in the gene promoter region. We investigated the association of SNPs in the IL-18 promoter at −607 and −137 with the level of IL-18 protein production by PBMC from healthy donors from Southwestern Siberia. The genetic distribution of these SNPs in the promoter site was established by PCR. IL-18 protein production was determined by ELISA. Our results showed that PBMC from donors carrying allele 137C have lower levels of both spontaneous and LPS-stimulated IL-18 production. In contrast, PBMC from donors carrying allele 607A showed significant increases in spontaneous and stimulated IL-18 production compared to wild type. Our study suggests that the SNPs −607 and −137 in the promoter region of the IL-18 gene influence the level of IL-18 protein production by PBMC from healthy donors in Southwestern Siberia.

Interaction study of rice stripe virus proteins reveals a region of the nucleocapsid protein (NP) required for NP self-interaction and nuclear localization.

Science.gov (United States)

Lian, Sen; Cho, Won Kyong; Jo, Yeonhwa; Kim, Sang-Min; Kim, Kook-Hyung

2014-04-01

Rice stripe virus (RSV), which belongs to the genus Tenuivirus, is an emergent virus problem. The RSV genome is composed of four single-strand RNAs (RNA1-RNA4) and encodes seven proteins. We investigated interactions between six of the RSV proteins by yeast-two hybrid (Y2H) assay in vitro and by bimolecular fluorescence complementation (BiFC) in planta. Y2H identified self-interaction of the nucleocapsid protein (NP) and NS3, while BiFC revealed self-interaction of NP, NS3, and NCP. To identify regions(s) and/or crucial amino acid (aa) residues required for NP self-interaction, we generated various truncated and aa substitution mutants. Y2H assay showed that the N-terminal region of NP (aa 1-56) is necessary for NP self-interaction. Further analysis with substitution mutants demonstrated that additional aa residues located at 42-47 affected their interaction with full-length NP. These results indicate that the N-terminal region (aa 1-36 and 42-47) is required for NP self-interaction. BiFC and co-localization studies showed that the region required for NP self-interaction is also required for NP localization at the nucleus. Overall, our results indicate that the N-terminal region (aa 1-47) of the NP is important for NP self-interaction and that six aa residues (42-47) are essential for both NP self-interaction and nuclear localization. Copyright © 2014 Elsevier B.V. All rights reserved.

Hypermethylation of the DPYD promoter region is not a major predictor of severe toxicity in 5-fluorouracil based chemotherapy

Directory of Open Access Journals (Sweden)

Aebi Stefan

2008-10-01

Full Text Available Abstract Background The activity of dihydropyrimidine dehydrogenase (DPD, the key enzyme of pyrimidine catabolism, is thought to be an important determinant for the occurrence of severe toxic reactions to 5-fluorouracil (5-FU, which is one of the most commonly prescribed chemotherapeutic agents for the treatment of solid cancers. Genetic variation in the DPD gene (DPYD has been proposed as a main factor for variation in DPD activity in the population. However, only a small proportion of severe toxicities in 5-FU based chemotherapy can be explained with such rare deleterious DPYD mutations resulting in severe enzyme deficiencies. Recently, hypermethylation of the DPYD promoter region has been proposed as an alternative mechanism for DPD deficiency and thus as a major cause of severe 5-FU toxicity. Methods Here, the prognostic significance of this epigenetic marker with respect to severe 5-FU toxicity was assessed in 27 cancer patients receiving 5-FU based chemotherapy, including 17 patients experiencing severe toxic side effects following drug administration, none of which were carriers of a known deleterious DPYD mutation, and ten control patients. The methylation status of the DPYD promoter region in peripheral blood mononuclear cells was evaluated by analysing for each patient between 19 and 30 different clones of a PCR-amplified 209 base pair fragment of the bisulfite-modified DPYD promoter region. The fragments were sequenced to detect bisulfite-induced, methylation-dependent sequence differences. Results No evidence of DPYD promoter methylation was observed in any of the investigated patient samples, whereas in a control experiment, as little as 10% methylated genomic DNA could be detected. Conclusion Our results indicate that DYPD promoter hypermethylation is not of major importance as a prognostic factor for severe toxicity in 5-FU based chemotherapy.